
Sample records for values aperiodic oscillatory

  1. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan


    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  2. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.


    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  3. Aperiodic order

    CERN Document Server

    Grimm, Uwe


    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  4. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean


    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  5. Quantifying Neural Oscillatory Synchronization: A Comparison between Spectral Coherence and Phase-Locking Value Approaches (United States)

    Lowet, Eric; Roberts, Mark J.; Bonizzi, Pietro; Karel, Joël; De Weerd, Peter


    Synchronization or phase-locking between oscillating neuronal groups is considered to be important for coordination of information among cortical networks. Spectral coherence is a commonly used approach to quantify phase locking between neural signals. We systematically explored the validity of spectral coherence measures for quantifying synchronization among neural oscillators. To that aim, we simulated coupled oscillatory signals that exhibited synchronization dynamics using an abstract phase-oscillator model as well as interacting gamma-generating spiking neural networks. We found that, within a large parameter range, the spectral coherence measure deviated substantially from the expected phase-locking. Moreover, spectral coherence did not converge to the expected value with increasing signal-to-noise ratio. We found that spectral coherence particularly failed when oscillators were in the partially (intermittent) synchronized state, which we expect to be the most likely state for neural synchronization. The failure was due to the fast frequency and amplitude changes induced by synchronization forces. We then investigated whether spectral coherence reflected the information flow among networks measured by transfer entropy (TE) of spike trains. We found that spectral coherence failed to robustly reflect changes in synchrony-mediated information flow between neural networks in many instances. As an alternative approach we explored a phase-locking value (PLV) method based on the reconstruction of the instantaneous phase. As one approach for reconstructing instantaneous phase, we used the Hilbert Transform (HT) preceded by Singular Spectrum Decomposition (SSD) of the signal. PLV estimates have broad applicability as they do not rely on stationarity, and, unlike spectral coherence, they enable more accurate estimations of oscillatory synchronization across a wide range of different synchronization regimes, and better tracking of synchronization-mediated information

  6. Quantifying Neural Oscillatory Synchronization: A Comparison between Spectral Coherence and Phase-Locking Value Approaches.

    Directory of Open Access Journals (Sweden)

    Eric Lowet

    Full Text Available Synchronization or phase-locking between oscillating neuronal groups is considered to be important for coordination of information among cortical networks. Spectral coherence is a commonly used approach to quantify phase locking between neural signals. We systematically explored the validity of spectral coherence measures for quantifying synchronization among neural oscillators. To that aim, we simulated coupled oscillatory signals that exhibited synchronization dynamics using an abstract phase-oscillator model as well as interacting gamma-generating spiking neural networks. We found that, within a large parameter range, the spectral coherence measure deviated substantially from the expected phase-locking. Moreover, spectral coherence did not converge to the expected value with increasing signal-to-noise ratio. We found that spectral coherence particularly failed when oscillators were in the partially (intermittent synchronized state, which we expect to be the most likely state for neural synchronization. The failure was due to the fast frequency and amplitude changes induced by synchronization forces. We then investigated whether spectral coherence reflected the information flow among networks measured by transfer entropy (TE of spike trains. We found that spectral coherence failed to robustly reflect changes in synchrony-mediated information flow between neural networks in many instances. As an alternative approach we explored a phase-locking value (PLV method based on the reconstruction of the instantaneous phase. As one approach for reconstructing instantaneous phase, we used the Hilbert Transform (HT preceded by Singular Spectrum Decomposition (SSD of the signal. PLV estimates have broad applicability as they do not rely on stationarity, and, unlike spectral coherence, they enable more accurate estimations of oscillatory synchronization across a wide range of different synchronization regimes, and better tracking of synchronization

  7. Aperiodic Volume Optics (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  8. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang


    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  9. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)


    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  10. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09) (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj


    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  11. Simulation of aperiodic bipedal sprinting. (United States)

    Celik, Huseyin; Piazza, Stephen J


    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  12. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.


    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue


    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  15. A nonlinear oscillatory problem

    International Nuclear Information System (INIS)

    Zhou Qingqing.


    We have studied the nonlinear oscillatory problem of orthotropic cylindrical shell, we have analyzed the character of the oscillatory system. The stable condition of the oscillatory system has been given. (author). 6 refs

  16. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics. (United States)

    Lin, Chenxi; Povinelli, Michelle L


    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  17. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  18. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.


    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  19. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović


    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  20. Aperiodicity Correction for Rotor Tip Vortex Measurements (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.


    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  1. A Trigonometrically Fitted Block Method for Solving Oscillatory Second-Order Initial Value Problems and Hamiltonian Systems

    Directory of Open Access Journals (Sweden)

    F. F. Ngwane


    Full Text Available In this paper, we present a block hybrid trigonometrically fitted Runge-Kutta-Nyström method (BHTRKNM, whose coefficients are functions of the frequency and the step-size for directly solving general second-order initial value problems (IVPs, including Hamiltonian systems such as the energy conserving equations and systems arising from the semidiscretization of partial differential equations (PDEs. Four discrete hybrid formulas used to formulate the BHTRKNM are provided by a continuous one-step hybrid trigonometrically fitted method with an off-grid point. We implement BHTRKNM in a block-by-block fashion; in this way, the method does not suffer from the disadvantages of requiring starting values and predictors which are inherent in predictor-corrector methods. The stability property of the BHTRKNM is discussed and the performance of the method is demonstrated on some numerical examples to show accuracy and efficiency advantages.

  2. A Trigonometrically Fitted Block Method for Solving Oscillatory Second-Order Initial Value Problems and Hamiltonian Systems


    Ngwane, F. F.; Jator, S. N.


    In this paper, we present a block hybrid trigonometrically fitted Runge-Kutta-Nyström method (BHTRKNM), whose coefficients are functions of the frequency and the step-size for directly solving general second-order initial value problems (IVPs), including Hamiltonian systems such as the energy conserving equations and systems arising from the semidiscretization of partial differential equations (PDEs). Four discrete hybrid formulas used to formulate the BHTRKNM are provided by a continuous one...

  3. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)


    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  4. Oscillatory systems in mitochondria

    Energy Technology Data Exchange (ETDEWEB)

    Gooch, V D; Packer, L


    Comparison of known mitochondrial oscillatory systems suggest that they all have a common mechanism. Investigation of the requirements of these various systems reveals a common set of basic features that indicate ion-transport processes to be the key components mediating oscillatory behavior. These ion-transport processes include (a) a diffusional transport of a cation and a H/sup +/, (b) a diffusional, non-ionic, coupled transport of a H/sup +/ with a weak acid anion, and (c) an energy-linked H/sup +/ transport. To adequately describe the oscillatory phenomenon, however, it is necessary to consider also the presence of (a) nonlinear concentration profiles of one or more ions within the membrane and its unstirred layers, and (b) feedback loops developed as a result of molecular conformational changes or membrane structural changes affecting ionic flows, each having a major influence on the other.

  5. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina


    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  6. A method to identify aperiodic disturbances in the ionosphere (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.


    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  7. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech


    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  8. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics. (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L


    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  9. Strobes: An oscillatory combustion

    NARCIS (Netherlands)

    Corbel, J.M.L.; Lingen, J.N.J. van; Zevenbergen, J.F.; Gijzeman, O.L.J.; Meijerink, A.


    Strobe compositions belong to the class of solid combustions. They are mixtures of powdered ingredients. When ignited, the combustion front evolves in an oscillatory fashion, and flashes of light are produced by intermittence. They have fascinated many scientists since their discovery at the

  10. Emergence of Oscillatory Dynamics

    DEFF Research Database (Denmark)

    Laugesen, Jakob Lund; Mosekilde, Erik


    Besides their systems nature, as described in the preceding chapters, the single most characteristic feature of a living organism is the self-sustained activity it displays in the form of a wide variety of different oscillatory processes [25, 9, 22, 23]. The respiratory cycle and the beating...

  11. Design principles for robust oscillatory behavior. (United States)

    Castillo-Hair, Sebastian M; Villota, Elizabeth R; Coronado, Alberto M


    Oscillatory responses are ubiquitous in regulatory networks of living organisms, a fact that has led to extensive efforts to study and replicate the circuits involved. However, to date, design principles that underlie the robustness of natural oscillators are not completely known. Here we study a three-component enzymatic network model in order to determine the topological requirements for robust oscillation. First, by simulating every possible topological arrangement and varying their parameter values, we demonstrate that robust oscillators can be obtained by augmenting the number of both negative feedback loops and positive autoregulations while maintaining an appropriate balance of positive and negative interactions. We then identify network motifs, whose presence in more complex topologies is a necessary condition for obtaining oscillatory responses. Finally, we pinpoint a series of simple architectural patterns that progressively render more robust oscillators. Together, these findings can help in the design of more reliable synthetic biomolecular networks and may also have implications in the understanding of other oscillatory systems.

  12. Synchronization in oscillatory networks

    CERN Document Server

    Osipov, Grigory V; Zhou, Changsong


    The formation of collective behavior in large ensembles or networks of coupled oscillatory elements is one of the oldest and most fundamental aspects of dynamical systems theory. Potential and present applications span a vast spectrum of fields ranging from physics, chemistry, geoscience, through life- and neurosciences to engineering, the economic and the social sciences. This work systematically investigates a large number of oscillatory network configurations that are able to describe many real systems such as electric power grids, lasers or the heart muscle - to name but a few. This book is conceived as an introduction to the field for graduate students in physics and applied mathematics as well as being a compendium for researchers from any field of application interested in quantitative models.

  13. Inferring oscillatory modulation in neural spike trains. (United States)

    Arai, Kensuke; Kass, Robert E


    Oscillations are observed at various frequency bands in continuous-valued neural recordings like the electroencephalogram (EEG) and local field potential (LFP) in bulk brain matter, and analysis of spike-field coherence reveals that spiking of single neurons often occurs at certain phases of the global oscillation. Oscillatory modulation has been examined in relation to continuous-valued oscillatory signals, and independently from the spike train alone, but behavior or stimulus triggered firing-rate modulation, spiking sparseness, presence of slow modulation not locked to stimuli and irregular oscillations with large variability in oscillatory periods, present challenges to searching for temporal structures present in the spike train. In order to study oscillatory modulation in real data collected under a variety of experimental conditions, we describe a flexible point-process framework we call the Latent Oscillatory Spike Train (LOST) model to decompose the instantaneous firing rate in biologically and behaviorally relevant factors: spiking refractoriness, event-locked firing rate non-stationarity, and trial-to-trial variability accounted for by baseline offset and a stochastic oscillatory modulation. We also extend the LOST model to accommodate changes in the modulatory structure over the duration of the experiment, and thereby discover trial-to-trial variability in the spike-field coherence of a rat primary motor cortical neuron to the LFP theta rhythm. Because LOST incorporates a latent stochastic auto-regressive term, LOST is able to detect oscillations when the firing rate is low, the modulation is weak, and when the modulating oscillation has a broad spectral peak.


    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)


    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.


    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie


    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  16. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan


    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  17. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system (United States)

    Kumar, Pawan; Parmananda, P.


    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  18. Identifying the Oscillatory Mechanism of the Glucose Oxidase-Catalase Coupled Enzyme System. (United States)

    Muzika, František; Jurašek, Radovan; Schreiberová, Lenka; Radojković, Vuk; Schreiber, Igor


    We provide experimental evidence of periodic and aperiodic oscillations in an enzymatic system of glucose oxidase-catalase in a continuous-flow stirred reactor coupled by a membrane with a continuous-flow reservoir supplied with hydrogen peroxide. To describe such dynamics, we formulate a detailed mechanism based on partial results in the literature. Finally, we introduce a novel method for estimation of unknown kinetic parameters. The method is based on matching experimental data at an oscillatory instability with stoichiometric constraints of the mechanism formulated by applying the stability theory of reaction networks. This approach has been used to estimate rate coefficients in the catalase part of the mechanism. Remarkably, model simulations show good agreement with the observed oscillatory dynamics, including apparently chaotic intermittent behavior. Our method can be applied to any reaction system with an experimentally observable dynamical instability.

  19. Oscillatory processes in plasma

    International Nuclear Information System (INIS)

    Gallin, E.


