Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.
Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian
2017-11-23
Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas
flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...
Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...
Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein
Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar
2015-01-01
The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. PMID:26175306
Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein.
Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar
2015-10-01
The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Tandemly repeated sequence in 5'end of mtDNA control region of ...
African Journals Online (AJOL)
Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).
Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M
1993-11-01
A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.
Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert
2017-10-01
Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.
Region segmentation along image sequence
International Nuclear Information System (INIS)
Monchal, L.; Aubry, P.
1995-01-01
A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs
Sequence determinants of human microsatellite variability
Directory of Open Access Journals (Sweden)
Jakobsson Mattias
2009-12-01
Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.
Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions
Directory of Open Access Journals (Sweden)
Marcela Coelho
2016-09-01
Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and 3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.
The complementarity-determining region sequences in IgY antivenom hypervariable regions
Directory of Open Access Journals (Sweden)
David Gitirana da Rocha
2017-08-01
Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.
Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M
1993-01-01
We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.
Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M
2017-10-01
Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.
Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor; Essex, M
2015-05-01
To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice.
Directory of Open Access Journals (Sweden)
Patrick D Schloss
Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results
Directory of Open Access Journals (Sweden)
Zhang Xinmin
2011-05-01
Full Text Available Abstract Background In highly copy number variable (CNV regions such as the human defensin gene locus, comprehensive assessment of sequence variations is challenging. PCR approaches are practically restricted to tiny fractions, and next-generation sequencing (NGS approaches of whole individual genomes e.g. by the 1000 Genomes Project is confined by an affordable sequence depth. Combining target enrichment with NGS may represent a feasible approach. Results As a proof of principle, we enriched a ~850 kb section comprising the CNV defensin gene cluster DEFB, the invariable DEFA part and 11 control regions from two genomes by sequence capture and sequenced it by 454 technology. 6,651 differences to the human reference genome were found. Comparison to HapMap genotypes revealed sensitivities and specificities in the range of 94% to 99% for the identification of variations. Using error probabilities for rigorous filtering revealed 2,886 unique single nucleotide variations (SNVs including 358 putative novel ones. DEFB CN determinations by haplotype ratios were in agreement with alternative methods. Conclusion Although currently labor extensive and having high costs, target enriched NGS provides a powerful tool for the comprehensive assessment of SNVs in highly polymorphic CNV regions of individual genomes. Furthermore, it reveals considerable amounts of putative novel variations and simultaneously allows CN estimation.
Directory of Open Access Journals (Sweden)
Smith-Keune Carolyn
2008-02-01
Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-β superfamily that negatively regulates growth of skeletal muscle tissue. The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. This gene potentially represents an important target for growth improvement of cultured finfish. Results Here we report molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer MSTN-1 gene. The barramundi MSTN-1 was encoded by three exons 379, 371 and 381 bp in length and translated into a 376-amino acid peptide. Intron 1 and 2 were 412 and 819 bp in length and presented typical GT...AG splicing sites. The upstream region contained cis-regulatory elements such as TATA-box and E-boxes. A first assessment of sequence variability suggested that higher mutation rates are found in the 5' flanking region with several SNP's present in this species. A putative micro RNA target site has also been observed in the 3'UTR (untranslated region and is highly conserved across teleost fish. The deduced amino acid sequence was conserved across vertebrates and exhibited characteristic conserved putative functional residues including a cleavage motif of proteolysis (RXXR, nine cysteines and two glycosilation sites. A qualitative analysis of the barramundi MSTN-1 expression pattern revealed that, in adult fish, transcripts are differentially expressed in various tissues other than skeletal muscles including gill, heart, kidney, intestine, liver, spleen, eye, gonad and brain. Conclusion Our findings provide valuable insights such as sequence variation and genomic information which will aid the further investigation of the barramundi MSTN-1 gene in association with growth. The finding for the first time in finfish MSTN of a miRNA target site in the 3'UTR provides an opportunity for the identification of regulatory mutations on the
Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.
Directory of Open Access Journals (Sweden)
Sergey I Nikolaev
Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.
DEFF Research Database (Denmark)
Willumsen, B M; Papageorge, A G; Hubbert, N
1985-01-01
or increasing it to 50 amino acids has relatively little effect on the capacity of the gene to induce morphological transformation of NIH 3T3 cells. Assays of GTP binding, GTPase and autophosphorylating activities of such mutant v-rasH-encoded proteins synthesized in bacteria indicated that the sequences...... that is required for post-translational processing, membrane localization and transforming activity of the proteins. We have now used the viral oncogene (v-rasH) of Harvey sarcoma virus to study the major variable region by deleting or duplicating parts of the gene. Reducing this region to five amino acids...... that encode these biochemical activities are located upstream from the major variable region. In the context of transformation, we propose that the region of sequence heterogeneity serves principally to connect the N-terminal catalytic domain with amino acids at the C terminus that are required to anchor...
Exome sequencing generates high quality data in non-target regions
Directory of Open Access Journals (Sweden)
Guo Yan
2012-05-01
Full Text Available Abstract Background Exome sequencing using next-generation sequencing technologies is a cost efficient approach to selectively sequencing coding regions of human genome for detection of disease variants. A significant amount of DNA fragments from the capture process fall outside target regions, and sequence data for positions outside target regions have been mostly ignored after alignment. Result We performed whole exome sequencing on 22 subjects using Agilent SureSelect capture reagent and 6 subjects using Illumina TrueSeq capture reagent. We also downloaded sequencing data for 6 subjects from the 1000 Genomes Project Pilot 3 study. Using these data, we examined the quality of SNPs detected outside target regions by computing consistency rate with genotypes obtained from SNP chips or the Hapmap database, transition-transversion (Ti/Tv ratio, and percentage of SNPs inside dbSNP. For all three platforms, we obtained high-quality SNPs outside target regions, and some far from target regions. In our Agilent SureSelect data, we obtained 84,049 high-quality SNPs outside target regions compared to 65,231 SNPs inside target regions (a 129% increase. For our Illumina TrueSeq data, we obtained 222,171 high-quality SNPs outside target regions compared to 95,818 SNPs inside target regions (a 232% increase. For the data from the 1000 Genomes Project, we obtained 7,139 high-quality SNPs outside target regions compared to 1,548 SNPs inside target regions (a 461% increase. Conclusions These results demonstrate that a significant amount of high quality genotypes outside target regions can be obtained from exome sequencing data. These data should not be ignored in genetic epidemiology studies.
Detecting Scareware by Mining Variable Length Instruction Sequences
Shahzad, Raja Khurram; Lavesson, Niklas
2011-01-01
Scareware is a recent type of malicious software that may pose financial and privacy-related threats to novice users. Traditional countermeasures, such as anti-virus software, require regular updates and often lack the capability of detecting novel (unseen) instances. This paper presents a scareware detection method that is based on the application of machine learning algorithms to learn patterns in extracted variable length opcode sequences derived from instruction sequences of binary files....
Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas
2014-01-01
Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations
Directory of Open Access Journals (Sweden)
Nadja Korotkova
Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hongzhi Cao
Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.
Directory of Open Access Journals (Sweden)
Dolores González
2012-12-01
Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m
Kang, Longli; Zhang, Xiaofeng; Liu, Kai; Zhao, Jianmin
2009-12-01
To analyze the sequence polymorphisms of the mitochondrial DNA hypervariable regions I (HVR I) and HVR II in the Deng population in Linzhi area of Tibet. mtDNAs obtained from 119 unrelated individuals were amplified and directly sequenced. One hundred and ten variable sites were identified, including nucleotide transitions, transversions, and insertions. In the HVR I region (nt16024-nt16365), 68 polymorphic sites and 119 haplotypes were observed, the genetic diversity was 0.9916. In the HVR II (nt73-nt340) region, 42 polymorphic sites and 113 haplotypes were observed, and the genetic diversity was 0.9907. The random match probability of the HVR I and HVR II regions were 0.0084 and 0.0093, respectively. When combining the HVR I and HVR II regions, 119 different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0084. There are some unique polymorphic loci in the Deng population. There are different genetic structures between Chinese and other Asian populations in the mitochondrial DNA D-loop region. Sequence polymorphism of mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.
Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing
2017-11-01
Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.
Climatological variability in regional air pollution
International Nuclear Information System (INIS)
Shannon, J.D.; Trexler, E.C. Jr.
1995-01-01
Although some air pollution modeling studies examine events that have already occurred (e.g., the Chernobyl plume) with relevant meteorological conditions largely known, most pollution modeling studies address expected or potential scenarios for the future. Future meteorological conditions, the major pollutant forcing function other than emissions, are inherently uncertain although much relevant information is contained in past observational data. For convenience in our discussions of regional pollutant variability unrelated to emission changes, we define meteorological variability as short-term (within-season) pollutant variability and climatological variability as year-to-year changes in seasonal averages and accumulations of pollutant variables. In observations and in some of our simulations the effects are confounded because for seasons of two different years both the mean and the within-season character of a pollutant variable may change. Effects of climatological and meteorological variability on means and distributions of air pollution parameters, particularly those related to regional visibility, are illustrated. Over periods of up to a decade climatological variability may mask or overstate improvements resulting from emission controls. The importance of including climatological uncertainties in assessing potential policies, particularly when based partly on calculated source-receptor relationships, is highlighted
2012-01-01
Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence
Optimization of sequence alignment for simple sequence repeat regions
Directory of Open Access Journals (Sweden)
Ogbonnaya Francis C
2011-07-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic
Directory of Open Access Journals (Sweden)
Pablo Sánchez
2012-06-01
Full Text Available Comparisons of the levels of genetic variation within and between a hatchery F1 (FAR, n=116 of Senegalese sole, Solea senegalensis, and its wild donor population (ATL, n = 26, both native to the SW Atlantic coast of the Iberian peninsula, as well as between the wild donor population and a wild western Mediterranean sample (MED, n=18, were carried out by characterizing 412 base pairs of the nucleotide sequence of the mitochondrial DNA control region I, and six polymorphic microsatellite loci. FAR showed a substantial loss of genetic variability (haplotypic diversity, h=0.49±0.066; nucleotide diversity, π=0.006±0.004; private allelic richness, pAg=0.28 to its donor population ATL (h=0.69±0.114; π=0.009±0.006; pAg=1.21. Pairwise FST values of microsatellite data were highly significant (P < 0.0001 between FAR and ATL (0.053 and FAR and MED (0.055. The comparison of wild samples revealed higher values of genetic variability in MED than in ATL, but only with mtDNA CR-I sequence data (h=0.948±0.033; π=0.030±0.016. However, pairwise ΦST and FST values between ATL and MED were highly significant (P < 0.0001 with mtDNA CR-I (0.228 and with microsatellite data (0.095, respectively. While loss of genetic variability in FAR could be associated with the sampling error when the broodstock was established, the results of parental and sibship inference suggest that most of these losses can be attributed to a high variance in reproductive success among members of the broodstock, particularly among females.
Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla
2013-01-01
Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.
Gough, N M; Bernard, O
1981-01-01
To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
Sequence Ready Characterization of the Pericentromeric Region of 19p12
Energy Technology Data Exchange (ETDEWEB)
Evan E. Eichler
2006-08-31
Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy to generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence
Mitochondrial DNA control region variability in wild boars from west Balkans
Directory of Open Access Journals (Sweden)
Đan Mihajla
2013-01-01
Full Text Available The wild boar (Sus scrofa is one of most abundant game species in hunting areas of Balkan region. The large fraction of pre-glacial genetic diversity in wild boar populations from the Balkans was addressed due to high proportion of unique mtDNA haplotypes found in Greece, indicating Balkan as main refugial area for wild boars. The aim of the present study is to characterize mitochondrial DNA control region variability in wild boars from different areas in the West Balkan region, in order to evaluate level of genetic variability, to detect unique haplotypes and to infer possible structuring. The total number of 163 individuals from different sampling localities were included in the study. A fragment of the mtDNA control region was amplified and sequenced by standard procedures. Population genetic analyses were performed using several computer packages: BioEdit, ARLEQUIN 3.5.1.2., Network 4.6.0.0 and MEGA5. Eleven different haplotypes were identified and haplotype diversity was 0.676, nucleotide diversity 0.0026, and the average number of nucleotide differences (k 1.169. The mismatch distribution and neutrality tests indicated the expansion of the all populations. It is shown that high level of genetic diversity is present in the wild boars from the West Balkan region and we have managed to detect regional unique haplotypes in high frequency. Genetic diversity differences have been found in regional wild boar groups, clustering them in two main clusters, but further speculations on the reasons for the observed clustering are prevented due to restricted informativness of the single locus marker. Obtained knowledge of genetic variation in the wild boar may be relevant for improving knowledge of the phylogeny and phylogeography of the wild boars, but as well as for hunting societies and responsible authorities for the effective control of wild boar populations.
Optical photometric variable stars towards the Galactic H II region NGC 2282
Dutta, Somnath; Mondal, Soumen; Joshi, Santosh; Jose, Jessy; Das, Ramkrishna; Ghosh, Supriyo
2018-05-01
We report here CCD I-band time series photometry of a young (2-5 Myr) cluster NGC 2282, in order to identify and understand the variability of pre-main-sequence (PMS) stars. The I-band photometry, down to ˜20.5 mag, enables us to probe the variability towards the lower mass end (˜0.1 M⊙) of PMS stars. From the light curves of 1627 stars, we identified 62 new photometric variable candidates. Their association with the region was established from H α emission and infrared (IR) excess. Among 62 variables, 30 young variables exhibit H α emission, near-IR (NIR)/mid-IR (MIR) excess or both and are candidate members of the cluster. Out of 62 variables, 41 are periodic variables, with a rotation rate ranging from 0.2-7 d. The period distribution exhibits a median period at ˜1 d, as in many young clusters (e.g. NGC 2264, ONC, etc.), but it follows a unimodal distribution, unlike others that have bimodality, with slow rotators peaking at ˜6-8 d. To investigate the rotation-disc and variability-disc connection, we derived the NIR excess from Δ(I - K) and the MIR excess from Spitzer [3.6]-[4.5] μm data. No conclusive evidence of slow rotation with the presence of discs around stars and fast rotation for discless stars is obtained from our periodic variables. A clear increasing trend of the variability amplitude with IR excess is found for all variables.
Directory of Open Access Journals (Sweden)
Elgion Lúcio Silva Loreto
2007-01-01
Full Text Available We have analyzed the sequenced genomes of three strains of Mycoplasma hyopneumoniae and one strain of M. synoviae, and have found three and two different transposable element families, respectively in each species. In M. hyopneumoniae, the Insertion Sequences of the IS4 family is represented by ISMHp1, a putatively active element. The IS3 family is represented by several degenerated sequences. A third element called tMH was found, which shows some characteristics reminiscent of retrotransposons. In M. synoviae, three different possibly active IS4 elements are present (ISMHp1-like; ISMs1 and IS1634-like elements. The IS30 family is represented by the degenerated IS1630-like element. The IS1634-like element is shown to be involved in chromosomal rearrangements and horizontal gene transfer (HGT. The ISMHp1-like element is shown to relate to the HGT of a 25-kb region from M. gallisepticum to M. synoviae. The fractions of these genomes that correspond to mobile elements varied from 1.35 to 3.13% in M. hyopneumonia strains and was 2.08% in M. synoviae. Although these species possess reduced genomes, they maintain mobile elements, perhaps as a mechanism for genetic variability production.
Partial summations of stationary sequences of non-Gaussian random variables
DEFF Research Database (Denmark)
Mohr, Gunnar; Ditlevsen, Ove Dalager
1996-01-01
The distribution of the sum of a finite number of identically distributed random variables is in many cases easily determined given that the variables are independent. The moments of any order of the sum can always be expressed by the moments of the single term without computational problems...... of convergence of the distribution of a sum (or an integral) of mutually dependent random variables to the Gaussian distribution. The paper is closely related to the work in Ditlevsen el al. [Ditlevsen, O., Mohr, G. & Hoffmeyer, P. Integration of non-Gaussian fields. Prob. Engng Mech 11 (1996) 15-23](2)....... lognormal variables or polynomials of standard Gaussian variables. The dependency structure is induced by specifying the autocorrelation structure of the sequence of standard Gaussian variables. Particularly useful polynomials are the Winterstein approximations that distributionally fit with non...
DEFF Research Database (Denmark)
Lorenzen, Niels; Cupit, P.M.; Secombes, C.J.
2000-01-01
and their neutralising activity was evident. Binding kinetic analyses by plasmon resonance identified differences in the dissociation rate constant (kd) as a possible explanation for the different reactivity levels of the MAbs. The Ig variable heavy (VH) and light (V kappa) domain gene sequences of the three hybridomas...... were compared. The inferred amino acid sequence of the two neutralising antibody VH domains differed by three amino acid residues (97% identity) and only one residue difference was evident in the Vk. domains. In contrast, IP1H3 shared only 38 and 39% identity with the 3F1A2 and 3F1H10 VH domains...... respectively and 49 and 50% identity with the 3F1A2 and 3F1H10 VK domains respectively. The neutralising antibodies were produced by hybridomas originating from the same fusion and the high nucleotide sequence homology of the variable Ig gene regions indicated that the plasma cell partners of the hybridomas...
The Effects of Delayed Reinforcement on Variability and Repetition of Response Sequences
Odum, Amy L.; Ward, Ryan D.; Burke, K. Anne; Barnes, Christopher A.
2006-01-01
Four experiments examined the effects of delays to reinforcement on key peck sequences of pigeons maintained under multiple schedules of contingencies that produced variable or repetitive behavior. In Experiments 1, 2, and 4, in the repeat component only the sequence right-right-left-left earned food, and in the vary component four-response…
Targeted sequencing of large genomic regions with CATCH-Seq.
Directory of Open Access Journals (Sweden)
Kenneth Day
Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.
International Nuclear Information System (INIS)
Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.
1989-01-01
The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region
Cultural conservatism and variability in the Acheulian sequence of Gesher Benot Ya'aqov.
Sharon, Gonen; Alperson-Afil, Nira; Goren-Inbar, Naama
2011-04-01
The Acheulian Technocomplex exhibits two phenomena: variability and conservatism. Variability is expressed in the composition and frequencies of tool types, particularly in the varying frequencies of bifaces (handaxes and cleavers). Conservatism is expressed in the continuous presence of bifaces along an immense time trajectory. The site of Gesher Benot Ya'aqov (GBY) offers a unique opportunity to study aspects of variability and conservatism as a result of its long cultural-stratigraphic sequence containing superimposed lithic assemblages. This study explores aspects of variability and conservatism within the Acheulian lithic assemblages of GBY, with emphasis placed on the bifacial tools. While variability has been studied through a comparison of typological frequencies in a series of assemblages from the site, evidence for conservatism was examined in the production modes expressed by the reduction sequence of the bifaces. We demonstrate that while pronounced typological variability is observed among the GBY assemblages, they were all manufactured by the same technology. The technology, size, and morphology of the bifaces throughout the entire stratigraphic sequence of GBY reflect the strong conservatism of their makers. We conclude that the biface frequency cannot be considered as a chrono/cultural marker that might otherwise allow us to distinguish between different phases within the Acheulian. The variability observed within the assemblages is explained as a result of different activities, tasks, and functions, which were carried out at specific localities along the shores of the paleo-Hula Lake in the early Middle Pleistocene. Copyright © 2010 Elsevier Ltd. All rights reserved.
Beer, Christian; Porada, Philipp; Ekici, Altug; Brakebusch, Matthias
2018-03-01
Effects of the short-term temporal variability of meteorological variables on soil temperature in northern high-latitude regions have been investigated. For this, a process-oriented land surface model has been driven using an artificially manipulated climate dataset. Short-term climate variability mainly impacts snow depth, and the thermal diffusivity of lichens and bryophytes. These impacts of climate variability on insulating surface layers together substantially alter the heat exchange between atmosphere and soil. As a result, soil temperature is 0.1 to 0.8 °C higher when climate variability is reduced. Earth system models project warming of the Arctic region but also increasing variability of meteorological variables and more often extreme meteorological events. Therefore, our results show that projected future increases in permafrost temperature and active-layer thickness in response to climate change will be lower (i) when taking into account future changes in short-term variability of meteorological variables and (ii) when representing dynamic snow and lichen and bryophyte functions in land surface models.
Ballooning mode second stability region for sequences of tokamak equilibria
International Nuclear Information System (INIS)
Sugiyama, L.; Mark, J.W.K.
A numerical study of several sequences of tokamak equilibria derived from two flux conserving sequences confirms the tendency of high n ideal MHD ballooning modes to stabilize for values of the plasma beta greater than a second critical beta, for sufficiently favorable equilibria. The major stabilizing effect of increasing the inverse rotational transform profile q(Psi) for equilibria with the same flux surface geometry is shown. The unstable region shifts toward larger shear d ln q/d ln γ and the width of the region measured in terms of the poloidal beta or a pressure gradient parameter, for fixed shear, decreases. The smaller aspect ratio sequences are more sensitive to changes in q and have less stringent limits on the attainable value of the plasma beta in the high beta stable region. Finally, the disconnected mode approximation is shown to provide a reasonable description of the second high beta stability boundary
Pearce, J.M.
2006-01-01
Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.
Nonlinear Synchronization for Automatic Learning of 3D Pose Variability in Human Motion Sequences
Directory of Open Access Journals (Sweden)
Mozerov M
2010-01-01
Full Text Available A dense matching algorithm that solves the problem of synchronizing prerecorded human motion sequences, which show different speeds and accelerations, is proposed. The approach is based on minimization of MRF energy and solves the problem by using Dynamic Programming. Additionally, an optimal sequence is automatically selected from the input dataset to be a time-scale pattern for all other sequences. The paper utilizes an action specific model which automatically learns the variability of 3D human postures observed in a set of training sequences. The model is trained using the public CMU motion capture dataset for the walking action, and a mean walking performance is automatically learnt. Additionally, statistics about the observed variability of the postures and motion direction are also computed at each time step. The synchronized motion sequences are used to learn a model of human motion for action recognition and full-body tracking purposes.
Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard
2017-07-01
The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.
N-linked glycosylation of the immunoglobulin variable region
van de Bovenkamp, Fleur S.; Derksen, Ninotska I. L.; Ooijevaar-de Heer, Pleuni; van Schie, Karin A.; Kruithof, Simone; Berkowska, Magdalena A.; van der Schoot, C. Ellen; Ijspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E. M.; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S. Marieke; Vidarsson, Gestur; Rispens, Theo
2018-01-01
N-glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we
THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION
Energy Technology Data Exchange (ETDEWEB)
Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov
2009-08-01
We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.
THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION
International Nuclear Information System (INIS)
Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen
2009-01-01
We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.
Directory of Open Access Journals (Sweden)
Brian Wade Jamandre
2014-01-01
Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.
Sardiñas, Gretel; Yero, Daniel; Climent, Yanet; Caballero, Evelin; Cobas, Karem; Niebla, Olivia
2009-02-01
The significance of Neisseria meningitidis serogroup B membrane proteins as vaccine candidates is continually growing. Here, we studied different aspects of antigen NMB0088, a protein that is abundant in outer-membrane vesicle preparations and is thought to be a surface protein. The gene encoding protein NMB0088 was sequenced in a panel of 34 different meningococcal strains with clinical and epidemiological relevance. After this analysis, four variants of NMB0088 were identified; the variability was confined to three specific segments, designated VR1, VR2 and VR3. Secondary structure predictions, refined with alignment analysis and homology modelling using FadL of Escherichia coli, revealed that almost all the variable regions were located in extracellular loop domains. In addition, the NMB0088 antigen was expressed in E. coli and a procedure for obtaining purified recombinant NMB0088 is described. The humoral immune response elicited in BALB/c mice was measured by ELISA and Western blotting, while the functional activity of these antibodies was determined in a serum bactericidal assay and an animal protection model. After immunization in mice, the recombinant protein was capable of inducing a protective response when it was administered inserted into liposomes. According to our results, the recombinant NMB0088 protein may represent a novel antigen for a vaccine against meningococcal disease. However, results from the variability study should be considered for designing a cross-protective formulation in future studies.
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.
International Nuclear Information System (INIS)
Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.
1987-01-01
It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs
Directory of Open Access Journals (Sweden)
Claros M Gonzalo
2010-06-01
Full Text Available Abstract Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
Regional simulation of interannual variability over South America
Misra, V.; Dirmeyer, P. A.; Kirtman, B. P.; Juang, H.-M. Henry; Kanamitsu, M.
2002-08-01
Three regional climate simulations covering the austral summer season during three contrasting phases of the El Niño-Southern Oscillation cycle were conducted with the Regional Spectral Model (RSM) developed at the National Centers for Environmental Prediction (NCEP). The simulated interannual variability of precipitation over the Amazon River Basin, the Intertropical Convergence Zone, the Pacific and Atlantic Ocean basins, and extratropical South America compare reasonably well with observations. The RSM optimally filters the peturbations about a time-varying base field, thereby enhancing the information content of the global NCEP reanalysis. The model is better than the reanalysis in reproducing the observed interannual variability of outgoing longwave radiation at both high frequencies (3-30 days) and intraseasonal (30-60 days) scales. The low-level jet shows a peak in its speed in 1998 and a minimum in the 1999 simulations. The lag correlation of the jet index with convection over various areas in continental South America indicates that the jet induces precipitation over the Pampas region downstream. A detailed moisture budget was conducted over various subregions. This budget reveals that moisture flux convergence determines most of the interannual variability of precipitation over the Amazon Basin, the Atlantic Intertropical Convergence Zone, and the Nordeste region of Brazil. However, both surface evaporation and surface moisture flux convergence were found to be critical in determining the interannual variability of precipitation over the southern Pampas, Gran Chaco area, and the South Atlantic Convergence Zone.
An ongoing earthquake sequence near Dhaka, Bangladesh, from regional recordings
Howe, M.; Mondal, D. R.; Akhter, S. H.; Kim, W.; Seeber, L.; Steckler, M. S.
2013-12-01
Earthquakes in and around the syntaxial region between the continent-continent collision of the Himalayan arc and oceanic subduction of the Sunda arc result primarily from the convergence of India and Eurasia-Sunda plates along two fronts. The northern front, the convergence of the Indian and Eurasian plates, has produced the Himalayas. The eastern front, the convergence of the Indian and Sunda plates, ranges from ocean-continent subduction at the Andaman Arc and Burma Arc, and transitions to continent-continent collision to the north at the Assam Syntaxis in northeast India. The India-Sunda convergence at the Burma Arc is extremely oblique. The boundary-normal convergence rate is ~17 mm/yr while the boundary-parallel rate is ~45 mm/yr including the well-known Sagaing strike-slip fault, which accommodates about half the shear component. This heterogeneous tectonic setting produces multiple earthquake sources that need to be considered when assessing seismic hazard and risk in this region. The largest earthquakes, just as in other subduction systems, are expected to be interplate events that occur on the low-angle megathrusts, such as the Mw 9.2 2004 Sumatra-Andaman earthquake and the 1762 earthquake along the Arakan margin. These earthquakes are known to produce large damage over vast areas, but since they account for large fault motions they are relatively rare. The majority of current seismicity in the study area is intraplate. Most of the seismicity associated with the Burma Arc subduction system is in the down-going slab, including the shallow-dipping part below the megathrust flooring the accretionary wedge. The strike of the wedge is ~N-S and Dhaka lies at its outer limit. One particular source relevant to seismic risk in Dhaka is illuminated by a multi-year sequence of earthquakes in Bangladesh less than 100 km southeast of Dhaka. The population in Dhaka (now at least 15 million) has been increasing dramatically due to rapid urbanization. The vulnerability
Directory of Open Access Journals (Sweden)
Danila Montewka Melotto-Passarin
2008-01-01
Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.
Lasecka-Dykes, Lidia; Wright, Caroline F.; Di Nardo, Antonello; Logan, Grace; Mioulet, Valerie; Jackson, Terry; Tuthill, Tobias J.; Knowles, Nick J.; King, Donald P.
2018-01-01
Foot-and-mouth disease virus (FMDV) causes a highly contagious disease of cloven-hooved animals that poses a constant burden on farmers in endemic regions and threatens the livestock industries in disease-free countries. Despite the increased number of publicly available whole genome sequences, FMDV data are biased by the opportunistic nature of sampling. Since whole genomic sequences of Southern African Territories (SAT) are particularly underrepresented, this study sequenced 34 isolates from eastern and southern Africa. Phylogenetic analyses revealed two novel genotypes (that comprised 8/34 of these SAT isolates) which contained unusual 5′ untranslated and non-structural encoding regions. While recombination has occurred between these sequences, phylogeny violation analyses indicated that the high degree of sequence diversity for the novel SAT genotypes has not solely arisen from recombination events. Based on estimates of the timing of ancestral divergence, these data are interpreted as being representative of un-sampled FMDV isolates that have been subjected to geographical isolation within Africa by the effects of the Great African Rinderpest Pandemic (1887–1897), which caused a mass die-out of FMDV-susceptible hosts. These findings demonstrate that further sequencing of African FMDV isolates is likely to reveal more unusual genotypes and will allow for better understanding of natural variability and evolution of FMDV. PMID:29652800
Spotin, Adel; Mahami-Oskouei, Mahmoud; Harandi, Majid Fasihi; Baratchian, Mehdi; Bordbar, Ali; Ahmadpour, Ehsan; Ebrahimi, Sahar
2017-01-01
To investigate the genetic variability and population structure of Echinococcus granulosus complex, 79 isolates were sequenced from different host species covering human, dog, camel, goat, sheep and cattle as of various geographical sub-populations of Iran (Northwestern, Northern, and Southeastern). In addition, 36 sequences of other geographical populations (Western, Southeastern and Central Iran), were directly retrieved from GenBank database for the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The confirmed isolates were grouped as G1 genotype (n=92), G6 genotype (n=14), G3 genotype (n=8) and G2 genotype (n=1). 50 unique haplotypes were identified based on the analyzed sequences of cox1. A parsimonious network of the sequence haplotypes displayed star-like features in the overall population containing IR23 (22: 19.1%) as the most common haplotype. According to the analysis of molecular variance (AMOVA) test, the high value of haplotype diversity of E. granulosus complex was shown the total genetic variability within populations while nucleotide diversity was low in all populations. Neutrality indices of the cox1 (Tajima's D and Fu's Fs tests) were shown negative values in Western-Northwestern, Northern and Southeastern populations which indicating significant divergence from neutrality and positive but not significant in Central isolates. A pairwise fixation index (Fst) as a degree of gene flow was generally low value for all populations (0.00647-0.15198). The statistically Fst values indicate that Echinococcus sensu stricto (genotype G1-G3) populations are not genetically well differentiated in various geographical regions of Iran. To appraise the hypothetical evolutionary scenario, further study is needed to analyze concatenated mitogenomes and as well a panel of single locus nuclear markers should be considered in wider areas of Iran and neighboring countries. Copyright © 2016 Elsevier B.V. All rights reserved.
Chakravorty, S; Sarkar, S; Gachhui, R
2015-01-01
The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
DEFF Research Database (Denmark)
Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata
2000-01-01
The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...
Yan, Ning; Nie, Hua-Ming; Jiang, Zhong-Rong; Yang, Ai-Guo; Deng, Shi-Jin; Guo, Li; Yu, Hua; Yan, Yu-Bao; Tsering, Dawa; Kong, Wei-Shu; Wang, Ning; Wang, Jia-Hai; Xie, Yue; Fu, Yan; Yang, De-Ying; Wang, Shu-Xian; Gu, Xiao-Bin; Peng, Xue-Rong; Yang, Guang-You
2013-09-01
To analyse genetic variability and population structure, 84 isolates of Echinococcus granulosus (Cestoda: Taeniidae) collected from various host species at different sites of the Tibetan plateau in China were sequenced for the whole mitochondrial nad1 (894 bp) and atp6 (513 bp) genes. The vast majority were classified as G1 genotype (n=82), and two samples from human patients in Sichuan province were identified as G3 genotype. Based on the concatenated sequences of nad1+atp6, 28 different haplotypes (NA1-NA28) were identified. A parsimonious network of the concatenated sequence haplotypes showed star-like features in the overall population, with NA1 as the major haplotype in the population networks. By AMOVA it was shown that variation of E. granulosus within the overall population was the main pattern of the total genetic variability. Neutrality indexes of the concatenated sequence (nad1+atp6) were computed by Tajima's D and Fu's Fs tests and showed high negative values for E. granulosus, indicating significant deviations from neutrality. FST and Nm values suggested that the populations were not genetically differentiated. Copyright © 2013 Elsevier B.V. All rights reserved.
Coral bleaching pathways under the control of regional temperature variability
Langlais, C. E.; Lenton, A.; Heron, S. F.; Evenhuis, C.; Sen Gupta, A.; Brown, J. N.; Kuchinke, M.
2017-11-01
Increasing sea surface temperatures (SSTs) are predicted to adversely impact coral populations worldwide through increasing thermal bleaching events. Future bleaching is unlikely to be spatially uniform. Therefore, understanding what determines regional differences will be critical for adaptation management. Here, using a cumulative heat stress metric, we show that characteristics of regional SST determine the future bleaching risk patterns. Incorporating observed information on SST variability, in assessing future bleaching risk, provides novel options for management strategies. As a consequence, the known biases in climate model variability and the uncertainties in regional warming rate across climate models are less detrimental than previously thought. We also show that the thresholds used to indicate reef viability can strongly influence a decision on what constitutes a potential refugia. Observing and understanding the drivers of regional variability, and the viability limits of coral reefs, is therefore critical for making meaningful projections of coral bleaching risk.
Measure of uncertainty in regional grade variability
Tutmez, B.; Kaymak, U.; Melin, P.; Castillo, O.; Gomez Ramirez, E.; Kacprzyk, J.; Pedrycz, W.
2007-01-01
Because the geological events are neither homogeneous nor isotropic, the geological investigations are characterized by particularly high uncertainties. This paper presents a hybrid methodology for measuring of uncertainty in regional grade variability. In order to evaluate the fuzziness in grade
Mans, Ben J; Pienaar, Ronel; Latif, Abdalla A; Potgieter, Fred T
2011-05-01
Sequence variation within the 18S SSU rRNA V4 hyper-variable region can affect the accuracy of real-time hybridization probe-based diagnostics for the detection of Theileria spp. infections. This is relevant for assays that use non-specific primers, such as the real-time hybridization assay for T. parva (Sibeko et al. 2008). To assess the effect of sequence variation on this test, the Theileria 18S gene from 62 buffalo and 49 cattle samples was cloned and ∼1000 clones sequenced. Twenty-six genotypes were detected which included known and novel genotypes for the T. buffeli, T. mutans, T. taurotragi and T. velifera clades. A novel genotype related to T. sp. (sable) was also detected in 1 bovine sample. Theileria genotypic diversity was higher in buffalo compared to cattle. Polymorphism within the T. parva hyper-variable region was confirmed by aberrant real-time melting peaks and supported by sequencing of the S5 ribosomal gene. Analysis of the S5 gene suggests that this gene can be a marker for species differentiation. T. parva, T. sp. (buffalo) and T. sp. (bougasvlei) remain the only genotypes amplified by the primer set of the hybridization assay. Therefore, the 18S sequence diversity observed does not seem to affect the current real-time hybridization assay for T. parva.
Directory of Open Access Journals (Sweden)
Mark W Robinson
2016-04-01
Full Text Available To maintain a persistent infection viruses such as hepatitis C virus (HCV employ a range of mechanisms that subvert protective T cell responses. The suppression of antigen-specific T cell responses by HCV hinders efforts to profile T cell responses during chronic infection and antiviral therapy. Conventional methods of detecting antigen-specific T cells utilise either antigen stimulation (e.g. ELISpot, proliferation assays, cytokine production or antigen-loaded tetramer staining. This limits the ability to profile T cell responses during chronic infection due to suppressed effector function and the requirement for prior knowledge of antigenic viral peptide sequences. Recently high-throughput sequencing (HTS technologies have been developed for the analysis of T cell repertoires. In the present study we have assessed the feasibility of HTS of the TCRβ complementarity determining region (CDR3 to track T cell expansions in an antigen-independent manner. Using sequential blood samples from HCV-infected individuals undergoing anti-viral therapy we were able to measure the population frequencies of >35,000 TCRβ sequence clonotypes in each individual over the course of 12 weeks. TRBV/TRBJ gene segment usage varied markedly between individuals but remained relatively constant within individuals across the course of therapy. Despite this stable TRBV/TRBJ gene segment usage, a number of TCRβ sequence clonotypes showed dramatic changes in read frequency. These changes could not be linked to therapy outcomes in the present study however the TCRβ CDR3 sequences with the largest fold changes did include sequences with identical TRBV/TRBJ gene segment usage and high joining region homology to previously published CDR3 sequences from HCV-specific T cells targeting the HLA-B*0801-restricted 1395HSKKKCDEL1403 and HLA-A*0101–restricted 1435ATDALMTGY1443 epitopes. The pipeline developed in this proof of concept study provides a platform for the design of
Fouad, Geoffrey; Skupin, André; Hope, Allen
2016-04-01
The flow duration curve (FDC) is one of the most widely used tools to quantify streamflow. Its percentile flows are often required for water resource applications, but these values must be predicted for ungauged basins with insufficient or no streamflow data. Regional regression is a commonly used approach for predicting percentile flows that involves identifying hydrologic regions and calibrating regression models to each region. The independent variables used to describe the physiographic and climatic setting of the basins are a critical component of regional regression, yet few studies have investigated their effect on resulting predictions. In this study, the complexity of the independent variables needed for regional regression is investigated. Different levels of variable complexity are applied for a regional regression consisting of 918 basins in the US. Both the hydrologic regions and regression models are determined according to the different sets of variables, and the accuracy of resulting predictions is assessed. The different sets of variables include (1) a simple set of three variables strongly tied to the FDC (mean annual precipitation, potential evapotranspiration, and baseflow index), (2) a traditional set of variables describing the average physiographic and climatic conditions of the basins, and (3) a more complex set of variables extending the traditional variables to include statistics describing the distribution of physiographic data and temporal components of climatic data. The latter set of variables is not typically used in regional regression, and is evaluated for its potential to predict percentile flows. The simplest set of only three variables performed similarly to the other more complex sets of variables. Traditional variables used to describe climate, topography, and soil offered little more to the predictions, and the experimental set of variables describing the distribution of basin data in more detail did not improve predictions
Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model
DEFF Research Database (Denmark)
Gao, Rui; Liu, Yanxia; Gjesing, Anette Marianne Prior
2014-01-01
Monogenic diabetes is a genetic disease often caused by mutations in genes involved in beta-cell function. Correct sub-categorization of the disease is a prerequisite for appropriate treatment and genetic counseling. Target-region capture sequencing is a combination of genomic region enrichment...... and next generation sequencing which might be used as an efficient way to diagnose various genetic disorders. We aimed to develop a target-region capture sequencing platform to screen 117 selected candidate genes involved in metabolism for mutations and to evaluate its performance using monogenic diabetes...
ASAP: Amplification, sequencing & annotation of plastomes
Directory of Open Access Journals (Sweden)
Folta Kevin M
2005-12-01
Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and
Regional impacts of ocean color on tropical Pacific variability
Anderson, W.; Gnanadesikan, A.; Wittenberg, A.
2009-08-01
The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño) while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.
Using a sequence characterized amplified region (SCAR) marker for ...
African Journals Online (AJOL)
GREGORY
2010-09-13
Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.
Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L
2003-10-01
The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.
Directory of Open Access Journals (Sweden)
2006-05-01
Full Text Available Many pathogenic microorganisms evade host immunity through extensive sequence variability in a protein region targeted by protective antibodies. In spite of the sequence variability, a variable region commonly retains an important ligand-binding function, reflected in the presence of a highly conserved sequence motif. Here, we analyze the limits of sequence divergence in a ligand-binding region by characterizing the hypervariable region (HVR of Streptococcus pyogenes M protein. Our studies were focused on HVRs that bind the human complement regulator C4b-binding protein (C4BP, a ligand that confers phagocytosis resistance. A previous comparison of C4BP-binding HVRs identified residue identities that could be part of a binding motif, but the extended analysis reported here shows that no residue identities remain when additional C4BP-binding HVRs are included. Characterization of the HVR in the M22 protein indicated that two relatively conserved Leu residues are essential for C4BP binding, but these residues are probably core residues in a coiled-coil, implying that they do not directly contribute to binding. In contrast, substitution of either of two relatively conserved Glu residues, predicted to be solvent-exposed, had no effect on C4BP binding, although each of these changes had a major effect on the antigenic properties of the HVR. Together, these findings show that HVRs of M proteins have an extraordinary capacity for sequence divergence and antigenic variability while retaining a specific ligand-binding function.
Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs
Directory of Open Access Journals (Sweden)
Ruan Jishou
2007-04-01
Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are
Regional impacts of ocean color on tropical Pacific variability
Directory of Open Access Journals (Sweden)
W. Anderson
2009-08-01
Full Text Available The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.
Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein
DEFF Research Database (Denmark)
Lannergård, Jonas; Kristensen, Bodil M.; Gustafsson, Mattias C. U.
2015-01-01
The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms...... fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant...
YSOVAR: MID-INFRARED VARIABILITY AMONG YSOs IN THE STAR FORMATION REGION GGD12-15
Energy Technology Data Exchange (ETDEWEB)
Wolk, Scott J.; Günther, H. Moritz; Poppenhaeger, Katja; Forbrich, J. [Harvard–Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [NASA Ames Research Center, M/S 244-5 Moffett Field, CA 94035 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 E. California Blvd., Pasadena, CA 91125 (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [Department of Physics Astronomy and Materials Science, Missouri State University, Springfield, MO 65897 (United States); Covey, K. R. [Department of Physics and Astronomy, Western Washington Univ., Bellingham, WA 98225-9164 (United States); Song, Inseok, E-mail: swolk@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)
2015-11-15
We present an IR-monitoring survey with the Spitzer Space Telescope of the star-forming region GGD 12-15. More than 1000 objects were monitored, including about 350 objects within the central 5′, which is found to be especially dense in cluster members. The monitoring took place over 38 days and is part of the Young Stellar Object VARiability project. The region was also the subject of a contemporaneous 67 ks Chandra observation. The field includes 119 previously identified pre-main sequence star candidates. X-rays are detected from 164 objects, 90 of which are identified with cluster members. Overall, we find that about half the objects in the central 5′ are young stellar objects (YSOs) based on a combination of their spectral energy distribution, IR variability, and X-ray emission. Most of the stars with IR excess relative to a photosphere show large amplitude (>0.1 mag) mid-infrared (mid-IR) variability. There are 39 periodic sources, and all but one is found to be a cluster member. Almost half of the periodic sources do not show IR excesses. Overall, more than 85% of the Class I, flat spectrum, and Class II sources are found to vary. The amplitude of the variability is larger in more embedded YSOs. Most of the Class I/II objects exhibit redder colors in a fainter state, which is compatible with time-variable extinction. A few become bluer when fainter, which can be explained with significant changes in the structure of the inner disk. A search for changes in the IR due to X-ray events is carried out, but the low number of flares prevented an analysis of the direct impact of X-ray flares on the IR light curves. However, we find that X-ray detected Class II sources have longer timescales for change in the MIR than a similar set of non-X-ray detected Class IIs.
Directory of Open Access Journals (Sweden)
Abdulahi Alfonso-Morales
Full Text Available Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV; it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV strains.Sequences of the hyper-variable region of the VP2 (HVR-VP2 gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST, Bayesian Tip-association Significance testing (BaTS and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium in 1987, Africa (Egypt around 1990, East Asia (China and Japan in 1993, the Caribbean Region (Cuba by 1995 and South America (Brazil around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection.To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.
Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J
2013-01-01
Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.
Internal variability in a regional climate model over West Africa
Energy Technology Data Exchange (ETDEWEB)
Vanvyve, Emilie; Ypersele, Jean-Pascal van [Universite catholique de Louvain, Institut d' astronomie et de geophysique Georges Lemaitre, Louvain-la-Neuve (Belgium); Hall, Nicholas [Laboratoire d' Etudes en Geophysique et Oceanographie Spatiales/Centre National d' Etudes Spatiales, Toulouse Cedex 9 (France); Messager, Christophe [University of Leeds, Institute for Atmospheric Science, Environment, School of Earth and Environment, Leeds (United Kingdom); Leroux, Stephanie [Universite Joseph Fourier, Laboratoire d' etude des Transferts en Hydrologie et Environnement, BP53, Grenoble Cedex 9 (France)
2008-02-15
Sensitivity studies with regional climate models are often performed on the basis of a few simulations for which the difference is analysed and the statistical significance is often taken for granted. In this study we present some simple measures of the confidence limits for these types of experiments by analysing the internal variability of a regional climate model run over West Africa. Two 1-year long simulations, differing only in their initial conditions, are compared. The difference between the two runs gives a measure of the internal variability of the model and an indication of which timescales are reliable for analysis. The results are analysed for a range of timescales and spatial scales, and quantitative measures of the confidence limits for regional model simulations are diagnosed for a selection of study areas for rainfall, low level temperature and wind. As the averaging period or spatial scale is increased, the signal due to internal variability gets smaller and confidence in the simulations increases. This occurs more rapidly for variations in precipitation, which appear essentially random, than for dynamical variables, which show some organisation on larger scales. (orig.)
