WorldWideScience

Sample records for vandenberg afb united

  1. CloudSat Safety Operations at Vandenberg AFB

    Science.gov (United States)

    Greenberg, Steve

    2006-01-01

    CloudSat safety operations at Vendenberg AFB is given. The topics include: 1) CloudSat Project Overview; 2) Vandenberg Ground Operations; 3) Delta II Launch Vehicle; 4) The A-Train; 5) System Safety Management; 6) CALIPSO Hazards Assessment; 7) CALIPSO Supplemental Safeguards; 8) Joint System Safety Operations; 9) Extended Stand-down; 10) Launch Delay Safety Concerns; and 11) Lessons Learned.

  2. Environmental Assessment, Minuteman III and Peacekeeper Silo Elimination, Malmstrom AFB, Montana; F. E. Warren AFB, Wyoming; and Vandenberg AFB, California

    Science.gov (United States)

    2013-05-01

    Baccharis pilularis), California sagebrush (Artemisia californica), and poison hemlock ( Conium maculatum ) are common species in the area (Vandenberg AFB...spotted bat (Euderma maculatum ) and Preble’s shrew (Sorex preblei). Habitat for the spotted bat is most often in rough, rocky, semiarid, and arid

  3. 33 CFR 334.1130 - Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones.

    Science.gov (United States)

    2010-07-01

    ... Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. 334.1130 Section 334.1130 Navigation and... RESTRICTED AREA REGULATIONS § 334.1130 Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB... (WSMC) at Vandenberg AFB, California. (3) The impacting of missile debris from launch operations will...

  4. Surface to 90 km winds for Kennedy Space Center, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Johnson, D. L.; Brown, S. C.

    1979-01-01

    Bivariate normal wind statistics for a 90 degree flight azimuth, from 0 through 90 km altitude, for Kennedy Space Center, Florida, and Vandenberg AFB, California are presented. Wind probability distributions and statistics for any rotation of axes can be computed from the five given parameters.

  5. NOAA-L satellite arrives at Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    Outside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., a crated National Oceanic and Atmospheric Administration (NOAA-L) satellite is lowered to the ground before being moved inside. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Evaluation of bromide mass discharge in a sandy aquifer at Vandenberg AFB, CA

    Science.gov (United States)

    Mackay, D. M.; Rasa, E.; Einarson, M.; Kaiser, P.; Chakraborty, I.; Scow, K. M.

    2009-12-01

    Side-by-side experiments were conducted by UC Davis research team at a former fuel station at Vandenberg Air Force Base (AFB) to evaluate the rate of transformation of methyl tert-butyl ether (MTBE) to tert-butyl alcohol (TBA) impacted by ethanol and to investigate evidence of TBA degradation under sulfate reducing conditions. On one side we injected groundwater amended with ethanol and MTBE. In the other lane we injected groundwater amended with TBA. On both sides, injected ground water was spiked with bromide tracer to provide estimates of groundwater flow direction variations, flow velocity, dispersion, and mobile mass loss resulting from diffusive sequestration into aquitards. 162 monitoring wells were aligned into seven transects located downgradient of the injection wells. The mass discharge approach was used to evaluate the natural attenuation of the injected constituents. In this talk we will focus on calculations of mass discharge of the bromide tracer at each of the seven monitoring well transects. The amount of bromide mass discharged through each transect was calculated for any sampling time using field measurements of break through curves. Cumulative mass discharges were estimated and, by iteration based on mass balance, the flow properties of the aquifer were estimated. The calibration process resulted in subtle but quantitatively important changes in our assumptions regarding key physical properties of the aquifer (thickness, porosity) which could be only approximately estimated by standard methods (coring, CPT, etc.). On the basis of this calibration, a more robust approach was devised for evaluating the source and fate of TBA in the aquifer.

  6. NOAA-L satellite is mated to Apogee Kick Motor at Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    Inside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., workers oversee the mating of the Apogee Kick Motor (below) to the National Oceanic and Atmospheric Administration (NOAA-L) satellite above. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Vector wind and vector wind shear models 0 to 27 km altitude for Cape Kennedy, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Smith, O. E.

    1976-01-01

    The techniques are presented to derive several statistical wind models. The techniques are from the properties of the multivariate normal probability function. Assuming that the winds can be considered as bivariate normally distributed, then (1) the wind components and conditional wind components are univariate normally distributed, (2) the wind speed is Rayleigh distributed, (3) the conditional distribution of wind speed given a wind direction is Rayleigh distributed, and (4) the frequency of wind direction can be derived. All of these distributions are derived from the 5-sample parameter of wind for the bivariate normal distribution. By further assuming that the winds at two altitudes are quadravariate normally distributed, then the vector wind shear is bivariate normally distributed and the modulus of the vector wind shear is Rayleigh distributed. The conditional probability of wind component shears given a wind component is normally distributed. Examples of these and other properties of the multivariate normal probability distribution function as applied to Cape Kennedy, Florida, and Vandenberg AFB, California, wind data samples are given. A technique to develop a synthetic vector wind profile model of interest to aerospace vehicle applications is presented.

  7. The second stage of a Titan II rocket is lifted for mating at the launch tower, Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    At the launch tower, Vandenberg Air Force Base, Calif., the second stage of a Titan II rocket is lifted to vertical. The Titan will power the launch of a National Oceanic and Atmospheric Administration (NOAA-L) satellite scheduled no earlier than Sept. 12. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. An inverse modeling approach to estimate groundwater flow and transport model parameters at a research site at Vandenberg AFB, CA

    Science.gov (United States)

    Rasa, E.; Foglia, L.; Mackay, D. M.; Ginn, T. R.; Scow, K. M.

    2009-12-01

    A numerical groundwater fate and transport model was developed for analyses of data from field experiments evaluating the impacts of ethanol on the natural attenuation of benzene, toluene, ethylbenzene, and xylenes (BTEX) and methyl tert-butyl ether (MTBE) at Vandenberg Air Force Base, Site 60. We used the U.S. Geological Survey (USGS) groundwater flow (MODFLOW2000) and transport (MT3DMS) models in conjunction with the USGS universal inverse modeling code (UCODE) to jointly determine flow and transport parameters using bromide tracer data from multiple experiments in the same location. The key flow and transport parameters include hydraulic conductivity of aquifer and aquitard layers, porosity, and transverse and longitudinal dispersivity. Aquifer and aquitard layers were assumed homogenous in this study. Therefore, the calibration parameters were not spatially variable within each layer. A total of 162 monitoring wells in seven transects perpendicular to the mean flow direction were monitored over the course of ten months, resulting in 1,766 bromide concentration data points and 149 head values used as observations for the inverse modeling. The results showed the significance of the concentration observation data in predicting the flow model parameters and indicated the sensitivity of the hydraulic conductivity of different zones in the aquifer including the excavated former contaminant zone. The model has already been used to evaluate alternative designs for further experiments on in situ bioremediation of the tert-butyl alcohol (TBA) plume remaining at the site. We describe the recent applications of the model and future work, including adding reaction submodels to the calibrated flow model.

  8. GPS Measurements at Vandenberg, AFB

    Science.gov (United States)

    1993-02-22

    friorov, S A Ahic Aia.. SSSR DoAf US9. Ill𔃺 1113 I Iughison. J I (ec O Clmate chirie The 07CC scientific Assessment (Cambridge ni~v Pressý 16 snez. MC... Change or Climate (Wolo~ng GrOAI Viii eHefta Comm’ents 14 Timerev A A & Egorov S A A4lereotof G&droi lo 7 50-56 e91e .r condied 13 A A TsonoS...Complex. might easily be recovering from the mainshock accelerations An examination of the station displacements indicates that Comparing the changing

  9. Baseline Noise Measurements at Vandenberg AFB, California.

    Science.gov (United States)

    1988-01-01

    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v rm--0ow.in .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  10. Final Programmatic Environmental Assessment for the 2011-2015 Integrated Natural Resources Management Plan for Vandenberg Air Force Base, California

    Science.gov (United States)

    2011-08-16

    UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Tetra Tech, Inc.,301 Mentor Drive, Suite A,Santa Barbara,CA,93111 8. PERFORMING ...Vandenberg AFB may not be known, base-wide surveys would be performed to document new populations.  Because rare species populations are dynamic and their...football/baseball/ softball fields, tennis courts, running tracks, picnic areas, and bicycle paths. Additional information regarding the outdoor

  11. Study on the Treatment of Wastewater Generated at KSC (Kennedy Space Center) STS (Space Transport System) Operations and Projected Effects on the Design of the STS Hazardous Waste Management Facility at Vandenberg AFB, California.

    Science.gov (United States)

    1983-10-01

    launch which gradually falls back to earth. This dust could be a combination of residual sandblasting sand on the launch support facilities, soil from...considerations, which were identified as follows on items from the STS-6 jar test evaluations: o The Effect of Temperature on Silica Precipitation...concrete and the geometry of the flame ducts at Vandenberg compared to KSC. The other 20% of the sludge results from additives ( diatomite and polymer) to

  12. Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California. Supplement.

    Science.gov (United States)

    1983-07-01

    2 of the Northern Channel Islands, have been motivated in part by concerns identified through interaction between the Air Force and the Coastal...ofA.SrZ 64 0 /OC 2SS - So#e.e. V, f-rrAq ~ WA~oJsie4,e~4 A-I 4&Ajt4 A fLA1//.t"lJAde~ R-SeI~u- dw rwy. £A4Pcr SL3*p~j* ps4 .Prm Al-fdc6k -5)’-ArFkAJ /7

  13. History of wildland fires on Vandenberg Air Force Base, California

    Science.gov (United States)

    Hickson, Diana E.

    1988-01-01

    The fire history of the past 50 years for Vandenberg AFB, California was determined using aerial photography, field investigation, and historical and current written records. This constitutes a record of the vegetation age classes for the entire base. The location, cause, and fuel type for sixty fires from this time period were determined. The fires were mapped and entered into a geographic infomation system (GIS) for Vandenberg. Fire history maps derived from this GIS were printed at 1:9600 scale and are on deposit at the Vandenberg Environmental Task Force Office. Although some ecologically significant plant communities on Vandenberg are adapted to fire, no natural fire frequency could be determined, since only one fire possibly caused by lightning occurred in the area now within the base since 1937. Observations made during this study suggest that burning may encourage the invasion of exotic species into chaparral, in particular Burton Mesa or sandhill chaparral, an unusual and geographically limited form of chaparral found on the base.

  14. Environmental Assessment for Vandenberg Gate Complex Construction, Dorm Construction and Demolition at Hanscom Air Force Base, Massachusetts

    Science.gov (United States)

    2014-12-01

    existing boundary line were examined for suitability for the Vandenberg Gate Complex construction. Essentially these “on-base” alternatives looked at the...together for purposes of estimating emissions (HAFB 2014d). Hanscom AFB also operates 13 small oil fired boilers ranging in size from 0.1 MMBtu/hr...located between the road and Hanscom AFB housing. The wooded buffer is composed primarily of a mixture of white pine ( Pinus strobus), red maple (Acer

  15. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland AFB, White Sands Missile Range/ Holloman AFB, New Mexico; Edwards AFB, Vandenberg AFB, California

    Science.gov (United States)

    2003-06-01

    Sneed pincushion cactus T Kuen_zler hedgehog cactus - Sacramento oricklv ooppy - I Sacramento Mountains checkerspot - ! butterfly . . Federal Status E...caiifomicus Coho salmon ~_j_Pncorhynchus kisutch , Unarmoured three- spined 1 C~asterosleus aculeatus- ----: stickleback , wi/liamsoni 1 E T E...septentrionalis) Kuenzler hedgehog cachts (Echinocereus fendleri var. kuenzleri) THREATENED Bald eagle (Haliaeetus /.:ucocephalus) Mexican spotted owl (Strix

  16. Environmental Impact Analysis Process. Supplement to Final Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California

    Science.gov (United States)

    1983-07-01

    access roads to industrial parks and areas, public tourism facilities and vocational schools. Eligible applicants include states, cities, coun- ties...Fill tum f~rm tmkszc tUV&, stege pcopelintu, and supply pcopaL1ans to Smm aiattia whica at the mmo Pa. * Ibims - prape1int pumps, vapt boil-off

  17. Environmental Assessment: Base Realignment and Closure (BRAC) 2005 Mission Realignments to Vandenberg AFB

    Science.gov (United States)

    2007-02-01

    implied by altered connective tissue metabolism and altered pulmonary morphology in animals after long-term exposures and pulmonary function...addition to the wildlife found in chaparral, other species include mammals like Heerman’s kangaroo rat (Dipodomys heermanni), Broad-footed mole (Scapanus

  1. Environmental Impact Analysis Process. Environmental Impact Statement Space Shuttle Program Vandenberg AFB, California

    Science.gov (United States)

    1978-01-01

    MAIMIEOIR, NATIUM L FEATURES TO BE ALTERED: Nost applicable. EMISSIONS: .• Operational: Space Shuttle main eagin. and SolidRocket Roast r exhaust. 414...symptom. (50) (2) From animal studies" (a) Bobwhite quail and domestic chicken eggs displayed a 50 percent mortality rate upon a single 15-minute exposure...t In another planned study (as opposed to casual observation) chicken eggs were exposed to about 30 sonic booms per day during incubation; median

  2. Level II Ergonomic Analyses, Dover AFB, DE

    Science.gov (United States)

    1999-02-01

    IERA-RS-BR-TR-1999-0002 UNITED STATES AIR FORCE IERA Level II Ergonomie Analyses, Dover AFB, DE Andrew Marcotte Marilyn Joyce The Joyce...Project (070401881, Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 4. TITLE AND SUBTITLE Level II Ergonomie Analyses, Dover...1.0 INTRODUCTION 1-1 1.1 Purpose Of The Level II Ergonomie Analyses : 1-1 1.2 Approach 1-1 1.2.1 Initial Shop Selection and Administration of the

  3. Hydrogen disposal investigation for the Space Shuttle launch complex at Vandenberg Air Force Base

    Science.gov (United States)

    Breit, Terry J.; Elliott, George

    1987-01-01

    The concern of an overpressure condition on the aft end of the Space Shuttle caused by ignition of unburned hydrogen being trapped in the Space Shuttle Main Engine exhaust duct at the Vandenberg AFB launch complex has been investigated for fifteen months. Approximately twenty-five concepts have been reviewed, with four concepts being thoroughly investigated. The four concepts investigated were hydrogen burnoff ignitors (ignitors located throughout the exhaust duct to continuously ignite any unburned hydrogen), jet mixing (utilizing large volumes of high pressure air to ensure complete combustion of the hydrogen), steam inert (utilizing flashing hot water to inert the duct with steam) and open duct concept (design an open duct or above grade J-deflector to avoid trapping hydrogen gas). Extensive studies, analyses and testing were performed at six test sites with technical support from twenty-two major organizations. In December 1986, the Air Force selected the steam inert concept to be utilized at the Vandenberg launch complex and authorized the design effort.

  4. Environmental Assessment: Conversion of the 820th Security Forces Group at Moody AFB, Georgia to a Contingency Response Group

    Science.gov (United States)

    2003-08-01

    Contingency Response Group (CRG) at Moody Air Force Base (AFB), GA . DESCRIPTION OF THE PROPOSED ACTION AND ALTERNATIVES. The United States Air Force...sinkhole formation. 3.5.3.3 Soils Moody AFB Moody AFB is located in the Tifton Upland District of the Lower Coastal Plain. In general, soils on...base. Arsenic, barium, chromium, copper, iron, selenium, and zinc have been found to be naturally occurring in the area. Predominant soils are Tifton

  5. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland Air Force Base (AFB) and White Sands Missile Range/Holloman AFB, NM, and Edwards AFB and Vandenberg AFB, CA

    Science.gov (United States)

    2003-06-01

    californicus- _" -~ T ~ - 1" T - E I T Coho salmon Unarmoured three- spined stickleback I Tidewater goby 1 Eucyclogobius n e w b e p i ,.I...ENDANGERED Black-footed ferret (Mustela nigripes)"" Northern aplomado falcon (Falcofemoralis septentrionalis) Kuenzler hedgehog cachls (Echi...Empidonax traillii ertimus) Kuenzler hedgehog cactus (Echinocer~.~rendleri var. kuenzleri) Todsen’s pennyroyal (Hedeoma fodsenii) Sacramento

  6. Analysis of wind bias change with respect to time at Cape Kennedy, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Adelfang, S. I.

    1978-01-01

    A statistical analysis is presented of the temporal variability of wind vectors at 1 km altitude intervals from 0 to 27 km altitude after applying a digital filter to the original wind profile data sample.

  7. Vandenberg Air Force Base Emission Survey.

    Science.gov (United States)

    1983-01-01

    propellants (hydrazine, UDMH , HDA [a high density IRFNA]) are transferred to 1,300 gallon weigh tanks called Propellant Transfer Units (PTUs). These...efficiency: 90% Use conversion formula of: (flow rate in scfm) ( UDMH vapor weight factor) (60 min/hr) = lb/hr (5 ft3/min) (1.56 x 10-4 x 210 Kppm lb/ft...materials included: 6 ’ i-1 hydrazine, unsymmetrical dimethyl hydrazine, monomethyl hydrazine, Aerozine-50 ( UDMH /hydrazine), inhibited red fuming nitric acid

  8. Vandenberg Air Force Base Upper Level Wind Launch Weather Constraints

    Science.gov (United States)

    Shafer, Jaclyn A.; Wheeler, Mark M.

    2012-01-01

    The 30th Operational Support Squadron Weather Flight (30 OSSWF) provides comprehensive weather services to the space program at Vandenberg Air Force Base (VAFB) in California. One of their responsibilities is to monitor upper-level winds to ensure safe launch operations of the Minuteman III ballistic missile. The 30 OSSWF tasked the Applied Meteorology Unit (AMU) to analyze VAFB sounding data with the goal of determining the probability of violating (PoV) their upper-level thresholds for wind speed and shear constraints specific to this launch vehicle, and to develop a tool that will calculate the PoV of each constraint on the day of launch. In order to calculate the probability of exceeding each constraint, the AMU collected and analyzed historical data from VAFB. The historical sounding data were retrieved from the National Oceanic and Atmospheric Administration Earth System Research Laboratory archive for the years 1994-2011 and then stratified into four sub-seasons: January-March, April-June, July-September, and October-December. The maximum wind speed and 1000-ft shear values for each sounding in each subseason were determined. To accurately calculate the PoV, the AMU determined the theoretical distributions that best fit the maximum wind speed and maximum shear datasets. Ultimately it was discovered that the maximum wind speeds follow a Gaussian distribution while the maximum shear values follow a lognormal distribution. These results were applied when calculating the averages and standard deviations needed for the historical and real-time PoV calculations. In addition to the requirements outlined in the original task plan, the AMU also included forecast sounding data from the Rapid Refresh model. This information provides further insight for the launch weather officers (LWOs) when determining if a wind constraint violation will occur over the next few hours on day of launch. The interactive graphical user interface (GUI) for this project was developed in

  9. San Antonio Creek Restoration, Vandenberg Air Force Base, California

    Science.gov (United States)

    2008-06-27

    Vandenberg Air Force Base Scientific Name Common Name Scientific Name Common Name Sambucus mexicana Blue elderberry Sonchus oleraceus * Common sow... Sonchus oleraceus Common sow-thistle exotic NI Spergularia bocconii Sand-spurry exotic FAC Spergularia marina Sand-spurry native FACW...border the existing roads within the project area. Both weedy non-native species adapted to frequent disturbance, such as sow thistle ( Sonchus

  10. Hoyt S. Vandenberg, The Life of a General

    Science.gov (United States)

    2000-01-01

    Offensive, 1939-1945 (London: Arms and Armour Press, 1984), p. 157; Kenneth Young, ed., The Dia- ries of Robert Bruce Lockhart, Vol. 2: 1939-1965...Godfrey McHugh, Vandenberg’s aide, recalled that Mrs. LeMay was at the Twining quarters measuring windows for drapes when word was announced that there...Messenger, Charles. "Bomber" Harris and the Strategic Bombing Offensive, 1939-1945. London: Arms and Armour Press, 1984. Millis, Walter, and E. S

  11. Vandenberg Air Force Base Pressure Gradient Wind Study

    Science.gov (United States)

    Shafer, Jaclyn A.

    2013-01-01

    Warning category winds can adversely impact day-to-day space lift operations at Vandenberg Air Force Base (VAFB) in California. NASA's Launch Services Program and other programs at VAFB use wind forecasts issued by the 30 Operational Support Squadron Weather Flight (30 OSSWF) to determine if they need to limit activities or protect property such as a launch vehicle. The 30 OSSWF tasked the AMU to develop an automated Excel graphical user interface that includes pressure gradient thresholds between specific observing stations under different synoptic regimes to aid forecasters when issuing wind warnings. This required the AMU to determine if relationships between the variables existed.

  12. John Dewey's Conception of Educative Experience: A Response to Donald Vandenberg's "Education or Experience?"

    Science.gov (United States)

    Chambliss, J. J.

    1982-01-01

    Responding to an article by Donald Vandenberg (Educational Theory, Summer 1980) on the meaning of the phrase "educative experience" in John Dewey's "Democracy in Education," Chambliss says that Vandenberg misunderstands Dewey's conception of both education and experience. Social and educational implications of Dewey's thought…

  13. Survey of Wastewater Discharge, Eielson AFB, Alaska, EHL(K) 73-24

    National Research Council Canada - National Science Library

    Thomas, Jerry F; Pauls, Chester F

    1973-01-01

    This report contains the results of a wastewater survey at Eielson AFB, Alaska, conducted by the USAF Environmental Health Laboratories, Kelly AFB, Texas and McClellan AFB, CA, between 22 and 27 June 1973...

  14. Aerospace medicine at Brooks AFB, TX: hail and farewell.

    Science.gov (United States)

    Nunneley, Sarah A; Webb, James T

    2011-05-01

    With the impending termination of USAF operations at Brooks Air Force Base (AFB) in San Antonio, TX, it is time to consider its historic role in Aerospace Medicine. The base was established in 1917 as a flight training center for the U.S. Army Air Service and in 1926 became home to its School of Aviation Medicine. The school moved to San Antonio's Randolph Field in 1931, but in 1959 it returned to Brooks where it occupied new facilities to support its role as a national center for U.S. Air Force aerospace medicine, including teaching, clinical medicine, and research. The mission was then expanded to encompass support of U.S. military and civilian space programs. With the abrupt termination of the military space program in 1969, research at Brooks focused on clinical aviation medicine and support of advanced military aircraft while continuing close cooperation with NASA in support of orbital spaceflight and the journey to the Moon. Reorganization in the 1990s assigned all research functions at Brooks to the Human Systems Division and its successors, leaving to USAFSAM the missions related to clinical work and teaching. In 2002 the USAF and the city of San Antonio implemented shared operation of Brooks as a "City-Base" in the hope of deflecting threatened closure. Nevertheless, under continuing pressure to consolidate military facilities in the United States, the 2005 Base Closure and Realignment Commission ordered Brooks closed by 2011, with its aerospace medicine functions relocated to new facilities at Wright-Patterson AFB in Dayton, OH.

  15. Final Environmental Assessment for the California Space Center at Vandenberg Air Force Base, California

    Science.gov (United States)

    2010-06-02

    rooted , mesophylic plant species that Chapter 3. Affected Environment Final Environmental Assessment - California Space Center, Vandenberg Air...Chapter 3. Affected Environment 3-12 Final Environmental Assessment - California Space Center, Vandenberg Air Force Base the root and debris zone of the...protruding objects, slippery soils or mud, and biological hazards including vegetation (i.e. poison oak and stinging nettle ), animals (i.e. insects

  16. Learning as Existential Engagement with/in Place: Departing from Vandenberg and the Reams

    Science.gov (United States)

    Hung, Ruyu

    2014-01-01

    This article takes Vandenberg's critique of Ream and Ream's view on the Deweyan learning environment as a departing point to explore the educational meaning of place. The divergence between Vandenberg and the Reams reminds us that the place is not merely a physical site for learners to be located in but also a horizon to be engaged with.…

  17. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    International Nuclear Information System (INIS)

    Theumer, M.G.; Lopez, A.G.; Masih, D.T.; Chulze, S.N.; Rubinstein, H.R.

    2003-01-01

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H 2 O 2 , while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H 2 O 2 . These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins

  18. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Energy Technology Data Exchange (ETDEWEB)

    Theumer, M G; Lopez, A G; Masih, D T; Chulze, S N; Rubinstein, H R

    2003-04-15

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H{sub 2}O{sub 2}, while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H{sub 2}O{sub 2}. These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins.

  19. Ground-Based Midcourse Defense (GMD) Initial Defensive Operations Capability (IDOC) at Vandenberg Air Force Base Environmental Assessment

    Science.gov (United States)

    2003-08-28

    Zielinski , EDAW, Inc., concerning utilities supply and demand for Vandenberg Air Force Base, 1 August. Rush, P., 2002. Personal communication between...Pernell W. Rush, Technical Sergeant, Water Utilities/Water Treatment NCO, USAF 30th CES/CEOIU, Vandenberg Air Force Base, and James E. Zielinski ... Dave Savinsky, Environmental Consultant, 30 CES/CEVC, Vandenberg Air Force Base, on the Preliminary Draft Ground-Based Midcourse Defense (GMD

  20. AFB/open cycle gas turbine conceptual design study

    Science.gov (United States)

    Dickinson, T. W.; Tashjian, R.

    1983-09-01

    Applications of coal fired atmospheric fluidized bed gas turbine systems in industrial cogeneration are identified. Based on site-specific conceptual designs, the potential benefits of the AFB/gas turbine system were compared with an atmospheric fluidized design steam boiler/steam turbine system. The application of these cogeneration systems at four industrial plant sites is reviewed. A performance and benefit analysis was made along with a study of the representativeness of the sites both in regard to their own industry and compared to industry as a whole. A site was selected for the conceptual design, which included detailed site definition, AFB/gas turbine and AFB/steam turbine cogeneration system designs, detailed cost estimates, and comparative performance and benefit analysis. Market and benefit analyses identified the potential market penetration for the cogeneration technologies and quantified the potential benefits.

  1. 78 FR 64839 - Endangered and Threatened Wildlife and Plants; Endangered Status for Vandenberg Monkeyflower

    Science.gov (United States)

    2013-10-29

    ... endangered species under the Endangered Species Act. If we finalize this rule as proposed, it would extend the Endangered Species Act's protections to this plant. The effect of this regulation will be to add Vandenberg monkeyflower to the List of Endangered and Threatened Plants under the Endangered Species Act...

  2. Analysis of vector wind change with respect to time for Vandenberg Air Force Base, California

    Science.gov (United States)

    Adelfang, S. I.

    1978-01-01

    A statistical analysis of the temporal variability of wind vectors at 1 km altitude intervals from 0 to 27 km altitude taken from a 10-year data sample of twice-daily rawinsode wind measurements over Vandenberg Air Force Base, California is presented.

  3. CloudSat Preps for Launch at Vandenberg Air Force Base, CA

    Science.gov (United States)

    2005-01-01

    The CloudSat spacecraft sits encapsulated within its Boeing Delta launch vehicle dual payload attach fitting at Vandenberg Air Force Base, Calif. CloudSat will share its ride to orbit late next month with NASA's CALIPSO spacecraft. The two spacecraft are designed to reveal the secrets of clouds and aerosols.

  4. Environmental Assessment of Beale AFB Grazing Lease Program

    Science.gov (United States)

    2012-12-01

    Beale AFB will use livestock (cattle, sheep and goats ) on its properties throughout the year as needed for the control of noxious weeds, reduction...initiating a wildfire. California Farm Bureau Federation policy recognizes that grazing is the most practical and environmentally acceptable way to...Site Monitoring Well Installation and Annual Targeted Goat Grazing Project, Placer County, California. 21 September 2011.  

  5. Environmental Assessment for Landfill Drainage Improvements Vandenberg Air Force Base, California

    Science.gov (United States)

    2003-04-07

    became increasingly important, corresponding to development of the tomol (a plank canoe), single-piece shell fishhooks, and harpoons (Glassow 1996...Chumash had a culture that "was as elaborate as that of any hunter-gatherer society on earth" (Moratto 1984: 118). Leadership was hereditary and chiefs...Improvements Vandenberg Air Force Base, California I I I I I I I Erlandson, Jon M., and Kevin Bartoy 1995 Cabrillo, the Chumash, and Old

  6. Building Energy Audit Report, for Hickam AFB, HI

    Energy Technology Data Exchange (ETDEWEB)

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.

    2010-09-30

    A building energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Hickam AFB, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This documents reports the results of that assessment.

  7. Final Environmental Assessment: Replace Hanscom AFB Middle School

    Science.gov (United States)

    2012-04-01

    2012 iv RFTA Reserve Forces Training Area SAPS Satellite Accumulation Points SF Square feet SIP State Implementation Plan SO2 Sulfur dioxide...Restoration Program (IRP), now called the Environmental Restoration Program ( ERP ). Subsequent discoveries increased the number of sites to 22. Each...EPA under CERCLA or by the Commonwealth of Massachusetts. No sites listed in the ERP for Hanscom AFB are located on or near the existing Middle

  8. Historic Landscape Survey, Maxwell AFB, Alabama

    Science.gov (United States)

    2013-08-01

    signifies Maxwell AFB’s historic landscapes. 2.1 The pre-military landscape Prehistory in the southeastern United States is generally designated as...the period of Native American occupation before Spanish explorers made contact in the fifteenth and sixteenth centuries. In Alabama, the prehistory ... prehistory or history is made clear.56 A historic property is determined to be either significant or not significant by applying standardized National

  9. Preliminary Assessment of Potential Avian Interactions at Four Proposed Wind Energy Facilities on Vandenberg Air Force Base, California

    Energy Technology Data Exchange (ETDEWEB)

    2004-08-01

    The United States Air Force (USAF) is investigating whether to install wind turbines to provide a supplemental source of electricity at Vandenberg Air Force Base (VAFB) near Lompoc, California. As part of that investigation, VAFB sought assistance from the U.S. Department of Energy's National Renewable Energy Laboratory (NREL) to provide a preliminary characterization of the potential risk to wildlife resources (mainly birds and bats) from wind turbine installations. With wind power development expanding throughout North America and Europe, concerns have surfaced over the number of bird fatalities associated with wind turbines. Guidelines developed for the wind industry by the National Wind Coordinating Committee (NWCC) recommend assessing potential impacts to birds, bats, and other potentially sensitive resources before construction. The primary purpose of an assessment is to identify potential conflicts with sensitive resources, to assist developers with identifying their permitting needs, and to develop strategies to avoid impacts or to mitigate their effects. This report provides a preliminary (Phase I) biological assessment of potential impacts to birds and bats that might result from construction and operation of the proposed wind energy facilities on VAFB.

  10. Frequency of sputum positive AFB cases among patients of pulmonary tuberculosis in tertiary care hospitals of northern Pakistan

    International Nuclear Information System (INIS)

    Khattak, M.I.; Zaman, M.; Ihsanullah; Muhammad, A.; Khan, N.

    2010-01-01

    Objective: This study was aimed to find out the frequency of sputum positive Acid Fast Bacilli (AFB) cases among pulmonary tuberculosis patients and to determine those patients who are the potential source of transmitting infection. Methods: This study was conducted in four medical units of Khyber Teaching Hospital, Peshawar and Chest Unit, Ayub Teaching Hospital, Abbottabad in collaboration with the pathology unit of Khyber Teaching Hospital, Peshawar, and Kohat Institute of Medical Sciences, Kohat. Three specimens of sputum were collected for three consecutive days in the morning and were transported immediately to the laboratory along with full details of the patients. Results: Out of two hundred total patients studied, 104 patients (52%) were sputum AFB positive. Among the 104 patients 60 patients (57.4%) were females. Sixty-four (61.52%) individuals were between 20-50 years. Majority of the patients were from poor, deprived and lower social class. Fifty-two (50%) patients had monthly income of less than Rs. 4,000; only 8 patients (7.67%) had monthly income of more than Rs. 12,000). Forty-eight patients <46.12% were house wives, 10 patients (9.61%) were unemployed. Most of the patients were under weight for their age and height. 24 patients (23.06%) were below 42 kg. The maximum (53.84%) number of patients was in weight range of 43-50 kg. Conclusion: Sputum AFB positive pulmonary tuberculosis is more in individuals of low socioeconomic group and in females. The patients put their children and family members at risk of tuberculosis infection. For the control of this disease early diagnosis of active disease and their treatment under supervision is important. (author)

  11. A steam inerting system for hydrogen disposal for the Vandenberg Shuttle

    Science.gov (United States)

    Belknap, Stuart B.

    1988-01-01

    A two-year feasibility and test program to solve the problem of unburned confined hydrogen at the Vandenberg Space Launch Complex Six (SLC-6) during Space Shuttle Main Engine (SSME) firings is discussed. A novel steam inerting design was selected for development. Available sound suppression water is superheated to flash to steam at the duct entrance. Testing, analysis, and design during 1987 showed that the steam inerting system (SIS) solves the problem and meets other flight-critical system requirements. The SIS design is complete and available for installation at SLC-6 to support shuttle or derivative vehicles.

  12. Determining the Probability of Violating Upper-Level Wind Constraints for the Launch of Minuteman Ill Ballistic Missiles At Vandenberg Air Force Base

    Science.gov (United States)

    Shafer, Jaclyn A.; Brock, Tyler M.

    2013-01-01

    The 30th Operational Support Squadron Weather Flight (30 OSSWF) provides comprehensive weather services to the space program at Vandenberg Air Force Base (VAFB) in California. One of their responsibilities is to monitor upper-level winds to ensure safe launch operations of the Minuteman Ill ballistic missile. The 30 OSSWF requested the Applied Meteorology Unit (AMU) analyze VAFB sounding data to determine the probability of violating (PoV) upper-level thresholds for wind speed and shear constraints specific to this launch vehicle, and to develop a graphical user interface (GUI) that will calculate the PoV of each constraint on the day of launch. The AMU suggested also including forecast sounding data from the Rapid Refresh (RAP) model. This would provide further insight for the launch weather officers (LWOs) when determining if a wind constraint violation will occur over the next few hours, and help to improve the overall upper winds forecast on launch day.

  13. Final Environmental Assessment for Minuteman III Modification

    National Research Council Canada - National Science Library

    Huynh, Thomas; Kriz, Joseph; Lindman, Terry; Ramanujam, Ram

    2004-01-01

    .... The locations covered in this EA include: FE Warren Air Force Base (AFB), WY; Hill AFB, UT; Malmstrom AFB, MT; Minot AFB, ND; Vandenberg AFB, CA; and US Army Kwajalein Atoll, Republic of the Marshall Islands.

  14. Vandenberg Air Force Base integrated resource assessment. Volume 3, Resource assessment

    Energy Technology Data Exchange (ETDEWEB)

    Daellenbach, K.K.; Dagle, J.E.; Dittmer, A.L.; Elliott, D.B.; Halverson, M.A.; Hickman, B.J.; Parker, G.B.; Richman, E.E.; Shankle, S.A.

    1993-06-01

    The US Air Force Space Command (SPACECOM) has tasked the Pacific Northwest Laboratory (PNL), as the lead laboratory supporting the US Department of Energy (DOE) Federal Energy Management Program (FEMP), to identify, evaluate, and assist in acquiring all cost-effective energy projects at Vandenberg Air Force Base (VAFB). This is part of a model program that PNL is designing to support energy-use decisions in the federal sector. This report provides the results of the fossil fuel and electric energy resource opportunity (ERO) assessments performed by PNL at the SPACECOM VAFB facility located approximately 50 miles northwest of Santa Barbara, California. It is a companion report to Volume 1, Executive Summary, and Volume 2, Baseline Detail. The results of the analysis of EROs are presented in ten common energy end-use categories (e.g., boilers and furnaces, service hot water, and building lighting). In addition, a case study of process loads at Space Launch Complex-4 (SLC-4) is included. A narrative description of each ERO is provided, including information on the installed cost, energy and dollar savings; impacts on operation and maintenance (O and M); and, when applicable, a discussion of energy supply and demand, energy security, and environmental issues. A description of the evaluation methodologies and technical and cost assumptions is also provided for each ERO. Summary tables present the cost-effectiveness of energy end-use equipment before and after the implementation of each ERO and present the results of the life-cycle cost (LCC) analysis indicating the net present value (NPV) and value index (VI) of each ERO. Finally, an appendix includes a summary of an economic analysis case study of the South Vandenberg Power Plant (SVPP) operating scenarios.

  15. High School Students' Performance on Vandenberg's Mental Rotations Test: Art Ability, Gender, Activities, Academic Performance, Strategies, and Ease of Taking the Test.

    Science.gov (United States)

    Gurny, Helen Graham

    This study tested whether mental rotation performance of 186 high school students (80 males and 106 females) in grades 9 through 12 in art and nonart classes on Vandenbergs Mental Rotations test (S. Vandenberg and Kuse, 1978) was affected by gender, visual-spatial activities, strategies used while performing the test, and the ease of test taking.…

  16. AFB-NETT - business opportunities for European biomass industry

    International Nuclear Information System (INIS)

    Higham, I.

    1997-01-01

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  17. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I. [ETSU, Oxfordshire (United Kingdom)

    1997-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  18. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I [ETSU, Oxfordshire (United Kingdom)

    1998-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  19. Very High-Performance Advanced Filter Bank Analog-to-Digital Converter (AFB ADC) Project

    National Research Council Canada - National Science Library

    Velazquez, Scott

    1999-01-01

    ... of the art by using a parallel array of individual commercial off the shelf converters. The significant performance improvements afforded by the Advanced Filter Bank Analog to Digital Converter (AFB ADC...

  20. Burrowing Owl and Other Migratory Bird Mitigation for a Runway Construction Project at Edwards AFB

    OpenAIRE

    Hoehn, Amber L.; Hagan, Mark; Bratton, Mark

    2009-01-01

    Edwards Air Force Base (AFB) scheduled the construction of a runway in the spring of 2007. The runway would be in an area that contained migratory birds and their habitat. The construction project would be near Edwards AFB main runway and had the potential not only to impact species protected under the Migratory Bird Treaty Act (MBTA), including the burrowing owl (Athene cunicularia), but also to increase bird and wildlife–aircraft strike hazards in the active flightline areas. To discourage ...