    The oscillatory process play an important part in plasma evolution, In hot plasma in particular, the interactions between the oscillation modes are preponderant in relation to the binary collisions between particles. The nonlineary interactions between collective plasma oscillations can generate, in this case, a non-balanced steady state of plasma (steady turbulence). The paper elucidates some aspects of the oscillatory phenomena which contribute to the plasma state evolution, especially of hot plasma. A major part of the paper is devoted to the study of parametric instabilities in plasma and their role in increasing the temperature of plasma components (electrons, ions). Both parametric instabilities in plasma in the vicinity of thermodynamic balance and parametric processes is steady turbulent plasma are analysed - in relation to additional heating of hot plasma. An important result of the thesis refers to the drowing-up of a non-lineary interaction model between the oscillation modes in turbulent plasma, being responsible for the electromagnetic radiation in hot plasma. On the basis of the model suggested in the paper the existence of a low frequency radiative mode in hot plasma in a turbulent state, can be demonstrated. Its frequency could be even lower than plasma frequency in the field of long waves be even lower than plasma frequency in the field of long waves. Such a radiative mode was detected experimentally in focussed plasma installations. (author)

  20. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen


    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  1. High Frequency Oscillatory Ventilation

    Directory of Open Access Journals (Sweden)

    AC Bryan


    Full Text Available High frequency oscillatory (HFO ventilation using low tidal volume and peak airway pressures is extremely efficient at eliminating carbon dioxide and raising pH in the newborn infant with acute respiratory failure. Improvement in oxygenation requires a strategy of sustained or repetitive inflations to 25 to 30 cm H2O in order to place the lung on the deflation limb of the pressure-volume curve. This strategy has also been shown to decrease the amount of secondary lung injury in animal models. Experience of the use of HFO ventilation as a rescue therapy as well as several published controlled trials have shown improved outcomes and a decrease in the use of extracorporeal membrane oxygenation when it has been used in newborns.

  2. Oscillatory flow chemical reactors

    Directory of Open Access Journals (Sweden)

    Slavnić Danijela S.


    Full Text Available Global market competition, increase in energy and other production costs, demands for high quality products and reduction of waste are forcing pharmaceutical, fine chemicals and biochemical industries, to search for radical solutions. One of the most effective ways to improve the overall production (cost reduction and better control of reactions is a transition from batch to continuous processes. However, the reactions of interests for the mentioned industry sectors are often slow, thus continuous tubular reactors would be impractically long for flow regimes which provide sufficient heat and mass transfer and narrow residence time distribution. The oscillatory flow reactors (OFR are newer type of tube reactors which can offer solution by providing continuous operation with approximately plug flow pattern, low shear stress rates and enhanced mass and heat transfer. These benefits are the result of very good mixing in OFR achieved by vortex generation. OFR consists of cylindrical tube containing equally spaced orifice baffles. Fluid oscillations are superimposed on a net (laminar flow. Eddies are generated when oscillating fluid collides with baffles and passes through orifices. Generation and propagation of vortices create uniform mixing in each reactor cavity (between baffles, providing an overall flow pattern which is close to plug flow. Oscillations can be created by direct action of a piston or a diaphragm on fluid (or alternatively on baffles. This article provides an overview of oscillatory flow reactor technology, its operating principles and basic design and scale - up characteristics. Further, the article reviews the key research findings in heat and mass transfer, shear stress, residence time distribution in OFR, presenting their advantages over the conventional reactors. Finally, relevant process intensification examples from pharmaceutical, polymer and biofuels industries are presented.

  3. Oscillatory solutions of the Cauchy problem for linear differential equations

    Directory of Open Access Journals (Sweden)

    Gro Hovhannisyan


    Full Text Available We consider the Cauchy problem for second and third order linear differential equations with constant complex coefficients. We describe necessary and sufficient conditions on the data for the existence of oscillatory solutions. It is known that in the case of real coefficients the oscillatory behavior of solutions does not depend on initial values, but we show that this is no longer true in the complex case: hence in practice it is possible to control oscillatory behavior by varying the initial conditions. Our Proofs are based on asymptotic analysis of the zeros of solutions, represented as linear combinations of exponential functions.

  4. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)


    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  5. Non-commutative Chern numbers for generic aperiodic discrete systems (United States)

    Bourne, Chris; Prodan, Emil


    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  6. Encapsulation Efficiency, Oscillatory Rheometry

    Directory of Open Access Journals (Sweden)

    Z. Mohammad Hassani


    Full Text Available Nanoliposomes are one of the most important polar lipid-based nanocarriers which can be used for encapsulation of both hydrophilic and hydrophobic active compounds. In this research, nanoliposomes based on lecithin-polyethylene glycol-gamma oryzanol were prepared by using a modified thermal method. Only one melting peak in DSC curve of gamma oryzanol bearing liposomes was observed which could be attributed to co-crystallization of both compounds. The addition of gamma oryzanol, caused to reduce the melting point of 5% (w/v lecithin-based liposome from 207°C to 163.2°C. At high level of lecithin, increasing of liposome particle size (storage at 4°C for two months was more obvious and particle size increased from 61 and 113 to 283 and 384 nanometers, respectively. The encapsulation efficiency of gamma oryzanol increased from 60% to 84.3% with increasing lecithin content. The encapsulation stability of oryzanol in liposome was determined at different concentrations of lecithin 3, 5, 10, 20% (w/v and different storage times (1, 7, 30 and 60 days. In all concentrations, the encapsulation stability slightly decreased during 30 days storage. The scanning electron microscopy (SEM images showed relatively spherical to elliptic particles which indicated to low extent of particles coalescence. The oscillatory rheometry showed that the loss modulus of liposomes were higher than storage modulus and more liquid-like behavior than solid-like behavior. The samples storage at 25°C for one month, showed higher viscoelastic parameters than those having been stored at 4°C which were attributed to higher membrane fluidity at 25°C and their final coalescence.Nanoliposomes are one of the most important polar lipid based nanocarriers which can be used for encapsulation of both hydrophilic and hydrophobic active compounds. In this research, nanoliposomes based on lecithin-polyethylene glycol-gamma oryzanol were prepared by using modified thermal method. Only one

  7. Aperiodic nanoplasmonic devices for directional colour filtering and sensing. (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit


    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  8. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá


    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  9. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  10. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin


    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  11. Oscillatory integration windows in neurons (United States)

    Gupta, Nitin; Singh, Swikriti Saran; Stopfer, Mark


    Oscillatory synchrony among neurons occurs in many species and brain areas, and has been proposed to help neural circuits process information. One hypothesis states that oscillatory input creates cyclic integration windows: specific times in each oscillatory cycle when postsynaptic neurons become especially responsive to inputs. With paired local field potential (LFP) and intracellular recordings and controlled stimulus manipulations we directly test this idea in the locust olfactory system. We find that inputs arriving in Kenyon cells (KCs) sum most effectively in a preferred window of the oscillation cycle. With a computational model, we show that the non-uniform structure of noise in the membrane potential helps mediate this process. Further experiments performed in vivo demonstrate that integration windows can form in the absence of inhibition and at a broad range of oscillation frequencies. Our results reveal how a fundamental coincidence-detection mechanism in a neural circuit functions to decode temporally organized spiking. PMID:27976720

  12. Advantages of Oscillatory Hydraulic Tomography (United States)

    Kitanidis, P. K.; Bakhos, T.; Cardiff, M. A.; Barrash, W.


    Characterizing the subsurface is significant for most hydrogeologic studies, such as those involving site remediation and groundwater resource explo¬ration. A variety of hydraulic and geophysical methods have been developed to estimate hydraulic conductivity and specific storage. Hydraulic methods based on the analysis of conventional pumping tests allow the estimation of conductivity and storage without need for approximate petrophysical relations, which is an advantage over most geophysical methods that first estimate other properties and then infer values of hydraulic parameters. However, hydraulic methods have the disadvantage that the head-change signal decays with distance from the pumping well and thus becomes difficult to separate from noise except in close proximity to the source. Oscillatory hydraulic tomography (OHT) is an emerging technology to im¬age the subsurface. This method utilizes the idea of imposing sinusoidally varying pressure or discharge signals at several points, collecting head observations at several other points, and then processing these data in a tomographic fashion to estimate conductivity and storage coefficients. After an overview of the methodology, including a description of the most important potential advantages and challenges associated with this approach, two key promising features of the approach will be discussed. First, the signal at an observation point is orthogonal to and thus can be separated from nuisance inputs like head fluctuation from production wells, evapotranspiration, irrigation, and changes in the level of adjacent streams. Second, although the signal amplitude may be weak, one can extract the phase and amplitude of the os¬cillatory signal by collecting measurements over a longer time, thus compensating for the effect of large distance through longer sampling period.


    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.


    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism


    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)


    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  15. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.


    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  16. Unstable oscillatory Pierce modes of neutralized electron beams

    International Nuclear Information System (INIS)

    Cary, J.R.; Lemons, D.S.


    Oscillatory modes of the Pierce system have been calculated. These modes are found to have growth rates comparable to the previously investigated purely growing modes. When these modes are included, it is found that the Pierce system is unstable for most values of ω/sub p/ L/V 0 >π

  17. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue


    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  18. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  19. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B


    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  20. Excito-oscillatory dynamics as a mechanism of ventricular fibrillation. (United States)

    Gray, Richard A; Huelsing, Delilah J


    The instabilities associated with reentrant spiral waves are of paramount importance to the initiation and maintenance of tachyarrhythmias, especially ventricular fibrillation (VF). In addition to tissue heterogeneities, there are only a few basic purported mechanisms of spiral wave breakup, most notably restitution. We test the hypothesis that oscillatory membrane properties act to destabilize spiral waves. We recorded transmembrane potential (V(m)) from isolated rabbit myocytes using a constant current stimulation protocol. We developed a mathematical model that included both the stable excitable equilibrium point at resting V(m) (-80 mV) and the unstable oscillatory equilibrium point at elevated V(m) (-10 mV). Spiral wave dynamics were studied in 2-dimensional grids using variants of the model. All models showed restitution and reproduced the experimental values of transmembrane resistance at rest and during the action potential plateau. Stable spiral waves were observed when the model showed only 1 equilibrium point. However, spatio-temporal complexity was observed if the model showed both excitable and oscillatory equilibrium points (i.e., excito-oscillatory models). The initial wave breaks resulted from oscillatory waves expanding in all directions; after a few beats, the patterns were characterized by a combination of unstable spiral waves and target patterns consistent with the patterns observed on the heart surface during VF. In our model, this VF-like activity only occurred when the single cell period of V(m) oscillations was within a specific range. The VF-like patterns observed in our excito-oscillatory models could not be explained by the existing proposed instability mechanisms. Our results introduce the important suggestion that membrane dynamics responsible for V(m) oscillations at elevated V(m) levels can destabilize spiral waves and thus may be a novel therapeutic target for preventing VF.

  1. Localized Oscillatory Energy Conversion in Magnetopause Reconnection (United States)

    Burch, J. L.; Ergun, R. E.; Cassak, P. A.; Webster, J. M.; Torbert, R. B.; Giles, B. L.; Dorelli, J. C.; Rager, A. C.; Hwang, K.-J.; Phan, T. D.; Genestreti, K. J.; Allen, R. C.; Chen, L.-J.; Wang, S.; Gershman, D.; Le Contel, O.; Russell, C. T.; Strangeway, R. J.; Wilder, F. D.; Graham, D. B.; Hesse, M.; Drake, J. F.; Swisdak, M.; Price, L. M.; Shay, M. A.; Lindqvist, P.-A.; Pollock, C. J.; Denton, R. E.; Newman, D. L.


    Data from the NASA Magnetospheric Multiscale mission are used to investigate asymmetric magnetic reconnection at the dayside boundary between the Earth's magnetosphere and the solar wind. High-resolution measurements of plasmas and fields are used to identify highly localized ( 15 electron Debye lengths) standing wave structures with large electric field amplitudes (up to 100 mV/m). These wave structures are associated with spatially oscillatory energy conversion, which appears as alternatingly positive and negative values of J · E. For small guide magnetic fields the wave structures occur in the electron stagnation region at the magnetosphere edge of the electron diffusion region. For larger guide fields the structures also occur near the reconnection X-line. This difference is explained in terms of channels for the out-of-plane current (agyrotropic electrons at the stagnation point and guide field-aligned electrons at the X-line).

  2. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde


    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  3. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob


    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  4. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.


    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  5. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.


    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  6. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.