International Nuclear Information System (INIS)
Schroeder, H.W. Jr.; Walter, M.A.; Hofker, M.H.; Ebens, A.; Van Dijk, K.W.; Liao, L.C.; Cox, D.W.; Milner, E.C.B.; Perlmutter, R.M.
1988-01-01
Antibody genes are assembled from a series of germ-line gene segments that are juxtaposed during the maturation of B lymphocytes. Although diversification of the adult antibody repertoire results in large part from the combinatorial joining of these gene segments, a restricted set of antibody heavy chain variable (V H ), diversity (D H ), and joining (J H ) region gene segments appears preferentially in the human fetal repertoire. The authors report here that one of these early-expressed V H elements (termed V H 6) is the most 3' V H gene segment, positioned 77 kilobases on the 5' side of the J H locus and immediately adjacent to a set of previously described D H sequences. In addition to providing a physical map linking human V H , D H , and J H elements, these results support the view that the programmed development of the antibody V H repertoire is determined in part by the chromosomal position of these gene segments
Time Separation Between Events in a Sequence: a Regional Property?
Muirwood, R.; Fitzenz, D. D.
2013-12-01
Earthquake sequences are loosely defined as events occurring too closely in time and space to appear unrelated. Depending on the declustering method, several, all, or no event(s) after the first large event might be recognized as independent mainshocks. It can therefore be argued that a probabilistic seismic hazard assessment (PSHA, traditionally dealing with mainshocks only) might already include the ground shaking effects of such sequences. Alternatively all but the largest event could be classified as an ';aftershock' and removed from the earthquake catalog. While in PSHA the question is only whether to keep or remove the events from the catalog, for Risk Management purposes, the community response to the earthquakes, as well as insurance risk transfer mechanisms, can be profoundly affected by the actual timing of events in such a sequence. In particular the repetition of damaging earthquakes over a period of weeks to months can lead to businesses closing and families evacuating from the region (as happened in Christchurch, New Zealand in 2011). Buildings that are damaged in the first earthquake may go on to be damaged again, even while they are being repaired. Insurance also functions around a set of critical timeframes - including the definition of a single 'event loss' for reinsurance recoveries within the 192 hour ';hours clause', the 6-18 month pace at which insurance claims are settled, and the annual renewal of insurance and reinsurance contracts. We show how temporal aspects of earthquake sequences need to be taken into account within models for Risk Management, and what time separation between events are most sensitive, both in terms of the modeled disruptions to lifelines and business activity as well as in the losses to different parties (such as insureds, insurers and reinsurers). We also explore the time separation between all events and between loss causing events for a collection of sequences from across the world and we point to the need to
Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S
2010-10-01
Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (Pc) 2010 Elsevier B.V. All rights reserved.
van de Bovenkamp, Fleur S; Derksen, Ninotska I L; Ooijevaar-de Heer, Pleuni; van Schie, Karin A; Kruithof, Simone; Berkowska, Magdalena A; van der Schoot, C Ellen; IJspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E M; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S Marieke; Vidarsson, Gestur; Rispens, Theo
2018-02-20
A hallmark of B-cell immunity is the generation of a diverse repertoire of antibodies from a limited set of germline V(D)J genes. This repertoire is usually defined in terms of amino acid composition. However, variable domains may also acquire N -linked glycans, a process conditional on the introduction of consensus amino acid motifs ( N -glycosylation sites) during somatic hypermutation. High levels of variable domain glycans have been associated with autoantibodies in rheumatoid arthritis, as well as certain follicular lymphomas. However, the role of these glycans in the humoral immune response remains poorly understood. Interestingly, studies have reported both positive and negative effects on antibody affinity. Our aim was to elucidate the role of variable domain glycans during antigen-specific antibody responses. By analyzing B-cell repertoires by next-generation sequencing, we demonstrate that N -glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we subsequently show that this process is subject to selection during antigen-specific antibody responses, skewed toward IgG4, and positively contributes to antigen binding. Together, these results highlight a physiological role for variable domain glycosylation as an additional layer of antibody diversification that modulates antigen binding.
Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.
Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han
2017-01-01
The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.
Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.
Directory of Open Access Journals (Sweden)
Heewon Seo
Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.
High genetic diversity in the coat protein and 3' untranslated regions
Indian Academy of Sciences (India)
The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...
Strong influence of variable treatment on the performance of numerically defined ecological regions.
Snelder, Ton; Lehmann, Anthony; Lamouroux, Nicolas; Leathwick, John; Allenbach, Karin
2009-10-01
Numerical clustering has frequently been used to define hierarchically organized ecological regionalizations, but there has been little robust evaluation of their performance (i.e., the degree to which regions discriminate areas with similar ecological character). In this study we investigated the effect of the weighting and treatment of input variables on the performance of regionalizations defined by agglomerative clustering across a range of hierarchical levels. For this purpose, we developed three ecological regionalizations of Switzerland of increasing complexity using agglomerative clustering. Environmental data for our analysis were drawn from a 400 m grid and consisted of estimates of 11 environmental variables for each grid cell describing climate, topography and lithology. Regionalization 1 was defined from the environmental variables which were given equal weights. We used the same variables in Regionalization 2 but weighted and transformed them on the basis of a dissimilarity model that was fitted to land cover composition data derived for a random sample of cells from interpretation of aerial photographs. Regionalization 3 was a further two-stage development of Regionalization 2 where specific classifications, also weighted and transformed using dissimilarity models, were applied to 25 small scale "sub-domains" defined by Regionalization 2. Performance was assessed in terms of the discrimination of land cover composition for an independent set of sites using classification strength (CS), which measured the similarity of land cover composition within classes and the dissimilarity between classes. Regionalization 2 performed significantly better than Regionalization 1, but the largest gains in performance, compared to Regionalization 1, occurred at coarse hierarchical levels (i.e., CS did not increase significantly beyond the 25-region level). Regionalization 3 performed better than Regionalization 2 beyond the 25-region level and CS values continued to
Liao, Weinan; Ren, Jie; Wang, Kun; Wang, Shun; Zeng, Feng; Wang, Ying; Sun, Fengzhu
2016-11-23
The comparison between microbial sequencing data is critical to understand the dynamics of microbial communities. The alignment-based tools analyzing metagenomic datasets require reference sequences and read alignments. The available alignment-free dissimilarity approaches model the background sequences with Fixed Order Markov Chain (FOMC) yielding promising results for the comparison of microbial communities. However, in FOMC, the number of parameters grows exponentially with the increase of the order of Markov Chain (MC). Under a fixed high order of MC, the parameters might not be accurately estimated owing to the limitation of sequencing depth. In our study, we investigate an alternative to FOMC to model background sequences with the data-driven Variable Length Markov Chain (VLMC) in metatranscriptomic data. The VLMC originally designed for long sequences was extended to apply to high-throughput sequencing reads and the strategies to estimate the corresponding parameters were developed. The flexible number of parameters in VLMC avoids estimating the vast number of parameters of high-order MC under limited sequencing depth. Different from the manual selection in FOMC, VLMC determines the MC order adaptively. Several beta diversity measures based on VLMC were applied to compare the bacterial RNA-Seq and metatranscriptomic datasets. Experiments show that VLMC outperforms FOMC to model the background sequences in transcriptomic and metatranscriptomic samples. A software pipeline is available at https://d2vlmc.codeplex.com.
Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions
International Nuclear Information System (INIS)
Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia
2013-01-01
16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
DEFF Research Database (Denmark)
de Mol, Friederike; Gerowitt, Bärbel; Kaczmarek, Sylwia
2015-01-01
The question on intraregional versus inter-regional variability in herbicide sensitivity for weed populations is of major importance, both in extrapolation of model parameters and in herbicide zonal approval procedures. We hypothesised that inter-regional variability in herbicide sensitivity for ...
OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.
Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-06-01
Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.
Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence
International Nuclear Information System (INIS)
Sun, Y.L.
2015-01-01
The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)
The discrete and localized nature of the variable emission from active regions
Arndt, Martina Belz; Habbal, Shadia Rifai; Karovska, Margarita
1994-01-01
Using data from the Extreme Ultraviolet (EUV) Spectroheliometer on Skylab, we study the empirical characteristics of the variable emission in active regions. These simultaneous multi-wavelength observations clearly confirm that active regions consist of a complex of loops at different temperatures. The variable emission from this complex has very well-defined properties that can be quantitatively summarized as follows: (1) It is localized predominantly around the footpoints where it occurs at discrete locations. (2) The strongest variability does not necessarily coincide with the most intense emission. (3) The fraction of the area of the footpoints, (delta n)/N, that exhibits variable emission, varies by +/- 15% as a function of time, at any of the wavelengths measured. It also varies very little from footpoint to footpoint. (4) This fractional variation is temperature dependent with a maximum around 10(exp 5) K. (5) The ratio of the intensity of the variable to the average background emission, (delta I)/(bar-I), also changes with temperature. In addition, we find that these distinctive characteristics persist even when flares occur within the active region.
Directory of Open Access Journals (Sweden)
Debnath Bhattacharyya
2013-01-01
Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.
Mandal, Bijoy Kumar; Kim, Tai-hoon
2013-01-01
We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321
Energy Technology Data Exchange (ETDEWEB)
Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)
1988-07-25
Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.
High-resolution regional climate model evaluation using variable-resolution CESM over California
Huang, X.; Rhoades, A.; Ullrich, P. A.; Zarzycki, C. M.
2015-12-01
Understanding the effect of climate change at regional scales remains a topic of intensive research. Though computational constraints remain a problem, high horizontal resolution is needed to represent topographic forcing, which is a significant driver of local climate variability. Although regional climate models (RCMs) have traditionally been used at these scales, variable-resolution global climate models (VRGCMs) have recently arisen as an alternative for studying regional weather and climate allowing two-way interaction between these domains without the need for nudging. In this study, the recently developed variable-resolution option within the Community Earth System Model (CESM) is assessed for long-term regional climate modeling over California. Our variable-resolution simulations will focus on relatively high resolutions for climate assessment, namely 28km and 14km regional resolution, which are much more typical for dynamically downscaled studies. For comparison with the more widely used RCM method, the Weather Research and Forecasting (WRF) model will be used for simulations at 27km and 9km. All simulations use the AMIP (Atmospheric Model Intercomparison Project) protocols. The time period is from 1979-01-01 to 2005-12-31 (UTC), and year 1979 was discarded as spin up time. The mean climatology across California's diverse climate zones, including temperature and precipitation, is analyzed and contrasted with the Weather Research and Forcasting (WRF) model (as a traditional RCM), regional reanalysis, gridded observational datasets and uniform high-resolution CESM at 0.25 degree with the finite volume (FV) dynamical core. The results show that variable-resolution CESM is competitive in representing regional climatology on both annual and seasonal time scales. This assessment adds value to the use of VRGCMs for projecting climate change over the coming century and improve our understanding of both past and future regional climate related to fine
Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis
DEFF Research Database (Denmark)
Ladefoged, Søren; Christiansen, Gunna
1994-01-01
of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...
Sequence organization and control of transcription in the bacteriophage T4 tRNA region.
Broida, J; Abelson, J
1985-10-05
Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.
Stellar Variability at the Main-sequence Turnoff of the Intermediate-age LMC Cluster NGC 1846
Salinas, R.; Pajkos, M. A.; Vivas, A. K.; Strader, J.; Contreras Ramos, R.
2018-04-01
Intermediate-age (IA) star clusters in the Large Magellanic Cloud (LMC) present extended main-sequence turn-offs (MSTO) that have been attributed to either multiple stellar populations or an effect of stellar rotation. Recently it has been proposed that these extended main sequences can also be produced by ill-characterized stellar variability. Here we present Gemini-S/Gemini Multi-Object Spectrometer (GMOS) time series observations of the IA cluster NGC 1846. Using differential image analysis, we identified 73 new variable stars, with 55 of those being of the Delta Scuti type, that is, pulsating variables close the MSTO for the cluster age. Considering completeness and background contamination effects, we estimate the number of δ Sct belonging to the cluster between 40 and 60 members, although this number is based on the detection of a single δ Sct within the cluster half-light radius. This amount of variable stars at the MSTO level will not produce significant broadening of the MSTO, albeit higher-resolution imaging will be needed to rule out variable stars as a major contributor to the extended MSTO phenomenon. Though modest, this amount of δ Sct makes NGC 1846 the star cluster with the highest number of these variables ever discovered. Lastly, our results present a cautionary tale about the adequacy of shallow variability surveys in the LMC (like OGLE) to derive properties of its δ Sct population. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the National Research Council (Canada), CONICYT (Chile), Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina), and Ministério da Ciência, Tecnologia e Inovação (Brazil).
Variability or conservation of hepatitis C virus hypervariable region 1?
Indian Academy of Sciences (India)
The hypervariable region 1 (HVR1) of the E2 protein of hepatitis C virus (HCV) is highly heterogeneous in its primary sequence and is responsible for significant inter- and intra-individual variation of the infecting virus, which may represent an important pathogenetic mechanism leading to immune escape and persistent ...
Impact of region contouring variability on image-based focal therapy evaluation
Gibson, Eli; Donaldson, Ian A.; Shah, Taimur T.; Hu, Yipeng; Ahmed, Hashim U.; Barratt, Dean C.
2016-03-01
Motivation: Focal therapy is an emerging low-morbidity treatment option for low-intermediate risk prostate cancer; however, challenges remain in accurately delivering treatment to specified targets and determining treatment success. Registered multi-parametric magnetic resonance imaging (MPMRI) acquired before and after treatment can support focal therapy evaluation and optimization; however, contouring variability, when defining the prostate, the clinical target volume (CTV) and the ablation region in images, reduces the precision of quantitative image-based focal therapy evaluation metrics. To inform the interpretation and clarify the limitations of such metrics, we investigated inter-observer contouring variability and its impact on four metrics. Methods: Pre-therapy and 2-week-post-therapy standard-of-care MPMRI were acquired from 5 focal cryotherapy patients. Two clinicians independently contoured, on each slice, the prostate (pre- and post-treatment) and the dominant index lesion CTV (pre-treatment) in the T2-weighted MRI, and the ablated region (post-treatment) in the dynamic-contrast- enhanced MRI. For each combination of clinician contours, post-treatment images were registered to pre-treatment images using a 3D biomechanical-model-based registration of prostate surfaces, and four metrics were computed: the proportion of the target tissue region that was ablated and the target:ablated region volume ratio for each of two targets (the CTV and an expanded planning target volume). Variance components analysis was used to measure the contribution of each type of contour to the variance in the therapy evaluation metrics. Conclusions: 14-23% of evaluation metric variance was attributable to contouring variability (including 6-12% from ablation region contouring); reducing this variability could improve the precision of focal therapy evaluation metrics.
Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard
2012-12-01
Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.
WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences
Directory of Open Access Journals (Sweden)
Pesole Graziano
2007-02-01
Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.
Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P
2018-01-01
We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.
Lin, Jo-Fu Lotus; Silva-Pereyra, Juan; Chou, Chih-Che; Lin, Fa-Hsuan
2018-04-11
Variability in neuronal response latency has been typically considered caused by random noise. Previous studies of single cells and large neuronal populations have shown that the temporal variability tends to increase along the visual pathway. Inspired by these previous studies, we hypothesized that functional areas at later stages in the visual pathway of face processing would have larger variability in the response latency. To test this hypothesis, we used magnetoencephalographic data collected when subjects were presented with images of human faces. Faces are known to elicit a sequence of activity from the primary visual cortex to the fusiform gyrus. Our results revealed that the fusiform gyrus showed larger variability in the response latency compared to the calcarine fissure. Dynamic and spectral analyses of the latency variability indicated that the response latency in the fusiform gyrus was more variable than in the calcarine fissure between 70 ms and 200 ms after the stimulus onset and between 4 Hz and 40 Hz, respectively. The sequential processing of face information from the calcarine sulcus to the fusiform sulcus was more reliably detected based on sizes of the response variability than instants of the maximal response peaks. With two areas in the ventral visual pathway, we show that the variability in response latency across brain areas can be used to infer the sequence of cortical activity.
Berger, C; Berger, B; Parson, W
2012-01-01
In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
DEFF Research Database (Denmark)
Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata
2000-01-01
The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...
International Nuclear Information System (INIS)
Millwater, Harry; Singh, Gulshan; Cortina, Miguel
2012-01-01
There are many methods to identify the important variable out of a set of random variables, i.e., “inter-variable” importance; however, to date there are no comparable methods to identify the “region” of importance within a random variable, i.e., “intra-variable” importance. Knowledge of the critical region of an input random variable (tail, near-tail, and central region) can provide valuable information towards characterizing, understanding, and improving a model through additional modeling or testing. As a result, an intra-variable probabilistic sensitivity method was developed and demonstrated for independent random variables that computes the partial derivative of a probabilistic response with respect to a localized perturbation in the CDF values of each random variable. These sensitivities are then normalized in absolute value with respect to the largest sensitivity within a distribution to indicate the region of importance. The methodology is implemented using the Score Function kernel-based method such that existing samples can be used to compute sensitivities for negligible cost. Numerical examples demonstrate the accuracy of the method through comparisons with finite difference and numerical integration quadrature estimates. - Highlights: ► Probabilistic sensitivity methodology. ► Determines the “region” of importance within random variables such as left tail, near tail, center, right tail, etc. ► Uses the Score Function approach to reuse the samples, hence, negligible cost. ► No restrictions on the random variable types or limit states.
HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.
Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C
2017-11-01
The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by
Integrated Variable Speed Limits Control and Ramp Metering for Bottleneck Regions on Freeway
Directory of Open Access Journals (Sweden)
Ming-hui Ma
2015-01-01
Full Text Available To enhance the efficiency of the existing freeway system and therefore to mitigate traffic congestion and related problems on the freeway mainline lane-drop bottleneck region, the advanced strategy for bottleneck control is essential. This paper proposes a method that integrates variable speed limits and ramp metering for freeway bottleneck region control to relieve the chaos in bottleneck region. To this end, based on the analyses of spatial-temporal patterns of traffic flow, a macroscopic traffic flow model is extended to describe the traffic flow operating characteristic by considering the impacts of variable speed limits in mainstream bottleneck region. In addition, to achieve the goal of balancing the priority of the vehicles on mainline and on-ramp, increasing capacity, and reducing travel delay on bottleneck region, an improved control model, as well as an advanced control strategy that integrates variable speed limits and ramp metering, is developed. The proposed method is tested in simulation for a real freeway infrastructure feed and calibrates real traffic variables. The results demonstrate that the proposed method can substantially improve the traffic flow efficiency of mainline and on-ramp and enhance the quality of traffic flow at the investigated freeway mainline bottleneck.
Verstynen, Timothy; Phillips, Jeff; Braun, Emily; Workman, Brett; Schunn, Christian; Schneider, Walter
2012-01-01
Many everyday skills are learned by binding otherwise independent actions into a unified sequence of responses across days or weeks of practice. Here we looked at how the dynamics of action planning and response binding change across such long timescales. Subjects (N = 23) were trained on a bimanual version of the serial reaction time task (32-item sequence) for two weeks (10 days total). Response times and accuracy both showed improvement with time, but appeared to be learned at different rates. Changes in response speed across training were associated with dynamic changes in response time variability, with faster learners expanding their variability during the early training days and then contracting response variability late in training. Using a novel measure of response chunking, we found that individual responses became temporally correlated across trials and asymptoted to set sizes of approximately 7 bound responses at the end of the first week of training. Finally, we used a state-space model of the response planning process to look at how predictive (i.e., response anticipation) and error-corrective (i.e., post-error slowing) processes correlated with learning rates for speed, accuracy and chunking. This analysis yielded non-monotonic association patterns between the state-space model parameters and learning rates, suggesting that different parts of the response planning process are relevant at different stages of long-term learning. These findings highlight the dynamic modulation of response speed, variability, accuracy and chunking as multiple movements become bound together into a larger set of responses during sequence learning.
DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T
Choudhary, M.; Kaplan, Samuel
2000-01-01
This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
Energy Technology Data Exchange (ETDEWEB)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
1987-10-16
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.
Directory of Open Access Journals (Sweden)
Michael H. Kohn
2008-01-01
Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.
Directory of Open Access Journals (Sweden)
Fabian König
Full Text Available The monoclonal antibody S9.6 is a widely-used tool to purify, analyse and quantify R-loop structures in cells. A previous study using the surface plasmon resonance technology and a single-chain variable fragment (scFv of S9.6 showed high affinity (0.6 nM for DNA-RNA and also a high affinity (2.7 nM for RNA-RNA hybrids. We used the microscale thermophoresis method allowing surface independent interaction studies and electromobility shift assays to evaluate additional RNA-DNA hybrid sequences and to quantify the binding affinities of the S9.6 antibody with respect to distinct sequences and their GC-content. Our results confirm high affinity binding to previously analysed sequences, but reveals that binding affinities are highly sequence specific. Our study presents R-loop sequences that independent of GC-content and in different sequence variations exhibit either no binding, binding affinities in the micromolar range and as well high affinity binding in the nanomolar range. Our study questions the usefulness of the S9.6 antibody in the quantitative analysis of R-loop sequences in vivo.
Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method
Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng
2013-01-01
To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Bapna, Mukund; Sunder Raman, Ramya; Ramachandran, S; Rajesh, T A
2013-03-01
This study characterizes over 5 years of high time resolution (5 min), airborne black carbon (BC) concentrations (July 2003 to December 2008) measured over Ahmedabad, an urban region in western India. The data were used to obtain different time averages of BC concentrations, and these averages were then used to assess the diurnal, seasonal, and annual variability of BC over the study region. Assessment of diurnal variations revealed a strong association between BC concentrations and vehicular traffic. Peaks in BC concentration were co-incident with the morning (0730 to 0830, LST) and late evening (1930 to 2030, LST) rush hour traffic. Additionally, diurnal variability in BC concentrations during major festivals (Diwali and Dushera during the months of October/November) revealed an increase in BC concentrations due to fireworks displays. Maximum half hourly BC concentrations during the festival days were as high as 79.8 μg m(-3). However, the high concentrations rapidly decayed suggesting that local meteorology during the festive season was favorable for aerosol dispersion. A multiple linear regression (MLR) model with BC as the dependent variable and meteorological parameters as independent variables was fitted. The variability in temperature, humidity, wind speed, and wind direction accounted for about 49% of the variability in measured BC concentrations. Conditional probability function (CPF) analysis was used to identify the geographical location of local source regions contributing to the effective BC measured (at 880 nm) at the receptor site. The east north-east (ENE) direction to the receptor was identified as a major source region. National highway (NH8) and two coal-fired thermal power stations (at Gandhinagar and Sabarmati) were located in the identified direction, suggesting that local traffic and power plant emissions were likely contributors to the measured BC.
R. McManamay; D. Orth; C. Dolloff; E. Frimpong
2011-01-01
Regional frameworks have been used extensively in recent years to aid in broad-scale management. Widely used landscape-based regional frameworks, such as hydrologic landscape regions (HLRs) and physiographic provinces, may provide predictive tools of hydrologic variability. However, hydrologic-based regional frameworks, created using only streamflow data, are also...
Assessment of regional air pollution variability in Istanbul
International Nuclear Information System (INIS)
Sen, Z.; Oztopal, A.
2001-01-01
Air pollution concentrations have temporal and spatial variations depending on the prevailing weather conditions, topographic features, city building heights and locations. When the measurements of air pollutants are available at set measurement sites, the regional variability degree of air pollutants is quantified using the point cumulative semi-variogram (PCSV). This technique provides a systematic method for calculating the changes in the concentrations of air pollutants with distance from a specific site. Regional variations of sulphur dioxide (SO 2 ) and total suspended particulate (TSP) matter concentrations in Istanbul city were evaluated using the PCSV concept. The data were available from 16 different air pollution measurement stations scattered all over the city for a period from 1988 to 1994. Monthly regional variation maps were drawn in and around the city at different radii of influence. These maps provide a reference for measuring future changes of air pollution in the city. (author)
Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.
Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael
2009-10-01
Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.
Characterizing CDOM Spectral Variability Across Diverse Regions and Spectral Ranges
Grunert, Brice K.; Mouw, Colleen B.; Ciochetto, Audrey B.
2018-01-01
Satellite remote sensing of colored dissolved organic matter (CDOM) has focused on CDOM absorption (aCDOM) at a reference wavelength, as its magnitude provides insight into the underwater light field and large-scale biogeochemical processes. CDOM spectral slope, SCDOM, has been treated as a constant or semiconstant parameter in satellite retrievals of aCDOM despite significant regional and temporal variabilities. SCDOM and other optical metrics provide insights into CDOM composition, processing, food web dynamics, and carbon cycling. To date, much of this work relies on fluorescence techniques or aCDOM in spectral ranges unavailable to current and planned satellite sensors (e.g., global variability in SCDOM and fit deviations in the aCDOM spectra using the recently proposed Gaussian decomposition method. From this, we investigate if global variability in retrieved SCDOM and Gaussian components is significant and regionally distinct. We iteratively decreased the spectral range considered and analyzed the number, location, and magnitude of fitted Gaussian components to understand if a reduced spectral range impacts information obtained within a common spectral window. We compared the fitted slope from the Gaussian decomposition method to absorption-based indices that indicate CDOM composition to determine the ability of satellite-derived slope to inform the analysis and modeling of large-scale biogeochemical processes. Finally, we present implications of the observed variability for remote sensing of CDOM characteristics via SCDOM.
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Energy Technology Data Exchange (ETDEWEB)
Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)
1989-06-12
The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.
Variable depth recursion algorithm for leaf sequencing
International Nuclear Information System (INIS)
Siochi, R. Alfredo C.
2007-01-01
The processes of extraction and sweep are basic segmentation steps that are used in leaf sequencing algorithms. A modified version of a commercial leaf sequencer changed the way that the extracts are selected and expanded the search space, but the modification maintained the basic search paradigm of evaluating multiple solutions, each one consisting of up to 12 extracts and a sweep sequence. While it generated the best solutions compared to other published algorithms, it used more computation time. A new, faster algorithm selects one extract at a time but calls itself as an evaluation function a user-specified number of times, after which it uses the bidirectional sweeping window algorithm as the final evaluation function. To achieve a performance comparable to that of the modified commercial leaf sequencer, 2-3 calls were needed, and in all test cases, there were only slight improvements beyond two calls. For the 13 clinical test maps, computation speeds improved by a factor between 12 and 43, depending on the constraints, namely the ability to interdigitate and the avoidance of the tongue-and-groove under dose. The new algorithm was compared to the original and modified versions of the commercial leaf sequencer. It was also compared to other published algorithms for 1400, random, 15x15, test maps with 3-16 intensity levels. In every single case the new algorithm provided the best solution
Takeda, Shuntaro; Furusawa, Akira
2017-09-22
We propose a scalable scheme for optical quantum computing using measurement-induced continuous-variable quantum gates in a loop-based architecture. Here, time-bin-encoded quantum information in a single spatial mode is deterministically processed in a nested loop by an electrically programmable gate sequence. This architecture can process any input state and an arbitrary number of modes with almost minimum resources, and offers a universal gate set for both qubits and continuous variables. Furthermore, quantum computing can be performed fault tolerantly by a known scheme for encoding a qubit in an infinite-dimensional Hilbert space of a single light mode.
Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman
2017-10-03
It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions
Directory of Open Access Journals (Sweden)
Tong-Jian Liu
2016-06-01
Full Text Available Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp were separated by a large single-copy region (82,064 bp and a small single-copy region (17,725 bp. The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.
Impact of Variable-Resolution Meshes on Regional Climate Simulations
Fowler, L. D.; Skamarock, W. C.; Bruyere, C. L.
2014-12-01
The Model for Prediction Across Scales (MPAS) is currently being used for seasonal-scale simulations on globally-uniform and regionally-refined meshes. Our ongoing research aims at analyzing simulations of tropical convective activity and tropical cyclone development during one hurricane season over the North Atlantic Ocean, contrasting statistics obtained with a variable-resolution mesh against those obtained with a quasi-uniform mesh. Analyses focus on the spatial distribution, frequency, and intensity of convective and grid-scale precipitations, and their relative contributions to the total precipitation as a function of the horizontal scale. Multi-month simulations initialized on May 1st 2005 using ERA-Interim re-analyses indicate that MPAS performs satisfactorily as a regional climate model for different combinations of horizontal resolutions and transitions between the coarse and refined meshes. Results highlight seamless transitions for convection, cloud microphysics, radiation, and land-surface processes between the quasi-uniform and locally- refined meshes, despite the fact that the physics parameterizations were not developed for variable resolution meshes. Our goal of analyzing the performance of MPAS is twofold. First, we want to establish that MPAS can be successfully used as a regional climate model, bypassing the need for nesting and nudging techniques at the edges of the computational domain as done in traditional regional climate modeling. Second, we want to assess the performance of our convective and cloud microphysics parameterizations as the horizontal resolution varies between the lower-resolution quasi-uniform and higher-resolution locally-refined areas of the global domain.
The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes
Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.
2003-01-01
The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes
Energy Technology Data Exchange (ETDEWEB)
Jackson, P.J.; Walthers, E.A.; Richmond, K.L. [Los Alamos National Lab., NM (United States)] [and others
1997-04-01
PCR analysis of 198 Bacillus anthracis isolates revealed a variable region of DNA sequence differing in length among the isolates. Five Polymorphisms differed by the presence Of two to six copies of the 12-bp tandem repeat 5{prime}-CAATATCAACAA-3{prime}. This variable-number tandem repeat (VNTR) region is located within a larger sequence containing one complete open reading frame that encodes a putative 30-kDa protein. Length variation did not change the reading frame of the encoded protein and only changed the copy number of a 4-amino-acid sequence (QYQQ) from 2 to 6. The structure of the VNTR region suggests that these multiple repeats are generated by recombination or polymerase slippage. Protein structures predicted from the reverse-translated DNA sequence suggest that any structural changes in the encoded protein are confined to the region encoded by the VNTR sequence. Copy number differences in the VNTR region were used to define five different B. anthracis alleles. Characterization of 198 isolates revealed allele frequencies of 6.1, 17.7, 59.6, 5.6, and 11.1% sequentially from shorter to longer alleles. The high degree of polymorphism in the VNTR region provides a criterion for assigning isolates to five allelic categories. There is a correlation between categories and geographic distribution. Such molecular markers can be used to monitor the epidemiology of anthrax outbreaks in domestic and native herbivore populations. 22 refs., 4 figs., 3 tabs.
Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat
2017-07-01
The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.
Remarkable sequence conservation of the last intron in the PKD1 gene.
Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P
2003-10-01
The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.
Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin
2009-05-01
DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.
Morphometric variability of Arctodiaptomus salinus (Copepoda) in the Mediterranean-Black Sea region
ANUFRIIEVA, Elena V.; SHADRIN, Nickolai V.
2015-01-01
Inter-species variability in morphological traits creates a need to know the range of variability of characteristics in the species for taxonomic and ecological tasks. Copepoda Arctodiaptomus salinus, which inhabits water bodies across Eurasia and North Africa, plays a dominant role in plankton of different water bodies-from fresh to hypersaline. This work assesses the intra- and inter-population morphometric variability of A. salinus in the Mediterranean-Black Sea region and discusses some o...
Directory of Open Access Journals (Sweden)
Shultz Jeffry
2008-07-01
Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de
An observational and modeling study of the regional impacts of climate variability
Horton, Radley M.
Climate variability has large impacts on humans and their agricultural systems. Farmers are at the center of this agricultural network, but it is often agricultural planners---regional planners, extension agents, commodity groups and cooperatives---that translate climate information for users. Global climate models (GCMs) are a leading tool for understanding and predicting climate and climate change. Armed with climate projections and forecasts, agricultural planners adapt their decision-making to optimize outcomes. This thesis explores what GCMs can, and cannot, tell us about climate variability and change at regional scales. The question is important, since high-quality regional climate projections could assist farmers and regional planners in key management decisions, contributing to better agricultural outcomes. To answer these questions, climate variability and its regional impacts are explored in observations and models for the current and future climate. The goals are to identify impacts of observed variability, assess model simulation of variability, and explore how climate variability and its impacts may change under enhanced greenhouse warming. Chapter One explores how well Goddard Institute for Space Studies (GISS) atmospheric models, forced by historical sea surface temperatures (SST), simulate climatology and large-scale features during the exceptionally strong 1997--1999 El Nino Southern Oscillation (ENSO) cycle. Reasonable performance in this 'proof of concept' test is considered a minimum requirement for further study of variability in models. All model versions produce appropriate local changes with ENSO, indicating that with correct ocean temperatures these versions are capable of simulating the large-scale effects of ENSO around the globe. A high vertical resolution model (VHR) provides the best simulation. Evidence is also presented that SST anomalies outside the tropical Pacific may play a key role in generating remote teleconnections even
Life-history strategies associated with local population variability confer regional stability.
Pribil, Stanislav; Houlahan, Jeff E
2003-07-07
A widely held ecological tenet is that, at the local scale, populations of K-selected species (i.e. low fecundity, long lifespan and large body size) will be less variable than populations of r-selected species (i.e. high fecundity, short lifespan and small body size). We examined the relationship between long-term population trends and life-history attributes for 185 bird species in the Czech Republic and found that, at regional spatial scales and over moderate temporal scales (100-120 years), K-selected bird species were more likely to show both large increases and decreases in population size than r-selected species. We conclude that life-history attributes commonly associated with variable populations at the local scale, confer stability at the regional scale.
Sequences of 12 monoclonal anti-dinitrophenyl spin-label antibodies for NMR studies
International Nuclear Information System (INIS)
Leahy, D.J.; Rule, G.S.; Whittaker, M.M.; McConnell, H.M.
1988-01-01
Eleven monoclonal antibodies specific for a spin-labeled dinitrophenyl hapten (DNP-SL) have been produces for use in NMR studies. They have been named AN01 and ANO3-AN12. The stability constants for the association of these antibodies with DNP-SL and related haptens were measured by fluorescence quenching. cDNA clones coding for the heavy and light chains of each antibody and of an additional anti-DNP-SL monoclonal antibody, ANO2, have been isolated. The nucleic acid sequence of the 5' end of each clone has been determined, and the amino acid sequence of the variable regions of each antibody has been deduced from the cDNA sequence. The sequences are relatively heterogeneous, but both the heavy and the light chains of ANO1 and ANO3 are derived from the same variable-region gene families as those of the ANO2 antibody. ANO7 has a heavy chain that is related to that of ANO2, and ANO9 has a related light chain. ANO5 and ANO6 are unrelated to ANO2 but share virtually identical heavy and light chains. Preliminary NMR difference spectra comparing related antibodies show that sequence-specific assignment of resonances is possible. Such spectra also provide a measure of structural relatedness
Directory of Open Access Journals (Sweden)
Sahu Binod B
2012-01-01
Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for
Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S
1996-10-01
The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.
Nomi, Jason S; Bolt, Taylor S; Ezie, C E Chiemeka; Uddin, Lucina Q; Heller, Aaron S
2017-05-31
Variability of neuronal responses is thought to underlie flexible and optimal brain function. Because previous work investigating BOLD signal variability has been conducted within task-based fMRI contexts on adults and older individuals, very little is currently known regarding regional changes in spontaneous BOLD signal variability in the human brain across the lifespan. The current study used resting-state fMRI data from a large sample of male and female human participants covering a wide age range (6-85 years) across two different fMRI acquisition parameters (TR = 0.645 and 1.4 s). Variability in brain regions including a key node of the salience network (anterior insula) increased linearly across the lifespan across datasets. In contrast, variability in most other large-scale networks decreased linearly over the lifespan. These results demonstrate unique lifespan trajectories of BOLD variability related to specific regions of the brain and add to a growing literature demonstrating the importance of identifying normative trajectories of functional brain maturation. SIGNIFICANCE STATEMENT Although brain signal variability has traditionally been considered a source of unwanted noise, recent work demonstrates that variability in brain signals during task performance is related to brain maturation in old age as well as individual differences in behavioral performance. The current results demonstrate that intrinsic fluctuations in resting-state variability exhibit unique maturation trajectories in specific brain regions and systems, particularly those supporting salience detection. These results have implications for investigations of brain development and aging, as well as interpretations of brain function underlying behavioral changes across the lifespan. Copyright © 2017 the authors 0270-6474/17/375539-10$15.00/0.
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Morphometric variability of Arctodiaptomus salinus (Copepoda) in the Mediterranean-Black Sea region.
Anufriieva, Elena V; Shadrin, Nickolai V
2015-11-18
Inter-species variability in morphological traits creates a need to know the range of variability of characteristics in the species for taxonomic and ecological tasks. Copepoda Arctodiaptomus salinus, which inhabits water bodies across Eurasia and North Africa, plays a dominant role in plankton of different water bodies-from fresh to hypersaline. This work assesses the intra- and inter-population morphometric variability of A. salinus in the Mediterranean-Black Sea region and discusses some observed regularities. The variability of linear body parameters and proportions was studied. The impacts of salinity, temperature, and population density on morphological characteristics and their variability can manifest themselves in different ways at the intra- and inter-population levels. A significant effect of salinity, pH and temperature on the body proportions was not found. Their intra-population variability is dependent on temperature and salinity. Sexual dimorphism of A. salinus manifests in different linear parameters, proportions, and their variability. There were no effects of temperature, pH and salinity on the female/male parameter ratio. There were significant differences in the body proportions of males and females in different populations. The influence of temperature, salinity, and population density can be attributed to 80%-90% of intra-population variability of A. salinus. However, these factors can explain less than 40% of inter-population differences. Significant differences in the body proportions of males and females from different populations may suggest that some local populations of A. salinus in the Mediterranean-Black Sea region are in the initial stages of differentiation.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Extreme Variables in Star Forming Regions
Contreras Peña, Carlos Eduardo
2015-01-01
in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of
Mesopause region temperature variability and its trend in southern Brazil
Venturini, Mateus S.; Bageston, José V.; Caetano, Nattan R.; Peres, Lucas V.; Bencherif, Hassan; Schuch, Nelson J.
2018-03-01
Nowadays, the study of the upper atmosphere is increasing, mostly because of the need to understand the patterns of Earth's atmosphere. Since studies on global warming have become very important for the development of new technologies, understanding all regions of the atmosphere becomes an unavoidable task. In this paper, we aim to analyze the temperature variability and its trend in the mesosphere and lower thermosphere (MLT) region during a period of 12 years (from 2003 to 2014). For this purpose, three different heights, i.e., 85, 90 and 95 km, were focused on in order to investigate the upper atmosphere, and a geographic region different to other studies was chosen, in the southern region of Brazil, centered in the city of Santa Maria, RS (29°41'02'' S; 53°48'25'' W). In order to reach the objectives of this work, temperature data from the SABER instrument (Sounding of the Atmosphere using Broadband Emission Radiometry), aboard NASA's Thermosphere Ionosphere Mesosphere Energetics Dynamics (TIMED) satellite, were used. Finally, two cases were studied related to distinct grids of latitude/longitude used to obtain the mean temperature profiles. The first case considered a grid of 20° × 20° lat/long, centered in Santa Maria, RS, Brazil. In the second case, the region was reduced to a size of 15° × 15° in order to compare the results and discuss the two cases in terms of differences or similarities in temperature trends. Observations show that the size of the geographical area used for the average temperature profiles can influence the results of variability and trend of the temperature. In addition, reducing the time duration of analyses from 24 to 12 h a day also influences the trend significantly. For the smaller geographical region (15° × 15°) and the 12 h daily time window (09:00-21:00 UT) it was found that the main contributions for the temperature variability at the three heights were the annual and semi-annual cycles and the solar flux influence
Badr, Hamada S.; Dezfuli, Amin K.; Zaitchik, Benjamin F.; Peters-Lidard, Christa D.
2016-01-01
Many studies have documented dramatic climatic and environmental changes that have affected Africa over different time scales. These studies often raise questions regarding the spatial extent and regional connectivity of changes inferred from observations and proxies and/or derived from climate models. Objective regionalization offers a tool for addressing these questions. To demonstrate this potential, applications of hierarchical climate regionalizations of Africa using observations and GCM historical simulations and future projections are presented. First, Africa is regionalized based on interannual precipitation variability using Climate Hazards Group Infrared Precipitation with Stations (CHIRPS) data for the period 19812014. A number of data processing techniques and clustering algorithms are tested to ensure a robust definition of climate regions. These regionalization results highlight the seasonal and even month-to-month specificity of regional climate associations across the continent, emphasizing the need to consider time of year as well as research question when defining a coherent region for climate analysis. CHIRPS regions are then compared to those of five GCMs for the historic period, with a focus on boreal summer. Results show that some GCMs capture the climatic coherence of the Sahel and associated teleconnections in a manner that is similar to observations, while other models break the Sahel into uncorrelated subregions or produce a Sahel-like region of variability that is spatially displaced from observations. Finally, shifts in climate regions under projected twenty-first-century climate change for different GCMs and emissions pathways are examined. A projected change is found in the coherence of the Sahel, in which the western and eastern Sahel become distinct regions with different teleconnections. This pattern is most pronounced in high-emissions scenarios.
Directory of Open Access Journals (Sweden)
N.L.P Indi Dharmayanti
2003-06-01
Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.
Directory of Open Access Journals (Sweden)
Blackmon Barbara P
2011-07-01
Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.
Constancy despite variability: Local and regional macrofaunal diversity in intertidal seagrass beds
Boyé, Aurélien; Legendre, Pierre; Grall, Jacques; Gauthier, Olivier
2017-12-01
The importance of seagrass habitat for the diversity of benthic fauna has been extensively studied worldwide. Most of the information available is, however, about α diversity while little consideration has been given to β diversity. To fill the knowledge gaps regarding the variability of epifaunal and infaunal seagrass assemblages at large spatial and temporal scales, we scrutinized an extensive dataset covering five years of monitoring of eight intertidal Zostera marina meadows around Brittany (France). High species richness arose at the regional scale from the combination of high local diversity of the meadows and substantial among-meadows β diversity. Epifauna and infauna appeared as distinct self-communities as they displayed different spatial and temporal patterns and varied in their responses to local hydrological conditions. Infauna had higher total β diversity than epifauna due to a tighter link to the great variability of local environmental conditions in the region. Both exhibited substantial variations in species composition and community structure with variations of dominant species that were accompanied by extensive change in numerous rare species. The dominant epifaunal species were all grazers. Changes in species composition were induced mostly by species replacement and rarely by richness differences between meadows. Indeed, species richness remained within a narrow range for all seagrass beds, suggesting a potential carrying capacity for species richness of the meadows. Overall, all meadows contributed equally to the regional turnover of seagrass macrofauna, emphasizing high variability and complementarity among beds at the regional scale. The implications of this substantial within-seagrass variability for the functioning of benthic ecosystems at broad scale and for conservation purposes in habitat mosaics warrant further investigations but our results clearly advocate taking into account within-habitat variation when evaluating the diversity
Long-term Variability of H2CO Masers in Star-forming Regions
Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.
2017-10-01
We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.
Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric
2014-01-01
Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.
Common 5S rRNA variants are likely to be accepted in many sequence contexts
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).
Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai
2015-01-01
In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
DEFF Research Database (Denmark)
Nyholm, Tufve; Jonsson, Joakim; Söderström, Karin
2013-01-01
and approximately equal for the prostate and seminal vesicles. Large differences in variability were observed for individual patients, and also for individual imaging sequences used at the different centers. There was however no indication of decreased variability with higher field strength. CONCLUSION: The overall......BACKGROUND: The use of magnetic resonance (MR) imaging as a part of preparation for radiotherapy is increasing. For delineation of the prostate several publications have shown decreased delineation variability using MR compared to computed tomography (CT). The purpose of the present work....... Two physicians from each center delineated the prostate and the seminal vesicles on each of the 25 image sets. The variability between the delineations was analyzed with respect to overall, intra- and inter-physician variability, and dependence between variability and origin of the MR images, i...
Montesino, Marta; Prieto, Lourdes
2012-01-01
Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.
Energy Technology Data Exchange (ETDEWEB)
Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others
1995-08-01
X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.
Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.
2012-10-01
Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.