  1. Soil erosion and causative factors at Vandenberg Air Force Base, California

    Science.gov (United States)

    Butterworth, Joel B.

    1988-01-01

    Areas of significant soil erosion and unvegetated road cuts were identified and mapped for Vandenberg Air Force Base. One hundred forty-two eroded areas (most greater than 1.2 ha) and 51 road cuts were identified from recent color infrared aerial photography and ground truthed to determine the severity and causes of erosion. Comparison of the present eroded condition of soils (as shown in the 1986 photography) with that in historical aerial photography indicates that most erosion on the base took place prior to 1928. However, at several sites accelerated rates of erosion and sedimentation may be occurring as soils and parent materials are eroded vertically. The most conspicuous erosion is in the northern part of the base, where severe gully, sheet, and mass movement erosion have occurred in soils and in various sedimentary rocks. Past cultivation practices, compounded by highly erodible soils prone to subsurface piping, are probably the main causes. Improper range management practices following cultivation may have also increased runoff and erosion. Aerial photography from 1986 shows that no appreciable headward erosion or gully sidewall collapse have occurred in this area since 1928.

  2. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  3. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  4. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  5. Ground Cloud Dispersion Measurements During The Titan IV Mission #K22 (12 May 1996) at Vandenberg Air Force Base; Volume 1-Test Overview and Data Summary

    National Research Council Canada - National Science Library

    1997-01-01

    ...) into the launch areas at Cape Canaveral Air Station (CCAS) and Vandenberg Air Force Base (VAFB). Large quantities of hazardous liquid fuels and oxidizers could also be released as a result of propellant transfer accidents or launch vehicle failures...

  6. Species biology and potential for controlling four exotic plants (Ammophila arenaria, Carpobrotus edulis, Cortaderia jubata and Gasoul crystallinum) on Vandenberg Air Force Base, California

    Science.gov (United States)

    Schmalzer, Paul A.; Hinkle, C. Ross

    1987-01-01

    Invasive exotic plants can displace native flora and modify community and ecosystem structure and function. Ammophila arenaria, Corpobrotus edulis, Cortaderia jubata, and Gasoul crystallinum are invasive plants present on Vandenberg Air Force Base, California, designated for study by the Environmental Task Force because of the perceived threat they represent to the native flora. Each plant's native habitat, how they came to be at Vandenberg, their propagation, and how they can be controlled is discussed.

  7. Ground-water data, 1969-77, Vandenberg Air Force Base area, Santa Barbara County, California

    Science.gov (United States)

    Lamb, Charles E.

    1980-01-01

    The water supply for Vandenberg Air Force Base is obtained from wells in the Lompoc Plain, San Antonio Valley, and Lompoc Terrace groundwater basins. Metered pumpage during the period 1969-77 from the Lompoc Plain decreased from a high of 3,670 acre-feet in 1969 to a low of 2,441 acre-feet in 1977, while pumpage from the San Antonio Valley increased from a low of 1 ,020 acre-feet in 1969 to a high of 1,829 acre-feet in 1977. Pumpage from the Lompoc Terrace has remained relatively constant and was 187 acre-feet in 1977. In the Barka Slough area of the San Antonio Valley, water levels in four shallow wells declined during 1976 and 1977. Water levels in observation wells in the two aquifers of the Lompoc Terrace ground-water basin fluctuated during the period, but show no long term trends. Chemical analyses or field determinations of temperature and specific conductance were made of 219 water samples collected from 53 wells. In the Lompoc Plain the dissolved-solids concentration in all water samples was more than 625 milligrams per liter, and in most was more than 1,000 milligrams per liter. The manganese concentration in analyzed samples equaled or exceeded the recommended limit of 50 micrograms per liter for public water supplies. Dissolved-solids concentrations increased with time in water samples from two wells east of the Air Force Base in San Antonio Valley. In the base well-field area, concentrations of dissolved solids ranged from 290 to 566 milligrams per liter. Eight analyses show manganese at or above the recommended limit of 50 milligrams per liter. In the Lompoc Terrace area dissolved-solids concentrations ranged from 470 to 824 milligrams per liter. Five new supply wells, nine observation wells, and two exploratory/observation wells were drilled on the base during the period 1972-77. (USGS)

  8. Quantifying MTBE biodegradation in the Vandenberg Air Force Base ethanol release study using stable carbon isotopes

    Science.gov (United States)

    McKelvie, Jennifer R.; Mackay, Douglas M.; de Sieyes, Nicholas R.; Lacrampe-Couloume, Georges; Sherwood Lollar, Barbara

    2007-12-01

    Compound-specific isotope analysis (CSIA) was used to assess biodegradation of MTBE and TBA during an ethanol release study at Vandenberg Air Force Base. Two continuous side-by-side field releases were conducted within a preexisting MTBE plume to form two lanes. The first involved the continuous injection of site groundwater amended with benzene, toluene and o-xylene ("No ethanol lane"), while the other involved the continuous injection of site groundwater amended with benzene, toluene and o-xylene and ethanol ("With ethanol lane"). The δ 13C of MTBE for all wells in the "No ethanol lane" remained constant during the experiment with a mean value of - 31.3 ± 0.5‰ ( n = 40), suggesting the absence of any substantial MTBE biodegradation in this lane. In contrast, substantial enrichment in 13C of MTBE by 40.6‰, was measured in the "With ethanol lane", consistent with the effects of biodegradation. A substantial amount of TBA (up to 1200 μg/L) was produced by the biodegradation of MTBE in the "With ethanol lane". The mean value of δ 13C for TBA in groundwater samples in the "With ethanol lane" was - 26.0 ± 1.0‰ ( n = 32). Uniform δ 13C TBA values through space and time in this lane suggest that substantial anaerobic biodegradation of TBA did not occur during the experiment. Using the reported range in isotopic enrichment factors for MTBE of - 9.2‰ to - 15.6‰, and values of δ 13C of MTBE in groundwater samples, MTBE first-order biodegradation rates in the "With ethanol lane" were 12.0 to 20.3 year - 1 ( n = 18). The isotope-derived rate constants are in good agreement with the previously published rate constant of 16.8 year - 1 calculated using contaminant mass-discharge for the "With ethanol lane".

  9. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Eglin AFB, Florida

    Science.gov (United States)

    1981-10-01

    Okaloosa Co. 3-12 Crestview South Quadrangle, Florida-Okaloosa Co. -13 Mossy ead Quadrangle, Florida-Walton Co 3-14 E-1 EGUN AFB 4,h aa V, WRAMATIO...I) Um AYPM hIN1DS SP * So". AM T 0 Tou A is a O I. h E-2 ES ENGINEERING -SCIENCE V%777-7NN7 .7-7 EGUN AFB 0.4 .m ... (1) WMg LAN DOSAMU *Y* CO u...r Oumm *p S(S Ann~ Il~~O 0*aAMa 2-3 ES ENGINEER ING - SCIENCE EGUN AFB %Tt MAR ESTHER * : . . - . - ~ - ~ r W R G H T L A N D F I L L 3 SITE 0296

  10. Finding No Significant Impact: Aircraft Weather Shelter at Laughlin AFB, TX

    Science.gov (United States)

    2004-06-01

    surface water flow is southeast into the Ro Grande and down toward the Gulf of Mexico. Lake Amistad reservoir, located approximately 12 miles northwest...characterized Lake Amistad reservoir as having excellent water quality (USAF, 1997). Laughlin AFB contains a total of 19 acres of surface water

  11. Relocation of the Air National Guard 176th Wing to Elmendorf AFB, Alaska

    Science.gov (United States)

    2007-09-01

    Park. Between 20 and 70 moose are estimated by Alaska Fish and Game to live on Elmendorf AFB, depending on the time of year, as portions of the herd ...also supports populations of small mammals including beaver (Castor canadensis), muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red

  12. Final Confirmation Sampling and Analysis Report for the POL Yard, Sites SS-06 and ST-40, Wurtsmith AFB, Michigan

    National Research Council Canada - National Science Library

    1999-01-01

    .... Wurtsmith AFBCA and AFCEE/ERT had no comments on the draft final report. This report represents the final contract deliverable for the AFCEE Extended Bioventing Project at the Wurtsmith AFB POL Yard...

  13. Remedial Investigation/Feasibility Study, Operable Unit 5, Elmendorf AFB, Anchorage, Alaska. Volume 1. Text

    Science.gov (United States)

    1994-03-04

    the protective steel casing to hold it in place and proec the surface seal. Protective steel boilards set in concrete were installed around monitorig ...banks, high watermarks, channel morphology, and canopy cover (Appendix J, Table 1.3). Weather Comdltlaos This assessment included approximate cloud

  14. Environmental Assessment Construction of a New Hazardous Cargo Pad Davis-Monthan AFB

    Science.gov (United States)

    2002-11-07

    PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 355th Civil Engineer Squadron (CES/CEVA),710 Third Street,Davis-Monthan AFB,AZ,85707 8. PERFORMING...agency for certain projects. Details of the preparation of this EA are mandated by the Council of Enviromental Quality (CEQ) in the series of...Base, Tucson, Arizona." October 1996. James M. Montgomery, Consulting Engineers for US army Corps of Engineers , Omaha Dist., Apri11990

  15. Williams AFB, Arizona Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-10-21

    N;I 1-L 9AL CLIMATOLOGY BRANCH ~.w~ .’ ETAC LJS. H A~(I EATV UMDT 2 f wEATHER SERVICE/MAC SEE FIRST HUMDIT 2 114 1 LLIAMS AFB AZ 69-70,73-80 JUL...4622 USAPETAC ’ol 0-87-5(01.A) , I roFql CL,-RAL CLIMATOLOGY BRANCH EATV 2 AFETAC SRVIE/ACATIVE UUTO HUMIDITY SEE FIRST PAGE Z Cl)4 AILLIAMS AFS AZ

  16. Installation Restoration Program. Phase 1. Records Search, Scott AFB, Illinois

    Science.gov (United States)

    1985-04-01

    mission of defense of the United States, has long been engaged in a wide variety of opera- tions dealing with toxic and hazardous materials. Federal...Histopathology-Cytology Sewer Dental Clinic/Laboratory 1680 Yes Yes DPDO, Sanitary Sewer, Medical Logistics Radiology/X-Ray 1680 Yes Yes DPDO, Sanitary...disintegrate. HALOGEN: The class of chemical elements including fluorine , chlorine, i bromine, and iodine. HALON 1211: A fire extinguishing agent

  17. Installation Restoration Program (IRP) Stage 3, Operable Unit B engineering Evaluation/Cost Analysis - Environmental Assessment for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1990-12-01

    U U U � o 0. .. . .. .. . ..0 C f 88 11 g 88 2= c c= 61 =" l w oA ID - f mW CD 0 x P.- I- W x- hi 8I fmd /06ETLO/V’dI V0 0 a 1 -,, C 22 2t ? i2...aa a a I I I 1 a a a a U a fta a a a a a a a a a a a a a * a a a a a a a a a * a a a I a a a a ft a a a I * a a a a * a aa I* a I a a a ac~ a a a ft a...Ba J.Ja ’-ft a -. aB I a a fta a Oa a ~ afla ft a 0-aQa a ft * * a * ~ d aa OaeO B a* - a a SIa I ft a a ma a £ a a ~a 3 -di I a a saga a ft a a ~SJI

  18. Determining the Probability of Violating Upper-Level Wind Constraints for the Launch of Minuteman III Ballistic Missiles at Vandenberg Air Force Base

    Science.gov (United States)

    Shafer, Jaclyn A.; Brock, Tyler M.

    2012-01-01

    The 30th Operational Support Squadron Weather Flight (30 OSSWF) provides comprehensive weather services to the space program at Vandenberg Air Force Base (VAFB) in California. One of their responsibilities is to monitor upper-level winds to ensure safe launch operations of the Minuteman Ill ballistic missile. The 30 OSSWF tasked the Applied Meteorology Unit (AMU) to analyze VAFB sounding data with the goal of determining the probability of violating (PoV) their upper-level thresholds for wind speed and shear constraints specific to this launch vehicle, and to develop a tool that will calculate the PoV of each constraint on the day of launch. In order to calculate the probability of exceeding each constraint, the AMU collected and analyzed historical data from VAFB. The historical sounding data were retrieved from the National Oceanic and Atmospheric Administration Earth System Research Laboratory archive for the years 1994-2011 and then stratified into four sub-seasons: January-March, April-June, July-September, and October-December. The AMU determined the theoretical distributions that best fit the maximum wind speed and maximum wind shear datasets and applied this information when calculating the averages and standard deviations needed for the historical and real-time PoV calculations. In addition, the AMU included forecast sounding data from the Rapid Refresh model. This information provides further insight for the launch weather officers (LWOs) when determining if a wind constraint violation will occur over the next few hours on the day of launch. The AMU developed an interactive graphical user interface (GUI) in Microsoft Excel using Visual Basic for Applications. The GUI displays the critical sounding data easily and quickly for LWOs on day of launch. This tool will replace the existing one used by the 30 OSSWF, assist the LWOs in determining the probability of exceeding specific wind threshold values, and help to improve the overall upper winds forecast for

  19. Data recovery program to mitigate the effects of the construction of space transportation system facilities on seven archaeological sites on Vandenberg Air Force Base, Santa Barbara County, California

    International Nuclear Information System (INIS)

    Glassow, M.A.

    1979-01-01

    A plan is proposed for the recovery of data from three prehistoric habitation sites, 4-SBa-539, 670, and 931, which will be adversely affected by the Space Transportation System Project, Vandenberg Air Force Base, California. Phase II testing suggests that SBa-539 and 670, fall within the Late Period, AD 1000 to European contact, with a possible Middle-Period component at 670, while SBa-931, radiocarbon-dated to BC 6000, represents the Early Period, or Millingstone Horizon, of Southern California prehistory. Excavation will utilize conventional fine scale techniques and specialized sample collection. Data analysis will provide information on prehistoric subsistence and settlement patterns, inter-regional trade, and functions of distinctive artifact types. Cultural change will be identified and comparisons made between cultural developments of Vandenberg and neighboring regions

  20. Perseus B over Edwards AFB on a Development Flight

    Science.gov (United States)

    1998-01-01

    from a mobile flight control station on the ground. A Global Positioning System (GPS) unit provides navigation data for continuous and precise location during flight. The ground control station features dual independent consoles for aircraft control and systems monitoring. A flight termination system, required for all remotely piloted aircraft being flown in military-restricted airspace, includes a parachute system deployed on command plus a C-Band radar beacon and a Mode-C transponder to aid in location. Dryden has provided hanger and office space for the Perseus B aircraft and for the flight test development team when on site for flight or ground testing. NASA's ERAST project is developing aeronautical technologies for a new generation of remotely piloted and autonomous aircraft for a variety of upper-atmospheric science missions and commercial applications. Dryden is the lead center in NASA for ERAST management and operations. Perseus B is approximately 25 feet long, has a wingspan of 71.5 feet, and stands 12 feet high. Perseus B is powered by a Rotax 914, four-cylinder piston engine mounted in the mid-fuselage area and integrated with an Aurora-designed three-stage turbocharger, connected to a lightweight two-blade propeller.

  1. PART I: Bioventing Pilot Test Work Plan for Fire Protection Training Area Site FY-03, Charleston AFB, South Carolina. PART II: Draft Interim Pilot Test Results Report for Fire Protection Training Area Site FT-03, Charleston AFB, South Carolina

    National Research Council Canada - National Science Library

    1993-01-01

    This site-specific work plan presents the scope of a bioventing pilot test for in situ treatment of fuel contaminated soils at the Fire Protection Training Area designated as Site FT-O3, Charleston Air Force Base (AFB), South Carolina...

  2. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1983-07-22

    PERCENTACE FREQUENCY Of WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) 7- 2650 EIELSON AF6 AK 73-8? *pp ALL WEATHER ISO -1 700 (KNEED I .3 4.6 7. 10...HOURLY OBSERVATIONS) 7 265C EIELSON AFB AX 73-82 DEC mn~y.. .y.rm,Io u ii. n~lu Sr.m ALL kEATHER ISO -1700 CLAm -- IL.S T.) SPEED i( MEA (KNTS) 1 - 3...fis r, i- &hS.2? q i- 7 &S2 kL%- &.S-2. fq 7Sf..7:p U8000 7Z.1 73. 73. 73. 73. ?6 73. 73. 38?8le 73.8 73.8 73.8 73.81 73., 27000 ’ ,i. L.bi~2~~ 800 I 8t

  3. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico. Final Environmental Impact Statement. Volume III: Comment Letters and Responses to Comments

    National Research Council Canada - National Science Library

    1998-01-01

    The Final Environmental Impact Statement analyzed the potential environmental consequences from the proposal to beddown 30 additional German Air Force Tornado aircraft and 640 personnel at Holloman Air Force Base (AFB) New Mexico...

  4. Monoclonal antibody anti-AFB1: scale-up in vitro for biotools development Anticorpo monoclonal antiAFB1: produção in vitro visando desenvolvimento de bioferramentas

    Directory of Open Access Journals (Sweden)

    Eiko Nakagawa Itano

    2010-12-01

    Full Text Available Aflatoxin B1 (AFB1 is a mycotoxin classified as group 1 (human carcinogen by International Agency for Research on Cancer - IARC, causing hazardous contamination in a wide variety of food and feed, where the monitoring depends on precision and accuracy of analytical method. The culture of AFB1 specific monoclonal antibody (mAb secreting hybridoma was performed for further development of immunochemical methods. The growth of hybridoma AF2 was carried out in RPMI medium + 15 % fetal bovine serum (FBS, as well as the same medium gradually amended with H-SFM medium (25, 50, 75 and 100 % H-SFM. The protein concentration in the culture supernatant ranged from 1.80 to 10.88 mg/mL. The culture amended with FBS-free synthetic H-SFM medium reached production of reagent with higher degree of purity and lower risk, in addition to lower protein content (2.29 mg/mL reached with 100 % H-SFM, which approaches the real content of pure mAb. The indirect competitive enzyme-linked immunosorbent assay (ic-ELISA and SDS-polyacrylamide gel electrophoresis (SDS-PAGE showed anti-AFB1 activity and IgG corresponding bands, respectively, indicating feasible application of mAb produced in 100, 75 and 50 % H-SFM for further use in the development of AFB1 detecting biotools. This mAb production can be an initial step that can supply the self-sufficient immune-reagent in the rapid diagnosis at national condition, which is essential in the food quality and safety.Aflatoxina B1 (AFB1 é uma micotoxina classificada pela International Agency for Research on Cancer - IARC no Grupo 1 (carcinógeno ao humano, responsável pelo perigo de contaminação em ampla variedade de alimento e ração, cujo monitoramento depende de metodologia analítica precisa e exata. O trabalho visou cultivo do hibridoma secretor de anticorpo monoclonal (AcM específico para AFB1 visando desenvolvimento de métodos imunoquímicos. Hibridoma AF2 foi cultivado em meio RPMI + 15 % de soro fetal bovino (SFB

  5. Transcriptome, antioxidant enzyme activity and histopathology analysis of hepatopancreas from the white shrimp Litopenaeus vannamei fed with aflatoxin B1(AFB1).

    Science.gov (United States)

    Zhao, Wei; Wang, Lei; Liu, Mei; Jiang, Keyong; Wang, Mengqiang; Yang, Guang; Qi, Cancan; Wang, Baojie

    2017-09-01

    Aflatoxin produced by Aspergillus flavus or Aspergillus parasiticus fungi during grain and feed processing and storage. Aflatoxins cause severe health problems reducing the yield and profitability of shrimp cultures. We sought to understand the interaction between shrimp immunity and aflatoxin B1 (AFB1), analyzing transcriptome expression, antioxidant enzyme activity, and histological features of the hepatopancreas of shrimp fed with AFB1. From over 4 million high-quality reads, de novo unigene assembly produced 103,644 fully annotated genes. A total of 1024 genes were differentially expressed in shrimp fed with AFB1, being involved in functions, such as peroxidase metabolism, signal transduction, transcriptional control, apoptosis, proteolysis, endocytosis, and cell adhesion and cell junction. Upon AFB1 challenge, there were severe histological alterations in shrimp hepatopancreas. AFB1 challenge increased the activity of several antioxidant enzymes. Our data contribute to improve the current understanding of host-AFB1 interaction, providing an abundant source for identification of novel genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.

    Science.gov (United States)

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad

    2014-01-01

    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p6.85pg/mg albumin) had significantly elevated level of total bilirubin (pMalaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in order to assess aflatoxin exposure in the general population of Malaysia. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. Response of Intestinal Bacterial Flora to the Long-term Feeding of Aflatoxin B1 (AFB1) in Mice.

    Science.gov (United States)

    Yang, Xiai; Liu, Liangliang; Chen, Jing; Xiao, Aiping

    2017-10-12

    In order to investigate the influence of aflatoxin B1 (AFB1) on intestinal bacterial flora, 24 Kunming mice (KM mice) were randomly placed into four groups, which were labeled as control, low-dose, medium-dose, and high-dose groups. They were fed intragastrically with 0.4 mL of 0 mg/L, 2.5 mg/L, 4 mg/L, or 10 mg/L of AFB1 solutions, twice a day for 2 months. The hypervariable region V3 + V4 on 16S rDNA of intestinal bacterial flora was sequenced by the use of a high-flux sequencing system on a Miseq Illumina platform; then, the obtained sequences were analyzed. The results showed that, when compared with the control group, both genera and phyla of intestinal bacteria in the three treatment groups decreased. About one third of the total genera and one half of the total phyla remained in the high-dose group. The dominant flora were Lactobacillus and Bacteroides in all groups. There were significant differences in the relative abundance of intestinal bacterial flora among groups. Most bacteria decreased as a whole from the control to the high-dose groups, but several beneficial and pathogenic bacterial species increased significantly with increasing dose of AFB1. Thus, the conclusion was that intragastric feeding with 2.5~10 mg/mL AFB1 for 2 months could decrease the majority of intestinal bacterial flora and induce the proliferation of some intestinal bacteria flora.

  8. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 1: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  9. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 4, Appendixes E and F: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  10. Transformación de la aflatoxina B1 de alimentos, en el cancerígeno humano, aducto AFB1-ADN

    Directory of Open Access Journals (Sweden)

    Magda Carvajal

    2013-01-01

    Full Text Available Las aflatoxinas (AF son metabolitos secundarios tóxicos principalmente de los hongos Aspergillus flavus y A. parasiticus, son potentes mutágenos y cancerígenos de alimentos y la exposición del hombre a ellas es continuo. Las AF se ligan al ADN, ARN y proteínas formando aductos AFB1-ADN que se acumulan por años y dañan desde los virus hasta el hombre. Es importante identificar y cuantificar estos aductos como biomarcadores de largo tiempo de riesgo de enfermedad, ya que originan mutaciones y cáncer, y están validados en animales y humanos. Las AF se activan en presencia del citocromo P450 como una molécula inestable 8,9 epóxido AFB1, que se liga al N7 de la guanina, y se transforma en los cancerígenos activos o aductos AFB1-Gua y, finalmente, en los aductos AFB1-FAPY y son una medida objetiva de la exposición humana a cancerígenos ambientales. Los aductos representan la exposición, absorción, distribución, metabolismo, reparación del ADN y cambio celular. Los temas tratados aquí son la formación de aductos AFB1-ADN, estudios in vitro e in vivo, exposición a una dieta con AFB1, efectos, desarrollo de cáncer y mutaciones en el gen supresor p53, rutas de exposición, vitaminas, tipos de aducto AFB1-ADN, metodología y su control.

  11. Remedial Investigation/Feasibility Study, Operable Unit 5, Elmendorf AFB, Anchorage, Alaska. Volume 2. Text and Appendices A - J

    Science.gov (United States)

    1994-03-04

    hitting abandoned paper sheathed copper wire telephone cable at 4.2’. Boring moved. No discernible floating product. 35.0 . 40.0 45.0 50.0 55.0 - jPROJECT...0.60 U N/C Magnesium, Mg 14.3 U 14.3 U N/C Manganese, Mn 0.80 U 0.80 U N/C Mercury, Hg 0.10 U 0.10 U N/C Nikel , Ni 7.7 U 7.7 U N/C Potassium, K 191 U

  12. Pope AFB, Fayetteville, North Carolina Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-06-01

    SERVICE/HAC T23030 POPE AFB NC 7[-81111 STAT ION STATION lNA&Ayl MSSgll’ TemN. WIT SULS TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 1.2 3 - 5 - 1- 19...STATINASha T PAGE 1 TWET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL * (F) 0 1.2 3-4 3-6 7-8 9.10 11-12113-14 15.16 17-1 19-.20 21.22123-24 25.2627.3 29.n 30 l

  13. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element

    Directory of Open Access Journals (Sweden)

    Özlem Ertekin

    2016-08-01

    Full Text Available This study introduces the use of an IgA isotype aflatoxin (AF specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl carbodiimide/N-hydroxy succinimide (EDC/NHS method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1.

  14. Environmental Assessment Preparation for Air Force Test Mission in the 21st Century: Upgrade and Improve the Test Capability at the Edwards AFB Test Complex

    Science.gov (United States)

    2015-04-01

    waste NAA Nonattainment Area NAAQS National Ambient Air Quality Standards NAGPRA Native American Graves Protection and Repatriation Act NDMA N...nitrate, and N- Nitrosodimethylamine ( NDMA ) plumes exist in these OUs. Locations of groundwater plumes at Edwards AFB are indicated by their respective

  15. Pure neuritic leprosy: Resolving diagnostic issues in acid fast bacilli (AFB)-negative nerve biopsies: A single centre experience from South India.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Megha S; Challa, Sundaram; Meena, A K; Kaul, Subhash

    2015-01-01

    Demonstration of lepra bacilli is essential for definite or unequivocal diagnosis of pure neuritic leprosy (PNL) on nerve biopsy. However, nerves always do not show bacilli owing to the changes of previous therapy or due to low bacillary load in tuberculoid forms. In absence of granuloma or lepra bacilli, other morphologic changes in endoneurium and perineurium can be of help in making a probable diagnosis of PNL and treating the patient with multidrug therapy. Forty-six biopsies of PNL were retrospectively reviewed and histologic findings were compared with 25 biopsies of non leprosy neuropathies (NLN) including vasculitic neuropathy and chronic inflammatory demyelinating polyneuropathy (CIDP). The distribution of endoneurial infiltrate and fibrosis, perineurial thickening, and myelin abnormalities were compared between PNL and NLN biopsies and analyzed by Chi-square test. Out of 46 PNL casses, 24 (52.17 %) biopsies were negative for acid fast bacilli (AFB). In these cases, the features which favor a diagnosis of AFB-negative PNL were endoneurial infiltrate (51.1%), endoneurial fibrosis (54.2%), perineurial thickening (70.8%), and reduced number of myelinated nerve fibers (75%). Nerve biopsy is an efficient tool to diagnose PNL and differentiate it from other causes of NLN. In absence of AFB, the diagnosis of PNL is challenging. In this article, we have satisfactorily evaluated the various hisopthological features and found that endoneurial inflammation, dense fibrosis, and reduction in the number of myelinated nerve fibers are strong supportive indicators of PNL regardless of AFB positivity.

  16. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    Science.gov (United States)

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    De Guzman, Zenaida M. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Cervancia, Cleofas R. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Feliciano, Chitho P., E-mail: cpfeliciano@pnri.dost.gov.ph [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City (Philippines)

    2011-10-15

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a {sup 60}Co source. Surviving spores were counted and used to estimate the decimal reduction (D{sub 10}) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10{sup 5}-9x10{sup 3} spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D{sub min}) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to {gamma}-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: > We characterized Paenibacillus larvae and determined its radiation sensitivity. > We investigated the effectiveness of gamma rays in inactivating P. larvae. > Gamma radiation inactivates P. larvae. > 15 kGy is effective for the sterilization of P. larvae-infected hives. > Irradiation produces no visible changes in the hives' body, waxes and frames.

  18. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    International Nuclear Information System (INIS)

    De Guzman, Zenaida M.; Cervancia, Cleofas R.; Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C.; Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C.; Feliciano, Chitho P.

    2011-01-01

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a 60 Co source. Surviving spores were counted and used to estimate the decimal reduction (D 10 ) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10 5 -9x10 3 spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D min ) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to γ-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: → We characterized Paenibacillus larvae and determined its radiation sensitivity. → We investigated the effectiveness of gamma rays in inactivating P. larvae. → Gamma radiation inactivates P. larvae. → 15 kGy is effective for the sterilization of P. larvae-infected hives. → Irradiation produces no visible changes in the hives' body, waxes and frames.

  19. Environmental Assessment for the Construction of Eielson AFB Youth Center Eielson Air Force Base, Alaska

    Science.gov (United States)

    2010-09-01

    5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S...AND ADDRESS(ES) Bestech,1040 Lorne Street unit 3,Sudbury, Ontario P3C 4R9, 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING...athletic activities, including soccer, baseball, softball , t-ball, football, cheerleading, junior wrestling, and basketball. Instructional programs

  20. Final Environmental Assessment (EA) for the Revitalization of Military Family Housing Keesler AFB, MS

    Science.gov (United States)

    2006-03-01

    12,000 square feet each). An Olympic-size swimming pool (approximately 71 feet by 164 feet). Twelve covered bus stops. A skateboard park...11,644 Covered Bus Stop 100 12 1,200 Skateboard Park 10,890 1 10,890 Storage Unit 100 534 53,400 Total N/A N/A 125,134 Location to be determined...Olympic-size Swimming Pool 1 1 Covered Bus Stop 5 4 3 12 Skateboard Park 1 1 Storage Unit 0 294 160 80 534 2.6 ALTERNATIVE 1 (IMMEDIATE

  1. Time to Detection in Culture Supports Prediction of Low Transmissibility of Tuberculosis and Discontinuation of Isolation for Low-Risk Patients With A Single AFB-Negative and NAAT-Negative Respiratory Specimen.

    Science.gov (United States)

    Khan, Saahir; Nakasone, Audrey; Ghajar, Minoo; Zhowandai, Mariam; Prabhu, Sunita; Alexander, Rick; Low, Julie; Peterson, Ellena; Thrupp, Lauri

    2018-05-01

    For 94 patients with culture-positive pulmonary tuberculosis, time-to-detection (TTD), acid-fast bacilli (AFB) smear, and nucleic acid amplification test (NAAT) results were reviewed. All 12 patients whose first specimen was negative by AFB smear and NAAT had prolonged TTD, indicating low transmissibility and supporting discontinuing isolation for low-risk patients.Infect Control Hosp Epidemiol 2018;39:619-621.

  2. Statistical analysis of ground-water contamination at the alert apron and northern landfill areas of Wurtsmith AFB, Michigan. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, P.; Naber, S.; Verducci, J.

    1988-07-01

    Two plumes of contamination are analyzed to determine their extent, composition, and movement. The large number of ground-water monitoring wells sampled over the past eight years at Wurtsmith AFB allow this analysis to be performed directly from empirical data, with minimal assumptions about solute transport mechanisms. Conclusions are drawn about the likely sources of contamination in the two plumes, the adequacy of the data for making risk assessments, and the likely consequences of alternative programs of remediation.

  3. Environmental Assessment Addressing FTFA07-1174, Repair Approach Lighting System at the North End of Runway 01/19 at Eglin AFB, Florida

    Science.gov (United States)

    2013-05-01

    Hyla andersonii Mammals American beaver Castor canadensis Florida black bear2 Ursus americanus floridanus Raccoon Procyon lotor Source: Eglin...water at a frequency and duration to support, and that under normal circumstances do support, a prevalence of vegetation typically adapted to life...virginiana American Beaver Castor canadensis Redbay Persea borbonia Little Blue Heron Egretta caerulea Source: USAF 2006 E-3 E.2 Eglin AFB

  4. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus.

    Science.gov (United States)

    Xing, Fuguo; Wang, Limin; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Yan; Zhao, Yueju; Liu, Yang

    2017-09-01

    Twenty Aspergillus niger strains were isolated from peanuts and 14 strains were able to completely inhibit AFB 1 production with co-cultivation. By using a Spin-X centrifuge system, it was confirmed that there are some soluble signal molecules or antibiotics involved in the inhibition by A. niger, although they are absent during the initial 24h of A. flavus growth when it is sensitive to inhibition. In A. flavus, 19 of 20 aflatoxin biosynthetic genes were down-regulated by A. niger. Importantly, the expression of aflS was significantly down-regulated, resulting in a reduction of AflS/AflR ratio. The results suggest that A. niger could directly inhibit AFB 1 biosynthesis through reducing the abundance of aflS to aflR mRNAs. Interestingly, atoxigenic A. flavus JZ2 and GZ15 effectively degrade AFB 1 . Two new metabolites were identified and the key toxic lactone and furofuran rings both were destroyed and hydrogenated, meaning that lactonase and reductase might be involved in the degradation process. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Factors which contributed for low quality sputum smears for the detection of acid fast bacilli (AFB) at selected health centers in Ethiopia: A quality control perspective.

    Science.gov (United States)

    Mekonen, Ayehu; Ayele, Yeshi; Berhan, Yifru; Woldeyohannes, Desalegn; Erku, Woldaregay; Sisay, Solomon

    2018-01-01

    Quality of tuberculosis (TB) microscopy diagnosis is not a guarantee despite implementation of External Quality Assurance (EQA) service in all laboratories of health facilities. Hence, we aimed at evaluating the technical quality and the findings of sputum smear microscopy for acid fast bacilli (AFB) at health centers in Hararge Zone, Oromia Region, Ethiopia. A cross-sectional study was carried out between July 8, 2014 and July 7, 2015.A pre-tested structured questionnaire was used to collect data. Lot Quality Assurance Sampling (LQAS) method was put into practice for collecting all necessary sample slides. Data were analyzed by using SPSS (Statistical Package for Social Sciences) version 20 software. P-value quality, smear size, smear thickness, staining and evenness were indicated in 40 (72.7%), 39 (70.9%), 37 (67.3%), 27(49.1%) and 37 (67.3%) of the collected samples, respectively. False negative AFB findings were significantly associated with lack of Internal Quality Control (IQC) measures (AOR (Adjusted Odds Ratio): 2.90 (95% CI (Confidence Interval): 1.25,6.75) and poor staining procedures (AOR: 2.16(95% CI: 1.01, 5.11). The qualities of AFB smear microscopy reading and smearing were low in most of the laboratories of the health centers. Therefore, it is essential to strength EQA program through building the capacity of laboratory professionals.

  6. Eielson Air Force Base operable unit 2 and other areas record of decision

    International Nuclear Information System (INIS)

    Lewis, R.E.; Smith, R.M.

    1994-10-01

    This decision document presents the selected remedial actions and no action decisions for Operable Unit 2 (OU2) at Eielson Air Force Base (AFB), Alaska, chosen in accordance with state and federal regulations. This document also presents the decision that no further action is required for 21 other source areas at Eielson AFB. This decision is based on the administrative record file for this site. OU2 addresses sites contaminated by leaks and spills of fuels. Soils contaminated with petroleum products occur at or near the source of contamination. Contaminated subsurface soil and groundwater occur in plumes on the top of a shallow groundwater table that fluctuates seasonally. These sites pose a risk to human health and the environment because of ingestion, inhalation, and dermal contact with contaminated groundwater. The purpose of this response is to prevent current or future exposure to the contaminated groundwater, to reduce further contaminant migration into the groundwater, and to remediate groundwater

  7. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 3, Appendixes B, C, and D: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  8. A COMMUNITY-BASED COLLEGE STUDY ON ADHERENCE TO DOTS AND RELATED DIAGNOSTIC INNOVATIONS ON AFB STAINING METHOD

    Directory of Open Access Journals (Sweden)

    Nilotpal Banerjee

    2016-10-01

    Full Text Available BACKGROUND The geographically isolated underdeveloped state, Tripura of north-eastern region of India has been facing multidimensional problems like unemployment, lack of hygiene, illiteracy, lack of industrialisation, etc. So, it was intended to study the magnitude of reported tuberculosis in the community around the Tripura Medical College through RNTCP. MATERIALS AND METHODS Questionnaire, interrogative methods was primarily adopted. Inspection to different villages around and direct interrogation was done on awareness about the programme. Self-modified innovative method was also adopted to compare scientific reproducibility along with conventional method for AFB staining. RESULTS Analysis of results reveal 28% of people interrogated knew about RNTC programme. 16% of people had seen and heard about the TB staff. 56% of people said that no health staff enquired on other factors like drinking water, mosquito and hygiene, etc. The innovative method of staining proved 100% successful, which was also easier, cheaper and more rapid. CONCLUSION DMC and DOTs services had been quite good as evident from document records and on interrogation to the attendees. 80% of attendees said that they would complete the course of treatment. 83% were happy with the provisions of DOTs and DMC.

  9. External quality assessment of AFB smear microscopy performances and its associated factors in selected private health facilities in Addis Ababa, Ethiopia.

    Science.gov (United States)

    Mosissa, Lemi; Kebede, Abebaw; Mindaye, Tedla; Getahun, Muluwork; Tulu, Sisay; Desta, Kassu

    2016-01-01

    Tuberculosis (TB) is still a public health problem in sub Saharan African countries. In resource-limited settings, TB diagnosis relies on sputum smear microscopy, with low and variable sensitivities, especially in paucibacillary pediatric and HIV-associated TB patients. Tuberculosis microscopy centers have several weaknesses like overworking, insufficiently trained personnel, inconsistent reagent supplies, and poorly maintained equipments; thus, there is a critical need for investments in laboratory infrastructure, capacity building, and quality assurance schemes. The performance of TB microscopy centers in the private health facilities in Addis Ababa is not known so far. The main objective of the study was to assess laboratory performance of acid fast bacilli (AFB) smear microscopy and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. A cross-sectional study was conducted in 33 selected private health facilities of Addis Ababa, Ethiopia comprising 7 hospitals, 2 NGO health centers, 23 higher clinics and 1 diagnostic laboratory that provide AFB smear microscopy services. The study was conducted from January to April 2014. A total of 283 stained sputum smears were randomly collected from participant laboratories for blinded rechecking, 320 panel slides were sent to 32 microscopy centers to evaluate their performance on AFB reading, staining and reporting. Checklists were used to assess quality issues of laboratories. Data were captured, cleaned, and analyzed using SPSS version 16.0; χ(2) tests, kappa statistics were used for comparison purpose. P value laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test performance. There were 10 (3.15%) major errors and 121 (37.8%) minor errors. The sensitivity, specificity, PPV and NPV of panel reading by microscopy centers were 89%, 96%, 96%, and 90% respectively. Out of 283 randomly selected slides for blind rechecking, 11 (3.9%) slides

  10. The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop.

    Science.gov (United States)

    Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine

    2017-12-01

    Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

  11. Eielson Air Force Base Operable Unit 2 baseline risk assessment

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, R.E.; Jarvis, T.T.; Jarvis, M.R.; Whelan, G.