    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  7. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)


    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  8. Oscillatory Reinstatement Enhances Declarative Memory. (United States)

    Javadi, Amir-Homayoun; Glen, James C; Halkiopoulos, Sara; Schulz, Mei; Spiers, Hugo J


    Declarative memory recall is thought to involve the reinstatement of neural activity patterns that occurred previously during encoding. Consistent with this view, greater similarity between patterns of activity recorded during encoding and retrieval has been found to predict better memory performance in a number of studies. Recent models have argued that neural oscillations may be crucial to reinstatement for successful memory retrieval. However, to date, no causal evidence has been provided to support this theory, nor has the impact of oscillatory electrical brain stimulation during encoding and retrieval been assessed. To explore this we used transcranial alternating current stimulation over the left dorsolateral prefrontal cortex of human participants [ n = 70, 45 females; age mean (SD) = 22.12 (2.16)] during a declarative memory task. Participants received either the same frequency during encoding and retrieval (60-60 or 90-90 Hz) or different frequencies (60-90 or 90-60 Hz). When frequencies matched there was a significant memory improvement (at both 60 and 90 Hz) relative to sham stimulation. No improvement occurred when frequencies mismatched. Our results provide support for the role of oscillatory reinstatement in memory retrieval. SIGNIFICANCE STATEMENT Recent neurobiological models of memory have argued that large-scale neural oscillations are reinstated to support successful memory retrieval. Here we used transcranial alternating current stimulation (tACS) to test these models. tACS has recently been shown to induce neural oscillations at the frequency stimulated. We stimulated over the left dorsolateral prefrontal cortex during a declarative memory task involving learning a set of words. We found that tACS applied at the same frequency during encoding and retrieval enhances memory. We also find no difference between the two applied frequencies. Thus our results are consistent with the proposal that reinstatement of neural oscillations during retrieval

  9. Oscillatory serotonin function in depression. (United States)

    Salomon, Ronald M; Cowan, Ronald L


    Oscillations in brain activities with periods of minutes to hours may be critical for normal mood behaviors. Ultradian (faster than circadian) rhythms of mood behaviors and associated central nervous system activities are altered in depression. Recent data suggest that ultradian rhythms in serotonin (5HT) function also change in depression. In two separate studies, 5HT metabolites in cerebrospinal fluid (CSF) were measured every 10 min for 24 h before and after chronic antidepressant treatment. Antidepressant treatments were associated with enhanced ultradian amplitudes of CSF metabolite levels. Another study used resting-state functional magnetic resonance imaging (fMRI) to measure amplitudes of dorsal raphé activation cycles following sham or active dietary depletions of the 5HT precursor (tryptophan). During depletion, amplitudes of dorsal raphé activation cycles increased with rapid 6 s periods (about 0.18 Hz) while functional connectivity weakened between dorsal raphé and thalamus at slower periods of 20 s (0.05 Hz). A third approach studied MDMA (ecstasy, 3,4-methylenedioxy-N-methylamphetamine) users because of their chronically diminished 5HT function compared with non-MDMA polysubstance users (Karageorgiou et al., 2009). Compared with a non-MDMA using cohort, MDMA users showed diminished fMRI intra-regional coherence in motor regions along with altered functional connectivity, again suggesting effects of altered 5HT oscillatory function. These data support a hypothesis that qualities of ultradian oscillations in 5HT function may critically influence moods and behaviors. Dysfunctional 5HT rhythms in depression may be a common endpoint and biomarker for depression, linking dysfunction of slow brain network oscillators to 5HT mechanisms affected by commonly available treatments. 5HT oscillatory dysfunction may define illness subtypes and predict responses to serotonergic agents. Further studies of 5HT oscillations in depression are indicated. Copyright

  10. Bifurcations of propellant burning rate at oscillatory pressure

    Energy Technology Data Exchange (ETDEWEB)

    Novozhilov, Boris V. [N. N. Semenov Institute of Chemical Physics, Russian Academy of Science, 4 Kosygina St., Moscow 119991 (Russian Federation)


    A new phenomenon, the disparity between pressure and propellant burning rate frequencies, has revealed in numerical studies of propellant burning rate response to oscillatory pressure. As is clear from the linear approximation, under small pressure amplitudes, h, pressure and propellant burning rate oscillations occur with equal period T (T-solution). In the paper, however, it is shown that at a certain critical value of the parameter h the system in hand undergoes a bifurcation so that the T-solution converts to oscillations with period 2T (2T-solution). When the bifurcation parameter h increases, the subsequent behavior of the system becomes complicated. It is obtained a sequence of period doubling to 4T-solution and 8T-solution. Beyond a certain value of the bifurcation parameter h an apparently fully chaotic solution is found. These effects undoubtedly should be taken into account in studies of oscillatory processes in combustion chambers. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  11. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob


    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  12. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li


    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  13. Disk partition function and oscillatory rolling tachyons

    International Nuclear Information System (INIS)

    Jokela, Niko; Jaervinen, Matti; Keski-Vakkuri, Esko; Majumder, Jaydeep


    An exact cubic open string field theory rolling tachyon solution was recently found by Kiermaier et al and Schnabl. This oscillatory solution has been argued to be related by a field redefinition to the simple exponential rolling tachyon deformation of boundary conformal theory. In the latter approach, the disk partition function takes a simple form. Out of curiosity, we compute the disk partition function for an oscillatory tachyon profile, and find that the result is nevertheless almost the same

  14. Characterization of Oscillatory Lift in MFC Airfoils


    Lang Jr, Joseph Reagle


    The purpose of this research is to characterize the response of an airfoil with an oscillatory morphing, Macro-fiber composite (MFC) trailing edge. Correlation of the airfoil lift with the oscillatory input is presented. Modal analysis of the test airfoil and apparatus is used to determine the frequency response function. The effects of static MFC inputs on the FRF are presented and compared to the unactuated airfoil. The transfer function is then used to determine the lift component du...

  15. Acoustic transmittance of an aperiodic deterministic multilayer structure

    International Nuclear Information System (INIS)

    Madrigal-Melchor, J; Enciso-Muñoz, A; Contreras-Solorio, D A


    We study theoretically the acoustic transmission for a multilayer structure where the characteristic acoustic impedance follows the values generated by the self-similar sequence called the 1 s counting sequence . The transmission spectrum shows clearly self-similarity characteristics.

  16. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise? (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D


    ways) manually controlled two systems (1st and 2nd order) subject to a periodic multi-sine disturbance. Joystick power was analysed using three models, continuous-linear-control (CC), continuous-linear-control with calculated noise spectrum (CCN), and intermittent control with aperiodic sampling triggered by prediction error thresholds (IC). Unlike the linear mechanism, the intermittent control mechanism explained the majority of total power (linear and remnant) (77-87% vs. 8-48%, IC vs. CC). Between conditions, IC used thresholds and distributions of open loop intervals consistent with, respectively, instructions and previous measured, model independent values; whereas CCN required changes in noise spectrum deviating from broadband, signal dependent noise. We conclude that manual tracking uses open loop predictive control with aperiodic sampling. Because aperiodic sampling is inherent to serial decision making within previously identified, specific frontal, striatal and parietal networks we suggest that these structures are intimately involved in visuo-manual tracking. © 2017 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  17. Microfluidic mixing through oscillatory transverse perturbations (United States)

    Wu, J. W.; Xia, H. M.; Zhang, Y. Y.; Zhu, P.


    Fluid mixing in miniaturized fluidic devices is a challenging task. In this work, the mixing enhancement through oscillatory transverse perturbations coupling with divergent circular chambers is studied. To simplify the design, an autonomous microfluidic oscillator is used to produce the oscillatory flow. It is then applied to four side-channels that intersect with a central channel of constant flow. The mixing performance is tested at high fluid viscosities of up to 16 cP. Results show that the oscillatory flow can cause strong transverse perturbations which effectively enhance the mixing. The influence of a fluidic capacitor in the central channel is also examined, which at low viscosities can intensify the perturbations and further improve the mixing.

  18. Catalyst Initiation in the Oscillatory Carbonylation Reaction

    Directory of Open Access Journals (Sweden)

    Katarina Novakovic


    Full Text Available Palladium(II iodide is used as a catalyst in the phenylacetylene oxidative carbonylation reaction that has demonstrated oscillatory behaviour in both pH and heat of reaction. In an attempt to extract the reaction network responsible for the oscillatory nature of this reaction, the system was divided into smaller parts and they were studied. This paper focuses on understanding the reaction network responsible for the initial reactions of palladium(II iodide within this oscillatory reaction. The species researched include methanol, palladium(II iodide, potassium iodide, and carbon monoxide. Several chemical reactions were considered and applied in a modelling study. The study revealed the significant role played by traces of water contained in the standard HPLC grade methanol used.

  19. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  20. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong


    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  1. Optimized emission in nanorod arrays through quasi-aperiodic inverse design. (United States)

    Anderson, P Duke; Povinelli, Michelle L


    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  2. Oscillatory regime of avalanche particle detectors

    International Nuclear Information System (INIS)

    Lukin, K.A.; Cerdeira, H.A.; Colavita, A.A.


    We describe the model of an avalanche high energy particle detector consisting of two pn-junctions, connected through an intrinsic semiconductor with a reverse biased voltage applied. We show that this detector is able to generate the oscillatory response on the single particle passage through the structure. The possibility of oscillations leading to chaotic behaviour is pointed out. (author). 15 refs, 7 figs

  3. Combinations of response-reinforcer relations in periodic and aperiodic schedules. (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E


    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  4. Aperiodic linear networked control considering variable channel delays: application to robots coordination. (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel


    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  5. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos


    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  6. Bistable flapping of flexible flyers in oscillatory flow (United States)

    Huang, Yangyang; Kanso, Eva


    Biological and bio-inspired flyers move by shape actuation. The direct control of shape variables for locomotory purposes is well studied. Less is known about indirect shape actuation via the fluid medium. Here, we consider a flexible Λ-flyer in oscillatory flow that is free to flap and rotate around its fixed apex. We study its motion in the context of the inviscid vortex sheet model. We first analyze symmetric flapping about the vertical axis of gravity. We find that there is a finite value of the flexibility that maximizes both the flapping amplitude and elastic energy storage. Our results show that rather than resonance, the flyer relies on fluidic effects to optimize these two quantities. We then perturb the flyer away from the vertical and analyze its stability. Four distinct types of rolling behavior are identified: mono-stable, bistable, bistable oscillatory rotations and chaotic dynamics. We categorize these types of behavior in terms of the flyer's and flow parameters. In particular, the transition from mono-stable to bistable behavior occurs at a constant value of the product of the flow amplitude and acceleration. This product can be interpreted as the ratio of fluidic drag to gravity, confirming the fluid role in this transition.

  7. Dynamic behavior of the bray-liebhafsky oscillatory reaction controlled by sulfuric acid and temperature (United States)

    Pejić, N.; Vujković, M.; Maksimović, J.; Ivanović, A.; Anić, S.; Čupić, Ž.; Kolar-Anić, Lj.


    The non-periodic, periodic and chaotic regimes in the Bray-Liebhafsky (BL) oscillatory reaction observed in a continuously fed well stirred tank reactor (CSTR) under isothermal conditions at various inflow concentrations of the sulfuric acid were experimentally studied. In each series (at any fixed temperature), termination of oscillatory behavior via saddle loop infinite period bifurcation (SNIPER) as well as some kind of the Andronov-Hopf bifurcation is presented. In addition, it was found that an increase of temperature, in different series of experiments resulted in the shift of bifurcation point towards higher values of sulfuric acid concentration.

  8. The role of high-frequency oscillatory activity in reward processing and learning. (United States)

    Marco-Pallarés, Josep; Münte, Thomas F; Rodríguez-Fornells, Antoni


    Oscillatory activity has been proposed as a key mechanism in the integration of brain activity of distant structures. Particularly, high frequency brain oscillatory activity in the beta and gamma range has received increasing interest in the domains of attention and memory. In addition, a number of recent studies have revealed an increase of beta-gamma activity (20-35 Hz) after unexpected or relevant positive reward outcomes. In the present manuscript we review the literature on this phenomenon and we propose that this activity is a brain signature elicited by unexpected positive outcomes in order to transmit a fast motivational value signal to the reward network. In addition, we hypothesize that beta-gamma oscillatory activity indexes the interaction between attentional and emotional systems, and that it directly reflects the appearance of unexpected positive rewards in learning-related contexts. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Stability of Armour Units in Oscillatory Flow

    DEFF Research Database (Denmark)

    Burcharth, Hans F.; Thompson, A. C.