Zhang, Jing; Song, Xiaohong; Ma, Marella J; Xiao, Li; Kenri, Tsuyoshi; Sun, Hongmei; Ptacek, Travis; Li, Shaoli; Waites, Ken B; Atkinson, T Prescott; Shibayama, Keigo; Dybvig, Kevin; Feng, Yanmei
2017-02-01
To characterize inter- and intra-strain variability of variable-number tandem repeats (VNTRs) in Mycoplasma pneumoniae to determine the optimal multilocus VNTR analysis scheme for improved strain typing. Whole genome assemblies and next-generation sequencing data from diverse M. pneumoniae isolates were used to characterize VNTRs and their variability, and to compare the strain discriminability of new VNTR and existing markers. We identified 13 VNTRs including five reported previously. These VNTRs displayed different levels of inter- and intra-strain copy number variations. All new markers showed similar or higher discriminability compared with existing VNTR markers and the P1 typing system. Our study provides novel insights into VNTR variations and potential new multilocus VNTR analysis schemes for improved genotyping of M. pneumoniae.
Giesemann, Anja M; Raab, Peter; Lyutenski, Stefan; Dettmer, Sabine; Bültmann, Eva; Frömke, Cornelia; Lenarz, Thomas; Lanfermann, Heinrich; Goetz, Friedrich
2014-03-01
Magnetic resonance imaging of the temporal bone has an important role in decision making with regard to cochlea implantation, especially in children with cochlear nerve deficiency. The purpose of this study was to evaluate the usefulness of the combination of an advanced high-resolution T2-weighted sequence with a surface coil in a 3-Tesla magnetic resonance imaging scanner in cases of suspected cochlear nerve aplasia. Prospective study. Seven patients with cochlear nerve hypoplasia or aplasia were prospectively examined using a high-resolution three-dimensional variable flip-angle turbo spin-echo sequence using a surface coil, and the images were compared with the same sequence in standard resolution using a standard head coil. Three neuroradiologists evaluated the magnetic resonance images independently, rating the visibility of the nerves in diagnosing hypoplasia or aplasia. Eight ears in seven patients with hypoplasia or aplasia of the cochlear nerve were examined. The average age was 2.7 years (range, 9 months-5 years). Seven ears had accompanying malformations. The inter-rater reliability in diagnosing hypoplasia or aplasia was greater using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence (fixed-marginal kappa: 0.64) than with the same sequence in lower resolution (fixed-marginal kappa: 0.06). Examining cases of suspected cochlear nerve aplasia using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence in combination with a surface coil shows significant improvement over standard methods. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.
Directory of Open Access Journals (Sweden)
Federico M Ibarbalz
Full Text Available The performance of two sets of primers targeting variable regions of the 16S rRNA gene V1-V3 and V4 was compared in their ability to describe changes of bacterial diversity and temporal turnover in full-scale activated sludge. Duplicate sets of high-throughput amplicon sequencing data of the two 16S rRNA regions shared a collection of core taxa that were observed across a series of twelve monthly samples, although the relative abundance of each taxon was substantially different between regions. A case in point was the changes in the relative abundance of filamentous bacteria Thiothrix, which caused a large effect on diversity indices, but only in the V1-V3 data set. Yet the relative abundance of Thiothrix in the amplicon sequencing data from both regions correlated with the estimation of its abundance determined using fluorescence in situ hybridization. In nonmetric multidimensional analysis samples were distributed along the first ordination axis according to the sequenced region rather than according to sample identities. The dynamics of microbial communities indicated that V1-V3 and the V4 regions of the 16S rRNA gene yielded comparable patterns of: 1 the changes occurring within the communities along fixed time intervals, 2 the slow turnover of activated sludge communities and 3 the rate of species replacement calculated from the taxa-time relationships. The temperature was the only operational variable that showed significant correlation with the composition of bacterial communities over time for the sets of data obtained with both pairs of primers. In conclusion, we show that despite the bias introduced by amplicon sequencing, the variable regions V1-V3 and V4 can be confidently used for the quantitative assessment of bacterial community dynamics, and provide a proper qualitative account of general taxa in the community, especially when the data are obtained over a convenient time window rather than at a single time point.
Evolution and strengthening of the Calabrian Regional Seismic Network during the Pollino sequence
D'Alessandro, Antonino; Gervasi, Anna; Guerra, Ignazio
2013-04-01
In the last three years the Calabria-Lucania border area is affected by an intense seismic activity generated by the activation of geological structures which be seat of clusters of microearthquakes, with energy release sufficient to be felt and to generate alarm and bother. Besides to the historical memory of the inhabitants of Mormanno (the town most affected of macroseismic effects) there are some historical documents that indicate the occurrence of a similar seismic crisis in 1888. A more recent seismic sequence, the first monitored by seismic instruments, occurred in 1973-1974. In the last case, the activity started in early 2010 and is still ongoing. The two shocks of ML = 4.3 and 5.0 and the the very long time duration differs this crisis from the previous ones. Given this background, in 1981 was installed at Mormanno a seismic station (MMN) belonging to Regional Seismic Network of the University of Calabria (RSRC), now also a station of the Italian National Seismic Network of the Istituto Nazionale di Geofisica Vulcanolgia (INSN-INGV). This seismic station made it possible to follow the evolution of seismicity in this area and in particular the progressive increase in seismic activity started in 2010. Since 2010, some 3D stand-alone, was installed by the University of Calabria. Further stations of INGV were installed in November 2011 after a sharp increase of the energy release and subsequently by the INGV and the GeoForschungsZentrum (Potsdam) after the main shock of the whole sequence. Seismic networks are powerful tools for understanding active tectonic processes in a monitored seismically active region. However, the optimal monitoring of a seismic region requires the assessment of the seismic network capabilities to identify seismogenic areas that are not adequately covered and to quantify measures that will allow the network improvement. In this paper we examine in detail the evolution and the strengthening of the RSRC in the last years analyzing the
Polly C. Buotte; David L. Peterson; Kevin S. McKelvey; Jeffrey A. Hicke
2016-01-01
Natural resource vulnerability to climate change can depend on the climatology and ecological conditions at a particular site. Here we present a conceptual framework for incorporating spatial variability in natural resource vulnerability to climate change in a regional-scale assessment. The framework was implemented in the first regional-scale vulnerability...
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Climate Drivers of Spatiotemporal Variability of Precipitation in the Source Region of Yangtze River
Du, Y.; Berndtsson, R.; An, D.; Yuan, F.
2017-12-01
Variability of precipitation regime has significant influence on the environment sustainability in the source region of Yangtze River, especially when the vegetation degradation and biodiversity reduction have already occurred. Understanding the linkage between variability of local precipitation and global teleconnection patterns is essential for water resources management. Based on physical reasoning, indices of the climate drivers can provide a practical way of predicting precipitation. Due to high seasonal variability of precipitation, climate drivers of the seasonal precipitation also varies. However, few reports have gone through the teleconnections between large scale patterns with seasonal precipitation in the source region of Yangtze River. The objectives of this study are therefore (1) assessment of temporal trend and spatial variability of precipitation in the source region of Yangtze River; (2) identification of climate indices with strong influence on seasonal precipitation anomalies; (3) prediction of seasonal precipitation based on revealed climate indices. Principal component analysis and Spearman rank correlation were used to detect significant relationships. A feed-forward artificial neural network(ANN) was developed to predict seasonal precipitation using significant correlated climate indices. Different influencing climate indices were revealed for precipitation in each season, with significant level and lag times. Significant influencing factors were selected to be the predictors for ANN model. With correlation coefficients between observed and simulated precipitation over 0.5, the results were eligible to predict the precipitation of spring, summer and winter using teleconnections, which can improve integrated water resources management in the source region of Yangtze River.
Swami, D.; Parthasarathy, D.; Dave, P.
2016-12-01
A key objective of the ongoing research is to understand the risk and vulnerability of agriculture and farming communities with respect to multiple climate change attributes, particularly monsoon variability and hydrology such as ground water availability. Climate Variability has always been a feature affecting Indian agriculture but the nature and characteristics of this variability is not well understood. Indian monsoon patterns are highly variable and most of the studies focus on larger domain such as Central India or Western coast (Ghosh et al., 2009) but district level analysis is missing i.e. the linkage between agriculture and climate variables at finer scale has not been investigated comprehensively. For example, Eastern Vidarbha region in Maharashtra is considered as one of the most agriculturally sensitive region in India, where every year a large number of farmers commit suicide. The main reasons for large number of suicides are climate related stressors such as droughts, hail storms, and monsoon variability aggravated with poor socio-economic conditions. Present study has tried to explore the areas in Vidarbha region of Maharashtra where famers and crop productivity, specifically cotton, sorghum, is highly vulnerable to monsoon variability, hydrological and socio-economic variables which are further modelled to determine the maximal contributing factor towards crops and farmers' vulnerability. After analysis using primary and secondary data, it will aid in decision making regarding field operations such as time of sowing, harvesting and irrigation requirements by optimizing the cropping pattern with climatic, hydrological and socio-economic variables. It also suggests the adaptation strategies to farmers regarding different types of cropping and water harvesting practices, optimized dates and timings for harvesting, sowing, water and nutrient requirements of particular crops according to the specific region. Primarily along with secondary analysis
Directory of Open Access Journals (Sweden)
Beatriz Lagnier Gil Ferreira
2016-04-01
Full Text Available The goal of this paper is to analyze the relation between socioeconomic variables and freight trip generation, regarding the Metropolitan Region of Rio de Janeiro, through the use of linear regression models. A systematic literature review is conducted in order to identify which independent variables could be used in the models. The variables found are mostly related to the establishment, such as number of employees, floor area, number of stores among others; and socioeconomic variables, such as population, households and jobs in the region. The relation between the latter and number of truck trips is verified with linear regression models, and the results show that the models are valid and the variables are able to explain the freight flow in the region studied, contributing to the region’s transport planning and to the strategic planning of companies that operate in the region.
Hydraulic fracturing and the Crooked Lake Sequences: Insights gleaned from regional seismic networks
Schultz, Ryan; Stern, Virginia; Novakovic, Mark; Atkinson, Gail; Gu, Yu Jeffrey
2015-04-01
Within central Alberta, Canada, a new sequence of earthquakes has been recognized as of 1 December 2013 in a region of previous seismic quiescence near Crooked Lake, ~30 km west of the town of Fox Creek. We utilize a cross-correlation detection algorithm to detect more than 160 events to the end of 2014, which is temporally distinguished into five subsequences. This observation is corroborated by the uniqueness of waveforms clustered by subsequence. The Crooked Lake Sequences have come under scrutiny due to its strong temporal correlation (>99.99%) to the timing of hydraulic fracturing operations in the Duvernay Formation. We assert that individual subsequences are related to fracturing stimulation and, despite adverse initial station geometry, double-difference techniques allow us to spatially relate each cluster back to a unique horizontal well. Overall, we find that seismicity in the Crooked Lake Sequences is consistent with first-order observations of hydraulic fracturing induced seismicity.
Two centuries of observed atmospheric variability and change over the North Sea region
Stendel, Martin; van den Besselaar, Else; Hannachi, Abdel; Kent, Elizabeth; Lefebvre, Christiana; Rosenhagen, Gudrun; Schenk, Frederik; van der Schrier, Gerard; Woollings, Tim
2016-04-01
In the upcoming North Sea Region Climate Change Assessment (NOSCCA), we present a synthesis of current knowledge about past, present and possible future climate change in the North Sea region. A climate change assessment from published scientific work has been conducted as a kind of regional IPCC report, and a book has been produced that will be published by Springer in 2016. In the framework of the NOSCCA project, we examine past and present studies of variability and changes in atmospheric variables within the North Sea region over the instrumental period, roughly the past 200 years, based on observations and reanalyses. The variables addressed in this presentation are large-scale circulation, pressure and wind, surface air temperature, precipitation and radiative properties (clouds, solar radiation, and sunshine duration). While air temperature over land, not unexpectedly, has increased everywhere in the North Sea region, with strongest trends in spring and in the north of the region, a precipitation increase has been observed in the north and a decrease in the south of the region. This pattern goes along with a north-eastward shift of storm tracks and is in agreement with climate model projections under enhanced greenhouse gas concentrations. For other variables, it is not obvious which part of the observed changes may be due to anthropogenic activities and which is internally forced. It remains also unclear to what extent atmospheric circulation over the North Sea region is influenced by distant factors, in particular Arctic sea-ice decline in recent decades. There are indications of an increase in the number of deep cyclones (but not in the total number of cyclones), while storminess since the late 19th century shows no robust trends. The persistence of circulation types appears to have increased over the last century, and consequently, there is an indication for 'more extreme' extreme events. However, changes in extreme weather events are difficult to assess
Kereszturi, Gábor; Németh, Károly; Cronin, Shane J.; Procter, Jonathan; Agustín-Flores, Javier
2014-10-01
Monogenetic basaltic volcanism is characterised by a complex array of eruptive behaviours, reflecting spatial and temporal variability of the magmatic properties (e.g. composition, eruptive volume, magma flux) as well as environmental factors at the vent site (e.g. availability of water, country rock geology, faulting). These combine to produce changes in eruption style over brief periods (minutes to days) in many eruption episodes. Monogenetic eruptions in some volcanic fields often start with a phreatomagmatic vent-opening phase that later transforms into "dry" magmatic explosive or effusive activity, with a strong variation in the duration and importance of this first phase. Such an eruption sequence pattern occurred in 83% of the known eruption in the 0.25 My-old Auckland Volcanic Field (AVF), New Zealand. In this investigation, the eruptive volumes were compared with the sequences of eruption styles preserved in the pyroclastic record at each volcano of the AVF, as well as environmental influencing factors, such as distribution and thickness of water-saturated semi- to unconsolidated sediments, topographic position, distances from known fault lines. The AVF showed that there is no correlation between ejecta ring volumes and environmental influencing factors that is valid for the entire AVF. In contrary, using a set of comparisons of single volcanoes with well-known and documented sequences, resultant eruption sequences could be explained by predominant patterns of the environment in which these volcanoes were erupted. Based on the spatial variability of these environmental factors, a first-order susceptibility hazard map was constructed for the AVF that forecasts areas of largest likelihood for phreatomagmatic eruptions by overlaying topographical and shallow geological information. Combining detailed phase-by-phase breakdowns of eruptive volumes and the event sequences of the AVF, along with the new susceptibility map, more realistic eruption scenarios can be
van Doorn, L J; Capriles, I; Maertens, G; DeLeys, R; Murray, K; Kos, T; Schellekens, H; Quint, W
1995-01-01
Sequence evolution of the hypervariable region 1 (HVR1) in the N terminus of E2/NS1 of hepatitis C virus (HCV) was studied retrospectively in six chimpanzees inoculated with the same genotype 1b strain, containing a unique predominant HVR1 sequence. Immediately after inoculation, all animals contained the same HVR predominant sequence. Two animals developed an acute self-limiting infection. Anti-HVR1 immunoglobulin G (IgG) was produced 40 to 60 days after inoculation and rapidly disappeared a...
Directory of Open Access Journals (Sweden)
Nian-Zhang Zhang
2014-01-01
Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.
Effects of Recent Regional Soil Moisture Variability on Global Net Ecosystem CO2 Exchange
Jones, L. A.; Madani, N.; Kimball, J. S.; Reichle, R. H.; Colliander, A.
2017-12-01
Soil moisture exerts a major regional control on the inter-annual variability of the global land sink for atmospheric CO2. In semi-arid regions, annual biomass production is closely coupled to variability in soil moisture availability, while in cold-season-affected regions, summer drought offsets the effects of advancing spring phenology. Availability of satellite solar-induced fluorescence (SIF) observations and improvements in atmospheric inversions has led to unprecedented ability to monitor atmospheric sink strength. However, discrepancies still exist between such top-down estimates as atmospheric inversion and bottom-up process and satellite driven models, indicating that relative strength, mechanisms, and interaction of driving factors remain poorly understood. We use soil moisture fields informed by Soil Moisture Active Passive Mission (SMAP) observations to compare recent (2015-2017) and historic (2000-2014) variability in net ecosystem land-atmosphere CO2 exchange (NEE). The operational SMAP Level 4 Carbon (L4C) product relates ground-based flux tower measurements to other bottom-up and global top-down estimates to underlying soil moisture and other driving conditions using data-assimilation-based SMAP Level 4 Soil Moisture (L4SM). Droughts in coastal Brazil, South Africa, Eastern Africa, and an anomalous wet period in Eastern Australia were observed by L4C. A seasonal seesaw pattern of below-normal sink strength at high latitudes relative to slightly above-normal sink strength for mid-latitudes was also observed. Whereas SMAP-based soil moisture is relatively informative for short-term temporal variability, soil moisture biases that vary in space and with season constrain the ability of the L4C estimates to accurately resolve NEE. Such biases might be caused by irrigation and plant-accessible ground-water. Nevertheless, SMAP L4C daily NEE estimates connect top-down estimates to variability of effective driving factors for accurate estimates of regional
Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David
2018-04-11
. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.
NEAR-INFRARED VARIABILITY AMONG YOUNG STELLAR OBJECTS IN THE STAR FORMATION REGION CYGNUS OB7
Energy Technology Data Exchange (ETDEWEB)
Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)
2013-08-20
We present an analysis of near-infrared time-series photometry in J, H, and K bands for about 100 epochs of a 1 Degree-Sign Multiplication-Sign 1 Degree-Sign region of the Lynds 1003/1004 dark cloud in the Cygnus OB7 region. Augmented by data from the Wide-field Infrared Survey Explorer, we identify 96 candidate disk bearing young stellar objects (YSOs) in the region. Of these, 30 are clearly Class I or earlier. Using the Wide-Field Imaging Camera on the United Kingdom Infrared Telescope, we were able to obtain photometry over three observing seasons, with photometric uncertainty better than 0.05 mag down to J Almost-Equal-To 17. We study detailed light curves and color trajectories of {approx}50 of the YSOs in the monitored field. We investigate the variability and periodicity of the YSOs and find the data are consistent with all YSOs being variable in these wavelengths on timescales of a few years. We divide the variability into four observational classes: (1) stars with periodic variability stable over long timescales, (2) variables which exhibit short-lived cyclic behavior, (3) long-duration variables, and (4) stochastic variables. Some YSO variability defies simple classification. We can explain much of the observed variability as being due to dynamic and rotational changes in the disk, including an asymmetric or changing blocking fraction, changes to the inner disk hole size, as well as changes to the accretion rate. Overall, we find that the Class I:Class II ratio of the cluster is consistent with an age of <1 Myr, with at least one individual, wildly varying source {approx}100, 000 yr old. We have also discovered a Class II eclipsing binary system with a period of 17.87 days.
Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi
2016-04-01
The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.
YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688
Energy Technology Data Exchange (ETDEWEB)
Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)
2014-12-01
The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.
Rimbu, Norel; Ionita, Monica; Swierczynski, Tina; Brauer, Achim; Kämpf, Lucas; Czymzik, Markus
2017-04-01
Flood triggered detrital layers in varved sediments of Lake Mondsee, located at the northern fringe of the European Alps (47°48'N,13°23'E), provide an important archive of regional hydroclimatic variability during the mid- to late Holocene. To improve the interpretation of the flood layer record in terms of large-scale climate variability, we investigate the relationships between observational hydrological records from the region, like the Mondsee lake level, the runoff of the lake's main inflow Griesler Ache, with observed precipitation and global climate patterns. The lake level shows a strong positive linear trend during the observational period in all seasons. Additionally, lake level presents important interannual to multidecadal variations. These variations are associated with distinct seasonal atmospheric circulation patterns. A pronounced anomalous anticyclonic center over the Iberian Peninsula is associated with high lake levels values during winter. This center moves southwestward during spring, summer and autumn. In the same time, a cyclonic anomaly center is recorded over central and western Europe. This anomalous circulation extends southwestward from winter to autumn. Similar atmospheric circulation patterns are associated with river runoff and precipitation variability from the region. High lake levels are associated with positive local precipitation anomalies in all seasons as well as with negative local temperature anomalies during spring, summer and autumn. A correlation analysis reveals that lake level, runoff and precipitation variability is related to large-scale sea surface temperature anomaly patterns in all seasons suggesting a possible impact of large-scale climatic modes, like the North Atlantic Oscillation and Atlantic Multidecadal Oscillation on hydroclimatic variability in the Lake Mondsee region. The results presented in this study can be used for a more robust interpretation of the long flood layer record from Lake Mondsee sediments
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
2010-01-01
Background The cultivated olive (Olea europaea L.) is the most agriculturally important species of the Oleaceae family. Although many studies have been performed on plastid polymorphisms to evaluate taxonomy, phylogeny and phylogeography of Olea subspecies, only few polymorphic regions discriminating among the agronomically and economically important olive cultivars have been identified. The objective of this study was to sequence the entire plastome of olive and analyze many potential polymorphic regions to develop new inter-cultivar genetic markers. Results The complete plastid genome of the olive cultivar Frantoio was determined by direct sequence analysis using universal and novel PCR primers designed to amplify all overlapping regions. The chloroplast genome of the olive has an organisation and gene order that is conserved among numerous Angiosperm species and do not contain any of the inversions, gene duplications, insertions, inverted repeat expansions and gene/intron losses that have been found in the chloroplast genomes of the genera Jasminum and Menodora, from the same family as Olea. The annotated sequence was used to evaluate the content of coding genes, the extent, and distribution of repeated and long dispersed sequences and the nucleotide composition pattern. These analyses provided essential information for structural, functional and comparative genomic studies in olive plastids. Furthermore, the alignment of the olive plastome sequence to those of other varieties and species identified 30 new organellar polymorphisms within the cultivated olive. Conclusions In addition to identifying mutations that may play a functional role in modifying the metabolism and adaptation of olive cultivars, the new chloroplast markers represent a valuable tool to assess the level of olive intercultivar plastome variation for use in population genetic analysis, phylogenesis, cultivar characterisation and DNA food tracking. PMID:20868482
Naegele, Klaudia; Lautenschlager, Irmeli; Gosert, Rainer; Loginov, Raisa; Bir, Katia; Helanterä, Ilkka; Schaub, Stefan; Khanna, Nina; Hirsch, Hans H
2018-04-22
Cytomegalovirus (CMV) management post-transplantation relies on quantification in blood, but inter-laboratory and inter-assay variability impairs commutability. An international multicenter study demonstrated that variability is mitigated by standardizing plasma volumes, automating DNA extraction and amplification, and calibration to the 1st-CMV-WHO-International-Standard as in the FDA-approved Roche-CAP/CTM-CMV. However, Roche-CAP/CTM-CMV showed under-quantification and false-negative results in a quality assurance program (UK-NEQAS-2014). To evaluate factors contributing to quantification variability of CMV viral load and to develop optimized CMV-UL54-QNAT. The UL54 target of the UK-NEQAS-2014 variant was sequenced and compared to 329 available CMV GenBank sequences. Four Basel-CMV-UL54-QNAT assays of 361 bp, 254 bp, 151 bp, and 95 bp amplicons were developed that only differed in reverse primer positions. The assays were validated using plasmid dilutions, UK-NEQAS-2014 sample, as well as 107 frozen and 69 prospectively collected plasma samples from transplant patients submitted for CMV QNAT, with and without DNase-digestion prior to nucleic acid extraction. Eight of 43 mutations were identified as relevant in the UK-NEQAS-2014 target. All Basel-CMV-UL54 QNATs quantified the UK-NEQAS-2014 but revealed 10-fold increasing CMV loads as amplicon size decreased. The inverse correlation of amplicon size and viral loads was confirmed using 1st-WHO-International-Standard and patient samples. DNase pre-treatment reduced plasma CMV loads by >90% indicating the presence of unprotected CMV genomic DNA. Sequence variability, amplicon length, and non-encapsidated genomes obstruct standardization and commutability of CMV loads needed to develop thresholds for clinical research and management. Besides regular sequence surveys, matrix and extraction standardization, we propose developing reference calibrators using 100 bp amplicons. Copyright © 2018 Elsevier B.V. All
Davis, Shannon R.; Pratt, Lawrence J.; Jiang, Houshuo
2015-01-01
The structure, variability, and regional connectivity of the Tokar Gap jet (TGJ) are described using WRF Model analyses and supporting atmospheric datasets from the East African–Red Sea–Arabian Peninsula (EARSAP) region during summer 2008. Sources
Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto
2017-02-01
Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Characterization of the Deep Water Surface Wave Variability in the California Current Region
Villas Bôas, Ana B.; Gille, Sarah T.; Mazloff, Matthew R.; Cornuelle, Bruce D.
2017-11-01
Surface waves are crucial for the dynamics of the upper ocean not only because they mediate exchanges of momentum, heat, energy, and gases between the ocean and the atmosphere, but also because they determine the sea state. The surface wave field in a given region is set by the combination of local and remote forcing. The present work characterizes the seasonal variability of the deep water surface wave field in the California Current region, as retrieved from over two decades of satellite altimetry data combined with wave buoys and wave model hindcast (WaveWatch III). In particular, the extent to which the local wind modulates the variability of the significant wave height, peak period, and peak direction is assessed. During spring/summer, regional-scale wind events of up to 10 m/s are the dominant forcing for waves off the California coast, leading to relatively short-period waves (8-10 s) that come predominantly from the north-northwest. The wave climatology throughout the California Current region shows average significant wave heights exceeding 2 m during most of the year, which may have implications for the planning and retrieval methods of the Surface Water and Ocean Topography (SWOT) satellite mission.
Wu, Quran; Zhang, Xuebin; Church, John A.; Hu, Jianyu
2017-03-01
Previous studies have shown that regional sea level exhibits interannual and decadal variations associated with the modes of climate variability. A better understanding of those low-frequency sea level variations benefits the detection and attribution of climate change signals. Nonetheless, the contributions of thermosteric, halosteric, and mass sea level components to sea level variability and trend patterns remain unclear. By focusing on signals associated with dominant climate modes in the Indo-Pacific region, we estimate the interannual and decadal fingerprints and trend of each sea level component utilizing a multivariate linear regression of two adjoint-based ocean reanalyses. Sea level interannual, decadal, and trend patterns primarily come from thermosteric sea level (TSSL). Halosteric sea level (HSSL) is of regional importance in the Pacific Ocean on decadal time scale and dominates sea level trends in the northeast subtropical Pacific. The compensation between TSSL and HSSL is identified in their decadal variability and trends. The interannual and decadal variability of temperature generally peak at subsurface around 100 m but that of salinity tend to be surface-intensified. Decadal temperature and salinity signals extend deeper into the ocean in some regions than their interannual equivalents. Mass sea level (MassSL) is critical for the interannual and decadal variability of sea level over shelf seas. Inconsistencies exist in MassSL trend patterns among various estimates. This study highlights regions where multiple processes work together to control sea level variability and change. Further work is required to better understand the interaction of different processes in those regions.
Directory of Open Access Journals (Sweden)
Hanghui Kong
2017-11-01
Full Text Available The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A. subgenus Lycoctonum and A. subg. Aconitum. The complete chloroplast (cp genome sequences were characterized in three species: A. angustius, A. finetianum, and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius, 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum, with each species possessing 126 genes with 84 protein coding genes (PCGs. While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψrps19 and Ψycf1 were in the LSC/IR/SSC boundaries, Ψrps16 and ΨinfA in the LSC region, and Ψycf15 in the IRb region. The nucleotide variability (Pi of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58–62 simple sequence repeats (SSRs were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum, respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum. Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species.
Kong, Hanghui; Liu, Wanzhen; Yao, Gang; Gong, Wei
2017-01-01
The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A . subgenus Lycoctonum and A . subg. Aconitum . The complete chloroplast (cp) genome sequences were characterized in three species: A. angustius , A. finetianum , and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius , 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum , with each species possessing 126 genes with 84 protein coding genes (PCGs). While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψ rps 19 and Ψ ycf 1 were in the LSC/IR/SSC boundaries, Ψ rps 16 and Ψ inf A in the LSC region, and Ψ ycf 15 in the IRb region. The nucleotide variability ( Pi ) of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58-62 simple sequence repeats (SSRs) were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum , respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum . Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species.
Short timescale variability in the faint sky variability survey
Morales-Rueda, L.; Groot, P.J.; Augusteijn, T.; Nelemans, G.A.; Vreeswijk, P.M.; Besselaar, E.J.M. van den
2006-01-01
We present the V-band variability analysis of the Faint Sky Variability Survey (FSVS). The FSVS combines colour and time variability information, from timescales of 24 minutes to tens of days, down to V = 24. We find that �1% of all point sources are variable along the main sequence reaching �3.5%
Regions of variability for a class of analytic and locally univalent ...
Indian Academy of Sciences (India)
f ′′(0) whenever f varies over the class C(A,B). Keywords. Janowski class; univalent functions; variability regions. 2000 Mathematics Subject Classification. 30C45. 1. Introduction and preliminary results. Let C be the complex plane. We use the following notations for open and closed discs with center c and radius r in the ...
Melanie Vanderhoof; Laurie Alexander
2016-01-01
The degree of hydrological connectivity between wetland systems and downstream receiving waters can be expected to influence the volume and variability of stream discharge. The Prairie Pothole Region contains a high density of depressional wetland features, a consequence of glacial retreat. Spatial variability in wetland density, drainage evolution, and precipitation...
Perko-Mäkelä, P; Alter, T; Isohanni, P; Zimmermann, S; Lyhs, U
2011-09-01
The aim of this study was to assess the diversity of thermotolerant Campylobacter spp. isolated from turkey flocks at six rearing farms 1-2 weeks prior to slaughter (360 faecal swab samples) and from 11 different stages at the slaughterhouse (636 caecal, environmental, neck skin and meat samples). A total of 121 Campylobacter isolates were identified to species level using a multiplex PCR assay and were typed by pulsed-field gel electrophoresis (PFGE) and flaA-short variable region (SVR) sequencing. All Campylobacter isolates were identified as Campylobacter jejuni. PFGE analysis with KpnI restriction enzyme resulted in 11 PFGE types (I-XI) and flaA SVR typing yielded in nine flaA-SVR alleles. The Campylobacter-positive turkey flocks A, C and E were colonized by a limited number of Campylobacter clones at the farm and slaughter. The present study confirms the traceability of flock-specific strains (PFGE types I, V and IX; flaA types 21, 36 and 161) from the farm along the entire processing line to meat cuts. It seems that stress factors such as high temperature of the defeathering water (54-56 °C), drying of the carcass skin during air chilling (24 h at 2 °C), and oxygen in the air could not eliminate Campylobacter completely. Campylobacter-negative flocks became contaminated during processing by the same subtypes of Campylobacter introduced into the slaughter house by preceeding positive flocks even if they were slaughtered on subsequent days. Proper and efficient cleaning and disinfection of slaughter and processing premises are needed to avoid cross-contamination, especially in countries with a low prevalence of Campylobacter spp. The majority of flaA SVR alleles displayed a distinct association with a specific PFGE type. However, a linear relationship for all strains among both typing methods could not be established. To specify genetic relatedness of strains, a combination of different genotyping methods, is needed. © 2011 Blackwell Verlag GmbH.
[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].
Chen, Suiqing; Lu, Xiaolei; Wang, Lili
2011-05-01
To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.
Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.
Reinl, Maren; Bartels, Andreas
2014-11-15
Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Quick regional centroid moment tensor solutions for the Emilia 2012 (northern Italy seismic sequence
Directory of Open Access Journals (Sweden)
Silvia Pondrelli
2012-10-01
Full Text Available In May 2012, a seismic sequence struck the Emilia region (northern Italy. The mainshock, of Ml 5.9, occurred on May 20, 2012, at 02:03 UTC. This was preceded by a smaller Ml 4.1 foreshock some hours before (23:13 UTC on May 19, 2012 and followed by more than 2,500 earthquakes in the magnitude range from Ml 0.7 to 5.2. In addition, on May 29, 2012, three further strong earthquakes occurred, all with magnitude Ml ≥5.2: a Ml 5.8 earthquake in the morning (07:00 UTC, followed by two events within just 5 min of each other, one at 10:55 UTC (Ml 5.3 and the second at 11:00 UTC (Ml 5.2. For all of the Ml ≥4.0 earthquakes in Italy and for all of the Ml ≥4.5 in the Mediterranean area, an automatic procedure for the computation of a regional centroid moment tensor (RCMT is triggered by an email alert. Within 1 h of the event, a manually revised quick RCMT (QRCMT can be published on the website if the solution is considered stable. In particular, for the Emilia seismic sequence, 13 QRCMTs were determined and for three of them, those with M >5.5, the automatically computed QRCMTs fitted the criteria for publication without manual revision. Using this seismic sequence as a test, we can then identify the magnitude threshold for automatic publication of our QRCMTs.
Directory of Open Access Journals (Sweden)
Masoume Vakili Azghandi
2016-05-01
Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.
Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J
2008-01-28
Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of
ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS
Directory of Open Access Journals (Sweden)
Alves-Ferreira Marcelo
2008-09-01
Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties
O'Keeffe, Jimmy; Buytaert, Wouter; Brozović, Nick; Mijic, Ana
2014-05-01
Over the last fifty years, changes in agriculture brought about by the Green Revolution have transformed India from a famine-prone, drought-susceptible country into the worlds' third largest grain producer and one of the most intensively irrigated parts of the globe. Regionally, cheap energy, subsidised seeds and fertilisers, and in some areas Government purchase guarantees for grain promote the intensification of farming. While this allows farmers to survive, it also aggravates the drain agriculture is having on resources, particularly energy and water. Analysis at a regional scale, however, masks the considerable spatial variability that exists on a more localised level and must be taken into consideration to understand correctly aggregate system response to policy, hydrologic, and climatic change. In this study we present and analyse the results from over 100 farmer interviews conducted in the data-scarce districts of Jalaun and Sitapur on the Gangetic Plains of Uttar Pradesh during the post monsoon period of 2013. Variables such as the volumes and timing of irrigation water applied, sources of water, methods of abstraction and irrigation, and costs incurred are mapped, using qualitative data analysis and GIS. Large differences between the districts emerge, for instance in the region of Jalaun where cheaper canal water is available in addition to groundwater. This has enabled farmers to afford more water efficient technologies such as sprinklers, a practice not found in Sitapur which depends almost exclusively on more expensive diesel pumps. Results are used to delineate the spatial variability in water use practices, along with farmer behaviour and decision making. The primary data are compared with socio-economic information taken from regionally produced statistical abstracts. The combined data are used to identify the main drivers that influence farmer decision-making, which is in turn leading to groundwater overdraught in many parts of North India. Finally
Genomic region operation kit for flexible processing of deep sequencing data.
Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa
2013-01-01
Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.
Mycosphaerella fijiensis, the causal agent of banana leaf streak disease (commonly known as black Sigatoka), is the most devastating pathogen attacking bananas (Musa spp). Recently the whole genome sequence of M. fijiensis became available. This sequence was screened for the presence of Variable Num...
Directory of Open Access Journals (Sweden)
Morteza Shojaei Moghadam
2010-01-01
Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.
Control region variability of haplogroup C1d and the tempo of the peopling of the Americas.
Directory of Open Access Journals (Sweden)
Gonzalo Figueiro
Full Text Available BACKGROUND: Among the founding mitochondrial haplogroups involved in the peopling of the Americas, haplogroup C1d has been viewed as problematic because of its phylogeny and because of the estimates of its antiquity, apparently being much younger than other founding haplogroups. Several recent analyses, based on data from the entire mitochondrial genome, have contributed to an advance in the resolution of these problems. The aim of our analysis is to compare the conclusions drawn from the available HVR-I and HVR-II data for haplogroup C1d with the ones based on whole mitochondrial genomes. METHODOLOGY/PRINCIPAL FINDINGS: HVR-I and HVR-II sequences defined as belonging to haplogroup C1d by standard criteria were gathered from the literature as well as from population studies carried out in Uruguay. Sequence phylogeny was reconstructed using median-joining networks, geographic distribution of lineages was analyzed and the age of the most recent common ancestor estimated using the ρ-statistic and two different mutation rates. The putative ancestral forms of the haplogroup were found to be more widespread than the derived lineages, and the lineages defined by np 194 were found to be widely distributed and of equivalent age. CONCLUSIONS/SIGNIFICANCE: The analysis of control region sequences is found to still harbor great potential in tracing microevolutionary phenomena, especially those found to have occurred in more recent times. Based on the geographic distributions of the alleles of np 7697 and np 194, both discussed as possible basal mutations of the C1d phylogeny, we suggest that both alleles were part of the variability of the haplogroup at the time of its entrance. Moreover, based on the mutation rates of the different sites stated to be diagnostic, it is possible that the anomalies found when analyzing the haplogroup are due to paraphyly.
Castori, Marco; Bottillo, Irene; Morlino, Silvia; Barone, Chiara; Cascone, Piero; Grammatico, Paola; Laino, Luigi
2016-01-01
Campomelic dysplasia and acampomelic campomelic dysplasia (ACD) are allelic disorders due to heterozygous mutations in or around SOX9. Translocations and deletions involving the SOX9 5' regulatory region are rare causes of these disorders, as well as Pierre Robin sequence (PRS) and 46,XY gonadal dysgenesis. Genotype-phenotype correlations are not straightforward due to the complex epigenetic regulation of SOX9 expression during development. We report a three-generation pedigree with a novel ∼1 Mb deletion upstream of SOX9 and including KCNJ2 and KCNJ16, and ascertained for dominant transmission of PRS. Further characterization of the family identified subtle appendicular anomalies and a variable constellation of axial skeletal features evocative of ACD in several members. Affected males showed learning disability. The identified deletion was smaller than all other chromosome rearrangements associated with ACD. Comparison with other reported translocations and deletions involving this region allowed further refining of genotype-phenotype correlations and an update of the smallest regions of overlap associated with the different phenotypes. Intrafamilial variability in this pedigree suggests a phenotypic continuity between ACD and PRS in patients carrying mutations in the SOX9 5' regulatory region. © 2015 Wiley Periodicals, Inc.
Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.
Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi
2017-07-01
PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.
Baldo, A M; Les, D H; Strausbaugh, L D
1999-11-01
Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.
Search for variable stars in the young open cluster Stock 18
Directory of Open Access Journals (Sweden)
Sinha Tirthendu
2017-01-01
Full Text Available We have carried out multi-epoch deep I band photometry of the open cluster Stock 18 to search for variable stars in star forming regions. In the present study, we report identification of 28 periodic and 165 non-periodic variables stars. The periods of most of the periodic variables are in between 2 to 20 hours and their magnitude varies between 0.05 to 0.6 mag. We have derived spectral energy distributions for 48 probable pre-main sequence variables and the average age and mass is found to be 2.7 ± 0.3 Myrs and 2.7 ± 0.2 M⊙, respectively.
A software pipeline for processing and identification of fungal ITS sequences
Directory of Open Access Journals (Sweden)
Kristiansson Erik
2009-01-01
Full Text Available Abstract Background Fungi from environmental samples are typically identified to species level through DNA sequencing of the nuclear ribosomal internal transcribed spacer (ITS region for use in BLAST-based similarity searches in the International Nucleotide Sequence Databases. These searches are time-consuming and regularly require a significant amount of manual intervention and complementary analyses. We here present software – in the form of an identification pipeline for large sets of fungal ITS sequences – developed to automate the BLAST process and several additional analysis steps. The performance of the pipeline was evaluated on a dataset of 350 ITS sequences from fungi growing as epiphytes on building material. Results The pipeline was written in Perl and uses a local installation of NCBI-BLAST for the similarity searches of the query sequences. The variable subregion ITS2 of the ITS region is extracted from the sequences and used for additional searches of higher sensitivity. Multiple alignments of each query sequence and its closest matches are computed, and query sequences sharing at least 50% of their best matches are clustered to facilitate the evaluation of hypothetically conspecific groups. The pipeline proved to speed up the processing, as well as enhance the resolution, of the evaluation dataset considerably, and the fungi were found to belong chiefly to the Ascomycota, with Penicillium and Aspergillus as the two most common genera. The ITS2 was found to indicate a different taxonomic affiliation than did the complete ITS region for 10% of the query sequences, though this figure is likely to vary with the taxonomic scope of the query sequences. Conclusion The present software readily assigns large sets of fungal query sequences to their respective best matches in the international sequence databases and places them in a larger biological context. The output is highly structured to be easy to process, although it still needs
Cechová, Jana; Lýsek, Jirí; Bartas, Martin; Brázda, Václav
2018-04-01
The NCBI database contains mitochondrial DNA (mtDNA) genomes from numerous species. We investigated the presence and locations of inverted repeat sequences (IRs) in these mtDNA sequences, which are known to be important for regulating nuclear genomes. IRs were identified in mtDNA in all species. IR lengths and frequencies correlate with evolutionary age and the greatest variability was detected in subgroups of plants and fungi and the lowest variability in mammals. IR presence is non-random and evolutionary favoured. The frequency of IRs generally decreased with IR length, but not for IRs 24 or 30 bp long, which are 1.5 times more abundant. IRs are enriched in sequences from the replication origin, followed by D-loop, stem-loop and miscellaneous sequences, pointing to the importance of IRs in regulatory regions of mitochondrial DNA. Data were produced using Palindrome analyser, freely available on the web at http://bioinformatics.ibp.cz. vaclav@ibp.cz. Supplementary data are available at Bioinformatics online.
ESA STSE “SST Diurnal Variability: Regional Extend - Implications in Atmospheric Modelling”
DEFF Research Database (Denmark)
Karagali, Ioanna
The diurnal variability of SST, driven by the coincident occurrence of low enough wind and solar heating, has been observed in various regions of the global ocean [4, 5, 6]. Atmospheric, oceanic and climate models are not adequately resolving the daily SST cycle, resulting in biases of the total...
Linking the uncertainty of low frequency variability in tropical forcing in regional climate change
Energy Technology Data Exchange (ETDEWEB)
Forest, Chris E. [Pennsylvania State Univ., University Park, PA (United States). Dept. of Meteorology; Barsugli, Joseph J. [Univ. of Colorado, Boulder, CO (United States). CIRES; Li, Wei [Pennsylvania State Univ., University Park, PA (United States). Dept. of Meteorology
2015-02-20
The project utilizes multiple atmospheric general circulation models (AGCMs) to examine the regional climate sensitivity to tropical sea surface temperature forcing through a series of ensemble experiments. The overall goal for this work is to use the global teleconnection operator (GTO) as a metric to assess the impact of model structural differences on the uncertainties in regional climate variability.
DEFF Research Database (Denmark)
Duarte, Vinícius da Silva; Giaretta, Sabrina; Treu, Laura
2018-01-01
Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
Energy Technology Data Exchange (ETDEWEB)
Stankunavicius, G.; Pupienis, D. [Vilnius Univ. (Lithuania). Dept. of Hydrology and Climatology; Basharin, D. [National Academy of Science of Ukraine, Sevastopol (Ukraine). Sevastopol Marine Hydrophysical Inst.
2012-11-01
Using a NCEP/NCAR Reanalysis dataset and the empirical orthogonal function (EOF) analysis approach we studied interannual to decadal variabilities of the sea-level air pressure (SLP) and the surface air temperature (SAT) fields over Eurasia during the 2nd part of the 20th century. Our results agree with those of the previous studies, which conclude that Eurasian trends are the result of storm-path changes driven by the interdecadal behaviour of the NAO-like meridional dipole pattern in the Atlantic. On interannual and decadal time scales, significant synchronous correlations between correspondent modes of SAT and SLP EOF patterns were found. This fact suggests that there is a strong and stable Eurasian interrelationship between SAT and SLP large-scale fields which affects the local climate of two sub-regions: the Black and Baltic Seas. The climate variability in these sub-regions was studied in terms of Eurasian large-scale surface-temperature and air-pressure patterns responses. We concluded that the sub-regional climate variability substantially differs over the Black and Baltic Seas, and depends on different Eurasian large-scale patterns. We showed that the Baltic Sea region is influenced by the patterns arising primary from NAO-like meridional dipole, as well as Scandinavian patterns, while the Black Sea's SAT/SLP variability is influenced mainly by the second mode EOF (eastern Atlantic) and large scale tropospheric wave structures. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Moore, B [Duke University Medical Physics Graduate Program, Durham, NC (United States); Yin, F; Cai, J [Duke University Medical Physics Graduate Program, Durham, NC (United States); Duke University Medical Center, Radiation Oncology, Durham, NC (United States); Czito, B; Palta, M [Duke University Medical Center, Radiation Oncology, Durham, NC (United States)
2016-06-15
Purpose: To determine the variation in tumor contrast between different MRI sequences and between patients for the purpose of MRI-based treatment planning. Methods: Multiple MRI scans of 11 patients with cancer(s) in the liver were included in this IRB-approved study. Imaging sequences consisted of T1W MRI, Contrast-Enhanced T1W MRI, T2W MRI, and T2*/T1W MRI. MRI images were acquired on a 1.5T GE Signa scanner with a four-channel torso coil. We calculated the tumor-to-tissue contrast to noise ratio (CNR) for each MR sequence by contouring the tumor and a region of interest (ROI) in a homogeneous region of the liver using the Eclipse treatment planning software. CNR was calculated (I-Tum-I-ROI)/SD-ROI, where I-Tum and I-ROI are the mean values of the tumor and the ROI respectively, and SD-ROI is the standard deviation of the ROI. The same tumor and ROI structures were used in all measurements for different MR sequences. Inter-patient Coefficient of variation (CV), and inter-sequence CV was determined. In addition, mean and standard deviation of CNR were calculated and compared between different MR sequences. Results: Our preliminary results showed large inter-patient CV (range: 37.7% to 88%) and inter-sequence CV (range 5.3% to 104.9%) of liver tumor CNR, indicating great variations in tumor CNR between MR sequences and between patients. Tumor CNR was found to be largest in CE-T1W (8.5±7.5), followed by T2W (4.2±2.4), T1W (3.4±2.2), and T2*/T1W (1.7±0.6) MR scans. The inter-patient CV of tumor CNR was also the largest in CE-T1W (88%), followed by T1W (64.3%), T1W (56.2%), and T2*/T1W (37.7) MR scans. Conclusion: Large inter-sequence and inter-patient variations were observed in liver tumor CNR. CE-T1W MR images on average provided the best tumor CNR. Efforts are needed to optimize tumor contrast and its consistency for MRI-based treatment planning of cancer in the liver. This project is supported by NIH grant: 1R21CA165384.