    1994-10-01

    Operable Unit 2 at Eielson Air Force Base (AFB) near Fairbanks, is one of several operable units characterized by petroleum, oil, and lubricant contamination, and by the presence of organic products floating at the water table, as a result of Air Force operations since the 1940s. The base is approximately 19,270 acres in size, and comprises the areas for military operations and a residential neighborhood for military dependents. Within Operable Unit 2, there are seven source areas. These source areas were grouped together primarily because of the contaminants released and hence are not necessarily in geographical proximity. Source area ST10 includes a surface water body (Hardfill Lake) next to a fuel spill area. The primary constituents of concern for human health include benzene, toluene, ethylbenzene, and xylenes (BTEX). Monitored data showed these volatile constituents to be present in groundwater wells. The data also showed an elevated level of trace metals in groundwater.

  12. A Policy Analysis of Using Unit Costs as a Means of Performance Measurement in the Air Force Science and Technology Program

    Science.gov (United States)

    1991-09-01

    demonstrate, is that there is more than one way to account for S &T costs and evaluate its program performance. The first option evaluated considers...Personal Communication. Wright Laboratory, Wright-Patterson AFB OH, 14 May 1991. Horngren , Charles T. and George Foster. Cost Accounting A Managerial...78 Programmatic Feedback ........ 79 S &T as Overhead............79 Scoring the Options............80 Unit Costs ................8 Programmatic

  13. Risk assessment of aflatoxins B1 (AFB1) in corn arepas in Colombia and chemical risk assessment case study mercury in Fish

    International Nuclear Information System (INIS)

    Correa Lizarazo, D.

    2013-01-01

    The power point presentation is about: Identify the pair substrate (corn, wheat and rice) - mycotoxin (DON, AFB1) higher risk for the Colombian population, based on the exposure assessment and mercury in freshwater fish from Colombia. This report answer some the following questions: what are the most consumed products in the country, which may create a risk for the Colombian population, what are the prevention and control recommendations to reduce potential contamination of the products selected, what are economic activities and their impact areas that contribute most to the incorporation of of mercury in freshwater fish from Colombia,what are the species that may pose greater accumulation of mercury and methylmercury identified , what is the risk associated with the consumption of the species, what are the preventive measures to minimize exposure from consumption of fish with mercury and methylmercury and possible intervention strategies

  14. Interaction of mammary bovine ABCG2 with AFB1 and its metabolites and regulation by PCB 126 in a MDCKII in vitro model.

    Science.gov (United States)

    Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C

    2017-12-01

    The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.

  15. Interface unit

    NARCIS (Netherlands)

    Keyson, D.V.; Freudenthal, A.; De Hoogh, M.P.A.; Dekoven, E.A.M.

    2001-01-01

    The invention relates to an interface unit comprising at least a display unit for communication with a user, which is designed for being coupled with a control unit for at least one or more parameters in a living or working environment, such as the temperature setting in a house, which control unit

  16. Remedial Action Plan for Expanded Bioventing System Facility 6454

    National Research Council Canada - National Science Library

    1996-01-01

    This draft remedial action plan (RAP) presents the scope for an expanded bioventing system for in situ treatment of fuel-contaminated soils at Site 6454 at Vandenberg Air Force Base (AFB), California...

  17. Smear-positive pulmonary tuberculosis and AFB examination practices according to the standard checklist of WHO's tuberculosis laboratory assessment tool in three governmental hospitals, Eastern Ethiopia.

    Science.gov (United States)

    Mekonnen, Abiyu

    2014-05-13

    Using the Directly Observed Treatment-Short course (DOTS) program the World Health Organization's global target was to detect 70% of new sputum-smear positive PTB cases. Smear positive PTB cases are more infectious than the smear negative cases. The TB case detection rate remains very low in Ethiopia, but there are increases in smear-negative PTB diagnosis which could be attributed to several factors including poor quality of sputum smear-microscopy. A five years retrospective record review of data between September, 2007 and August, 2012 and an in-depth assessment of AFB staining practices of sputum smear using a standard checklist were made. The proportion of smear positive cases relative to overall Acid Fast Bacilli (AFB) screened was determined over a five year period to indicate the overall prevalence and the trend. Odds ratio with 95 percent confidence interval was calculated for categorical variables using multivariate Logistic Regression model to assess the strength of association. A total of 1266 individuals' data were reviewed. The majority of the study participants were male, 704 (55.6%), and rural residents, 690 (54.5%). The overall prevalence rate of smear positive PTB was 21.6%. Age categories between 15-24 and 25-34 years were independent predictors of smear positive PTB with adjusted odds ratio of 2.246 [95% CI (1.098-4.597)] and 2.267 [95% CI (1.107-4.642)], respectively. More males were affected by PTB than females with an adjusted odds ratio of 1.426 [95% CI (1.083-1.879)]. An in-depth interview with the respective laboratory chiefs showed that quality control measures for sputum smear microscopy were used at different levels of the testing activities; however, equipment function verification as a quality control measure was not accomplished regularly in all of the study hospital laboratories. The smear positive PTB case detection rate indicated in this study is significantly lower than the countries which met the 70% target of the World Health

  18. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  19. Evaluación de adsorbentes para la reducción de aflatoxina M1 en leche de vacas alimentadas con dietas contaminadas artificialmente con AFB

    Directory of Open Access Journals (Sweden)

    Federico Rojo

    2014-01-01

    Full Text Available Los adsorbentes han sido utilizados ampliamente para prevenir las micotoxicosis y la transferencia d e toxinas o sus metabolitos dentro de la cadena alimentaria. Particularmente, se unen a las aflatoxinas dentro del tracto gastrointestinal de los rumiantes, disminuyendo su biodisponibilidad y la transferencia de aflatoxin a M 1 (AFM 1 a la leche. El presente estudio se desarrolló para evaluar dos métodos de exposición a aflatoxina B 1 en vacas Holstein y monitorear la transferencia AFM 1 a la leche. Adicionalmente, se analizó el potencial de tres adsorbentes de aflatoxinas en ambos experimentos. Los resultados mostraron una tasa de trasferencia de AFB 1 a AFM 1 / día de 3.35 y 1.8 % en los dos experimentos respectivamente. La transferencia estimada de AFM 1 en la leche observada en el segundo método fue cercana a las obtenidas de vacas alimentadas con alimentos natura lmente contaminados con aflatoxinas. A diferencia de los glucomananos de paredes cel ulares de levaduras, ambos adsorbentes de aluminosilicatos disminuyeron significativamente los niveles de AFM 1 en la leche ( P <0.05.

  20. Generating Units

    Data.gov (United States)

    Department of Homeland Security — Generating Units are any combination of physically connected generators, reactors, boilers, combustion turbines, and other prime movers operated together to produce...

  1. Evaluation of Random Blinded Re-Checking of AFB Slides under Revised National Tuberculosis Control Programme in Solapur District

    Directory of Open Access Journals (Sweden)

    Swapnil Vishnu Lale

    2013-01-01

    Full Text Available Background: One of the important components of revised national tuberculosis control programme is ‘Good quality diagnosis, primarily by sputum smear microscopy’. All efforts are made to ensure that the designated microscopy centers function at optimal level. The process of ‘Random Blinded Re-Checking’ (RBRCof Acid Fast Bacillus slides is built in the programme. Objectives: To study the relationship of different types of errors detected in RBRC with respect to time, place and cost. To study the stability and capability of the process of RBRC. Methods: Analysis of secondary data of external quality assessment of Solapur district since January 2006 is supplemented by direct implementation of the programme since April 2011 till date. Data analysis is done using statistical software Minitab version 16.Results: Since January 2006 to May 2012;42191 slides were re-checked in 77 RBRC sessions at District Tuberculosis Center, Solapur.Different types of 69 errors were detected. Onsite evaluation and panel testing did not show any discordance. Barshi and Mangalwedha Tuberculosis Units (TU showed significantly higher number of errors as compared to Karmala TU. (P<0.002 Weighted Pareto Chart revealed that the costliest form of errors is high false negatives and low false negatives. Conclusion:Detection of errors in RBRC sessions follows Poisson distribution. The process of RBRC is found to be in control and capable of achieving the desired target of detection of errors.

  2. Visible and near-ultraviolet spectroscopy at Thule AFB (76.5 N) from January 28 - February 15, 1988

    Science.gov (United States)

    Mount, G. H.; Sanders, R. W.; Jakoubek, R. O.; Schmeltekopf, A. L.; Solomon, S.

    1988-01-01

    Near-ultraviolet and visible spectrographs identical to those employed at McMurdo Station, Antarctica (77.8 S) during the austral spring seasons of 1986 and 1987 were used to study the stratosphere above Thule, Greenland (76.5 N) during early spring, 1988. Observations were carried out both at night using the direct moon as a light source, and during the day by collecting the scattered light from the zenith sky when solar zenith angles were less than about 94.5 degrees. Excellent meteorological conditions prevailed in the troposphere and stratosphere at Thule. Surface weather was extremely clear over most of the period, facilitating measurements of the direct light from the moon. The lower stratospheric arctic polar vortex was located very near Thule throughout the observing period, and temperature at the 30 mbar level were typically below -80 C above Thule, according to the National Meteorological Center daily analyses. Thus conditions were favorable for polar stratospheric cloud formation above Thule. Total column ozone abundances were about 350 to 400 Dobson units, and did not suggest a clear temporal trend over the observing period. Stratospheric nitrogen dioxide measurements were complicated by the presence of a large component of tropospheric pollution on many occasions. Stratospheric nitrogen dioxide could be identified on most days using the absorption in the scattered light from the zenith sky, which greatly enhances the stratospheric airmass while suppressing the tropospheric contribution. These measurements suggest that the total vertical column abundance of nitrogen dioxide present over Thule in February was extremely low, sometimes as low as 3 x 10 to the 14th per sq cm. The abundance of nitrogen dioxide increased systemically from about 3 x 10 to the 14th in late January to 1.0 x 10 to the 15th per sq cm in mid-February, perhaps because of photolysis of N2O5 in the upper part of the stratosphere, near 25 to 35 km.

  3. Unit Manning

    National Research Council Canada - National Science Library

    McGinniss, Mike

    2003-01-01

    .... This decision combines two crucial initiatives: first, transforming the Army from an individual soldier replacement system to a unit manning system that enhances cohesion and keeps trained soldiers, leaders, and commanders together longer, thereby...

  4. Detector Unit

    CERN Multimedia

    1960-01-01

    Original detector unit of the Instituut voor Kernfysisch Onderzoek (IKO) BOL project. This detector unit shows that silicon detectors for nuclear physics particle detection were already developed and in use in the 1960's in Amsterdam. Also the idea of putting 'strips' onto the silicon for high spatial resolution of a particle's impact on the detector were implemented in the BOL project which used 64 of these detector units. The IKO BOL project with its silicon particle detectors was designed, built and operated from 1965 to roughly 1977. Detector Unit of the BOL project: These detectors, notably the ‘checkerboard detector’, were developed during the years 1964-1968 in Amsterdam, The Netherlands, by the Natuurkundig Laboratorium of the N.V. Philips Gloeilampen Fabrieken. This was done in close collaboration with the Instituut voor Kernfysisch Onderzoek (IKO) where the read-out electronics for their use in the BOL Project was developed and produced.

  5. Drilling unit

    Energy Technology Data Exchange (ETDEWEB)

    Umanchik, N P; Demin, A V; Khrustalev, N N; Linnik, G N; Lovchev, S V; Rozin, M M; Sidorov, R V; Sokolov, S I; Tsaregradskiy, Yu P

    1981-01-01

    A drilling unit is proposed which includes a hydraulic lifter, hydraulic multiple-cylinder pump with valve distribution and sectional drilling pump with separators of the working and flushing fluid. In order to reduce metal consumption and the overall dimensions of the drilling unit, the working cavity of each cylinder of the hydraulic multiple-cylinder pump is equipped with suction and injection valves and is hydraulically connected to the working cavity by one of the sections of the drilling pump.

  6. [Conservation Units.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  7. Ergonomic Survey, Hill AFB, UT

    Science.gov (United States)

    1991-03-01

    Hygiene NIOSH a. CAPT Roger Jensen, Division of Safety Research b. LCDR Patricia Schnitzer, Division of Safety Research c. GS-14 Vern Putz-Anderson... Patricia Schnitzer was provided a current listing (October 1988-October 1990) of the CTD cases from the PHOENIX data base for review. There were a...MOTIVE AERO-MOTIVE U.K. LTD. RO. Box 2678 1090 Brevik Place Rassau Industrial Estate Kalamazoo, M1 49003 Mississauga, Ontario Ebbw Vale Gwent NP3 5SD Ph

  8. AFB Directory of Services Listings

    Science.gov (United States)

    ... radio-talking-book/index.jsp Minnesota STAR Program Centennial Office Building Room 358 658 Cedar Street St. ... and Human Services Nebraska State Office Building 301 Centennial Mall South Lincoln, NE 68508 http://www.adrcnebraska. ...

  9. Final Environmental Assessment (EA) for Modification of Airspace Units R-3008A/B/C from Visual Flight Rules (VFR) to VFR-Instrument Flight Rules (IFR) at Moody Air Force Base, Georgia

    Science.gov (United States)

    2015-09-30

    RULES ( IFR ) AT MOODY AIR FORCE BASE, GEORGIA September 2015 Finding of No Significant Impact Modification of Airspace Units R-3008A/B/C from...Interactions with Federally- Recognized Tribes. These tribal governments were also consulted regarding impacts to Final EA for VFR- IFR in R-3008A/B/C at Moody...analysis would focus on impacts to these Final EA for VFR- IFR in R-3008A/B/C at Moody AFB September 2015 2-5 resources from proposed activities

  10. Microcontroller Unit

    International Nuclear Information System (INIS)

    Tulaev, A.B.

    1994-01-01

    The general purpose micro controller unit based on 8-bit single-chip microcomputer of the MCS-51 family is described. The controller has the data and program memories, a serial interface and an external bus for functional I/O extensions. The controller consists of a microcomputer chip, up to 4 ROM-RAM chips and 10 SSI and MSI chips, and it measures 160x120 mm. Both hardware and software micro system debugging tools are described. (author). 8 refs., 1 fig., 1 tab

  11. Solar unit

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanov, A M; Trushevskiy, S N; Tveryanovich, E V

    1982-01-01

    A solar unit is proposed which contains an inclined solar collector with supply and outlet pipelines, the first of which is connected to the source of a heat carrier, while the second is connected through the valve to the tank for collecting heated heat carrier equipped with a device for recovery. In order to improve the effectiveness of heating the heat carrier, it additionally contains a concentrator of solar radiation and a device for maintaining a level of the heat carrier in the collector in the zone of the focal spot of the concentrator, while the heat pipeline is connected to the source of the heat carrier with the help of a device for maintaining the level of the heat carrier.

  12. Termination unit

    Science.gov (United States)

    Traeholt, Chresten [Frederiksberg, DK; Willen, Dag [Klagshamn, SE; Roden, Mark [Newnan, GA; Tolbert, Jerry C [Carrollton, GA; Lindsay, David [Carrollton, GA; Fisher, Paul W [Heiskell, TN; Nielsen, Carsten Thidemann [Jaegerspris, DK

    2014-01-07

    This invention relates to a termination unit comprising an end-section of a cable. The end section of the cable defines a central longitudinal axis and comprising end-parts of N electrical phases, an end-part of a neutral conductor and a surrounding thermally insulation envelope adapted to comprising a cooling fluid. The end-parts of the N electrical phases and the end-part of the neutral conductor each comprising at least one electrical conductor and being arranged in the cable concentrically around a core former with a phase 1 located relatively innermost, and phase N relatively outermost in the cable, phase N being surrounded by the neutral conductor, electrical insulation being arrange between neighboring electrical phases and between phase N and the neutral conductor, and wherein the end-parts of the neutral conductor and the electrical phases each comprise a contacting surface electrically connected to at least one branch current lead to provide an electrical connection: The contacting surfaces each having a longitudinal extension, and being located sequentially along the longitudinal extension of the end-section of the cable. The branch current leads being individually insulated from said thermally insulation envelope by individual electrical insulators.

  13. Termination unit

    Energy Technology Data Exchange (ETDEWEB)

    Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann

    2016-05-03

    Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

  14. Continental United States Military Housing Inspections Southeast

    Science.gov (United States)

    2015-09-24

    that the HVAC system design used in the noncommissioned officer academy buildings at Fort Gordon was not appropriate or adequate for the climatic... HVAC ) system problems; mold; and moisture were not adequately addressed, resulting in poor indoor air quality and potential exposure of occupants to...Patrick AFB. 3 The number of military personnel occupying unaccompanied housing at NS Mayport fluctuates based on ship arrival and departure

  15. SI units in radiology

    Energy Technology Data Exchange (ETDEWEB)

    Iyer, P S [Bhabha Atomic Research Centre, Bombay (India). Div. of Radiation Protection

    1978-11-01

    The proposal of the International Commission on Radiation Units and Measurements that the special units of radiation and radioactivity-roentgen, rad, rem and curie-be replaced by the International System (SI) of Units has been accepted by international bodies. This paper reviews the resons for introducing the new units and their features. The relation between the special units and the corresponding SI units is discussed with examples. In spite of anticipated difficulties, the commission recommends a smooth and efficient changeover to the SI units in ten years.

  16. NASA Conjunction Assessment Organizational Approach and the Associated Determination of Screening Volume Sizes

    Science.gov (United States)

    Newman, Lauri K.; Hejduk, Matthew D.

    2015-01-01

    NASA is committed to safety of flight for all of its operational assets Performed by CARA at NASA GSFC for robotic satellites Focus of this briefing Performed by TOPO at NASA JSC for human spaceflight he Conjunction Assessment Risk Analysis (CARA) was stood up to offer this service to all NASA robotic satellites Currently provides service to 70 operational satellites NASA unmanned operational assets Other USG assets (USGS, USAF, NOAA) International partner assets Conjunction Assessment (CA) is the process of identifying close approaches between two orbiting objects; sometimes called conjunction screening The Joint Space Operations Center (JSpOC) a USAF unit at Vandenberg AFB, maintains the high accuracy catalog of space objects, screens CARA-supported assets against the catalog, performs OD tasking, and generates close approach data.

  17. Vegetation studies on Vandenberg Air Force Base, California

    Science.gov (United States)

    Schmalzer, Paul A.; Hickson, Diana E.; Hinkle, C. Ross

    1988-01-01

    Vandenburg Air Force Base, located in coastal central California with an area of 98,400 ac, contains resources of considerable biological significance. Available information on the vegetation and flora of Vandenburg is summarized and new data collected in this project are presented. A bibliography of 621 references dealing with vegetation and related topics related to Vanderburg was compiled from computer and manual literature searches and a review of past studies of the base. A preliminary floristic list of 642 taxa representing 311 genera and 80 families was compiled from past studies and plants identified in the vegetation sampling conducted in this project. Fifty-two special interest plant species are known to occur or were suggested to occur. Vegetation was sampled using permanent plots and transects in all major plant communities including chaparral, Bishop pine forest, tanbark oak forest, annual grassland, oak woodland, coastal sage scrub, purple sage scrub, coastal dune scrub, coastal dunes, box elder riparian woodland, will riparian woodland, freshwater marsh, salt marsh, and seasonal wetlands. Comparison of the new vegetation data to the compostie San Diego State University data does not indicate major changes in most communities since the original study. Recommendations are made for additional studies needed to maintain and extend the environmental data base and for management actions to improve resource protection.

  18. Unit Cost Compendium Calculations

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Unit Cost Compendium (UCC) Calculations raw data set was designed to provide for greater accuracy and consistency in the use of unit costs across the USEPA...

  19. United States housing, 2012

    Science.gov (United States)

    Delton Alderman

    2013-01-01

    Provides current and historical information on housing market in the United States. Information includes trends for housing permits and starts, housing completions for single and multifamily units, and sales and construction. This report will be updated annually.

  20. United Cerebral Palsy

    Science.gov (United States)

    ... your local affiliate Find your local affiliate United Cerebral Palsy United Cerebral Palsy (UCP) is a trusted resource for individuals with Cerebral Palsy and other disabilities and their networks. Individuals with ...

  1. Malaria Treatment (United States)

    Science.gov (United States)

    ... Providers, Emergency Consultations, and General Public. Contact Us Malaria Treatment (United States) Recommend on Facebook Tweet Share Compartir Treatment of Malaria: Guidelines For Clinicians (United States) Download PDF version ...

  2. Potential Impacts Related to the Air Training Command Realignments. Institutional Characteristics, Transportation, Civilian Community Utilities, Land Use for Craig AFB, Alabama, Webb AFB, Texas, Columbus AFB, Mississippi, Laughlin AFB, Texas, Reese AFB, Texas, Vance AFB, Oklahoma

    Science.gov (United States)

    1976-12-30

    response and 70.4 percent civilian response, extend to 100 percent population, 1975; Counity Census Data, General Social =0 Economic Characteristics. 25...transportation problems exist and the alternative action is not txpected to disturb the situation in the future. 86 On-Base (AFERN 4.4.1.3) No major problema of...values could increase in specific residential areas that are perceived as meeting certain economic and social needs where current 7acancies are minimal

  3. Universal Documentation System Handbook. Volume 2. Requirement Formats and Instructions, Program Introduction, Program Requirements Document/Operations Requirements.

    Science.gov (United States)

    1989-08-01

    horizontal plane is defined as a plane normal to the geocentric position vector. Inertial Azimuth Heading Angle entries are the angles measured east of north...0CATICN: Enter the areas or locations that are to be staffed with redical perscnel, i.e., Vandenberg AFB Hospital, PMIC; or offshore boats, etc. NUMB

  4. Universal Documentation System Handbook. Volume 2. Requirement Formats and Instructions; Program Introduction, Program Requirements Document/Operations Requirements

    Science.gov (United States)

    1989-08-01

    and the local horizontal plane, measured positive above the horizontal plane. The local horizontal plane is defined as a plane normal to the geocentric ...preparation instructions for Format 1000. LOCATION: Enter the areas or locations that are to be staffed with medical personnel, i.e., Vandenberg AFB

  5. 77 FR 32592 - Procurement List; Additions

    Science.gov (United States)

    2012-06-01

    ..., Lawrence, KS. Contracting Activity: Defense Logistics Agency Troop Support, Philadelphia, PA. Coverage: C-List for 100% of the requirement of the Department of Defense, as aggregated by the Defense Logistics... Supply Store (COCESS), 30th Civil Engineering Squadron, 1515 Iceland Avenue, Room 150, Vandenberg AFB, CA...

  6. A multiplicity logic unit

    International Nuclear Information System (INIS)

    Bialkowski, J.; Moszynski, M.; Zagorski, A.

    1981-01-01

    The logic diagram principle of operation and some details of the design of the multiplicity logic unit are presented. This unit was specially designed to fulfil the requirements of a multidetector arrangement for gamma-ray multiplicity measurements. The unit is equipped with 16 inputs controlled by a common coincidence gate. It delivers a linear output pulse with the height proportional to the multiplicity of coincidences and logic pulses corresponding to 0, 1, ... up to >= 5-fold coincidences. These last outputs are used to steer the routing unit working with the multichannel analyser. (orig.)

  7. ENERGY STAR Unit Reports

    Data.gov (United States)

    Department of Housing and Urban Development — These quarterly Federal Fiscal Year performance reports track the ENERGY STAR qualified HOME units that Participating Jurisdictions record in HUD's Integrated...

  8. 31 CFR 515.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 515.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including the Trust Territory of...

  9. 31 CFR 500.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 500.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including U.S. trust territories...

  10. 31 CFR 535.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 535.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof including the Trust Territory of...

  11. Severe Weather Forecasting for Laughlin AFB, TX

    National Research Council Canada - National Science Library

    Cercone, Eric J

    2007-01-01

    .... Indices, including convective available potential energy (CAPE) and mean layer CAPE (MLCAPE), along with sounding parameters and combinations of such as 0-2 and 0-6 km bulk shear, 700-500 mb lapse rate, lifted condensation level...

  12. Historic Landscape Survey, Randolph AFB, Texas

    Science.gov (United States)

    2013-09-01

    listed men. Throughout 1930 and 1931, construction at the base was steady in spite of the nation’s depressed economy.22 Figure 3. The road... centennial year of 1932, during which patriotic societies planted trees throughout the country in honor of the first president. During the next year, the

  13. Herbicide Orange Site Characterization Study, Eglin AFB

    Science.gov (United States)

    1987-01-01

    F THIS PAGE Availabilit o this r is sp f o.n" the reverse of fo cove* . - .’.r. 717 CSAT CO ES ’SU JEC TE MS Coninu onrevrseif ece~ar an idntiy b...of Hardstand 7 and Surface Water Drainages ......... 4 3 Hardstand 7 Herbicide Oran&e Storage Locations .............. 5 4 Concentrations (in ppb) of...insoluble in water . The formula contained an approximate 50/50 mixture of the herbicides 2,4-dichlorophenoxyacetic acid (2,4,-D) and 2,4,5

  14. Neighbors United for Health

    Science.gov (United States)

    Westhoff, Wayne W.; Corvin, Jaime; Virella, Irmarie

    2009-01-01

    Modeled upon the ecclesiastic community group concept of Latin America to unite and strengthen the bond between the Church and neighborhoods, a community-based organization created Vecinos Unidos por la Salud (Neighbors United for Health) to bring health messages into urban Latino neighborhoods. The model is based on five tenants, and incorporates…

  15. Smart Rocking Armour Units

    NARCIS (Netherlands)

    Hofland, B.; Arefin, Syed Shamsil; van der Lem, Cock; van gent, Marcel

    2018-01-01

    This paper describes a method to measure the rocking motion of lab-scale armour units. Sensors as found in mobile phones are used. These sensors, data-storage and battery are all embedded in the model units, such that they can be applied without wires attached to them. The technique is applied to

  16. METRIC context unit architecture

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, R.O.

    1988-01-01

    METRIC is an architecture for a simple but powerful Reduced Instruction Set Computer (RISC). Its speed comes from the simultaneous processing of several instruction streams, with instructions from the various streams being dispatched into METRIC's execution pipeline as they become available for execution. The pipeline is thus kept full, with a mix of instructions for several contexts in execution at the same time. True parallel programming is supported within a single execution unit, the METRIC Context Unit. METRIC's architecture provides for expansion through the addition of multiple Context Units and of specialized Functional Units. The architecture thus spans a range of size and performance from a single-chip microcomputer up through large and powerful multiprocessors. This research concentrates on the specification of the METRIC Context Unit at the architectural level. Performance tradeoffs made during METRIC's design are discussed, and projections of METRIC's performance are made based on simulation studies.

  17. Decision unit program

    International Nuclear Information System (INIS)

    Madjar, N.; Pastor, C.; Chambon, B.; Drain, D.; Giorni, A.; Dauchy, A.

    1981-01-01

    A decision unit has been built to simplify the electronic logic set-up in multi-detectors experiments. This unit, designed with fast memories used as decision making tables, replaces conventional logic modules. Nine inputs are provided for receiving the fast detector signals (charged particles, gammas, neutrons, ...). Fifteen independent outputs allow the identification of the choosen events among the 2 9 possible events. A CAMAC interface between the unit and the computer, or a manual control auxiliary module, is used to load, in the memory, the pattern of the choosen events [fr

  18. Smart Rocking Armour Units

    OpenAIRE

    Hofland, B.; Arefin, Syed Shamsil; van der Lem, Cock; van gent, Marcel

    2018-01-01

    This paper describes a method to measure the rocking motion of lab-scale armour units. Sensors as found in mobile phones are used. These sensors, data-storage and battery are all embedded in the model units, such that they can be applied without wires attached to them. The technique is applied to double-layer units in order to compare the results to the existing knowledge for this type of armour layers. In contrast to previous research, the gyroscope reading is used to determine the (rocking)...

  19. Allocating multiple units

    DEFF Research Database (Denmark)

    Tranæs, Torben; Krishna, Kala

    2002-01-01

    This paper studies the allocation and rent distribution in multi-unit, combinatorial-bid auctions under complete information. We focus on the natural multi-unit analogue of the first-price auction, where buyers bid total payments, pay their bids, and where the seller allocates goods to maximize his...... auction, which is the multi unit analogue of a second-price auction. Furthermore, we characterize these equilibria when valuations take a number of different forms: diminishing marginal valuations, increasing average valuations, and marginal valuations with single turning points...

  20. Measuring and Assessing Technical Training Performance in the Army’s Schools and Units: A Survey of Current Methods

    Science.gov (United States)

    1988-10-01

    Madey and Stenner , 1981) and the Delphi Technique (Dalkey, 1969). These techniques are used by management analysts, industrial-organizational...Personnel Research Laboratory, Aerospace Medical Division, Lackland AFB, TX, May 1963. Madey, D, & Stenner , J. (1980). Policy implications analysis: A

  1. Tax Unit Boundaries

    Data.gov (United States)

    Kansas Data Access and Support Center — The Statewide GIS Tax Unit boundary file was created through a collaborative partnership between the State of Kansas Department of Revenue Property Valuation...

  2. Insects: An Interdisciplinary Unit

    Science.gov (United States)

    Leger, Heather

    2007-01-01

    The author talks about an interdisciplinary unit on insects, and presents activities that can help students practice communication skills (interpersonal, interpretive, and presentational) and learn about insects with hands-on activities.

  3. UnitedHealth Group

    Science.gov (United States)

    UnitedHealth Group provides accessible and affordable services, improved quality of care, coordinated health care efforts, and a supportive environment for shared decision making between patients and their physicians.

  4. Operable Unit Boundaries

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset consists of operable unit data from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times and...

  5. Flywheel and power unit

    Energy Technology Data Exchange (ETDEWEB)

    Seeley, R.W.

    1992-10-28

    A power unit, e.g. for an electrically driven vehicle, incorporates a flywheel for storing kinetic energy and a battery for storing electrical energy. The battery is incorporated as a substantial part of the rotating mass of the flywheel. Preferably the unit further includes an electrical machine being a motor or generator or machine operable either as a motor or a generator for transferring energy between the battery and the flywheel and/or for the input or output of rotary energy therefrom or thereto. The motor may be used for powering the flywheel and may also operate in a regenerative mode for recharging the unit on de-acceleration of the vehicle. The unit of the invention may also be utilized as an electrical stored power source, e.g. wind or water driven. (author)

  6. Does size matter? Animal units and animal unit months

    Science.gov (United States)

    Lamar Smith; Joe Hicks; Scott Lusk; Mike Hemmovich; Shane Green; Sarah McCord; Mike Pellant; John Mitchell; Judith Dyess; Jim Sprinkle; Amanda Gearhart; Sherm Karl; Mike Hannemann; Ken Spaeth; Jason Karl; Matt Reeves; Dave Pyke; Jordan Spaak; Andrew Brischke; Del Despain; Matt Phillippi; Dave Weixelmann; Alan Bass; Jessie Page; Lori Metz; David Toledo; Emily Kachergis

    2017-01-01

    The concepts of animal units, animal unit months, and animal unit equivalents have long been used as standards for range management planning, estimating stocking rates, reporting actual use, assessing grazing fees, ranch appraisal, and other purposes. Increasing size of cattle on rangelands has led some to suggest that the definition of animal units and animal unit...

  7. UniTed

    OpenAIRE

    Harma, Eero

    2010-01-01

    UniTed on Teddy boy- tyylistä inspiroitunut kevät/kesä mallisto naisille.Mallistossa yhdistyy perinteinen teddy boy- vaatetus ja klassinen feminiinisyys, sekä menneisyys ja nykyisyys. Suunnittelun lähtökohtia olivat naisellisuus, tyylikkyys ja pyrkimys luoda nykyaikaista suunnittelua menneisyydestä lainaillen. United is a teddy boy- style inspired spring/summer collection for women. The collection combines traditional Teddy boy style with classical feminity and past with the present. The b...

  8. Freestanding midwifery unit versus obstetric unit

    DEFF Research Database (Denmark)

    Overgaard, Charlotte; Møller, Anna Margrethe; Fenger-Grøn, Morten

    2011-01-01

    low-risk women intending FMU birth and a matched control group of 839 low-risk women intending OU birth were included at the start of care in labour. OU women were individually chosen to match selected obstetric/socio-economic characteristics of FMU women. Analysis was by intention to treat. Main......Objective To compare perinatal and maternal morbidity and birth interventions in low-risk women giving birth in two freestanding midwifery units (FMUs) and two obstetric units (OUs). Design A cohort study with a matched control group. Setting The region of North Jutland, Denmark. Participants 839...... women were significantly less likely to experience an abnormal fetal heart rate (RR: 0.3, 95% CI 0.2 to 0.5), fetal–pelvic complications (0.2, 0.05 to 0.6), shoulder dystocia (0.3, 0.1 to 0.9), occipital–posterior presentation (0.5, 0.3 to 0.9) and postpartum haemorrhage >500 ml (0.4, 0.3 to 0...

  9. KC-46A Formal Training Unit (FTU) and First Main Operating Base (MOB 1) Beddown EIS. Volume 1

    Science.gov (United States)

    2014-03-01

    discharged into the sanitary sewer system. Most of the sanitary sewer system at Altus AFB is over 45 years old and constructed of vitrified clay ...drained (USDA 2002a, 2003). The textures of the Tillman-Hollister soils range from clay loam to clay , with the Hollister subsurface soils being more clayey...range from sandy to sandy loam to sandy clay loam, with the Nobscot soils having a more sandy nature, especially in the surface soils (Altus AFB 2009a

  10. Rapanos v. United States & Carabell v. United States

    Science.gov (United States)

    Documents associated with guidance for implementing the definition of waters of the United States under the Clean Water Act following the Rapanos v. United States, and Carabell v. United States Supreme Court decision.

  11. Gas-centrifuge unit

    International Nuclear Information System (INIS)

    Stark, T.M.

    1977-01-01

    An isotope-enrichment unit is described for separating a gaseous mixture feedstock including a compound of a light nuclear isotope at a predetermined concentration and a compound of a heavy nuclear isotope at a predetermined concentration into at least two unit-output fractions including a waste fraction depleted in the light isotope to a predetermined concentration and a product fraction enriched in the light isotope to a predetermined concentration. The unit comprises a first group of cascades of gas centrifuges, each cascade having an enriching stage, a stripping stage, an input, a light-fraction output, and a heavy-fraction output for separating the gaseous-mixture feed stock into light and heavy gaseous-mixture fractions; and an auxillary cascade

  12. Mechanical strainer unit

    International Nuclear Information System (INIS)

    Kraeling, J.B.; Netkowicz, R.J.; Schnall, I.H.

    1983-01-01

    The mechanical strainer unit is connected to a flanged conduit which originates in and extends out of a suppression chamber in a nuclear reactor. The strainer includes a plurality of centrally apertured plates positioned along a common central axis and in parallel and spaced relationship. The plates have a plurality of bores radially spaced about the central axis. Spacer means such as washers are positioned between adjacent plates to maintain the plates is spaced relationship and form communicating passages of a predetermined size to the central apertures. Connecting means such as bolts or studs extend through the aligned bores to maintain the unit in assembled relationship and secure the unit to the pipe. By employing perforated plates and blocking off certain of the communicating passages, a dual straining effect can be achieved

  13. Mobile emergency response unit

    International Nuclear Information System (INIS)

    Kadi, W.J.; Trolan, R.T.; Becker, J.F.

    1979-01-01

    The Hotspot quick-response unit was the solution to a requirement to find, identify, and control areas of radioactive contamination at the scene of a nuclear weapons accident. The unit consists of two trucks and two trailers, and is designed to be transported by one U.S. Air Force C-141. One truck (generator truck) carries a 40 kW generator-heater-air conditioner combination, spare tires, and accessories. The other (water truck) carries supplies and a 250-gal water tank. One trailer (counting trailer) contains detecting, counting, and recording equipment. The other (decontaminating trailer) contains a shower, sink, 30-gal hot water tank, and supplies

  14. Transfer of manufacturing units

    DEFF Research Database (Denmark)

    Madsen, Erik Skov; Riis, Jens Ove; Sørensen, Brian Vejrum

    2008-01-01

    The ongoing and unfolding relocation of activities is one of the major trends, that calls for attention in the domain of operations management. In particular, prescriptive models outlining: stages of the process, where to locate, and how to establish the new facilities have been studied, while...... and dilemmas to be addressed when transferring manufacturing units....

  15. United States Attorney Prosecutions

    Science.gov (United States)

    1993-10-01

    property of CocaCola Bottling Company, Fayetteville, North Carolina, of a value in excess of $100.00, in violation of Title 18 United States Code, Section...another, to-wit: a Cocacola soft drink machine, the amount of damage to said personal property being more than $200.00, in violation of North Carolina

  16. Planter unit test stand

    Science.gov (United States)

    A planter test stand was developed to evaluate individual row-crop metering units in early 2013. This test stand provided the ability to quantify actual seed metering in terms of population, seed spacing, skips, and multiples over a range of meter RPMs and vacuum pressures. Preliminary data has been...

  17. United Kingdom's experience

    International Nuclear Information System (INIS)

    Drummond, S.M.

    1994-01-01

    This is a presentation of the United Kingdom's experience with power transmission open access. The topics of the presentation include the objectives of changing, commercial arrangements and economic drivers, long term effects, the effects of moving to a more competitive environment, and factors affecting open access such as political climate and market regulation

  18. Whale Teaching Unit.

    Science.gov (United States)

    Peninsula Humane Society, San Mateo, CA.