    Despite numerous breakwater model tests very little is known today about the various phenomena and parameters that determine the hydraulic stability characteristics of different types of armour. This is because separation of parameters is extremely difficult in traditional tests.With the object...... of separating some of the factors a deterministic test, in which horizontal beds of armour units were exposed to oscillatory flow, was performed in a pulsating water tunnel....

  10. Oscillatory Convection in Rotating Liquid Metals (United States)

    Bertin, Vincent; Grannan, Alex; Aurnou, Jonathan


    We have performed laboratory experiments in a aspect ratio Γ = 2 cylinder using liquid gallium (Pr = 0 . 023) as the working fluid. The Ekman number varies from E = 4 ×10-5 to 4 ×10-6 and the Rayleigh number varies from Ra = 3 ×105 to 2 ×107 . Using heat transfer and temperature measurements within the fluid, we characterize the different styles of low Pr rotating convective flow. The convection threshold is first overcome in the form of a container scale inertial oscillatory mode. At stronger forcing, wall-localized modes develop, coexisting with the inertial oscillatory modes in the bulk. When the strength of the buoyancy increases further, the bulk flow becomes turbulent while the wall modes remain. Our results imply that rotating convective flows in liquid metals do not develop in the form of quasi-steady columns, as in Pr = 1 planetary and stellar dynamo models, but in the form of oscillatory motions. Therefore, convection driven dynamo action in low Pr fluids can differ substantively than that occurring in typical Pr = 1 numerical models. Our results also suggest that low wavenumber, wall modes may be dynamically and observationally important in liquid metal dynamo systems. We thank the NSF Geophysics Program for support of this project.

  11. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates. (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain


    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  12. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel


    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  13. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob


    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  14. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao


    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  15. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.


    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  16. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.


    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  17. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.


    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  18. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers. (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S


    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  19. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.


    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  20. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns (United States)

    Duarte, Fabiola; Lemus, Luis


    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  1. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)


    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  2. 3D LDV Measurements in Oscillatory Boundary Layers (United States)

    Mier, J. M.; Garcia, M. H.


    The oscillatory boundary layer represents a particular case of unsteady wall-bounded flows in which fluid particles follow a periodic sinusoidal motion. Unlike steady boundary layer flows, the oscillatory flow regime and bed roughness character change in time along the period for every cycle, a characteristic that introduces a high degree of complexity in the analysis of these flows. Governing equations can be derived from the general Navier-Stokes equations for the motion of fluids, from which the exact solution for the laminar oscillatory boundary layer is obtained (also known as the 2nd Stokes problem). No exact solution exists for the turbulent case, thus, understanding of the main flow characteristics comes from experimental work. Several researchers have reported experimental work in oscillatory boundary layers since the 1960's; however, larger scale facilities and the development of newer measurement techniques with improved temporal and spatial resolution in recent years provides a unique opportunity to achieve a better understanding about this type of flows. Several experiments were performed in the Large Oscillatory Water and Sediment Tunnel (LOWST) facility at the Ven Te Chow Hydrosystems Laboratory, for a range of Reynolds wave numbers between 6x10^4 3D Laser Doppler Velocimetry (LDV) system was used to measure instantaneous flow velocities with a temporal resolution up to ~ 1,000 Hz. It was mounted on a 3-axis traverse with a spatial resolution of 0.01 mm in all three directions. The closest point to the bottom was measured at z = 0.2 mm (z+ ≈ 4), which allowed to capture boundary layer features with great detail. In order to achieve true 3D measurements, 2 probes were used on a perpendicular configuration, such that u and w components were measured from a probe on the side of the flume and v component was measured from a probe pointing down through and access window on top of the flume. The top probe was submerged in a water container, such that the

  3. Bidirectional Frontoparietal Oscillatory Systems Support Working Memory. (United States)

    Johnson, Elizabeth L; Dewar, Callum D; Solbakk, Anne-Kristin; Endestad, Tor; Meling, Torstein R; Knight, Robert T


    The ability to represent and select information in working memory provides the neurobiological infrastructure for human cognition. For 80 years, dominant views of working memory have focused on the key role of prefrontal cortex (PFC) [1-8]. However, more recent work has implicated posterior cortical regions [9-12], suggesting that PFC engagement during working memory is dependent on the degree of executive demand. We provide evidence from neurological patients with discrete PFC damage that challenges the dominant models attributing working memory to PFC-dependent systems. We show that neural oscillations, which provide a mechanism for PFC to communicate with posterior cortical regions [13], independently subserve communications both to and from PFC-uncovering parallel oscillatory mechanisms for working memory. Fourteen PFC patients and 20 healthy, age-matched controls performed a working memory task where they encoded, maintained, and actively processed information about pairs of common shapes. In controls, the electroencephalogram (EEG) exhibited oscillatory activity in the low-theta range over PFC and directional connectivity from PFC to parieto-occipital regions commensurate with executive processing demands. Concurrent alpha-beta oscillations were observed over parieto-occipital regions, with directional connectivity from parieto-occipital regions to PFC, regardless of processing demands. Accuracy, PFC low-theta activity, and PFC → parieto-occipital connectivity were attenuated in patients, revealing a PFC-independent, alpha-beta system. The PFC patients still demonstrated task proficiency, which indicates that the posterior alpha-beta system provides sufficient resources for working memory. Taken together, our findings reveal neurologically dissociable PFC and parieto-occipital systems and suggest that parallel, bidirectional oscillatory systems form the basis of working memory. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Oscillatory magneto-convection under magnetic field modulation


    Kiran, Palle; Bhadauria, B.S.; Narasimhulu, Y.


    In this paper we investigate an oscillatory mode of nonlinear magneto-convection under time dependant magnetic field. The time dependant magnetic field consists steady and oscillatory parts. The oscillatory part of the imposed magnetic field is assumed to be of third order. An externally imposed vertical magnetic field in an electrically conducting horizontal fluid layer is considered. The finite amplitude analysis is discussed while perturbing the system. The complex Ginzburg-Landau model is...

  5. Enhancing Rotational Diffusion Using Oscillatory Shear

    KAUST Repository

    Leahy, Brian D.


    Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced for anisotropic particles in oscillatory shear. This enhancement arises from variations in the particle\\'s rotation (Jeffery orbit) and depends on the strain amplitude, rate, and particle aspect ratio in a manner that is distinct from the translational diffusion. This separate tunability of translational and rotational diffusion opens the door to new techniques for controlling positions and orientations of suspended anisotropic colloids. © 2013 American Physical Society.

  6. Power System Oscillatory Behaviors: Sources, Characteristics, & Analyses

    Energy Technology Data Exchange (ETDEWEB)

    Follum, James D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Tuffner, Francis K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Dosiek, Luke A. [Union College, Schenectady, NY (United States); Pierre, John W. [Univ. of Wyoming, Laramie, WY (United States)


    This document is intended to provide a broad overview of the sources, characteristics, and analyses of natural and forced oscillatory behaviors in power systems. These aspects are necessarily linked. Oscillations appear in measurements with distinguishing characteristics derived from the oscillation’s source. These characteristics determine which analysis methods can be appropriately applied, and the results from these analyses can only be interpreted correctly with an understanding of the oscillation’s origin. To describe oscillations both at their source within a physical power system and within measurements, a perspective from the boundary between power system and signal processing theory has been adopted.

  7. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate. (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J


    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  8. Learning in AN Oscillatory Cortical Model (United States)

    Scarpetta, Silvia; Li, Zhaoping; Hertz, John

    We study a model of generalized-Hebbian learning in asymmetric oscillatory neural networks modeling cortical areas such as hippocampus and olfactory cortex. The learning rule is based on the synaptic plasticity observed experimentally, in particular long-term potentiation and long-term depression of the synaptic efficacies depending on the relative timing of the pre- and postsynaptic activities during learning. The learned memory or representational states can be encoded by both the amplitude and the phase patterns of the oscillating neural populations, enabling more efficient and robust information coding than in conventional models of associative memory or input representation. Depending on the class of nonlinearity of the activation function, the model can function as an associative memory for oscillatory patterns (nonlinearity of class II) or can generalize from or interpolate between the learned states, appropriate for the function of input representation (nonlinearity of class I). In the former case, simulations of the model exhibits a first order transition between the "disordered state" and the "ordered" memory state.

  9. Cracking the code of oscillatory activity.

    Directory of Open Access Journals (Sweden)

    Philippe G Schyns


    Full Text Available Neural oscillations are ubiquitous measurements of cognitive processes and dynamic routing and gating of information. The fundamental and so far unresolved problem for neuroscience remains to understand how oscillatory activity in the brain codes information for human cognition. In a biologically relevant cognitive task, we instructed six human observers to categorize facial expressions of emotion while we measured the observers' EEG. We combined state-of-the-art stimulus control with statistical information theory analysis to quantify how the three parameters of oscillations (i.e., power, phase, and frequency code the visual information relevant for behavior in a cognitive task. We make three points: First, we demonstrate that phase codes considerably more information (2.4 times relating to the cognitive task than power. Second, we show that the conjunction of power and phase coding reflects detailed visual features relevant for behavioral response--that is, features of facial expressions predicted by behavior. Third, we demonstrate, in analogy to communication technology, that oscillatory frequencies in the brain multiplex the coding of visual features, increasing coding capacity. Together, our findings about the fundamental coding properties of neural oscillations will redirect the research agenda in neuroscience by establishing the differential role of frequency, phase, and amplitude in coding behaviorally relevant information in the brain.

  10. Three-dimensional Oscillatory Magnetic Reconnection

    International Nuclear Information System (INIS)

    Thurgood, Jonathan O.; McLaughlin, James A.; Pontin, David I.


    Here we detail the dynamic evolution of localized reconnection regions about 3D magnetic null points using numerical simulation. We demonstrate for the first time that reconnection triggered by the localized collapse of a 3D null point that is due to an external magnetohydrodynamic (MHD) wave involves a self-generated oscillation, whereby the current sheet and outflow jets undergo a reconnection reversal process during which back-pressure formation at the jet heads acts to prise open the collapsed field before overshooting the equilibrium into an opposite-polarity configuration. The discovery that reconnection at fully 3D nulls can proceed naturally in a time-dependent and periodic fashion suggests that oscillatory reconnection mechanisms may play a role in explaining periodicity in astrophysical phenomena associated with magnetic reconnection, such as the observed quasi-periodicity of solar and stellar flare emission. Furthermore, we find that a consequence of oscillatory reconnection is the generation of a plethora of freely propagating MHD waves that escape the vicinity of the reconnection region.

  11. Oscillatory mechanisms of process binding in memory. (United States)

    Klimesch, Wolfgang; Freunberger, Roman; Sauseng, Paul


    A central topic in cognitive neuroscience is the question, which processes underlie large scale communication within and between different neural networks. The basic assumption is that oscillatory phase synchronization plays an important role for process binding--the transient linking of different cognitive processes--which may be considered a special type of large scale communication. We investigate this question for memory processes on the basis of different types of oscillatory synchronization mechanisms. The reviewed findings suggest that theta and alpha phase coupling (and phase reorganization) reflect control processes in two large memory systems, a working memory and a complex knowledge system that comprises semantic long-term memory. It is suggested that alpha phase synchronization may be interpreted in terms of processes that coordinate top-down control (a process guided by expectancy to focus on relevant search areas) and access to memory traces (a process leading to the activation of a memory trace). An analogous interpretation is suggested for theta oscillations and the controlled access to episodic memories. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  12. Three-dimensional Oscillatory Magnetic Reconnection

    Energy Technology Data Exchange (ETDEWEB)

    Thurgood, Jonathan O.; McLaughlin, James A. [Department of Mathematics, Physics and Electrical Engineering, Northumbria University, Newcastle upon Tyne, NE1 1ST (United Kingdom); Pontin, David I., E-mail: [Division of Mathematics, University of Dundee, Dundee, DD1 4HN (United Kingdom)


    Here we detail the dynamic evolution of localized reconnection regions about 3D magnetic null points using numerical simulation. We demonstrate for the first time that reconnection triggered by the localized collapse of a 3D null point that is due to an external magnetohydrodynamic (MHD) wave involves a self-generated oscillation, whereby the current sheet and outflow jets undergo a reconnection reversal process during which back-pressure formation at the jet heads acts to prise open the collapsed field before overshooting the equilibrium into an opposite-polarity configuration. The discovery that reconnection at fully 3D nulls can proceed naturally in a time-dependent and periodic fashion suggests that oscillatory reconnection mechanisms may play a role in explaining periodicity in astrophysical phenomena associated with magnetic reconnection, such as the observed quasi-periodicity of solar and stellar flare emission. Furthermore, we find that a consequence of oscillatory reconnection is the generation of a plethora of freely propagating MHD waves that escape the vicinity of the reconnection region.