International Nuclear Information System (INIS)
Moore, B; Yin, F; Cai, J; Czito, B; Palta, M
2016-01-01
Purpose: To determine the variation in tumor contrast between different MRI sequences and between patients for the purpose of MRI-based treatment planning. Methods: Multiple MRI scans of 11 patients with cancer(s) in the liver were included in this IRB-approved study. Imaging sequences consisted of T1W MRI, Contrast-Enhanced T1W MRI, T2W MRI, and T2*/T1W MRI. MRI images were acquired on a 1.5T GE Signa scanner with a four-channel torso coil. We calculated the tumor-to-tissue contrast to noise ratio (CNR) for each MR sequence by contouring the tumor and a region of interest (ROI) in a homogeneous region of the liver using the Eclipse treatment planning software. CNR was calculated (I_Tum-I_ROI)/SD_ROI, where I_Tum and I_ROI are the mean values of the tumor and the ROI respectively, and SD_ROI is the standard deviation of the ROI. The same tumor and ROI structures were used in all measurements for different MR sequences. Inter-patient Coefficient of variation (CV), and inter-sequence CV was determined. In addition, mean and standard deviation of CNR were calculated and compared between different MR sequences. Results: Our preliminary results showed large inter-patient CV (range: 37.7% to 88%) and inter-sequence CV (range 5.3% to 104.9%) of liver tumor CNR, indicating great variations in tumor CNR between MR sequences and between patients. Tumor CNR was found to be largest in CE-T1W (8.5±7.5), followed by T2W (4.2±2.4), T1W (3.4±2.2), and T2*/T1W (1.7±0.6) MR scans. The inter-patient CV of tumor CNR was also the largest in CE-T1W (88%), followed by T1W (64.3%), T1W (56.2%), and T2*/T1W (37.7) MR scans. Conclusion: Large inter-sequence and inter-patient variations were observed in liver tumor CNR. CE-T1W MR images on average provided the best tumor CNR. Efforts are needed to optimize tumor contrast and its consistency for MRI-based treatment planning of cancer in the liver. This project is supported by NIH grant: 1R21CA165384
The terroir of vineyards - climatic variability in an Austrian wine-growing region
Gerersdorfer, T.
2010-09-01
The description of a terroir is a concept in viticulture that relates the sensory attributes of wine to the environmental conditions in which the grapes grow. Many factors are involved including climate, soil, cultivar, human practices and all these factors interact manifold. The study area of Carnuntum is a small wine-growing region in the eastern part of Austria. It is rich of Roman remains which play a major role in tourism and the marketing strategies of the wines as well. An interdisciplinary study on the environmental characteristics particularly with regard to growing conditions of grapes was started in this region. The study is concerned with the description of the physiogeographic properties of the region and with the investigation of the dominating viticultural functions. Grape-vines depend on climatic conditions to a high extent. Compared to other influencing factors like soil, climate plays a significant role. In the framework of this interdisciplinary project climatic variability within the Carnuntum wine-growing region is investigated. On the one hand microclimatic variations are influenced by soil type and by canopy management. On the other hand the variability is a result of the topoclimate (altitude, aspect and slope) and therefore relief is a major terroir factor. Results of microclimatic measurements and variations are presented with focus on the interpretation of the relationship between relief, structure of the vineyards and the climatic conditions within the course of a full year period.
Directory of Open Access Journals (Sweden)
J. J. Gómez-Navarro
2012-01-01
Full Text Available In this study we analyse the role of internal variability in regional climate simulations through a comparison of two regional paleoclimate simulations for the last millennium. They share the same external forcings and model configuration, differing only in the initial condition used to run the driving global model simulation. A comparison of these simulations allows us to study the role of internal variability in climate models at regional scales, and how it affects the long-term evolution of climate variables such as temperature and precipitation. The results indicate that, although temperature is homogeneously sensitive to the effect of external forcings, the evolution of precipitation is more strongly governed by random unpredictable internal dynamics. There are, however, some areas where the role of internal variability is lower than expected, allowing precipitation to respond to the external forcings. In this respect, we explore the underlying physical mechanisms responsible for it. This study identifies areas, depending on the season, in which a direct comparison between model simulations of precipitation and climate reconstructions would be meaningful, but also other areas where good agreement between them should not be expected even if both are perfect.
Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja
2015-01-01
Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873
In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms
Directory of Open Access Journals (Sweden)
Amit Kumar Dubey
2010-01-01
Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
Directory of Open Access Journals (Sweden)
Tyson Jess
2012-12-01
Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Becker, M.; Karpytchev, M.; Hu, A.; Deser, C.; Lennartz-Sassinek, S.
2017-12-01
Today, the Climate models (CM) are the main tools for forecasting sea level rise (SLR) at global and regional scales. The CM forecasts are accompanied by inherent uncertainties. Understanding and reducing these uncertainties is becoming a matter of increasing urgency in order to provide robust estimates of SLR impact on coastal societies, which need sustainable choices of climate adaptation strategy. These CM uncertainties are linked to structural model formulation, initial conditions, emission scenario and internal variability. The internal variability is due to complex non-linear interactions within the Earth Climate System and can induce diverse quasi-periodic oscillatory modes and long-term persistences. To quantify the effects of internal variability, most studies used multi-model ensembles or sea level projections from a single model ran with perturbed initial conditions. However, large ensembles are not generally available, or too small, and computationally expensive. In this study, we use a power-law scaling of sea level fluctuations, as observed in many other geophysical signals and natural systems, which can be used to characterize the internal climate variability. From this specific statistical framework, we (1) use the pre-industrial control run of the National Center for Atmospheric Research Community Climate System Model (NCAR-CCSM) to test the robustness of the power-law scaling hypothesis; (2) employ the power-law statistics as a tool for assessing the spread of regional sea level projections due to the internal climate variability for the 21st century NCAR-CCSM; (3) compare the uncertainties in predicted sea level changes obtained from a NCAR-CCSM multi-member ensemble simulations with estimates derived for power-law processes, and (4) explore the sensitivity of spatial patterns of the internal variability and its effects on regional sea level projections.
Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar
2017-09-01
To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first
International Nuclear Information System (INIS)
Frost, Gerald V; Epstein, Howard E; Walker, Donald A
2014-01-01
Widespread increases in Arctic tundra productivity have been documented for decades using coarse-scale satellite observations, but finer-scale observations indicate that changes have been very uneven, with a high degree of landscape- and regional-scale heterogeneity. Here we analyze time-series of the Normalized Difference Vegetation Index (NDVI) observed by Landsat (1984–2012), to assess landscape- and regional-scale variability of tundra vegetation dynamics in the northwest Siberian Low Arctic, a little-studied region with varied soils, landscape histories, and permafrost attributes. We also estimate spatio-temporal rates of land-cover change associated with expansion of tall alder (Alnus) shrublands, by integrating Landsat time-series with very-high-resolution imagery dating to the mid-1960s. We compiled Landsat time-series for eleven widely-distributed landscapes, and performed linear regression of NDVI values on a per-pixel basis. We found positive net NDVI trends (‘greening’) in nine of eleven landscapes. Net greening occurred in alder shrublands in all landscapes, and strong greening tended to correspond to shrublands that developed since the 1960s. Much of the spatial variability of greening within landscapes was linked to landscape physiography and permafrost attributes, while between-landscape variability largely corresponded to differences in surficial geology. We conclude that continued increases in tundra productivity in the region are likely in upland tundra landscapes with fine-textured, cryoturbated soils; these areas currently tend to support discontinuous vegetation cover, but are highly susceptible to rapid increases in vegetation cover, as well as land-cover changes associated with the development of tall shrublands. (paper)
High levels of diversity characterize mandrill (Mandrillus sphinx) Mhc-DRB sequences.
Abbott, Kristin M; Wickings, E Jean; Knapp, Leslie A
2006-08-01
The major histocompatibility complex (MHC) is highly polymorphic in most primate species studied thus far. The rhesus macaque (Macaca mulatta) has been studied extensively and the Mhc-DRB region demonstrates variability similar to humans. The extent of MHC diversity is relatively unknown for other Old World monkeys (OWM), especially among genera other than Macaca. A molecular survey of the Mhc-DRB region in mandrills (Mandrillus sphinx) revealed extensive variability, suggesting that other OWMs may also possess high levels of Mhc-DRB polymorphism. In the present study, 33 Mhc-DRB loci were identified from only 13 animals. Eleven were wild-born and presumed to be unrelated and two were captive-born twins. Two to seven different sequences were identified for each individual, suggesting that some mandrills may have as many as four Mhc-DRB loci on a single haplotype. From these sequences, representatives of at least six Mhc-DRB loci or lineages were identified. As observed in other primates, some new lineages may have arisen through the process of gene conversion. These findings indicate that mandrills have Mhc-DRB diversity not unlike rhesus macaques and humans.
Fourment, Mercedes; Ferrer, Milka; González-Neves, Gustavo; Barbeau, Gérard; Bonnardot, Valérie; Quénol, Hervé
2017-09-01
Spatial variability of temperature was studied in relation to the berry basic composition and secondary compounds of the Tannat cultivar at harvest from vineyards located in Canelones and Montevideo, the most important wine region of Uruguay. Monitoring of berries and recording of temperature were performed in 10 commercial vineyards of Tannat situated in the southern coastal wine region of the country for three vintages (2012, 2013, and 2014). Results from a multivariate correlation analysis between berry composition and temperature over the three vintages showed that (1) Tannat responses to spatial variability of temperature were different over the vintages, (2) correlations between secondary metabolites and temperature were higher than those between primary metabolites, and (3) correlation values between berry composition and climate variables increased when ripening occurred under dry conditions (below average rainfall). For a particular studied vintage (2013), temperatures explained 82.5% of the spatial variability of the berry composition. Daily thermal amplitude was found to be the most important spatial mode of variability with lower values recorded at plots nearest to the sea and more exposed to La Plata River. The highest levels in secondary compounds were found in berries issued from plots situated as far as 18.3 km from La Plata River. The increasing knowledge of temperature spatial variability and its impact on grape berry composition contributes to providing possible issues to adapt grapevine to climate change.
DEFF Research Database (Denmark)
Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter
2016-01-01
This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...
Delport, Wayne; Ferguson, J Willem H; Bloomer, Paulette
2002-06-01
We determined the mitochondrial DNA control region sequences of six Bucerotiformes. Hornbills have the typical avian gene order and their control region is similar to other avian control regions in that it is partitioned into three domains: two variable domains that flank a central conserved domain. Two characteristics of the hornbill control region sequence differ from that of other birds. First, domain I is AT rich as opposed to AC rich, and second, the control region is approximately 500 bp longer than that of other birds. Both these deviations from typical avian control region sequence are explainable on the basis of repeat motifs in domain I of the hornbill control region. The repeat motifs probably originated from a duplication of CSB-1 as has been determined in chicken, quail, and snowgoose. Furthermore, the hornbill repeat motifs probably arose before the divergence of hornbills from each other but after the divergence of hornbills from other avian taxa. The mitochondrial control region of hornbills is suitable for both phylogenetic and population studies, with domains I and II probably more suited to population and phylogenetic analyses, respectively.
Directory of Open Access Journals (Sweden)
Eva Hřibová
2011-03-01
Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.
Regional climate change: Precipitation variability in mountainous part of Bulgaria
Directory of Open Access Journals (Sweden)
Nikolova Nina
2007-01-01
Full Text Available The aim of paper is to analyze temporal and spatial changes in monthly precipitation as well as extremely dry and wet months in mountainous part of Bulgaria. Study precipitation variability in mountainous part is very important because this part is the region where the rivers take its source from. Extreme values of monthly precipitation are important information for better understanding of the whole variability and trends in precipitation time series. The mean investigated period is 1951-2005 and the reference period is so called temporary climate - 1961- 1990. Extreme dry precipitation months are defined as a month whose monthly precipitation is lower than 10% of gamma distribution in the reference period 1961-1990. Extreme wet months are determined with respect to 90% percentiles of gamma distribution (monthly precipitation is higher than 90%. The result of the research show that in mountainous part of Bulgaria during 1950s and 1960s number of extremely wet months is higher than number of dry months. Decreasing of monthly precipitation is a feature for 1980s. This dry period continues till 2004. The years 2000 makes impression as driest year in high mountains with about 7 extremely dry months. The second dry year is 1993. The negative precipitation anomaly is most clearly determined during last decade at study area. The present research points out that fluctuation of precipitation in mountainous part of Bulgaria are coinciding with regional and global climate trends.
International Nuclear Information System (INIS)
Shannon, J.D.
1984-01-01
In a growing number of emission policy analyses, regulatory proceedings, and cost/benefit assessments, numerical models of long-range transport and deposition of air pollutants have been exercised to estimate source-receptor (S-R) relationships--for the particular meteorological conditions input to the model. The representativeness of the meteorological conditions, or the variability of the model estimates with climatological input from different years or corresponding seasons from different years, is seldom evaluated. Here, two full years (1980 and 1981) of meteorological data, as well as data from January and July of 1978, are used in the Advanced Statistical Trajectory Regional Air Pollution (ASTRAP) model (Shannon, 1981), one of the eight Memorandum of Intent (MOI) models, to estimate deposition for the S-R matrix combination of eleven source regions and nine receptors used in the MOI reports. (S-R matrices of dimensions 40 by 9 were also examined in the MOI reports.) Improvements in the ASTRAP model and in the emission inventory since the earlier work require recalculation of the two-month 1978 simulation in order for the comparison to isolate the effect of meteorological variability. The source regions are listed, and the receptor regions are provide. For completeness, an additional source region, the western states and provinces, has been added, as well as a total for the 48 contiguous states and 10 provinces. 4 references, 9 tables
Interannual variability of mass transport in the Canary region from LADCP data
Comas-Rodríguez, Isis; Hernández-Guerra, Alonso; Vélez-Belchí, Pedro; Fraile-Nuez, Eugenio
2010-05-01
The variability of the Canary Current is a widely studied topic regarding its role as eastern boundary of the North Atlantic Subtropical Gyre. The Canary region provides indeed an interesting study area in terms of estimating variability scales of the Subtropical Gyre as well as the water masses dynamics. RAPROCAN (RAdial PROfunda de CANarias - Canary deep hydrographic section) is a project based on the reaching of these goals through the obtaining of hydrographic measures during cruises taking place approximately along 29°N, to the North of the Canary Archipelago, twice a year since 2006. The full depth sampling carried out allows the study of temperature and salinity distribution and the calculation of mass transports across the section. The transport estimates are compared to those obtained from previous measurements and estimates in the region. Therefore, transports and their variability through the last decade are quantified. The most significant advance made to previous works is the use of LADCP (Lowered Acoustic Doppler Current Profiler) data informing the initial geostrophic calculations. Thus, corrections are applied to each geostrophic profile considering the reference velocity obtained from LADCP data. ADCP-referenced transport estimates are obtained, providing a successful comparison between the velocity fields obtained from the hydrographic measures. While this work shows the interannual variability observed in winter since 1997, preliminary results confirm previous hypotheses about the magnitude of the Canary Current. Those results including LADCP data also provide new aspects in the circulation distribution across the Canary Archipelago. Also moored current meter data were taken into account in the up close study of the Current through the Lanzarote Passage. Interesting conclusions were drawn that certify the usefulness of LADCP data in referencing geostrophic calculations, while corroborating the results obtained through this methodology. Hence
Long term precipitation trends and variability within the Mediterranean region
Directory of Open Access Journals (Sweden)
C. M. Philandras
2011-12-01
Full Text Available In this study, the trends and variability of annual precipitation totals and annual rain days over land within the Mediterranean region are analyzed. Long term ground-based observations concerning, on one hand, monthly precipitation totals (1900–2010 and rain days (1965–2010 from 40 meteorological stations within the Mediterranean region were obtained from the Hellenic National Meteorological Service and the World Climate Data and Monitoring Programme (WCDMP of the World Meteorological Organization. On the other hand, high spatial resolution (0.5° × 0.5° gridded monthly data CRU TS 3.1 were acquired from the Climatic Research Unit, University of East Anglia, for the period 1901–2009. The two datasets were compared by means of trends and variability, while the influence of the North Atlantic Oscillation (NAO in the Mediterranean precipitation was examined. In the process, the climatic changes in the precipitation regime between the period 1961–1990 (reference period and the period 2071–2100 (future climate were presented using climate model simulations (RACMO2.1/KNMI. The future climate projections were based on SRES A1B.
The findings of the analysis showed that statistically significant (95% confidence level negative trends of the annual precipitation totals exist in the majority of Mediterranean regions during the period 1901–2009, with an exception of northern Africa, southern Italy and western Iberian peninsula, where slight positive trends (not statistically significant at 95% CL appear. Concerning the annual number of rain days, a pronounced decrease of 20 %, statistically significant (95% confidence level, appears in representative meteorological stations of east Mediterranean, while the trends are insignificant for west and central Mediterranean. Additionally, NAO index was found to be anticorrelated with the precipitation totals and the number of rain days mainly in Spain, southern France, Italy and Greece. These
Chooi, Kar Mun; Cohen, Daniel; Pearson, Michael N
2013-04-01
Grapevine leafroll-associated virus 3 (GLRaV-3) is an economically important virus, which is found in all grapevine growing regions worldwide. Its accurate detection in nursery and field samples is of high importance for certification schemes and disease management programmes. To reduce false negatives that can be caused by sequence variability, a new universal primer pair was designed against a divergent sequence data set, targeting the open reading frame 4 (heat shock protein 70 homologue gene), and optimised for conventional one-step RT-PCR and one-step SYBR Green real-time RT-PCR assays. In addition, primer pairs for the simultaneous detection of specific GLRaV-3 variants from groups 1, 2, 6 (specifically NZ-1) and the outlier NZ2 variant, and the generic detection of variants from groups 1 to 5 were designed and optimised as a conventional one-step multiplex RT-PCR assay using the plant nad5 gene as an internal control (i.e. one-step hexaplex RT-PCR). Results showed that the generic and variant specific assays detected in vitro RNA transcripts from a range of 1×10(1)-1×10(8) copies of amplicon per μl diluted in healthy total RNA from Vitis vinifera cv. Cabernet Sauvignon. Furthermore, the assays were employed effectively to screen 157 germplasm and 159 commercial field samples. Thus results demonstrate that the GLRaV-3 generic and variant-specific assays are prospective tools that will be beneficial for certification schemes and disease management programmes, as well as biological and epidemiological studies of the divergent GLRaV-3 populations. Copyright © 2013 Elsevier B.V. All rights reserved.
Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred
2017-06-29
The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known
Learning multiple variable-speed sequences in striatum via cortical tutoring.
Murray, James M; Escola, G Sean
2017-05-08
Sparse, sequential patterns of neural activity have been observed in numerous brain areas during timekeeping and motor sequence tasks. Inspired by such observations, we construct a model of the striatum, an all-inhibitory circuit where sequential activity patterns are prominent, addressing the following key challenges: (i) obtaining control over temporal rescaling of the sequence speed, with the ability to generalize to new speeds; (ii) facilitating flexible expression of distinct sequences via selective activation, concatenation, and recycling of specific subsequences; and (iii) enabling the biologically plausible learning of sequences, consistent with the decoupling of learning and execution suggested by lesion studies showing that cortical circuits are necessary for learning, but that subcortical circuits are sufficient to drive learned behaviors. The same mechanisms that we describe can also be applied to circuits with both excitatory and inhibitory populations, and hence may underlie general features of sequential neural activity pattern generation in the brain.
2010-04-01
The objective of this study was to generate a baseline understanding of current policy responses to climate : change/variability at the state and regional transportation-planning and -decision levels. Specifically, : researchers were interested in th...
Influence of Climate Variability on US Regional Homicide Rates
Harp, R. D.; Karnauskas, K. B.
2017-12-01
Recent studies have found consistent evidence of a relationship between temperature and criminal behavior. However, despite agreement in the overall relationship, little progress has been made in distinguishing between two proposed explanatory theories. The General Affective Aggression Model (GAAM) suggests that high temperatures create periods of higher heat stress that enhance individual aggressiveness, whereas the Routine Activities Theory (RAT) theorizes that individuals are more likely to be outdoors interacting with others during periods of pleasant weather with a resulting increase in both interpersonal interactions and victim availability. Further, few studies have considered this relationship within the context of climate change in a quantitative manner. In an effort to distinguish between the two theories, and to examine the statistical relationships on a broader spatial scale than previously, we combined data from the Supplementary Homicide Report (SHR—compiled by the Federal Bureau of Investigation) and the North American Regional Reanalysis (NARR—compiled by the National Centers for Environmental Protection, a branch of the National Oceanic and Atmospheric Administration). US homicide data described by the SHR was compared with seven relevant observed climate variables (temperature, dew point, relative humidity, accumulated precipitation, accumulated snowfall, snow cover, and snow depth) provided by the NARR atmospheric reanalysis. Relationships between homicide rates and climate variables, as well as reveal regional spatial patterns will be presented and discussed, along with the implications due to future climate change. This research lays the groundwork for the refinement of estimates of an oft-overlooked climate change impact, which has previously been estimated to cause an additional 22,000 murders between 2010 and 2099, including providing important constraints for empirical models of future violent crime incidences in the face of global
Bm86 midgut protein sequence variation in South Texas cattle fever ticks
Directory of Open Access Journals (Sweden)
Kammlah Diane M
2010-11-01
Full Text Available Abstract Background Cattle fever ticks, Rhipicephalus (Boophilus microplus and R. (B. annulatus, vector bovine and equine babesiosis, and have significantly expanded beyond the permanent quarantine zone established in South Texas. Currently, there are no vaccines approved for use within the United States for controlling these vectors. Vaccines developed in Australia and Cuba based on the midgut antigen Bm86 have variable efficacy against cattle fever ticks. A possible explanation for this variation in vaccine efficacy is amino acid sequence divergence between the recombinant Bm86 vaccine component and native Bm86 expressed in ticks from different geographical regions of the world. Results There was 91.8% amino acid sequence identity in Bm86 among R. microplus and R. annulatus sequenced from South Texas infestations. When South Texas isolates were compared to the Australian Yeerongpilly and Cuban Camcord vaccine strains, there was 89.8% and 90.0% identity, respectively. Most of the sequence divergence was focused in one region of the protein, amino acids 206-298. Hydrophilicity profiles revealed that two short regions of Bm86 (amino acids 206-210 and 560-570 appear to be more hydrophilic in South Texas isolates compared to vaccine strains. Only one amino acid difference was found between South Texas and vaccine strains within two previously described B-cell epitopes. A total of 4 amino acid differences were observed within three peptides previously shown to induce protective immune responses in cattle. Conclusions Sequence differences between South Texas isolates and Yeerongpilly and Camcord strains are spread throughout the entire Bm86 sequence, suggesting that geographic variation does exist. Differences within previously described B-cell epitopes between South Texas isolates and vaccine strains are minimal; however, short regions of hydrophilic amino acids found unique to South Texas isolates suggest that additional unique surface exposed
Manen, Jean-François; Habashi, Christine; Jeanmonod, Daniel; Park, Jeong-Mi; Schneeweiss, Gerald M
2004-11-01
The rbcL sequences of 106 specimens representing 28 species of the four recognized sections of Orobanche were analyzed and compared. Most sequences represent pseudogenes with premature stop codons. This study confirms that the American lineage (sects. Gymnocaulis and Myzorrhiza) contains potentially functional rbcL-copies with intact open reading frames and low rates of non-synonymous substitutions. For the first time, this is also shown for a member of the Eurasian lineage, O. coerulescens of sect. Orobanche, while all other investigated species of sects. Orobanche and Trionychon contain pseudogenes with distorted reading frames and significantly higher rates of non-synonymous substitutions. Phylogenetic analyses of the rbcL sequences give equivocal results concerning the monophyly of Orobanche, and the American lineage might be more closely related to Boschniakia and Cistanche than to the other sections of Orobanche. Additionally, species of sect. Trionychon phylogenetically nest in sect. Orobanche. This is in concordance with results from other plastid markers (rps2 and matK), but in disagreement with other molecular (nuclear ITS), morphological, and karyological data. This might indicate that the ancestor of sect. Trionychon has captured the plastid genome, or parts of it, of a member of sect. Orobanche. Apart from the phylogenetically problematic position of sect. Trionychon, the phylogenetic relationships within sect. Orobanche are similar to those inferred from nuclear ITS data and are close to the traditional groupings traditionally recognized based on morphology. The intraspecific variation of rbcL is low and is neither correlated with intraspecific morphological variability nor with host range. Ancestral character reconstruction using parsimony suggests that the ancestor of O. sect. Orobanche had a narrow host range.
Global variation in the long-term seasonal changes observed in ionospheric F region data
Directory of Open Access Journals (Sweden)
C. J. Scott
2015-04-01
Full Text Available Long-term variability has previously been observed in the relative magnitude of annual and semi-annual variations in the critical frequency (related to the peak electron concentration of the ionospheric F2 layer (foF2. In this paper we investigate the global patterns in such variability by calculating the time varying power ratio of semi-annual to annual components seen in ionospheric foF2 data sequences from 77 ionospheric monitoring stations around the world. The temporal variation in power ratios observed at each station was then correlated with the same parameter calculated from similar epochs for the Slough/Chilton data set (for which there exists the longest continuous sequence of ionospheric data. This technique reveals strong regional variation in the data, which bears a striking similarity to the regional variation observed in long-term changes to the height of the ionospheric F2 layer. We argue that since both the height and peak density of the ionospheric F2 region are influenced by changes to thermospheric circulation and composition, the observed long-term and regional variability can be explained by such changes. In the absence of long-term measurements of thermospheric composition, detailed modelling work is required to investigate these processes.
Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae
Energy Technology Data Exchange (ETDEWEB)
Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.; Boore,Jeffrey L.
2007-01-01
The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae, respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.
Wang, Ming-yi; Chen, Cheng; Gao, Xiao-zhong; Li, Jie; Yue, Jing; Ling, Feng; Wang, Xiao-chun; Shao, Shi-he
2013-01-01
Helicobacter pylori (H. pylori) is a major human pathogen that is responsible for various gastroduodenal diseases. We investigated the prevalence of H. pylori virulence markers in a region at high risk of gastric cancer. One hundred and sixteen H. pylori strains were isolated from patients with gastroduodenal diseases. cagA, the cagA 3' variable region, cagPAI genes, vacA, and dupA genotypes were determined by PCR, and some amplicons of the cagA 3' variable region, cagPAI genes and dupA were sequenced. cagA was detected in all strains. The cagA 3' variable region of 85 strains (73.3%) was amplified, and the sequences of 24 strains were obtained including 22 strains possessing the East Asian-type. The partial cagPAI presented at a higher frequency in chronic gastritis (44.4%) than that of the severe clinical outcomes (9.7%, p dupA and sequencing of dupA revealed an ORF of 2449-bp. The prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes (40.3%) than that from chronic gastritis (20.4%, p = 0.02). The high rate of East Asian-type cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA may underlie the high risk of gastric cancer in the region. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Umberto Rosani
Full Text Available BACKGROUND: Effective innate responses against potential pathogens are essential in the living world and possibly contributed to the evolutionary success of invertebrates. Taken together, antimicrobial peptide (AMP precursors of defensin, mytilin, myticin and mytimycin can represent about 40% of the hemocyte transcriptome in mussels injected with viral-like and bacterial preparations, and unique profiles of myticin C variants are expressed in single mussels. Based on amplicon pyrosequencing, we have ascertained and compared the natural and Vibrio-induced diversity of AMP transcripts in mussel hemocytes from three European regions. METHODOLOGY/PRINCIPAL FINDINGS: Hemolymph was collected from mussels farmed in the coastal regions of Palavas (France, Vigo (Spain and Venice (Italy. To represent the AMP families known in M. galloprovincialis, nine transcript sequences have been selected, amplified from hemocyte RNA and subjected to pyrosequencing. Hemolymph from farmed (offshore and wild (lagoon Venice mussels, both injected with 10(7 Vibrio cells, were similarly processed. Amplicon pyrosequencing emphasized the AMP transcript diversity, with Single Nucleotide Changes (SNC minimal for mytilin B/C and maximal for arthropod-like defensin and myticin C. Ratio of non-synonymous vs. synonymous changes also greatly differed between AMP isotypes. Overall, each amplicon revealed similar levels of nucleotidic variation across geographical regions, with two main sequence patterns confirmed for mytimycin and no substantial changes after immunostimulation. CONCLUSIONS/SIGNIFICANCE: Barcoding and bidirectional pyrosequencing allowed us to map and compare the transcript diversity of known mussel AMPs. Though most of the genuine cds variation was common to the analyzed samples we could estimate from 9 to 106 peptide variants in hemolymph pools representing 100 mussels, depending on the AMP isoform and sampling site. In this study, no prevailing SNC patterns related
Directory of Open Access Journals (Sweden)
Siya Liu
2017-09-01
Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.
Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.
2014-01-01
Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.
Regularized rare variant enrichment analysis for case-control exome sequencing data.
Larson, Nicholas B; Schaid, Daniel J
2014-02-01
Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.
Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E
2016-09-01
Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.
The evolutionary state of the β Canis Majoris variables
International Nuclear Information System (INIS)
Shobbrook, R.R.
1978-01-01
It is found from accurate β photometry of bright stars in the region of the β CMa instability strip that about three-quarters of the stars in the strip, to a distance modulus of 8.0, are β CMa variables. The strip is not resolved by the data so that its intrinsic width is uncertain, but the conclusion from a consideration of theoretical evolutionary rates is that the variables must be very near the end of core hydrogen burning. Comparison of the relative positions of the empirical and theoretical instability strip and zero age main sequence indicates that the observationally located upper ZAMS is too bright. (author)
Directory of Open Access Journals (Sweden)
Knut Rudi
2003-01-01
Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.
Hoy, Marshal S.; Rodriguez, Rusty J.
2013-01-01
Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.
Regions identity between the genome of vertebrates and non-retroviral families of insect viruses.
Fan, Gaowei; Li, Jinming
2011-11-10
The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.
DeShon, H. R.; Brudzinski, M.; Frohlich, C.; Hayward, C.; Jeong, S.; Hornbach, M. J.; Magnani, M. B.; Ogwari, P.; Quinones, L.; Scales, M. M.; Stump, B. W.; Sufri, O.; Walter, J. I.
2017-12-01
Since October 2008, the Fort Worth basin in north Texas has experienced over 30 magnitude (M) 3.0+ earthquakes, including one M4.0. Five named earthquake sequences have been recorded by local seismic networks: DFW Airport, Cleburne-Johnson County, Azle, Irving-Dallas, and Venus-Johnson County. Earthquakes have occurred on northeast (NE)-southwest (SW) trending Precambrian basement faults and within the overlying Ellenburger limestone unit used for wastewater disposal. Focal mechanisms indicate primarily normal faulting, and stress inversions indicate maximum regional horizontal stress strikes 20-30° NE. The seismogenic sections of the faults in either the basement or within the Ellenburger appear optimally oriented for failure within the modern stress regime. Stress drop estimates range from 10 to 75 bars, with little variability between and within the named sequences, and the values are consistent with intraplate earthquake stress drops in natural tectonic settings. However, the spatio-temporal history of each sequence relative to wastewater injection data varies. The May 2015 M4.0 Venus earthquake, for example, is only the largest of what is nearly 10 years of earthquake activity on a single fault structure. Here, maximum earthquake size has increased with time and exhibits a log-linear relationship to cumulative injected volume from 5 nearby wells. At the DFW airport, where the causative well was shut-in within a few months of the initial earthquakes and soon after the well began operation, we document migration away from the injector on the same fault for nearly 6 km sporadically over 5 years. The Irving-Dallas and Azle sequences, like DFW airport, appear to have started rather abruptly with just a few small magnitude earthquakes in the weeks or months preceding the significant set of magnitude 3.5+ earthquakes associated with each sequence. There are no nearby (<10 km) injection operations to the Irving-Dallas sequence and the Azle linked wells operated for
Directory of Open Access Journals (Sweden)
Justin N Vaughn
Full Text Available Plants from the Zingiberaceae family are a key source of spices and herbal medicines. Species identification within this group is critical in the search for known and possibly novel bioactive compounds. To facilitate precise characterization of this group, we have sequenced chloroplast genomes from species representing five major groups within Zingiberaceae. Generally, the structure of these genomes is similar to the basal angiosperm excepting an expansion of 3 kb associated with the inverted repeat A region. Portions of this expansion appear to be shared across the entire Zingiberales order, which includes gingers and bananas. We used whole plastome alignment information to develop DNA barcodes that would maximize the ability to differentiate species within the Zingiberaceae. Our computation pipeline identified regions of high variability that were flanked by highly conserved regions used for primer design. This approach yielded hitherto unexploited regions of variability. These theoretically optimal barcodes were tested on a range of species throughout the family and were found to amplify and differentiate genera and, in some cases, species. Still, though these barcodes were specifically optimized for the Zingiberaceae, our data support the emerging consensus that whole plastome sequences are needed for robust species identification and phylogenetics within this family.
Directory of Open Access Journals (Sweden)
Nicholas J Schurch
Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084
Alhammad, Yousef; Gu, Jun; Boo, Irene; Harrison, David; McCaffrey, Kathleen; Vietheer, Patricia T; Edwards, Stirling; Quinn, Charles; Coulibaly, Fásseli; Poumbourios, Pantelis; Drummer, Heidi E
2015-12-01
Hepatitis C virus (HCV) envelope glycoproteins E1 and E2 form a heterodimer and mediate receptor interactions and viral fusion. Both E1 and E2 are targets of the neutralizing antibody (NAb) response and are candidates for the production of vaccines that generate humoral immunity. Previous studies demonstrated that N-terminal hypervariable region 1 (HVR1) can modulate the neutralization potential of monoclonal antibodies (MAbs), but no information is available on the influence of HVR2 or the intergenotypic variable region (igVR) on antigenicity. In this study, we examined how the variable regions influence the antigenicity of the receptor binding domain of E2 spanning HCV polyprotein residues 384 to 661 (E2661) using a panel of MAbs raised against E2661 and E2661 lacking HVR1, HVR2, and the igVR (Δ123) and well-characterized MAbs isolated from infected humans. We show for a subset of both neutralizing and nonneutralizing MAbs that all three variable regions decrease the ability of MAbs to bind E2661 and reduce the ability of MAbs to inhibit E2-CD81 interactions. In addition, we describe a new MAb directed toward the region spanning residues 411 to 428 of E2 (MAb24) that demonstrates broad neutralization against all 7 genotypes of HCV. The ability of MAb24 to inhibit E2-CD81 interactions is strongly influenced by the three variable regions. Our data suggest that HVR1, HVR2, and the igVR modulate exposure of epitopes on the core domain of E2 and their ability to prevent E2-CD81 interactions. These studies suggest that the function of HVR2 and the igVR is to modulate antibody recognition of glycoprotein E2 and may contribute to immune evasion. This study reveals conformational and antigenic differences between the Δ123 and intact E2661 glycoproteins and provides new structural and functional data about the three variable regions and their role in occluding neutralizing and nonneutralizing epitopes on the E2 core domain. The variable regions may therefore function to
Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean
2003-08-01
A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.
UL146 variability among clinical isolates of Human Cytomegalovirus from Japan
Directory of Open Access Journals (Sweden)
Francisco Aguayo
2010-01-01
Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.
Variability and molecular typing of the woody-tree infecting prunus necrotic ringspot ilarvirus.
Vasková, D; Petrzik, K; Karesová, R
2000-01-01
The 3'-part of the movement protein gene, the intergenic region and the complete coat protein gene of sixteen isolates of Prunus necrotic ringspot virus (PNRSV) from five different host species from the Czech Republic were sequenced in order to search for the bases of extensive variability of viroses caused by this pathogen. According to phylogenetic analyses all the 46 isolates sequenced to date split into three main groups, which correlated to a certain extend with their geographic origin. Modelled serological properties showed that all the new isolates belong to one serotype.
Energy Technology Data Exchange (ETDEWEB)
Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)
2017-09-01
We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.
Characterisation of silent and active genes for a variable large protein of Borrelia recurrentis
Directory of Open Access Journals (Sweden)
Scragg Ian G
2002-10-01
Full Text Available Abstract Background We report the characterisation of the variable large protein (vlp gene expressed by clinical isolate A1 of Borrelia recurrentis; the agent of the life-threatening disease louse-borne relapsing fever. Methods The major vlp protein of this isolate was characterised and a DNA probe created. Use of this together with standard molecular methods was used to determine the location of the vlp1B. recurrentis A1 gene in both this and other isolates. Results This isolate was found to carry silent and expressed copies of the vlp1B. recurrentis A1 gene on plasmids of 54 kbp and 24 kbp respectively, whereas a different isolate, A17, had only the silent vlp1B. recurrentis A17 on a 54 kbp plasmid. Silent and expressed vlp1 have identical mature protein coding regions but have different 5' regions, both containing different potential lipoprotein leader sequences. Only one form of vlp1 is transcribed in the A1 isolate of B. recurrentis, yet both 5' upstream sequences of this vlp1 gene possess features of bacterial promoters. Conclusion Taken together these results suggest that antigenic variation in B. recurrentis may result from recombination of variable large and small protein genes at the junction between lipoprotein leader sequence and mature protein coding region. However, this hypothetical model needs to be validated by further identification of expressed and silent variant protein genes in other B. recurrentis isolates.
Ning, Hong-Rui; Huang, Si-Yang; Wang, Jin-Lei; Xu, Qian-Ming; Zhu, Xing-Quan
2015-06-01
Toxoplasma gondii is a eukaryotic parasite of the phylum Apicomplexa, which infects all warm-blood animals, including humans. In the present study, we examined sequence variation in dense granule 20 (GRA20) genes among T. gondii isolates collected from different hosts and geographical regions worldwide. The complete GRA20 genes were amplified from 16 T. gondii isolates using PCR, sequence were analyzed, and phylogenetic reconstruction was analyzed by maximum parsimony (MP) and maximum likelihood (ML) methods. The results showed that the complete GRA20 gene sequence was 1,586 bp in length among all the isolates used in this study, and the sequence variations in nucleotides were 0-7.9% among all strains. However, removing the type III strains (CTG, VEG), the sequence variations became very low, only 0-0.7%. These results indicated that the GRA20 sequence in type III was more divergence. Phylogenetic analysis of GRA20 sequences using MP and ML methods can differentiate 2 major clonal lineage types (type I and type III) into their respective clusters, indicating the GRA20 gene may represent a novel genetic marker for intraspecific phylogenetic analyses of T. gondii.
Sequencing intractable DNA to close microbial genomes.
Directory of Open Access Journals (Sweden)
Richard A Hurt
Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Sequencing Intractable DNA to Close Microbial Genomes
Energy Technology Data Exchange (ETDEWEB)
Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL
2012-01-01
Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Noisy: Identification of problematic columns in multiple sequence alignments
Directory of Open Access Journals (Sweden)
Grünewald Stefan
2008-06-01
Full Text Available Abstract Motivation Sequence-based methods for phylogenetic reconstruction from (nucleic acid sequence data are notoriously plagued by two effects: homoplasies and alignment errors. Large evolutionary distances imply a large number of homoplastic sites. As most protein-coding genes show dramatic variations in substitution rates that are not uncorrelated across the sequence, this often leads to a patchwork pattern of (i phylogenetically informative and (ii effectively randomized regions. In highly variable regions, furthermore, alignment errors accumulate resulting in sometimes misleading signals in phylogenetic reconstruction. Results We present here a method that, based on assessing the distribution of character states along a cyclic ordering of the taxa, allows the identification of phylogenetically uninformative homoplastic sites in a multiple sequence alignment. Removal of these sites appears to improve the performance of phylogenetic reconstruction algorithms as measured by various indices of "tree quality". In particular, we obtain more stable trees due to the exclusion of phylogenetically incompatible sites that most likely represent strongly randomized characters. Software The computer program noisy implements this approach. It can be employed to improving phylogenetic reconstruction capability with quite a considerable success rate whenever (1 the average bootstrap support obtained from the original alignment is low, and (2 there are sufficiently many taxa in the data set – at least, say, 12 to 15 taxa. The software can be obtained under the GNU Public License from http://www.bioinf.uni-leipzig.de/Software/noisy/.
Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.
2001-01-01
A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in
Zarzycki, C.; Jablonowski, C.
2013-12-01
Using General Circulation Models (GCMs) to resolve sub-synoptic features in climate simulations has traditionally been difficult due to a multitude of atmospheric processes operating at subgrid scales requiring significant parameterization. For example, at traditional GCM horizontal grid resolutions of 50-300 km, tropical cyclones are generally under-resolved. This paper explores a novel variable-resolution global modeling approach that allows for high spatial resolutions in areas of interest, such as low-latitude ocean basins where tropical cyclogenesis occurs. Such multi-resolution GCM designs allow for targeted use of computing resources at the regional level while maintaining a globally-continuous model domain and may serve to bridge the gap between GCMs with uniform grids and boundary-forced limited area models. A statically-nested, variable-resolution option has recently been introduced into the Community Atmosphere Model's (CAM) Spectral Element (SE) dynamical core. A 110 km CAM-SE grid with a 28 km nest over the Atlantic Ocean has been coupled to land, ocean, and ice components within the Community Earth System Model (CESM). We present the results of a multi-decadal climate simulation using Atmospheric Model Intercomparison Project (AMIP) protocols, which force the model with historical sea surface temperatures and airborne chemical species. To investigate whether refinement improves the representation of tropical cyclones, we compare Atlantic storm statistics to observations with specific focus paid to intensity profiles and track densities. The resolution dependance of both cyclone structure and objective detection between refined and unrefined basins is explored. In addition, we discuss the potential impact of using variable-resolution grids on the large-scale synoptic interannual variability by comparing refined grid simulations to reanalysis data as well as an unrefined, globally-uniform CAM-SE simulation with identical forcing. We also evaluate the
Silva, Carlos Batista; Silva, Maria Elisa Siqueira; Ambrizzi, Tércio
2017-07-01
This paper investigates possible linear relationships between climate, hydrology, and oceanic surface variability in the Pantanal region (in South America's central area), over interannual and interdecadal time ranges. In order to verify the mentioned relations, lagged correlation analysis and linear adjustment between river discharge at the Pantanal region and sea surface temperature were used. Composite analysis for atmospheric fields, air humidity flux divergence, and atmospheric circulation at low and high levels, for the period between 1970 and 2003, was analyzed. Results suggest that the river discharge in the Pantanal region is linearly associated with interdecadal and interannual oscillations in the Pacific and Atlantic oceans, making them good predictors to continental hydrological variables. Considering oceanic areas, 51 % of the annual discharge in the Pantanal region can be linearly explained by mean sea surface temperature (SST) in the Subtropical North Pacific, Tropical North Pacific, Extratropical South Pacific, and Extratropical North Atlantic over the period. Considering a forecast approach in seasonal scale, 66 % of the monthly discharge variance in Pantanal, 3 months ahead of SST, is explained by the oceanic variables, providing accuracy around 65 %. Annual discharge values in the Pantanal region are strongly related to the Pacific Decadal Oscillation (PDO) variability (with 52 % of linear correlation), making it possible to consider an interdecadal variability and a consequent subdivision of the whole period in three parts: 1st (1970-1977), 2nd (1978-1996), and 3rd (1997-2003) subperiods. The three subperiods coincide with distinct PDO phases: negative, positive, and negative, respectively. Convergence of humidity flux at low levels and the circulation pattern at high levels help to explain the drier and wetter subperiods. During the wetter 2nd subperiod, the air humidity convergence at low levels is much more evident than during the other two
White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.