    Materials in this teaching unit are designed to foster an interest in whale preservation among intermediate grade and junior high school students. Several readings provide background information on various types of whales and the economic value of whales. Student activities include a true and false game, a crossword, and a mobile. A resource list…

  19. Multifunctional centrifugal grinding unit

    Science.gov (United States)

    Sevostyanov, V. S.; Uralskij, V. I.; Uralskij, A. V.; Sinitsa, E. V.

    2018-03-01

    The article presents scientific and engineering developments of multifunctional centrifugal grinding unit in which the selective effect of grinding bodies on the crushing material is realized, depending on its physical and mechanical characteristics and various schemes for organizing the technological process

  20. United in change

    NARCIS (Netherlands)

    Hanneke Posthumus; Josje den Ridder; Joep de Hart

    2014-01-01

    Original title: Verenigd in verandering The importance of citizens who unite in civil society organisations is broadly recognised. Organisations bind people to each other, to the community and to the political system. How are civil-society organisations in the Netherlands faring? Is there

  1. Unit III: International Conflict.

    Science.gov (United States)

    Maxey, Phyllis

    1983-01-01

    This lesson helps students understand the global network involved in international events. Students have an opportunity to examine the impact of international law and the role of international organizations, national governments, and private individuals in the effort to secure the release of United States hostages in Iran. (AM)

  2. Unit 16 - Output

    OpenAIRE

    Unit 16, CC in GIS; Star, Jeffrey L.

    1990-01-01

    This unit discusses issues related to GIS output, including the different types of output possible and the hardware for producing each. It describes text, graphic and digital data that can be generated by a GIS as well as line printers, dot matrix printers/plotters, pen plotters, optical scanners and cathode ray tubes (CRTs) as technologies for generating the output.

  3. Defining line replaceable units

    NARCIS (Netherlands)

    Parada Puig, J. E.; Basten, R. J I

    2015-01-01

    Defective capital assets may be quickly restored to their operational condition by replacing the item that has failed. The item that is replaced is called the Line Replaceable Unit (LRU), and the so-called LRU definition problem is the problem of deciding on which item to replace upon each type of

  4. Contamination analysis unit

    International Nuclear Information System (INIS)

    Gregg, H.R.; Meltzer, M.P.

    1996-01-01

    The portable Contamination Analysis Unit (CAU) measures trace quantities of surface contamination in real time. The detector head of the portable contamination analysis unit has an opening with an O-ring seal, one or more vacuum valves and a small mass spectrometer. With the valve closed, the mass spectrometer is evacuated with one or more pumps. The O-ring seal is placed against a surface to be tested and the vacuum valve is opened. Data is collected from the mass spectrometer and a portable computer provides contamination analysis. The CAU can be used to decontaminate and decommission hazardous and radioactive surfaces by measuring residual hazardous surface contamination, such as tritium and trace organics. It provides surface contamination data for research and development applications as well as real-time process control feedback for industrial cleaning operations and can be used to determine the readiness of a surface to accept bonding or coatings. 1 fig

  5. Combustion strategy : United Kingdom

    Energy Technology Data Exchange (ETDEWEB)

    Greenhalgh, D. [Heriot-Watt Univ., Edingburgh, Scotland (United Kingdom). School of Engineering and Physical Sciences

    2009-07-01

    The United Kingdom's combustion strategy was briefly presented. Government funding sources for universities were listed. The United Kingdom Research Councils that were listed included the Arts and Humanities Research Council (AHRC) and the Biotechnology and Biological Sciences Research Council (BBSRC); the Engineering and Physical Sciences Research Council (EPSRC); the Economic and Social Research Council; the Medical Research Council; the Natural Environment Research Council; and the Science and Technology Facilities Council. The EPSRC supported 65 grants worth 30.5 million pounds. The combustion industry was noted to be dominated by three main players of which one was by far the largest. The 3 key players were Rolls-Royce; Jaguar Land Rover; and Doosan Babcock. Industry and government involvement was also discussed for the BIS Technology Strategy Board, strategy technology areas, and strategy application areas.

  6. Uranium chemistry research unit

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    The initial field of research of this Unit, established in 1973, was the basic co-ordination chemistry of uranium, thorium, copper, cobalt and nickel. Subsequently the interest of the Unit extended to extractive metallurgy relating to these metals. Under the term 'co-ordination chemistry' is understood the interaction of the central transition metal ion with surrounding atoms in its immediate vicinity (within bonding distance) and the influence they have on each other - for example, structural studies for determining the number and arrangement of co-ordinated atoms and spectrophotometric studies to establish how the f electron energy levels of uranium are influenced by the environment. New types of uranium compounds have been synthesized and studied, and the behaviour of uranium ions in non-aqueous systems has also received attention. This work can be applied to the development and study of extractants and new extractive processes for uranium

  7. Laser color recording unit

    Science.gov (United States)

    Jung, E.

    1984-05-01

    A color recording unit was designed for output and control of digitized picture data within computer controlled reproduction and picture processing systems. In order to get a color proof picture of high quality similar to a color print, together with reduced time and material consumption, a photographic color film material was exposed pixelwise by modulated laser beams of three wavelengths for red, green and blue light. Components of different manufacturers for lasers, acousto-optic modulators and polygon mirrors were tested, also different recording methods as (continuous tone mode or screened mode and with a drum or flatbed recording principle). Besides the application for the graphic arts - the proof recorder CPR 403 with continuous tone color recording with a drum scanner - such a color hardcopy peripheral unit with large picture formats and high resolution can be used in medicine, communication, and satellite picture processing.

  8. Optimally Locating MARFORRES Units

    OpenAIRE

    Salmeron, Javier; Dell, Rob

    2015-01-01

    Javier Salmeron and Rob Dell The U.S. Marine Forces Reserve (USMCR, MARFORRES) is conducting realignment studies where discretionary changes may benefit from formal mathematical analysis. This study has developed an optimization tool to guide and/or support Commander, MARFORRES (CMFR) decisions. A prototype of the optimization tool has been tested with data from the units and Reserve Training Centers (RTCs) in the San Francisco, CA and Sacramento, CA areas. Prepared for: MARFORRES, POC:...

  9. LIDAR COMBINED SCANNING UNIT

    Directory of Open Access Journals (Sweden)

    V. V. Elizarov

    2016-11-01

    Full Text Available Subject of Research. The results of lidar combined scanning unit development for locating leaks of hydrocarbons are presented The unit enables to perform high-speed scanning of the investigated space in wide and narrow angle fields. Method. Scanning in a wide angular field is produced by one-line scanning path by means of the movable aluminum mirror with a frequency of 20Hz and amplitude of 20 degrees of swing. Narrowband scanning is performed along a spiral path by the deflector. The deflection of the beam is done by rotation of the optical wedges forming part of the deflector at an angle of ±50. The control function of the scanning node is performed by a specialized software product written in C# programming language. Main Results. This scanning unit allows scanning the investigated area at a distance of 50-100 m with spatial resolution at the level of 3 cm. The positioning accuracy of the laser beam in space is 15'. The developed scanning unit gives the possibility to browse the entire investigated area for the time not more than 1 ms at a rotation frequency of each wedge from 50 to 200 Hz. The problem of unambiguous definition of the beam geographical coordinates in space is solved at the software level according to the rotation angles of the mirrors and optical wedges. Lidar system coordinates are determined by means of GPS. Practical Relevance. Development results open the possibility for increasing the spatial resolution of scanning systems of a wide range of lidars and can provide high positioning accuracy of the laser beam in space.

  10. Radiation quantities and units

    International Nuclear Information System (INIS)

    1980-01-01

    This report supersedes ICRU Report 19. Since ICRU Report 19 was published, a number of discussions have taken place between members of the Report Committee on Fundamental Quantities and Units and other workers in the field. Some of these discussions have resulted in the acceptance of certain modifications in the material set out in Report 19 and these modifications are incorporated in the current report. In addition, there has been some expansion and rearrangement of the material in the earlier report. In line, with providing more didactic material and useful source material for other ICRU reports, the general considerations in subsection 1.A of Report 19 have been expanded and placed in a separate subsection. The additional material includes discussions of four terms that are used in this document - quantity, unit, stochastic, and non-stochastic - along with a brief discussion of the mathematical formalism used in ICRU reports. As in ICRU Report 19, the definitions of quantities and units specifically designed for radiation protection (Part B) are separated from those of the general quantities (Part A). The inclusion of the index concept outlined in ICRU Report 25[4] required an extension of Part B

  11. United States rejoin ITER

    International Nuclear Information System (INIS)

    Roberts, M.

    2003-01-01

    Upon pressure from the United States Congress, the US Department of Energy had to withdraw from further American participation in the ITER Engineering Design Activities after the end of its commitment to the EDA in July 1998. In the years since that time, changes have taken place in both the ITER activity and the US fusion community's position on burning plasma physics. Reflecting the interest in the United States in pursuing burning plasma physics, the DOE's Office of Science commissioned three studies as part of its examination of the option of entering the Negotiations on the Agreement on the Establishment of the International Fusion Energy Organization for the Joint Implementation of the ITER Project. These were a National Academy Review Panel Report supporting the burning plasma mission; a Fusion Energy Sciences Advisory Committee (FESAC) report confirming the role of ITER in achieving fusion power production, and The Lehman Review of the ITER project costing and project management processes (for the latter one, see ITER CTA Newsletter, no. 15, December 2002). All three studies have endorsed the US return to the ITER activities. This historical decision was announced by DOE Secretary Abraham during his remarks to employees of the Department's Princeton Plasma Physics Laboratory. The United States will be working with the other Participants in the ITER Negotiations on the Agreement and is preparing to participate in the ITA

  12. United States advanced technologies

    International Nuclear Information System (INIS)

    Longenecker, J.R.

    1985-01-01

    In the United States, the advanced technologies have been applied to uranium enrichment as a means by which it can be assured that nuclear fuel cost will remain competitive in the future. The United States is strongly committed to the development of advanced enrichment technology, and has brought both advanced gas centrifuge (AGC) and atomic vapor laser isotope separation (AVLIS) programs to a point of significant technical refinement. The ability to deploy advanced technologies is the basis for the confidence in competitive future price. Unfortunately, the development of advanced technologies is capital intensive. The year 1985 is the key year for advanced technology development in the United States, since the decision on the primary enrichment technology for the future, AGC or AVLIS, will be made shortly. The background on the technology selection process, the highlights of AGC and AVLIS programs and the way to proceed after the process selection are described. The key objective is to maximize the sales volume and minimize the operating cost. This will help the utilities in other countries supply low cost energy on a reliable, long term basis. (Kako, I.)

  13. Dover AFB Catchment Area TRICARE Marketing Plan, 436th Medical Group, Dover AFB, Delaware,

    Science.gov (United States)

    1997-06-01

    cosmetic changes (Nadiu, Kleimenhagen, and Pillari 1992). Berkowitz classifies the debate in terms of eras. During the production era, the function was to...facilities in Smyrna and Fenton , Delaware. KGH has aggressive marketing and community education programs which include classes on: cardiopulmonary

  14. The Military Emergency Unit

    International Nuclear Information System (INIS)

    Gonzalez Requena, J. M.

    2007-01-01

    One of the most justified and pressing demands that society makes of the State, requiring a fast, forceful and effective response, is that it guarantees the safety of people and their assets when a disaster seriously endangers them. At the proposal of the President of the Government, the Cabinet of Ministers, in its meeting held on October 7, 2005, agreed to create the Military Emergency Unit, known since the as the UME. Its mission is to intervene anywhere in the national territory when the President of the Government, or the Minister to whom he delegates, so decides in order to assure the safety and welfare of citizens in cases of serious risk, disaster, catastrophe or any other public need. The UME is organically incorporated into the Ministry of Defense and its actions may be supported with all the available human and material needs of the Armed Forces. Availability and effectiveness, with calmness and humility, have characterized the early actions of the Military Emergency Unit and are the guidelines for future action. The first steps of this military unit have focused on a clear goal: collaboration and participation in situations whose seriousness requires the coordination of different forces in order to immediately respond to them. The UME is the States tool to join forces and, with other administration and institutions, help to rapidly and effectively deal with emergencies. It has taken its first step and achieved the capacity specified in the UME Operations Order for 2007. The 150 men and women per battalion, plus the 80 in the Gando detachment, are on active duty and have sufficient material means to deploy, if necessary and when requested by the regions, town councils an other administrative bodies, to help in the extinction of forest fires. (Author)

  15. Decommissioning Unit Cost Data

    International Nuclear Information System (INIS)

    Sanford, P. C.; Stevens, J. L.; Brandt, R.

    2002-01-01

    The Rocky Flats Closure Site (Site) is in the process of stabilizing residual nuclear materials, decommissioning nuclear facilities, and remediating environmental media. A number of contaminated facilities have been decommissioned, including one building, Building 779, that contained gloveboxes used for plutonium process development but did little actual plutonium processing. The actual costs incurred to decommission this facility formed much of the basis or standards used to estimate the decommissioning of the remaining plutonium-processing buildings. Recent decommissioning activities in the first actual production facility, Building 771, implemented a number of process and procedural improvements. These include methods for handling plutonium contaminated equipment, including size reduction, decontamination, and waste packaging, as well as management improvements to streamline planning and work control. These improvements resulted in a safer working environment and reduced project cost, as demonstrated in the overall project efficiency. The topic of this paper is the analysis of how this improved efficiency is reflected in recent unit costs for activities specific to the decommissioning of plutonium facilities. This analysis will allow the Site to quantify the impacts on future Rocky Flats decommissioning activities, and to develop data for planning and cost estimating the decommissioning of future facilities. The paper discusses the methods used to collect and arrange the project data from the individual work areas within Building 771. Regression and data correlation techniques were used to quantify values for different types of decommissioning activities. The discussion includes the approach to identify and allocate overall project support, waste management, and Site support costs based on the overall Site and project costs to provide a ''burdened'' unit cost. The paper ultimately provides a unit cost basis that can be used to support cost estimates for

  16. Unit for air decontamination

    International Nuclear Information System (INIS)

    Mariano H, E.

    1991-02-01

    To fulfill the applicable requirements of safety to the ventilation systems in nuclear facilities, it is necessary to make a cleaning of the air that hurtles to the atmosphere. For that which was designed and it manufactured an unit for decontamination of the air for the Pilot plant of production of Nuclear Fuel that this built one with national parts, uses Hepa national filters and the design can adapt for different dimensions of filters, also can be added a lodging for a prefilter or to adopt two Hepa filters. (Author)

  17. Waste Water Treatment Unit

    International Nuclear Information System (INIS)

    Ramadan, A.E.K.

    2004-01-01

    A wastewater treatment plant to treat both the sanitary and industrial effluent originated from process, utilities and off site units of the refinery is described. The purpose is to obtain at the end of the treatment plant, a water quality that is in compliance with contractual requirements and relevant environmental regulations. first treatment (pretreatment). Primary de-oiling, Equalization, Neutralization, Secondary de-oiling. Second treatment (Biological), The mechanism of BOD removal, Biological flocculation, Nutrient requirements, Nitrification, De-nitrification, Effect of temperature, Effect of ph, Toxicity

  18. Applied Meteorology Unit (AMU)

    Science.gov (United States)

    Bauman, William; Crawford, Winifred; Barrett, Joe; Watson, Leela; Wheeler, Mark

    2010-01-01

    This report summarizes the Applied Meteorology Unit (AMU) activities for the first quarter of Fiscal Year 2010 (October - December 2009). A detailed project schedule is included in the Appendix. Included tasks are: (1) Peak Wind Tool for User Launch Commit Criteria (LCC), (2) Objective Lightning Probability Tool, Phase III, (3) Peak Wind Tool for General Forecasting, Phase II, (4) Upgrade Summer Severe Weather Tool in Meteorological Interactive Data Display System (MIDDS), (5) Advanced Regional Prediction System (ARPS) Data Analysis System (ADAS) Update and Maintainability, (5) Verify 12-km resolution North American Model (MesoNAM) Performance, and (5) Hybrid Single-Particle Lagrangian Integrated Trajectory (HYSPLIT) Graphical User Interface.

  19. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  20. The United Kingdom

    International Nuclear Information System (INIS)

    Jones, P.M.S.

    1987-01-01

    The history of nuclear development in the United Kingdom is traced, together with the factors (eg electricity demand, fossil fuel prices, political policy) that have influenced policy choices. Many of the research establishments and the fissile material production plants were established in the late 1940s. In these early years the civil and military development programmes were not separate. The initial growth period was in the 1950s when the plan was to build twelve reactors in three groups of four over ten years. The first were to be Magnox type reactors. This was trebled in 1957 and the advanced gas cooled reactor was developed. The Windscale fire in 1957 affected confidence in the nuclear programme. However, five AGR twin-reactor stations were ordered in 1964. These ran into construction problems and delay and it was not until 1980 that more new units were contemplated. The plan then was to build a pressurized water reactor at Sizewell-B. A delay to allow for the public inquiry put back the start of this until 1987 with commissioning planned for 1994. A list of the UK nuclear power stations is given and their operating performance discussed. The present situation and future prospects for nuclear power are reviewed. (U.K.)

  1. Functional unit for a processor

    NARCIS (Netherlands)

    Rohani, A.; Kerkhoff, Hans G.

    2013-01-01

    The invention relates to a functional unit for a processor, such as a Very Large Instruction Word Processor. The invention further relates to a processor comprising at least one such functional unit. The invention further relates to a functional unit and processor capable of mitigating the effect of

  2. Design of hydraulic recuperation unit

    Directory of Open Access Journals (Sweden)

    Jandourek Pavel

    2016-01-01

    Full Text Available This article deals with design and measurement of hydraulic recuperation unit. Recuperation unit consist of radial turbine and axial pump, which are coupled on the same shaft. Speed of shaft with impellers are 6000 1/min. For economic reasons, is design of recuperation unit performed using commercially manufactured propellers.

  3. Snakes: An Integrated Unit Plan.

    Science.gov (United States)

    Lawrence, Lisa

    This document presents an integrated unit plan on snakes targeting second grade students. Objectives of the unit include developing concepts of living things, understanding the contribution and importance of snakes to the environment, and making connections between different disciplines. The unit integrates the topic of snakes into the areas of…

  4. Inlet Geomorphology Evolution Work Unit

    Science.gov (United States)

    2015-10-30

    Coastal Inlets Research Program Inlet Geomorphology Evolution Work Unit The Inlet Geomorphology Evolution work unit of the CIRP develops methods...morphologic response. Presently, the primary tool of the Inlet Geomorphology Evolution work unit is the Sediment Mobility Tool (SMT), which allows the user

  5. United Arab Emirates.

    Science.gov (United States)

    1985-02-01

    This discussion of the United Arab Emirates focuses on the following: the people; geography; history; government; political conditions; defense; the economy; foreign relations; and relations between the US and the United Arab Emirates. In 1983 the population was estimated at 1,194,000. In 1984 the annual growth rate was negative. Life expectancy is about 60 years. Fewer than 20% of the population are UAE citizens. Indigenous Emiris are Arab; the rest of the population includes significant numbers of other Arabs -- Palestinians, Egyptians, Jordanians, Yemenis, Omanis, as well as many Iranians, Pakistanis, Indians, and West Europeans, especially in Dubai. The UAE is in the eastern Arabian Peninsula, bounded on the north by the Persian Gulf. European and Arab pirates roamed the Trucial Coast area from the 17th century into the 19th century. Early British expeditions against the pirates led to further campaigns against their headquarters. Piracy continued intermittently until 1835, when the shaikhs agreed not to engage in hostilities at sea. Primarily in reaction to the ambitions of other European countries, the UK and the Trucial States established closer bonds in an 1892 treaty. In 1968 the British government announced its decision, reaffirmed in March 1971, to end the treaty relationship with the gulf shaikhdoms. When the British protective treaty with the Trucial Shaikhdoms ended on December 1, they became fully independent. On December 2, 1971, 6 of them entered into a union called the United Arab Emirates. The 7th, Ras al-Khaimah, joined in early 1972. Administratively, the UAE is a loose federation of 7 emirates, each with its own ruler. The pace at which local government in each emirate is evolving, from traditional to modern, is set primarily by the ruler. Under the provisional constitution of 1971, each emirate reserves considerable powers, including control over mineral rights, taxation, and police powers. In this milieu, the growth of federal powers has

  6. UNITED KINGDOM: under pressure

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    While attempting bravely to sustain the legacy left by J.J. Thomson, Rutherford, Chadwick, Cockcroft, Blackett, Dirac and others earlier this century, the United Kingdom, one of the major contributors to CERN, has suffered in recent years from an erosion of the international purchasing power of the pound sterling. At the same time, the national scientific community has squabbled over the apportionment of the research cake. In recent years, the CERN budget has remained constant in real terms, but the pound has drifted steadily down. In 1984 one pound bought 3.15 Swiss francs, now it gets just over 2. The hypersensitivity which left calculations at the mercy of exchange rate hiccups was cushioned in 1988 by a new method of calculating national CERN contributions, introduced by Chris Llewellyn Smith, now the Laboratory's Director General, using less sensitive input data

  7. United Kingdom national report

    International Nuclear Information System (INIS)

    Tomkins, B.

    1998-01-01

    Report of the United Kingdom deals with life extension granted to Calder Hall and Chapelcross reactors for further 10 years operation. The two well recognised life-limiting features of Magnox type reactors are graphite core ageing and materials properties of the reactor pressure circuit components. These features have been scrutinised particularly closely and the conclusion has been reached that there are no safety factors which will necessarily limit the plant life to less than 50 years. Two other life-limiting factors are hear exchanger tubes and the heat exchanger tube failures internal to boiler shells and the integrity of the main engineering structures of the plant. It was concluded that appropriate routine ageing monitoring programs are in place in respect to these features to support continuing operation beyond 40 years

  8. Mobile power plant units

    Energy Technology Data Exchange (ETDEWEB)

    Radtke, R

    1979-10-05

    Diesel engines of the MaK line 282 AK/332 with a cylinder power up to 160 kW are used, either as 6-cylinder or 8-cylinder in-line engine or as 12-cylinder V engine. Fuel consumption is between 207 and 212 g/kW. The engine is mounted on a frame, together with a generator. The fuel reserve in the tank will last for 8 hours. The lubricating system, the cooling water and starting air system, the switchboard system, and the frame are described. The switchboard plant is mounted either on a skid undercarriage or on the undercarriage. The plant can be operated independently or parallel to the network. The unit can be remote-controlled via push buttons or control knobs. A picture is presented of a mobile diesel aggregate which is in service in Libya.

  9. The United States

    International Nuclear Information System (INIS)

    Art, R.J.

    1991-01-01

    This paper reports that at least in the national security arena, the outcomes of bureaucratic infighting and domestic political struggles are not determined wholly by what goes on with the state. Rather struggles among contending groups are greatly affected by what is perceived to be happening outside the nation. Because external conditions give greater potency to some domestic forces over other, the external environment is never neutral in its domestic impact. The decisions of the period 1950-53 discussed above illustrate the point. But so too do the decisions of 1947, 1960-61 and 1969-72. In the 1947 case, Soviet intransigence provoked US nuclear rearmament. In the 1960-61 case, extended deterrent considerations pushed the United States to preserve its again newly discovered nuclear superiority. In the 1969-72 case, a Soviet determination to remain equal forced US acceptance of nuclear equality. And perhaps the best evidence of all, the perpetuation of parity ended the US inclination to resort to nuclear brinkmanship. In each instance, concerns about relative position heavily affected nuclear choice. Finally, the events of the past three years testify to the effects of international events on domestic choice. Under the terms of the 1987 INF Treaty, the two superpowers decided to dismantle and destroy an entire class of missiles of intermediate range (500-3000 kilometers) that both had deployed in Europe in the 1970s and 1980s, and in their June 1990 joint statement on strategic nuclear weapons, President Gorbachev and Brush agreed to cut the number of Soviet and US long range nuclear forces by 30 per cent. This agreement marks a watershed in US-Soviet strategic arm negotiations because for the first time the United States and the Soviet Union agreed in principals to reduce the number of weapons aimed at one another. Between 1985 and 1990 the cold war was brought to a close

  10. SI units in radiation protection

    International Nuclear Information System (INIS)

    Herrmann, D.

    1976-10-01

    In the field of radiation protection all hitherto used units for activity, activity concentrations, exposure, absorbed dose, and dose rates have to be replaced by SI units during the next years. For this purpose graphs and conversion tables are given as well as recommendations on unit combinations preferentially to be used. As to the dose equivalent, it is suggested to introduce a new special unit being 100 times greater than the rem, instead of maintaining the rem or using the gray for both absorbed dose and dose equivalent. Measures and time schedule relating to the gradual transition to SI units in measuring techniques, training, and publishing et cetera are explained. (author)

  11. Proceedings of the United States Air Force STINFO Officers Policy Conference - 1981,

    Science.gov (United States)

    1982-08-01

    breakthrough might sound the death knell for the STI community. A new information community would fill the vacuum, they contended. The study was completed a...OH 45433 Knudtson, Gail AFWAL/TST Horseman , Hazel WPAFB OH 45433 AFWAL/TST WPAFB OH 45433 Kowalsky, Tom HQ MAC/XPSR Huff, Frank Scott AFB IL 62225

  12. SI units in radiation protection

    International Nuclear Information System (INIS)

    Jain, V.K.; Soman, S.D.

    1978-01-01

    International System of Units abbreviated as SI units has been adopted by most of the countries of the world. Following this development, the implementation of SI units has become mandatory with a transition period of about ten years. Some of the journals have already adopted the SI units and any material sent for publication to them must use only these. International Commission on Radiation Units and Measurement (ICRU) published letters in several journals including Physics in Medicine and Biology, Health Physics, British Journal of Radiology, etc. outlining the latest recommendations on SI units to elicit the reactions of scientists in the general field of radiological sciences. Reactions to the letters were numerous as can be seen in the correspondence columns of these journals for the last few years and ranged from great misgivings and apprehension to support and appreciation. SI units have also been the subject of editorial comments in several journals. On the basis of a survey of this literature, it may be said that there was general agreement on the long term advantage of SI units inspite of some practical difficulties in their use particularly in the initial stages. This report presents a review of SI units in radiological sciences with a view to familiarize the users with the new units in terms of the old. A time table for the gradual changeover to the SI units is also outlined. (auth.)

  13. SI units in biomedical dosimetry

    International Nuclear Information System (INIS)

    Liden, K.

    1975-01-01

    The International commission on radiation units and measurements (ICRU), during the period from 1953 to 1962 presented its definitions of the quantities absorbed dose, exposure, activity, and dose equivalent and the corresponding special units the rad, the roentgen, the curie, and the rem. At the same time an international practical system of units was developed, Le Systeme International d'Unites (SI). It was adopted by the 11th Conference Generale des Poids et Mesures (CGPM) in 1960 and is now officially introduced in almost all countries. The general implementation of the SI means difficulties for the future use of the special radiation units, because the numerical factors involved prevent their adoption as SI units. In view of this, and after having sampled the opinion in the radiological field, the ICRU prepared a Statement on Units in July, 1974 which was forwarded to the Comite International des Poids et Mesures (CIPM) and its Comite Consultatif des Unites (CCU) for consideration. As a result of this statement the CIPM has now proposed, that the 15rh CGPM adopt special names for two SI units, namely the becquerel, symbol Bq, for the unit of activity of radionuclides equal to the reciprocal second, s 1- , and the gray, symbol Gy, for the unit of absorbed dose equal to the joule per kilogram, J/kg. The 15th CGPM will consider this matter in May, 1975. (author)

  14. [United theory of aging].

    Science.gov (United States)

    Trubitsyn, A G

    2012-01-01

    In attempts to develop a means of life prolongation the humankind has created more than three hundred theories of the aging; each of them offers the original cause of aging. However, none of them has given practical result by now. The majority of the theories have now only historical interest. There are several different theories that are mainly under consideration currently. They are based on reliable, proven evidence: the free radical theory, the protein error theory, the replicative senescence theory, the theory of reparation weakening, the immunological theory, several versions of neuroendocrinal theories, and programmed aging theory. The theory presented here is based on conception that the life as the phenomenon represents many of the interconnected physical and chemical processes propelled by energy of the mitochondrial bioenergetical machine. Gradual degradation of all vital processes is caused by the programmed decrease in level of bioenergetics. This theory unites all existing theories of aging constructed on authentic facts: it is shown, that such fundamental phenomena accompanying aging process as the increase in level of reactive oxygen species (ROS), the decrease in the general level of protein synthesis, the limitation of cellular dividing (Haiflick limit), decrease in efficiency of reparation mechanisms are caused by bioenergetics attenuation. Each of these phenomena in turn generates a number of harmful secondary processes. Any of the theories bases on one of these destructive phenomena or their combination. Hence, each of them describes one of sides of process of the aging initially caused by programmed decrease of level of bioenergetics. This united theory gives the chance to understand the nature of aging clock and explains a phenomenon of increase in longevity at the condition of food restriction. Failures of attempts to develop means from aging are explained by that the manipulations with the separate secondary phenomena of attenuation of

  15. United Kingdom position paper

    International Nuclear Information System (INIS)

    1983-01-01

    In any system employing liquid sodium as a coolant, large heat transfer coefficients exist between the metal structure containing the coolant, and the coolant itself. Any rapidly varying temperatures, either space wise or time wise, in the sodium are readily transmitted to the surrounding metal structure, resulting in the generation of appreciable thermal stresses within these structures. In particular, the phenomenon of thermal stratification in the sodium coolant has the potential to induce unacceptable thermal stresses throughout the system. With respect to the present U.K. fast reactor design, a large programme of work in connection with the thermal hydraulic aspects of the plant is in hand. This programme is being undertaken as a joint effort by the National Nuclear Corporation, the United Kingdom Atomic Energy Authority, and the Central Electricity Generating Board. Work is in progress both to identify the areas of the system that will be susceptible to, and to ensure that the design is capable of successfully withstanding any thermal stratification effects. The production of stratification phenomena depends both upon the design and the operation of the reactor system. These are briefly described below. Areas where thermal stratification effects exist are then identified and the programme of work associated with each area is outlined

  16. Intensive Care Unit Delirium

    Directory of Open Access Journals (Sweden)

    Yongsuk Kim

    2015-05-01

    Full Text Available Delirium is described as a manifestation of acute brain injury and recognized as one of the most common complications in intensive care unit (ICU patients. Although the causes of delirium vary widely among patients, delirium increases the risk of longer ICU and hospital length of stay, death, cost of care, and post-ICU cognitive impairment. Prevention and early detection are therefore crucial. However, the clinical approach toward delirium is not sufficiently aggressive, despite the condition’s high incidence and prevalence in the ICU setting. While the underlying pathophysiology of delirium is not fully understood, many risk factors have been suggested. As a way to improve delirium-related clinical outcome, high-risk patients can be identified. A valid and reliable bedside screening tool is also needed to detect the symptoms of delirium early. Delirium is commonly treated with medications, and haloperidol and atypical antipsychotics are commonly used as standard treatment options for ICU patients although their efficacy and safety have not been established. The approaches for the treatment of delirium should focus on identifying the underlying causes and reducing modifiable risk factors to promote early mobilization.

  17. Mobile contingency unit

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Sergio O. da; Magalhaes, Milton P. de [Petroleo Brasileiro S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil); Junqueira, Rodrigo A.; Torres, Carlos A.R. [PETROBRAS Transporte S/A (TRANSPETRO), Rio de Janeiro, RJ (Brazil)

    2009-07-01

    This paper is aimed at presenting what is already a reality in TRANSPETRO in the area covered by OSBRA, a pipeline that carries by-products to the Mid-West region of Brazil. In order to meet the needs of covering occasional accidents, TRANSPETRO counts on a standardized system of emergency management. It is a great challenge to secure an efficient communication along the 964 km of extension, considering that there are shadow zones where it is not possible to use conventional means of communication such as mobile telephony and internet. It was in this context that the Mobile Contingency Unit Via Satellite - MCU was developed, to extend the communication facilities existing in fixed installations to remote places, mainly the pipeline right of ways. In case of emergency, simulation and work in the pipeline right of way, MCU is fully able to provide the same data, voice, closed-circuit TV and satellite video conference facilities that are available in any internal area of the PETROBRAS system. (author)

  18. Biobank Report: United Kingdom.

    Science.gov (United States)

    Kaye, Jane; Bell, Jessica; Briceno, Linda; Mitchell, Colin

    2016-03-01

    The United Kingdom is a leader in genomics research, and the presence of numerous types of biobanks and the linking of health data and research within the UK evidences the importance of biobank-based research in the UK. There is no biobank-specific law in the UK and research on biobank materials is governed by a confusing set of statutory law, common law, regulations, and guidance documents. Several layers of applicable law, from European to local, further complicate an understanding of privacy protections. Finally, biobanks frequently contain data in addition to the samples; the legal framework in the UK generally differentiates between data and samples and the form of the data affects the applicability of legal provisions. Biobanks must be licensed by the Human Tissue Authority; certain projects must be reviewed by Research Ethics Committees, and all projects are encouraged to be reviewed by them. Data Access Committees in biobanks are also common in the UK. While this confusing array of legal provisions leaves privacy protections in biobanking somewhat unclear, changes at the EU level may contribute to harmonization of approaches to privacy. © 2016 American Society of Law, Medicine & Ethics.

  19. The United Kingdom

    International Nuclear Information System (INIS)

    Croft, S.; Williams, P.

    1991-01-01

    The possession of nuclear weapons by the United Kingdom has long been a controversial issue in British politics, and among historians and strategists. Part of the controversy has revolved around questions of motivation. Why did the British Government under Prime Minister Clement Attlee develop nuclear weapons? Why have successive British governments maintained and, in fact, modernized the national nuclear force? This paper reports that a frequent response to these questions is to place the issue of the acquisition of nuclear weapons by the UK into a post-colonial context. In the nineteenth and early twentieth centuries, Britain was a great power with global assets and commitments. After the Empire was reduced in size and importance, however, and eventually swept away, Britain could not longer claim to be a superpower in any modern sense. Nevertheless, it is suggested, British policy makers had developed a foreign policy based upon certain assumptions about Britain's position and power and they were reluctant to relinquish these assumptions. Furthermore, it is contended, the decision to develop nuclear weapons was taken to reinforce what were the pretensions of a medium power, and the continued obsession of successive British governments with nuclear weapons provides evidence that Britain has still not come to terms with its reduced role and limited influence. In short, the British infatuation with nuclear weapons over the past 40 years is best explained in terms of concerns about status

  20. Units of rotational information

    Science.gov (United States)

    Yang, Yuxiang; Chiribella, Giulio; Hu, Qinheping

    2017-12-01

    Entanglement in angular momentum degrees of freedom is a precious resource for quantum metrology and control. Here we study the conversions of this resource, focusing on Bell pairs of spin-J particles, where one particle is used to probe unknown rotations and the other particle is used as reference. When a large number of pairs are given, we show that every rotated spin-J Bell state can be reversibly converted into an equivalent number of rotated spin one-half Bell states, at a rate determined by the quantum Fisher information. This result provides the foundation for the definition of an elementary unit of information about rotations in space, which we call the Cartesian refbit. In the finite copy scenario, we design machines that approximately break down Bell states of higher spins into Cartesian refbits, as well as machines that approximately implement the inverse process. In addition, we establish a quantitative link between the conversion of Bell states and the simulation of unitary gates, showing that the fidelity of probabilistic state conversion provides upper and lower bounds on the fidelity of deterministic gate simulation. The result holds not only for rotation gates, but also to all sets of gates that form finite-dimensional representations of compact groups. For rotation gates, we show how rotations on a system of given spin can simulate rotations on a system of different spin.

  1. Hanford Site Waste management units report

    International Nuclear Information System (INIS)

    1992-01-01

    This report summarizes the operable units in several areas of the Hanford Site Waste Facility. Each operable unit has several waste units (crib, ditch, pond, etc.). The operable units are summarized by describing each was unit. Some of the descriptions are unit name, unit type, waste category start data, site description, etc. The descriptions will vary for each waste unit in each operable unit and area of the Hanford Site

  2. Judicial Process, Grade Eight. Resource Unit (Unit V).

    Science.gov (United States)

    Minnesota Univ., Minneapolis. Project Social Studies Curriculum Center.

    This resource unit, developed by the University of Minnesota's Project Social Studies, introduces eighth graders to the judicial process. The unit was designed with two major purposes in mind. First, it helps pupils understand judicial decision-making, and second, it provides for the study of the rights guaranteed by the federal Constitution. Both…

  3. The Executive Process, Grade Eight. Resource Unit (Unit III).

    Science.gov (United States)

    Minnesota Univ., Minneapolis. Project Social Studies Curriculum Center.

    This resource unit, developed by the University of Minnesota's Project Social Studies, introduces eighth graders to the executive process. The unit uses case studies of presidential decision making such as the decision to drop the atomic bomb on Hiroshima, the Cuba Bay of Pigs and quarantine decisions, and the Little Rock decision. A case study of…

  4. United States mineral resources

    Science.gov (United States)

    Brobst, Donald A.; Pratt, Walden P.

    1973-01-01

    650 of the U.S. Bureau of Mines) ; indeed, we regard that book and the present volume as being complementary. In the examination of the geologic possibilities for finding new deposits-in many respects the principal innovative contributions of this volume-we asked the authors to frankly apply the limits of their ingenuity and not only to summarize current theories but also to express their own intuitive ideas, however speculative and unconventional they may seem, that have come from years of study devoted to the origin of mineral deposits. Readers will see that some authors have speculated more courageously than others. In any case, we believe readers will find all the chapters interesting, and many stimulating; and a few we believe can be frankly characterized as intellectually exciting. Most chapters include a section on prospecting techniques, and a summary of geologic or related problems on which the authors believe research might be most fruitful in the continuing efforts to find new resources. An integral part of the book is the bibliographic material cited at the conclusion of each chapter, in lieu of repetition of detailed descriptions already in print. Index and "spot" maps are not included in most chapters because they are available elsewhere, and in many cases with more detail than could possibly be included here. Maps showing the distribution of known deposits of many commodities in the United States are available in the Mineral Resource (MR) map series of the U.S. Geological Survey and in the National Atlas of the United States. The first three chapters deal not with resources of specific commodities but with general information that is pertinent to the study of mineral resources. In the introductory chapter we discuss the purposes of the book, the distinctions between reserves and various categories of resources, and some general conclusions drawn from our view of the book in its entirety. In the second chapter V. E. McKelvey discusses the problems of

  5. Fatigue of Concrete Armour Units

    DEFF Research Database (Denmark)

    Sørensen, N. B.; Burcharth, H. F.; Liu, Z.