  13. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon


    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  14. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups (United States)

    Ward, Jonathan A.; Grindrod, Peter


    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  15. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng


    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  16. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons. (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N


    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  17. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  18. A novel scenario of aperiodical impacts appearance in the turbine draft tube (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.


    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  19. Automatic control of oscillatory penetration apparatus (United States)

    Lucon, Peter A


    A system and method for controlling an oscillatory penetration apparatus. An embodiment is a system and method for controlling a sonic drill having a displacement and an operating range and operating at a phase difference, said sonic drill comprising a push-pull piston and eccentrics, said method comprising: operating the push-pull piston at an initial push-pull force while the eccentrics are operated at a plurality of different operating frequencies within the operating range of the sonic drill and measuring the displacement at each operating frequency; determining an efficient operating frequency for the material being drilled and operating the eccentrics at said efficient operating frequency; determining the phase difference at which the sonic drill is operating; and if the phase difference is not substantially equal to minus ninety degrees, operating the push-pull piston at another push-pull force.

  20. Production of oscillatory flow in wind tunnels (United States)

    Al-Asmi, K.; Castro, I. P.


    A method for producing oscillatory flow in open-circuit wind tunnels driven by centrifugal fans is described. Performance characteristics of a new device installed on two such tunnels of greatly differing size are presented. It is shown that sinusoidal variations of the working section flow, having peak-to-peak amplitudes up to at least 30 percent of the mean flow speed and frequencies up to, typically, that corresponding to the acoustic quarter-wave-length frequency determined by the tunnel size, can be obtained with negligible harmonic distortion or acoustic noise difficulties. A brief review of the various methods that have been used previously is included, and the advantages and disadvantages of these different techniques are highlighted. The present technique seems to represent a significant improvement over many of them.

  1. Multiphase patterns in periodically forced oscillatory systems

    International Nuclear Information System (INIS)

    Elphick, C.; Hagberg, A.; Meron, E.


    Periodic forcing of an oscillatory system produces frequency locking bands within which the system frequency is rationally related to the forcing frequency. We study extended oscillatory systems that respond to uniform periodic forcing at one quarter of the forcing frequency (the 4:1 resonance). These systems possess four coexisting stable states, corresponding to uniform oscillations with successive phase shifts of π/2. Using an amplitude equation approach near a Hopf bifurcation to uniform oscillations, we study front solutions connecting different phase states. These solutions divide into two groups: π fronts separating states with a phase shift of π and π/2 fronts separating states with a phase shift of π/2. We find a type of front instability where a stationary π front 'decomposes' into a pair of traveling π/2 fronts as the forcing strength is decreased. The instability is degenerate for an amplitude equation with cubic nonlinearities. At the instability point a continuous family of pair solutions exists, consisting of π/2 fronts separated by distances ranging from zero to infinity. Quintic nonlinearities lift the degeneracy at the instability point but do not change the basic nature of the instability. We conjecture the existence of similar instabilities in higher 2n:1 resonances (n=3,4,hor-ellipsis) where stationary π fronts decompose into n traveling π/n fronts. The instabilities designate transitions from stationary two-phase patterns to traveling 2n-phase patterns. As an example, we demonstrate with a numerical solution the collapse of a four-phase spiral wave into a stationary two-phase pattern as the forcing strength within the 4:1 resonance is increased. copyright 1999 The American Physical Society

  2. Oscillatory transenantiomerization of the selected 2-arylpropionic acid (2-APAs) in vitro as a spontaneous phenomenon

    International Nuclear Information System (INIS)

    Sajewicz, M.; Alska, T.K.


    In this paper, we summarize the results of our earlier investigations on an attempted enantioseparation of the selected 2-arylpropionic acids (2-APAs) by means of the chiral thin layer chromatography (TLC). These results have been originally presented in a series of the research papers published in several chromatography journals. In the current article it was reminded that the prolonged storage of the investigated 2-APAs in the aqueous and the non-aqueous solutions results in an oscillatory change of the respective retardation factor (RF) and the specific rotation (alfa)/sub P/) values. An assumption is introduced as to the chemical nature of the observed phenomenon. It is assumed that the observed oscillations are due to the repeated structural inversion (in our study labelled as oscillatory transenantiomerization) of one enantiomer to its respective antimer. One attempts to at least roughly explain the molecular mechanism of transenantiomerization either by keto-enol tautomerism, or by formation of an intermediate enolic anion, any of these two reaction mechanisms possible only in the basic environment. Then one reflects on the most probable mechanism responsible for the oscillatory nature of the observed structural inversion. It is concluded that the oscillations could be due to an enhanced viscosity of the investigated 2-APA solutions (as compared with those of the respective pure solvents) and/or due to the molecular self-organization within these solutions, resulting in anisotropic properties thereof. Finally, it is concluded that an ultimate explanation of the observed oscillatory transenantiomerization of the selected 2-APAs could probably be offered by the Brusselator-type kinetic model implemented with the diffusion term. In the last section of this paper, argumentation is presented strongly in favour of this particular model and against any alternative speculation as to the supramolecular nature of the observed oscillatory phenomena. (author)

  3. On exact solutions for oscillatory flows in a generalized Burgers fluid with slip condition

    Energy Technology Data Exchange (ETDEWEB)

    Hayat, Tasawar [Dept. of Mathematics, Quaid-i-Azam Univ., Islamabad (Pakistan); Dept. of Mathematics, Coll. of Sciences, KS Univ., Riyadh (Saudi Arabia); Najam, Saher [Theoretical Plasma Physics Div., PINSTECH, P.O. Nilore, Islamabad (Pakistan); Sajid, Muhammad; Mesloub, Said [Dept. of Mathematics, Coll. of Sciences, KS Univ., Riyadh (Saudi Arabia); Ayub, Muhammad [Dept. of Mathematics, Quaid-i-Azam Univ., Islamabad (Pakistan)


    An analysis is performed for the slip effects on the exact solutions of flows in a generalized Burgers fluid. The flow modelling is based upon the magnetohydrodynamic (MHD) nature of the fluid and modified Darcy law in a porous space. Two illustrative examples of oscillatory flows are considered. The results obtained are compared with several limiting cases. It has been shown here that the derived results hold for all values of frequencies including the resonant frequency. (orig.)

  4. Low frequency oscillatory flow in a rotating curved pipe

    Institute of Scientific and Technical Information of China (English)

    陈华军; 章本照; 苏霄燕


    The low frequency oscillatory flow in a rotating curved pipe was studied by using the method of bi-parameter perturbation. Perturbation solutions up to the second order were obtained and the effects of rotationon the low frequency oscillatory flow were examined in detail, The results indicated that there exists evident difference between the low frequency oscillatory flow in a rotating curved pipe and in a curved pipe without ro-tation. During a period, four secondary vortexes may exist on the circular cross-section and the distribution of axial velocity and wall shear stress are related to the ratio of the Coriolis foree to centrifugal foree and the axial pressure gradient.

  5. Low frequency oscillatory flow in a rotating curved pipe

    Institute of Scientific and Technical Information of China (English)

    陈华军; 章本照; 苏霄燕


    The low frequency oscillatory flow in a rotating curved pipe was studied by using the method of bi-parameter perturbation. Perturbation solutions up to the second order were obtained and the effects of rotation on the low frequency oscillatory flow were examined in detail. The results indicated that there exists evident difference between the low frequency oscillatory flow in a rotating curved pipe and in a curved pipe without rotation. During a period, four secondary vortexes may exist on the circular cross-section and the distribution of axial velocity and wall shear stress are related to the ratio of the Coriolis force to centrifugal force and the axial pressure gradient.

  6. Microstructure characterization of Cu processed by compression with oscillatory torsion

    International Nuclear Information System (INIS)

    Rodak, K.; Pawlicki, J.


    High purity Cu (99.9%) was subjected to severe plastic deformation up to a total effective strain ε ft = 130 through compression with the oscillatory torsion method at room temperature. This method produces an ultrafine grain microstructure. The microstructure evolution was investigated with respect to the value of the total effective strain using a scanning electron microscope with an electron-backscattered diffraction technique and a scanning transmission electron microscope. The results of the structural analyses show that increasing ε ft from 2 to 50 causes progress in the grain refinement. A quantitative study of the microstructure parameters, such as fraction of high angle boundaries, grain and subgrain diameter, and the area fraction of grains up to 1 μm, shows that deformation at ε ft = 45 guaranteed the best conditions for refining the microstructure of Cu. Using high values of ε ft in the range 60 to 130 restricts grain refinement because intensive recovery begins to dominate in the microstructure. - Highlights: • Cu was processed by SPD metodto an effective strain 130. • The microstructure evolution has been investigated. • The method allows to produce an ultrafine grain microstructure

  7. Microstructure characterization of Cu processed by compression with oscillatory torsion

    Energy Technology Data Exchange (ETDEWEB)

    Rodak, K., E-mail: [Institute of Materials Science, Silesian University of Technology, Krasińskiego 8, 40-019 Katowice (Poland); Pawlicki, J., E-mail: [Department of Automotive Vehicle Construction, Silesian University of Technology, Krasińskiego 8, 40–019 Katowice (Poland)


    High purity Cu (99.9%) was subjected to severe plastic deformation up to a total effective strain ε{sub ft} = 130 through compression with the oscillatory torsion method at room temperature. This method produces an ultrafine grain microstructure. The microstructure evolution was investigated with respect to the value of the total effective strain using a scanning electron microscope with an electron-backscattered diffraction technique and a scanning transmission electron microscope. The results of the structural analyses show that increasing ε{sub ft} from 2 to 50 causes progress in the grain refinement. A quantitative study of the microstructure parameters, such as fraction of high angle boundaries, grain and subgrain diameter, and the area fraction of grains up to 1 μm, shows that deformation at ε{sub ft} = 45 guaranteed the best conditions for refining the microstructure of Cu. Using high values of ε{sub ft} in the range 60 to 130 restricts grain refinement because intensive recovery begins to dominate in the microstructure. - Highlights: • Cu was processed by SPD metodto an effective strain 130. • The microstructure evolution has been investigated. • The method allows to produce an ultrafine grain microstructure.

  8. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe


    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  9. Inertial particle manipulation in microscale oscillatory flows (United States)

    Agarwal, Siddhansh; Rallabandi, Bhargav; Raju, David; Hilgenfeldt, Sascha


    Recent work has shown that inertial effects in oscillating flows can be exploited for simultaneous transport and differential displacement of microparticles, enabling size sorting of such particles on extraordinarily short time scales. Generalizing previous theory efforts, we here derive a two-dimensional time-averaged version of the Maxey-Riley equation that includes the effect of an oscillating interface to model particle dynamics in such flows. Separating the steady transport time scale from the oscillatory time scale results in a simple and computationally efficient reduced model that preserves all slow-time features of the full unsteady Maxey-Riley simulations, including inertial particle displacement. Comparison is made not only to full simulations, but also to experiments using oscillating bubbles as the driving interfaces. In this case, the theory predicts either an attraction to or a repulsion from the bubble interface due to inertial effects, so that versatile particle manipulation is possible using differences in particle size, particle/fluid density contrast and streaming strength. We also demonstrate that these predictions are in agreement with experiments.

  10. Oscillatory Stokes Flow Past a Slip Cylinder (United States)

    Palaniappan, D.


    Two-dimensional transient slow viscous flow past a circular cylinder with Navier slip boundary conditions is considered in the limit of low-Reynolds number. The oscillatory Stokes flow problem around a cylinder is solved using the stream function method leading to an analytic solution in terms of modified Bessel functions of the second kind. The corresponding steady-state behavior yields the familiar paradoxical result first detected by Stokes. It is noted that the two key parameters, viz., the frequency λ, and the slip coefficient ξ have a significant impact on the flow field in the vicinity of the cylinder contour. In the limit of very low frequency, the flow is dominated by a term containing a well-known biharmonic function found by Stokes that has a singular behavior at infinity. Local streamlines for small times show interesting flow patterns. Attached eddies due to flow separation - observed in the no-slip case - either get detached or pushed away from the cylinder surface as ξ is varied. Computed asymptotic results predict that the flow exhibits inviscid behavior far away from the cylinder in the frequency range 0 < λ << 1 . Although the frequency of oscillations is finite, our exact solutions reveal fairly rapid transitions in the flow domain. Research Enhancement grant, TAMUCC.