2013-01-01
The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.
Wang, Yan; Liu, Guo-Hua; Li, Jia-Yuan; Xu, Min-Jun; Ye, Yong-Gang; Zhou, Dong-Hui; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan
2013-02-01
This study examined sequence variation in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 5 (nad5) and cytochrome b (cytb), among Trichuris ovis isolates from different hosts in Guangdong Province, China. A portion of the cox1 (pcox1), nad5 (pnad5) and cytb (pcytb) genes was amplified separately from individual whipworms by PCR, and was subjected to sequencing from both directions. The size of the sequences of pcox1, pnad5 and pcytb was 618, 240 and 464 bp, respectively. Although the intra-specific sequence variations within T. ovis were 0-0.8% for pcox1, 0-0.8% for pnad5 and 0-1.9% for pcytb, the inter-specific sequence differences among members of the genus Trichuris were significantly higher, being 24.3-26.5% for pcox1, 33.7-56.4% for pnad5 and 24.8-26.1% for pcytb, respectively. Phylogenetic analyses using combined sequences of pcox1, pnad5 and pcytb, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), indicated that all of the T. ovis isolates grouped together with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA sequences among T. ovis isolates from different hosts, and have implications for studying molecular epidemiology and population genetics of T. ovis.
Climate variability and wine quality over Portuguese regions
Gouveia, Célia M.; Gani, Érico A.; Liberato, Margarida L. R.
2015-04-01
characterized in each region by high/low quality wines. Finally, we also investigated how climate variability is related to DOC wine quality for different regions using North Atlantic Oscillation (NAO) index. Results reveal a strong dependence of wine quality for all regions on maximum temperature and precipitation during spring and summer (the growing season) as expected. However the role of temperature on wine quality seems to be distinct among the diverse regions probably due to their different climate zoning. Moreover, it is shown that the differences associated with high/low quality wine are in agreement with different synoptic fields patterns. Our results suggest that this type of analysis may be used in developing a tool that may help anticipating a vintage/high quality year, based on already available seasonal climate outlooks. Santo F.E., de Lima M.I.P., Ramos A.M., Trigo R.M., Trends in seasonal surface air temperature in mainland Portugal, since 1941, International Journal Climatolology, 34: 1814-1837, doi: 10.1002/joc.3803 (2014) de Lima M.I.P., Santo F.E., Ramos A.M. , Trigo, R.M., Trends and correlations in annual extreme precipitation indices for mainland Portugal, 1941-2007, Theoretical and Applied Climatology, DOI:10.1007/s00704-013-1079-6 (2014) Acknowledgements: This work was partially supported by national funds through FCT (Fundação para a Ciência e a Tecnologia, Portugal) under project QSECA (PTDC/AAGGLO/4155/2012).
Unified Deep Learning Architecture for Modeling Biology Sequence.
Wu, Hongjie; Cao, Chengyuan; Xia, Xiaoyan; Lu, Qiang
2017-10-09
Prediction of the spatial structure or function of biological macromolecules based on their sequence remains an important challenge in bioinformatics. When modeling biological sequences using traditional sequencing models, characteristics, such as long-range interactions between basic units, the complicated and variable output of labeled structures, and the variable length of biological sequences, usually lead to different solutions on a case-by-case basis. This study proposed the use of bidirectional recurrent neural networks based on long short-term memory or a gated recurrent unit to capture long-range interactions by designing the optional reshape operator to adapt to the diversity of the output labels and implementing a training algorithm to support the training of sequence models capable of processing variable-length sequences. Additionally, the merge and pooling operators enhanced the ability to capture short-range interactions between basic units of biological sequences. The proposed deep-learning model and its training algorithm might be capable of solving currently known biological sequence-modeling problems through the use of a unified framework. We validated our model on one of the most difficult biological sequence-modeling problems currently known, with our results indicating the ability of the model to obtain predictions of protein residue interactions that exceeded the accuracy of current popular approaches by 10% based on multiple benchmarks.
Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.
2013-01-01
Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Simple sequence repeat (SSR)-based genetic variability among ...
African Journals Online (AJOL)
The objective of this study was to compare if simple sequence repeat (SSR) markers could correctly identify peanut genotypes with difference in specific leaf weight (SLW) and relative water content (RWC). Four peanut genotypes and two water regimes (FC and 1/3 available water; 1/3 AW) were arranged in factorial ...
Regions identity between the genome of vertebrates and non-retroviral families of insect viruses
Directory of Open Access Journals (Sweden)
Fan Gaowei
2011-11-01
Full Text Available Abstract Background The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Results Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Conclusion Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.
Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.
Directory of Open Access Journals (Sweden)
You-Wang Lu
Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.
Espin‐Garcia, Osvaldo; Craiu, Radu V.
2017-01-01
ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496
Some aspects of regional flow of variable-density groundwater in crystalline basement rock of Sweden
International Nuclear Information System (INIS)
Voss, C.I.; Andersson, Johan
1991-12-01
The distribution of saltwaters in the Baltic shield in Sweden is consistent with ongoing but incomplete Holocene flushing and depends on the geometry and connectivity of conductive structures at both regional and local scales, and on the surface topography. Numerical simulation of regional variable-density fluid flow during Holocene land-rise and coastal regression shows that the existence of any old saltwater, whether derived from submarine recharge in regions below Sweden's highest post-glacial coastline or geochemical processes, is an indication either of slow fluid movements through the bedrock over long times, or of long travel distances through fracture systems before arriving at measurement points. During the land-rise period, regional flow is not affected by the variable density of fluids in the upper few kilometers of the shield and the topography of the water table is the only driving force. The spatial distribution of meteoric flushing water and pre-Holocene waters may be complex, with the possibility of relatively fresh water in fracture zones below salty units even at depths of a few kilometers. The domination of the topographic driving force implies that deep saltwater is not necessarily stagnant, and significant saltwater flows may be expected to occur in well-connected horizons even at depth. Local topography variation and fracture zone location combine to create a complex flow field in which local topographic driving forces extend to considerable depth in some areas, whereas regional topographic forces predominate in others. Thus, a pattern may be difficult to discern in measurements of the regional saltwater distribution, although it is clear that the coastal region is the major zone of discharge for deeper pre-Holocene fluids. During the land-rise period, regional flow equilibrates with changing climatic conditions and coastal positions, while the distribution of flushing water and older waters lags and will perpetually change between successive
Zarzycki, C. M.; Gettelman, A.; Callaghan, P.
2017-12-01
Accurately predicting weather extremes such as precipitation (floods and droughts) and temperature (heat waves) requires high resolution to resolve mesoscale dynamics and topography at horizontal scales of 10-30km. Simulating such resolutions globally for climate scales (years to decades) remains computationally impractical. Simulating only a small region of the planet is more tractable at these scales for climate applications. This work describes global simulations using variable-resolution static meshes with multiple dynamical cores that target the continental United States using developmental versions of the Community Earth System Model version 2 (CESM2). CESM2 is tested in idealized, aquaplanet and full physics configurations to evaluate variable mesh simulations against uniform high and uniform low resolution simulations at resolutions down to 15km. Different physical parameterization suites are also evaluated to gauge their sensitivity to resolution. Idealized variable-resolution mesh cases compare well to high resolution tests. More recent versions of the atmospheric physics, including cloud schemes for CESM2, are more stable with respect to changes in horizontal resolution. Most of the sensitivity is due to sensitivity to timestep and interactions between deep convection and large scale condensation, expected from the closure methods. The resulting full physics model produces a comparable climate to the global low resolution mesh and similar high frequency statistics in the high resolution region. Some biases are reduced (orographic precipitation in the western United States), but biases do not necessarily go away at high resolution (e.g. summertime JJA surface Temp). The simulations are able to reproduce uniform high resolution results, making them an effective tool for regional climate studies and are available in CESM2.
Zhao, Jianmin; Kang, Longli; Bian, Liqiang; La, Zong
2008-10-01
To analyze the sequence polymorphisms of mitochondrial DNA HVR I and HVR II in Tibetan population in Changdu area of Tibet. mtDNAs obtained from 97 unrelated individuals were amplified and directly sequenced. One hundred and eleven variable sites were identified, including nucleotide transitions, transversions, insertions and deletions. In HVR I region (nt16024-nt16365), sixty-eight polymorphic sites and 92 haplotypes were observed, and the genetic diversity was 0.9985. In HVR II region (nt73-nt340), forty-three polymorphic sites and 91 haplotypes were detected, and the genetic diversity was 0.9882. The random match probability of HVR I and HVR II regions were 0.0120 and 0.0118, respectively. When the sequence analysis of HVR I and HVR II regions were combined, ninety-seven different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0103. There are some unique polymorphic loci in the Changdu Tibetan population. The results suggest that there are significant difference in the genetic structure in the mitochondrial DNA D-loop region between Changdu Tibetans and other Asian populations and Caucasians. Sequence polymorphism in mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.
Anti-DNA antibodies: Sequencing, cloning, and expression
Energy Technology Data Exchange (ETDEWEB)
Barry, M.M.
1992-01-01
To gain some insight into the mechanism of systemic lupus erythematosus, and the interactions involved in proteins binding to DNA four anti-DNA antibodies have been investigated. Two of the antibodies, Hed 10 and Jel 242, have previously been prepared from female NZB/NZW mice which develop an autoimmune disease resembling human SLE. The remaining two antibodies, Jel 72 and Jel 318, have previously been produced via immunization of C57BL/6 mice. The isotypes of the four antibodies investigated in this thesis were determined by an enzyme-linked-immunosorbent assay. All four antibodies contained [kappa] light chains and [gamma]2a heavy chains except Jel 318 which contains a [gamma]2b heavy chain. The complete variable regions of the heavy and light chains of these four antibodies were sequenced from their respective mRNAs. The gene segments and variable gene families expressed in each antibody were identified. Analysis of the genes used in the autoimmune anti-DNA antibodies and those produced by immunization indicated no obvious differences to account for their different origins. Examination of the amino acid residues present in the complementary-determining regions of these four antibodies indicates a preference for aromatic amino acids. Jel 72 and Jel 242 contain three arginine residues in the third complementary-determining region. A single-chain Fv and the variable region of the heavy chain of Hed 10 were expressed in Escherichia coli. Expression resulted in the production of a 26,000 M[sub r] protein and a 15,000 M[sub r] protein. An immunoblot indicated that the 26,000 M[sub r] protein was the Fv for Hed 10, while the 15,000 M[sub r] protein was shown to bind poly (dT). The contribution of the heavy chain to DNA binding was assessed.
Bejerman, Nicolás; Giolitti, Fabián; Trucco, Verónica; de Breuil, Soledad; Dietzgen, Ralf G; Lenardon, Sergio
2016-07-01
Alfalfa dwarf disease, probably caused by synergistic interactions of mixed virus infections, is a major and emergent disease that threatens alfalfa production in Argentina. Deep sequencing of diseased alfalfa plant samples from the central region of Argentina resulted in the identification of a new virus genome resembling enamoviruses in sequence and genome structure. Phylogenetic analysis suggests that it is a new member of the genus Enamovirus, family Luteoviridae. The virus is tentatively named "alfalfa enamovirus 1" (AEV-1). The availability of the AEV-1 genome sequence will make it possible to assess the genetic variability of this virus and to construct an infectious clone to investigate its role in alfalfa dwarfism disease.
Xu, Ming-Xiang; Liu, Guo-Bin; Zhao, Yun-Ge
2011-02-01
Classical statistics methods were adopted to analyze the soil quality variability, its affecting factors, and affecting degree at a regional scale (700 km2) in the central part of hilly Loess Plateau region of China. There existed great differences in the variability of test soil quality indicators. Soil pH, structural coefficient, silt content, specific gravity, bulk density, total porosity, capillary porosity, and catalase activity were the indicators with weak variability; soil nutrients (N, P, and K) contents, CaCO3 content, cation exchange capacity (CEC), clay content, micro-aggregate mean mass diameter, aggregate mean mass diameter, water-stable aggregates, respiration rate, microbial quotient, invertase and phosphatase activities, respiratory quotient, and microbial carbon and nitrogen showed medium variation; while soil labile organic carbon and phosphorus contents, erosion-resistance, permeability coefficient, and urease activity were the indicators with strong variability. The variability of soil CaCO3, total P and K, CEC, texture, and specific gravity, etc. was correlated with topography and other environmental factors, while the variability of dynamic soil quality indicators, including soil organic matter content, nitrogen content, water-stable aggregates, permeability, microbial biomass carbon and nitrogen, enzyme activities, and respiration rate, was mainly correlated with land use type. Overall, land use pattern explained 97% of the variability of soil quality indicators in the region. It was suggested that in the evaluation of soil quality in hilly Loess Plateau region, land use type and environmental factors should be fully considered.
Directory of Open Access Journals (Sweden)
Ratan Chopra
2016-12-01
Full Text Available To test the hypothesis that the cultivated peanut species possesses almost no molecular variability, we sequenced a diverse panel of 22 Arachis accessions representing Arachis hypogaea botanical classes, A-, B-, and K- genome diploids, a synthetic amphidiploid, and a tetraploid wild species. RNASeq was performed on pools of three tissues, and de novo assembly was performed. Realignment of individual accession reads to transcripts of the cultivar OLin identified 306,820 biallelic SNPs. Among 10 naturally occurring tetraploid accessions, 40,382 unique homozygous SNPs were identified in 14,719 contigs. In eight diploid accessions, 291,115 unique SNPs were identified in 26,320 contigs. The average SNP rate among the 10 cultivated tetraploids was 0.5, and among eight diploids was 9.2 per 1000 bp. Diversity analysis indicated grouping of diploids according to genome classification, and cultivated tetraploids by subspecies. Cluster analysis of variants indicated that sequences of B genome species were the most similar to the tetraploids, and the next closest diploid accession belonged to the A genome species. A subset of 66 SNPs selected from the dataset was validated; of 782 SNP calls, 636 (81.32% were confirmed using an allele-specific discrimination assay. We conclude that substantial genetic variability exists among wild species. Additionally, significant but lesser variability at the molecular level occurs among accessions of the cultivated species. This survey is the first to report significant SNP level diversity among transcripts, and may explain some of the phenotypic differences observed in germplasm surveys. Understanding SNP variants in the Arachis accessions will benefit in developing markers for selection.
Cellular specificity of HIV-1 replication can be controlled by LTR sequences
International Nuclear Information System (INIS)
Reed-Inderbitzin, Edward; Maury, Wendy
2003-01-01
Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry
Gao, Tao; Wang, Huixia Judy; Zhou, Tianjun
2017-01-01
of precipitation extremes over monsoon regions in China (MRC). However, research on monsoon extremes in China and their associations with climate variables is limited. In this study, we examine the space-time variations of extreme precipitation across the MRC
Directory of Open Access Journals (Sweden)
Piñeyro David
2011-11-01
Full Text Available Abstract Background Telomere replication in Drosophila depends on the transposition of a domesticated retroelement, the HeT-A retrotransposon. The sequence of the HeT-A retrotransposon changes rapidly resulting in differentiated subfamilies. This pattern of sequence change contrasts with the essential function with which the HeT-A is entrusted and brings about questions concerning the extent of sequence variability, the telomere contribution of different subfamilies, and whether wild type and mutant Drosophila stocks show different HeT-A scenarios. Results A detailed study on the variability of HeT-A reveals that both the level of variability and the number of subfamilies are higher than previously reported. Comparisons between GIII, a strain with longer telomeres, and its parental strain Oregon-R indicate that both strains have the same set of HeT-A subfamilies. Finally, the presence of a highly conserved splicing pattern only in its antisense transcripts indicates a putative regulatory, functional or structural role for the HeT-A RNA. Interestingly, our results also suggest that most HeT-A copies are actively expressed regardless of which telomere and where in the telomere they are located. Conclusions Our study demonstrates how the HeT-A sequence changes much faster than previously reported resulting in at least nine different subfamilies most of which could actively contribute to telomere extension in Drosophila. Interestingly, the only significant difference observed between Oregon-R and GIII resides in the nature and proportion of the antisense transcripts, suggesting a possible mechanism that would in part explain the longer telomeres of the GIII stock.
Stereophysicochemical variability plots highlight conserved antigenic areas in Flaviviruses
Directory of Open Access Journals (Sweden)
Zhou Bin
2005-04-01
Full Text Available Abstract Background Flaviviruses, which include Dengue (DV and West Nile (WN, mutate in response to immune system pressure. Identifying escape mutants, variant progeny that replicate in the presence of neutralizing antibodies, is a common way to identify functionally important residues of viral proteins. However, the mutations typically occur at variable positions on the viral surface that are not essential for viral replication. Methods are needed to determine the true targets of the neutralizing antibodies. Results Stereophysicochemical variability plots (SVPs, 3-D images of protein structures colored according to variability, as determined by our PCPMer program, were used to visualize residues conserved in their physical chemical properties (PCPs near escape mutant positions. The analysis showed 1 that escape mutations in the flavivirus envelope protein are variable residues by our criteria and 2 two escape mutants found at the same position in many flaviviruses sit above clusters of conserved residues from different regions of the linear sequence. Conservation patterns in T-cell epitopes in the NS3- protease suggest a similar mechanism of immune system evasion. Conclusion The SVPs add another dimension to structurally defining the binding sites of neutralizing antibodies. They provide a useful aid for determining antigenically important regions and designing vaccines.
Sequencing of the Hepatitis C Virus: A Systematic Review.
Directory of Open Access Journals (Sweden)
Brendan Jacka
Full Text Available Since the identification of hepatitis C virus (HCV, viral sequencing has been important in understanding HCV classification, epidemiology, evolution, transmission clustering, treatment response and natural history. The length and diversity of the HCV genome has resulted in analysis of certain regions of the virus, however there has been little standardisation of protocols. This systematic review was undertaken to map the location and frequency of sequencing on the HCV genome in peer reviewed publications, with the aim to produce a database of sequencing primers and amplicons to inform future research. Medline and Scopus databases were searched for English language publications based on keyword/MeSH terms related to sequence analysis (9 terms or HCV (3 terms, plus "primer" as a general search term. Exclusion criteria included non-HCV research, review articles, duplicate records, and incomplete description of HCV sequencing methods. The PCR primer locations of accepted publications were noted, and purpose of sequencing was determined. A total of 450 studies were accepted from the 2099 identified, with 629 HCV sequencing amplicons identified and mapped on the HCV genome. The most commonly sequenced region was the HVR-1 region, often utilised for studies of natural history, clustering/transmission, evolution and treatment response. Studies related to genotyping/classification or epidemiology of HCV genotype generally targeted the 5'UTR, Core and NS5B regions, while treatment response/resistance was assessed mainly in the NS3-NS5B region with emphasis on the Interferon sensitivity determining region (ISDR region of NS5A. While the sequencing of HCV is generally constricted to certain regions of the HCV genome there is little consistency in the positioning of sequencing primers, with the exception of a few highly referenced manuscripts. This study demonstrates the heterogeneity of HCV sequencing, providing a comprehensive database of previously
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
Salerno, Michael; Taylor, Angela; Yang, Yang; Kuruvilla, Sujith; Ragosta, Michael; Meyer, Craig H; Kramer, Christopher M
2014-07-01
Adenosine stress cardiovascular magnetic resonance perfusion imaging can be limited by motion-induced dark-rim artifacts, which may be mistaken for true perfusion abnormalities. A high-resolution variable-density spiral pulse sequence with a novel density compensation strategy has been shown to reduce dark-rim artifacts in first-pass perfusion imaging. We aimed to assess the clinical performance of adenosine stress cardiovascular magnetic resonance using this new perfusion sequence to detect obstructive coronary artery disease. Cardiovascular magnetic resonance perfusion imaging was performed during adenosine stress (140 μg/kg per minute) and at rest on a Siemens 1.5-T Avanto scanner in 41 subjects with chest pain scheduled for coronary angiography. Perfusion images were acquired during injection of 0.1 mmol/kg Gadolinium-diethylenetriaminepentacetate at 3 short-axis locations using a saturation recovery interleaved variable-density spiral pulse sequence. Significant stenosis was defined as >50% by quantitative coronary angiography. Two blinded reviewers evaluated the perfusion images for the presence of adenosine-induced perfusion abnormalities and assessed image quality using a 5-point scale (1 [poor] to 5 [excellent]). The prevalence of obstructive coronary artery disease by quantitative coronary angiography was 68%. The average sensitivity, specificity, and accuracy were 89%, 85%, and 88%, respectively, with a positive predictive value and negative predictive value of 93% and 79%, respectively. The average image quality score was 4.4±0.7, with only 1 study with more than mild dark-rim artifacts. There was good inter-reader reliability with a κ statistic of 0.67. Spiral adenosine stress cardiovascular magnetic resonance results in high diagnostic accuracy for the detection of obstructive coronary artery disease with excellent image quality and minimal dark-rim artifacts. © 2014 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Requena Jose M
2012-04-01
Full Text Available Abstract Background The Leishmaniases are a group of clinically diverse diseases caused by parasites of the genus Leishmania. To distinguish between species is crucial for correct diagnosis and prognosis as well as for treatment decisions. Recently, sequencing of the HSP70 coding region has been applied in phylogenetic studies and for identifying of Leishmania species with excellent results. Methods In the present study, we analyzed the 3’-untranslated region (UTR of Leishmania HSP70-type I gene from 24 strains representing eleven Leishmania species in the belief that this non-coding region would have a better discriminatory capacity for species typing than coding regions. Results It was observed that there was a remarkable degree of sequence conservation in this region, even between species of the subgenus Leishmania and Viannia. In addition, the presence of many microsatellites was a common feature of the 3´-UTR of HSP70-I genes in the Leishmania genus. Finally, we constructed dendrograms based on global sequence alignments of the analyzed Leishmania species and strains, the results indicated that this particular region of HSP70 genes might be useful for species (or species complex typing, improving for particular species the discrimination capacity of phylogenetic trees based on HSP70 coding sequences. Given the large size variation of the analyzed region between the Leishmania and Viannia subgenera, direct visualization of the PCR amplification product would allow discrimination between subgenera, and a HaeIII-PCR-RFLP analysis might be used for differentiating some species within each subgenera. Conclusions Sequence and phylogenetic analyses indicated that this region, which is readily amplified using a single pair of primers from both Old and New World Leishmania species, might be useful as a molecular marker for species discrimination.
Variability in the Water Footprint of Arable Crop Production across European Regions
Directory of Open Access Journals (Sweden)
Anne Gobin
2017-02-01
Full Text Available Crop growth and yield are affected by water use during the season: the green water footprint (WF accounts for rain water, the blue WF for irrigation and the grey WF for diluting agri-chemicals. We calibrated crop yield for FAO’s water balance model “Aquacrop” at field level. We collected weather, soil and crop inputs for 45 locations for the period 1992–2012. Calibrated model runs were conducted for wheat, barley, grain maize, oilseed rape, potato and sugar beet. The WF of cereals could be up to 20 times larger than the WF of tuber and root crops; the largest share was attributed to the green WF. The green and blue WF compared favourably with global benchmark values (R2 = 0.64–0.80; d = 0.91–0.95. The variability in the WF of arable crops across different regions in Europe is mainly due to variability in crop yield ( c v ¯ = 45% and to a lesser extent to variability in crop water use ( c v ¯ = 21%. The WF variability between countries ( c v ¯ = 14% is lower than the variability between seasons ( c v ¯ = 22% and between crops ( c v ¯ = 46%. Though modelled yields increased up to 50% under sprinkler irrigation, the water footprint still increased between 1% and 25%. Confronted with drainage and runoff, the grey WF tended to overestimate the contribution of nitrogen to the surface and groundwater. The results showed that the water footprint provides a measurable indicator that may support European water governance.
Mohr, K. I.; Slayback, D. A.; Nicholls, S.; Yager, K.
2013-12-01
The Andes extend from the west coast of Colombia (10N) to the southern tip of Chile (53S). In southern Peru and Bolivia, the Central Andes is split into separate eastern and western cordilleras, with a high plateau (≥ 3000 m), the Altiplano, between them. Because 90% of the Earth's tropical mountain glaciers are located in the Central Andes, our study focuses on this region, defining its zonal extent as 7S-21S and the meridional extent as the terrain 1000 m and greater. Although intense convection occurs during the wet season in the Altiplano, it is not included in the lists of regions with frequent or the most intense convection. The scarcity of in-situ observations with sufficient density and temporal resolution to resolve individual storms or even mesoscale-organized cloud systems and documented biases in microwave-based rainfall products in poorly gauged mountainous regions have impeded the development of an extensive literature on convection and convective systems in this region. With the tropical glaciers receding at unprecedented rates, leaving seasonal precipitation as an increasingly important input to the water balance in alpine valley ecosystems and streams, understanding the nature and characteristics of the seasonal precipitation becomes increasingly important for the rural economies in this region. Previous work in analyzing precipitation in the Central Andes has emphasized interannual variability with respect to ENSO, this is the first study to focus on shorter scale variability with respect to organized convection. The present study took advantage of the University of Utah's Precipitation Features database compiled from 14 years of TRMM observations (1998-2012), supplemented by field observations of rainfall and streamflow, historical gauge data, and long-term WRF-simulations, to analyze the intraseasonal variability of precipitating systems and their relationship regional dynamical features such as the Bolivian High. Through time series and
Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W
2009-05-01
Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.
Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.
2014-09-01
Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.
Dumitrescu, Alexandru; Busuioc, Aristita
2016-04-01
EURO-CORDEX is the European branch of the international CORDEX initiative that aims to provide improved regional climate change projections for Europe. The main objective of this paper is to document the performance of the individual models in reproducing the variability of precipitation extremes in Romania. Here three EURO-CORDEX regional climate models (RCMs) ensemble (scenario RCP4.5) are analysed and inter-compared: DMI-HIRHAM5, KNMI-RACMO2.2 and MPI-REMO. Compared to previous studies, when the RCM validation regarding the Romanian climate has mainly been made on mean state and at station scale, a more quantitative approach of precipitation extremes is proposed. In this respect, to have a more reliable comparison with observation, a high resolution daily precipitation gridded data set was used as observational reference (CLIMHYDEX project). The comparison between the RCM outputs and observed grid point values has been made by calculating three extremes precipitation indices, recommended by the Expert Team on Climate Change Detection Indices (ETCCDI), for the 1976-2005 period: R10MM, annual count of days when precipitation ≥10mm; RX5DAY, annual maximum 5-day precipitation and R95P%, precipitation fraction of annual total precipitation due to daily precipitation > 95th percentile. The RCMs capability to reproduce the mean state for these variables, as well as the main modes of their spatial variability (given by the first three EOF patterns), are analysed. The investigation confirms the ability of RCMs to simulate the main features of the precipitation extreme variability over Romania, but some deficiencies in reproducing of their regional characteristics were found (for example, overestimation of the mea state, especially over the extra Carpathian regions). This work has been realised within the research project "Changes in climate extremes and associated impact in hydrological events in Romania" (CLIMHYDEX), code PN II-ID-2011-2-0073, financed by the Romanian
Directory of Open Access Journals (Sweden)
Anitha Shanmugham
Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.
Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H
2008-01-01
During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.
Hoa, T T T; Zwart, M P; Phuong, N T; de Jong, M C M; Vlak, J M
2012-11-01
White spot syndrome virus (WSSV) is the most important pathogen in shrimp farming systems worldwide including the Mekong Delta, Vietnam. The genome of WSSV is characterized by the presence of two major 'indel regions' found at ORF14/15 and ORF23/24 (WSSV-Thailand) and three regions with variable number tandem repeats (VNTR) located in ORF75, ORF94 and ORF125. In the current study, we investigated whether or not the number of repeat units in the VNTRs correlates with virus outbreak status and/or shrimp farming practice. We analysed 662 WSSV samples from individual WSSV-infected Penaeus monodon shrimp from 104 ponds collected from two important shrimp farming regions of the Mekong Delta: Ca Mau and Bac Lieu. Using this large data set and statistical analysis, we found that for ORF94 and ORF125, the mean number of repeat units (RUs) in VNTRs was significantly lower in disease outbreak ponds than in non-outbreak ponds. Although a higher mean RU number was observed in the improved-extensive system than in the rice-shrimp or semi-intensive systems, these differences were not significant. VNTR sequences are thus not only useful markers for studying WSSV genotypes and populations, but specific VNTR variants also correlate with disease outbreaks in shrimp farming systems. © 2012 Blackwell Publishing Ltd.
Sexton, E.; Thomas, A.; Delbridge, B. G.
2017-12-01
Large earthquakes often exhibit complex slip distributions and occur along non-planar fault geometries, resulting in variable stress changes throughout the region of the fault hosting aftershocks. To better discern the role of geometric discontinuities on aftershock sequences, we compare areas of enhanced and reduced Coulomb failure stress and mean stress for systematic differences in the time dependence and productivity of these aftershock sequences. In strike-slip faults, releasing structures, including stepovers and bends, experience an increase in both Coulomb failure stress and mean stress during an earthquake, promoting fluid diffusion into the region and further failure. Conversely, Coulomb failure stress and mean stress decrease in restraining bends and stepovers in strike-slip faults, and fluids diffuse away from these areas, discouraging failure. We examine spatial differences in seismicity patterns along structurally complex strike-slip faults which have hosted large earthquakes, such as the 1992 Mw 7.3 Landers, the 2010 Mw 7.2 El-Mayor Cucapah, the 2014 Mw 6.0 South Napa, and the 2016 Mw 7.0 Kumamoto events. We characterize the behavior of these aftershock sequences with the Epidemic Type Aftershock-Sequence Model (ETAS). In this statistical model, the total occurrence rate of aftershocks induced by an earthquake is λ(t) = λ_0 + \\sum_{i:t_i
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Directory of Open Access Journals (Sweden)
P. De Vita
2012-05-01
Full Text Available Thus far, studies on climate change have focused mainly on the variability of the atmospheric and surface components of the hydrologic cycle, investigating the impact of this variability on the environment, especially with respect to the risks of desertification, droughts and floods. Conversely, the impacts of climate change on the recharge of aquifers and on the variability of groundwater flow have been less investigated, especially in Mediterranean karst areas whose water supply systems depend heavily upon groundwater exploitation.
In this paper, long-term climatic variability and its influence on groundwater recharge were analysed by examining decadal patterns of precipitation, air temperature and spring discharges in the Campania region (southern Italy, coupled with the North Atlantic Oscillation (NAO.
The time series of precipitation and air temperature were gathered over 90 yr, from 1921 to 2010, using 18 rain gauges and 9 air temperature stations with the most continuous functioning. The time series of the winter NAO index and of the discharges of 3 karst springs, selected from those feeding the major aqueducts systems, were collected for the same period.
Regional normalised indexes of the precipitation, air temperature and karst spring discharges were calculated, and different methods were applied to analyse the related time series, including long-term trend analysis using smoothing numerical techniques, cross-correlation and Fourier analysis.
The investigation of the normalised indexes highlighted the existence of long-term complex periodicities, from 2 to more than 30 yr, with differences in average values of up to approximately ±30% for precipitation and karst spring discharges, which were both strongly correlated with the winter NAO index.
Although the effects of the North Atlantic Oscillation (NAO had already been demonstrated in the long-term precipitation and streamflow patterns of
Xu, Jun; Wang, Fang; Zhao, Desheng; Liu, Jiang; Su, Hong; Wang, Baolong
2018-03-30
Enterovirus 71 (EV71) is the main pathogen of hand-foot-mouth disease (HFMD) and causes several neurological complications. As new strains of EV71 are constantly discovered, it is important to understand the genomic characteristics of the viruses and the mechanism of virulence. Herein, we isolated five strains of EV71 from HFMD patients with or without neurovirulence and sequenced their whole genomes. We then performed whole genome sequence analysis of totally 36 EV71 strains. The phylogenetic analysis of the VP1 region revealed all five isolated strains are clustered into C4a of C4 subgenotype. In addition, by comparing the complete genome sequences of 36 strains, 253 variable amino acid positions were found, 14 of which were identified to be associated with neurovirulence (P < 0.05). Moreover, a similar pattern of amino acid variants combination was identified in four strains without neurovirulence, indicating this type of variant pattern might be associated with avirulence. The strains with neurovirulence appeared to be distinguished from those without neurovirulence by the variants in VP1 and P2 regions, implying VP1 and P2 are the important regions associated with neurovirulence. Indeed, 3-D modeling of VP1 and P2 regions of non-neurovirulent and neurovirulent strains revealed that the different variants resulted in different protein structures and amino acid composition of ligand binding site, which might account for their difference in neurovirulence. In summary, our study reveals 14 variable amino acid positions of VP1, P2 and P3 regions are related to the virulence and that mutations in the capsid proteins of EV71 might contribute to neurovirulence. © 2018 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
Belušić, Andreina; Prtenjak, Maja Telišman; Güttler, Ivan; Ban, Nikolina; Leutwyler, David; Schär, Christoph
2018-06-01
Over the past few decades the horizontal resolution of regional climate models (RCMs) has steadily increased, leading to a better representation of small-scale topographic features and more details in simulating dynamical aspects, especially in coastal regions and over complex terrain. Due to its complex terrain, the broader Adriatic region represents a major challenge to state-of-the-art RCMs in simulating local wind systems realistically. The objective of this study is to identify the added value in near-surface wind due to the refined grid spacing of RCMs. For this purpose, we use a multi-model ensemble composed of CORDEX regional climate simulations at 0.11° and 0.44° grid spacing, forced by the ERA-Interim reanalysis, a COSMO convection-parameterizing simulation at 0.11° and a COSMO convection-resolving simulation at 0.02° grid spacing. Surface station observations from this region and satellite QuikSCAT data over the Adriatic Sea have been compared against daily output obtained from the available simulations. Both day-to-day wind and its frequency distribution are examined. The results indicate that the 0.44° RCMs rarely outperform ERA-Interim reanalysis, while the performance of the high-resolution simulations surpasses that of ERA-Interim. We also disclose that refining the grid spacing to a few km is needed to properly capture the small-scale wind systems. Finally, we show that the simulations frequently yield the accurate angle of local wind regimes, such as for the Bora flow, but overestimate the associated wind magnitude. Finally, spectral analysis shows good agreement between measurements and simulations, indicating the correct temporal variability of the wind speed.
Lee, Jangho; Kim, Kwang-Yul
2018-02-01
CSEOF analysis is applied for the springtime (March, April, May) daily PM10 concentrations measured at 23 Ministry of Environment stations in Seoul, Korea for the period of 2003-2012. Six meteorological variables at 12 pressure levels are also acquired from the ERA Interim reanalysis datasets. CSEOF analysis is conducted for each meteorological variable over East Asia. Regression analysis is conducted in CSEOF space between the PM10 concentrations and individual meteorological variables to identify associated atmospheric conditions for each CSEOF mode. By adding the regressed loading vectors with the mean meteorological fields, the daily atmospheric conditions are obtained for the first five CSEOF modes. Then, HYSPLIT model is run with the atmospheric conditions for each CSEOF mode in order to back trace the air parcels and dust reaching Seoul. The K-means clustering algorithm is applied to identify major source regions for each CSEOF mode of the PM10 concentrations in Seoul. Three main source regions identified based on the mean fields are: (1) northern Taklamakan Desert (NTD), (2) Gobi Desert and (GD), and (3) East China industrial area (ECI). The main source regions for the mean meteorological fields are consistent with those of previous study; 41% of the source locations are located in GD followed by ECI (37%) and NTD (21%). Back trajectory calculations based on CSEOF analysis of meteorological variables identify distinct source characteristics associated with each CSEOF mode and greatly facilitate the interpretation of the PM10 variability in Seoul in terms of transportation route and meteorological conditions including the source area.
Relations between segmental and motor variability in prosodically complex nonword sequences.
Goffman, Lisa; Gerken, Louann; Lucchesi, Julie
2007-04-01
To assess how prosodic prominence and hierarchical foot structure influence segmental and articulatory aspects of speech production, specifically segmental accuracy and variability, and oral movement trajectory variability. Thirty individuals participated: 10 young adults, 10 children who are normally developing, and 10 children diagnosed with specific language impairment. Segmental error and segmental variability and movement trajectory variability were compared in low and high prosodic prominence conditions (i.e., strong and weak syllables) and in different prosodic foot structures. Between-participants findings were that both groups of children showed more segmental error and segmental variability and more movement trajectory variability than did adults. A similar within-participant pattern of results was observed for all 3 groups. Prosodic prominence influenced both segmental and motor levels of analysis, with weak syllables produced less accurately and with more lip and jaw movement trajectory variability than strong syllables. However, hierarchical foot structure affected segmental but not motor measures of speech production accuracy and variability. Motor and segmental variables were not consistently aligned. This pattern of results has clinical implications because inferences about motor variability may not directly follow from observations of segmental variability.
DEFF Research Database (Denmark)
Pilbeam, Llewellyn Howard
but unconfirmed in kimberlite sensu stricto magmas. It is here termed digestion fractional crystallisation (DFC) and it is argued that the DFC process may account for much of the global varia-bility in kimberlite compositions. The bulk rock trace element geochemistry of the Majuagaa kimberlite is used...... melts in the kimberlites sensu stricto of the Maniitsoq region to relatively more SiO2, Al2O3, FeOT, TiO2 and K2O enriched ultramafic lamprophyres of the Sarfartoq and Sisimuit regions. Simple mixing modelling supports the formation of this sequence due to variable interaction of the primary melt...
Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K
2010-03-09
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Mitochondrial DNA D-loop sequence variation among 5 maternal lines of the Zemaitukai horse breed
Directory of Open Access Journals (Sweden)
E. Gus Cothran
2005-12-01
Full Text Available Genetic variation in Zemaitukai horses was investigated using mitochondrial DNA (mtDNA sequencing. The study was performed on 421 bp of the mitochondrial DNA control region, which is known to be more variable than other sections of the mitochondrial genome. Samples from each of the remaining maternal family lines of Zemaitukai horses and three random samples for other Lithuanian (Lithuanian Heavy Draught, Zemaitukai large type and ten European horse breeds were sequenced. Five distinct haplotypes were obtained for the five Zemaitukai maternal families supporting the pedigree data. The minimal difference between two different sequence haplotypes was 6 and the maximal 11 nucleotides in Zemaitukai horse breed. A total of 20 nucleotide differences compared to the reference sequence were found in Lithuanian horse breeds. Genetic cluster analysis did not shown any clear pattern of relationship among breeds of different type.
Statistical inference of the generation probability of T-cell receptors from sequence repertoires.
Murugan, Anand; Mora, Thierry; Walczak, Aleksandra M; Callan, Curtis G
2012-10-02
Stochastic rearrangement of germline V-, D-, and J-genes to create variable coding sequence for certain cell surface receptors is at the origin of immune system diversity. This process, known as "VDJ recombination", is implemented via a series of stochastic molecular events involving gene choices and random nucleotide insertions between, and deletions from, genes. We use large sequence repertoires of the variable CDR3 region of human CD4+ T-cell receptor beta chains to infer the statistical properties of these basic biochemical events. Because any given CDR3 sequence can be produced in multiple ways, the probability distribution of hidden recombination events cannot be inferred directly from the observed sequences; we therefore develop a maximum likelihood inference method to achieve this end. To separate the properties of the molecular rearrangement mechanism from the effects of selection, we focus on nonproductive CDR3 sequences in T-cell DNA. We infer the joint distribution of the various generative events that occur when a new T-cell receptor gene is created. We find a rich picture of correlation (and absence thereof), providing insight into the molecular mechanisms involved. The generative event statistics are consistent between individuals, suggesting a universal biochemical process. Our probabilistic model predicts the generation probability of any specific CDR3 sequence by the primitive recombination process, allowing us to quantify the potential diversity of the T-cell repertoire and to understand why some sequences are shared between individuals. We argue that the use of formal statistical inference methods, of the kind presented in this paper, will be essential for quantitative understanding of the generation and evolution of diversity in the adaptive immune system.
Davis, Ronald L.; Davidson, Norman
1984-01-01
Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...
Kumari, K.; Oberheide, J.
2017-12-01
Nonmigrating tidal diagnostics of SABER temperature observations in the ionospheric dynamo region reveal a large amount of variability on time-scales of a few days to weeks. In this paper, we discuss the physical reasons for the observed short-term tidal variability using a novel approach based on Information theory and Bayesian statistics. We diagnose short-term tidal variability as a function of season, QBO, ENSO, and solar cycle and other drivers using time dependent probability density functions, Shannon entropy and Kullback-Leibler divergence. The statistical significance of the approach and its predictive capability is exemplified using SABER tidal diagnostics with emphasis on the responses to the QBO and solar cycle. Implications for F-region plasma density will be discussed.
Directory of Open Access Journals (Sweden)
Tang Liu
Full Text Available Microbial communities of activated sludge (AS play a key role in the performance of wastewater treatment processes. However, seasonal variability of microbial population in varying AS-based processes has been poorly correlated with operation of full-scale wastewater treatment systems (WWTSs. In this paper, significant seasonal variability of AS microbial communities in eight WWTSs located in the city of Guangzhou were revealed in terms of 16S rRNA-based Miseq sequencing. Furthermore, variation redundancy analysis (RDA demonstrated that the microbial community compositions closely correlated with WWTS operation parameters such as temperature, BOD, NH4+-N and TN. Consequently, support vector regression models which reasonably predicted effluent BOD, SS and TN in WWTSs were established based on microbial community compositions. This work provided an alternative tool for rapid assessment on performance of full-scale wastewater treatment plants.
Climate variability and land cover change over the North American monsoon region (Invited)
Zeng, X.; Scheftic, W. D.; Broxton, P. D.
2013-12-01
The North American Monsoon System over Mexico and southwestern United States represents a weather/climate and ecosystem coupled "macrosystem". The weather and climate affect the seasonal and interannual variability of ecosystem, while the ecosystem change affects surface energy, water, and carbon fluxes that, in turn, affect weather and climate. Furthermore, long-term weather/climate data have a much coarser horizontal resolution than the satellite land cover data. Here the North American Regional Reanalysis (NARR) data at 32 km grid spacing will be combined with various satellite remote sensing products at 1 km and/or 8 km resolution from AVHRR, MODIS, and SPOT for the period of 1982 to present. Our analysis includes: a) precipitation, wind, and precipitable water data from NARR to characterize the North American monsoon; b) land cover type, normalized difference vegetation index (NDVI), green vegetation fraction, and leaf-area index (LAI) data to characterize the seasonal and interannual variability of ecosystem; c) assessing the consistency of various satellite products; and d) testing the coherence in the weather/climate and ecosystem variability.
Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life
DEFF Research Database (Denmark)
Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J
2016-01-01
Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...
Directory of Open Access Journals (Sweden)
Ana Mansourkiaei
2016-04-01
Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.
Lee, K-E; Lee, E-J; Park, H-S
2016-08-30
Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.
Directory of Open Access Journals (Sweden)
Geoffrey Fouad
2018-06-01
New hydrological insights for the region: A set of three variables selected based on an expert assessment of factors that influence percentile flows performed similarly to larger sets of variables selected using a data-driven method. Expert assessment variables included mean annual precipitation, potential evapotranspiration, and baseflow index. Larger sets of up to 37 variables contributed little, if any, additional predictive information. Variables used to describe the distribution of basin data (e.g. standard deviation were not useful, and average values were sufficient to characterize physical and climatic basin conditions. Effectiveness of the expert assessment variables may be due to the high degree of multicollinearity (i.e. cross-correlation among additional variables. A tool is provided in the Supplementary material to predict percentile flows based on the three expert assessment variables. Future work should develop new variables with a strong understanding of the processes related to percentile flows.
Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P
2015-10-01
Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Small, R.J. [Naval Research Laboratory, Jacobs Technology, Stennis Space Center, MS (United States); University of Hawaii, International Pacific Research Center, POST 401, Honolulu, HI (United States); Xie, Shang-Ping [University of Hawaii, International Pacific Research Center, POST 401, Honolulu, HI (United States); University of Hawaii, Department of Meteorology, School of Ocean and Earth Science and Technology, Honolulu, HI (United States); Maloney, Eric D. [Colorado State University, Department of Atmospheric Science, Fort Collins, CO (United States); Szoeke, Simon P. de [Oregon State University, College of Oceanic and Atmospheric Sciences, Corvallis, OR (United States); Miyama, Toru [Frontier Research for Global Change, Yokohama (Japan)
2011-03-15
Intraseasonal variability in the eastern Pacific warm pool in summer is studied, using a regional ocean-atmosphere model, a linear baroclinic model (LBM), and satellite observations. The atmospheric component of the model is forced by lateral boundary conditions from reanalysis data. The aim is to quantify the importance to atmospheric deep convection of local air-sea coupling. In particular, the effect of sea surface temperature (SST) anomalies on surface heat fluxes is examined. Intraseasonal (20-90 day) east Pacific warm-pool zonal wind and outgoing longwave radiation (OLR) variability in the regional coupled model are correlated at 0.8 and 0.6 with observations, respectively, significant at the 99% confidence level. The strength of the intraseasonal variability in the coupled model, as measured by the variance of outgoing longwave radiation, is close in magnitude to that observed, but with a maximum located about 10 further west. East Pacific warm pool intraseasonal convection and winds agree in phase with those from observations, suggesting that remote forcing at the boundaries associated with the Madden-Julian oscillation determines the phase of intraseasonal convection in the east Pacific warm pool. When the ocean model component is replaced by weekly reanalysis SST in an atmosphere-only experiment, there is a slight improvement in the location of the highest OLR variance. Further sensitivity experiments with the regional atmosphere-only model in which intraseasonal SST variability is removed indicate that convective variability has only a weak dependence on the SST variability, but a stronger dependence on the climatological mean SST distribution. A scaling analysis confirms that wind speed anomalies give a much larger contribution to the intraseasonal evaporation signal than SST anomalies, in both model and observations. A LBM is used to show that local feedbacks would serve to amplify intraseasonal convection and the large-scale circulation. Further
Ceapa, Corina; Davids, Mark; Ritari, Jarmo; Lambert, Jolanda; Wels, Michiel; Douillard, François P; Smokvina, Tamara; de Vos, Willem M; Knol, Jan; Kleerebezem, Michiel
2016-07-02
Lactobacillus rhamnosus is a diverse Gram-positive species with strains isolated from different ecological niches. Here, we report the genome sequence analysis of 40 diverse strains of L. rhamnosus and their genomic comparison, with a focus on the variable genome. Genomic comparison of 40 L. rhamnosus strains discriminated the conserved genes (core genome) and regions of plasticity involving frequent rearrangements and horizontal transfer (variome). The L. rhamnosus core genome encompasses 2,164 genes, out of 4,711 genes in total (the pan-genome). The accessory genome is dominated by genes encoding carbohydrate transport and metabolism, extracellular polysaccharides (EPS) biosynthesis, bacteriocin production, pili production, the cas system, and the associated clustered regularly interspaced short palindromic repeat (CRISPR) loci, and more than 100 transporter functions and mobile genetic elements like phages, plasmid genes, and transposons. A clade distribution based on amino acid differences between core (shared) proteins matched with the clade distribution obtained from the presence-absence of variable genes. The phylogenetic and variome tree overlap indicated that frequent events of gene acquisition and loss dominated the evolutionary segregation of the strains within this species, which is paralleled by evolutionary diversification of core gene functions. The CRISPR-Cas system could have contributed to this evolutionary segregation. Lactobacillus rhamnosus strains contain the genetic and metabolic machinery with strain-specific gene functions required to adapt to a large range of environments. A remarkable congruency of the evolutionary relatedness of the strains' core and variome functions, possibly favoring interspecies genetic exchanges, underlines the importance of gene-acquisition and loss within the L. rhamnosus strain diversification. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Erika KULCSÁR
2010-06-01
Full Text Available I started from the assumption that there are more variables that have a significant influence on the expected number of days of staying in the Centre Development Region. To identify those variables this paper includes the analysis of variance with two variables that are not interacting, in this case the dependent variable is the question "How many days did you plan to stay in Centre Development Region?" and the independent variables are: "What is the purpose of your stay?" "What is the highest level of education?". Given that there are cases when interactions occur between variables, I also analyzed the interaction effects between the two independent variables. The paper also includes an ANOVA analysis with three variables between which interactions relationships occur. After identifying the dependency relations between the variables I found that the inclusion of the third variable, namely the "Marital status" of respondents, adds value to the model. Following the results obtained by ANOVA analysis, I identified those socio-demographic characteristics that, in my opinion, companies that operate on tourist market in the Center Development Region should consider when fundamenting marketing strategies in tourism.
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Nogueira, M.
2017-10-01
Monthly-to-decadal variability of the regional precipitation over Intertropical Convergence Zone and north-Atlantic and north-Pacific storm tracks was investigated using ERA-20C reanalysis. Satellite-based precipitation (P) and evaporation (E) climatological patterns were well reproduced by ERA-20C. Regional P and E monthly time series displayed 20% differences, but these decreased rapidly with time scale ( 10% at yearly time scales). Spectral analysis showed good scale-by-scale statistical agreement between ERA-20C and observations. Using ERA-Interim showed no improvement despite the much wider range of information assimilated (including satellites). Remarkably high Detrended Cross-Correlation Analysis coefficients (ρDCCA > 0.7 and often ρDCCA > 0.9) revealed tight links between the nonperiodic variability of P, moisture divergence (DIV), and pressure velocity (ω) at monthly-to-decadal time scales over all the wet regions. In contrast, ρDCCA was essentially nonsignificant between nonperiodic P and E or sea surface temperature (SST). Thus, the nonperiodic monthly-to-decadal variability of precipitation in these regions is almost fully controlled by dynamics and not by local E or SST (suggested by Clausius-Clapeyron relation). Analysis of regional nonperiodic standard deviations and power spectra (and respective spectral exponents, β) provided further robustness to this conclusion. Finally, clear transitions in β for P, DIV, and ω between tropical and storm track regions were found. The latter is dominated by transient storms, with energy accumulation at synoptic scales and β β values (0.2 to 0.4) were found in the tropics, implying longer-range autocorrelations and slower decreasing variability and information creation with time scale, consistent with the important forcing from internal modes of variability (e.g., El Niño-Southern Oscillation).
Climate related diseases. Current regional variability and projections to the year 2100
Directory of Open Access Journals (Sweden)
Błażejczyk Krzysztof
2018-03-01
Full Text Available The health of individuals and societies depends on different factors including atmospheric conditions which influence humans in direct and indirect ways. The paper presents regional variability of some climate related diseases (CRD in Poland: salmonellosis intoxications, Lyme boreliosis, skin cancers (morbidity and mortality, influenza, overcooling deaths, as well as respiratory and circulatory mortality. The research consisted of two stages: 1 statistical modelling basing on past data and 2 projections of CRD for three SRES scenarios of climate change (A1B, A2, B1 to the year 2100. Several simple and multiply regression models were found for the relationships between climate variables and CRD. The models were applied to project future levels of CRD. At the end of 21st century we must expect increase in: circulatory mortality, Lyme boreliosis infections and skin cancer morbidity and mortality. There is also projected decrease in: respiratory mortality, overcooling deaths and influenza infections.
Energy Technology Data Exchange (ETDEWEB)
Gutowski, William J. [Iowa State Univ., Ames, IA (United States)
2017-12-28
This project developed and applied a regional Arctic System model for enhanced decadal predictions. It built on successful research by four of the current PIs with support from the DOE Climate Change Prediction Program, which has resulted in the development of a fully coupled Regional Arctic Climate Model (RACM) consisting of atmosphere, land-hydrology, ocean and sea ice components. An expanded RACM, a Regional Arctic System Model (RASM), has been set up to include ice sheets, ice caps, mountain glaciers, and dynamic vegetation to allow investigation of coupled physical processes responsible for decadal-scale climate change and variability in the Arctic. RASM can have high spatial resolution (~4-20 times higher than currently practical in global models) to advance modeling of critical processes and determine the need for their explicit representation in Global Earth System Models (GESMs). The pan-Arctic region is a key indicator of the state of global climate through polar amplification. However, a system-level understanding of critical arctic processes and feedbacks needs further development. Rapid climate change has occurred in a number of Arctic System components during the past few decades, including retreat of the perennial sea ice cover, increased surface melting of the Greenland ice sheet, acceleration and thinning of outlet glaciers, reduced snow cover, thawing permafrost, and shifts in vegetation. Such changes could have significant ramifications for global sea level, the ocean thermohaline circulation and heat budget, ecosystems, native communities, natural resource exploration, and commercial transportation. The overarching goal of the RASM project has been to advance understanding of past and present states of arctic climate and to improve seasonal to decadal predictions. To do this the project has focused on variability and long-term change of energy and freshwater flows through the arctic climate system. The three foci of this research are: - Changes
Nóbrega de Sousa, Taís; Carvalho, Luzia Helena; Alves de Brito, Cristiana Ferreira
2011-01-01
The dependence of Plasmodium vivax on invasion mediated by Duffy binding protein (DBP) makes this protein a prime candidate for development of a vaccine. However, the development of a DBP-based vaccine might be hampered by the high variability of the protein ligand (DBP(II)), known to bias the immune response toward a specific DBP variant. Here, the hypothesis being investigated is that the analysis of the worldwide DBP(II) sequences will allow us to determine the minimum number of haplotypes (MNH) to be included in a DBP-based vaccine of broad coverage. For that, all DBP(II) sequences available were compiled and MNH was based on the most frequent nonsynonymous single nucleotide polymorphisms, the majority mapped on B and T cell epitopes. A preliminary analysis of DBP(II) genetic diversity from eight malaria-endemic countries estimated that a number between two to six DBP haplotypes (17 in total) would target at least 50% of parasite population circulating in each endemic region. Aiming to avoid region-specific haplotypes, we next analyzed the MNH that broadly cover worldwide parasite population. The results demonstrated that seven haplotypes would be required to cover around 60% of DBP(II) sequences available. Trying to validate these selected haplotypes per country, we found that five out of the eight countries will be covered by the MNH (67% of parasite populations, range 48-84%). In addition, to identify related subgroups of DBP(II) sequences we used a Bayesian clustering algorithm. The algorithm grouped all DBP(II) sequences in six populations that were independent of geographic origin, with ancestral populations present in different proportions in each country. In conclusion, in this first attempt to undertake a global analysis about DBP(II) variability, the results suggest that the development of DBP-based vaccine should consider multi-haplotype strategies; otherwise a putative P. vivax vaccine may not target some parasite populations.
Energy Technology Data Exchange (ETDEWEB)
Deque, M.; Somot, S. [Meteo-France, Centre National de Recherches Meteorologiques, CNRS/GAME, Toulouse Cedex 01 (France); Sanchez-Gomez, E. [Cerfacs/CNRS, SUC URA1875, Toulouse Cedex 01 (France); Goodess, C.M. [University of East Anglia, Climatic Research Unit, Norwich (United Kingdom); Jacob, D. [Max Planck Institute for Meteorology, Hamburg (Germany); Lenderink, G. [KNMI, Postbus 201, De Bilt (Netherlands); Christensen, O.B. [Danish Meteorological Institute, Copenhagen Oe (Denmark)
2012-03-15
Various combinations of thirteen regional climate models (RCM) and six general circulation models (GCM) were used in FP6-ENSEMBLES. The response to the SRES-A1B greenhouse gas concentration scenario over Europe, calculated as the difference between the 2021-2050 and the 1961-1990 means can be viewed as an expected value about which various uncertainties exist. Uncertainties are measured here by variance explained for temperature and precipitation changes over eight European sub-areas. Three sources of uncertainty can be evaluated from the ENSEMBLES database. Sampling uncertainty is due to the fact that the model climate is estimated as an average over a finite number of years (30) despite a non-negligible interannual variability. Regional model uncertainty is due to the fact that the RCMs use different techniques to discretize the equations and to represent sub-grid effects. Global model uncertainty is due to the fact that the RCMs have been driven by different GCMs. Two methods are presented to fill the many empty cells of the ENSEMBLES RCM x GCM matrix. The first one is based on the same approach as in FP5-PRUDENCE. The second one uses the concept of weather regimes to attempt to separate the contribution of the GCM and the RCM. The variance of the climate response is analyzed with respect to the contribution of the GCM and the RCM. The two filling methods agree that the main contributor to the spread is the choice of the GCM, except for summer precipitation where the choice of the RCM dominates the uncertainty. Of course the implication of the GCM to the spread varies with the region, being maximum in the South-western part of Europe, whereas the continental parts are more sensitive to the choice of the RCM. The third cause of spread is systematically the interannual variability. The total uncertainty about temperature is not large enough to mask the 2021-2050 response which shows a similar pattern to the one obtained for 2071-2100 in PRUDENCE. The uncertainty
Examining regional variability in work ethic within Mexico: Individual difference or shared value.
Arciniega, Luis M; Woehr, David J; Del Rincón, Germán A
2018-02-19
Despite the acceptance of work ethic as an important individual difference, little research has examined the extent to which work ethic may reflect shared environmental or socio-economic factors. This research addresses this concern by examining the influence of geographic proximity on the work ethic experienced by 254 employees from Mexico, working in 11 different cities in the Northern, Central and Southern regions of the country. Using a sequence of complementary analyses to assess the main source of variance on seven dimensions of work ethic, our results indicate that work ethic is most appropriately considered at the individual level. © 2018 International Union of Psychological Science.
16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments
DEFF Research Database (Denmark)
Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain
2015-01-01
communities in meat and the meat process environment with special focus on the Enterobacteriaceae family as a subpopulation comprising enteropathogens including Salmonella. Samples were analyzed by a nested PCR approach combined with MiSeq® Illumina®16S DNA sequencing and standardized culture methods as cross...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same...
Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C
1993-01-01
DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)
Arambula, Diego; Wong, Wenge; Medhekar, Bob A; Guo, Huatao; Gingery, Mari; Czornyj, Elizabeth; Liu, Minghsun; Dey, Sanghamitra; Ghosh, Partho; Miller, Jeff F
2013-05-14
Diversity-generating retroelements (DGRs) are a unique family of retroelements that confer selective advantages to their hosts by facilitating localized DNA sequence evolution through a specialized error-prone reverse transcription process. We characterized a DGR in Legionella pneumophila, an opportunistic human pathogen that causes Legionnaires disease. The L. pneumophila DGR is found within a horizontally acquired genomic island, and it can theoretically generate 10(26) unique nucleotide sequences in its target gene, legionella determinent target A (ldtA), creating a repertoire of 10(19) distinct proteins. Expression of the L. pneumophila DGR resulted in transfer of DNA sequence information from a template repeat to a variable repeat (VR) accompanied by adenine-specific mutagenesis of progeny VRs at the 3'end of ldtA. ldtA encodes a twin-arginine translocated lipoprotein that is anchored in the outer leaflet of the outer membrane, with its C-terminal variable region surface exposed. Related DGRs were identified in L. pneumophila clinical isolates that encode unique target proteins with homologous VRs, demonstrating the adaptability of DGR components. This work characterizes a DGR that diversifies a bacterial protein and confirms the hypothesis that DGR-mediated mutagenic homing occurs through a conserved mechanism. Comparative bioinformatics predicts that surface display of massively variable proteins is a defining feature of a subset of bacterial DGRs.
Prijović, M; Skaljac, M; Drobnjaković, T; Zanić, K; Perić, P; Marčić, D; Puizina, J
2014-06-01
The greenhouse whitefly Trialeurodes vaporariorum Westwood, 1856 (Hemiptera: Aleyrodidae) is an invasive and highly polyphagous phloem-feeding pest of vegetables and ornamentals. Trialeurodes vaporariorum causes serious damage due to direct feeding and transmits several important plant viruses. Excessive use of insecticides has resulted in significantly reduced levels of susceptibility of various T. vaporariorum populations. To determine the genetic variability within and among populations of T. vaporariorum from Serbia and to explore their genetic relatedness with other T. vaporariorum populations, we analysed the mitochondrial cytochrome c oxidase I (COI) sequences of 16 populations from Serbia and six neighbouring countries: Montenegro (three populations), Macedonia (one population) and Croatia (two populations), for a total of 198 analysed specimens. A low overall level of sequence divergence and only five variable nucleotides and six haplotypes were found. The most frequent haplotype, H1, was identified in all Serbian populations and in all specimens from distant localities in Croatia and Macedonia. The COI sequence data that was retrieved from GenBank and the data from our study indicated that H1 is the most globally widespread T. vaporariorum haplotype. A lack of spatial genetic structure among the studied T. vaporariorum populations, as well as two demographic tests that we performed (Tajima's D value and Fu's Fs statistics), indicate a recent colonisation event and population growth. Phylogenetic analyses of the COI haplotypes in this study and other T. vaporariorum haplotypes that were retrieved from GenBank were performed using Bayesian inference and median-joining (MJ) network analysis. Two major haplogroups with only a single unique nucleotide difference were found: haplogroup 1 (containing the five Serbian haplotypes and those previously identified in India, China, the Netherlands, the United Kingdom, Morocco, Reunion and the USA) and haplogroup 3
Wang, J.; Nathan, R.; Horne, A.
2017-12-01
Traditional approaches to characterize water-dependent ecosystem outcomes in response to flow have been based on time-averaged hydrological indicators, however there is increasing recognition for the need to characterize ecological processes that are highly dependent on the sequencing of flow conditions (i.e. floods and droughts). This study considers the representation of flow regimes when considering assessment of ecological outcomes, and in particular, the need to account for sequencing and variability of flow. We conducted two case studies - one in the largely unregulated Ovens River catchment and one in the highly regulated Murray River catchment (both located in south-eastern Australia) - to explore the importance of flow sequencing to the condition of a typical long-lived ecological asset in Australia, the River Red Gum forests. In the first, the Ovens River case study, the implications of representing climate change using different downscaling methods (annual scaling, monthly scaling, quantile mapping, and weather generator method) on the sequencing of flows and resulting ecological outcomes were considered. In the second, the Murray River catchment, sequencing within a historic drought period was considered by systematically making modest adjustments on an annual basis to the hydrological records. In both cases, the condition of River Red Gum forests was assessed using an ecological model that incorporates transitions between ecological conditions in response to sequences of required flow components. The results of both studies show the importance of considering how hydrological alterations are represented when assessing ecological outcomes. The Ovens case study showed that there is significant variation in the predicted ecological outcomes when different downscaling techniques are applied. Similarly, the analysis in the Murray case study showed that the drought as it historically occurred provided one of the best possible outcomes for River Red Gum
[Analysis of COX1 sequences of Taenia isolates from four areas of Guangxi].
Yang, Yi-Chao; Ou-Yang, Yi; Su, Ai-Rong; Wan, Xiao-Ling; Li, Shu-Lin
2012-06-01
To analyze the COX1 sequences of Taenia isolates from four areas of Guangxi Zhuang Autonomous Region, and to understand the distribution of Taenia asiatica in Guangxi. Patients with taeniasis in Luzhai, Rongshui, Tiandong and Sanjiang in Guangxi were treated by deworming, and the Taenia isolates were collected. Cyclooxygenase-1 (COX1) sequences of these isolates were amplified by PCR, and the PCR products were sequenced by T-A clone sequencing. The homogeneities and genetic distances were calculated and analyzed, and the phylogenic trees were constructed by some softwares. Meanwhile, the COX1 sequences of the isolates from the 4 areas were compared separately with the sequences of Taenia species in GenBank. The COX1 sequence of the 5 Taenia isolates collected had the same length of 444 bp. There were 5 variable positions between the Luzhai isolate and Taenia asiatica, the homogeneity was 98.87% and their genetic distance was 0.011. The phylogenetic tree analysis revealed that the Luzhai isolate and Taenia asiatica locating at the same node had a close relationship. The homogeneity between Rongshui isolate A and Taenia solium was 100%, while the homogeneity of Rongshui isolate B with Taeniasis saginata and Taenia asiatica were 98.20% and 96.17%, respectively. The homogeneities of the Tiandong and Sanjiang isolates with Taenia solium were 99.55% and 96.40%, respectively, and the genetic distances were 0.005 and 0.037, respectively. The homogeneity between the Luzhai isolate and Taeniasis saginate was 96.40%. Taenia asiatica exists in Luzhai and Taenia solium and Taenia saginata coexist in Rongshui, Guangxi Zhuang Autonomous Region.
Schroeer, K.; Kirchengast, G.
2018-06-01
Potential increases in extreme rainfall induced hazards in a warming climate have motivated studies to link precipitation intensities to temperature. Increases exceeding the Clausius-Clapeyron (CC) rate of 6-7%/°C-1 are seen in short-duration, convective, high-percentile rainfall at mid latitudes, but the rates of change cease or revert at regionally variable threshold temperatures due to moisture limitations. It is unclear, however, what these findings mean in term of the actual risk of extreme precipitation on a regional to local scale. When conditioning precipitation intensities on local temperatures, key influences on the scaling relationship such as from the annual cycle and regional weather patterns need better understanding. Here we analyze these influences, using sub-hourly to daily precipitation data from a dense network of 189 stations in south-eastern Austria. We find that the temperature sensitivities in the mountainous western region are lower than in the eastern lowlands. This is due to the different weather patterns that cause extreme precipitation in these regions. Sub-hourly and hourly intensities intensify at super-CC and CC-rates, respectively, up to temperatures of about 17 °C. However, we also find that, because of the regional and seasonal variability of the precipitation intensities, a smaller scaling factor can imply a larger absolute change in intensity. Our insights underline that temperature precipitation scaling requires careful interpretation of the intent and setting of the study. When this is considered, conditional scaling factors can help to better understand which influences control the intensification of rainfall with temperature on a regional scale.
Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren
2002-06-01
Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.
Ultradeep Pyrosequencing of Hepatitis C Virus Hypervariable Region 1 in Quasispecies Analysis
Directory of Open Access Journals (Sweden)
Kamila Caraballo Cortés
2013-01-01
Full Text Available Genetic variability of hepatitis C virus (HCV determines pathogenesis of infection, including viral persistence and resistance to treatment. The aim of the present study was to characterize HCV genetic heterogeneity within a hypervariable region 1 (HVR1 of a chronically infected patient by ultradeep 454 sequencing strategy. Three independent sequencing error correction methods were applied. First correction method (Method I implemented cut-off for genetic variants present in less than 1%. In the second method (Method II, a condition to call a variant was bidirectional coverage of sequencing reads. Third method (Method III used Short Read Assembly into Haplotypes (ShoRAH program. After the application of these three different algorithms, HVR1 population consisted of 8, 40, and 186 genetic haplotypes. The most sensitive method was ShoRAH, allowing to reconstruct haplotypes constituting as little as 0.013% of the population. The most abundant genetic variant constituted only 10.5%. Seventeen haplotypes were present in a frequency above 1%, and there was wide dispersion of the population into very sparse haplotypes. Our results indicate that HCV HVR1 heterogeneity and quasispecies population structure may be reconstructed by ultradeep sequencing. However, credible analysis requires proper reconstruction methods, which would distinguish sequencing error from real variability in vivo.
Time Variability of the Dust Sublimation Zones in Pre-Main Sequence Disk Systems
Sitko, Michael L.; Carpenter, W. J.; Grady, C. A.; Russel, R. W.; Lynch, D. K.; Rudy, R. J.; Mazuk, S. M.; Venturini, C. C.; Kimes, R. L.; Beerman, L. C.;
2007-01-01
The dust sublimation zone (DSZ) is the region of pre-main sequence (PMS) disks where dust grains most easily anneal, sublime, and condense out of the gas. Because of this, it is a location where crystalline material may be enhanced and redistributed throughout the rest of the disk. A decade-long program to monitor the thermal emission of the grains located in this region demonstrates that large changes in emitted flux occur in many systems. Changes in the thermal emission between 3 and 13.5 microns were observed in HD 31648 (MWC 480), HD 163296 (MWC 275), and DG Tau. This emission is consistent with it being produced at the DSZ, where the transition from a disk of gas to one of gas+dust occurs. In the case of DG Tau, the outbursts were accompanied by increased emission on the 10 micron silicate band on one occasion, while on another occasion it went into absorption. This requires lofting of the material above the disk into the line of sight. Such changes will affect the determination of the inner disk structure obtained through interferometry measurements, and this has been confirmed in the case of HD 163296. Cyclic variations in the heating of the DSZ will lead to the annealing of large grains, the sublimation of smaller grains, possibly followed by re-condensation as the zone enters a cooling phase. Lofting of dust above the disk plane, and outward acceleration by stellar winds and radiation pressure, can re-distribute the processed material to cooler regions of the disk, where cometesimals form. This processing is consistent with the detection of the preferential concentration of large crystalline grains in the inner few AU of PMS disks using interferometric spectroscopy with the VLTI.
Khanshour, Anas M; Cothran, Ernest Gus
2013-09-13
Maternal inheritance is an essential point in Arabian horse population genetics and strains classification. The mitochondrial DNA (mtDNA) sequencing is a highly informative tool to investigate maternal lineages. We sequenced the whole mtDNA D-loop of 251 Arabian horses to study the genetic diversity and phylogenetic relationships of Arabian populations and to examine the traditional strain classification system that depends on maternal family lines using native Arabian horses from the Middle East. The variability in the upstream region of the D-loop revealed additional differences among the haplotypes that had identical sequences in the hypervariable region 1 (HVR1). While the American-Arabians showed relatively low diversity, the Syrian population was the most variable and contained a very rare and old haplogroup. The Middle Eastern horses had major genetic contributions to the Western horses and there was no clear pattern of differentiation among all tested populations. Our results also showed that several individuals from different strains shared a single haplotype, and individuals from a single strain were represented in clearly separated haplogroups. The whole mtDNA D-loop sequence was more powerful for analysis of the maternal genetic diversity in the Arabian horses than using just the HVR1. Native populations from the Middle East, such as Syrians, could be suggested as a hot spot of genetic diversity and may help in understanding the evolution history of the Arabian horse breed. Most importantly, there was no evidence that the Arabian horse breed has clear subdivisions depending on the traditional maternal based strain classification system.
Karimi, Zahra; Ahmadi, Ali; Najafi, Ali; Ranjbar, Reza
2018-01-01
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci as novel and applicable regions in prokaryotic genomes have gained great attraction in the post genomics era. These unique regions are diverse in number and sequence composition in different pathogenic bacteria and thereby can be a suitable candidate for molecular epidemiology and genotyping studies. Results:Furthermore, the arrayed structure of CRISPR loci (several unique repeats spaced with the variable sequence) and associated cas genes act as an active prokaryotic immune system against viral replication and conjugative elements. This property can be used as a tool for RNA editing in bioengineering studies. The aim of this review was to survey some details about the history, nature, and potential applications of CRISPR arrays in both genetic engineering and bacterial genotyping studies.
International Nuclear Information System (INIS)
Telesca, Luciano; Amatulli, Giuseppe; Lasaponara, Rosa; Lovallo, Michele; Santulli, Adriano
2007-01-01
The spatial clustering of the forest-fire sequence (1997-2003) of Liguria Region (Northern Italy) has been analysed using the correlation dimension D C , calculated by means of the correlation integral method. Studying the variations of this parameter, we recognize the presence of a strong variability of the spatial clusterization, modulated by seasonal cycles. Furthermore, we found that the larger fires (size >400 ha) mark the cyclic behaviour of the correlation dimension
Directory of Open Access Journals (Sweden)
Graner Andreas
2008-10-01
Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular
X. Li; S. Zhong; X. Bian; W.E. Heilman
2010-01-01
The climate and climate variability of low-level winds over the Great Lakes region of the United States is examined using 30 year (1979-2008) wind records from the recently released North American Regional Reanalysis (NARR), a three-dimensional, high-spatial and temporal resolution, and dynamically consistent climate data set. The analyses focus on spatial distribution...
Barth, A.P.; Wooden, J.L.; Miller, David; Howard, Keith A.; Fox, Lydia; Schermer, Elizabeth R.; Jacobson, C.E.
2017-01-01
Intrusive rock sequences in the central and eastern Mojave Desert segment of the Jurassic Cordilleran arc of the western United States record regional and temporal variations in magmas generated during the second prominent pulse of Mesozoic continental arc magmatism. U/Pb zircon ages provide temporal control for describing variations in rock and zircon geochemistry that reflect differences in magma source components. These source signatures are discernible through mixing and fractionation processes associated with magma ascent and emplacement. The oldest well-dated Jurassic rocks defining initiation of the Jurassic pulse are a 183 Ma monzodiorite and a 181 Ma ignimbrite. Early to Middle Jurassic intrusive rocks comprising the main stage of magmatism include two high-K calc-alkalic groups: to the north, the deformed 183–172 Ma Fort Irwin sequence and contemporaneous rocks in the Granite and Clipper Mountains, and to the south, the 167–164 Ma Bullion sequence. A Late Jurassic suite of shoshonitic, alkali-calcic intrusive rocks, the Bristol Mountains sequence, ranges in age from 164 to 161 Ma and was emplaced as the pulse began to wane. Whole-rock and zircon trace-element geochemistry defines a compositionally coherent Jurassic arc with regional and secular variations in melt compositions. The arc evolved through the magma pulse by progressively greater input of old cratonic crust and lithospheric mantle into the arc magma system, synchronous with progressive regional crustal thickening.
Srinivasan, Mridula; Dassis, Mariela; Benn, Emily; Stockin, Karen A.; Martinez, Emmanuelle; Machovsky-Capuska, Gabriel E.
2015-05-01
Few studies have investigated regional and natural climate variability on seabird populations using ocean reanalysis datasets (e.g. Simple Ocean Data Assimilation (SODA)) that integrate atmospheric information to supplement ocean observations and provide improved estimates of ocean conditions. Herein we use a non-systematic dataset on Australasian gannets (Morus serrator) from 2001 to 2009 to identify potential connections between Gannet Sightings Per Unit Effort (GSPUE) and climate and oceanographic variability in a region of known importance for breeding seabirds, the Hauraki Gulf (HG), New Zealand. While no statistically significant relationships between GSPUE and global climate indices were determined, there was a significant correlation between GSPUE and regional SST anomaly for HG. Also, there appears to be a strong link between global climate indices and regional climate in the HG. Further, based on cross-correlation function coefficients and lagged multiple regression models, we identified potential leading and lagging climate variables, and climate variables but with limited predictive capacity in forecasting future GSPUE. Despite significant inter-annual variability and marginally cooler SSTs since 2001, gannet sightings appear to be increasing. We hypothesize that at present underlying physical changes in the marine ecosystem may be insufficient to affect supply of preferred gannet main prey (pilchard Sardinops spp.), which tolerate a wide thermal range. Our study showcases the potential scientific value of lengthy non-systematic data streams and when designed properly (i.e., contain abundance, flock size, and spatial data), can yield useful information in climate impact studies on seabirds and other marine fauna. Such information can be invaluable for enhancing conservation measures for protected species in fiscally constrained research environments.
Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun
2014-06-01
To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.
Mulder, V.L.; Bruin, de S.; Schaepman, M.E.
2013-01-01
This paper presents a sparse, remote sensing-based sampling approach making use of conditioned Latin Hypercube Sampling (cLHS) to assess variability in soil properties at regional scale. The method optimizes the sampling scheme for a defined spatial population based on selected covariates, which are
Directory of Open Access Journals (Sweden)
Marie-Pier Poulin-Lord
2014-01-01
Conclusion: Different and possibly unique strategies are used by each autistic individual. That enhanced variability in localization of activations in the autistic group is found in regions typically more variable in non-autistics raises the possibility that autism involves an enhancement and/or an alteration of typical plasticity mechanisms. The current study also highlights the necessity to verify, in fMRI studies involving autistic people, that hypoactivation at the group level does not result from each individual successfully completing a task using a unique brain allocation, even by comparison to his own group.
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Rainfall variability, climate change and regionalization in the African monsoon region
International Nuclear Information System (INIS)
Fontaine, Bernard; Roucou, Pascal; Vigaud, Nicolas; Camara, Moctar; Konare, Abdourahamane; Sanda, Seidou Ibrah; Diedhiou, Arona; Janicot, Serge
2012-01-01
This summary recalls some results at the end of the AMMA international experiment (2003-2010) in terms of variability of the African monsoon at the intra-seasonal to multi-decadal scales and of climate prospective. The results confirmed the weight of surface temperatures and marine tele-connections for inter-annual and decadal fluctuations and stressed the importance of atmospheric variability. They also described the dominant modes of intra-seasonal variability as their interactions with the surface. Several hypotheses involving memory effects related to soil water and vegetation, particularly in boreal spring and autumn have also been made. Prospective analysis from model output suggests rainfall surplus around 2050 over the Eastern-central Sahel and relative deficit to the West. Phase 2 of AMMA (2010-2020) will focus more on aspects that have a high social impact in direct collaboration with meteorological services predictability, prediction scores, operational indicators, evaluation of the part of anthropogenic forcing in the current and future variations. (authors)
Energy Technology Data Exchange (ETDEWEB)
Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C
2010-11-29
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitate the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected
Energy Technology Data Exchange (ETDEWEB)
Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others
1995-04-01
In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.
Directory of Open Access Journals (Sweden)
Nicolás Sarute
Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.
Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina
2013-01-01
Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.
Wei, Wei; Davis, Robert E; Jomantiene, Rasa; Zhao, Yan
2008-08-19
Mobile genetic elements have impacted biological evolution across all studied organisms, but evidence for a role in evolutionary emergence of an entire phylogenetic clade has not been forthcoming. We suggest that mobile element predation played a formative role in emergence of the phytoplasma clade. Phytoplasmas are cell wall-less bacteria that cause numerous diseases in plants. Phylogenetic analyses indicate that these transkingdom parasites descended from Gram-positive walled bacteria, but events giving rise to the first phytoplasma have remained unknown. Previously we discovered a unique feature of phytoplasmal genome architecture, genes clustered in sequence-variable mosaics (SVMs), and suggested that such structures formed through recurrent, targeted attacks by mobile elements. In the present study, we discovered that cryptic prophage remnants, originating from phages in the order Caudovirales, formed SVMs and comprised exceptionally large percentages of the chromosomes of 'Candidatus Phytoplasma asteris'-related strains OYM and AYWB, occupying nearly all major nonsyntenic sections, and accounting for most of the size difference between the two genomes. The clustered phage remnants formed genomic islands exhibiting distinct DNA physical signatures, such as dinucleotide relative abundance and codon position GC values. Phytoplasma strain-specific genes identified as phage morons were located in hypervariable regions within individual SVMs, indicating that prophage remnants played important roles in generating phytoplasma genetic diversity. Because no SVM-like structures could be identified in genomes of ancestral relatives including Acholeplasma spp., we hypothesize that ancient phage attacks leading to SVM formation occurred after divergence of phytoplasmas from acholeplasmas, triggering evolution of the phytoplasma clade.
Nguyen, H.; Hendon, H. H.; Lim, E.-P.; Boschat, G.; Maloney, E.; Timbal, B.
2018-01-01
In order to understand the regional impacts of variations in the extent of the Hadley circulation in the Southern Hemisphere, regional Hadley circulations are defined in three sectors centered on the main tropical heat sources over Africa, Asia-Pacific (Maritime Continent) and the Americas. These regional circulations are defined by computing a streamfunction from the divergent component of the meridional wind. A major finding from this study is that year-to-year variability in the extent of the hemispheric Hadley circulation in the Southern Hemisphere is primarily governed by variations of the extent of the Hadley circulation in the Asia-Pacific sector, especially during austral spring and summer when there is little co-variability with the African sector, and the American sector exhibits an out of phase behavior. An expanded Hadley circulation in the Southern Hemisphere (both hemispherically and in the Asia-Pacific sector) is associated with La Niña conditions and a poleward expansion of the tropical wet zone in the Asia-Pacific sector. While La Niña also promotes expansion in the American and African sectors during austral winter, these tropical conditions tend to promote contraction in the two sectors during austral summer as a result of compensating convergence over the Americas and Africa sectors: a process driven by variations in the Walker circulation and Rossby wave trains emanating from the tropical Indian Ocean.
Tao, F.; Rötter, R.
2013-12-01
Many studies on global climate report that climate variability is increasing with more frequent and intense extreme events1. There are quite large uncertainties from both the plot- and regional-scale models in simulating impacts of climate variability and extremes on crop development, growth and productivity2,3. One key to reducing the uncertainties is better exploitation of experimental data to eliminate crop model deficiencies and develop better algorithms that more adequately capture the impacts of extreme events, such as high temperature and drought, on crop performance4,5. In the present study, in a first step, the inter-annual variability in wheat yield and climate from 1971 to 2012 in Finland was investigated. Using statistical approaches the impacts of climate variability and extremes on wheat growth and productivity were quantified. In a second step, a plot-scale model, WOFOST6, and a regional-scale crop model, MCWLA7, were calibrated and validated, and applied to simulate wheat growth and yield variability from 1971-2012. Next, the estimated impacts of high temperature stress, cold damage, and drought stress on crop growth and productivity based on the statistical approaches, and on crop simulation models WOFOST and MCWLA were compared. Then, the impact mechanisms of climate extremes on crop growth and productivity in the WOFOST model and MCWLA model were identified, and subsequently, the various algorithm and impact functions were fitted against the long-term crop trial data. Finally, the impact mechanisms, algorithms and functions in WOFOST model and MCWLA model were improved to better simulate the impacts of climate variability and extremes, particularly high temperature stress, cold damage and drought stress for location-specific and large area climate impact assessments. Our studies provide a good example of how to improve, in parallel, the plot- and regional-scale models for simulating impacts of climate variability and extremes, as needed for
Variability in large-scale wind power generation: Variability in large-scale wind power generation
Energy Technology Data Exchange (ETDEWEB)
Kiviluoma, Juha [VTT Technical Research Centre of Finland, Espoo Finland; Holttinen, Hannele [VTT Technical Research Centre of Finland, Espoo Finland; Weir, David [Energy Department, Norwegian Water Resources and Energy Directorate, Oslo Norway; Scharff, Richard [KTH Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Söder, Lennart [Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Menemenlis, Nickie [Institut de recherche Hydro-Québec, Montreal Canada; Cutululis, Nicolaos A. [DTU, Wind Energy, Roskilde Denmark; Danti Lopez, Irene [Electricity Research Centre, University College Dublin, Dublin Ireland; Lannoye, Eamonn [Electric Power Research Institute, Palo Alto California USA; Estanqueiro, Ana [LNEG, Laboratorio Nacional de Energia e Geologia, UESEO, Lisbon Spain; Gomez-Lazaro, Emilio [Renewable Energy Research Institute and DIEEAC/EDII-AB, Castilla-La Mancha University, Albacete Spain; Zhang, Qin [State Grid Corporation of China, Beijing China; Bai, Jianhua [State Grid Energy Research Institute Beijing, Beijing China; Wan, Yih-Huei [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA; Milligan, Michael [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA
2015-10-25
The paper demonstrates the characteristics of wind power variability and net load variability in multiple power systems based on real data from multiple years. Demonstrated characteristics include probability distribution for different ramp durations, seasonal and diurnal variability and low net load events. The comparison shows regions with low variability (Sweden, Spain and Germany), medium variability (Portugal, Ireland, Finland and Denmark) and regions with higher variability (Quebec, Bonneville Power Administration and Electric Reliability Council of Texas in North America; Gansu, Jilin and Liaoning in China; and Norway and offshore wind power in Denmark). For regions with low variability, the maximum 1 h wind ramps are below 10% of nominal capacity, and for regions with high variability, they may be close to 30%. Wind power variability is mainly explained by the extent of geographical spread, but also higher capacity factor causes higher variability. It was also shown how wind power ramps are autocorrelated and dependent on the operating output level. When wind power was concentrated in smaller area, there were outliers with high changes in wind output, which were not present in large areas with well-dispersed wind power.
Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei
2013-10-01
The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.
Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang
2018-04-01
This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
New tool to assemble repetitive regions using next-generation sequencing data
Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz
2017-08-01
The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.
Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q; Karchin, Rachel
2015-10-01
Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single
Directory of Open Access Journals (Sweden)
Noushin Niknafs
2015-10-01
Full Text Available Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8 can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
Guzman-Morales, J.; Gershunov, A.
2015-12-01
Santa Ana Winds (SAWs) are an integral feature of the regional climate of Southern California/Northern Baja California region. In spite of their tremendous episodic impacts on the health, economy and mood of the region, climate-scale behavior of SAW is poorly understood. In the present work, we identify SAWs in mesoscale dynamical downscaling of a global reanalysis product and construct an hourly SAW catalogue spanning 65 years. We describe the long-term SAW climatology at relevant time-space resolutions, i.e, we developed local and regional SAW indices and analyse their variability on hourly, daily, annual, and multi-decadal timescales. Local and regional SAW indices are validated with available anemometer observations. Characteristic behaviors are revealed, e.g. the SAW intensity-duration relationship. At interdecadal time scales, we find that seasonal SAW activity is sensitive to prominent large-scale low-frequency modes of climate variability rooted in the tropical and north Pacific ocean-atmosphere system that are also known to affect the hydroclimate of this region. Lastly, we do not find any long-term trend in SAW frequency and intensity as previously reported. Instead, we identify a significant long-term trend in SAW behavior whereby contribution of extreme SAW events to total seasonal SAW activity has been increasing at the expense of moderate events. These findings motivate further investigation on SAW evolution in future climate and its impact on wildfires.
Directory of Open Access Journals (Sweden)
Kelly Alexsandra Souza Menezes
Full Text Available ABSTRACT Legume-rhizobia symbiosis is a cross-kingdom association that results in large amounts of nitrogen incorporated in food webs. For the Brazilian semi-arid region, data on genetic variability and symbiotic efficiency of Papilionoidae rhizobial communities are very scarce. The aim of this study was to evaluate the genetic variability and the symbiotic efficiency of eight rhizobial isolates obtained from “mulungu” (Erythrina velutina Willd. nodules. For 16S rRNA gene sequencing, the genomic DNA was extracted using a commercial kit, amplified with universal primers, and subjected to sequencing reactions. For the isolate ESA 71, PCR amplifications for nodC and nodA genes were attempted. Rhizobial efficiency was assessed by two greenhouse experiments. The first assay was carried out under gnotobiotic conditions, with sterile sand as a substrate; the second experiment was conducted in a non-sterile soil. For both experiments, the inoculation treatments consisted of a single inoculation of each isolate, in addition to a treatment with Bradyrhizobium elkanii BR 5609 as a reference strain. Furthermore, two non-inoculated control treatments, supplied and not supplied with mineral N, were also evaluated. Bacterial identification indicated that both α and β-rhizobia could be found in “mulungu” root nodules. Three isolates where classified within the Rhizobium genus, four bacteria belonged to Bradyrhizobium and one isolate clustered with Burkholderia. Positive amplification of an intragenic fragment of the nodA gene using a primer set to β-rhizobia could be found for ESA 71 (Burkholderia. All bacterial isolates were effective in colonizing “mulungu” roots. In the first experiment, all inoculated treatments and N fertilization increased the N concentration in “mulungu” shoot tissues. For total N in the shoots, the isolates ESA 70, ESA 72, and ESA 75 stood out. In the non-sterile substrate experiment, the isolates ESA 70, ESA 71, ESA
Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson
2017-06-01
Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.
Energy Technology Data Exchange (ETDEWEB)
Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.
1983-01-01
The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study.
International Nuclear Information System (INIS)
Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.
1983-01-01
The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study
Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming
2013-03-01
Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.
Khan, Firdos; Pilz, Jürgen
2016-04-01
South Asia is under the severe impacts of changing climate and global warming. The last two decades showed that climate change or global warming is happening and the first decade of 21st century is considered as the warmest decade over Pakistan ever in history where temperature reached 53 0C in 2010. Consequently, the spatio-temporal distribution and intensity of precipitation is badly effected and causes floods, cyclones and hurricanes in the region which further have impacts on agriculture, water, health etc. To cope with the situation, it is important to conduct impact assessment studies and take adaptation and mitigation remedies. For impact assessment studies, we need climate variables at higher resolution. Downscaling techniques are used to produce climate variables at higher resolution; these techniques are broadly divided into two types, statistical downscaling and dynamical downscaling. The target location of this study is the monsoon dominated region of Pakistan. One reason for choosing this area is because the contribution of monsoon rains in this area is more than 80 % of the total rainfall. This study evaluates a statistical downscaling technique which can be then used for downscaling climatic variables. Two statistical techniques i.e. quantile regression and copula modeling are combined in order to produce realistic results for climate variables in the area under-study. To reduce the dimension of input data and deal with multicollinearity problems, empirical orthogonal functions will be used. Advantages of this new method are: (1) it is more robust to outliers as compared to ordinary least squares estimates and other estimation methods based on central tendency and dispersion measures; (2) it preserves the dependence among variables and among sites and (3) it can be used to combine different types of distributions. This is important in our case because we are dealing with climatic variables having different distributions over different meteorological
Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo
2017-02-01
Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Directory of Open Access Journals (Sweden)
Marta Brozynska
Full Text Available Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina and Ion Torrent (Life Technology sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare. Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.