    1995-01-01

    In the present article fatigue as a possible reason for failure of Dolosse armour units made of plain concrete is discussed.......In the present article fatigue as a possible reason for failure of Dolosse armour units made of plain concrete is discussed....

  6. NZG 201 portable spectrometric unit

    International Nuclear Information System (INIS)

    Jursa, P.; Novakova, O.; Slezak, V.

    The NZG 201 spectrometric unit is a portable single-channel processing unit supplied from the mains or a battery which allows the qualitative and quantitative measurement of different types of ionizing radiation when connected to a suitable detection unit. The circuit layout and the choice of control elements makes the spectrometric unit suitable for use with scintillation detector units. The spectrometric unit consists of a pulse amplifier, an amplitude pulse analyzer, a pulse counter, a pulse rate counter with an output for a recorder, a high voltage source and a low voltage source. The block diagram is given. All circuits are modular and are mounted on PCB's. The apparatus is built in a steel cabinet with a raised edge which protects the control elements. The linear pulse amplifier has a maximum gain of 1024, the pulse counter has a maximum capacity of 10 6 -1 imp and time resolution better than 0.5 μs. The temperature interval at which the apparatus is operational is 0 to 45 degC, its weight is 12.5 kg and dimensions 36x280x310 mm, energy range O.025 to 2.5 MeV, for 137 Cs the energy resolution is 8 to 10%. The spectrometric unit NZG 2O1 may, with regard to its parameters, number and range of control elements, be used as a universal measuring unit. (J.P.)

  7. Imagine There's No Carnegie Unit

    Science.gov (United States)

    Klevgaard, Janine

    2013-01-01

    This article describes how the Alberta Education High School Flexibility Enhancement Pilot Project allowed 16 high schools in Alberta, Canada, to remove the restrictions of the Carnegie unit, the seat time per credit requirement that has been widely used since 1906. The two purposes of the project were to determine whether the Carnegie unit should…

  8. Definitions of Quantities and Units.

    Science.gov (United States)

    Spurgin, C. B.

    1983-01-01

    Compares various methods of defining derived quantities, arguing for a definitional formula using base or fundamental units in a word equation, or symbol-equations with the symbols explained. Suggests that fundamental units be defined operationally or left regarded as intuitive as in the case of length and time. (JM)

  9. Science Unit Plans. PACE '94.

    Science.gov (United States)

    Schoon, Kenneth J., Ed.; Wiles, Clyde A., Ed.

    This booklet contains mathematics unit plans for Biology, Chemistry, and Physical Science developed by PACE (Promoting Academic Excellence In Mathematics, Science & Technology for Workers of the 21st Century). Each unit plan contains suggested timing, objectives, skills to be acquired, workplace relationships, learning activities with suggested…

  10. Edison Home Community Study Unit.

    Science.gov (United States)

    Lee County School District, Ft. Myers, FL. Dept. of Environmental Education and Instructional Development Services.

    History is not merely events that occurred in the past. The past has influenced the present, as the present will influence the future. The purpose of this community study unit is to provide fourth grade students with an opportunity to investigate some of the history of Lee County, Florida. The unit's focus is on Thomas Edison, who built a home in…

  11. 7 CFR 1160.104 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true United States. 1160.104 Section 1160.104 Agriculture... Definitions § 1160.104 United States. United States means the 48 contiguous states in the continental United States and the District of Columbia, except that United States means the 50 states of the United States...

  12. United States panel presentations

    International Nuclear Information System (INIS)

    Beyea, J.

    1990-01-01

    Before I begin I have to make a disclaimer. That is that I am going to be talking about public perception because I think that is very important. But I do not want to give the impression that I think the public is wrong. I happen to agree with the public's perception of nuclear power, and I want to make that clear. I do not like the current generation of nuclear plants as I have made clear in many statements that I have made. On the other hand, in the long term, I feel that we have only two choices on the supply side, and that is nuclear power and solar electricity. And although I think solar electricity has the best chance, I am realistic enough to know that technologies do not always work the way I want. And so I think it is necessary to have at least some kind of nuclear option available. On the other hand, I do not think just any kind of nuclear technology will do. I want to talk to you about the conditions that I think you have to take into account when you try to design reactors that are publicly acceptable. I look at this as an insurance policy. Again, I do not want to be misquoted: I think nuclear power should be considered as an insurance policy, not as our first line of defense. Having made those disclaimers, what we need to do is set out a problem statement. The problem statement I set out is, 'How could one design and demonstrate a nuclear reactor that would regain public confidence in the United States, if one chose to do that?' By regaining confidence, I mean regaining sufficient confidence to site reactors at a number of locations. It is a pretty heavy task because the public cannot judge the technical issues. They have to judge the players by their characters and their histories, just as the way we calibrate anyone that knows things that we do not. I have three theses that I think are crucial. The first is that people do not believe in the claims of advocates, of any point of view, not just nuclear power, once the advocates have been proved wrong on

  13. The United Kingdom: Issues for the United States

    National Research Council Canada - National Science Library

    Archick, Kristin

    2007-01-01

    ...; and more recently, from the UK's strong support in countering terrorism and confronting Iraq. The United States and Britain also share a mutually beneficial trade and economic relationship, and are each other's biggest foreign direct investors...

  14. A functional intranet for the United States Coast Guard Unit

    OpenAIRE

    Hannah, Robert Todd.

    1998-01-01

    Approved for public release; distribution in unlimited. This thesis describes the complete development process of a friendly functional Intranet for an operational United States Coast Guard (USCG) electronic Support Unit (ESU) in Alameda, California. The final product is suitable for immediate use. It may also be used as a prototype for future Intranet development efforts. The methodology used to develop a finished, working product provides the core subject matter for this thesis. The disc...

  15. Development of diagnostic mammography unit

    Energy Technology Data Exchange (ETDEWEB)

    Matsubara, M.; Muraki, T.; Kitade, K. (Toshiba Corp., Kawasaki, Kanagawa (Japan))

    1981-07-01

    The mortality from breast cancer is gradually increasing year after year. Accordingly, it is eagerly desired that X-ray diagnosis information be obtainable with higher accuracy and ease for early detection of the disease. Meeting this demand, development has been made of a 2 x magnification mammography unit (Model MGU-01) capabel of minutely depicting microcalcifications with a size of 150 ..mu..m or thereabout and the peripheral condition of a mammary abscess. The background of the development, the substance of the unit and the examination made of the unit are described here.

  16. Development of diagnostic mammography unit

    International Nuclear Information System (INIS)

    Matsubara, Mitsuyoshi; Muraki, Takeshi; Kitade, Kooichi

    1981-01-01

    The mortality from breast cancer is gradually increasing year after year. Accordingly, it is eagerly desired that X-ray diagnosis information be obtainable with higher accuracy and ease for early detection of the disease. Meeting this demand, development has been made of a 2 x magnification mammography unit (Model MGU-01) capabel of minutely depicting microcalcifications with a size of 150 μm or thereabout and the peripheral condition of a mammary abscess. The background of the development, the substance of the unit and the examination made of the unit are described here. (author)

  17. Ad valorem versus unit taxes

    DEFF Research Database (Denmark)

    Schröder, Philipp J.H.; Sørensen, Allan

    2010-01-01

    a general equilibrium monopolistic competition model with heterogeneous firms and intra-industry reallocations. We show that the welfare superiority of ad valorem over unit taxes under imperfect competition is not only preserved but amplified. The additional difference between the tools arises because unit...... taxes distort relative prices, which in turn reduces average industry productivity through reallocations (the survival and increased market share of lower productivity firms). Importantly, numerical solutions of the model reveal that the relative welfare loss from using the unit tax increases...

  18. Design of Dolos Armour Units

    DEFF Research Database (Denmark)

    Burcharth, H. F.; Liu, Zhou

    1993-01-01

    The slender, complex types of armour units, such as Tetrapods and Dolosse are widely used. Many of the recent failures are such rubble mound breakwaters revealed that there is an imbalance between strength (structural integrity) of the units and the hydraulic stability (resistance to displacements......) of the armour layers. The paper deals only with dolos armour and presents the first design diagrammes and formulae where stresses from static, quasistatic and impact loads are implemented as well as the hydraulic stability. The dolos is treated as a multi shape unit where the thickness can be adjusted...

  19. Tax_Units_2011_Final

    Data.gov (United States)

    Kansas Data Access and Support Center — The Statewide GIS Tax Unit boundary file was created through a collaborative partnership between the State of Kansas Department of Revenue Property Valuation...

  20. Integrated Ground Operations Demonstration Units

    Data.gov (United States)

    National Aeronautics and Space Administration — The overall goal of the AES Integrated Ground Operations Demonstration Units (IGODU) project is to demonstrate cost efficient cryogenic operations on a relevant...

  1. Renewable energies in United Kingdom

    International Nuclear Information System (INIS)

    Baize, T.

    1993-01-01

    An evaluation of research and development policy in United Kingdom on renewable energy sources is presented with economical studies (short or long term profitability), engaged programs and electric production. (A.B.). refs. tabs

  2. NCHS - Injury Mortality: United States

    Data.gov (United States)

    U.S. Department of Health & Human Services — This dataset describes injury mortality in the United States beginning in 1999. Two concepts are included in the circumstances of an injury death: intent of injury...

  3. Unit 06 - Sampling the World

    OpenAIRE

    Unit 06, CC in GIS; Parson, Charles; Nyerges, Timothy

    1990-01-01

    This unit begins the section on data acquisition by looking at how the infinite complexity of the real world can be discretized and sampled. It considers sampling techniques and associated issues of accuracy and standards.

  4. Environmental Control Unit Harness Project

    Science.gov (United States)

    Oliva-Buisson, Yvette J.

    2014-01-01

    Testing four new Environmental Control Unit Harnesses for improved user comfort during SCAPE operations. Phase I, testing in a lab environment, Phase II will continue testing the best candidates in a field environment.

  5. 77 FR 48542 - United States

    Science.gov (United States)

    2012-08-14

    ... litigation.'' United States v. Armour and Co., 402 U.S. 673, 681 (1971). Section 5 of the Clayton Act... relief in consent judgment that contained recitals in which defendants asserted their innocence); Armour...

  6. Dedicated education unit: student perspectives.

    Science.gov (United States)

    Nishioka, Vicki M; Coe, Michael T; Hanita, Makoto; Moscato, Susan R

    2014-01-01

    The study compared students' perceptions of their clinical learning experiences in a dedicated education unit (DEU) with their experiences in traditional clinical education. Unlike traditional academic-instructor models, expert nurses in the DEU provide clinical education to students with faculty support. This repeated measures design used student surveys, supplemented by focus group data. Students were more likely to agree that their clinical learning experience was high quality and they had a consistent mentoring relationship during DEU rotations. Students also reported the quality of the unit's learning environment, the leadership style of the nurse manager, and the nursing care on the unit was more favorable in DEUs than traditional units. Consistent with their changed role in DEUs, faculty members were less active in helping students integrate theory and practice. These findings provide additional evidence of the value that the DEU model contributes to high-quality clinical education.

  7. United States Strategy for Mexico

    National Research Council Canada - National Science Library

    Centner, Robert C

    2005-01-01

    The security and stability of Mexico is of national interest to the United States, and a strong, effective alliance between the two countries is pivotal to our national defense strategy and economic prosperity...

  8. Architecture of nuclear power units

    International Nuclear Information System (INIS)

    Malaniuk, B.

    1981-01-01

    Nuclear units with circulation cooling using cooling towers are dominating points of the landscape. The individual cooling towers or pairs of cooling towers should be situated in the axes of double units and should also linearly be arranged, rhythmically in the respective zone. Examples are shown of the architectural designs of several nuclear power plants in the USA, the UK, the USSR, France, the FRG and Italy. (H.S.)

  9. Environmental process improvement feasibility study and demonstration program

    Science.gov (United States)

    Martin, Rodger L.

    1994-01-01

    This report is the final product of an environmental study conducted by Western Commercial Space Center, Inc. under contract to Tennessee-Calspan Center for Space Transportation and Applied Research. The purpose of this investigation is to accurately document the current environmental and permitting processes associated with commercial space launch activity at Vandenberg AFB, and make recommendations to streamline those processes. The particular areas of interest focus on: identifying applicable Federal, state, and local laws, Department of Defense directives, and Air force regulations; defining the environmental process on Vandenberg AFB and how it relates with other agencies, including Federal and state regulatory agencies; and defining the air quality permit process. Study investigation results are applied to an example Pilot Space Launch Vehicle (PSLV) planning to launch from Vandenberg AFB. The PSLV space hardware is analyzed with respect to environmental and permitting issues associated with vehicle processing, facilities required (existing or new), and launch. The PSLV verified the earlier findings of the study and gave insight into streamlining recommendations.

  10. Management of planned unit outages

    International Nuclear Information System (INIS)

    Brune, W.

    1984-01-01

    Management of planned unit outages at the Bruno Leuschner Nuclear Power Plant is based on the experience gained with Soviet PWR units of the WWER type over a period of more than 50 reactor-years. For PWR units, planned outages concentrate almost exclusively on annual refuellings and major maintenance of the power plant facilities involved. Planning of such major maintenance work is based on a standardized basic network plan and a catalogue of standardized maintenance and inspection measures. From these, an overall maintenance schedule of the unit and partial process plans of the individual main components are derived (manually or by computer) and, in the temporal integration of major maintenance at every unit, fixed starting times and durations are determined. More than 75% of the maintenance work at the Bruno Leuschner Nuclear Power Plant is carried out by the plant's own maintenance personnel. Large-scale maintenance of every unit is controlled by a special project head. He is assisted by commissioners, each of whom is responsible for his own respective item. A daily control report is made. The organizational centre is a central office which works in shifts around the clock. All maintenance orders and reports of completion pass through this office; thus, the overall maintenance schedule can be corrected daily. To enforce the proposed operational strategy, suitable accompanying technical measures are required with respect to effective facility monitoring and technical diagnosis, purposeful improvement of particularly sensitive components and an increase in the effectiveness of maintenance work by special technologies and devices. (author)

  11. Survival among patients with HIV infection and smear-negative pulmonary tuberculosis - United States, 1993-2006.

    Directory of Open Access Journals (Sweden)

    J Sean Cavanaugh

    Full Text Available BACKGROUND: In patients with HIV and tuberculosis (TB in resource-constrained settings, smear-negative disease has been associated with higher mortality than smear-positive disease. Higher reported mortality may be due to misdiagnosis, diagnostic delays, or because smear-negative disease indicates more advanced immune suppression. METHODS: We analyzed culture-confirmed, pulmonary TB among patients with TB and HIV in the United States from 1993-2008 to calculate prevalence ratios (PRs for smear-negative disease by demographic and clinical characteristics. Allowing two years for treatment outcome to be reported, we determined hazard ratios (HRs for survival by smear status, adjusted for significant covariates on patients before 2006. RESULTS: Among 16,710 cases with sputum smear results, 6,739 (39% were sputum smear-negative and 9,971 (58% were sputum smear-positive. The prevalence of smear-negative disease was lower in male patients (PR: 0.89, 95% confidence interval [CI]: 0.86-0.93 and in those who were homeless (PR: 0.92, CI: 0.87-0.97 or used alcohol excessively (PR: 0.91, CI: 0.87-0.95, and higher in persons diagnosed while incarcerated (PR: 1.20, CI: 1.13-1.27. Patients with smear-negative disease had better survival compared to patients with smear-positive disease, both before (HR: 0.82, CI: 0.75-0.90 and after (HR: 0.81, CI: 0.71-0.92 the introduction of combination anti-retroviral therapy. CONCLUSIONS: In the United States, smear-negative pulmonary TB in patients with HIV was not associated with higher mortality, in contrast to what has been documented in high TB burden settings. Smear-negative TB can be routinely and definitively diagnosed in the United States, whereas high-burden countries often rely solely on AFB-smear microscopy. This difference could contribute to diagnostic and treatment delays in high-burden countries, possibly resulting in higher mortality.

  12. SI units in engineering and technology

    CERN Document Server

    Qasim, S H

    2016-01-01

    SI Units in Engineering and Technology focuses on the use of the International System of Units-Systeme International d'Unités (SI). The publication first elaborates on the SI, derivation of important engineering units, and derived SI units in science and engineering. Discussions focus on applied mechanics in mechanical engineering, electrical and magnetic units, stress and pressure, work and energy, power and force, and magnitude of SI units. The text then examines SI units conversion tables and engineering data in SI units. Tables include details on the sectional properties of metals in SI units, physical properties of important molded plastics, important physical constants expressed in SI units, and temperature, area, volume, and mass conversion. Tables that show the mathematical constants, standard values expressed in SI units, and Tex count conversion are also presented. The publication is a dependable source of data for researchers interested in the use of the International System of Units-Systeme Inter...

  13. 31 CFR 800.225 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 800.225 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.225 United States. The term United States or U.S. means the United States of America, the States of the United States, the District of Columbia, and any commonwealth...

  14. Nations United: The United Nations, the United States, and the Global Campaign Against Terrorism. A Curriculum Unit & Video for Secondary Schools.

    Science.gov (United States)

    Houlihan, Christina; McLeod, Shannon

    This curriculum unit and 1-hour videotape are designed to help students understand the purpose and functions of the United Nations (UN) and explore the relationship between the United Nations and the United States. The UN's role in the global counterterrorism campaign serves as a case study for the unit. The students are asked to develop a basic…

  15. Ecological units: definitions and application.

    Science.gov (United States)

    Jax, Kurt

    2006-09-01

    Concepts of ecological units, such as population, community, and ecosystem, are at the basis of ecological theory and research and have increasingly become the focus of conservation strategies. Concepts of these units still suffer from inconsistencies and confusions over terminology. The different concepts are treated here together as a common "conceptual cluster," with similar ecological functions (roles) and similar problems in their definition and use. An analysis of the multitude of existing terms and concepts that have been developed for these units reveals that they differ with respect to at least four basic criteria: (i) the questions as to whether they are defined statistically or via a network of interactions; (ii) if their boundaries are drawn by topographical or process-related criteria; (iii) how high the required internal relationships are; and (iv) if they are perceived as "real" entities or abstractions by an observer The various definitions cannot be easily sorted into just a few types, but they can be characterized by several independent criteria. I argue that serious problems arise if the different possibilities of defining ecological units are not recognized and if the concepts are perceived as self-evident. The different concepts of ecological units should be defined and used in a philosophically informed manner I propose a dual approach to the use of ecological units. Generic meanings of the main concepts (especially population, community, and ecosystem) should be retained only as heuristically useful perspectives, while specific and "operational" definitions of the concepts as units should be developed, depending on specific purposes of their use. Some thoughts on the basic requirements for such definitions and the domains of their uses are briefly explained.

  16. Terrestrial Environment (Climatic) Criteria Guidelines for use in Aerospace Vehicle Development. 2008 Revision

    Science.gov (United States)

    Johnson, D. L. (Editor)

    2008-01-01

    This document provides guidelines for the terrestrial environment that are specifically applicable in the development of design requirements/specifications for NASA aerospace vehicles, payloads, and associated ground support equipment. The primary geographic areas encompassed are the John F. Kennedy Space Center, FL; Vandenberg AFB, CA; Edwards AFB, CA; Michoud Assembly Facility, New Orleans, LA; John C. Stennis Space Center, MS; Lyndon B. Johnson Space Center, Houston, TX; George C. Marshall Space Flight Center, Huntsville, AL; and the White Sands Missile Range, NM. This document presents the latest available information on the terrestrial environment applicable to the design and operations of aerospace vehicles and supersedes information presented in NASA-HDBK-1001 and TM X-64589, TM X-64757, TM-78118, TM-82473, and TM-4511. Information is included on winds, atmospheric thermodynamic models, radiation, humidity, precipitation, severe weather, sea state, lightning, atmospheric chemistry, seismic criteria, and a model to predict atmospheric dispersion of aerospace engine exhaust cloud rise and growth. In addition, a section has been included to provide information on the general distribution of natural environmental extremes in the conterminous United States, and world-wide, that may be needed to specify design criteria in the transportation of space vehicle subsystems and components. A section on atmospheric attenuation has been added since measurements by sensors on certain Earth orbital experiment missions are influenced by the Earth s atmosphere. There is also a section on mission analysis, prelaunch monitoring, and flight evaluation as related to the terrestrial environment inputs. The information in these guidelines is recommended for use in the development of aerospace vehicle and related equipment design and associated operational criteria, unless otherwise stated in contract work specifications. The terrestrial environmental data in these guidelines are

  17. Applied Meteorology Unit (AMU) Quarterly Report First Quarter FY-14

    Science.gov (United States)

    Bauman, William Henry; Crawford, Winifred C.; Shafer, Jaclyn A.; Watson, Leela R.; Huddleston, Lisa L.; Decker, Ryan K.

    2014-01-01

    NASA's LSP and other programs at Vandenberg Air Force Base (VAFB) use wind forecasts issued by the 30th Operational Support Squadron (30 OSS) to determine if they need to limit activities or protect property such as a launch vehicle due to the occurrence of warning level winds at VAFB in California. The 30 OSS tasked the AMU to provide a wind forecasting capability to improve wind warning forecasts and enhance the safety of their customers' operations. This would allow 30 OSS forecasters to evaluate pressure gradient thresholds between pairs of regional observing stations to help determine the onset and duration of warning category winds. Development of such a tool will require that solid relationships exist between wind speed and the pressure gradient of one or more station pairs. As part of this task, the AMU will also create a statistical climatology of meteorological observations from the VAFB wind towers.

  18. Applied Meteorology Unit Quarterly Report, Second Quarter FY-13

    Science.gov (United States)

    Bauman, William; Crawford, Winifred; Watson, Leela; Shafer, Jaclyn; Huddleston, Lisa

    2013-01-01

    The AMU team worked on six tasks for their customers: (1) Ms. Crawford continued work on the objective lightning forecast task for airports in east-central Florida, and began work on developing a dual-Doppler analysis with local Doppler radars, (2) Ms. Shafer continued work for Vandenberg Air Force Base on an automated tool to relate pressure gradients to peak winds, (3) Dr. Huddleston continued work to develop a lightning timing forecast tool for the Kennedy Space Center/Cape Canaveral Air Force Station area, (4) Dr. Bauman continued work on a severe weather forecast tool focused on east-central Florida, (5) Mr. Decker began developing a wind pairs database for the Launch Services Program to use when evaluating upper-level winds for launch vehicles, and (6) Dr. Watson began work to assimilate observational data into the high-resolution model configurations, she created for Wallops Flight Facility and the Eastern Range.

  19. Applied Meteorology Unit Quarterly Report. First Quarter FY-13

    Science.gov (United States)

    2013-01-01

    The AMU team worked on five tasks for their customers: (1) Ms. Crawford continued work on the objective lightning forecast task for airports in east-central Florida. (2) Ms. Shafer continued work on the task for Vandenberg Air Force Base to create an automated tool that will help forecasters relate pressure gradients to peak wind values. (3) Dr. Huddleston began work to develop a lightning timing forecast tool for the Kennedy Space Center/Cape Canaveral Air Force Station area. (3) Dr. Bauman began work on a severe weather forecast tool focused on east-central Florida. (4) Dr. Watson completed testing high-resolution model configurations for Wallops Flight Facility and the Eastern Range, and wrote the final report containing the AMU's recommendations for model configurations at both ranges.

  20. United Nations Peacekeeping: Issues for Congress

    National Research Council Canada - National Science Library

    Browne, Marjorie A

    2008-01-01

    A major issue facing the United Nations, the United States, and the 110th Congress is the extent to which the United Nations has the capacity to restore or keep the peace in the changing world environment...

  1. United Nations Peacekeeping: Issues for Congress

    National Research Council Canada - National Science Library

    Browne, Marjorie A

    2007-01-01

    A major issue facing the United Nations, the United States, and the 110th Congress is the extent to which the United Nations has the capacity to restore or keep the peace in the changing world environment...

  2. Mobile units to hydro geochemistry characterization

    International Nuclear Information System (INIS)

    Gomez, P.; Martinez, B.; Turrero, M.J.

    1994-01-01

    This report shows the mobile units for hydro geochemical studies. The authors analyze the work of mobile unit and the cars that conform the unit: Sampling car and analysis car: The sampling and equipment are took into account as well

  3. United Nations and Multilateralism: Appraising USA's Unilateralism ...

    African Journals Online (AJOL)

    DrNneka

    global peace and security, as well as the survival of the United Nations. This is because ... Key Words: United Nations, multilateralism, United States, unilateralism, national interest, UN Charter ..... Lebanon, Iraq, Turkey, Egypt, Jordan, etc.

  4. UNIT COMMITMENT: A NEW TRUNCATED METHOD OF UNIT ...

    African Journals Online (AJOL)

    NIJOTECH

    Data obtained from the National Electric Power Authority (NEPA) has been used to test the efficacy of this approach. ... every unit in the system must be respected. Some of these ..... Analysis of Power System Reliability. 2.Edwin K. W, Machat, ...

  5. Photovoltaic mounting/demounting unit

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a photovoltaic arrangement comprising a photovoltaic assembly comprising a support structure defining a mounting surface onto which a photovoltaic module is detachably mounted; and a mounting/demounting unit comprising at least one mounting/demounting apparatus...... which when the mounting/demounting unit is moved along the mounting surface, causes the photovoltaic module to be mounted or demounted to the support structure; wherein the photovoltaic module comprises a carrier foil and wherein a total thickness of the photo voltaic module is below 500 muiotaeta....... The present invention further relates to an associated method for mounting/demounting photovoltaic modules....

  6. Organization of the POCT Unit.

    Science.gov (United States)

    Warade, Jayesh

    2015-03-01

    Point-of-care testing (POCT) has evolved as an important part of laboratory medicine by virtue of its compactness, portability, and the feasibility of operation by nonlaboratory personnel, where fast and accurate testing methods are a primary concern and, as a result, improving the patient care. To successfully achieve POCT quality in networks, a multidisciplinary organizational approach is required. A clearly defined organizational structure should be put in place for proper functioning and optimum utilization of each POCT unit. The POCT unit must include designated authority, responsibility, and accountability.

  7. The Benevolent Hegemon: The United States National Space Protection Strategy-Anchored in Cooperation Not Technology

    Science.gov (United States)

    2010-04-01

    for data distribution, and not methods of firepower delivery, protection is unnecessary. 1 In addition, since the physical loss of a satellite does...capabilities at the transmission sites, the satellites, or the user equipment; (2) physical attacks against actual spacecraft or ground stations; (3...Barry D. “Doctrine, Technology, and War.” In Warfare Studies AY10 Coursebook , edited by Sharon McBride, 15-35. Maxwell AFB, AL: Air University Press

  8. The United Nations at 40

    International Nuclear Information System (INIS)

    1985-01-01

    The United Nations adopted a resolution expressing the hope that 1985 would mark the beginning of an era of durable and global peace and justice, social and economic development and progress and independence of all peoples. 1985 is the organization's 40th anniversary year - the United Nations Charter entered into force on 24 October 1945 - and the Assembly has chosen 'United Nations for a better world' as the anniversary theme. It also has decided to hold a brief commemorative session culminating on 24 October this year. Member States of the UN also have been urged to organize appropriate observance of the anniversary, with the widest possible participation, and to consider the creation of national committees to evaluate the contribution of the UN system over the past four decades, its continuing relevance in the current international situation, and ways in which it could be strengthened and made more effective. Among other things, the Assembly in its resolution appealed to the international mass media, both public and private, to contribute more effectively to dissemination of information on UN activities. During the commemorative session planned this October, a final document is expected to be adopted for which the Assembly has asked the Preparatory Committee for the Fortieth Anniversary of the United Nations to compose a suitable text. The Preparatory Committee had been established by the Assembly in 1983, and by December 1984, 98 countries had joined in its work, which relates to various activities

  9. Kitchen Units for the Classroom.

    Science.gov (United States)

    Illinois Univ., Urbana. Agricultural Experiment Station.

    This study is concerned with functional standards for storage of equipment, use of space, and arrangement of work centers in kitchen units for four students within a high school foods laboratory. Lists of equipment and measurements for storage areas are given for each work center. (FS)

  10. Norovirus in the United States

    Centers for Disease Control (CDC) Podcasts

    2013-09-09

    Dr. Aron Hall, a CDC epidemiologist specializing in norovirus, discusses the impact of norovirus in the United States.  Created: 9/9/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 9/17/2013.

  11. Solar Renewable Energy. Teaching Unit.

    Science.gov (United States)

    Buchanan, Marion; And Others

    This unit develops the concept of solar energy as a renewable resource. It includes: (1) an introductory section (developing understandings of photosynthesis and impact of solar energy); (2) information on solar energy use (including applications and geographic limitations of solar energy use); and (3) future considerations of solar energy…

  12. Spherical Approximation on Unit Sphere

    Directory of Open Access Journals (Sweden)

    Eman Samir Bhaya

    2018-01-01

    Full Text Available In this paper we introduce a Jackson type theorem for functions in LP spaces on sphere And study on best approximation of  functions in  spaces defined on unit sphere. our central problem is to describe the approximation behavior of functions in    spaces for  by modulus of smoothness of functions.

  13. United States Navy DL Perspective

    Science.gov (United States)

    2010-08-10

    United States Navy DL Perspective CAPT Hank Reeves Navy eLearning Project Director 10 August 2010 Report Documentation Page Form ApprovedOMB No...Marine Corps (USMC) Navy eLearning Ongoing Shared with USMC, Coast Guard 9 NeL Help Site https://ile-help.nko.navy.mil/ile/ https://s-ile

  14. Victorian Era: An Interdisciplinary Unit.

    Science.gov (United States)

    Gildart, Donna Mae; And Others

    Seventh grade students studied the Victorian period using a 4-6 week interdisciplinary unit that integrated language arts, mathematics, art, science, social studies, music, home economics, parents, and business into the program. The main goals were to help students understand the importance of all curriculum subjects; comprehend how subjects are…

  15. Tractor Safety. Unit A-9.

    Science.gov (United States)

    Luft, Vernon D.; Backlund, Paul

    This document is a teacher's guide for a unit in tractor and machinery safety for college freshmen. It is intended to be used for 10 hours of instruction for freshmen who are intending to work on or around machinery. Safety hazards directly and indirectly related to many types of machinery are covered in addition to tractors. The objectives of the…

  16. Vapor generating unit blowdown arrangement

    International Nuclear Information System (INIS)

    McDonald, B.N.

    1978-01-01

    A vapor generating unit having a U-shaped tube bundle is provided with an orificed downcomer shroud and a fluid flow distribution plate between the lower hot and cold leg regions to promote fluid entrained sediment deposition in proximity to an apertured blowdown pipe

  17. Cholera in the United States

    Centers for Disease Control (CDC) Podcasts

    2011-11-08

    Anna Newton, Surveillance Epidemiologist at CDC, discusses cholera that was brought to the United States during an outbreak in Haiti and the Dominican Republic (Hispaniola).  Created: 11/8/2011 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 11/8/2011.

  18. The United Nations at 40

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-10-01

    The United Nations adopted a resolution expressing the hope that 1985 would mark the beginning of an era of durable and global peace and justice, social and economic development and progress and independence of all peoples. 1985 is the organization's 40th anniversary year - the United Nations Charter entered into force on 24 October 1945 - and the Assembly has chosen 'United Nations for a better world' as the anniversary theme. It also has decided to hold a brief commemorative session culminating on 24 October this year. Member States of the UN also have been urged to organize appropriate observance of the anniversary, with the widest possible participation, and to consider the creation of national committees to evaluate the contribution of the UN system over the past four decades, its continuing relevance in the current international situation, and ways in which it could be strengthened and made more effective. Among other things, the Assembly in its resolution appealed to the international mass media, both public and private, to contribute more effectively to dissemination of information on UN activities. During the commemorative session planned this October, a final document is expected to be adopted for which the Assembly has asked the Preparatory Committee for the Fortieth Anniversary of the United Nations to compose a suitable text. The Preparatory Committee had been established by the Assembly in 1983, and by December 1984, 98 countries had joined in its work, which relates to various activities.

  19. [Developments in medical units. 1915].

    Science.gov (United States)

    Fajardo-Ortiz, Guillermo

    2016-01-01

    In 1915 the political, economic, and social instability initiated the destruction of medical units; they had no administrative bases and they lacked the resources. However, needs encouraged that structures arose to meet the wounded, fractured, and traumatized, called “blood” hospitals and so-called crosses and sanitary trains.

  20. Genetic maps and physical units

    International Nuclear Information System (INIS)

    Karunakaran, V.; Holt, G.

    1976-01-01

    The relationships between physical and genetic units are examined. Genetic mapping involves the detection of linkage of genes and the measurement of recombination frequencies. The genetic distance is measured in map units and is proportional to the recombination frequencies between linked markers. Physical mapping of genophores, particularly the simple genomes of bacteriophages and bacterial plasmids can be achieved through heteroduplex analysis. Genetic distances are dependent on recombination frequencies and, therefore, can only be correlated accurately with physical unit lengths if the recombination frequency is constant throughout the entire genome. Methods are available to calculate the equivalent length of DNA per average map unit in different organisms. Such estimates indicate significant differences from one organism to another. Gene lengths can also be calculated from the number of amino acids in a specified polypeptide and relating this to the number of nucleotides required to code for such a polypeptide. Many attempts have been made to relate microdosimetric measurements to radiobiological data. For irradiation effects involving deletion of genetic material such a detailed correlation may be possible in systems where heteroduplex analysis or amino acid sequencing can be performed. The problems of DNA packaging and other functional associations within the cell in interpreting data is discussed

  1. "Mexico in Transition." Curriculum Units.

    Science.gov (United States)

    Oregon Univ., Eugene. Foreign Language Resource Center.

    These curriculum units were developed in a National Endowment for the Humanities 1994 summer seminar "Mexico in Transition." The 23 lessons are written in Spanish. Lessons are entitled: (1) "La Migracion Mexicana Vista a Traves del Cuento 'Paso del Norte' de Juan Rulfo" (Jose Jorge Armendariz); (2) "Los Grupos Indigenas de…

  2. Pentachlorophenol (PCP) sludge recycling unit

    International Nuclear Information System (INIS)

    1994-08-01

    The Guelph Utility Pole Company treats utility poles by immersion in pentachlorophenol (PCP) or by pressure treatment with chromated copper arsenate (CCA). The PCP treatment process involves a number of steps, each producing a certain amount of sludge and other wastes. In a plant upgrading program to improve processing and treatment of poles and to reduce and recycle waste, a PCP recovery unit was developed, first as an experimental pilot-scale unit and then as a full-scale unit. The PCP recovery unit is modular in design and can be modified to suit different requirements. In a recycling operation, the sludge is pumped through a preheat system (preheated by waste heat) and suspended solids are removed by a strainer. The sludge is then heated in a tank and at a predetermined temperature it begins to separate into its component parts: oil, steam, and solids. The steam condenses to water containing low amounts of light oil, and this water is pumped through an oil/water separator. The recovered oil is reused in the wood treatment process and the water is used in the CCA plant. The oil remaining in the tank is reused in PCP treatment and the solid waste, which includes small stones and wood particles, is removed and stored. By the third quarter of operation, the recovery unit was operating as designed, processing ca 10,000 gal of sludge. This sludge yielded 6,500 gal of water, 3,500 gal of oil, and ca 30 gal of solids. Introduction of the PCP sludge recycling system has eliminated long-term storage of PCP sludge and minimized costs of hazardous waste disposal. 4 figs

  3. United Nations opens gender coordinating unit for Afghanistan.

    Science.gov (United States)

    Morris, K

    1999-02-06

    The UN has created a gender coordinating unit for Afghanistan in an effort to combat some problems encountered by women and girls in the country. Reports continue to come in of women in Afghanistan being denied the right to work, to be educated, and to have access to medical care. The gap in education between men and women continues to widen as a result of edicts issued by Taliban authorities banning girls from attending formal schools and female teachers from working. The situation has grown worse since the UN and nongovernmental organizations (NGOs) withdrew international workers last year due to security concerns. Although a UN mission will travel to the country this week to discuss the return of international staff, the gender coordinating unit will for now have to work out of Islamabad, Pakistan. The unit will create guidelines for gender mainstreaming, a strategy in which mainstream policies and resource allocations are changed to reflect the principle of gender equality. Other goals include setting realistic objectives for gender activities, working with partners on pilot projects, and establishing minimum standards for best practices. MERLIN, a NGO with a primary health care program run by local staff in the Taliban-controlled province of Farah, welcomes the move.

  4. Qualification of package units; Qualifizierung von Package Units

    Energy Technology Data Exchange (ETDEWEB)

    Brombacher, M.; Walter, U. [Bayer AG, Leverkusen (Germany)

    1999-07-01

    The use of package units in pharmaceutical plants is increasing. If they are involved in the manufacture of pharmaceuticals and have an influence on the quality of the end product, the user is required to validate the processes used. Parallel to the growing demands with respect to the automation of these units, the importance of PCS equipment has increased and with this the necessity for its qualification. Experience to date shows that the manufacturer's awareness of these requirements can be heightened still further. This paper describes approaches for improving the present situation and should be interpreted not as criticism but as providing an opportunity to increase the knowledge base and work together to define solutions which satisfy the guidelines. (orig.) [German] Der Einsatz von Package Units in Pharma-Anlagen erfaehrt zunehmende Verbreitung. Wenn sie an der Herstellung von Arzneimitteln beteiligt sind und auf die Qualitaet des Endprodukts Einfluss nehmen, unterliegen sie der Validierungspflicht, die der Anwender zu gewaehrleisten hat. Entsprechend den wachsenden Anforderungen an die Automatisierung dieser Einheiten ist auch der Stellenwert der PLT-Ausruestung angestiegen und mit ihm die Notwendigkeit von deren Qualifizierung. Die bisherige Praxis zeigt, dass die Sensbilitaet der Hersteller diesen Anforderungen gegenueber noch besser entwickelt werden kann. Der Beitrag zeigt Wege auf, um die derzeitige Situation zu verbessern und sollte nicht als Kritik sondern als Chance aufgefasst werden, den Wissensstand auszugleichen und gemeinsam zu richtliniengerechten Loesungen zu kommen. (orig.)