  11. Oscillatory exchange coupling in magnetic molecules

    International Nuclear Information System (INIS)

    Sevincli, H; Senger, R T; Durgun, E; Ciraci, S


    Recently, first-principles calculations based on the spin-dependent density functional theory (DFT) have revealed that the magnetic ground state of a finite linear carbon chain capped by two transition metal (TM) atoms alternates between ferromagnetic and antiferromagnetic configurations depending on the number of carbon atoms. The character of indirect exchange coupling in this nanoscale, quasi-zero-dimensional system is different from those analogous extended structures consisting of magnetic layers separated by a non-magnetic spacer (or magnetic impurities in a non-magnetic host material) and a formulation based on an atomic picture is needed. We present a tight-binding model which provides a theoretical framework to the underlying mechanism of the exchange coupling in molecular structures. The model calculations are capable of reproducing the essential features of the DFT results for the indirect exchange coupling and the atomic magnetic moments in the TM-C n -TM structures as functions of the number of carbon atoms. In nanostructures consisting of a few atoms the concepts of extended wavefunctions and the band theory lose their validity, and hence the oscillatory exchange coupling turns out to be a consequence of quantum interference effects due to the spin-dependent onsite and hopping energies

  12. Turbulent shear control with oscillatory bubble injection

    International Nuclear Information System (INIS)

    Park, Hyun Jin; Oishi, Yoshihiko; Tasaka, Yuji; Murai, Yuichi; Takeda, Yasushi


    It is known that injecting bubbles into shear flow can reduce the frictional drag. This method has advantages in comparison to others in simplicity of installation and also in environment. The amount of drag reduction by bubbles depends on the void fraction provided in the boundary layer. It means, however, that certain power must be consumed to generate bubbles in water, worsening the total power-saving performance. We propose oscillatory bubble injection technique to improve the performance in this study. In order to prove this idea of new type of drag reduction, velocity vector field and shear stress profile in a horizontal channel flow are measured by ultrasonic velocity profiler (UVP) and shear stress transducer, respectively. We measure the gas-liquid interface from the UVP signal, as well. This compound measurement with different principles leads to deeper understanding of bubble-originated drag reduction phenomena, in particular for unsteady process of boundary layer alternation. At these experiments, the results have demonstrated that the intermittency promotes the drag reduction more than normal continuous injection for the same void fraction supplied.

  13. Processing oscillatory signals by incoherent feedforward loops (United States)

    Zhang, Carolyn; Wu, Feilun; Tsoi, Ryan; Shats, Igor; You, Lingchong

    From the timing of amoeba development to the maintenance of stem cell pluripotency,many biological signaling pathways exhibit the ability to differentiate between pulsatile and sustained signals in the regulation of downstream gene expression.While networks underlying this signal decoding are diverse,many are built around a common motif, the incoherent feedforward loop (IFFL),where an input simultaneously activates an output and an inhibitor of the output.With appropriate parameters,this motif can generate temporal adaptation,where the system is desensitized to a sustained input.This property serves as the foundation for distinguishing signals with varying temporal profiles.Here,we use quantitative modeling to examine another property of IFFLs,the ability to process oscillatory signals.Our results indicate that the system's ability to translate pulsatile dynamics is limited by two constraints.The kinetics of IFFL components dictate the input range for which the network can decode pulsatile dynamics.In addition,a match between the network parameters and signal characteristics is required for optimal ``counting''.We elucidate one potential mechanism by which information processing occurs in natural networks with implications in the design of synthetic gene circuits for this purpose. This work was partially supported by the National Science Foundation Graduate Research Fellowship (CZ).

  14. Recent developments in structure-preserving algorithms for oscillatory differential equations

    CERN Document Server

    Wu, Xinyuan


    The main theme of this book is recent progress in structure-preserving algorithms for solving initial value problems of oscillatory differential equations arising in a variety of research areas, such as astronomy, theoretical physics, electronics, quantum mechanics and engineering. It systematically describes the latest advances in the development of structure-preserving integrators for oscillatory differential equations, such as structure-preserving exponential integrators, functionally fitted energy-preserving integrators, exponential Fourier collocation methods, trigonometric collocation methods, and symmetric and arbitrarily high-order time-stepping methods. Most of the material presented here is drawn from the recent literature. Theoretical analysis of the newly developed schemes shows their advantages in the context of structure preservation. All the new methods introduced in this book are proven to be highly effective compared with the well-known codes in the scientific literature. This book also addre...

  15. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.


    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  16. Oscillatory ripples, evaluation of ancient wave climates and ...

    African Journals Online (AJOL)

    Oscillatory ripples, evaluation of ancient wave climates and epierogeny in the Anambra ... conditions, epierogenic patterns and paleogeographic history of the basins. ... shallow and marked by low to moderate hydrodynamic energy conditions.

  17. Resting-state oscillatory brain dynamics in Alzheimer disease

    NARCIS (Netherlands)

    de Haan, W.; Stam, C.J.; Jones, B.F.; Zuiderwijk, I.M.; van Dijk, B.W.; Scheltens, P.


    Altered oscillatory brain activity in Alzheimer disease (AD) may reflect underlying neuropathological changes, and its characterization might lead to new diagnostic possibilities. The present study using quantitative magnetoencephalography was set up to examine power spectrum changes in AD patients,

  18. Synchronization enhancement via an oscillatory bath in a network of ...

    Indian Academy of Sciences (India)


    Feb 5, 2015 ... 2Monell Chemical Senses Center, 3500 Market Street, Philadelphia, PA 19104, USA ... The robustness of synchronization strategy is tested using a local and global ..... enhancement effect that the oscillatory bath has in the ...

  19. Enhanced Gamma Oscillatory Activity in Rats with Chronic Inflammatory Pain


    Wang, Jing; Wang, Jing; Xing, Guo-Gang; Li, Xiaoli; Wan, You


    It has been reported that oscillatory gamma activity participates in brief acute pain and tonic ongoing pain. It is of great interest to determine whether the gamma activity is involved in chronic pain since chronic pain is a more severe pathological condition characterized by pain persistency. To investigate the oscillatory gamma activity in chronic pain, in the present study, we recorded spontaneous electrocorticogram (ECoG) signals during chronic pain development in rats with chronic infla...

  20. Oscillatory magneto-convection under magnetic field modulation

    Directory of Open Access Journals (Sweden)

    Palle Kiran


    Full Text Available In this paper we investigate an oscillatory mode of nonlinear magneto-convection under time dependant magnetic field. The time dependant magnetic field consists steady and oscillatory parts. The oscillatory part of the imposed magnetic field is assumed to be of third order. An externally imposed vertical magnetic field in an electrically conducting horizontal fluid layer is considered. The finite amplitude analysis is discussed while perturbing the system. The complex Ginzburg-Landau model is used to derive an amplitude of oscillatory convection for weakly nonlinear mode. Heat transfer is quantified in terms of the Nusselt number, which is governed by the Landau equation. The variation of the modulation excitation of the magnetic field alternates heat transfer in the layer. The modulation excitation of the magnetic field is used either to enhance or diminish the heat transfer in the system. Further, it is found that, oscillatory mode of convection enhances the heat transfer and than stationary convection. The results have possible technological applications in magnetic fluid based systems involving energy transmission. Keywords: Weakly nonlinear theory, Oscillatory convection, Complex Ginzburg Landau model, Magnetic modulation

  1. Estimating confidence intervals in predicted responses for oscillatory biological models. (United States)

    St John, Peter C; Doyle, Francis J


    The dynamics of gene regulation play a crucial role in a cellular control: allowing the cell to express the right proteins to meet changing needs. Some needs, such as correctly anticipating the day-night cycle, require complicated oscillatory features. In the analysis of gene regulatory networks, mathematical models are frequently used to understand how a network's structure enables it to respond appropriately to external inputs. These models typically consist of a set of ordinary differential equations, describing a network of biochemical reactions, and unknown kinetic parameters, chosen such that the model best captures experimental data. However, since a model's parameter values are uncertain, and since dynamic responses to inputs are highly parameter-dependent, it is difficult to assess the confidence associated with these in silico predictions. In particular, models with complex dynamics - such as oscillations - must be fit with computationally expensive global optimization routines, and cannot take advantage of existing measures of identifiability. Despite their difficulty to model mathematically, limit cycle oscillations play a key role in many biological processes, including cell cycling, metabolism, neuron firing, and circadian rhythms. In this study, we employ an efficient parameter estimation technique to enable a bootstrap uncertainty analysis for limit cycle models. Since the primary role of systems biology models is the insight they provide on responses to rate perturbations, we extend our uncertainty analysis to include first order sensitivity coefficients. Using a literature model of circadian rhythms, we show how predictive precision is degraded with decreasing sample points and increasing relative error. Additionally, we show how this method can be used for model discrimination by comparing the output identifiability of two candidate model structures to published literature data. Our method permits modellers of oscillatory systems to confidently

  2. Particle and Blood Cell Dynamics in Oscillatory Flows Final Report

    International Nuclear Information System (INIS)

    Restrepo, Juan M.


    Our aim has been to uncover fundamental aspects of the suspension and dislodgement of particles in wall-bounded oscillatory flows, in flows characterized by Reynolds numbers encompassing the situation found in rivers and near shores (and perhaps in some industrial processes). Our research tools are computational and our coverage of parameter space fairly broad. Computational means circumvent many complications that make the measurement of the dynamics of particles in a laboratory setting an impractical task, especially on the broad range of parameter space we plan to report upon. The impact of this work on the geophysical problem of sedimentation is boosted considerably by the fact that the proposed calculations can be considered ab-initio, in the sense that little to no modeling is done in generating dynamics of the particles and of the moving fluid: we use a three-dimensional Navier Stokes solver along with straightforward boundary conditions. Hence, to the extent that Navier Stokes is a model for an ideal incompressible isotropic Newtonian fluid, the calculations yield benchmark values for such things as the drag, buoyancy, and lift of particles, in a highly controlled environment. Our approach will be to make measurements of the lift, drag, and buoyancy of particles, by considering progressively more complex physical configurations and physics.

  3. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit


    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.


    Directory of Open Access Journals (Sweden)

    M.I. Baranov


    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  5. Oscillatory device for use with linear tribometer, for tribological evaluation of biomaterials (United States)

    Athayde, J. N.; Siqueira, C. J. M.; Kuromoto, N. K.; Cambraia, H. N.


    Orthopedic implants still have limitations regarding their durability, despite being in use for over fifty years. Particles arising from wear due to the relative motion of their surfaces remain responsible for aseptic failure. This paper presents a device to be coupled with a reciprocal linear tribometer to reproduce the ex vivo wear of biomaterials, allowing the measurement of force and coefficient of friction. The device consists of a structure connected to the tribometer that transforms its reciprocal linear motion into one that is oscillatory for the mechanical assembly that contains the samples to test the desired biomaterials. The tribological pair used for testing consisted of Ultra High Molecular Weight Polyethylene (UHMWPE) in conjunction with the austenitic stainless steel AISI 316L in dry lubrication. The results showed that the values of the coefficient of friction in the linear mode and oscillatory mode and the UHMWPE life curve in the oscillatory mode were consistent with those cited in the literature for tests in a dry lubrication environment. Moreover, the UHMWPE sample life curve showed a reduction in the wear rate that can be explained by the preponderance of a wear mechanism over the others. The volumetric wear showed an increase with the number of cycles.

  6. An optimum design of R-C oscillatory De-Qing circuit

    International Nuclear Information System (INIS)

    Cao Dezhang; Pan Linghe; Yang Tianlu


    An optimum design of R-C oscillatory De-Qing circuit has been developed for voltage regulation of the pulse modulator. When a new coefficient T 3 /T is introduced, the selection of De-Qing circuit parameters will become quite simple and the optimum parameters can be calculated directly. The De-Qing circuit parameters calculated will be effective in the whole range of the percentage regulation η from zero to maximum design value. The limit value of η is 0.36 or 0.29, theoretically, when the time constant of the De-Qing circuit is 3RC or 5RC respectively

  7. Fluid mechanics experiments in oscillatory flow. Volume 1: Report (United States)

    Seume, J.; Friedman, G.; Simon, T. W.