Gao, Tao
2017-07-19
The El Niño-Southern Oscillation (ENSO), Indian Ocean Dipole (IOD), North Atlantic Oscillation (NAO), Atlantic Multidecadal Oscillation (AMO) and Pacific decadal oscillation (PDO) are well understood to be major drivers for the variability of precipitation extremes over monsoon regions in China (MRC). However, research on monsoon extremes in China and their associations with climate variables is limited. In this study, we examine the space-time variations of extreme precipitation across the MRC, and assess the time-varying influences of the climate drivers using Bayesian dynamic linear regression and their combined nonlinear effects through fitting generalized additive models. Results suggest that the central-east and south China is dominated by less frequent but more intense precipitation. Extreme rainfalls show significant positive trends, coupled with a significant decline of dry spells, indicating an increasing chance of occurrence of flood-induced disasters in the MRC during 1960–2014. Majority of the regional indices display some abrupt shifts during the 1990s. The influences of climate variables on monsoon extremes exhibit distinct interannual or interdecadal variations. IOD, ENSO and AMO have strong impacts on monsoon and extreme precipitation, especially during the 1990s, which is generally consistent with the abrupt shifts in precipitation regimes around this period. Moreover, ENSO mainly affects moderate rainfalls and dry spells, while IOD has a more significant impact on precipitation extremes. These findings could be helpful for improving the forecasting of monsoon extremes in China and the evaluations of climate models.
Directory of Open Access Journals (Sweden)
Loïc Coutte
2009-02-01
Full Text Available Lyme disease Borrelia can infect humans and animals for months to years, despite the presence of an active host immune response. The vls antigenic variation system, which expresses the surface-exposed lipoprotein VlsE, plays a major role in B. burgdorferi immune evasion. Gene conversion between vls silent cassettes and the vlsE expression site occurs at high frequency during mammalian infection, resulting in sequence variation in the VlsE product. In this study, we examined vlsE sequence variation in B. burgdorferi B31 during mouse infection by analyzing 1,399 clones isolated from bladder, heart, joint, ear, and skin tissues of mice infected for 4 to 365 days. The median number of codon changes increased progressively in C3H/HeN mice from 4 to 28 days post infection, and no clones retained the parental vlsE sequence at 28 days. In contrast, the decrease in the number of clones with the parental vlsE sequence and the increase in the number of sequence changes occurred more gradually in severe combined immunodeficiency (SCID mice. Clones containing a stop codon were isolated, indicating that continuous expression of full-length VlsE is not required for survival in vivo; also, these clones continued to undergo vlsE recombination. Analysis of clones with apparent single recombination events indicated that recombinations into vlsE are nonselective with regard to the silent cassette utilized, as well as the length and location of the recombination event. Sequence changes as small as one base pair were common. Fifteen percent of recovered vlsE variants contained "template-independent" sequence changes, which clustered in the variable regions of vlsE. We hypothesize that the increased frequency and complexity of vlsE sequence changes observed in clones recovered from immunocompetent mice (as compared with SCID mice is due to rapid clearance of relatively invariant clones by variable region-specific anti-VlsE antibody responses.
Phylogeny and variability of Colletotrichum truncatum associated with soybean anthracnose in Brazil.
Rogério, F; Ciampi-Guillardi, M; Barbieri, M C G; Bragança, C A D; Seixas, C D S; Almeida, A M R; Massola, N S
2017-02-01
Fungal diseases are among the main factors limiting high yields of soybean crop. Colletotrichum isolates from soybean plants with anthracnose symptoms were studied from different regions and time periods in Brazil using molecular, morphological and pathogenic analyses. Bayesian phylogenetic inference of GAPDH, HIS3 and ITS-5.8S rDNA sequences, the morphologies of colony and conidia, and inoculation tests on seeds and seedlings were performed. All isolates clustered only with Colletotrichum truncatum species in three well-separated clusters. Intraspecific genetic diversity revealed 27 distinct haplotypes in 51 fungal isolates; some of which were identical to C. truncatum sequences from other regions around the world, while others were related to alternative hosts. Conidia were falcate, hyaline, unicellular and aseptate, formed in acervuli, with variable dimensions. Despite being pathogenic to seedlings by both inoculation methods, variation was observed in the aggressiveness of the tested isolates, which was not correlated with genetic variation. The identification of C. truncatum in the sampled isolates was evidenced as being the only causal agent of soybean anthracnose in Brazil until 2007, with relevant genetic, morphological and pathogenic variability as well as a broad geographical origin. The wide distribution of the predominant C. truncatum haplotype indicated the existence of a highly efficient mechanism of pathogen dispersal over long distances, reinforcing the role of seeds as the primary source of disease inoculum. The characterization and distribution of Colletotrichum species in soybean-producing regions in Brazil is fundamental for understanding the disease epidemiology and for ensuring effective control strategies against anthracnose. © 2016 The Society for Applied Microbiology.
Restriction analysis of genetic variability of Polish isolates of Tomato black ring virus.
Jończyk, Magdalena; Borodynko, Natasza; Pospieszny, Henryk
2004-01-01
Several different isolates of Tomato black ring virus (TBRV) have been collected in Poland from cucumber, tomato, potato and black locust plants. Biological tests showed some differences in the range of infected plants and the type of symptoms, which was the basis for selection of seven the most biologically different TBRV isolates. According to the sequence of TBRV-MJ, several primer pairs were designed and almost the entire sequence of both genomic RNAs was amplified. The RT-PCR products derived from all tested TBRV isolates were digested by restriction enzymes. On the basis of the restriction patterns, the variable and the conserved regions of the TBRV genome were defined and the relationships between the Polish TBRV isolates established.
International Nuclear Information System (INIS)
Menzies, J.W.; Laing, J.D.
1988-01-01
This paper presents the results of a photometric programme aimed at improving the UBV(RI)sub(c) standard sequences in the Harvard F regions and in the Small and Large Magellanic Clouds. Magnitudes and colours are given for 99 stars, and they are compared with the current values which were obtained or compiled by a previous author. (author)
Direct, rapid RNA sequence analysis
International Nuclear Information System (INIS)
Peattie, D.A.
1987-01-01
The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions
Directory of Open Access Journals (Sweden)
Lotta Vikström
2017-05-01
Full Text Available Historically, little is known about whether and to what extent disabled people found work and formed families. To fill this gap, this study analyses the life course trajectories of both disabled and non-disabled individuals, between the ages of 15 and 33, from the Sundsvall region in Sweden during the nineteenth century. Having access to micro-data that report disabilities in a population of 8,874 individuals from the parish registers digitised by the Demographic Data Base, Umeå University, we employ sequence analysis on a series of events that are expected to occur in life of young adults: getting a job, marrying and becoming a parent, while also taking into account out-migration and death. Through this method we obtain a holistic picture of the life course of disabled people. Main findings show that their trajectories did not include work or family to the same extent as those of non-disabled people. Secondary findings concerning migration and mortality indicate that the disabled rarely out-migrated from the region, and they suffered from premature deaths. To our knowledge this is the first study to employ sequence analysis on a substantially large number of cases to provide demographic evidence of how disability shaped human trajectories in the past during an extended period of life. Accordingly, we detail our motivation for this method, describe our analytical approach, and discuss the advantages and disadvantages associated with sequence analysis for our case study.
Directory of Open Access Journals (Sweden)
García-Aguirre Laura
2007-08-01
Full Text Available Abstract Background Hepatitis C virus (HCV has been the subject of intense research and clinical investigation as its major role in human disease has emerged. Previous and recent studies have suggested a diversification of type 1 HCV in the South American region. The degree of genetic variation among HCV strains circulating in Bolivia and Colombia is currently unknown. In order to get insight into these matters, we performed a phylogenetic analysis of HCV 5' non-coding region (5'NCR sequences from strains isolated in Bolivia, Colombia and Uruguay, as well as available comparable sequences of HCV strains isolated in South America. Methods Phylogenetic tree analysis was performed using the neighbor-joining method under a matrix of genetic distances established under the Kimura-two parameter model. Signature pattern analysis, which identifies particular sites in nucleic acid alignments of variable sequences that are distinctly representative relative to a background set, was performed using the method of Korber & Myers, as implemented in the VESPA program. Prediction of RNA secondary structures was done by the method of Zuker & Turner, as implemented in the mfold program. Results Phylogenetic tree analysis of HCV strains isolated in the South American region revealed the presence of a distinct genetic lineage inside genotype 1. Signature pattern analysis revealed that the presence of this lineage is consistent with the presence of a sequence signature in the 5'NCR of HCV strains isolated in South America. Comparisons of these results with the ones found for Europe or North America revealed that this sequence signature is characteristic of the South American region. Conclusion Phylogentic analysis revealed the presence of a sequence signature in the 5'NCR of type 1 HCV strains isolated in South America. This signature is frequent enough in type 1 HCV populations circulating South America to be detected in a phylogenetic tree analysis as a distinct
Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.
2018-03-01
One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Gutmann, E. D.; Ikeda, K.; Deser, C.; Rasmussen, R.; Clark, M. P.; Arnold, J. R.
2015-12-01
The uncertainty in future climate predictions is as large or larger than the mean climate change signal. As such, any predictions of future climate need to incorporate and quantify the sources of this uncertainty. One of the largest sources comes from the internal, chaotic, variability within the climate system itself. This variability has been approximated using the 30 ensemble members of the Community Earth System Model (CESM) large ensemble. Here we examine the wet and dry end members of this ensemble for cool-season precipitation in the Colorado Rocky Mountains with a set of high-resolution regional climate model simulations. We have used the Weather Research and Forecasting model (WRF) to simulate the periods 1990-2000, 2025-2035, and 2070-2080 on a 4km grid. These simulations show that the broad patterns of change depicted in CESM are inherited by the high-resolution simulations; however, the differences in the height and location of the mountains in the WRF simulation, relative to the CESM simulation, means that the location and magnitude of the precipitation changes are very different. We further show that high-resolution simulations with the Intermediate Complexity Atmospheric Research model (ICAR) predict a similar spatial pattern in the change signal as WRF for these ensemble members. We then use ICAR to examine the rest of the CESM Large Ensemble as well as the uncertainty in the regional climate model due to the choice of physics parameterizations.
DEFF Research Database (Denmark)
Lannergård, Jonas; Gustafsson, Caj Ulrik Mattias; Waldemarsson, Johan
2011-01-01
Sequence variation of antigenic proteins allows pathogens to evade antibody attack. The variable protein commonly includes a hypervariable region (HVR), which represents a key target for antibodies and is therefore predicted to be immunodominant. To understand the mechanism(s) of antibody evasion...
Directory of Open Access Journals (Sweden)
Miri eMichaeli
2012-12-01
Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.
Directory of Open Access Journals (Sweden)
Walid Mottawea
2018-05-01
Full Text Available Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella. In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S. Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.
[Complete genome sequencing and sequence analysis of BCG Tice].
Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli
2012-10-04
The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.
Assessing Regional Scale Variability in Extreme Value Statistics Under Altered Climate Scenarios
Energy Technology Data Exchange (ETDEWEB)
Brunsell, Nathaniel [Univ. of Kansas, Lawrence, KS (United States); Mechem, David [Univ. of Kansas, Lawrence, KS (United States); Ma, Chunsheng [Wichita State Univ., KS (United States)
2015-02-20
Recent studies have suggested that low-frequency modes of climate variability can significantly influence regional climate. The climatology associated with extreme events has been shown to be particularly sensitive. This has profound implications for droughts, heat waves, and food production. We propose to examine regional climate simulations conducted over the continental United States by applying a recently developed technique which combines wavelet multi–resolution analysis with information theory metrics. This research is motivated by two fundamental questions concerning the spatial and temporal structure of extreme events. These questions are 1) what temporal scales of the extreme value distributions are most sensitive to alteration by low-frequency climate forcings and 2) what is the nature of the spatial structure of variation in these timescales? The primary objective is to assess to what extent information theory metrics can be useful in characterizing the nature of extreme weather phenomena. Specifically, we hypothesize that (1) changes in the nature of extreme events will impact the temporal probability density functions and that information theory metrics will be sensitive these changes and (2) via a wavelet multi–resolution analysis, we will be able to characterize the relative contribution of different timescales on the stochastic nature of extreme events. In order to address these hypotheses, we propose a unique combination of an established regional climate modeling approach and advanced statistical techniques to assess the effects of low-frequency modes on climate extremes over North America. The behavior of climate extremes in RCM simulations for the 20th century will be compared with statistics calculated from the United States Historical Climatology Network (USHCN) and simulations from the North American Regional Climate Change Assessment Program (NARCCAP). This effort will serve to establish the baseline behavior of climate extremes, the
Eichmann, Cordula; Parson, Walther
2008-09-01
The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.
Automated sequence-specific protein NMR assignment using the memetic algorithm MATCH
International Nuclear Information System (INIS)
Volk, Jochen; Herrmann, Torsten; Wuethrich, Kurt
2008-01-01
MATCH (Memetic Algorithm and Combinatorial Optimization Heuristics) is a new memetic algorithm for automated sequence-specific polypeptide backbone NMR assignment of proteins. MATCH employs local optimization for tracing partial sequence-specific assignments within a global, population-based search environment, where the simultaneous application of local and global optimization heuristics guarantees high efficiency and robustness. MATCH thus makes combined use of the two predominant concepts in use for automated NMR assignment of proteins. Dynamic transition and inherent mutation are new techniques that enable automatic adaptation to variable quality of the experimental input data. The concept of dynamic transition is incorporated in all major building blocks of the algorithm, where it enables switching between local and global optimization heuristics at any time during the assignment process. Inherent mutation restricts the intrinsically required randomness of the evolutionary algorithm to those regions of the conformation space that are compatible with the experimental input data. Using intact and artificially deteriorated APSY-NMR input data of proteins, MATCH performed sequence-specific resonance assignment with high efficiency and robustness
DEFF Research Database (Denmark)
Bartels, Mette Damkjaer; Petersen, Andreas; Worning, Peder
2014-01-01
spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and ...
Conservation and variability of dengue virus proteins: implications for vaccine design.
Directory of Open Access Journals (Sweden)
Asif M Khan
2008-08-01
Full Text Available Genetic variation and rapid evolution are hallmarks of RNA viruses, the result of high mutation rates in RNA replication and selection of mutants that enhance viral adaptation, including the escape from host immune responses. Variability is uneven across the genome because mutations resulting in a deleterious effect on viral fitness are restricted. RNA viruses are thus marked by protein sites permissive to multiple mutations and sites critical to viral structure-function that are evolutionarily robust and highly conserved. Identification and characterization of the historical dynamics of the conserved sites have relevance to multiple applications, including potential targets for diagnosis, and prophylactic and therapeutic purposes.We describe a large-scale identification and analysis of evolutionarily highly conserved amino acid sequences of the entire dengue virus (DENV proteome, with a focus on sequences of 9 amino acids or more, and thus immune-relevant as potential T-cell determinants. DENV protein sequence data were collected from the NCBI Entrez protein database in 2005 (9,512 sequences and again in 2007 (12,404 sequences. Forty-four (44 sequences (pan-DENV sequences, mainly those of nonstructural proteins and representing approximately 15% of the DENV polyprotein length, were identical in 80% or more of all recorded DENV sequences. Of these 44 sequences, 34 ( approximately 77% were present in >or=95% of sequences of each DENV type, and 27 ( approximately 61% were conserved in other Flaviviruses. The frequencies of variants of the pan-DENV sequences were low (0 to approximately 5%, as compared to variant frequencies of approximately 60 to approximately 85% in the non pan-DENV sequence regions. We further showed that the majority of the conserved sequences were immunologically relevant: 34 contained numerous predicted human leukocyte antigen (HLA supertype-restricted peptide sequences, and 26 contained T-cell determinants identified by
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
Yang, Wan; Kominz, Michelle A.
2003-01-01
The Cisco Group on the Eastern Shelf of the Midland Basin is composed of fluvial, deltaic, shelf, shelf-margin, and slope-to-basin carbonate and siliciclastic rocks. Sedimentologic and stratigraphic analyses of 181 meter-to-decimeter-scale depositional sequences exposed in the up-dip shelf indicated that the siliciclastic and carbonate parasequences in the transgressive systems tracts (TST) are thin and upward deepening, whereas those in highstand systems tracts (HST) are thick and upward shallowing. The sequences can be subdivided into five types on the basis of principal lithofacies, and exhibit variable magnitude of facies shift corresponding to variable extents of marine transgression and regression on the shelf. The sequence stacking patterns and their regional persistence suggest a three-level sequence hierarchy controlled by eustasy, whereas local and regional changes in lithology, thickness, and sequence type, magnitude, and absence were controlled by interplay of eustasy, differential shelf subsidence, depositional topography, and pattern of siliciclastic supply. The outcropping Cisco Group is highly incomplete with an estimated 6-11% stratigraphic completeness. The average duration of deposition of the major (third-order) sequences is estimated as 67-102 ka on the up-dip shelf and increases down dip, while the average duration of the major sequence boundaries (SB) is estimated as 831-1066 ka and decreases down dip. The nondepositional and erosional hiatus on the up-dip shelf was represented by lowstand deltaic systems in the basin and slope.
International Nuclear Information System (INIS)
Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.
2003-01-01
It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant
Magnetic Field Diagnostics and Spatio-Temporal Variability of the Solar Transition Region
Peter, H.
2013-12-01
Magnetic field diagnostics of the transition region from the chromosphere to the corona faces us with the problem that one has to apply extreme-ultraviolet (EUV) spectro-polarimetry. While for the coronal diagnostics techniques already exist in the form of infrared coronagraphy above the limb and radio observations on the disk, one has to investigate EUV observations for the transition region. However, so far the success of such observations has been limited, but various current projects aim to obtain spectro-polarimetric data in the extreme UV in the near future. Therefore it is timely to study the polarimetric signals we can expect from these observations through realistic forward modeling. We employ a 3D magneto-hydrodynamic (MHD) forward model of the solar corona and synthesize the Stokes I and Stokes V profiles of C iv (1548 Å). A signal well above 0.001 in Stokes V can be expected even if one integrates for several minutes to reach the required signal-to-noise ratio, and despite the rapidly changing intensity in the model (just as in observations). This variability of the intensity is often used as an argument against transition region magnetic diagnostics, which requires exposure times of minutes. However, the magnetic field is evolving much slower than the intensity, and therefore the degree of (circular) polarization remains rather constant when one integrates in time. Our study shows that it is possible to measure the transition region magnetic field if a polarimetric accuracy on the order of 0.001 can be reached, which we can expect from planned instrumentation.
Nutz, Alexis; Schuster, Mathieu; Boës, Xavier; Rubino, Jean-Loup
2017-01-01
Lakes act as major archives for continental paleoenvironments, particularly when the evolution of lake levels over time serves as a guide for understanding regional paleohydrology and paleoclimate. In this paper, two sections from the Nachukui Formation (Turkana Depression, East African Rift System) provide a complete record of lake level variability and then paleohydrology for Lake Turkana between 1.95 and 1.72 Ma. This period corresponds to a key time during which important human evolutionary and technological innovations have occurred in East Africa and in the Turkana area. Based on sedimentary facies and sequence analyses on coastal deposits, one long-term regressive-transgressive cycle is identified between 1.95 and 1.72 Ma. Superimposed on this trend, five higher-frequency cycles of lake level change are identified between 1.87 and 1.76 Ma. Origins of these periodicities are attributed to orbital forcings. The extents of bathymetry change and shoreline migration during these periods are explored, suggesting that the period between 1.87 and 1.76 Ma was relatively dry and that climate experienced a relatively low variability. This finding differs strongly from most of the previous paleoenvironmental investigations in the region that argue high climate variability during a relatively wet period. This work emphasizes the importance of using sequence stratigraphy for analyzing lacustrine deposits.
Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.
Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V
1999-11-01
ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.
Musgrove, MaryLynn; Opsahl, Stephen P.; Mahler, Barbara J.; Herrington, Chris; Sample, Thomas; Banta, John
2016-01-01
Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO3−) loading to surface and groundwater. We investigate variability and sources of NO3− in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO3− stable isotopes (δ15N and δ18O). These data were augmented by historical data collected from 1937 to 2007. NO3− concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO3− concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO3− concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO3−. These results highlight the vulnerability of karst aquifers to NO3− contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO3−than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates that subaqueous nitrification of organic N in the aquifer, as opposed to in soils, might be a previously
Decomposing global crop yield variability
Ben-Ari, Tamara; Makowski, David
2014-11-01
Recent food crises have highlighted the need to better understand the between-year variability of agricultural production. Although increasing future production seems necessary, the globalization of commodity markets suggests that the food system would also benefit from enhanced supplies stability through a reduction in the year-to-year variability. Here, we develop an analytical expression decomposing global crop yield interannual variability into three informative components that quantify how evenly are croplands distributed in the world, the proportion of cultivated areas allocated to regions of above or below average variability and the covariation between yields in distinct world regions. This decomposition is used to identify drivers of interannual yield variations for four major crops (i.e., maize, rice, soybean and wheat) over the period 1961-2012. We show that maize production is fairly spread but marked by one prominent region with high levels of crop yield interannual variability (which encompasses the North American corn belt in the USA, and Canada). In contrast, global rice yields have a small variability because, although spatially concentrated, much of the production is located in regions of below-average variability (i.e., South, Eastern and South Eastern Asia). Because of these contrasted land use allocations, an even cultivated land distribution across regions would reduce global maize yield variance, but increase the variance of global yield rice. Intermediate results are obtained for soybean and wheat for which croplands are mainly located in regions with close-to-average variability. At the scale of large world regions, we find that covariances of regional yields have a negligible contribution to global yield variance. The proposed decomposition could be applied at any spatial and time scales, including the yearly time step. By addressing global crop production stability (or lack thereof) our results contribute to the understanding of a key
Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China
Zhao, Sufen; He, Peimin
2011-11-01
The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.
Directory of Open Access Journals (Sweden)
R. Lalitha
2018-01-01
Full Text Available The freshwater Testudine species have gained importance in recent years, as most of their population is threatened due to exploitation for delicacy and pet trade. In this regard, Lissemys punctata, a freshwater terrapin, predominantly distributed in Asian countries has gained its significance for the study. A pilot study report on mitochondrial markers (Cyt b and D-loop conducted on L. punctata species from southern Karnataka, India was presented in this investigation. A complete region spanning 1.14 kb and ∼1 kb was amplified by HotStart PCR and sequenced by Sanger sequencing. The Cyt b sequence revealed 85 substitution sites, no indels and 17 parsimony informative sites, whereas D-loop showed 189 variable sites, 51 parsimony informative sites with 5′ functional domains TAS, CSB-F, CSBs (1, 2, 3 preceding tandem repeat at 3′ end. Current data highlights the intraspecific variations in these target regions and variations validated using suitable evolutionary models points out that the overall point mutations observed in the region are transitions leading to no structural and functional alterations. The mitochondrial data generated uncover the genetic diversity within species and conservationist can utilize the data to estimate the effective population size or for forensic identification of animal or its seizures during unlawful trade activities.
Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir
2018-04-01
Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.
Spatial and temporal variability of rainfall in the Tocantins-Araguaia hydrographic region
Directory of Open Access Journals (Sweden)
Glauber Epifanio Loureiro
2015-01-01
Full Text Available Current paper examines the space-time dynamics of yearly rainfall of the Tocantins-Araguaia Hydrographic Region (TAHR, foregrounded on rainfall volume from isohyet maps and interpolated by Kriging geo-statistical method. Rainfall space dynamics was undertaken by the analysis of descriptive statistics, Index of Meteorological Irregularity (IMI and Variation Coefficient. Temporal dynamics was analyzed through the distribution of total annual volume precipitation for each TAHR sub-basin by the Standardized Anomaly Index, trend and magnitude test provided by Mann-Kendall and Sen Tests. Results correlated with meteorological anomalies of the Atlantic (Dipole and Pacific (ENOS Oceans show a highly heterogeneous rainfall behavior with temporal variability. Or rather, a decrease of rainfall extensiveness during years of intense meteorological anomaly with a rainfall increase south of the High Tocantins and Araguaia sub-basins and a decrease of rainfall in the Lower Tocantins sub-basin, with El Niño features. Although the Mann-Kendall test does not show statistically a significant trend for rainfall in the TAHR region, Sen’s estimator reveals a decrease in rainfall in the High Tocantins (-1.24 km³ year-1 and Araguaia (-1.13 km³ year-1 sub-basins and a rainfall increase in the Lower Tocantins sub-basin (0.53 km³ year-1 and in the TAHR region (-1.5 km³ year-1.
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia
2017-07-24
Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.
Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.
2004-01-01
Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.
Hu, A.; Bates, S. C.
2017-12-01
Observations indicate that the global mean surface temperature is rising, so does the global mean sea level. Sea level rise (SLR) can impose significant impacts on island and coastal communities, especially when SLR is compounded with storm surges. Here, via analyzing results from two sets of ensemble simulations from the Community Earth System Model version 1, we investigate how the potential SLR benefits through mitigating the future emission scenarios from business as usual to a mild-mitigation over the 21st Century would be affected by internal climate variability. Results show that there is almost no SLR benefit in the near term due to the large SLR variability due to the internal ocean dynamics. However, toward the end of the 21st century, the SLR benefit can be as much as a 26±1% reduction of the global mean SLR due to seawater thermal expansion. Regionally, the benefits from this mitigation for both near and long terms are heterogeneous. They vary from just a 11±5% SLR reduction in Melbourne, Australia to a 35±6% reduction in London. The processes contributing to these regional differences are the coupling of the wind-driven ocean circulation with the decadal scale sea surface temperature mode in the Pacific and Southern Oceans, and the changes of the thermohaline circulation and the mid-latitude air-sea coupling in the Atlantic.
Amino acid and structural variability of Yersinia pestis LcrV protein
Energy Technology Data Exchange (ETDEWEB)
Anisimov, A P; Dentovskaya, S V; Panfertsev, E A; Svetoch, T E; Kopylov, P K; Segelke, B W; Zemla, A; Telepnev, M V; Motin, V L
2009-11-09
The LcrV protein is a multifunctional virulence factor and protective antigen of the plague bacterium which is generally conserved between the epidemic strains of Yersinia pestis. They investigated the diversity in the LcrV sequences among non-epidemic Y. pestis strains which have a limited virulence in selected animal models and for humans. Sequencing of lcrV genes from ten Y. pestis strains belonging to different phylogenetic groups (subspecies) showed that the LcrV proteins possess four major variable hotspots at positions 18, 72, 273, and 324-326. These major variations, together with other minor substitutions in amino acid sequences, allowed them to classify the LcrV alleles into five sequence types (A-E). They observed that the strains of different Y. pestis subspecies can have the same typ of LcrV, and different types of LcrV can exist within the same natural plague focus. The LcrV polymorphisms were structurally analyzed by comparing the modeled structures of LcrV from all available strains. All changes except one occurred either in flexible regions or on the surface of the protein, but local chemical properties (i.e. those of a hydrophobic, hydrophilic, amphipathic, or charged nature) were conserved across all of the strains. Polymorphisms in flexible and surface regions are likely subject to less selective pressure, and have a limited impact on the structure. In contrast, the substitution of tryptophan at position 113 with either glutamic acid or glycine likely has a serious influence on the regional structure of the protein, and these mutations might have an effect on the function of LcrV. The polymorphisms at positions 18, 72 and 273 were accountable for differences in oligomerization of LcrV. The importance of the latter property in emergence of epidemic strains of Y. pestis during evolution of this pathogen will need to be further investigated.
Directory of Open Access Journals (Sweden)
Taís Nóbrega de Sousa
Full Text Available The dependence of Plasmodium vivax on invasion mediated by Duffy binding protein (DBP makes this protein a prime candidate for development of a vaccine. However, the development of a DBP-based vaccine might be hampered by the high variability of the protein ligand (DBP(II, known to bias the immune response toward a specific DBP variant. Here, the hypothesis being investigated is that the analysis of the worldwide DBP(II sequences will allow us to determine the minimum number of haplotypes (MNH to be included in a DBP-based vaccine of broad coverage. For that, all DBP(II sequences available were compiled and MNH was based on the most frequent nonsynonymous single nucleotide polymorphisms, the majority mapped on B and T cell epitopes. A preliminary analysis of DBP(II genetic diversity from eight malaria-endemic countries estimated that a number between two to six DBP haplotypes (17 in total would target at least 50% of parasite population circulating in each endemic region. Aiming to avoid region-specific haplotypes, we next analyzed the MNH that broadly cover worldwide parasite population. The results demonstrated that seven haplotypes would be required to cover around 60% of DBP(II sequences available. Trying to validate these selected haplotypes per country, we found that five out of the eight countries will be covered by the MNH (67% of parasite populations, range 48-84%. In addition, to identify related subgroups of DBP(II sequences we used a Bayesian clustering algorithm. The algorithm grouped all DBP(II sequences in six populations that were independent of geographic origin, with ancestral populations present in different proportions in each country. In conclusion, in this first attempt to undertake a global analysis about DBP(II variability, the results suggest that the development of DBP-based vaccine should consider multi-haplotype strategies; otherwise a putative P. vivax vaccine may not target some parasite populations.
Delta Scuti variables. Lecture 6
International Nuclear Information System (INIS)
Cox, A.N.
1983-01-01
The class of variables near or on the upper main sequence, the delta Scuti variables, are not only the usual ones about the masses, radii, and luminosities, but also the age, rotation, element diffusion to change the surface layer composition, the occurance of convection and the presence of radial and nonradial pulsation modes
Directory of Open Access Journals (Sweden)
Irshad M. Sulaiman
2014-06-01
Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.
Antarctic climate variability on regional and continental scales over the last 2000 years
Directory of Open Access Journals (Sweden)
B. Stenni
2017-11-01
Full Text Available Climate trends in the Antarctic region remain poorly characterized, owing to the brevity and scarcity of direct climate observations and the large magnitude of interannual to decadal-scale climate variability. Here, within the framework of the PAGES Antarctica2k working group, we build an enlarged database of ice core water stable isotope records from Antarctica, consisting of 112 records. We produce both unweighted and weighted isotopic (δ18O composites and temperature reconstructions since 0 CE, binned at 5- and 10-year resolution, for seven climatically distinct regions covering the Antarctic continent. Following earlier work of the Antarctica2k working group, we also produce composites and reconstructions for the broader regions of East Antarctica, West Antarctica and the whole continent. We use three methods for our temperature reconstructions: (i a temperature scaling based on the δ18O–temperature relationship output from an ECHAM5-wiso model simulation nudged to ERA-Interim atmospheric reanalyses from 1979 to 2013, and adjusted for the West Antarctic Ice Sheet region to borehole temperature data, (ii a temperature scaling of the isotopic normalized anomalies to the variance of the regional reanalysis temperature and (iii a composite-plus-scaling approach used in a previous continent-scale reconstruction of Antarctic temperature since 1 CE but applied to the new Antarctic ice core database. Our new reconstructions confirm a significant cooling trend from 0 to 1900 CE across all Antarctic regions where records extend back into the 1st millennium, with the exception of the Wilkes Land coast and Weddell Sea coast regions. Within this long-term cooling trend from 0 to 1900 CE, we find that the warmest period occurs between 300 and 1000 CE, and the coldest interval occurs from 1200 to 1900 CE. Since 1900 CE, significant warming trends are identified for the West Antarctic Ice Sheet, the Dronning Maud Land coast and the
Castro, C. L.; Beltran-Przekurat, A. B.; Pielke, R. A.
2007-05-01
Previous work has established that the dominant modes of Pacific SSTs influence the summer climate of North America through large-scale forcing, and this effect is most pronounced during the early part of the season. It is hypothesized, then, that land surface influences become more dominant in the latter part of the season as remote teleconnection influences diminish. As a first step toward investigation of this hypothesis in a regional climate model (RCM) framework, the statistically signficant spatiotemporal patterns of variability and covariability in North American precipitation (specified by the standardized precipitation index, or SPI), soil moisture, and vegetation are determined for timescales from a month to six months. To specify these respective data we use: CPC gauge- derived precipitation (1950-2000), Variable Infiltration Capacity (VIC) Model and NOAH Model NLDAS soil moisture and temperature, and the Global Inventory Modeling and Mapping Studies Normalized Difference Vegetation Index (GIMMS-NDVI). The principal statistical tool used is multiple taper frequency singular value decomposition (MTM-SVD), and this is supplemented by wavelet analysis for specific areas of interest. The significant interannual variability in all of these data occur at a timescale of about 7 to 9 years and appears to be the integrated effect of remote SST forcing from the Pacific. Considering the entire year, the spatial pattern for precipitation resembles the typical ENSO winter signature. If the summer season is considered seperately, the out of phase relationship between precipitation anomalies in the central U.S. and core monsoon region is apparent. The largest soil moisture anomalies occur in the central U.S., since precipitation in this region has a consistent relationship to Pacific SSTs for the entire year. This helps to explain the approximately 20 year periodicity in drought conditions there. Unlike soil moisture, the largest anomalies in vegetation occur in the
Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong
2008-08-01
In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.
Energy Technology Data Exchange (ETDEWEB)
Musgrove, M., E-mail: mmusgrov@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Opsahl, S.P. [U.S. Geological Survey, 5563 DeZavala, Ste. 290, San Antonio, TX 78249 (United States); Mahler, B.J. [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Herrington, C. [City of Austin Watershed Protection Department, Austin, TX 78704 (United States); Sample, T.L. [U.S. Geological Survey, 19241 David Memorial Dr., Ste. 180, Conroe, TX 77385 (United States); Banta, J.R. [U.S. Geological Survey, 5563 DeZavala, Ste. 290, San Antonio, TX 78249 (United States)
2016-10-15
Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO{sub 3}{sup −}) loading to surface and groundwater. We investigate variability and sources of NO{sub 3}{sup −} in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO{sub 3}{sup −} stable isotopes (δ{sup 15}N and δ{sup 18}O). These data were augmented by historical data collected from 1937 to 2007. NO{sub 3}{sup −} concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO{sub 3}{sup −} concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO{sub 3}{sup −} concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO{sub 3}{sup −}. These results highlight the vulnerability of karst aquifers to NO{sub 3}{sup −} contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO{sub 3}{sup −} than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates
International Nuclear Information System (INIS)
Musgrove, M.; Opsahl, S.P.; Mahler, B.J.; Herrington, C.; Sample, T.L.; Banta, J.R.
2016-01-01
Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO 3 − ) loading to surface and groundwater. We investigate variability and sources of NO 3 − in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO 3 − stable isotopes (δ 15 N and δ 18 O). These data were augmented by historical data collected from 1937 to 2007. NO 3 − concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO 3 − concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO 3 − concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO 3 − . These results highlight the vulnerability of karst aquifers to NO 3 − contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO 3 − than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates that subaqueous nitrification of organic N in the aquifer, as opposed to in soils, might be a
Fogt-Wyrwas, R; Mizgajska-Wiktor, H; Pacoń, J; Jarosz, W
2013-12-01
Some parasitic nematodes can inhabit different definitive hosts, which raises the question of the intraspecific variability of the nematode genotype affecting their preferences to choose particular species as hosts. Additionally, the issue of a possible intraspecific DNA microheterogeneity in specimens from different parts of the world seems to be interesting, especially from the evolutionary point of view. The problem was analysed in three related species - Toxocara canis, Toxocara cati and Toxascaris leonina - specimens originating from Central Europe (Poland). Using specific primers for species identification, internal transcribed spacer (ITS)-1 and ITS-2 regions were amplified and then sequenced. The sequences obtained were compared with sequences previously described for specimens originating from other geographical locations. No differences in nucleotide sequences were established in T. canis isolated from two different hosts (dogs and foxes). A comparison of ITS sequences of T. canis from Poland with sequences deposited in GenBank showed that the scope of intraspecific variability of the species did not exceed 0.4%, while in T. cati the differences did not exceed 2%. Significant differences were found in T. leonina, where ITS-1 differed by 3% and ITS-2 by as much as 7.4% in specimens collected from foxes in Poland and dogs in Australia. Such scope of differences in the nucleotide sequence seems to exceed the intraspecific variation of the species.
DNA watermarks in non-coding regulatory sequences
Directory of Open Access Journals (Sweden)
Pyka Martin
2009-07-01
Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Coupled ocean-atmosphere surface variability and its climate impacts in the tropical Atlantic region
Fontaine, B.; Janicot, Serge; Roucou, P.
This study examines time evolution and statistical relationships involving the two leading ocean-atmosphere coupled modes of variability in the tropical Atlantic and some climate anomalies over the tropical 120°W-60°W region using selected historical files (75-y near global SSTs and precipitation over land), more recent observed data (30-y SST and pseudo wind stress in the tropical Atlantic) and reanalyses from the US National Centers for Environmental Prediction (NCEP/NCAR) reanalysis System on the period 1968-1997: surface air temperature, sea level pressure, moist static energy content at 850 hPa, precipitable water and precipitation. The first coupled mode detected through singular value decomposition of the SST and pseudo wind-stress data over the tropical Atlantic (30°N-20°S) expresses a modulation in the thermal transequatorial gradient of SST anomalies conducted by one month leading wind-stress anomalies mainly in the tropical north Atlantic during northern winter and fall. It features a slight dipole structure in the meridional plane. Its time variability is dominated by a quasi-decadal signal well observed in the last 20-30 ys and, when projected over longer-term SST data, in the 1920s and 1930s but with shorter periods. The second coupled mode is more confined to the south-equatorial tropical Atlantic in the northern summer and explains considerably less wind-stress/SST cross-covariance. Its time series features an interannual variability dominated by shorter frequencies with increased variance in the 1960s and 1970s before 1977. Correlations between these modes and the ENSO-like Nino3 index lead to decreasing amplitude of thermal anomalies in the tropical Atlantic during warm episodes in the Pacific. This could explain the nonstationarity of meridional anomaly gradients on seasonal and interannual time scales. Overall the relationships between the oceanic component of the coupled modes and the climate anomaly patterns denote thermodynamical
Contribution of execution noise to arm movement variability in three-dimensional space.
Apker, Gregory A; Buneo, Christopher A
2012-01-01
Reaching movements are subject to noise associated with planning and execution, but precisely how these noise sources interact to determine patterns of endpoint variability in three-dimensional space is not well understood. For frontal plane movements, variability is largest along the depth axis (the axis along which visual planning noise is greatest), with execution noise contributing to this variability along the movement direction. Here we tested whether these noise sources interact in a similar way for movements directed in depth. Subjects performed sequences of two movements from a single starting position to targets that were either both contained within a frontal plane ("frontal sequences") or where the first was within the frontal plane and the second was directed in depth ("depth sequences"). For both sequence types, movements were performed with or without visual feedback of the hand. When visual feedback was available, endpoint distributions for frontal and depth sequences were generally anisotropic, with the principal axes of variability being strongly aligned with the depth axis. Without visual feedback, endpoint distributions for frontal sequences were relatively isotropic and movement direction dependent, while those for depth sequences were similar to those with visual feedback. Overall, the results suggest that in the presence of visual feedback, endpoint variability is dominated by uncertainty associated with planning and updating visually guided movements. In addition, the results suggest that without visual feedback, increased uncertainty in hand position estimation effectively unmasks the effect of execution-related noise, resulting in patterns of endpoint variability that are highly movement direction dependent.
International Nuclear Information System (INIS)
Soloviev, A.A.; Vorobieva, I.A.
1995-08-01
A seismically active region is represented as a system of absolutely rigid blocks divided by infinitely thin plane faults. The interaction of the blocks along the fault planes and with the underlying medium is viscous-elastic. The system of blocks moves as a consequence of prescribed motion of boundary blocks and the underlying medium. When for some part of a fault plane the stress surpasses a certain strength level a stress-drop (''a failure'') occurs. It can cause a failure for other parts of fault planes. The failures are considered as earthquakes. As a result of the numerical simulation a synthetic earthquake catalogue is produced. This procedure is applied for numerical modeling of dynamics of the block structure approximating the tectonic structure of the Vrancea region. By numerical experiments the values of the model parameters were obtained which supplied the synthetic earthquake catalog with the space distribution of epicenters close to the real distribution of the earthquake epicenters in the Vrancea region. The frequency-magnitude relations (Gutenberg-Richter curves) obtained for the synthetic and real catalogs have some common features. The sequences of earthquakes arising in the model are studied for some artificial structures. It is found that ''foreshocks'', ''main shocks'', and ''aftershocks'' could be detected among earthquakes forming the sequences. The features of aftershocks, foreshocks, and catalogs of main shocks are analysed. (author). 5 refs, 12 figs, 16 tabs
Sequence Capture versus Restriction Site Associated DNA Sequencing for Shallow Systematics.
Harvey, Michael G; Smith, Brian Tilston; Glenn, Travis C; Faircloth, Brant C; Brumfield, Robb T
2016-09-01
Sequence capture and restriction site associated DNA sequencing (RAD-Seq) are two genomic enrichment strategies for applying next-generation sequencing technologies to systematics studies. At shallow timescales, such as within species, RAD-Seq has been widely adopted among researchers, although there has been little discussion of the potential limitations and benefits of RAD-Seq and sequence capture. We discuss a series of issues that may impact the utility of sequence capture and RAD-Seq data for shallow systematics in non-model species. We review prior studies that used both methods, and investigate differences between the methods by re-analyzing existing RAD-Seq and sequence capture data sets from a Neotropical bird (Xenops minutus). We suggest that the strengths of RAD-Seq data sets for shallow systematics are the wide dispersion of markers across the genome, the relative ease and cost of laboratory work, the deep coverage and read overlap at recovered loci, and the high overall information that results. Sequence capture's benefits include flexibility and repeatability in the genomic regions targeted, success using low-quality samples, more straightforward read orthology assessment, and higher per-locus information content. The utility of a method in systematics, however, rests not only on its performance within a study, but on the comparability of data sets and inferences with those of prior work. In RAD-Seq data sets, comparability is compromised by low overlap of orthologous markers across species and the sensitivity of genetic diversity in a data set to an interaction between the level of natural heterozygosity in the samples examined and the parameters used for orthology assessment. In contrast, sequence capture of conserved genomic regions permits interrogation of the same loci across divergent species, which is preferable for maintaining comparability among data sets and studies for the purpose of drawing general conclusions about the impact of
Genetic Diversity in Passiflora Species Assessed by Morphological and ITS Sequence Analysis
Directory of Open Access Journals (Sweden)
Shiamala Devi Ramaiya
2014-01-01
Full Text Available This study used morphological characterization and phylogenetic analysis of the internal transcribed spacer (ITS region of nuclear ribosomal DNA to investigate the phylogeny of Passiflora species. The samples were collected from various regions of East Malaysia, and discriminant function analysis based on linear combinations of morphological variables was used to classify the Passiflora species. The biplots generated five distinct groups discriminated by morphological variables. The group consisted of cultivars of P. edulis with high levels of genetic similarity; in contrast, P. foetida was highly divergent from other species in the morphological biplots. The final dataset of aligned sequences from nine studied Passiflora accessions and 30 other individuals obtained from GenBank database (NCBI yielded one most parsimonious tree with two strongly supported clades. Maximum parsimony (MP tree showed the phylogenetic relationships within this subgenus Passiflora support the classification at the series level. The constructed phylogenic tree also confirmed the divergence of P. foetida from all other species and the closeness of wild and cultivated species. The phylogenetic relationships were consistent with results of morphological assessments. The results of this study indicate that ITS region analysis represents a useful tool for evaluating genetic diversity in Passiflora at the species level.
Directory of Open Access Journals (Sweden)
Élise Lépy
2017-10-01
Full Text Available In Finnish Lapland, reindeer herders’ activity is strongly dependent on the surrounding natural environment, which is directly exposed to environmental changes and climatic variations. By assessing whether there is any evidence of change in climate in Fell Lapland over the last 50 years, this paper attempts to link global climatic trends with local conditions and respond to the need of information at the local level. It aims at assessing the changes in temperature, precipitation and snow cover at a regional and local scale, as well as determining the climatic trends for the period 1960–2011. Statistical methods were used to conduct analyses of the regional homogeneity, the annual and seasonal variability, and the cold intensity. The results show that the regional climate is not homogeneous and differences exist between locations. Nevertheless, it can be concluded that, in general, a warming trend is discernible for the period 1960–2011, frost and thaw cycles slightly increase, and variations in mean temperatures are more important in the winter. Precipitation is more variable according to the site but, in general, precipitation is increasing with time, especially in the winter, and the snow cover does not seem to contain any discernible trend.
Characterization of variable EST SSR markers for Norway spruce (Picea abies L.