  5. 7 CFR 1250.308 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1250.308 Section 1250.308 Agriculture... Research and Promotion Order Definitions § 1250.308 United States. United States means the 48 contiguous States of the United States of America and the District of Columbia. ...

  6. 31 CFR 598.317 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 598.317 Section 598.317 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 598.317 United States. The term United States means the United States, its territories and...

  7. 31 CFR 596.312 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 596.312 Section 596.312 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 596.312 United States. The term United States means the United States, including its...

  8. 31 CFR 538.314 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 538.314 Section 538.314 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 538.314 United States. The term United States means the United States, its territories and possessions...

  9. 31 CFR 543.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 543.310 Section 543.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 543.310 United States. The term United States means the United States, its territories and...

  10. 31 CFR 542.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 542.310 Section 542.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  11. 31 CFR 548.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 548.310 Section 548.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  12. 7 CFR 65.255 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false United States. 65.255 Section 65.255 Agriculture..., PEANUTS, AND GINSENG General Provisions Definitions § 65.255 United States. United States means the 50... United States. ...

  13. 31 CFR 546.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 546.310 Section 546.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  14. 31 CFR 594.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 594.313 Section 594.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 594.313 United States. The term United States means the United States, its territories and...

  15. 31 CFR 588.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 588.310 Section 588.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 588.310 United States. The term United States means the United States, its territories and...

  16. 7 CFR 1206.23 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1206.23 Section 1206.23 Agriculture... INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.23 United States. United... Rico, and the territories and possessions of the United States. ...

  17. 31 CFR 536.315 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 536.315 Section 536.315 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 536.315 United States. The term United States means the United States, its territories and...

  18. 31 CFR 544.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 544.310 Section 544.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 544.310 United States. The term United States means the United States, its...

  19. 31 CFR 592.311 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 592.311 Section 592... § 592.311 United States. The term United States, when used in the geographic sense, means the several States, the District of Columbia, and any commonwealth, territory, or possession of the United States. ...

  20. 31 CFR 545.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 545.313 Section 545.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 545.313 United States. The term United States means the United States, its territories and...

  1. 7 CFR 1205.23 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1205.23 Section 1205.23 Agriculture... Procedures for Conduct of Sign-up Period Definitions § 1205.23 United States. The term United States means the 50 states of the United States of America. Procedures ...

  2. 31 CFR 595.314 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 595.314 Section 595.314 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 595.314 United States. The term United States means the United States, its territories and possessions...

  3. 31 CFR 586.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 586.318 Section 586...) KOSOVO SANCTIONS REGULATIONS General Definitions § 586.318 United States. The term United States means the United States, its territories and possessions, and all areas under the jurisdiction or authority...

  4. 31 CFR 537.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 537.318 Section 537.318 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....318 United States. The term United States means the United States, its territories and possessions...

  5. 31 CFR 597.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 597.318 Section 597... General Definitions § 597.318 United States. The term United States means the United States, its territories, states, commonwealths, districts, and possessions, and all areas under the jurisdiction or...

  6. 31 CFR 560.307 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 560.307 Section 560.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 560.307 United States. The term United States means the United States, including its territories and...

  7. 7 CFR 1150.106 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true United States. 1150.106 Section 1150.106 Agriculture... Order Definitions § 1150.106 United States. United States means the 48 contiguous States in the continental United States. ...

  8. 31 CFR 593.311 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 593.311 Section 593.311 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 593.311 United States. The term United States means the United States, its...

  9. 31 CFR 585.316 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 585.316 Section 585.316 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 585.316 United States. The term United States means the United States, its...

  10. 31 CFR 575.319 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 575.319 Section 575.319 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....319 United States. The term United States means the United States, its territories and possessions...

  11. 7 CFR 1212.31 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1212.31 Section 1212.31 Agriculture..., Consumer Education, and Industry Information Order Definitions § 1212.31 United States. “United States... territories and possessions of the United States. ...

  12. 31 CFR 539.312 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 539.312 Section 539.312 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 539.312 United States. The term United States means the United States, its...

  13. 31 CFR 551.309 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....309 United States. The term United States means the United States, its territories and possessions...

  14. 7 CFR 1219.26 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1219.26 Section 1219.26 Agriculture..., AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.26 United States. United States means collectively the several 50 States of the United States, the District of...

  15. 31 CFR 587.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 587.310 Section 587...) MILOSEVIC SANCTIONS REGULATIONS General Definitions § 587.310 United States. The term United States means the United States, its territories and possessions, and all areas under the jurisdiction or authority...

  16. 31 CFR 541.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 541.310 Section 541.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 541.310 United States. The term United States means the United States, its territories and possessions...

  17. 22 CFR 120.13 - United States.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false United States. 120.13 Section 120.13 Foreign... United States. United States, when used in the geographical sense, includes the several states, the Commonwealth of Puerto Rico, the insular possessions of the United States, the District of Columbia, the...

  18. 7 CFR 1205.313 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1205.313 Section 1205.313 Agriculture... Research and Promotion Order Definitions § 1205.313 United States. United States means the 50 States of the United States of America. [31 FR 16758, Dec. 31, 1966. Redesignated at 56 FR 64472, Dec. 10, 1991] ...

  19. 31 CFR 540.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 540.313 Section 540.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 540.313 United States. The term United States means the United States, its...

  20. 31 CFR 547.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 547.310 Section 547.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 547.310 United States. The term United States means the United States, its...

  1. Hanford Site waste management units report

    International Nuclear Information System (INIS)

    1993-04-01

    The Hanford Site Waste Management Units Report was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments of the 1984. This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in the report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of the units report, the list of units is more extensive than required by Section 3004(u) of Hazardous and Solid Waste Amendments of the 1984. In Sections 3.0 through 6.0 of this report, the four aggregate areas are subdivided into their operable units. The operable units are further divided into two parts: (1) those waste management units assigned to the operable unit that will be remediated as part of the Environmental Restoration Remedial Actions (ERRA) Program, and (2) those waste management units located within the operable unit boundaries but not assigned to the ERRA program. Only some operable unit sections contain the second part

  2. Waste management units - Savannah River Site

    International Nuclear Information System (INIS)

    1989-10-01

    This report is a compilation of worksheets from the waste management units of Savannah River Plant. Information is presented on the following: Solid Waste Management Units having received hazardous waste or hazardous constituents with a known release to the environment; Solid Waste Management Units having received hazardous waste or hazardous constituents with no known release to the environment; Solid Waste Management Units having received no hazardous waste or hazardous constituents; Waste Management Units having received source; and special nuclear, or byproduct material only

  3. Organization of Control Units with Operational Addressing

    OpenAIRE

    Alexander A. Barkalov; Roman M. Babakov; Larysa A. Titarenko

    2012-01-01

    The using of operational addressing unit as the block of control unit is proposed. The new structure model of Moore finite-state machine with reduced hardware amount is developed. The generalized structure of operational addressing unit is suggested. An example of synthesis process for Moore finite-state machine with operational addressing unit is given. The analytical researches of proposed structure of control unit are executed.

  4. Masturbation in the United States.

    Science.gov (United States)

    Das, Aniruddha

    2007-01-01

    Using data from the nationally representative National Health and Social Life Survey, this study queried the correlates of masturbation in the United States in 1992. Among those aged 18-60, 38% (CI, 35-41) of women and 61% (CI, 57-65) of men reported any masturbation over the preceding year. The system of factors underlying masturbation was similar for both genders, consistent with a convergence in gender patterns of sexual expression in the United States. Among both women and men, masturbation responded to a stable sexualized personality pattern, catalyzed by early-life factors and manifested in current sexual traits. Strikingly, the masturbation-partnered sex linkage, often conceptualized either as compensating for unsatisfying sex or complementing a satisfactory sex life, appeared to be bimodal for both genders. For some, masturbation complemented an active and pleasurable sex life, while among others, it compensated for a lack of partnered sex or satisfaction in sex.

  5. Units for radiation protection work

    International Nuclear Information System (INIS)

    Lindborg, L.

    1997-06-01

    ICRU has defined special measurable (operational) quantities for radiation protection. A consequence of using the operational quantities is that hand-held and personal dosemeters can give different measuring results in the same radiation situation. The differences vary and are caused by the geometry of the radiation field. The units have well documented relations to e.g. the ICRP effective dose and equivalent dose to an organ or tissue. Therefore, it is possible to estimate these doses from a measured value of e.g. the ambient dose equivalent. ICRU and ICRP have recently reviewed these relations in two important commonly issued reports (Report 57 and Publication 74). This report tries to show the value of understanding these units and their relations and is primarily meant to be used for educational purposes. 11 refs

  6. Optical programmable Boolean logic unit.

    Science.gov (United States)

    Chattopadhyay, Tanay

    2011-11-10

    Logic units are the building blocks of many important computational operations likes arithmetic, multiplexer-demultiplexer, radix conversion, parity checker cum generator, etc. Multifunctional logic operation is very much essential in this respect. Here a programmable Boolean logic unit is proposed that can perform 16 Boolean logical operations from a single optical input according to the programming input without changing the circuit design. This circuit has two outputs. One output is complementary to the other. Hence no loss of data can occur. The circuit is basically designed by a 2×2 polarization independent optical cross bar switch. Performance of the proposed circuit has been achieved by doing numerical simulations. The binary logical states (0,1) are represented by the absence of light (null) and presence of light, respectively.

  7. Phoenix's Wet Chemistry Laboratory Units

    Science.gov (United States)

    2008-01-01

    This image shows four Wet Chemistry Laboratory units, part of the Microscopy, Electrochemistry, and Conductivity Analyzer (MECA) instrument on board NASA's Phoenix Mars Lander. This image was taken before Phoenix's launch on August 4, 2007. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  8. THE UNITED STATES EDUCATIONAL SYSTEM

    OpenAIRE

    David Suriñach Fernández

    2017-01-01

    The United States educational system is very complex. Due to the fact a big number of agents take play of its regulation, the differences between the education from one State compared to the education from another, or even between school districts, might be considerable. The last two largest federal education initiatives, No Child Left Behind and Race to the Top, have had a huge impact on the American education system. The escalation of the standardized test throughout the whole country as a ...

  9. The Uranium Chemistry Research Unit

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    The article discusses the research work done at the Uranium Chemistry Research Unit of the University of Port Elizabeth. The initial research programme dealt with fundamental aspects of uranium chemistry. New uranium compounds were synthesized and their chemical properties were studied. Research was also done to assist the mining industry, as well as on nuclear medicine. Special mentioning is made of the use of technetium for medical diagnosis and therapy

  10. Eddy current tube testing unit

    International Nuclear Information System (INIS)

    Dufayet, J.P.; Duret, G.

    1975-01-01

    The unit described can check a wide variety of tubes in quick succession and its modular design gives it a high degree of versability. Suitably defined working conditions and specific fittings enable most of the faults encountered in the manufacture of a tube to be detected. By appropriate means of selection based on signal amplitude, phase and frequency analyses it is possible to adapt selection criteria to the seriousness of the different categories of defect [fr

  11. Environmental performance reviews: United States

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-01-15

    This book presents OECD assessments and recommendations regarding the United States' effort to manage its environment including air, water nature, and biodiversity to do this in a sustainable manner; and to do this in co-operation with its global neighbours. In particular, it assesses progress made since 1996, when OECD's previous review on the US was done. 40 figs., 21 tabs.

  12. Pricing decision-making units

    OpenAIRE

    R F&aauml;re; S Grosskopf; D Margaritis

    2013-01-01

    In this note we extend the standard DEA paradigm to address the question of how one can price DMUs (decision-making units). To do this we use an adjoint transformation to the technology generated by these DMUs which links to traditional linear programming theory of the firm and is similar to pricing portfolios in financial markets. We also provide a numerical example illustrating the practicality of the proposed method.

  13. Dixie Valley Bottoming Binary Unit

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, Dale [Terra-Gen Sierra Holdings, LLC, Reno, NV (United States)

    2014-12-21

    This binary plant is the first air cooled, high-output refrigeration based waste heat recovery cycle in the industry. Its working fluid is environmentally friendly and as such, the permits that would be required with a hydrocarbon based cycle are not necessary. The unit is largely modularized, meaning that the unit’s individual skids were assembled in another location and were shipped via truck to the plant site. The Air Cooled Condensers (ACC), equipment piping, and Balance of Plant (BOP) piping were constructed at site. This project further demonstrates the technical feasibility of using low temperature brine for geothermal power utilization. The development of the unit led to the realization of low temperature, high output, and environmentally friendly heat recovery systems through domestic research and engineering. The project generates additional renewable energy, resulting in cleaner air and reduced carbon dioxide emissions. Royalty and tax payments to governmental agencies will increase, resulting in reduced financial pressure on local entities. The major components of the unit were sourced from American companies, resulting in increased economic activity throughout the country.

  14. United States National Seismographic Network

    International Nuclear Information System (INIS)

    Buland, R.

    1993-09-01

    The concept of a United States National Seismograph Network (USNSN) dates back nearly 30 years. The idea was revived several times over the decades. but never funded. For, example, a national network was proposed and discussed at great length in the so called Bolt Report (U. S. Earthquake Observatories: Recommendations for a New National Network, National Academy Press, Washington, D.C., 1980, 122 pp). From the beginning, a national network was viewed as augmenting and complementing the relatively dense, predominantly short-period vertical coverage of selected areas provided by the Regional Seismograph Networks (RSN's) with a sparse, well-distributed network of three-component, observatory quality, permanent stations. The opportunity finally to begin developing a national network arose in 1986 with discussions between the US Geological Survey (USGS) and the Nuclear Regulatory Commission (NRC). Under the agreement signed in 1987, the NRC has provided $5 M in new funding for capital equipment (over the period 1987-1992) and the USGS has provided personnel and facilities to develop. deploy, and operate the network. Because the NRC funding was earmarked for the eastern United States, new USNSN station deployments are mostly east of 105 degree W longitude while the network in the western United States is mostly made up of cooperating stations (stations meeting USNSN design goals, but deployed and operated by other institutions which provide a logical extension to the USNSN)

  15. Pickering Unit 1 chemical cleaning

    International Nuclear Information System (INIS)

    Smee, J.L.; Fiola, R.J.; Brennenstuhl, K.R.; Zerkee, D.D.; Daniel, C.M.

    1995-01-01

    The secondary sides of all 12 boilers at Pickering Unit 1 were chemically cleaned in 1994 by the team of Ontario Hydro, B and W International (Cambridge, Ontario) and B and W Nuclear Technologies (Lynchburg, Virginia). A multi-step EPRI/SGOG process was employed in a similar manner to previous clearings at Units 5 and 6 in 1992 and 1993, respectively. A major innovation with the Unit 1 cleaning was the incorporation of a crevice cleaning step, the first time this had been done on Ontario Hydro plants. In addition, six boilers were cleaned in parallel compared to three at a time in previous Pickering cleanings. This significantly reduced cleaning time. A total of 6,770 kg of sludge was removed through direct chemical dissolution. It consisted of 66% iron/nickel oxides and 28% copper metal. A total of 1,600,000 L (420,000 US gallons) of liquid waste was produced. It was processed through the spent solvent treatment facility located at the Bruce Nuclear Power Development site. Visual inspection performed after the cleaning indicated that the crevices between the boiler tubes and the tube support structure were completely clear of deposit and the general condition of the tubing and lattice bars appeared to be in 'as new' condition. (author)

  16. Measurement units of physical values

    International Nuclear Information System (INIS)

    Debraine, P.

    1955-01-01

    The aim of this paper is twofold: 1) to give an analysis of the formation conditions of the various systems of units, 2) to show how the practical problems involving changes of units can be solved. This analysis leads to the conception of 'types' of systems, which is very useful to clarity the question of rationalized and non rationalized systems. The second point which consists essentially in: 1) finding the relationship between the measures of a given quantity in different systems, 2) deriving practical formulas, 3) deriving formulas in various 'types' of systems, is made easier by use of sets of: * definition formulas, * transformation formulas, * units of the various practical systems with useful numerical information covering the following fields: ** geometry, ** kinematics, ** mechanics, ** electricity and magnetism, ** thermodynamics, ** radiation, ** photometry, These sets being printed on coloured paper can be easily found. A number of numerical examples (21) show in a detailed way how to solve the various problems likely to occur. A chapter is particularly devoted to the Giorgi MKS system. (author) [fr

  17. Low cost balancing unit design

    Science.gov (United States)

    Golembiovsky, Matej; Dedek, Jan; Slanina, Zdenek

    2017-06-01

    This article deals with the design of a low-cost balancing system which consist of battery balancing units, accumulator pack units and coordinator unit with interface for higher level of battery management system. This solution allows decentralized mode of operation and the aim of this work is implementation of controlling and diagnostic mechanism into an electric scooter project realized at Technical university of Ostrava. In todays world which now fully enjoys the prime of electromobility, off-grid battery systems and other, it is important to seek the optimal balance between functionality and the economy side of BMS that being electronics which deals with secondary cells of batery packs. There were numerous sophisticated, but not too practical BMS models in the past, such as centralized system or standalone balance modules of individual cells. This article aims at development of standalone balance modules which are able to communicate with the coordinator, adjust their parameters and ensure their cells safety in case of a communication failure. With the current worldwide cutting cost trend in mind, the emphasis was put on the lowest price possible for individual component. The article is divided into two major categories, the first one being desing of power electronics with emphasis on quality, safety (cooling) and also cost. The second part describes development of a communication interface with reliability and cost in mind. The article contains numerous graphs from practical measurements. The outcome of the work and its possible future is defined in the conclusion.

  18. Strategic renewal for business units.

    Science.gov (United States)

    Whitney, J O

    1996-01-01

    Over the past decade, business units have increasingly taken the role of strategy formulation away from corporate headquarters. The change makes sense: business units are closer to customers, competitors, and costs. Nevertheless, business units can fail, just as headquarters once did, by losing their focus on the organization's priorities and capabilities. John Whitney--turnaround expert and professor of management at Columbia University--offers a method for refocusing companies that he calls the strategic-renewal process. The principles behind the process are straightforward, but its execution demands extensive data, rigorous analysis, and the judgment of key decision makers. However, when applied with diligence, it can produce a strategy that yields both growth and profit. To carry out the process, managers must analyze, one by one or in logical groupings, the company's customers, the products it sells, and the services it offers in light of three criteria: strategic importance, significance, and profitability. Does a given customer, product, or service mesh with the organization's goals? Is it significant in terms of current and future revenues? And is it truly profitable when all costs are care fully considered? Customers, products, and services that do not measure up, says the author, must be weeded out relentlessly. Although the process is a painstaking one, the article offers clear thinking on why-and how-to go about it. A series of exhibits takes managers through the questions they need to raise, and two matrices offer Whitney's concentrated wisdom on when to cultivate--and when to prune.

  19. High pressure gas reinjection unit

    Energy Technology Data Exchange (ETDEWEB)

    1976-03-01

    Nuovo Pignone has built for gas reinjection at Ekofisk the highest pressure injection unit to date: suction pressure 246 bar, discharge 647 bar, for 5.7 million cu m/day of natural gas, and driven by a GE MS 5001 gas turbine of 24,000 hp. The barrel-type compressor has been used already in Algeria at Hassi Messaoud. Full scale tests have shown that the unit is satisfactory; special attention being paid to the stability of the rotor. Air cooled heat exchangers were used in the test loop to cool the discharge gas; at Ekofisk, heat exchangers with sea water will be used. The valves in the test loop were of a special, low- noise type. Vibrations of the rotor system and changes in gas pressure monitored, showing that a pressure of 680 bars can be achieved without instability. Economic considerations lead to preference for rotary compressors driven by gas turbines for similar applications in the exploitation of oil fields. A graph of the characteristics of the unit is given.

  20. Terminal Forecast Reference Notebook (TFRN) for Luke AFB, Arizona,

    Science.gov (United States)

    1980-06-02

    due west of the base; the Sierra Estrella , 4,512 feet, about 12 miles to the south; the Phoenix Mountains, 2,740 feet, about 20 miles to the east...from any other direction will usually miss the base by more than 5 nautical miles because of the steering effect of the Sierra Estrella and the White...does the Sierra Estrella between 152 and 210 degrees. Most radar signal blocking can be eliminated, with the exception of the White Tanks, by raising

  1. Results and Lessons Learned Interim Report: Altus AFB Site

    National Research Council Canada - National Science Library

    McHugh, Thomas

    2005-01-01

    ...) to address the critical groundwater-to-indoor-air vapor intrusion pathway. By increasing our understanding of this critical pathway, guidelines can be improved, thereby better focusing Department of Defense (DoD...

  2. Surface Observation Climatic Summaries for McChord AFB Washington

    Science.gov (United States)

    1989-07-01

    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  3. Dicty_cDB: AFB241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available esis elongation factor 1-alpha (tef2) gene, partial cds. 682 0.0 2 AF157274 |AF157274.1 Phascolomyces arti...culosus translation elongation factor 1-alpha (EF-1alpha) gene, partial cds. 105 2e

  4. Surface Observation Climatic Summaries for Richards-Gebaur AFB, Missouri

    Science.gov (United States)

    1991-04-01

    SUPERSEDES: N/A APR 91 LST TOUTC 406 I MONTH IJAN I FEB I MAR IAP IMAY I JUN I JUL IAUG ISEP IOCT INOV I DEC IANN IYOR- EXTRN MAX TERP(F) 71 82 85 92 94 104...ANDVSBILIT *JN I FEB IAR IM I JUN I JUL IAUG IsEP I OCT I V I DEC I YOR LST 00 - 02 10 03 - 05 10 CIG 06 - 08 23.8 31.5 31.0 22.1 24.0 15.0 12.7 17.4

  5. Waste Analysis Plan and Waste Characterization Survey, Barksdale AFB, Louisiana

    Science.gov (United States)

    1991-03-01

    4C ;J4 c Ia’) La C; c) 0C\\Jc 8 "= "A -’O ’ 04 CŔ" c C’j C-J CAJe~ .- 44 C’) 0% C% 40w 0 l0 O LCD LA O L O 0 0 -IT~ LA 0 00- -T 0 0 0 0 rC 0 0 1- -C (D...r" 3flP1 7, r, ’. hrm Ai IP mn- 3f 1 f r1~r~~ r*NP m r.4 . 4 .-1- 1n i ito NP Mn.’ 3 12fl n 4f c;I rn’." ’, rfi 3I A’. 7 7?A I (>nd ht ~ HIM S)A R46 S

  6. Proposed Closure of Myrtle Beach AFB, South Carolina

    Science.gov (United States)

    1990-07-01

    royal fern (Osmunda regalis), poison ivy (Toxicodendron radicans), and cane (Arundinaria gigantea). Common vines are yellow jasmine (Gelsemium... Ledbetter , Major, U.S. Air Force, Attorney, AFRCE-BMS/DES B.S., 1973, Mathematics, University of Georgia. Athens M.A., 1978, 1 ublic Administration...Richard Garthe F. Lee Howell Murray Geddes Sharon F. Howell Peggy J. Geddes Gary Hoyve Fred G. Gerty Greg Hucks C-5 Jeannine Hucks Jessie R. Lee Lacy K

  7. Surface Observation Climatic Summaries (SOCS) For Mather AFB, California

    Science.gov (United States)

    1992-02-01

    1100 SPEND (RTS) CE14 GEIS GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS CATEGORY A 1.7 .5 .1 930 1.6 .6 .1 930 1.6 .4 930 3.4 1.0...ITS) GE14 0E18 GE25 ORS GE14 GEIS GE25 OS GE14 GEl8 GE25 OBS GE14 GE18 GE25 OBS CATEGORY A 5.7 2.4 930 5.2 1.3 .2 930 1.7 .5 .2 930 1.5 .5 .1 930...TIME (LST) 0600 - 2000 ALL HOURS SPEED K75 GE14 GEl8 GE25 OBS GE14 GEl8 UE25 OS CAT Y A 3.5 1.1 .1 4650 2.8 .9

  8. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

    Science.gov (United States)

    1985-02-01

    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  9. Installation Restoration Program. Phase I. Records Search, Brooks AFB, Texas

    Science.gov (United States)

    1985-03-01

    decay of the cadavers occurred. The waste was packaged in plastic bags, placed in seven 55-gallon drums and buried in a hole 7 to 8 feet deep. The drums...Receptors subscore (I x factor score subtotal/maximm score subtotal) 44 - II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity...subtotal) 44 II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity, the degree of hazard, and the confidence level of the

  10. Installation Restoration Program. Phase I. Records. Loring AFB, Maine.

    Science.gov (United States)

    1984-01-01

    periphyton from rivers and streams. Publications Dr. Knight has authored several technical papers on ecosystem metabolism, phytoplankton ecology, and...should be made of glacial till and esker (ice contact) deposits along with the calcareous bedrock (Carys Mills Formation) as they relate to the base...material defects of aircraft struc- tures, component parts, and related ground equipment. Wastes generated by the processes involved include PD-680

  11. Dicty_cDB: AFB514 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TCACTGTTCATCCAAAATTCTTAACAACAAGAAGAAGCGGAACCAAGAACAAGAAGA ACA sequence update 2001. 6. 1 Translated Amino Acid sequence ---atsnnqlmip...skg*ihchrfshc*nq*treristsl rfirsnsreiclyf*fh*tnc*wycrqcfhlkii*cylsl*nhl*rchgyvqenhgkdlv ltvhpkflttrrsgtknkkn Frame B: ---atsnnqlmips

  12. Dicty_cDB: AFB744 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lqhpkripplpfsfxixrxyanfc*xlfxgktiplever***h*kcqsqnprqrry spxstxfhfxw*tixxwpxsl*lqhpkxipxpfsxxikrwxanxcknlxwx...xhxigsxrf **hxkcxxqnsxqxrysxrstxinfxwxtixxwxxxx*lqxskgixxpfsxxikrwxanx c*nfnr*nxpxgsxr***x*kc*sqxprqxrxspxst

  13. Wastewater Characterization and Hazardous Waste Survey, Hickam AFB, Hawaii.

    Science.gov (United States)

    1987-05-01

    5200 20 Jan Bldg 2178 7.6 26 4400 20 Jan Lift Station 1A 7.2 26 9000 2" Jan Bldg 2045 6.5 26 12000 2’ Jan Bldg 358A 7.4 24 27000 21 Jan Lift Station 12...8217679b Toluene n/a 6850-00- 281-2002 Alum Alodine n/a 8030-00-779-4699 Methyl Iso Ketone n/a 6810-00-286-3785 Thinner MIL 81772 8010-O0-181-8080 1055 15

  14. AFB (Acid-Fast Bacillus) Smear and Culture

    Science.gov (United States)

    ... of Conditions Not Listed? Not Listed? Acidosis and Alkalosis Adrenal Insufficiency and Addison Disease Alcoholism Allergies Alzheimer ... to produce sputum, a health practitioner may collect respiratory samples using a procedure called a bronchoscopy. Bronchoscopy ...

  15. Dicty_cDB: AFB336 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available A009G02 of library BC0AA from strain CBS 767 of Debaryomyces hansenii. 48 3e-11 4 AA550135 |AA550135.1 1237m...3 gmbPfHB3.1, G. Roman Reddy Plasmodium falciparum genomic clone 1237m, DNA sequence. 60 3e-06 2 BP134604 |B

  16. Mercury and Silver in Clinic Wastewater Goodfellow AFB, Texas

    Science.gov (United States)

    1989-07-01

    SE(JrTY CLASSIFICATION 1b RESTRICTIVE MARINGSuncfassi I ed N/A 2a SCRITY CLASSIFICATION AUTHORITY 3 DISTRIBUTION / AVAiLABILIT OF REPORT N/A Approved...Material suctioned from teeth restoration are collected in a central separator/collection tank. The tank is automatically cleaned by rinsing it with water ...insoluble or sparingly soluble in water . In neutral or alkaline solutions, mercury is oxidized directly to the mercuric state with the formatin of

  17. Environmental Assessment Tent City at Grand Forks AFB, North Dakota

    Science.gov (United States)

    2004-11-15

    animals such as sponges, flatworms, nematode worms, segmented worms, snails, clams, and immature and adult insects , fish, amphibians, turtles, and... nettle (Laportea canadensis), stinging nettle (Urtica dioica), beggars’ ticks (Bidens frondosa), and waterleaf (Hydrophyllum viginianum) are

  18. Performance Monitoring of the Permeable Reactive Barrier at Dover AFB

    National Research Council Canada - National Science Library

    1999-01-01

    Based on column tests conducted between February and June 1997, NERL recommended that in terms of effectiveness in achieving cleanup standards and kinetics, a pyrite-iron combination ranked as the best reactive medium (EPA, 1997...

  19. Installation Restoration Program. Phase 1 - Records Search, Robins AFB, Georgia.

    Science.gov (United States)

    1982-04-01

    Environmental Biology , University of Florida, Gainesville, Florida Business Administration, Georgia State University Professional Affiliations 04 American Water...slay Irn IA lii a aswo vets* 16 40 saw. ben IT 11 Cad"~ L2 U . 5 clay.Sft W 10 isgwk 12 07 10 -ZA coeseedu osi tW streaks of 2W 0 coal" 12 S Koala lo

  20. Environmental Assessment: Space Innovation and Development Center Schriever AFB, Colorado

    Science.gov (United States)

    2006-03-01

    coloradensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least tern (interior population) .A Sterna antillarum E Mexican spotted owl Strix...Haliaeetus leucocephalus T Boreal toad Bufo boreas boreas c Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least...T CUSTER Bald eagle IIaliaeetus leucocephalus T Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Mexican

  1. Water and Wastewater Characterization Survey, Williams AFB AZ

    Science.gov (United States)

    1991-03-01

    effluent discharges. Most industrial effluent originates from the flight line operations. The WWTP includes primary sedimentation , trickling filters...final sedimentation , plug-flow chlorine contact basin, and a stabilization pond. Samples were collected at the influent and effluent of the plant...Stispcndcd Solido ~ 60) 31 pit wvithll 6.0 to 90- *1 1*0 is Totil toxic 0, plan:*’ aq (leCiitc(l at .i10 (1 R Pitt 4133. 5 (IIIL)RINE REOPENEP T1 his permit

  2. External quality assessment of AFB smear microscopy performances ...

    African Journals Online (AJOL)

    Data were captured, cleaned, and analyzed using SPSS version 16.0; χ2 tests, kappa statistics were used for comparison purpose. P value < 0.05 considered statistically significant. Among the 32 participant laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test ...

  3. Coin sorting unit; Koka ikkatsu tonyu shori unit

    Energy Technology Data Exchange (ETDEWEB)

    Oyabu, H.; Nishiyama, T.; Iijima, S. [Fuji Electric Co. Ltd., Tokyo (Japan)

    1999-08-10

    There are promising demands for barrier-free vending machines which can easily be used by the aged and the handicapped as well as ordinary people. Fuji Electric had developed an advanced unit for throwing in coins for the new hearty series that can smoothly be used by the aged and the handicapped. Its main advantages are (1) two or more coins can be thrown in together, (2) The port for putting in coins and the port for taking out change are of unified construction and simply adjoin each other, (3) Directional signs in braille are added. (author)

  4. Hanford Site waste management units report

    International Nuclear Information System (INIS)

    1993-04-01

    The Hanford Site Waste Management Units Report was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments of the 1984. This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in the report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of the units report, the list of units is more extensive than required by Section 3004(u) of Hazardous and Solid Waste Amendments of the 1984. In Sections 3.0 through 6.0 of this report, the four aggregate areas are subdivided into their operable units. The operable units are further divided into two parts: (1) those waste management units assigned to the operable unit that will be remediated as part of the Environmental Restoration Remedial Actions (ERRA) Program, and (2) those waste management units located within the operable unit boundaries but not assigned to the ERRA program. Only some operable unit sections contain the second part.Volume two contains Sections 4.0 through 6.0 and the following appendices: Appendix A -- acronyms and definition of terms; Appendix B -- unplanned releases that are not considered to be units; and Appendix C -- operable unit maps

  5. Environmental Assessment:Security and Safety Upgrades to Entry Control Facilities Vandenberg Air Force Base, California

    Science.gov (United States)

    2009-07-08

    vegetation (i.e., poison oak and stinging nettle ), animals (i.e., insects, spiders, and snakes), and disease vectors (i.e., ticks, rodents), exist...processing pulpy roots or tubers (Glassow 1997). Along the Santa Barbara Channel coastline, use of shellfish declined as other animal foods became more...for temporary camps where they gathered grasses, roots , tubers, and bulbs. Hunting marine mammals became important during times when seals and sea

  6. Environmental Assessment for the California Space Center at Vandenberg Air Force Base, California

    Science.gov (United States)

    2010-04-08

    shallow- rooted , mesophylic plant species that Chapter 3. Affected Environment Final Draft Environmental Assessment - California Space Center...buckwheat flowers and buds where the larvae feed until maturation. Upon maturation larvae burrow into the soil and pupate, usually within the root and...terrain, sharp or protruding objects, slippery soils or mud, and biological hazards including vegetation (i.e. poison oak and stinging nettle

  7. Potential Exploration, Development, and Production of Oil and Gas Resources, Vandenberg Air Force Base, California

    Science.gov (United States)

    1987-12-01

    was a cold experience. Ice all along the roadside. We were cold and stiff when we oot In I wn for srhnol]. In w uter the road was very bad and the big...chalkrock grade on the Santa Rosa Road was very slippery, ,nd the mud, in other narts, was deep. My father, in bad weather, would ride on horseback...of the San Francisco office (415) 393-2000, Chris Berka of the Washington, D.C. office (202) 628-4900, or Daniel J. Curtin, Jr. or David A. Gold of

  8. Environmental Assessment for the Space Complex-5 SCOUT Launcher Relocation, Vandenberg Air Force Base, California

    Science.gov (United States)

    2009-01-01

    Agreement (L,nderJ) ;ng PA) stipu atmg thaI Cold War propertIes significant for their distir.c:ivc physical characteristics and ~hclr historic function...launch complex th t dir Iy upported ooerational missions 0 the exceptionally imp rtant Cold War program. n You l1ave aiso submi tea a map that outlines

  9. Environmental Assessment: Western Snowy Plover Habitat Restoration, Vandenberg Air Force Base, California

    Science.gov (United States)

    2008-08-01

    during low tide periods, and then allow it to wash out into the ocean with the ensuing high tide. Salt water may render seeds and vegetation...Archaeological Society Occasional Paper No. 7. Greenwood, R.S. 1978. Obispeño and Purisimeño Chumash. In California, edited by Robert F. Heizer , pp. 520–523

  10. Installation Restoration Program. Phase I. Records Search. Vandenberg Air Force Base, California.

    Science.gov (United States)

    1984-12-01

    acidity or alkalinity POL Petroleum, oils, and lubricants PVC Polyvinyl chloride plastic RCRA Resource Conservation and Recovery Act RP-1 Rocket propellant...multiplter: Subscore 3 K ?hvsical State ulriptier Waste Caracteristics Subscore 50 X 1 50 11-1. CS-I HAZARD ASSESSMENT RATING METHODOLOGY FORM (Continued

  11. Final Environmental Assessment: Western Range Command Transmit Site Vandenberg Air Force Base, California

    Science.gov (United States)

    2005-01-20

    between the U.S. and Canada, Japan, Mexico and the former Soviet Union for the protection of migratory birds. Under the Act, taking, killing or...Song sparrow I Northern mockingbird I Brown-headed cowbird I Fox sparrow !Lazuli bunting !California towhee !Spotted towhee IBushtit !Black

  12. Environmental Assessment: Combat Information Transport System Upgrade Vandenberg Air Force Base, California

    Science.gov (United States)

    2006-07-21

    impacted by general construction hazards. Biological hazards, including vegetation (i.e., poison oak and stinging nettle ), animals (i.e., insects ...or protruding objects, slippery soils or mud, and unstable ground. Bi?logical hazards such as animals ( insects , spiders, and snakes), and disease...Region Interagency Archeological Services Branch, San Francisco. Hamilton, M. Colleen, Wendy Nettles , and Clayton G. Lebow 2004 SLC-4 to SLC-6

  13. Environmental Assessment: 13th Street Bridge Emergency Repair and Retrofit Vandenberg Air Force Base California

    Science.gov (United States)

    2003-06-23

    project site. • Biological hazards, including vegetation (i.e., poison oak and stinging nettle ), animals (i.e., insects , spiders, and snakes), and 4-18...channel, and in dryer areas of the site. Herbaceous species in the understory include stinging nettle (Urtica dioica), California blackberry (Rubus...Nightshade FAC/FACU Poison oak Nightshade FAC/FACU Stinging nettle FACW Cockle-bur FAC+ COMMENTS Likely C. Canadensis Most E/eocharis spp

  14. Environmental Assessment: San Antonio Creek Restoration at Vandenberg Air Force Base, California

    Science.gov (United States)

    2008-09-08

    biological hazards including vegetation (i.e. poison oak and stinging nettle ), animals (i.e. insects , spiders, and snakes), and disease vectors (i.e...acre. Native grasses and herbs such as giant wild rye (Leymus condensatus), and stinging nettle (Urtica dioica) dominate this vegetation type...mud, and unstable ground. Biological hazards such as animals ( insects , spiders, and snakes), and disease vectors (ticks and rodents). 3.6.3

  15. Environmental Assessment for East Housing Area Solar Energy Project, Vandenberg Air Force Base, California

    Science.gov (United States)

    2014-07-01

    May. Gevirtz, Elihu, 2014. Email communication with Craig Woodman dated 20 May, 2014. Glassow, Michael A. 1996. Purisimeño Chumash Prehistory ...William C. Sturtevant, general editor. Smithsonian Institution, Washington, D.C. 1972. 9000 Years of Prehistory at Diablo Canyon, San Luis Obispo

  16. Theater Ballistic Missile Targets Programmatic Environmental Assessment Vandenberg Air Force Base, California

    Science.gov (United States)

    1997-12-01

    S UNK Lichnanthe albopilosa White sand dune scarab beetle – S UNK Myotis ciliolabrum Small-footed myotis – S UNK Myotis evotis Long-eared myotis...many seabirds, including western gull and rhinoceros auklet (Cerorhinca monocerata). Regionally rare and declining species observed in the area

  17. Uniting to prevent unwanted pregnancies.

    Science.gov (United States)

    Lynch, D

    1994-02-18

    In reading the column of Cal Thomas entitled "Speaking Truth to Power" it becomes clear that the forces aligned against each other on the issue of reproductive choice should work together in order to reduce the number of unwanted pregnancies. An estimated 400 million women are unable to limit their family size for economic reasons. More are inhibited by social or religious constraints. When family planning (FP) services are available, and the status and education levels of women are raised, abortion rates decrease. This is demonstrated in the Netherlands, where legal abortions and contraception are available. The abortion rate is less than 5/1000 women there, one of the lowest worldwide. Latin America, where abortion is illegal and FP services are lacking, has abortion rates of 30-60/1000. Furthermore, these illegal abortions usually have a tragic effect on the woman's health. Of an estimated 6 million pregnancies annually in the United States, approximately half are unintended. Of these, about 1.6 million are aborted. Of the women in the United States who become pregnant annually, 82% are unmarried, 25% are under 20 years of age, and 33% make less than $11,000 yearly. If industrialized nations made contraceptives and FP services available to the poor worldwide, the quality of life on earth would increase. Human misery, anarchy, and resource depletion would decrease. State and local governments should increase support of domestic FP activities, while the federal government should raise its funding of international FP services. In order to reach the goals set by the 1989 Amsterdam Declaration, which was signed by the US, the annual contribution of the United States needs to be doubled. 4% of the US foreign aid budget, $720 million, is less than 0.1% of its $1.5 trillion budget. This amounts to less than $3 per US citizen.