    Results of a fluid mechanics measurement program in oscillating flow within a circular duct are presented. The program began with a survey of transition behavior over a range of oscillation frequency and magnitude and continued with a detailed study at a single operating point. Such measurements were made in support of Stirling engine development. Values of three dimensionless parameters, Re(sub max), Re(sub w), and A(sub R), embody the velocity amplitude, frequency of oscillation and mean fluid displacement of the cycle, respectively. Measurements were first made over a range of these parameters which included operating points of all Stirling engines. Next, a case was studied with values of these parameters that are representative of the heat exchanger tubes in the heater section of NASA's Stirling cycle Space Power Research Engine (SPRE). Measurements were taken of the axial and radial components of ensemble-averaged velocity and rms-velocity fluctuation and the dominant Reynolds shear stress, at various radial positions for each of four axial stations. In each run, transition from laminar to turbulent flow, and its reverse, were identified and sufficient data was gathered to propose the transition mechanism. Models of laminar and turbulent boundary layers were used to process the data into wall coordinates and to evaluate skin friction coefficients. Such data aids in validating computational models and is useful in comparing oscillatory flow characteristics to those of fully-developed steady flow. Data were taken with a contoured entry to each end of the test section and with flush square inlets so that the effects of test section inlet geometry on transition and turbulence are documented. Volume 1 contains the text of the report including figures and supporting appendices. Volume 2 contains data reduction program listings and tabulated data (including its graphical presentation).

  8. Fluid mechanics experiments in oscillatory flow. Volume 1

    International Nuclear Information System (INIS)

    Seume, J.; Friedman, G.; Simon, T.W.


    Results of a fluid mechanics measurement program is oscillating flow within a circular duct are present. The program began with a survey of transition behavior over a range of oscillation frequency and magnitude and continued with a detailed study at a single operating point. Such measurements were made in support of Stirling engine development. Values of three dimensionless parameters, Re max , Re W , and A R , embody the velocity amplitude, frequency of oscillation and mean fluid displacement of the cycle, respectively. Measurements were first made over a range of these parameters which included operating points of all Stirling engines. Next, a case was studied with values of these parameters that are representative of the heat exchanger tubes in the heater section of NASA's Stirling cycle Space Power Research Engine (SPRE). Measurements were taken of the axial and radical components of ensemble-averaged velocity and rms-velocity fluctuation and the dominant Reynolds shear stress, at various radial positions for each of four axial stations. In each run, transition from laminar to turbulent flow, and in reverse, were identified and sufficient data was gathered to propose the transition mechanism. Models of laminar and turbulent boundary layers were used to process the data into wall coordinates and to evaluate skin friction coefficients. Such data aids in validating computational models and is useful in comparing oscillatory flow characteristics to those of fully-developed steady flow. Data were taken with a contoured entry to each end of the test section and with flush square inlets so that the effects of test section inlet geometry on transition and turbulence are documented. The following is presented in two-volumes. Volume I contains the text of the report including figures and supporting appendices. Volume II contains data reduction program listings and tabulated data (including its graphical presentation)

  9. Assessment of oscillatory stability constrained available transfer capability

    International Nuclear Information System (INIS)

    Jain, T.; Singh, S.N.; Srivastava, S.C.


    This paper utilizes a bifurcation approach to compute oscillatory stability constrained available transfer capability (ATC) in an electricity market having bilateral as well as multilateral transactions. Oscillatory instability in non-linear systems can be related to Hopf bifurcation. At the Hopf bifurcation, one pair of the critical eigenvalues of the system Jacobian reaches imaginary axis. A new optimization formulation, including Hopf bifurcation conditions, has been developed in this paper to obtain the dynamic ATC. An oscillatory stability based contingency screening index, which takes into account the impact of transactions on severity of contingency, has been utilized to identify critical contingencies to be considered in determining ATC. The proposed method has been applied for dynamic ATC determination on a 39-bus New England system and a practical 75-bus Indian system considering composite static load as well as dynamic load models. (author)

  10. Two-scale approach to oscillatory singularly perturbed transport equations

    CERN Document Server

    Frénod, Emmanuel


    This book presents the classical results of the two-scale convergence theory and explains – using several figures – why it works. It then shows how to use this theory to homogenize ordinary differential equations with oscillating coefficients as well as oscillatory singularly perturbed ordinary differential equations. In addition, it explores the homogenization of hyperbolic partial differential equations with oscillating coefficients and linear oscillatory singularly perturbed hyperbolic partial differential equations. Further, it introduces readers to the two-scale numerical methods that can be built from the previous approaches to solve oscillatory singularly perturbed transport equations (ODE and hyperbolic PDE) and demonstrates how they can be used efficiently. This book appeals to master’s and PhD students interested in homogenization and numerics, as well as to the Iter community.

  11. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity (United States)

    Kato, N.


    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  12. Assessment of dynamic mechanical properties of the respiratory system during high-frequency oscillatory ventilation*. (United States)

    Dellacà, Raffaele L; Zannin, Emanuela; Ventura, Maria L; Sancini, Giulio; Pedotti, Antonio; Tagliabue, Paolo; Miserocchi, Giuseppe


    1) To investigate the possibility of estimating respiratory system impedance (Zrs, forced oscillation technique) by using high-amplitude pressure oscillations delivered during high-frequency oscillatory ventilation; 2) to characterize the relationship between Zrs and continuous distending pressure during an increasing/decreasing continuous distending pressure trial; 3) to evaluate how the optimal continuous distending pressure identified by Zrs relates to the point of maximal curvature of the deflation limb of the quasi-static pressure-volume curve. Prospective laboratory animal investigation. Experimental medicine laboratory. Eight New Zealand rabbits. The rabbits were ventilated with high-frequency oscillatory ventilation. Zrs was measured while continuous distending pressure was increased and decreased between 2 and 26 cm H2O in 1-minute steps of 4 cm H2O. At each step, a low-amplitude (6 cm H2O) sinusoidal signal was alternated with a high-amplitude (18 cm H2O) asymmetric high-frequency oscillatory ventilation square pressure waveform. Pressure-volume curves were determined at the end of the continuous distending pressure trial. All measurements were repeated after bronchoalveolar lavage. Zrs was estimated from flow and pressure measured at the inlet of the tracheal tube and expressed as resistance (Rrs) and reactance (Xrs). Linear correlation between the values, measured by applying the small-amplitude sinusoidal signal and the ventilator waveform, was good for Xrs (r = 0.95 ± 0.04) but not for Rrs (r = 0.60 ± 0.34). Following lavage, the Xrs-continuous distending pressure curves presented a maximum on the deflation limb, identifying an optimal continuous distending pressure that was, on average, 1.1 ± 1.7 cm H2O below the point of maximal curvature of the deflation limb of the pressure-volume curves. Xrs can be accurately measured during high-frequency oscillatory ventilation without interrupting ventilation and/or connecting additional devices. An optimal

  13. Nonlinear response of dense colloidal suspensions under oscillatory shear: mode-coupling theory and Fourier transform rheology experiments. (United States)

    Brader, J M; Siebenbürger, M; Ballauff, M; Reinheimer, K; Wilhelm, M; Frey, S J; Weysser, F; Fuchs, M


    Using a combination of theory, experiment, and simulation we investigate the nonlinear response of dense colloidal suspensions to large amplitude oscillatory shear flow. The time-dependent stress response is calculated using a recently developed schematic mode-coupling-type theory describing colloidal suspensions under externally applied flow. For finite strain amplitudes the theory generates a nonlinear response, characterized by significant higher harmonic contributions. An important feature of the theory is the prediction of an ideal glass transition at sufficiently strong coupling, which is accompanied by the discontinuous appearance of a dynamic yield stress. For the oscillatory shear flow under consideration we find that the yield stress plays an important role in determining the nonlinearity of the time-dependent stress response. Our theoretical findings are strongly supported by both large amplitude oscillatory experiments (with Fourier transform rheology analysis) on suspensions of thermosensitive core-shell particles dispersed in water and Brownian dynamics simulations performed on a two-dimensional binary hard-disk mixture. In particular, theory predicts nontrivial values of the exponents governing the final decay of the storage and loss moduli as a function of strain amplitude which are in good agreement with both simulation and experiment. A consistent set of parameters in the presented schematic model achieves to jointly describe linear moduli, nonlinear flow curves, and large amplitude oscillatory spectroscopy.

  14. On oscillatory microstructure during cellular growth of directionally solidified Sn-36at.%Ni peritectic alloy. (United States)

    Peng, Peng; Li, Xinzhong; Li, Jiangong; Su, Yanqing; Guo, Jingjie


    An oscillatory microstructure has been observed during deep-cellular growth of directionally solidified Sn-36at.%Ni hyperperitectic alloy containing intermetallic compounds with narrow solubility range. This oscillatory microstructure with a dimension of tens of micrometers has been observed for the first time. The morphology of this wave-like oscillatory structure is similar to secondary dendrite arms, and can be observed only in some local positions of the sample. Through analysis such as successive sectioning of the sample, it can be concluded that this oscillatory microstructure is caused by oscillatory convection of the mushy zone during solidification. And the influence of convection on this oscillatory microstructure was characterized through comparison between experimental and calculations results on the wavelength. Besides, the change in morphology of this oscillatory microstructure has been proved to be caused by peritectic transformation during solidification. Furthermore, the melt concentration increases continuously during solidification of intermetallic compounds with narrow solubility range, which helps formation of this oscillatory microstructure.

  15. One central oscillatory drive is compatible with experimental motor unit behaviour in essential and Parkinsonian tremor (United States)

    Dideriksen, Jakob L.; Gallego, Juan A.; Holobar, Ales; Rocon, Eduardo; Pons, Jose L.; Farina, Dario


    Objective. Pathological tremors are symptomatic to several neurological disorders that are difficult to differentiate and the way by which central oscillatory networks entrain tremorogenic contractions is unknown. We considered the alternative hypotheses that tremor arises from one oscillator (at the tremor frequency) or, as suggested by recent findings from the superimposition of two separate inputs (at the tremor frequency and twice that frequency). Approach. Assuming one central oscillatory network we estimated analytically the relative amplitude of the harmonics of the tremor frequency in the motor neuron output for different temporal behaviors of the oscillator. Next, we analyzed the bias in the relative harmonics amplitude introduced by superimposing oscillations at twice the tremor frequency. These findings were validated using experimental measurements of wrist angular velocity and surface electromyography (EMG) from 22 patients (11 essential tremor, 11 Parkinson’s disease). The ensemble motor unit action potential trains identified from the EMG represented the neural drive to the muscles. Main results. The analytical results showed that the relative power of the tremor harmonics in the analytical models of the neural drive was determined by the variability and duration of the tremor bursts and the presence of the second oscillator biased this power towards higher values. The experimental findings accurately matched the analytical model assuming one oscillator, indicating a negligible functional role of secondary oscillatory inputs. Furthermore, a significant difference in the relative power of harmonics in the neural drive was found across the patient groups, suggesting a diagnostic value of this measure (classification accuracy: 86%). This diagnostic power decreased substantially when estimated from limb acceleration or the EMG. Signficance. The results indicate that the neural drive in pathological tremor is compatible with one central network

  16. Synchronization enhancement via an oscillatory bath in a network of ...

    Indian Academy of Sciences (India)


    Feb 5, 2015 ... The possibility of using a dynamic environment to achieve and optimize phase synchronization in a network of self-excited cells with free-end boundary conditions is addressed in this paper. The dynamic environment is an oscillatory bath coupled linearly to a network of four cells. The boundaries of the ...

  17. An extended discrete gradient formula for oscillatory Hamiltonian systems

    International Nuclear Information System (INIS)

    Liu Kai; Shi Wei; Wu Xinyuan


    In this paper, incorporating the idea of the discrete gradient method into the extended Runge–Kutta–Nyström integrator, we derive and analyze an extended discrete gradient formula for the oscillatory Hamiltonian system with the Hamiltonian H(p,q)= 1/2 p T p+ 1/2 q T Mq+U(q), where q:R→R d represents generalized positions, p:R→R d represents generalized momenta and M is an element of R dxd is a symmetric and positive semi-definite matrix. The solution of this system is a nonlinear oscillator. Basically, many nonlinear oscillatory mechanical systems with a partitioned Hamiltonian function lend themselves to this approach. The extended discrete gradient formula presented in this paper exactly preserves the energy H(p, q). We derive some properties of the new formula. The convergence is analyzed for the implicit schemes based on the discrete gradient formula, and it turns out that the convergence of the implicit schemes based on the extended discrete gradient formula is independent of ‖M‖, which is a significant property for the oscillatory Hamiltonian system. Thus, it transpires that a larger step size can be chosen for the new energy-preserving schemes than that for the traditional discrete gradient methods when applied to the oscillatory Hamiltonian system. Illustrative examples show the competence and efficiency of the new schemes in comparison with the traditional discrete gradient methods in the scientific literature. (paper)

  18. Oscillatory and electrohydrodynamic instabilities in flow over a ...

    Indian Academy of Sciences (India)

    of fluid flow past flexible surfaces is qualitatively different from the flow over rigid .... work. Oscillatory flows are unsteady, and it is important to precisely define the ..... from 5 to 16, though there is less variation in the critical stress for a steady ...