Directory of Open Access Journals (Sweden)
Spiess Nadine
2011-10-01
Full Text Available Abstract Background Norway spruce is widely distributed across Europe and the predominant tree of the Alpine region. Fast growth and the fact that timber can be harvested cost-effectively in relatively young populations define its status as one of the economically most important tree species of Northern Europe. In this study, EST derived simple sequence repeat (SSR markers were developed for the assessment of putative functional diversity in Austrian Norway spruce stands. Results SSR sequences were identified by analyzing 14,022 publicly available EST sequences. Tri-nucleotide repeat motifs were most abundant in the data set followed by penta- and hexa-nucleotide repeats. Specific primer pairs were designed for sixty loci. Among these, 27 displayed polymorphism in a testing population of 16 P. abies individuals sampled across Austria and in an additional screening population of 96 P. abies individuals from two geographically distinct Austrian populations. Allele numbers per locus ranged from two to 17 with observed heterozygosity ranging from 0.075 to 0.99. Conclusions We have characterized variable EST SSR markers for Norway spruce detected in expressed genes. Due to their moderate to high degree of variability in the two tested screening populations, these newly developed SSR markers are well suited for the analysis of stress related functional variation present in Norway spruce populations.
DEFF Research Database (Denmark)
Piskur, Jure; Langkjær, Rikke Breinhold
2004-01-01
For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...
Jaeger, K. L.
2017-12-01
The U.S. Geological Survey (USGS) has developed the PRObability Of Streamflow PERmanence (PROSPER) model, a GIS-based empirical model that provides predictions of the annual probability of a stream channel having year-round flow (Streamflow permanence probability; SPP) for any unregulated and minimally-impaired stream channel in the Pacific Northwest (Washington, Oregon, Idaho, western Montana). The model provides annual predictions for 2004-2016 at a 30-m spatial resolution based on monthly or annually updated values of climatic conditions, and static physiographic variables associated with the upstream basin. Prediction locations correspond to the channel network consistent with the National Hydrography Dataset stream grid and are publicly available through the USGS StreamStats platform (https://water.usgs.gov/osw/streamstats/). In snowmelt-driven systems, the most informative predictor variable was mean upstream snow water equivalent on May 1, which highlights the influence of late spring snow cover for supporting streamflow in mountain river networks. In non-snowmelt-driven systems, the most informative variable was mean annual precipitation. Streamflow permanence probabilities varied across the study area by geography and from year-to-year. Notably lower SPP corresponded to the climatically drier subregions of the study area. Higher SPP were concentrated in coastal and higher elevation mountain regions. In addition, SPP appeared to trend with average hydroclimatic conditions, which were also geographically coherent. The year-to-year variability lends support for the growing recognition of the spatiotemporal dynamism of streamflow permanence. An analysis of three focus basins located in contrasting geographical and hydroclimatic settings demonstrates differences in the sensitivity of streamflow permanence to antecedent climate conditions as a function of geography. Consequently, results suggest that PROSPER model can be a useful tool to evaluate regions of the
Vitacca, Michele; Barbano, Luca; Colombo, Daniele; Leoni, Olivia; Guffanti, Enrico
2018-01-29
Few studies have analyzed the prevalence and accessibility of home mechanical ventilation (HMV) in Italy. We aimed to investigate the prevalence and prescription variability of HMV as well as of long-term oxygen therapy (LTOT) and continuous positive airway pressure (CPAP), in the Lombardy Region. Prescribing rates of HMV (both noninvasive and tracheostomies), CPAP (auto-CPAP, CPAP/other sleep machines) and LTOT (liquid-O2, O2-gas, concentrators) in the 15 Local Healthcare districts of Lombardy were gathered from billing data for 2012 and compared. Crude rates (per 100,000 population) and rates for the different healthcare districts were calculated. In 2012, 6325 patients were on HMV (crude prescription rate: 63/100,000) with a high variation across districts (8/100,000 in Milano 1 vs 150/100,000 in Pavia). There were 14,237 patients on CPAP (crude prescription rate: 142/100,000; CPAP/other sleep machines 95.3% vs auto-CPAP 4.7%) with also high intra-regional variation (56/100,000 in Mantova vs. 260/100,000 in Pavia). There were 21,826 patients on LTOT (prescription rate: 217/100,000 rate; liquid-O2 94%, O2-gas 2.08%, O2-concentrators 3.8%), with again high intra-regional variation (100/100,000 in Bergamo vs 410/100,000 in Valle Camonica). The crude rate of HMV prescriptions in Lombardy is very high, with a high intra-regional variability in prescribing HMV, LTOT and CPAP which is partly explainable by the accessibility to specialist centers with HMV/sleep-study facilities. Analysis of administrative data and variability mapping can help identify areas of reduced access for an improved standardization of services. An audit among Health Payer and prescribers to interpret the described huge variability could be welcomed.
Variability of Actinobacteria, a minor component of rumen microflora.
Suľák, M; Sikorová, L; Jankuvová, J; Javorský, P; Pristaš, P
2012-07-01
Actinobacteria (Actinomycetes) are a significant and interesting group of gram-positive bacteria. They are regular, though infrequent, members of the microbial life in the rumen and represent up to 3 % of total rumen bacteria; there is considerable lack of information about ecology and biology of rumen actinobacteria. During the characterization of variability of rumen treponemas using non-cultivation approach, we also noted the variability of rumen actinobacteria. By using Treponema-specific primers a specific 16S rRNA gene library was prepared from cow and sheep rumen total DNA. About 10 % of recombinant clones contained actinobacteria-like sequences. Phylogenetic analyses of 11 clones obtained showed the high variability of actinobacteria in the ruminant digestive system. While some sequences are nearly identical to known sequences of actinobacteria, we detected completely new clusters of actinobacteria-like sequences, representing probably new, as yet undiscovered, group of rumen Actinobacteria. Further research will be necessary for understanding their nature and functions in the rumen.
Dissociable effects of practice variability on learning motor and timing skills.
Caramiaux, Baptiste; Bevilacqua, Frédéric; Wanderley, Marcelo M; Palmer, Caroline
2018-01-01
Motor skill acquisition inherently depends on the way one practices the motor task. The amount of motor task variability during practice has been shown to foster transfer of the learned skill to other similar motor tasks. In addition, variability in a learning schedule, in which a task and its variations are interweaved during practice, has been shown to help the transfer of learning in motor skill acquisition. However, there is little evidence on how motor task variations and variability schedules during practice act on the acquisition of complex motor skills such as music performance, in which a performer learns both the right movements (motor skill) and the right time to perform them (timing skill). This study investigated the impact of rate (tempo) variability and the schedule of tempo change during practice on timing and motor skill acquisition. Complete novices, with no musical training, practiced a simple musical sequence on a piano keyboard at different rates. Each novice was assigned to one of four learning conditions designed to manipulate the amount of tempo variability across trials (large or small tempo set) and the schedule of tempo change (randomized or non-randomized order) during practice. At test, the novices performed the same musical sequence at a familiar tempo and at novel tempi (testing tempo transfer), as well as two novel (but related) sequences at a familiar tempo (testing spatial transfer). We found that practice conditions had little effect on learning and transfer performance of timing skill. Interestingly, practice conditions influenced motor skill learning (reduction of movement variability): lower temporal variability during practice facilitated transfer to new tempi and new sequences; non-randomized learning schedule improved transfer to new tempi and new sequences. Tempo (rate) and the sequence difficulty (spatial manipulation) affected performance variability in both timing and movement. These findings suggest that there is a
Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)
2013-01-01
Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.
Webster, R J; Williams, A; Marchetti, F; Yauk, C L
2018-07-01
Mutations in germ cells pose potential genetic risks to offspring. However, de novo mutations are rare events that are spread across the genome and are difficult to detect. Thus, studies in this area have generally been under-powered, and no human germ cell mutagen has been identified. Whole Genome Sequencing (WGS) of human pedigrees has been proposed as an approach to overcome these technical and statistical challenges. WGS enables analysis of a much wider breadth of the genome than traditional approaches. Here, we performed power analyses to determine the feasibility of using WGS in human families to identify germ cell mutagens. Different statistical models were compared in the power analyses (ANOVA and multiple regression for one-child families, and mixed effect model sampling between two to four siblings per family). Assumptions were made based on parameters from the existing literature, such as the mutation-by-paternal age effect. We explored two scenarios: a constant effect due to an exposure that occurred in the past, and an accumulating effect where the exposure is continuing. Our analysis revealed the importance of modeling inter-family variability of the mutation-by-paternal age effect. Statistical power was improved by models accounting for the family-to-family variability. Our power analyses suggest that sufficient statistical power can be attained with 4-28 four-sibling families per treatment group, when the increase in mutations ranges from 40 to 10% respectively. Modeling family variability using mixed effect models provided a reduction in sample size compared to a multiple regression approach. Much larger sample sizes were required to detect an interaction effect between environmental exposures and paternal age. These findings inform study design and statistical modeling approaches to improve power and reduce sequencing costs for future studies in this area. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Species-level analysis of DNA sequence data from the NIH Human Microbiome Project.
Conlan, Sean; Kong, Heidi H; Segre, Julia A
2012-01-01
Outbreaks of antibiotic-resistant bacterial infections emphasize the importance of surveillance of potentially pathogenic bacteria. Genomic sequencing of clinical microbiological specimens expands our capacity to study cultivable, fastidious and uncultivable members of the bacterial community. Herein, we compared the primary data collected by the NIH's Human Microbiome Project (HMP) with published epidemiological surveillance data of Staphylococcus aureus. The HMP's initial dataset contained microbial survey data from five body regions (skin, nares, oral cavity, gut and vagina) of 242 healthy volunteers. A significant component of the HMP dataset was deep sequencing of the 16S ribosomal RNA gene, which contains variable regions enabling taxonomic classification. Since species-level identification is essential in clinical microbiology, we built a reference database and used phylogenetic placement followed by most recent common ancestor classification to look at the species distribution for Staphylococcus, Klebsiella and Enterococcus. We show that selecting the accurate region of the 16S rRNA gene to sequence is analogous to carefully selecting culture conditions to distinguish closely related bacterial species. Analysis of the HMP data showed that Staphylococcus aureus was present in the nares of 36% of healthy volunteers, consistent with culture-based epidemiological data. Klebsiella pneumoniae and Enterococcus faecalis were found less frequently, but across many habitats. This work demonstrates that large 16S rRNA survey studies can be used to support epidemiological goals in the context of an increasing awareness that microbes flourish and compete within a larger bacterial community. This study demonstrates how genomic techniques and information could be critically important to trace microbial evolution and implement hospital infection control.
Habte, Frezghi; Budhiraja, Shradha; Keren, Shay; Doyle, Timothy C; Levin, Craig S; Paik, David S
2013-01-01
We estimated reader-dependent variability of region of interest (ROI) analysis and evaluated its impact on preclinical quantitative molecular imaging. To estimate reader variability, we used five independent image datasets acquired each using microPET and multispectral fluorescence imaging (MSFI). We also selected ten experienced researchers who utilize molecular imaging in the same environment that they typically perform their own studies. Nine investigators blinded to the data type completed the ROI analysis by drawing ROIs manually that delineate the tumor regions to the best of their knowledge and repeated the measurements three times, non-consecutively. Extracted mean intensities of voxels within each ROI are used to compute the coefficient of variation (CV) and characterize the inter- and intra-reader variability. The impact of variability was assessed through random samples iterated from normal distributions for control and experimental groups on hypothesis testing and computing statistical power by varying subject size, measured difference between groups and CV. The results indicate that inter-reader variability was 22.5% for microPET and 72.2% for MSFI. Additionally, mean intra-reader variability was 10.1% for microPET and 26.4% for MSFI. Repeated statistical testing showed that a total variability of CV variability has been observed mainly due to differences in the ROI placement and geometry drawn between readers, which may adversely affect statistical power and erroneously lead to negative study outcomes.
Tran Thi Tuyet, H.; Zwart, M.P.; Phuong, N.T.; Oanh, D.T.H.; Jong, de M.C.M.; Vlak, J.M.
2012-01-01
Sequence comparisons of the genomes of white spot syndrome virus (WSSV) strains have identified regions containing variable-length insertions/deletions (i.e. indels). Indel-I and Indel-II, positioned between open reading frames (ORFs) 14/15 and 23/24, respectively, are the largest and the most
Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J
1998-08-01
Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.
Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.
2006-01-01
Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921
Sequencing of BAC pools by different next generation sequencing platforms and strategies
Directory of Open Access Journals (Sweden)
Scholz Uwe
2011-10-01
Full Text Available Abstract Background Next generation sequencing of BACs is a viable option for deciphering the sequence of even large and highly repetitive genomes. In order to optimize this strategy, we examined the influence of read length on the quality of Roche/454 sequence assemblies, to what extent Illumina/Solexa mate pairs (MPs improve the assemblies by scaffolding and whether barcoding of BACs is dispensable. Results Sequencing four BACs with both FLX and Titanium technologies revealed similar sequencing accuracy, but showed that the longer Titanium reads produce considerably less misassemblies and gaps. The 454 assemblies of 96 barcoded BACs were improved by scaffolding 79% of the total contig length with MPs from a non-barcoded library. Assembly of the unmasked 454 sequences without separation by barcodes revealed chimeric contig formation to be a major problem, encompassing 47% of the total contig length. Masking the sequences reduced this fraction to 24%. Conclusion Optimal BAC pool sequencing should be based on the longest available reads, with barcoding essential for a comprehensive assessment of both repetitive and non-repetitive sequence information. When interest is restricted to non-repetitive regions and repeats are masked prior to assembly, barcoding is non-essential. In any case, the assemblies can be improved considerably by scaffolding with non-barcoded BAC pool MPs.
Oppen, M J; Willis, B L; Vugt, H W; Miller, D J
2000-09-01
Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency.
Preliminary notes on dual relevance of ITS sequences and pigments in Hygrocybe taxonomy.
Babos, M; Halász, K; Zagyva, T; Zöld-Balogh, A; Szegő, D; Bratek, Z
2011-06-01
The relationships based on ITS sequences of 48 Hygrocybe s.l. specimens were studied and compared with previously described taxonomic groups. Our specimens formed two well separated genetic groups. The first one includes the species characterized by vivid yellow and red colours, while species belonging to other clades were pallid or pale brown, and in most cases with pink or olive tones. This separation is supported by the presence of muscaflavin pigments among some species referred to Hygrocybe (Bresinsky & Kronawitter 1986). The subgenera distinguished by morphological features can be relatively well recognized on phylogenetic trees, however, the majority of sections were not supported. Variability in the ITS region of Hygrocybe species is unusually high. In some cases sequences differed by more than 25 %, and the lengths of ITS regions also showed large differences. Taxa that were considered as closely related, e.g. the H. conica aggregate, were found to have identical or highly similar sequences. Our results seem to confirm the taxonomic concept of Bresinsky (2008) who proposed the division of the genus Hygrocybe. Hence H. calyptriformis and all examined members of subg. Gliophorus (H. irrigata, H. laeta, H. nitrata, H. psittacina) and subg. Cuphophyllus could be excluded from the genus Hygrocybe s.str. Based on these results further research using DNA markers at the intergeneric level is suggested to revaluate the taxonomy of former Hygrocybe species.
Li, Jun; Guo, Xian-Guang; Wang, Yue-Zhao
2010-08-01
A 838 bp fragment of mtDNA ND4-tRNALeu gene was sequenced for 66 individuals from five populations (DB: Dabancheng, TU: Turpan, SS: Shanshan, HL: Liushuquan, HD: East district of Hami) of Phrynocephalus axillaris distributed in east of Xinjiang Uygur Autonomous Region. Seventeen haplotypes were identified from 29 nucleotide polymorphic sites in the aligned 838 bp sequence. Excluding DB, there were relatively high haplotype diversity [(0.600+/-0.113)oscillation since Pleistocene and genetic drift.
Use of variability modes to evaluate AR4 climate models over the Euro-Atlantic region
Energy Technology Data Exchange (ETDEWEB)
Casado, M.J.; Pastor, M.A. [Agencia Estatal de Meteorologia (AEMET), Madrid (Spain)
2012-01-15
This paper analyzes the ability of the multi-model simulations from the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) to simulate the main leading modes of variability over the Euro-Atlantic region in winter: the North-Atlantic Oscillation (NAO), the Scandinavian mode (SCAND), the East/Atlantic Oscillation (EA) and the East Atlantic/Western Russia mode (EA/WR). These modes of variability have been evaluated both spatially, by analyzing the intensity and location of their anomaly centres, as well as temporally, by focusing on the probability density functions and e-folding time scales. The choice of variability modes as a tool for climate model assessment can be justified by the fact that modes of variability determine local climatic conditions and their likely change may have important implications for future climate changes. It is found that all the models considered are able to simulate reasonably well these four variability modes, the SCAND being the mode which is best spatially simulated. From a temporal point of view the NAO and SCAND modes are the best simulated. UKMO-HadGEM1 and CGCM3.1(T63) are the models best at reproducing spatial characteristics, whereas CCSM3 and CGCM3.1(T63) are the best ones with regard to the temporal features. GISS-AOM is the model showing the worst performance, in terms of both spatial and temporal features. These results may bring new insight into the selection and use of specific models to simulate Euro-Atlantic climate, with some models being clearly more successful in simulating patterns of temporal and spatial variability than others. (orig.)
Gubser, Caroline; Smith, Geoffrey L
2002-04-01
Camelpox virus (CMPV) and variola virus (VAR) are orthopoxviruses (OPVs) that share several biological features and cause high mortality and morbidity in their single host species. The sequence of a virulent CMPV strain was determined; it is 202182 bp long, with inverted terminal repeats (ITRs) of 6045 bp and has 206 predicted open reading frames (ORFs). As for other poxviruses, the genes are tightly packed with little non-coding sequence. Most genes within 25 kb of each terminus are transcribed outwards towards the terminus, whereas genes within the centre of the genome are transcribed from either DNA strand. The central region of the genome contains genes that are highly conserved in other OPVs and 87 of these are conserved in all sequenced chordopoxviruses. In contrast, genes towards either terminus are more variable and encode proteins involved in host range, virulence or immunomodulation. In some cases, these are broken versions of genes found in other OPVs. The relationship of CMPV to other OPVs was analysed by comparisons of DNA and predicted protein sequences, repeats within the ITRs and arrangement of ORFs within the terminal regions. Each comparison gave the same conclusion: CMPV is the closest known virus to variola virus, the cause of smallpox.
International Nuclear Information System (INIS)
Tiderius, C.J.; Tjoernstrand, J.; Aakeson, P.; Soedersten, K.; Dahlberg, L.; Leander, P.
2004-01-01
Purpose: To establish the reproducibility of a standardized region of interest (ROI) drawing procedure in delayed gadolinium-enhanced magnetic resonance imaging (MRI) of cartilage (dGEMRIC). Material and Methods: A large ROI in lateral and medial femoral weight-bearing cartilage was drawn in images of 12 healthy male volunteers by 6 investigators with different skills in MRI. The procedure was done twice, with a 1-week interval. Calculated T1-values were evaluated for intra- and interobserver variability. Results: The mean interobserver variability for both compartments ranged between 1.3% and 2.3% for the 6 different investigators without correlation to their experience in MRI. Post-contrast intra-observer variability was low in both the lateral and the medial femoral cartilage, 2.6% and 1.5%, respectively. The larger variability in lateral than in medial cartilage was related to slightly longer and thinner ROIs. Conclusion: Intra-observer variability and interobserver variability are both low when a large standardized ROI is used in dGEMRIC. The experience of the investigator does not affect the variability, which further supports a clinical applicability of the method
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Role of climate variability in the heatstroke death rates of Kanto region in Japan
Akihiko, Takaya; Morioka, Yushi; Behera, Swadhin K.
2014-07-01
The death toll by heatstroke in Japan, especially in Kanto region, has sharply increased since 1994 together with large interannual variability. The surface air temperature and humidity observed during boreal summers of 1980-2010 were examined to understand the role of climate in the death toll. The extremely hot days, when the daily maximum temperature exceeds 35°C, are more strongly associated with the death toll than the conventional Wet Bulb Globe Temperature index. The extremely hot days tend to be associated with El Niño/Southern Oscillation or the Indian Ocean Dipole, suggesting a potential link with tropical climate variability to the heatstroke related deaths. Also, the influence of these climate modes on the death toll has strengthened since 1994 probably related to global warming. It is possible to develop early warning systems based on seasonal climate predictions since recent climate models show excellent predictability skills for those climate modes.
Parkin, Derek B; Archer, Linda L; Childress, April L; Wellehan, James F X
2009-07-01
Bearded dragons (Pogona vitticeps) are popular pets in the United States. Agamid Adenovirus 1 (AgAdV1) is an important infectious agent of bearded dragons. The only AgAdV1 sequences available to date are from a highly conserved region of the DNA polymerase gene. Degenerate primers were designed to amplify a variable region of the AgAdV1 hexon gene for sequencing. Genetic differences were identified within the hexon gene of 17 bearded dragons from 4 collections. Much less diversity was present in the polymerase gene. Bayesian analysis of the hexon nucleotide alignment identified two larger groups and two isolates that did not tightly cluster with these two groups. Multiple genotypes were identified within collections, and individual genotypes were seen in different collections. Three bearded dragons appeared to be infected by multiple strains. These findings show that this hexon region is useful for AgAdV1 genotyping, which can be used epidemiologically as well as in future investigations of AgAdV1 evolution and clinical implications of strain differences.
DEFF Research Database (Denmark)
Mikkelsen, J G; Lund, Anders Henrik; Duch, M
1998-01-01
during minus-strand DNA synthesis occurred within defined areas of the genome and did not lead to misincorporations at the crossover site. The nonrandom distribution of recombination sites did not reflect a bias for specific sites due to selection at the level of marker gene expression. We address...... whether template switching is affected by the length of sequence identity, by palindromic sequences, and/or by putative stem-loop structures. Sixteen of 24 sites of recombination colocalized with the kissing-loop dimerization region, and we propose that RNA-RNA interactions between palindromic sequences...
A novel large deletion of the ICR1 region including H19 and putative enhancer elements.
Fryssira, Helen; Amenta, Stella; Kanber, Deniz; Sofocleous, Christalena; Lykopoulou, Evangelia; Kanaka-Gantenbein, Christina; Cerrato, Flavia; Lüdecke, Hermann-Josef; Bens, Susanne; Riccio, Andrea; Buiting, Karin
2015-05-06
Beckwith-Wiedemann syndrome (BWS) is a rare pediatric overgrowth disorder with a variable clinical phenotype caused by deregulation affecting imprinted genes in the chromosomal region 11p15. Alterations of the imprinting control region 1 (ICR1) at the IGF2/H19 locus resulting in biallelic expression of IGF2 and biallelic silencing of H19 account for approximately 10% of patients with BWS. The majority of these patients have epimutations of the ICR1 without detectable DNA sequence changes. Only a few patients were found to have deletions. Most of these deletions are small affecting different parts of the ICR1 differentially methylated region (ICR1-DMR) removing target sequences for CTCF. Only a very few deletions reported so far include the H19 gene in addition to the CTCF binding sites. None of these deletions include IGF2. A male patient was born with hypotonia, facial dysmorphisms and hypoglycemia suggestive of Beckwith-Wiedemann syndrome. Using methylation-specific (MS)-MLPA (Multiplex ligation-dependent probe amplification) we have identified a maternally inherited large deletion of the ICR1 region in a patient and his mother. The deletion results in a variable clinical expression with a classical BWS in the mother and a more severe presentation of BWS in her son. By genome-wide SNP array analysis the deletion was found to span ~100 kb genomic DNA including the ICR1DMR, H19, two adjacent non-imprinted genes and two of three predicted enhancer elements downstream to H19. Methylation analysis by deep bisulfite next generation sequencing revealed hypermethylation of the maternal allele at the IGF2 locus in both, mother and child, although IGF2 is not affected by the deletion. We here report on a novel large familial deletion of the ICR1 region in a BWS family. Due to the deletion of the ICR1-DMR CTCF binding cannot take place and the residual enhancer elements have access to the IGF2 promoters. The aberrant methylation (hypermethylation) of the maternal IGF2
In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species
Directory of Open Access Journals (Sweden)
Evandro Vagner Tambarussi
2009-01-01
Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.
Davis, Shannon R.
2015-05-14
The structure, variability, and regional connectivity of the Tokar Gap jet (TGJ) are described using WRF Model analyses and supporting atmospheric datasets from the East African–Red Sea–Arabian Peninsula (EARSAP) region during summer 2008. Sources of the TGJ’s unique quasi-diurnal nature and association with atypically high atmospheric moisture transport are traced back to larger-scale atmospheric dynamics influencing its forcing. These include seasonal shifts in the intertropical convergence zone (ITCZ), variability of the monsoon and North African wind regimes, and ties to other orographic flow patterns. Strong modulation of the TGJ by regional processes such as the desert heating cycle, wind convergence at the ITCZ surface front, and the local land–sea breeze cycle are described. Two case studies present the interplay of these influences in detail. The first of these was an “extreme” gap wind event on 12 July, in which horizontal velocities in the Tokar Gap exceeded 26 m s−1 and the flow from the jet extended the full width of the Red Sea basin. This event coincided with development of a large mesoscale convective complex (MCC) and precipitation at the entrance of the Tokar Gap as well as smaller gaps downstream along the Arabian Peninsula. More typical behavior of the TGJ during the 2008 summer is discussed using a second case study on 19 July. Downwind impact of the TGJ is evaluated using Lagrangian model trajectories and analysis of the lateral moisture fluxes (LMFs) during jet events. These results suggest means by which TGJ contributes to large LMFs and has potential bearing upon Sahelian rainfall and MCC development.
Observations of regional and local variability in the optical properties of maritime clouds
Energy Technology Data Exchange (ETDEWEB)
White, A.B. [Univ. of Colorado at Boulder/National Oceanic and Atmospheric Administration, Boulder, CO (United States); Fairall, C.W. [Environmental Technology Lab., Boulder, CO (United States)
1996-04-01
White and Fairall (1995) calculated the optical properties of the marine boundary layer (MBL) clouds observed during the Atlantic Stratocumulus Transition Experiment (ASTEX) and compared their results with the results obtained by Fairall et al. for the MBL clouds observed during the First International Satellite Climatology Program (ISSCP) Regional Experiment (FIRE). They found a factor of two difference in the optical depth versus liquid water relationship that applies to the clouds observed in each case. In the present study, we present evidence to support this difference. We also investigate the local variability exhibited in the ASTEX optical properties using measurements of the boundary layer aerosol concentration.
Sequencing and association analysis of the type 1 diabetes – linked region on chromosome 10p12-q11
Directory of Open Access Journals (Sweden)
Barratt Bryan J
2007-05-01
Full Text Available Abstract Background In an effort to locate susceptibility genes for type 1 diabetes (T1D several genome-wide linkage scans have been undertaken. A chromosomal region designated IDDM10 retained genome-wide significance in a combined analysis of the main linkage scans. Here, we studied sequence polymorphisms in 23 Mb on chromosome 10p12-q11, including the putative IDDM10 region, to identify genes associated with T1D. Results Initially, we resequenced the functional candidate genes, CREM and SDF1, located in this region, genotyped 13 tag single nucleotide polymorphisms (SNPs and found no association with T1D. We then undertook analysis of the whole 23 Mb region. We constructed and sequenced a contig tile path from two bacterial artificial clone libraries. By comparison with a clone library from an unrelated person used in the Human Genome Project, we identified 12,058 SNPs. We genotyped 303 SNPs and 25 polymorphic microsatellite markers in 765 multiplex T1D families and followed up 22 associated polymorphisms in up to 2,857 families. We found nominal evidence of association in six loci (P = 0.05 – 0.0026, located near the PAPD1 gene. Therefore, we resequenced 38.8 kb in this region, found 147 SNPs and genotyped 84 of them in the T1D families. We also tested 13 polymorphisms in the PAPD1 gene and in five other loci in 1,612 T1D patients and 1,828 controls from the UK. Overall, only the D10S193 microsatellite marker located 28 kb downstream of PAPD1 showed nominal evidence of association in both T1D families and in the case-control sample (P = 0.037 and 0.03, respectively. Conclusion We conclude that polymorphisms in the CREM and SDF1 genes have no major effect on T1D. The weak T1D association that we detected in the association scan near the PAPD1 gene may be either false or due to a small genuine effect, and cannot explain linkage at the IDDM10 region.
Directory of Open Access Journals (Sweden)
Alberto Muñoz
2016-10-01
Full Text Available Ecological Niche Models (ENMs are widely used to describe how environmental factors influence species distribution. Modelling at a local scale, compared to a large scale within a high environmental gradient, can improve our understanding of ecological species niches. The main goal of this study is to assess and compare the contribution of environmental variables to amphibian and reptile ENMs in two Spanish national parks located in contrasting biogeographic regions, i.e., the Mediterranean and the Atlantic area. The ENMs were built with maximum entropy modelling using 11 environmental variables in each territory. The contributions of these variables to the models were analysed and classified using various statistical procedures (Mann–Whitney U tests, Principal Components Analysis and General Linear Models. Distance to the hydrological network was consistently the most relevant variable for both parks and taxonomic classes. Topographic variables (i.e., slope and altitude were the second most predictive variables, followed by climatic variables. Differences in variable contribution were observed between parks and taxonomic classes. Variables related to water availability had the larger contribution to the models in the Mediterranean park, while topography variables were decisive in the Atlantic park. Specific response curves to environmental variables were in accordance with the biogeographic affinity of species (Mediterranean and non-Mediterranean species and taxonomy (amphibians and reptiles. Interestingly, these results were observed for species located in both parks, particularly those situated at their range limits. Our findings show that ecological niche models built at local scale reveal differences in habitat preferences within a wide environmental gradient. Therefore, modelling at local scales rather than assuming large-scale models could be preferable for the establishment of conservation strategies for herptile species in natural
Santos, Xavier; Felicísimo, Ángel M.
2016-01-01
Ecological Niche Models (ENMs) are widely used to describe how environmental factors influence species distribution. Modelling at a local scale, compared to a large scale within a high environmental gradient, can improve our understanding of ecological species niches. The main goal of this study is to assess and compare the contribution of environmental variables to amphibian and reptile ENMs in two Spanish national parks located in contrasting biogeographic regions, i.e., the Mediterranean and the Atlantic area. The ENMs were built with maximum entropy modelling using 11 environmental variables in each territory. The contributions of these variables to the models were analysed and classified using various statistical procedures (Mann–Whitney U tests, Principal Components Analysis and General Linear Models). Distance to the hydrological network was consistently the most relevant variable for both parks and taxonomic classes. Topographic variables (i.e., slope and altitude) were the second most predictive variables, followed by climatic variables. Differences in variable contribution were observed between parks and taxonomic classes. Variables related to water availability had the larger contribution to the models in the Mediterranean park, while topography variables were decisive in the Atlantic park. Specific response curves to environmental variables were in accordance with the biogeographic affinity of species (Mediterranean and non-Mediterranean species) and taxonomy (amphibians and reptiles). Interestingly, these results were observed for species located in both parks, particularly those situated at their range limits. Our findings show that ecological niche models built at local scale reveal differences in habitat preferences within a wide environmental gradient. Therefore, modelling at local scales rather than assuming large-scale models could be preferable for the establishment of conservation strategies for herptile species in natural parks. PMID
International Nuclear Information System (INIS)
Tenney, Rebeca M.; Bell, Christie L.; Wilson, James M.
2014-01-01
Adeno-associated virus serotype 8 (AAV8) is a promising vector for liver-directed gene therapy. Although efficient uncoating of viral capsids has been implicated in AAV8's robust liver transduction, much about the biology of AAV8 hepatotropism remains unclear. Our study investigated the structural basis of AAV8 liver transduction efficiency by constructing chimeric vector capsids containing sequences derived from AAV8 and AAV2 – a highly homologous yet poorly hepatotropic serotype. Engineered vectors containing capsid variable regions (VR) VII and IX from AAV8 in an AAV2 backbone mediated near AAV8-like transduction in mouse liver, with higher numbers of chimeric genomes detected in whole liver cells and isolated nuclei. Interestingly, chimeric capsids within liver nuclei also uncoated similarly to AAV8 by 6 weeks after administration, in contrast with AAV2, of which a significantly smaller proportion were uncoated. This study links specific AAV capsid regions to the transduction ability of a clinically relevant AAV serotype. - Highlights: • We construct chimeric vectors to identify determinants of AAV8 liver transduction. • An AAV2-based vector with 17 AAV8 residues exhibited high liver transduction in mice. • This vector also surpassed AAV2 in cell entry, nuclear entry and onset of expression. • Most chimeric vector particles were uncoated at 6 weeks, like AAV8 and unlike AAV2. • Chimera retained heparin binding and was antigenically distinct from AAV2 and AAV8
Energy Technology Data Exchange (ETDEWEB)
Tenney, Rebeca M.; Bell, Christie L.; Wilson, James M., E-mail: wilsonjm@mail.med.upenn.edu
2014-04-15
Adeno-associated virus serotype 8 (AAV8) is a promising vector for liver-directed gene therapy. Although efficient uncoating of viral capsids has been implicated in AAV8's robust liver transduction, much about the biology of AAV8 hepatotropism remains unclear. Our study investigated the structural basis of AAV8 liver transduction efficiency by constructing chimeric vector capsids containing sequences derived from AAV8 and AAV2 – a highly homologous yet poorly hepatotropic serotype. Engineered vectors containing capsid variable regions (VR) VII and IX from AAV8 in an AAV2 backbone mediated near AAV8-like transduction in mouse liver, with higher numbers of chimeric genomes detected in whole liver cells and isolated nuclei. Interestingly, chimeric capsids within liver nuclei also uncoated similarly to AAV8 by 6 weeks after administration, in contrast with AAV2, of which a significantly smaller proportion were uncoated. This study links specific AAV capsid regions to the transduction ability of a clinically relevant AAV serotype. - Highlights: • We construct chimeric vectors to identify determinants of AAV8 liver transduction. • An AAV2-based vector with 17 AAV8 residues exhibited high liver transduction in mice. • This vector also surpassed AAV2 in cell entry, nuclear entry and onset of expression. • Most chimeric vector particles were uncoated at 6 weeks, like AAV8 and unlike AAV2. • Chimera retained heparin binding and was antigenically distinct from AAV2 and AAV8.
Arbefeville, S; Harris, A; Ferrieri, P
2017-09-01
Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r
Stochastic modelling of daily rainfall sequences
Buishand, T.A.
1977-01-01
Rainfall series of different climatic regions were analysed with the aim of generating daily rainfall sequences. A survey of the data is given in I, 1. When analysing daily rainfall sequences one must be aware of the following points:Kou, Xingxia; Tian, Xiangjun; Zhang, Meigen; Peng, Zhen; Zhang, Xiaoling
2017-10-01
A regional surface carbon dioxide (CO2) flux inversion system, the Tan-Tracker-Region, was developed by incorporating an assimilation scheme into the Community Multiscale Air Quality (CMAQ) regional chemical transport model to resolve fine-scale CO2 variability over East Asia. The proper orthogonal decomposition-based ensemble four-dimensional variational data assimilation approach (POD-4DVar) is the core algorithm for the joint assimilation framework, and simultaneous assimilations of CO2 concentrations and surface CO2 fluxes are applied to help reduce the uncertainty in initial CO2 concentrations. A persistence dynamical model was developed to describe the evolution of the surface CO2 fluxes and help avoid the "signal-to-noise" problem; thus, CO2 fluxes could be estimated as a whole at the model grid scale, with better use of observation information. The performance of the regional inversion system was evaluated through a group of single-observation-based observing system simulation experiments (OSSEs). The results of the experiments suggest that a reliable performance of Tan-Tracker-Region is dependent on certain assimilation parameter choices, for example, an optimized window length of approximately 3 h, an ensemble size of approximately 100, and a covariance localization radius of approximately 320 km. This is probably due to the strong diurnal variation and spatial heterogeneity in the fine-scale CMAQ simulation, which could affect the performance of the regional inversion system. In addition, because all observations can be artificially obtained in OSSEs, the performance of Tan-Tracker-Region was further evaluated through different densities of the artificial observation network in different CO2 flux situations. The results indicate that more observation sites would be useful to systematically improve the estimation of CO2 concentration and flux in large areas over the model domain. The work presented here forms a foundation for future research in which a
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W
2007-05-01
Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.
Braunmiller, J.; Thompson, G.; McNutt, S. R.
2017-12-01
On 9 January 2014, a magnitude Mw=5.1 earthquake occurred along the Bahamas-Cuba suture at the northern coast of Cuba revealing a surprising seismic hazard source for both Cuba and southern Florida where it was widely felt. Due to its location, the event and its aftershocks (M>3.5) were recorded only at far distances (300+ km) resulting in high-detection thresholds, low location accuracy, and limited source parameter resolution. We use three-component regional seismic data to study the sequence. High-pass filtered seismograms at the closest site in southern Florida are similar in character suggesting a relatively tight event cluster and revealing additional, smaller aftershocks not included in the ANSS or ISC catalogs. Aligning on the P arrival and low-pass filtering (T>10 s) uncovers a surprise polarity flip of the large amplitude surface waves on vertical seismograms for some aftershocks relative to the main shock. We performed regional moment tensor inversions of the main shock and its largest aftershocks using complete three-component seismograms from stations distributed throughout the region to confirm the mechanism changes. Consistent with the GCMT solution, we find an E-W trending normal faulting mechanism for the main event and for one immediate aftershock. Two aftershocks indicate E-W trending reverse faulting with essentially flipped P- and T-axes relative to the normal faulting events (and the same B-axes). Within uncertainties, depths of the two event families are indistinguishable and indicate shallow faulting (<10 km). One intriguing possible interpretation is that both families ruptured the same fault with reverse mechanisms compensating for overshooting. However, activity could also be spatially separated either vertically (with reverse mechanisms possibly below extension) or laterally. The shallow source depth and the 200-km long uplifted chain of islands indicate that larger, shallow and thus potentially tsunamigenic earthquakes could occur just
Viral metagenomics: Analysis of begomoviruses by illumina high-throughput sequencing
Idris, Ali; Al-Saleh, Mohammed; Piatek, Marek J.; Al-Shahwan, Ibrahim; Ali, Shahjahan; Brown, Judith K.
2014-01-01
Traditional DNA sequencing methods are inefficient, lack the ability to discern the least abundant viral sequences, and ineffective for determining the extent of variability in viral populations. Here, populations of single-stranded DNA plant
Aerosol and rainfall variability over the Indian monsoon region: distributions, trends and coupling
Directory of Open Access Journals (Sweden)
R. Gautam
2009-09-01
Full Text Available Aerosol solar absorption over the Indian monsoon region has a potential role of modulating the monsoon circulation and rainfall distribution as suggested by recent studies based on model simulations. Prior to the onset of the monsoon, northern India is influenced by significant dust transport that constitutes the bulk of the regional aerosol loading over the Gangetic-Himalayan region. In this paper, a multi-sensor characterization of the increasing pre-monsoon aerosol loading over northern India, in terms of their spatial, temporal and vertical distribution is presented. Aerosol transport from the northwestern arid regions into the Indo-Gangetic Plains and over the foothills of the Himalayas is found to be vertically extended to elevated altitudes (up to 5 km as observed from the space-borne lidar measurements (CALIPSO. In relation with the enhanced pre-monsoon aerosol loading and the associated solar absorption effects on tropospheric temperature anomalies, this paper investigates the monsoon rainfall variability over India in recent past decades from an observational viewpoint. It is found that the early summer monsoon rainfall over India is on the rise since 1950s, as indicated by historical rainfall data, with over 20% increase for the period 1950–2004. This large sustained increase in the early summer rainfall is led by the observed strengthening of the pre-monsoon tropospheric land-sea thermal gradient over the Indian monsoon region as indicated by microwave satellite measurements (MSU of tropospheric temperatures from 1979–2007. Combined analysis of changes in tropospheric temperatures and summer monsoon rainfall in the past three decades, suggest a future possibility of an emerging rainfall pattern of a wetter monsoon over South Asia in early summer followed by a drier period.
Directory of Open Access Journals (Sweden)
IVAN MARTINI
2017-08-01
Full Text Available Basin-margin paralic deposits are sensitive indicators of relative sea-level changes and typically show complex stratigraphic architectures that only a facies-based sequence-stratigraphic approach, supported by detailed biostratigraphic data, can help unravel, thus providing constraints for the tectono-stratigraphic reconstructions of ancient basins. This paper presents a detailed facies analysis of Pliocene strata exposed in a marginal key-area of the northern Siena-Radicofani Basin (Tuscany, Italy, which is used as a ground for a new sequence-stratigraphic scheme of the studied area. The study reveals a more complex sedimentary history than that inferred from the recent geological maps produced as part of the Regional Cartographic Project (CARG, which are based on lithostratigraphic principles. Specifically, four sequences (S1 to S4, in upward stratigraphic order have been recognised, each bounded by erosional unconformities and deposited within the Zanclean-early Gelasian time span. Each sequence typically comprises fluvial to open marine facies, with deposits of different sequences that show striking lithological similarities.The architecture and internal variability shown by the studied depositional sequences are typical of low-accommodation basin-margin settings, that shows: i a poorly-developed to missing record of the falling-stage systems tract; ii a lowstand system tract predominantly made of fluvio-deltaic deposits; iii a highstand system tract with substantial thickness variation between different sequences due to erosional processes associated with the overlying unconformity; iv a highly variable transgressive system tract, ranging from elementary to parasequential organization.
Chang, Perng-Kuang; Scharfenstein, Leslie L; Solorzano, Cesar D; Abbas, Hamed K; Hua, Sui-Sheng T; Jones, Walker A; Zablotowicz, Robert M
2015-05-04
Aspergillus oryzae and Aspergillus flavus are closely related fungal species. The A. flavus morphotype that produces numerous small sclerotia (S strain) and aflatoxin has a unique 1.5 kb deletion in the norB-cypA region of the aflatoxin gene cluster (i.e. the S genotype). Phylogenetic studies have indicated that an isolate of the nonaflatoxigenic A. flavus with the S genotype is the ancestor of A. oryzae. Genome sequence comparison between A. flavus NRRL3357, which produces large sclerotia (L strain), and S-strain A. flavus 70S identified a region (samA-rosA) that was highly variable in the two morphotypes. A third type of samA-rosA region was found in A. oryzae RIB40. The three samA-rosA types were later revealed to be commonly present in A. flavus L-strain populations. Of the 182 L-strain A. flavus field isolates examined, 46%, 15% and 39% had the samA-rosA type of NRRL3357, 70S and RIB40, respectively. The three types also were found in 18 S-strain A. flavus isolates with different proportions. For A. oryzae, however, the majority (80%) of the 16 strains examined had the RIB40 type and none had the NRRL3357 type. The results suggested that A. oryzae strains in the current culture collections were mostly derived from the samA-rosA/RIB40 lineage of the nonaflatoxigenic A. flavus with the S genotype. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2015-10-05
This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.
Directory of Open Access Journals (Sweden)
Mohammad Reza Ashrafzadeh
2015-12-01
Full Text Available In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187 and high values of Fst (range=0.728-0.972 among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran was found to be around 19000 BP.
Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region
Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela
2008-01-01
The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...
[Hydrologic variability and sensitivity based on Hurst coefficient and Bartels statistic].
Lei, Xu; Xie, Ping; Wu, Zi Yi; Sang, Yan Fang; Zhao, Jiang Yan; Li, Bin Bin
2018-04-01
Due to the global climate change and frequent human activities in recent years, the pure stochastic components of hydrological sequence is mixed with one or several of the variation ingredients, including jump, trend, period and dependency. It is urgently needed to clarify which indices should be used to quantify the degree of their variability. In this study, we defined the hydrological variability based on Hurst coefficient and Bartels statistic, and used Monte Carlo statistical tests to test and analyze their sensitivity to different variants. When the hydrological sequence had jump or trend variation, both Hurst coefficient and Bartels statistic could reflect the variation, with the Hurst coefficient being more sensitive to weak jump or trend variation. When the sequence had period, only the Bartels statistic could detect the mutation of the sequence. When the sequence had a dependency, both the Hurst coefficient and the Bartels statistics could reflect the variation, with the latter could detect weaker dependent variations. For the four variations, both the Hurst variability and Bartels variability increased with the increases of variation range. Thus, they could be used to measure the variation intensity of the hydrological sequence. We analyzed the temperature series of different weather stations in the Lancang River basin. Results showed that the temperature of all stations showed the upward trend or jump, indicating that the entire basin had experienced warming in recent years and the temperature variability in the upper and lower reaches was much higher. This case study showed the practicability of the proposed method.