  18. Entomology Unit annual report 2003

    International Nuclear Information System (INIS)

    2003-01-01

    As described in the 2002 Annual Report an improved medfly genetic sexing strain (GSS) was developed, VIENNA 8. This strain shows improved production characteristics and will have a major impact on the production efficiency in SIT rearing facilities. During 2003 this strain was transferred to four rearing facilities in Guatemala, Peru, South Africa and Tunisia based on acceptable QC data developed for the strain in the Unit. For the first time the strain was transferred to the different facilities under an agreement that prevents further distribution to third parties without consent of the Unit. In the past, strains originating from the Unit have been freely exchanged within the medfly SIT community, sometimes with not always the best results. During 2003 there has been a substantial increase in the resources devoted to activities in fruit flies other than medfly e.g. Bactrocera oleae and Anastrepha fraterculus. Rearing of the olive fly, B. oleae has traditionally not been straightforward due to the very specific, and expensive, larval diet that is required by this monophagous pest. With the disappearance of an essential larval diet component from the commercial market an urgent search is underway for an alternative. In 2004, experiments will be carried out to identify improved larval diets. For A. fraterculus, a large-scale evaluation of mating compatibility between different geographical races has been carried out by a consultant. Progress has been made in the containerised rearing of tsetse fly colonies. The container required considerable work before the temperature and humidity controls were suitable for tsetse rearing and a closed colony of Glossina fuscipes is now being reared. Discussions are now underway to install a version of TPU 3.2 (an automated tsetse feeding and production unit) in the container. A protocol for the handling, irradiation and eventual release of large numbers of sterile male tsetse has been formulated and it will involve at least two

  19. Optics in the United kingdom.

    Science.gov (United States)

    Ditchburn, R W

    1969-10-01

    Optics is interpreted to include x-ray optics, electronic optics, and short wave radiooptics as well as the more conventional visible, uv, and ir optics. Recent work in Britain on x-ray optics (applied to molecular biology), on scanning electron microscopy, and in radioastronomy (discovery of pulsars) is mentioned. In the optics of the visible and ir there is an increasing interest in over-all systems design. .The formation of large industrial units capable of carrying through major design program, requiring advanced mechanical and electronic design associated with new lens systems, is welcomed.

  20. Graphs with Eulerian unit spheres

    OpenAIRE

    Knill, Oliver

    2015-01-01

    d-spheres in graph theory are inductively defined as graphs for which all unit spheres S(x) are (d-1)-spheres and that the removal of one vertex renders the graph contractible. Eulerian d-spheres are geometric d-spheres which are d+1 colorable. We prove here that G is an Eulerian sphere if and only if the degrees of all the (d-2)-dimensional sub-simplices in G are even. This generalizes a Kempe-Heawood result for d=2 and is work related to the conjecture that all d-spheres have chromatic numb...

  1. Enhanced Master Controller Unit Tester

    Science.gov (United States)

    Benson, Patricia; Johnson, Yvette; Johnson, Brian; Williams, Philip; Burton, Geoffrey; McCoy, Anthony

    2007-01-01

    The Enhanced Master Controller Unit Tester (EMUT) software is a tool for development and testing of software for a master controller (MC) flight computer. The primary function of the EMUT software is to simulate interfaces between the MC computer and external analog and digital circuitry (including other computers) in a rack of equipment to be used in scientific experiments. The simulations span the range of nominal, off-nominal, and erroneous operational conditions, enabling the testing of MC software before all the equipment becomes available.

  2. Loviisa Unit One: Annealing - healing

    Energy Technology Data Exchange (ETDEWEB)

    Kohopaeae, J.; Virsu, R. [ed.; Henriksson, A. [ed.

    1997-11-01

    Unit 1 of the Loviisa nuclear powerplant was annealed in connection with the refuelling outage in the summer of 1996. This type of heat treatment restored the toughness properties of the pressure vessel weld, which had been embrittled be neutron radiation, so that it is almost equivalent to a new weld. The treatment itself was an ordinary metallurgical procedure that took only a few days. But the material studies that preceded it began over fifteen years ago and have put IVO at the forefront of world-wide expertise in the area of radiation embrittlement

  3. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 4, Grissom AFB Indiana.

    Science.gov (United States)

    1988-03-01

    the absolute value of the flow angle taken at each traverse point must be less than or equal to 20 degrees. The flow angle in the bypass stack averaged...are permitted: with the test include a zero and span cedures approved by the Board or the (I) Fires celebrating Twelfth Night calibration check at the...HUMIDITY DATA ALL TEMPS INPUT IN DEGREES FARENHEIT AND CONVERTED TO DEG. K. AMBIENT DRY BULB (K) = 279.2611 AMBIENT WET BULB (K) = 276.4833 - SOURCE

  4. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1988-06-01

    run, a flue gas sample for orsat analysis (measures oxygen, and carbon dioxide for stack gas molecular weight determination and emissions correction...was taken. Orsat sampling and analysis equipment are shown in Figures 5 and 6. Flue gas moisture content, also needed for determination of gas molecular ...where applicable) background a-e (B) Visible emisions shall not exceed is not limited to, monitoring results, opac- recorded on a field data sheet at

  5. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3, 4, and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1989-06-01

    Occupational and Environmental Health Laboratory (AFSC) Human Systems Division Brooks Air Force Base, Texas 78235-5501 89 8 28 48 UNCLASSIFIED SE(t"cr...IIiZ .nQ ,P %.6 PO 9𔃼 TOTA I’A53O0 1~~jy &~J7 52c’ f.-~O Qri,_00i -Loc o I I or 0QQ~i -5mcI) 0 c 4003 -5 3 -00o ) Ivf 2 ’?00 13, 1-4I __ -0-31. rA4...The laboratory data sheets were not suitable for reproduction ; therefore, the coal analysis results are presented in the following table. AS RECEIVED

  6. Multi-Unit Initiating Event Analysis for a Single-Unit Internal Events Level 1 PSA

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong San; Park, Jin Hee; Lim, Ho Gon [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    The Fukushima nuclear accident in 2011 highlighted the importance of considering the risks from multi-unit accidents at a site. The ASME/ANS probabilistic risk assessment (PRA) standard also includes some requirements related to multi-unit aspects, one of which (IE-B5) is as follows: 'For multi-unit sites with shared systems, DO NOT SUBSUME multi-unit initiating events if they impact mitigation capability [1].' However, the existing single-unit PSA models do not explicitly consider multi-unit initiating events and hence systems shared by multiple units (e.g., alternate AC diesel generator) are fully credited for the single unit and ignores the need for the shared systems by other units at the same site [2]. This paper describes the results of the multi-unit initiating event (IE) analysis performed as a part of the at-power internal events Level 1 probabilistic safety assessment (PSA) for an OPR1000 single unit ('reference unit'). In this study, a multi-unit initiating event analysis for a single-unit PSA was performed, and using the results, dual-unit LOOP initiating event was added to the existing PSA model for the reference unit (OPR1000 type). Event trees were developed for dual-unit LOOP and dual-unit SBO which can be transferred from dual- unit LOOP. Moreover, CCF basic events for 5 diesel generators were modelled. In case of simultaneous SBO occurrences in both units, this study compared two different assumptions on the availability of the AAC D/G. As a result, when dual-unit LOOP initiating event was added to the existing single-unit PSA model, the total CDF increased by 1∼ 2% depending on the probability that the AAC D/G is available to a specific unit in case of simultaneous SBO in both units.

  7. Chapter 2. The production units

    International Nuclear Information System (INIS)

    1998-01-01

    In the second chapter of this CD ROM the production units of the Slovak Electric, Plc. (Slovenske elektrarne, a.s.), are presented. It consist of next paragraphs: (1) Nuclear power plants (A-1 Nuclear Power Plant (History, Technological scheme, basic data are presented); V-1, V-2 Bohunice Nuclear Power Plant (History 1972-1985, technological scheme; nuclear safety, radiation protection, heat supply, international co-operation and basic data are presented); Mochovce Nuclear Power Plant (History 1980-1998, technological scheme, construction completion, milestones of commissioning, safety and environmental protection as well as basic data are included). (2) Conventional sources of energy (Vojany fossil power plant (History 1959-1992, Technological units of power plant, Impact of operation on the environment, Plant of Vojany FPP Renewal and Reconstruction, Basic data are listed), Novaky fossil power plant (History 1949-1998, Technological scheme, current investment construction, basic data, Handlova heating plant). Kosice Combined Heat Power Plant (History 1960-1995, technological scheme, State metrology centre, acredited chemical laboratory, basic data). (3) Hydroelectric power plants (Trencin HPPs: Cierny Vah pumped storage HPP, Liptovska Mara HPP, Orava HPP, Sucany HPP, Miksova HPP, Nosice HPP, Velke Kozmalovce HPP, Gabcikovo HPP, Dubnica HPP, Nove Mesto n/V HPP, Madunice HPP, Kralova HPP) and Dobsina HPPs: (Dobsina HPP, Ruzin HPP, Domasa HPP, small HPPs) are presented

  8. Are environmental scanning units effective?

    Science.gov (United States)

    Stubbart, C

    1982-06-01

    Many authorities have urged companies to set up environmental scanning to assist corporate planning. Some advocates have recommended a unit at corporate level. This would give breadth of view and penetration into the future. It would arm decision makers with accurate forecasts. The information would be broad in scope and future directed. It could provide also assumptions for long-range planning. The Fahey and King study produced a model of corporate scanning types. The data showed that environmental information was built into the plan. Though the political environment was important, scanning was inadequate. The best location for scanning was not at corporate level and most firms used irregular methods. The Thomas study concluded that effective environmental scanning was permanent and multi level and that 'best practice' was continuous scanning. In 1978 the sample organizations were revisited. Five of the twelve have not changed their practice. The factors which encouraged a continuous model were the attitudes of academics and business media, demonstrated success of the units, the right kind of personnel. Contrary influences were changes in top management, decentralization moves, resource cuts, defining the environment and its significance, the availability of scanning competent personnel, surprise itself, and the availability of alternatives e.g. external forecasts.

  9. East Carnduff Unit: corrosion problems

    Energy Technology Data Exchange (ETDEWEB)

    Banks, C D

    1966-07-01

    Waterflooding of the East Carnduff Unit began in late 1962. The first injection line leak was discovered April 29, 1965. The first 6 leaks in the East Carnduff Unit occurred within a period of less than one month--a very startling and serious warning of pending problems. Analysis of the pipe removed showed a deep pit covered by a severe scale in the piping fitting. Several remedial actions were tried in order to develop the present inhibition program. First, the lines were cleaned as well as possible utilizing rubber pig spheres with normal injection pressure. This proved very effective and 2 passes wiped out most of the scale in the lines. Only one line required acid. After the lines had been cleaned, a water treating rate of an organic amine corrosion inhibitor, 10 ppm of the scale inhibitor, and bactericide at the rate of 40 ppm slugs 2 days per month was initiated. The above treating program is in use at the present time and is maintaining a very low leak frequency. This experience has demonstrated 2 important points in waterflood operations: (1) a bare piping system in warm brine service requires constant attention to insure that it is being kept clean; and (2) reliance cannot be placed on any one method of checking corrosion rates.

  10. Devolution in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Marković Ratko

    2014-01-01

    Full Text Available Devolution is a transfer of the legislative powers of the Westminster Parliament to the parliaments of the historical provinces once united with England into the United Kingdom, which are directly elected by the provincial population. That delegation is asymmetrical and revocable, but it does not affect the basic norms of the British unwritten constitution on parliamentary supremacy. Over the devolution the provinces do not acquire the primary competence, but the one that is given to them by the transfer of the legislative powers of the Westminster Parliament. A special law retaining the Westminster Parliament's primary competence and sovereignty grants this competence. Regarding the scope of the devolved powers of the provinces and the organizational mechanism for their execution, there is a significant asymmetry. In all the provinces, there is a unique junction between devolved powers and their holders. Before the referendum on the independence in Scotland in September 2014, the increase of devolved powers was promised not only for all the historical provinces (Scotland, Wales, Northern Ireland, but for England as well, which represents a step towards the federalization of the UK. Devolution and several other institutions of the British constitution also, have a stamp 'Made in Britain' which does not allow easy imitation and transfer to another countries and their constitutions.

  11. Equivalent unit in telecommunications services

    Directory of Open Access Journals (Sweden)

    Luiza Santangelo Reis

    2016-03-01

    Full Text Available The aim of this study is to analyze the relationship between the “cost” and “production” variables in a telecommunications company, measuring the latter in the unit of measure termed Network Units (NU.  The study shows a Pearson correlation coefficient of 0.55 -evaluated as moderate - over the course of a 24-month period and resulting from 177 trials.  Subsequently, only the work teams composed of the company´s standard structure were taken into consideration, which yielded 32 observations of interest and a derived correlation coefficient of 0.8.  Finally, the data pertaining to each individual work team over a determined length of time was analyzed, showing strong correlation coefficients in seven of the eleven, and in the remainder, a moderate linear relationship between the variables analyzed.  These results suggest the viability of applying the NU production measurement model in the telecommunications company in question

  12. Teen Pregnancy in the United States

    Science.gov (United States)

    ... United States: the contribution of abstinence and improved contraceptive use. Am J Public Health. 2007;97(1):150-6. Lindberg LD, Santelli JS, Desai, S. Understanding the Decline in Adolescent Fertility in the United States, 2007–2012. J ...

  13. 76 FR 66845 - United Nations Day, 2011

    Science.gov (United States)

    2011-10-27

    ... become ever more intertwined, the leadership, staff, and member states of the United Nations continue to... a time of dramatic political transformation, the United Nations can embrace democratic movements and...

  14. 16-channel analog store and multiplexer unit

    Energy Technology Data Exchange (ETDEWEB)

    Brossard, M; Kulka, Z [Clermont-Ferrand-2 Univ., 63 - Aubiere (France). Lab. de Physique Corpusculaire

    1979-03-15

    A 16-channel analog store and multiplexer unit is described. The unit enables storing and selection of analog information which is then digitally encoded by single ADC. This solution becomes economically attractive particularly in multidetector pulse height analysis systems.

  15. Coordinator, Evaluation Unit | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary The Evaluation Unit Coordinator is expected to: ... with Centre policies and procedures and disseminates information to Unit staff on changes ... Coordinates the planning and organization of technical and administrative meetings ...

  16. Order units in a C-algebra

    Indian Academy of Sciences (India)

    Abstract. Order unit property of a positive element in a *-algebra is defined. It is proved that precisely projections satisfy this order theoretic property. This way, unital hereditary *-subalgebras of a *-algebra are characterized.

  17. Labour of love yields new maternity unit.

    Science.gov (United States)

    2012-01-01

    Birmingham's City Hospital's new maternity unit is an inspiring departure from conventional units. Contemporary design and the latest technology combine to give mothers a safe, yet relaxed, environment in which to give birth. HEJ reports.

  18. Fatigue in Breakwater Concrete Armour Units

    DEFF Research Database (Denmark)

    Burcharth, Hans F.

    The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units.......The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units....

  19. Vehicle with inclinable caterpillar propulsion units

    International Nuclear Information System (INIS)

    Clar, G.

    1991-01-01

    This vehicle usable in hostile environment such nuclear industry has four propulsion units with a caterpillar track and two integrated motors: one for advancing the caterpillar track and the other for inclining the propulsion unit when overcoming obstacles. Each propulsion unit is easily replaceable because there are no mechanical parts in the body of the vehicle [fr

  20. 24 CFR 970.31 - Replacement units.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Replacement units. 970.31 Section... PUBLIC HOUSING PROGRAM-DEMOLITION OR DISPOSITION OF PUBLIC HOUSING PROJECTS § 970.31 Replacement units. Notwithstanding any other provision of law, replacement public housing units may be built on the original public...

  1. Oil Vulnerabilities and United States Strategy

    Science.gov (United States)

    2007-02-08

    Mazda, Mercedes - Benz , Ford, Mercury, and Nissan offer flexible fuel vehicles in the United States. Ethanol is currently produced in the United States...USAWC STRATEGY RESEARCH PROJECT OIL VULNERABILITIES AND UNITED STATES STRATEGY by Colonel Shawn P. Walsh...Colleges and Schools, 3624 Market Street, Philadelphia, PA 19104, (215) 662-5606. The Commission on Higher Education is an institutional accrediting

  2. 7 CFR 1215.20 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1215.20 Section 1215.20 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... United States. United States means all of the States. Popcorn Board ...

  3. 7 CFR 1260.108 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1260.108 Section 1260.108 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Promotion and Research Order Definitions § 1260.108 United States. United States means the 50 States and the...

  4. 7 CFR 1280.127 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1280.127 Section 1280.127 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.127 United States. United States means collectively the 50 States and the District of Columbia. ...

  5. 7 CFR 1210.315 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1210.315 Section 1210.315 Agriculture... PLAN Watermelon Research and Promotion Plan Definitions § 1210.315 United States. United States means each of the several States and the District of Columbia. [60 FR 10797, Feb. 28, 1995] National...

  6. 7 CFR 1221.32 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1221.32 Section 1221.32 Agriculture... INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.32 United States. United States or U.S. means collectively the 50 States, the District of Columbia, the Commonwealth of...

  7. 7 CFR 1216.30 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1216.30 Section 1216.30 Agriculture... INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.30 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto Rico...

  8. 7 CFR 1218.22 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1218.22 Section 1218.22 Agriculture... INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.22 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto Rico...

  9. SPOKEN CUZCO QUECHUA, UNITS 1-6.

    Science.gov (United States)

    SOLA, DONALD F.; AND OTHERS

    THE MATERIALS IN THIS VOLUME COMPRISE SIX UNITS WHICH PRESENT BASIC ASPECTS OF CUZCO QUECHUA PHONOLOGY, MORPHOLOGY, AND SYNTAX FOR THE BEGINNING STUDENT. THE SIX UNITS ARE DESIGNED FOR APPROXIMATELY 120 HOURS OF SUPERVISED CLASS WORK WITH OUTSIDE PREPARATION EXPECTED OF THE STUDENT. EACH UNIT CONSISTS OF A DIALOGUE TO BE MEMORIZED, A DIALOGUE…

  10. United Nations and multilateralism: appraising USA's unilateralism ...

    African Journals Online (AJOL)

    Multilateralism as symbolized by the United Nations Organization, seems to have come under threat today, and nowhere is this more evident than in the United States-United Nations relations particularly in the area of military interventions around the world. The aim of this paper is to appraise the practice of the principle of ...

  11. Ecological units of the Northern Region: Subsections

    Science.gov (United States)

    John A. Nesser; Gary L. Ford; C. Lee Maynard; Debbie Dumroese

    1997-01-01

    Ecological units are described at the subsection level of the Forest Service National Hierarchical Framework of Ecological Units. A total of 91 subsections are delineated on the 1996 map "Ecological Units of the Northern Region: Subsections," based on physical and biological criteria. This document consists of descriptions of the climate, geomorphology,...

  12. Image processing unit with fall-back.

    NARCIS (Netherlands)

    2011-01-01

    An image processing unit ( 100,200,300 ) for computing a sequence of output images on basis of a sequence of input images, comprises: a motion estimation unit ( 102 ) for computing a motion vector field on basis of the input images; a quality measurement unit ( 104 ) for computing a value of a

  13. Unit area control in California forests

    Science.gov (United States)

    William E. Hallin

    1951-01-01

    There is a definite distinction between the basic concept of unit area control and the specific techniques or treatments used for specific units. Unit area control as a term was first used in connection with a cutting trial in the sugar pine-fir type; consequently, many foresters think the term refers merely to the technique used in sugar pine management, This is not...

  14. 12 CFR 541.10 - Dwelling unit.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Dwelling unit. 541.10 Section 541.10 Banks and... FEDERAL SAVINGS ASSOCIATIONS § 541.10 Dwelling unit. The term dwelling unit means the unified combination of rooms designed for residential use by one family, other than a single-family dwelling. ...

  15. Malaria Surveillance - United States, 2015.

    Science.gov (United States)

    Mace, Kimberly E; Arguin, Paul M; Tan, Kathrine R

    2018-05-04

    Malaria in humans is caused by intraerythrocytic protozoa of the genus Plasmodium. These parasites are transmitted by the bite of an infective female Anopheles species mosquito. The majority of malaria infections in the United States occur among persons who have traveled to regions with ongoing malaria transmission. However, malaria is occasionally acquired by persons who have not traveled out of the country through exposure to infected blood products, congenital transmission, laboratory exposure, or local mosquitoborne transmission. Malaria surveillance in the United States is conducted to provide information on its occurrence (e.g., temporal, geographic, and demographic), guide prevention and treatment recommendations for travelers and patients, and facilitate transmission control measures if locally acquired cases are identified. This report summarizes confirmed malaria cases in persons with onset of illness in 2015 and summarizes trends in previous years. Malaria cases diagnosed by blood film microscopy, polymerase chain reaction, or rapid diagnostic tests are reported to local and state health departments by health care providers or laboratory staff members. Case investigations are conducted by local and state health departments, and reports are transmitted to CDC through the National Malaria Surveillance System (NMSS), the National Notifiable Diseases Surveillance System (NNDSS), or direct CDC consultations. CDC reference laboratories provide diagnostic assistance and conduct antimalarial drug resistance marker testing on blood samples submitted by health care providers or local or state health departments. This report summarizes data from the integration of all NMSS and NNDSS cases, CDC reference laboratory reports, and CDC clinical consultations. CDC received reports of 1,517 confirmed malaria cases, including one congenital case, with an onset of symptoms in 2015 among persons who received their diagnoses in the United States. Although the number of

  16. Sleep in intensive care unit

    DEFF Research Database (Denmark)

    Boyko, Yuliya; Jennum, Poul; Nikolic, Miki

    2017-01-01

    PURPOSE: To determine if improving intensive care unit (ICU) environment would enhance sleep quality, assessed by polysomnography (PSG), in critically ill mechanically ventilated patients. MATERIALS AND METHODS: Randomized controlled trial, crossover design. The night intervention "quiet routine...... Medicine) sleep scoring criteria were insufficient for the assessment of polysomnograms. Modified classification for sleep scoring in critically ill patients, suggested by Watson et al. (Crit Care Med 2013;41:1958-1967), was used. RESULTS: Sound level analysis showed insignificant effect...... patients. We were not able to further reduce the already existing low noise levels in the ICU and did not find any association between the environmental intervention and the presence of normal sleep characteristics in the PSG....

  17. Fracking in the United States

    International Nuclear Information System (INIS)

    Cho, Renee

    2015-01-01

    Over the last decade, advances in technology have made it profitable to extract natural gas from shale, leading to a boom in shale gas development in the United States. Hydraulic fracturing, or fracking, the controversial method for extracting natural gas, offers numerous benefits: relatively cheap energy, enhanced energy security, job creation, tax revenues and decreased dependence on dirty coal. Fracking, however, can also increase greenhouse gas emissions, pollute the air and result in health effects, consume huge quantities of water, and cause earthquakes. While some areas welcome fracking for the economic benefits it brings, other communities are attempting to ban fracking altogether. This article examines the benefits and risks of fracking in the U.S

  18. United States uranium enrichment policies

    International Nuclear Information System (INIS)

    Roberts, R.W.

    1977-01-01

    ERDA's uranium enrichment program policies governing the manner in which ERDA's enrichment complex is being operated and expanded to meet customer requirements for separative work, research and development activities directed at providing technology alternatives for future enrichment capacity, and establishing the framework for additional domestic uranium enrichment capacity to meet the domestic and foreign nuclear industry's growing demand for enrichment services are considered. The ERDA enrichment complex consists of three gaseous diffusion plants located in Oak Ridge, Tennessee; Paducah, Kentucky; and Portsmouth, Ohio. Today, these plants provide uranium enrichment services for commercial nuclear power generation. These enrichment services are provided under contracts between the Government and the utility customers. ERDA's program involves a major pilot plant cascade, and pursues an advanced isotope separation technique for the late 1980's. That the United States must develop additional domestic uranium enrichment capacity is discussed

  19. Biblis unit A thirty years

    International Nuclear Information System (INIS)

    Lauer, H.

    2004-01-01

    The first nuclear power plant in the Federal Republic of Germany started operation in 1961. It was followed by a consistent period of development until a new energy source had become available by the late sixties which was both powerful and capable of expansion. With 1200 MW electric power, the pressurized water reactor of Biblis A in 1974 was equipped with the world's most powerful single-shaft turbine generator. In 187,656 hours of operation, Biblis A over the past thirty years generated slightly more than 211 billion kWh of gross electricity (by July 31, 2004). The operating experience accumulated also resulted in improvements and modifications of technical plant systems in the 1970s and 1980s which served to bring the unit up to the then current state of the art. Modifications of technical plant systems serving to increase the safety margins or improve operating systems, always in the light of the state of the art, have been carried out consistently and continuously over the years. In combination with a high level of qualification of the operating personnel, which is ensured by an efficient system of primary and refresher training courses of responsible shift personnel and other groups of power plant personnel, this creates a lasting foundation of safe plant operation. In connection with the preparations for, and the execution of, revision outages, Biblis provided the first experience with a PWR of this size category. Unit A of the Biblis nuclear power station is proof of the fact that technical and safety challenges can be solved, and have been solved, by engineering expertise. The high availability and low susceptibility to failure of the plant demonstrate the widely optimized maintenance strategy and the high qualification and motivation of the staff. (orig.)

  20. Edexcel A2 Physics Student Unit Guide

    CERN Document Server

    Benn, Mike

    2010-01-01

    Student Unit Guides are perfect for revision. Each guide is written by an examiner and explains the unit requirements, summarises the relevant unit content and includes a series of specimen questions and answers. There are three sections to each guide:. Introduction - includes advice on how to use the guide, an explanation of the skills being tested by the assessment objectives, an outline of the unit or module and, depending on the unit, suggestions for how to revise effectively and prepare for the examination questions. Content Guidance - provides an examiner's overview of the module's key t

  1. AQA A2 Chemistry Student Unit Guide

    CERN Document Server

    Cross, Margaret

    2010-01-01

    Student Unit Guides are perfect for revision. Each guide is written by an examiner and explains the unit requirements, summarises the relevant unit content and includes a series of specimen questions and answers. There are three sections to each guide:. Introduction - includes advice on how to use the guide, an explanation of the skills being tested by the assessment objectives, an outline of the unit or module and, depending on the unit, suggestions for how to revise effectively and prepare for the examination questions. Content Guidance - provides an examiner's overview of the module's key t

  2. Hanford Site Waste Managements Units reports

    International Nuclear Information System (INIS)

    1992-01-01

    The Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC 1984). This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in this report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. The information in this report is extracted from the Waste Information Data System (WIDS). The WIDS provides additional information concerning the waste management units contained in this report and is maintained current with changes to these units. This report is updated annually if determined necessary per the Hanford Federal Facility Agreement and Consent Order Order (commonly referred to as the Tri-Party Agreement, Ecology et al. 1990). This report identifies 1,414 waste management units. Of these, 1,015 units are identified as solid waste management units (SWMU), and 342 are RCRA treatment, storage, and disposal units. The remaining 399 are comprised mainly of one-time spills to the environment, sanitary waste disposal facilities (i.e., septic tanks), and surplus facilities awaiting decontamination and decommissioning

  3. 3 CFR - Waiver of Reimbursement Under the United Nations Participation Act to Support the United Nations...

    Science.gov (United States)

    2010-01-01

    ... Participation Act to Support the United Nations/African Union Mission in Darfur Presidential Documents Other... the United Nations Participation Act to Support the United Nations/African Union Mission in Darfur... the United Nations/African Union Mission in Darfur to support the airlift of equipment for...

  4. Discharge from an emergency department observation unit and a surgical assessment unit

    DEFF Research Database (Denmark)

    Schultz, Helen; Qvist, Niels; Backer Mogensen, Christian

    2014-01-01

    To investigate the experiences of patients with acute abdominal pain at discharge from an emergency department observation unit compared with discharge from a surgical assessment unit.......To investigate the experiences of patients with acute abdominal pain at discharge from an emergency department observation unit compared with discharge from a surgical assessment unit....

  5. Malaria Surveillance - United States, 2014.

    Science.gov (United States)

    Mace, Kimberly E; Arguin, Paul M

    2017-05-26

    Malaria in humans is caused by intraerythrocytic protozoa of the genus Plasmodium. These parasites are transmitted by the bite of an infective female Anopheles mosquito. The majority of malaria infections in the United States occur among persons who have traveled to regions with ongoing malaria transmission. However, malaria is occasionally acquired by persons who have not traveled out of the country through exposure to infected blood products, congenital transmission, laboratory exposure, or local mosquitoborne transmission. Malaria surveillance in the United States is conducted to identify episodes of local transmission and to guide prevention recommendations for travelers. This report summarizes cases in persons with onset of illness in 2014 and trends during previous years. Malaria cases diagnosed by blood film, polymerase chain reaction, or rapid diagnostic tests are reported to local and state health departments by health care providers or laboratory staff. Case investigations are conducted by local and state health departments, and reports are transmitted to CDC through the National Malaria Surveillance System, National Notifiable Diseases Surveillance System, or direct CDC consultations. CDC conducts antimalarial drug resistance marker testing on blood samples submitted by health care providers or local or state health departments. Data from these reporting systems serve as the basis for this report. CDC received reports of 1,724 confirmed malaria cases, including one congenital case and two cryptic cases, with onset of symptoms in 2014 among persons in the United States. The number of confirmed cases in 2014 is consistent with the number of confirmed cases reported in 2013 (n = 1,741; this number has been updated from a previous publication to account for delayed reporting for persons with symptom onset occurring in late 2013). Plasmodium falciparum, P. vivax, P. ovale, and P. malariae were identified in 66.1%, 13.3%, 5.2%, and 2.7% of cases, respectively

  6. Geographic Perspectives on the Relationship of Air Force Base Realignments to Rural Community Welfare in the United States.

    Science.gov (United States)

    1982-11-15

    as a "boom and bust" economy tied to the destiny of Larson AFB. Two basic activities have served to underpin and sustai4n the local economy; these...may seem. The ombudsznanship role played by the then embryo Office of Economic Adjustment, several federal agencies and the Maine congressional...civilian aviation purposes proved to be of vital importance to successful operation of the embryo port district. A source of funds was desperately

  7. Hanford Site Waste Management Units Report

    International Nuclear Information System (INIS)

    1991-01-01

    This Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC). The report provides a comprehensive inventory of all types of waste management units at the Hanford Site and consists of waste disposal units, including (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structure, (5) RCRA treatment and storage units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. In support of the Hanford RCRA permit, a field was added to designate whether the waste management unit is a solid waste management unit (SWMU). As SWMUs are identified, they will added to the Hanford Waste Information Data System (WIDS), which is the database supporting this report, and added to the report at its next annual update. A quality review of the WIDS was conducted this past year. The review included checking all data against their reference and making appropriate changes, updating the data elements using the most recent references, marking duplicate units for deletion, and addition additional information. 6 refs

  8. Hanford Site Waste Management Units Report

    International Nuclear Information System (INIS)

    1991-01-01

    This Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC). The report provides a comprehensive inventory of all types of waste management units at the Hanford Site and consists of waste disposal units, including (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment and storage units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. In support of the Hanford RCRA permit, a field was added to designate whether the waste management unit is a solid waste management unit (SWMU). As SWMUs are identified, they will added to the Hanford Waste Information Data System (WIDS), which is the database supporting this report, and added to the report at its next annual update. A quality review of the WIDS was conducted this past year. The review included checking all data against their reference and making appropriate changes, updating the data elements using the most recent references, marking duplicate units for deletion, and adding additional information. 6 refs

  9. Generating units performances: power system requirements

    Energy Technology Data Exchange (ETDEWEB)

    Fourment, C; Girard, N; Lefebvre, H

    1994-08-01

    The part of generating units within the power system is more than providing power and energy. Their performance are not only measured by their energy efficiency and availability. Namely, there is a strong interaction between the generating units and the power system. The units are essential components of the system: for a given load profile the frequency variation follows directly from the behaviour of the units and their ability to adapt their power output. In the same way, the voltage at the units terminals are the key points to which the voltage profile at each node of the network is linked through the active and especially the reactive power flows. Therefore, the customer will experience the frequency and voltage variations induced by the units behaviour. Moreover, in case of adverse conditions, if the units do not operate as well as expected or trip, a portion of the system, may be the whole system, may collapse. The limitation of the performance of a unit has two kinds of consequences. Firstly, it may result in an increased amount of not supplied energy or loss of load probability: for example if the primary reserve is not sufficient, a generator tripping may lead to an abnormal frequency deviation, and load may have to be shed to restore the balance. Secondly, the limitation of a unit performance results in an economic over-cost for the system: for instance, if not enough `cheap` units are able to load-following, other units with higher operating costs have to be started up. We would like to stress the interest for the operators and design teams of the units on the one hand, and the operators and design teams of the system on the other hand, of dialog and information exchange, in operation but also at the conception stage, in order to find a satisfactory compromise between the system requirements and the consequences for the generating units. (authors). 11 refs., 4 figs.

  10. International law and United Nations

    Directory of Open Access Journals (Sweden)

    Savić Matej

    2012-01-01

    Full Text Available Along with centuries-lasting open military pretensions of world superpowers, modern diplomacy has developed, as beginning a war, as well as coming to peace demanded political activity which resulted, first in signing, and then coming into effect of international documents, on the basis of which, a foundation for the modern international order has been cast. Further on, by the formation of international organizations, codification has been allowed, as well as a progressive development of international law. Additionally, in the sense of preserving international peace and security, first the League of Nations was formed, and following the ending of World War II, the UN. Generally, the functioning of the United Nation's organs, has been regulated by legal rules, however political goals, tendencies, and mechanisms which the member states are using determine greatly the activity above all of the Security Council, but furthermore of the General Assembly, as a plenary organ. Nevertheless, the achieved results of the Commission for International Law in the meaning of creation of international conventions, as well as state adhering to the same, present unassailable achievements in the sense of development of international law. On the other hand, tendencies of motion of international relationships are aimed at establishing a multi-polar system in the international community. Today, the political scene is assuming a new appearance, by which the nearly built international system is already awaiting further progressive development.

  11. Decommissioning: a United Kingdom perspective

    International Nuclear Information System (INIS)

    Haworth, A.; Reed, D.L.; Bleeze, A.

    1995-01-01

    The paper considers the United Kingdom legislative framework relevant to decommissioning of facilities on nuclear licensed sites. It describes the various legislative bodies involved in regulating this activity and the inspectorate concerned. The licensing regime is described in some detail highlighting the UK arrangements whereby a license is granted for the site upon which nuclear facilities are planned or exist. The license remains in place throughout the life of the plant on the site: from initial planning through to the end of decommissioning. A site (of part of) is not de-licensed until it can be stated that there has ceased to be any danger from ionising radiations from anything on the site (or appropriate part of the site). The final part of the paper considers the changes arising from the commercialization of the nuclear power industry in UK and the restatement of the Nuclear Installation Inspectorate's policy on decommissioning which has arisen as a result of a review made in response to these changes. (author)

  12. Several hundred megawatt MHD units

    International Nuclear Information System (INIS)

    Pishchikov, S.; Pinkhasik, D.; Sidorov, V.

    1978-01-01

    The features are described of the future MHD unit U-25 tested at the Institute of High Temperatures of the Academy of Sciences of the USSR. The attainable thermal load of the combustion chamber is 290x10 6 kJ/m 3 .h. Three types of channel were tested, i.e., the Faraday channel divided into sections with modular insulating walls, the diagonal channel without metal body, and an improved Faraday channel with an output of 20 MW. The described MHD generator is equipped with an inverter which transforms direct current into alternating current, continuously adjusts the load from no-load operation to short-circuit connection and maintains the desired electrical voltage independently of the changes in loading. A new technique of connecting and disconnecting the oxygen equipment was developed which considerably reduces the time of start-up and shut-down. Natural gas is used for heating the air heaters. All equipment used in the operation of the MHD generator is remote controlled by computer or manually. (J.B.)

  13. Several hundred megawatt MHD units

    Energy Technology Data Exchange (ETDEWEB)

    Pishchikov, S; Pinkhasik, D; Sidorov, V

    1978-07-01

    The features are described of the future MHD unit U-25 tested at the Institute of High Temperatures of the Academy of Sciences of the USSR. The attainable thermal load of the combustion chamber is 290x10/sup 6/ kJ/m/sup 3/.h. Three types of channel were tested, i.e., the Faraday channel divided into sections with modular insulating walls, the diagonal channel without metal body, and an improved Faraday channel with an output of 20 MW. The described MHD generator is equipped with an inverter which transforms direct current into alternating current, continuously adjusts the load from no-load operation to short-circuit connection and maintains the desired electrical voltage independently of the changes in loading. A new technique of connecting and disconnecting the oxygen equipment was developed which considerably reduces the time of start-up and shut-down. Natural gas is used for heating the air heaters. All equipment used in the operation of the MHD generator is remote controlled by computer or manually.

  14. AREVA in the United States

    International Nuclear Information System (INIS)

    2007-01-01

    In 2005, the United States had 297 million inhabitants (the 3. most populous country in the world) and a land area of 9.4 million km 2 (17 times larger than France). With a GDP of 10,996 billion dollars (under the economic conditions of the year 2000), the U.S. is the largest economic power in the world. It is also the largest consumer of energy, with primary energy consumption of 2,329 million metric tons, meaning that 25% of the world's energy is consumed by just 4% of its population. Although it has large domestic energy supplies, the U.S. is very far from achieving energy self-sufficiency. A decline of nearly 50% in oil production over a period of more than 30 years and the simultaneous stagnation of gas production have further weakened the U.S. energy balance. On a more general level, the increasing depletion of hydrocarbon resources (gas and oil), the concentration of the world's main resources in geo-politically unstable areas and the forecasted increase in the consumption and price of hydrocarbons, especially since 2005, mean that energy independence and supply security have become 2 of the top priorities of U.S. commercial and international policy. In 2007, the U.S. accounted for 22% of global CO 2 emissions, equaling those of China. In relation to population, the U.S. emits 8 metric tons/inhabitant compared to a world average of 4.2 metric tons/inhabitant. Although global warming is seen as a reality by the American public, it has only recently become a major argument in favor of a nuclear energy revival in the U.S. The context is, however, changing significantly. This is evidenced by America's adoption, in recent years, of measures to reduce greenhouse gases, particularly through the development of new, more environmentally friendly technologies. Since 2001, nearly 23 billion dollars in public funds have been devoted to climate research and the development of clean energy sources, notably renewable energies such as wind and solar, but also hydrogen and

  15. Patient dose in neonatal units

    International Nuclear Information System (INIS)

    Smans, K.; Struelens, L.; Smet, M.; Bosmans, H.; Vanhavere, F.

    2008-01-01

    Lung disease represents one of the most life-threatening conditions in prematurely born children. In the evaluation of the neonatal chest, the primary and most important diagnostic study is therefore the chest radiograph. Since prematurely born children are very sensitive to radiation, those radiographs may lead to a significant radiation detriment. Hence, knowledge of the patient dose is necessary to justify the exposures. A study to assess the patient doses was started at the neonatal intensive care unit (NICU) of the Univ. Hospital in Leuven. Between September 2004 and September 2005, prematurely born babies underwent on average 10 X-ray examinations in the NICU. In this sample, the maximum was 78 X-ray examinations. For chest radiographs, the median entrance skin dose was 34 μGy and the median dose area product was 7.1 mGy.cm 2 . By means of conversion coefficients, the measured values were converted to organ doses. Organ doses were calculated for three different weight classes: extremely low birth weight infants ( 2500 g). The doses to the lungs for a single chest radiograph for infants with extremely low birth weights, low birth weights and normal birth weights were 24, 25 and 32 μGy, respectively. (authors)

  16. United Kingdom electric system privatization

    Energy Technology Data Exchange (ETDEWEB)

    Lolli, A. (Bologna Univ. (Italy))

    1992-03-01

    This paper reviews the mechanics and first results of deregulation in the electric power industry of the United Kingdom. Several aspects are dealt with, namely: 1983 Energy Act impacts on ownership and subsequent changes brought about by the 1989 Energy Act; the Act's stipulations with regard to share acquisition and distribution; the division of the patrimony of the Area Boards; natural monopolistic characteristics of power distribution; vertical integration in Scotland, target investment limits in Government and public participation; the 'golden share' concept to guarantee public participation; current 40% share ownership by the Government; 15% private ownership limit for individual investors; external control by Government of licensing and rate structure setting; the impacts of organizational changes on the overall cost benefits of deregulation; modified Governmental regulatory powers; measures to ensure competition and consumer protection; provisions regarding misbehaviour; second tier suppliers and reserve fuel supply obligations; deregulation impacts on nuclear power marketing; power pooling regulations; installation of new transmission lines; provisions encouraging the use of diverse energy sources; franchising; interconnection with national grid; regulation of technical operations; standby as it affects rate structure; and spot market pricing.

  17. Neurovascular Unit in Chronic Pain

    Directory of Open Access Journals (Sweden)

    Beatrice Mihaela Radu

    2013-01-01

    Full Text Available Chronic pain is a debilitating condition with major socioeconomic impact, whose neurobiological basis is still not clear. An involvement of the neurovascular unit (NVU has been recently proposed. In particular, the blood-brain barrier (BBB and blood-spinal cord barrier (BSCB, two NVU key players, may be affected during the development of chronic pain; in particular, transient permeabilization of the barrier is suggested by several inflammatory- and nerve-injury-based pain models, and we argue that the clarification of molecular BBB/BSCB permeabilization events will shed new light in understanding chronic pain mechanisms. Possible biases in experiments supporting this theory and its translational potentials are discussed. Moving beyond an exclusive focus on the role of the endothelium, we propose that our understanding of the mechanisms subserving chronic pain will benefit from the extension of research efforts to the NVU as a whole. In this view, the available evidence on the interaction between analgesic drugs and the NVU is here reviewed. Chronic pain comorbidities, such as neuroinflammatory and neurodegenerative diseases, are also discussed in view of NVU changes, together with innovative pharmacological solutions targeting NVU components in chronic pain treatment.

  18. Management information systems. [United Kingdom

    Energy Technology Data Exchange (ETDEWEB)

    Hartley, D.; Spence, A.C.

    1985-02-01

    The successful application in the United Kingdom of the real time monitoring and control systems (MINOS) for underground mining operations, particularly in coal transport and the development of coalface monitoring (FIDO) in 1980 led naturally to the design of an operational data base for management. A User Group of experienced colliery managers produced a Management Information System (MIS) requirements specification and began the evolution of the systems of today. Twenty-four mines operate MIS in different ways from total dependency to a means of checking their manual reporting system. MIS collects useful data from all the major MINOS applications and provides a means of manually inputting other, relevant information. A wide variety of displays and reports are available to management, adjusted to meet individual requirements. The benefits from the use of MIS are difficult to quantify, since they become part of the management process. Further developments are taking place based on operational experience and requirements and taking advantage of the recent advances in computer technology. MIS is the modern management tool in British coal mining, collecting, storing, analysing and presenting accurate information upon which management decision making is based.

  19. AREVA in the United States

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    In 2005, the United States had 297 million inhabitants (the 3. most populous country in the world) and a land area of 9.4 million km{sup 2} (17 times larger than France). With a GDP of 10,996 billion dollars (under the economic conditions of the year 2000), the U.S. is the largest economic power in the world. It is also the largest consumer of energy, with primary energy consumption of 2,329 million metric tons, meaning that 25% of the world's energy is consumed by just 4% of its population. Although it has large domestic energy supplies, the U.S. is very far from achieving energy self-sufficiency. A decline of nearly 50% in oil production over a period of more than 30 years and the simultaneous stagnation of gas production have further weakened the U.S. energy balance. On a more general level, the increasing depletion of hydrocarbon resources (gas and oil), the concentration of the world's main resources in geo-politically unstable areas and the forecasted increase in the consumption and price of hydrocarbons, especially since 2005, mean that energy independence and supply security have become 2 of the top priorities of U.S. commercial and international policy. In 2007, the U.S. accounted for 22% of global CO{sub 2} emissions, equaling those of China. In relation to population, the U.S. emits 8 metric tons/inhabitant compared to a world average of 4.2 metric tons/inhabitant. Although global warming is seen as a reality by the American public, it has only recently become a major argument in favor of a nuclear energy revival in the U.S. The context is, however, changing significantly. This is evidenced by America's adoption, in recent years, of measures to reduce greenhouse gases, particularly through the development of new, more environmentally friendly technologies. Since 2001, nearly 23 billion dollars in public funds have been devoted to climate research and the development of clean energy sources, notably renewable energies such as wind and solar

  20. The Kozloduy project management unit

    International Nuclear Information System (INIS)

    Carnes, W.S.; Gros-Gean, P.; Demireva, E.

    2004-01-01

    The Project Management Unit (PMU) has been established in support to the Kozloduy NPP decommissioning department. It is comprised of a Consortium of the British Nuclear Group, EDF and subcontractor ENPRO Consult. It is responsible for the management of seven projects (a facility for dry storage of spent fuel; equipment to treat low activity liquid radioactive waste; provision of physical separation of the plant systems and areas to be decommissioned from the ones in operation; equipment to decontaminate and clean pools and large tanks; a facility to provide high volume reduction of solid radioactive wastes and retrieval and conditioning of ion exchange resins and other sorbents; equipment to provide measurement for the free-release of materials and components; a facility for personnel monitoring, decontamination and clothes changing for work outside of the normal radiological control areas) that will be used in support of the KNPP decommissioning process. The projects will be tendered in compliance with the European Bank for Reconstruction and Development requirements

  1. Data report: western United States

    International Nuclear Information System (INIS)

    Cook, J.R.; Fay, W.M.

    1982-04-01

    This abbreviated summary data report, presents results of ground water and stream surface sediment reconnaissance in the western United States. Surface sediment samples were collected at 67,741 sites, at a target sampling density of one site per 13 square kilometers. Ground water samples were collected at 13,979 sites, and surface water samples were collected at 2,958 sites. Neutron activaton analysis results are given for uranium and 16 other elements in sediments, and for uranium and 9 other elements in waters. Mass spectrometry results are given for helium in ground waters. Supplemental analyses of the sediments for extractable uranium and 22 other elements are given where they are available. Supplemental analyses of water samples for 33 additional elements are also reported where they are available. Analytical data and field measurements are presented in tables on microfiche. Data from ground water sites (on microfiche in pocket) include (1) water chemistry measurements (pH, conductivity, and alkalinity), (2) physical measurements where applicable (water temperature, well description, and scintillometer reading), and (3) elemental analyses (U, Al, Br Cl, Dy, F, Mg, Mn, Na, and V by neutron activation and Ag, Al, As, B, Ba, Be, Ca, Ce, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Mo, Na, Nb, Ni, P, Sc, Se, Si, Sr, Th, Ti, V, Y, Zn, and Zr by spectrophotometry). Helium analyses are given for ground water

  2. Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-13

    Science.gov (United States)

    Bauman, William; Crawford, Winifred; Watson, Leela; Shafer, Jaclyn; Huddleston, Lisa

    2013-01-01

    Ms. Shafer completed the task to determine relationships between pressure gradients and peak winds at Vandenberg Air Force Base (VAFB), and began developing a climatology for the VAFB wind towers; Dr. Huddleston completed the task to develop a tool to help forecast the time of the first lightning strike of the day in the Kennedy Space Center (KSC)/Cape Canaveral Air Force Station (CCAFS) area; Dr. Bauman completed work on a severe weather forecast tool focused on the Eastern Range (ER), and also developed upper-winds analysis tools for VAFB and Wallops Fl ight Facility (WFF); Ms. Crawford processed and displayed radar data in the software she will use to create a dual-Doppler analysis over the east-central Florida and KSC/CCAFS areas; Mr. Decker completed developing a wind pairs database for the Launch Services Program to use when evaluating upper-level winds for launch vehicles; Dr. Watson continued work to assimilate observational data into the high-resolution model configurations she created for WFF and the ER.

  3. The Unitality of Quantum B-algebras

    Science.gov (United States)

    Han, Shengwei; Xu, Xiaoting; Qin, Feng

    2018-02-01

    Quantum B-algebras as a generalization of quantales were introduced by Rump and Yang, which cover the majority of implicational algebras and provide a unified semantic for a wide class of substructural logics. Unital quantum B-algebras play an important role in the classification of implicational algebras. The main purpose of this paper is to construct unital quantum B-algebras from non-unital quantum B-algebras.

  4. Junior Leader Training Development in Operational Units

    Science.gov (United States)

    2012-04-01

    UNITS Successful operational units do not arise without tough, realistic, and challenging training. Field Manual (FM) 7-0, Training Units and D...operations. The manual provides junior leaders with guidance on how to conduct training and training management. Of particular importance is the definition...1 Relation htp between ADDIE and the Anny Training Management Model. The Army Training Management Model and ADDIE process appear in TRADOC PAM 350

  5. Fatigue in Breakwater Concrete Armour Units

    OpenAIRE

    Burcharth, Hans F.

    1984-01-01

    The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units. Results showing significant fatigue from impact tests with Dolosse made of unreinforced and steel fibre reinforced flyash concrete are presented. Moreover universal graphs for fatigue in armour units made of conventional unreinforced concrete exposed to impact load ...

  6. Seasonal unit roots in trade variables

    OpenAIRE

    Carol Alexander; Manuel Cantavella Jordá

    1997-01-01

    In this paper we examine the presence of seasonal unit roots in trade variables for Germany, France, the United Kingdom, and Italy, using the procedure developed by Hylleberg, Engle, Granger, and Yoo (1990) [HEGY]. Both quarterly and monthly data reject the presence of unit roots at most seasonal frequencies, more frequently in quarterly than in monthly data. This has important implications for econometric modeling of trade balance, exchange rates and income in European Union (EU) countries. ...

  7. Military Service Records and Unit Histories: A Guide to Locating Sources

    Science.gov (United States)

    2012-07-26

    records, therefoa- e , written authorization from the veta -an or ne.’Ct of kin is not rEqUired. However, in ordet" to protect the privacy of the...line E -mail: MPR.center@nara.gov Older military personnel records (generally prior to World War I, depending on the service branch) are located at...AFB, DC 20032-5000 E -mail: afhso.research@pentagon.af.mil http://www.afhso.af.mil/ (202) 404-2264 National Museum of the U.S. Air Force 1100

  8. Contemporary United States Foreign Policy Towards Indonesia

    National Research Council Canada - National Science Library

    McAslan, Hugh

    2004-01-01

    United States national interests in Indonesia have traditionally being based on strategic security requirements given Indonesia's geographic location between the Indian and Pacific Oceans, and strong...

  9. Polymeric Traypack Integrity: Bench-Scale Unit

    National Research Council Canada - National Science Library

    Canavan, Jeffrey

    2002-01-01

    .... Additional experimentation was conducted to determine the applicability of the unit for non-destructive residual gas testing since current destructive tests represent a substantial continuing expense...

  10. Stabilization of gas turbine unit power

    Science.gov (United States)

    Dolotovskii, I.; Larin, E.

    2017-11-01

    We propose a new cycle air preparation unit which helps increasing energy power of gas turbine units (GTU) operating as a part of combined cycle gas turbine (CCGT) units of thermal power stations and energy and water supply systems of industrial enterprises as well as reducing power loss of gas turbine engines of process blowers resulting from variable ambient air temperatures. Installation of GTU power stabilizer at CCGT unit with electric and thermal power of 192 and 163 MW, respectively, has resulted in reduction of produced electrical energy production costs by 2.4% and thermal energy production costs by 1.6% while capital expenditures after installation of this equipment increased insignificantly.

  11. Portable brine evaporator unit, process, and system

    Science.gov (United States)

    Hart, Paul John; Miller, Bruce G.; Wincek, Ronald T.; Decker, Glenn E.; Johnson, David K.

    2009-04-07

    The present invention discloses a comprehensive, efficient, and cost effective portable evaporator unit, method, and system for the treatment of brine. The evaporator unit, method, and system require a pretreatment process that removes heavy metals, crude oil, and other contaminates in preparation for the evaporator unit. The pretreatment and the evaporator unit, method, and system process metals and brine at the site where they are generated (the well site). Thus, saving significant money to producers who can avoid present and future increases in transportation costs.

  12. Logistics Support of Naval Expeditionary Units

    National Research Council Canada - National Science Library

    Nilsen, Jan

    2004-01-01

    .... Based on literature from strategic management, logistics, and supply chain management, the research evaluates the existing theater logistics capabilities and the requirements of the supported expeditionary units...

  13. Clinical Epidemiology Unit - overview of research areas

    Science.gov (United States)

    Clinical Epidemiology Unit (CEU) conducts etiologic research with potential clinical and public health applications, and leads studies evaluating population-based early detection and cancer prevention strategies

  14. 78 FR 4134 - Notice of Intent To Prepare An Environmental Impact Statement (EIS) On the Proposal To Relocate...

    Science.gov (United States)

    2013-01-18

    ... Proposal To Relocate the 18th Aggressor Squadron From Eielson Air Force Base (EAFB), Alaska to Joint Base... Eielson AFB, AK AGENCY: Pacific Air Forces, United States Air Force, DOD. ACTION: Notice of Intent... Statement (EIS) considering a proposal to relocate the 18th Aggressor Squadron from Eielson AFB to Joint...

  15. GENDER ISSUES: Perceptions of Readiness in Selected Units

    National Research Council Canada - National Science Library

    1999-01-01

    .... More than 13,000 women have joined these units.3 Among the units that have opened to women are Army smoke and chemical companies, forward support battalions, air defense artillery headquarters' units, military police units, and engineer companies...

  16. TRAINING OF THE STATE PRESIDENT'S UNIT

    African Journals Online (AJOL)

    The primary function of the State President's Unit is to protect the head of state - not his person as is generally believed, but his authority over the state. Ironically, the ceremonial performances of the State President's Unit lead people to believe that they are only capable of doing drill exer- cises. However, upon investigating.

  17. 40 CFR 157.27 - Unit packaging.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Unit packaging. 157.27 Section 157.27 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PACKAGING REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.27 Unit packaging. Pesticide products...

  18. Organizational evaluation of an interprofessional study unit

    DEFF Research Database (Denmark)

    Jensen, Didde Cramer; Nørgaard, Birgitte; Draborg, Eva

    2012-01-01

    This article presents results from an organizational evaluation of an interprofessional clinical study unit (ICS) in Denmark. The aim of this study was to test whether the ICS was based on a durable organizational concept and to identify the prerequisites for the unit to be successful...

  19. Global Entrepreneurship and the United States

    Science.gov (United States)

    2010-09-01

    Global Entrepreneurship and the United States by Zoltan J. Acs Laszlo Szerb Ruxton, MD 21204 for under contract number SBAHQ-09...SUBTITLE Global Entrepreneurship and the United States 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...3 2.1. Assessing Entrepreneurship ..................................................................................4 2.2. Stages of Development

  20. Charpak, Garwin, propose unit for radiation dose

    CERN Multimedia

    Feder, Toni

    2002-01-01

    Becquerels, curries, grays, rads, rems, roentgens, sieverts - even for specialists the units of radiation can get confusing. That's why two eminent physicists, Georges Charpak of France, and Richard Garwin, are proposing the DARI as a unit of radiation dose they hope will help the public evaluate the risks associated with low-level radiation exposure (1 page)

  1. Block Gas Sol Unit in Haderslev

    DEFF Research Database (Denmark)

    Vejen, Niels Kristian

    2000-01-01

    Investigation of a SDHW system based on a Block Gas Sol Unit from Baxi A/S installed by a consumer i Haderslev, Denmark.......Investigation of a SDHW system based on a Block Gas Sol Unit from Baxi A/S installed by a consumer i Haderslev, Denmark....

  2. Traditional African Religion: A Resource Unit.

    Science.gov (United States)

    Garland, William E.

    This resource unit is based on research conducted by Lynn Mitchell and Ernest Valenzuela, experienced classroom teachers of African history and culture. The unit consists of an introduction by Mr. Garland and two major parts. Part I is an annotated bibliography of selected sources on various aspects of traditional African Religion useful in…

  3. Portable field water sample filtration unit

    International Nuclear Information System (INIS)

    Hebert, A.J.; Young, G.G.

    1977-01-01

    A lightweight back-packable field-tested filtration unit is described. The unit is easily cleaned without cross contamination at the part-per-billion level and allows rapid filtration of boiling hot and sometimes muddy water. The filtration results in samples that are free of bacteria and particulates and which resist algae growth even after storage for months. 3 figures

  4. Unit labour costs, productivity and international competitiveness

    NARCIS (Netherlands)

    Ark, Bart van; Stuivenwold, Edwin; Ypma, Gerard

    2005-01-01

    This paper provides international comparisons of relative levels of unit labour costs (ULC) for several OECD countries relative to the United States. The estimates are based on the Total Economy Database and the 60-Industry Database of the Groningen Growth and Development Centre (GGDC), and are also

  5. United States housing, first quarter 2013

    Science.gov (United States)

    Delton Alderman

    2014-01-01

    Provides current and historical information on housing market in the United States. Information includes trends for housing permits and starts, housing under construction, and housing completions for single and multifamily units, and sales and construction. This report will be updated regularly.

  6. 78 FR 64385 - United Nations Day, 2013

    Science.gov (United States)

    2013-10-28

    ... A Proclamation In 1945, after two world wars that showed the horrific lethality of modern conflict.... We celebrate the organization's challenging and often unheralded work of forging a world in which... children and grandchildren from the ravages of war, the members of the United Nations committed ``to unite...

  7. An intersection test for panel unit roots

    NARCIS (Netherlands)

    Hanck, C.

    2013-01-01

    This article proposes a new panel unit root test based on Simes' ( 1986) classical intersection test. The test is robust to general patterns of cross-sectional dependence and yet is straightforward to implement, only requiring p-values of time series unit root tests of the series in the panel, and

  8. National Lexicography Units: Past, Present, Future

    African Journals Online (AJOL)

    Mariëtta Alberts, Research Unit for Languages and Literature in SA Context,. Northwest ..... NLUs were also assisted with the marketing of the units and the obtaining .... each dictionary project, and developing an editorial style guide for each dic- .... The DSAE edited the South African Concise Oxford Dictionary that was.

  9. Oversight Institutions Within the United Nations

    DEFF Research Database (Denmark)

    Pontoppidan, Caroline Aggestam

    2015-01-01

    This article will give a description of the role of internal audit and governance functions within the United Nations system. The United Nations has, during the last 10 years, worked to establish effective oversight services. Oversight, governance and hereunder the internal audit function has been...

  10. Performance and burnout in intensive care units

    NARCIS (Netherlands)

    Keijsers, GJ; Schaufeli, WB; LeBlanc, P; Zwerts, C; Miranda, DR

    1995-01-01

    The relationship between three different performance measures and burnout was explored in 20 Dutch Intensive Care Units (ICUs). Burnout (i.e. emotional exhaustion and depersonalization) proved to be significantly related to nurses' perceptions of performance as well as to objectively assessed unit

  11. Physical protection of nuclear operational units

    International Nuclear Information System (INIS)

    1981-07-01

    The general principles of and basic requirements for the physical protection of operational units in the nuclear field are established. They concern the operational units whose activities are related with production, utilization, processing, reprocessing, handling, transport or storage of materials of interest for the Brazilian Nuclear Program. (I.C.R.) [pt

  12. 7 CFR 275.6 - Management units.

    Science.gov (United States)

    2010-01-01

    ... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PERFORMANCE REPORTING SYSTEM Management Evaluation (ME... management unit; (iii) Food Stamp Program participation, including the number of persons and number of... 7 Agriculture 4 2010-01-01 2010-01-01 false Management units. 275.6 Section 275.6 Agriculture...

  13. How Do We Really Compute with Units?

    Science.gov (United States)

    Fiedler, B. H.

    2010-01-01

    The methods that we teach students for computing with units of measurement are often not consistent with the practice of professionals. For professionals, the vast majority of computations with quantities of measure are performed within programs on electronic computers, for which an accounting for the units occurs only once, in the design of the…

  14. Unit roots, nonlinearities and structural breaks

    DEFF Research Database (Denmark)

    Haldrup, Niels; Kruse, Robinson; Teräsvirta, Timo

    One of the most influential research fields in econometrics over the past decades concerns unit root testing in economic time series. In macro-economics much of the interest in the area originate from the fact that when unit roots are present, then shocks to the time series processes have...

  15. 75 FR 65561 - United Nations Day, 2010

    Science.gov (United States)

    2010-10-26

    ... A Proclamation Sixty-five years ago, 51 nations came together in the aftermath of one of history's... all peoples. The United Nations has made great advances since it first developed out of ruin and... of nations. The United Nations' humanitarian assistance lifts up countless lives, supporting nations...

  16. Understanding "Romeo and Juliet": A Thematic Unit.

    Science.gov (United States)

    Koveleski, Erin

    This curriculum unit for Grade 9 combines the classic Shakespeare play "Romeo and Juliet" with three young adult novels: "The Outsiders" (S.E. Hinton), "Summer of My German Soldier" (Bette Greene), and "The Witch of Blackbird Pond" (Elizabeth George Speare). To complete the unit, all students will be…

  17. The Carnegie Unit: Past, Present, and Future

    Science.gov (United States)

    Silva, Elena; White, Taylor

    2015-01-01

    For more than a century, the Carnegie Unit has been the central organizing feature of American education. Translated into the "credit hour" in higher education (roughly, one hour of class time per week in a 14-16 week semester), this time-based unit is embedded in nearly every aspect of the system, from faculty-workload and…

  18. Improper colouring of (random) unit disk graphs

    NARCIS (Netherlands)

    Kang, R.J.; Müller, T.; Sereni, J.S.

    2008-01-01

    For any graph G, the k-improper chromatic number ¿k(G) is the smallest number of colours used in a colouring of G such that each colour class induces a subgraph of maximum degree k. We investigate ¿k for unit disk graphs and random unit disk graphs to generalise results of McDiarmid and Reed

  19. 28 CFR 0.1 - Organizational units.

    Science.gov (United States)

    2010-07-01

    ... Legal Policy. Office of Public Affairs. Office of the Pardon Attorney. Office of Special Counsel for Immigration Related Unfair Employment Practices. Community Relations Service. Executive Office for Immigration Review. Executive Office for United States Attorneys. Executive Office for United States Trustees...

  20. Chinese Dragons in an American Science Unit

    Science.gov (United States)

    Lew, Lee Yuen; McLure, John W.

    2005-01-01

    Can art and science find a happy home in the same unit? We think the answer is yes, if the central problem interests the students and allows them to try out multiple abilities. The sixth-grade unit described in this article, which we called "The Dragon Project," grew mainly from two roots, a study of ancient China and a later probe into…

  1. "Units of Comparison" across Languages, across Time

    Science.gov (United States)

    Thomas, Margaret

    2009-01-01

    Lardiere's keynote article adverts to a succession of "units of comparison" that have been employed in the study of cross-linguistic differences, including mid-twentieth-century structural patterns, generative grammar's parameters, and (within contemporary Minimalism) features. This commentary expands on the idea of units of cross-linguistic…

  2. The United Nations and Its Critics.

    Science.gov (United States)

    Menon, Bhaskar P.

    1989-01-01

    Provides a brief history of the development of the United Nations. Identifies achievements of the United Nations in the promotion of human rights, the translation of the Universal Declaration of Human Rights into binding international covenants, and the establishment of monitoring mechanisms to ensure the protection of human rights. (KO)

  3. SPOKEN AYACUCHO QUECHUA, UNITS 11-20.

    Science.gov (United States)

    PARKER, GARY J.; SOLA, DONALD F.

    THE ESSENTIALS OF AYACUCHO GRAMMAR WERE PRESENTED IN THE FIRST VOLUME OF THIS SERIES, SPOKEN AYACUCHO QUECHUA, UNITS 1-10. THE 10 UNITS IN THIS VOLUME (11-20) ARE INTENDED FOR USE IN AN INTERMEDIATE OR ADVANCED COURSE, AND PRESENT THE STUDENT WITH LENGTHIER AND MORE COMPLEX DIALOGS, CONVERSATIONS, "LISTENING-INS," AND DICTATIONS AS WELL…

  4. SPOKEN COCHABAMBA QUECHUA, UNITS 1-12.

    Science.gov (United States)

    LASTRA, YOLANDA; SOLA, DONALD F.

    THE FIRST OF TWO VOLUMES PREPARED FOR TEACHING THE COCHABAMBA DIALECT OF QUECHUA TO SPEAKERS OF ENGLISH, THIS DOCUMENT IS MADE UP OF 12 UNITS THAT COMPRISE A 6-WEEK INTENSIVE COURSE OF 20 CLASS HOURS A WEEK. EACH UNIT CONSISTS OF ONE OR MORE DIALOGS TO BE MEMORIZED, A DIALOG REVIEW, A SECTION ON GRAMMAR WITH ACCOMPANYING EXERCISES, CONVERSATION,…

  5. SPOKEN COCHABAMBA QUECHUA, UNITS 13-24.

    Science.gov (United States)

    LASTRA, YOLANDA; SOLA, DONALD F.

    UNITS 13-24 OF THE SPOKEN COCHABAMBA QUECHUA COURSE FOLLOW THE GENERAL FORMAT OF THE FIRST VOLUME (UNITS 1-12). THIS SECOND VOLUME IS INTENDED FOR USE IN AN INTERMEDIATE OR ADVANCED COURSE AND INCLUDES MORE COMPLEX DIALOGS, CONVERSATIONS, "LISTENING-INS," AND DICTATIONS, AS WELL AS GRAMMAR AND EXERCISE SECTIONS COVERING ADDITIONAL…

  6. Unit: Plants, Inspection Pack, National Trial Print.

    Science.gov (United States)

    Australian Science Education Project, Toorak, Victoria.

    This is a National Trial Print of a unit on plants produced as a part of the Australian Science Education Project. The unit consists of an information booklet for students, a booklet for recording student data, and a teacher's guide. The material, designed for use with students in the upper elementary grades, takes from 15 to 20 forty-minute…

  7. Unit 148 - World Wide Web Basics

    OpenAIRE

    148, CC in GIScience; Yeung, Albert K.

    2000-01-01

    This unit explains the characteristics and the working principles of the World Wide Web as the most important protocol of the Internet. Topics covered in this unit include characteristics of the World Wide Web; using the World Wide Web for the dissemination of information on the Internet; and using the World Wide Web for the retrieval of information from the Internet.

  8. Topology optimization of inertia driven dosing units

    DEFF Research Database (Denmark)

    Andreasen, Casper Schousboe

    2017-01-01

    This paper presents a methodology for optimizing inertia driven dosing units, sometimes referred to as eductors, for use in small scale flow applications. The unit is assumed to operate at low to moderate Reynolds numbers and under steady state conditions. By applying topology optimization...

  9. An Environmental Unit for the Social Studies.

    Science.gov (United States)

    Kroll, Claudia J.

    Based on the inquiry method of learning, this instructional unit attempts to encourage students to discover for themselves the facts, problems, values, conflicts, and potential solutions of an environmental issue. Specifically, it deals with surface mining in the United States, with special focus on surface mining in Illinois. Materials and…

  10. Stresses in Dolos Breakwater Armour Units

    DEFF Research Database (Denmark)

    Burcharth, H. F.; Liu, Z.

    1991-01-01

    Breakage of slender unreinforced armour unite is the cause of many breakwater failures. Design diagrams to ensure structural integrity of armour unite such as dolosse and tetrapods have not been available. The article presents results of an analysis of the stresses in dolosse based on model tests...

  11. Portable Power And Digital-Communication Units

    Science.gov (United States)

    Levin, Richard R.; Henry, Paul K.; Rosenberg, Leigh S.

    1992-01-01

    Conceptual network of electronic-equipment modules provides electrical power and digital radio communications at multiple sites not served by cables. System includes central communication unit and portable units powered by solar photovoltaic arrays. Useful to serve equipment that must be set up quickly at remote sites or buildings that cannot be modified to provide cable connections.

  12. Immigration Enforcement Within the United States

    Science.gov (United States)

    2006-04-06

    Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Policy Issues...Remained in the United States, (Washington: Center for Immigration Studies, May 2002). Immigration Enforcement Within the United States Introduction ...interior enforcement lack a border component. For example, fugitive taskforces, investigations of alien slavery and sweatshops , and employer sanctions do

  13. Socioeconomic Development Inequalities among Geographic Units ...

    African Journals Online (AJOL)

    Socio-economic development inequality among geographic units is a phenomenon common in both the developed and developing countries. Regional inequality may result in dissension among geographic units of the same state due to the imbalance in socio-economic development. This study examines the inequality ...

  14. 75 FR 25925 - United States Mint

    Science.gov (United States)

    2010-05-10

    ... Committee May 25, 2010 Public Meeting. SUMMARY: Pursuant to United States Code, Title 31, section 5135(b)(8... scheduled for May 25, 2010. Date: May 25, 2010. Time: 9 a.m. to 12 p.m. Location: 8th Floor Board Room, United States Mint, 801 9th Street, NW., Washington, DC 20220. Subject: Review and discuss obverse and...

  15. American Recovery and Reinvestment Act (ARRA) FEMP Technical Assistance for Geothermal Resource Evaluation Projects

    Energy Technology Data Exchange (ETDEWEB)

    Robert P. Breckenridge; Thomas R. Wood; Joel Renner

    2010-09-01

    The purpose of this document is to report on the evaluation of geothermal resource potential on and around three different United States (U. S.) Air Force Bases (AFBs): Nellis AFB and Air Force Range (AFR) in the State of Nevada (see maps 1 and 5), Holloman AFB in the State of New Mexico (see map 2), and Mountain Home AFB in the State of Idaho (see map 3). All three sites are located in semi-arid parts of the western U. S. The U. S. Air Force, through its Air Combat Command (ACC) located at Langley AFB in the State of Virginia, asked the Federal Energy Management Program (FEMP) for technical assistance to conduct technical and feasibility evaluations for the potential to identify viable geothermal resources on or around three different AFBs. Idaho National Laboratory (INL) is supporting FEMP in providing technical assistance to a number of different Federal Agencies. For this report, the three different AFBs are considered one project because they all deal with potential geothermal resource evaluations. The three AFBs will be evaluated primarily for their opportunity to develop a geothermal resource of high enough quality grade (i.e., temperature, productivity, depth, etc.) to consider the possibility for generation of electricity through a power plant. Secondarily, if the resource for the three AFBs is found to be not sufficient enough for electricity generation, then they will be described in enough detail to allow the base energy managers to evaluate if the resource is suitable for direct heating or cooling. Site visits and meetings by INL personnel with the staff at each AFB were held in late FY-2009 and FY-2010. This report provides a technical evaluation of the opportunities and challenges for developing geothermal resources on and around the AFBs. An extensive amount of literature and geographic information was evaluated as a part of this assessment. Resource potential maps were developed for each of the AFBs.

  16. Anti-Terrorism Authority Under the Laws of the United Kingdom and the United States

    National Research Council Canada - National Science Library

    Feikert, Clare; Doyle, Charles

    2006-01-01

    This is a comparison of the laws of the United Kingdom and of the United States that govern criminal and intelligence investigations of terrorist activities Both systems rely upon a series of statutory authorizations...

  17. Intelligent multi-unit disk controller

    International Nuclear Information System (INIS)

    Poirot, Lucien

    1982-01-01

    This controller has been designed as a link between a 16 bits minicomputer and two types of disks units interface: the SMD interface and an equivalent to the DRI unit interface. Four units of each type can be handled by the controller. A bit slice microprocessor controls the interface with the disks units. The maximum exchange rate is 8 megabits per second. A CRC feature has been provided for error detection. A 16 bits microprocessor implements the interface to the computer, assuring head positioning, the management of bad tracks, as well as the supervision of each transfer. A internal buffer memory allows an asynchronous dialogue with the computer. The implementation of the controller makes easy the adaptation to disks units of various types, and though it has been initially intended for a minicomputer of the MITRA type, its microprocessor based design makes it fitted to any minicomputer. (author) [fr

  18. A computer controlled tele-cobalt unit

    International Nuclear Information System (INIS)

    Brace, J.A.

    1982-01-01

    A computer controlled cobalt treatment unit was commissioned for treating patients in January 1980. Initially the controlling computer was a minicomputer, but now the control of the therapy unit is by a microcomputer. The treatment files, which specify the movement and configurations necessary to deliver the prescribed dose, are produced on the minicomputer and then transferred to the microcomputer using minitape cartridges. The actual treatment unit is based on a standard cobalt unit with a few additional features e.g. the drive motors can be controlled either by the computer or manually. Since the treatment unit is used for both manual and automatic treatments, the operational procedure under computer control is made to closely follow the manual procedure for a single field treatment. The necessary safety features which protect against human, hardware and software errors as well as the advantages and disadvantages of computer controlled radiotherapy are discussed

  19. Cultural traits as units of analysis.

    Science.gov (United States)

    O'Brien, Michael J; Lyman, R Lee; Mesoudi, Alex; VanPool, Todd L

    2010-12-12

    Cultural traits have long been used in anthropology as units of transmission that ostensibly reflect behavioural characteristics of the individuals or groups exhibiting the traits. After they are transmitted, cultural traits serve as units of replication in that they can be modified as part of an individual's cultural repertoire through processes such as recombination, loss or partial alteration within an individual's mind. Cultural traits are analogous to genes in that organisms replicate them, but they are also replicators in their own right. No one has ever seen a unit of transmission, either behavioural or genetic, although we can observe the effects of transmission. Fortunately, such units are manifest in artefacts, features and other components of the archaeological record, and they serve as proxies for studying the transmission (and modification) of cultural traits, provided there is analytical clarity over how to define and measure the units that underlie this inheritance process.

  20. Stroke Unit: General principles and standards

    Directory of Open Access Journals (Sweden)

    Mehmet Akif Topçuoğlu

    2015-04-01

    Full Text Available Evidence-based medicinal methods have convincingly shown that stroke unit approach reduces mortality and disability rates, improves the quality of life and economic burden resulting from acute ischemic and hemorrhagic stroke. Any contemporary stroke system of care cannot be successful without putting the stroke unit concept in the center of its organization. Stroke units are the main elements of primary and comprehensive stroke centers. As a modernization process, this article focuses on practical issues and suggestions related to integration of the stroke unit approach to a regionally organized stroke system of care for perusal by not only national health authorities and service providers, but also neurologists. Stroke unit quality metrics revisited herein are of critical importance for hospitals establishing or renovating primary and comprehensive stroke centers.