  19. Dark chocolate’s compositional effects revealed by oscillatory rheology

    NARCIS (Netherlands)

    van der Vaart, K.; Depypere, F.; De Graef, V.; Schall, P.; Fall, A.; Bonn, D.; Dewettinck, K.


    In this study, two types of oscillatory shear rheology are applied on dark chocolate with varying volume fraction, particle size distribution, and soy lecithin concentration. The first, a conventional strain sweep, allows for the separation of the elastic and viscous properties during the yielding.

  20. On stellar collapse: continual or oscillatory. A short comment

    International Nuclear Information System (INIS)

    Leung, P.T.


    We comment on a previously published paper on the oscillatory dynamics of stellar collapse and conclude that the Schwarzschild interior solution applied to the 'inflection points' can never give rise to a 'turning back' motion, in spite of the fact that the geodesic equation really does not always describe an attractive gravitational acceleration

  1. Oscillatory behaviour of solutions of linear neutral differential ...

    African Journals Online (AJOL)

    The paper considers the contribution of space-time noise to the oscillatory behaviour of solutions of a linear neutral stochastic delay differential equation. It was established that under certain conditions on the time lags and their speed of adjustments, the presence of noise generates oscillation in the solution of the equation ...

  2. Large Amplitude Oscillatory Extension of Soft Polymeric Networks

    DEFF Research Database (Denmark)

    Bejenariu, Anca Gabriela; Rasmussen, Henrik K.; Skov, Anne Ladegaard


    sing a filament stretching rheometer (FSR) surrounded by a thermostatic chamber and equipped with a micrometric laser it is possible to measure large amplitude oscillatory elongation (LAOE) on elastomeric based networks with no base flow as in the LAOE method for polymer melts. Poly(dimethylsilox...

  3. New insights into strobe reactions: An intriguing oscillatory combustion phenomenon

    NARCIS (Netherlands)

    Corbel, J.M.L.


    Strobes are self-sustained oscillatory combustions that have various applications in the fireworks industry and also in the military area (signaling, missile decoys and crowd control). However, most of the strobe compositions were discovered using trial and error methods. The fundamentals mechanisms

  4. Oscillatory magnetoconductance of quantum double-well channels

    International Nuclear Information System (INIS)

    Rojo, A.G.; Kumar, N.; Balseiro, C.A.


    The recently observed flux-periodic interference effect between parallel quantum double-well channels is theoretically studied in a discrete model that takes into account tunneling between channels. We obtain oscillatory magnetoconductance with small modulations which is attributable to the tunneling. Our treatment includes the effect of evanescent modes. (author). 7 refs, 2 figs

  5. On the effect of a longitudinal magnetic field on oscillatory ...

    Indian Academy of Sciences (India)

    . The frequency, ... dinal magnetic field on the oscillatory characteristics of a subnormal region it is proposed to study the variation of ... earth to provide a signal to the oscilloscope (60 MHz digital storage, PM 3350, Phillips). A current meter ...

  6. Non-Steady Oscillatory Flow in Coarse Granular Materials

    DEFF Research Database (Denmark)

    Andersen, O. H.; Gent, M. R. A. van; Meer, J. W. van der


    Stationary and oscillatory flow through coarse granular materials have been investigated experimentally at Delft Hydraulics in their oscillating water tunnel with the objective of determining the coefficients of the extended Forchheimer equation. Cylinders, spheres and different types of rock have....... Further, for the non-stationary term, the virtual mass coefficient will be derived....

  7. Resting-State Oscillatory Activity in Autism Spectrum Disorders (United States)

    Cornew, Lauren; Roberts, Timothy P. L.; Blaskey, Lisa; Edgar, J. Christopher


    Neural oscillatory anomalies in autism spectrum disorders (ASD) suggest an excitatory/inhibitory imbalance; however, the nature and clinical relevance of these anomalies are unclear. Whole-cortex magnetoencephalography data were collected while 50 children (27 with ASD, 23 controls) underwent an eyes-closed resting-state exam. A Fast Fourier…

  8. Oscillations during observations: Dynamic oscillatory networks serving visuospatial attention. (United States)

    Wiesman, Alex I; Heinrichs-Graham, Elizabeth; Proskovec, Amy L; McDermott, Timothy J; Wilson, Tony W


    The dynamic allocation of neural resources to discrete features within a visual scene enables us to react quickly and accurately to salient environmental circumstances. A network of bilateral cortical regions is known to subserve such visuospatial attention functions; however the oscillatory and functional connectivity dynamics of information coding within this network are not fully understood. Particularly, the coding of information within prototypical attention-network hubs and the subsecond functional connections formed between these hubs have not been adequately characterized. Herein, we use the precise temporal resolution of magnetoencephalography (MEG) to define spectrally specific functional nodes and connections that underlie the deployment of attention in visual space. Twenty-three healthy young adults completed a visuospatial discrimination task designed to elicit multispectral activity in visual cortex during MEG, and the resulting data were preprocessed and reconstructed in the time-frequency domain. Oscillatory responses were projected to the cortical surface using a beamformer, and time series were extracted from peak voxels to examine their temporal evolution. Dynamic functional connectivity was then computed between nodes within each frequency band of interest. We find that visual attention network nodes are defined functionally by oscillatory frequency, that the allocation of attention to the visual space dynamically modulates functional connectivity between these regions on a millisecond timescale, and that these modulations significantly correlate with performance on a spatial discrimination task. We conclude that functional hubs underlying visuospatial attention are segregated not only anatomically but also by oscillatory frequency, and importantly that these oscillatory signatures promote dynamic communication between these hubs. Hum Brain Mapp 38:5128-5140, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Oscillatory Störmer-Cowell methods

    NARCIS (Netherlands)

    P.J. van der Houwen; E. Messina; B.P. Sommeijer (Ben)


    textabstractWe consider explicit methods for initial-value problems for special second-order ordinary differential equations where the righthand side does not contain the derivative of ${bf y$ and where the solution components are known to be periodic with frequencies $|omega_j$ lying in a given

  10. Saccadic reaction times to audiovisual stimuli show effects of oscillatory phase reset.

    Directory of Open Access Journals (Sweden)

    Adele Diederich

    Full Text Available Initiating an eye movement towards a suddenly appearing visual target is faster when an accessory auditory stimulus occurs in close spatiotemporal vicinity. Such facilitation of saccadic reaction time (SRT is well-documented, but the exact neural mechanisms underlying the crossmodal effect remain to be elucidated. From EEG/MEG studies it has been hypothesized that coupled oscillatory activity in primary sensory cortices regulates multisensory processing. Specifically, it is assumed that the phase of an ongoing neural oscillation is shifted due to the occurrence of a sensory stimulus so that, across trials, phase values become highly consistent (phase reset. If one can identify the phase an oscillation is reset to, it is possible to predict when temporal windows of high and low excitability will occur. However, in behavioral experiments the pre-stimulus phase will be different on successive repetitions of the experimental trial, and average performance over many trials will show no signs of the modulation. Here we circumvent this problem by repeatedly presenting an auditory accessory stimulus followed by a visual target stimulus with a temporal delay varied in steps of 2 ms. Performing a discrete time series analysis on SRT as a function of the delay, we provide statistical evidence for the existence of distinct peak spectral components in the power spectrum. These frequencies, although varying across participants, fall within the beta and gamma range (20 to 40 Hz of neural oscillatory activity observed in neurophysiological studies of multisensory integration. Some evidence for high-theta/alpha activity was found as well. Our results are consistent with the phase reset hypothesis and demonstrate that it is amenable to testing by purely psychophysical methods. Thus, any theory of multisensory processes that connects specific brain states with patterns of saccadic responses should be able to account for traces of oscillatory activity in observable

  11. Kinetic insights over a PEMFC operating on stationary and oscillatory states. (United States)

    Mota, Andressa; Gonzalez, Ernesto R; Eiswirth, Markus


    Kinetic investigations in the oscillatory state have been carried out in order to shed light on the interplay between the complex kinetics exhibited by a proton exchange membrane fuel cell fed with poisoned H(2) (108 ppm of CO) and the other in serie process. The apparent activation energy (E(a)) in the stationary state was investigated in order to clarify the E(a) observed in the oscillatory state. The apparent activation energy in the stationary state, under potentiostatic control, rendered (a) E(a) ≈ 50-60 kJ mol(-1) over 0.8 V < E < 0.6 V and (b) E(a) ≈ 10 kJ mol(-1) at E = 0.3 V. The former is related to the H(2) adsorption in the vacancies of the surface poisoned by CO and the latter is correlated to the process of proton conductivity in the membrane. The dependence of the period-one oscillations on the temperature yielded a genuine Arrhenius dependence with two E(a) values: (a) E(a) around 70 kJ mol(-1), at high temperatures, and (b) E(a) around 10-15 kJ mol(-1), at lower temperatures. The latter E(a) indicates the presence of protonic mass transport coupled to the essential oscillatory mechanism. These insights point in the right direction to predict spatial couplings between anode and cathode as having the highest strength as well as to speculate the most likely candidates to promote spatial inhomogeneities. © 2011 American Chemical Society

  12. Oscillatory attractors: a new cosmological phase

    Energy Technology Data Exchange (ETDEWEB)

    Bains, Jasdeep S. [Center for the Fundamental Laws of Nature, Harvard University, 17 Oxford St, Cambridge, MA 02138 (United States); Hertzberg, Mark P. [Institute of Cosmology, Department of Physics and Astronomy, Tufts University, 574 Boston Ave, Medford, MA 02155 (United States); Wilczek, Frank, E-mail:, E-mail:, E-mail: [Center for Theoretical Physics, Department of Physics, MIT, 77 Massachusetts Ave, Cambridge, MA 02139 (United States)


    In expanding FRW spacetimes, it is usually the case that homogeneous scalar fields redshift and their amplitudes approach limiting values: Hubble friction usually ensures that the field relaxes to its minimum energy configuration, which is usually a static configuration. Here we discover a class of relativistic scalar field models in which the attractor behavior is the field oscillating indefinitely, with finite amplitude, in an expanding FRW spacetime, despite the presence of Hubble friction. This is an example of spontaneous breaking of time translation symmetry. We find that the effective equation of state of the field has average value ( w )=−1, implying that the field itself could drive an inflationary or dark energy dominated phase. This behavior is reminiscent of ghost condensate models, but in the new models, unlike in the ghost condensate models, the energy-momentum tensor is time dependent, so that these new models embody a more definitive breaking of time translation symmetry. We explore (quantum) fluctuations around the homogeneous background solution, and find that low k -modes can be stable, while high k -modes are typically unstable. We discuss possible interpretations and implications of that instability.

  13. The evolution of a horizontal scale for oscillatory magnetoconvection

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, J O [Monash Univ., Clayton (Australia). Dept. of Mathematics; Lopez, J M [Aeronautical Research Labs., Port Melbourne (Australia). Aerodynamics Div.


    Oscillatory convective motions have been observed in the umbrae of sunspots and, in the past, the linear theory of overstability has been used for sunspot models. Here a non-linear model for oscillatory convection has been used to investigate the possibility of a preferred horizontal cell size for these motions, in the presence of a magnetic field. The integration forward in time, from the conductive state, of the non-linear multimode equations governing magnetoconvection when the magnetic Prandtl number is less than one portrays a complex interaction between the evolving magnetic and vertical velocity horizontal scales. Preferred horizontal scales for the convective cells have been established by identifying the modes that substantially contribute to the overall convective heat transport. All other modes, although initially perturbed, in time essentially decay to zero through self interaction. 8 refs., 5 figs.

  14. Disturbed oscillatory brain dynamics in subcortical ischemic vascular dementia

    Directory of Open Access Journals (Sweden)

    van Straaten Elisabeth CW


    Full Text Available Abstract Background White matter hyperintensities (WMH can lead to dementia but the underlying physiological mechanisms are unclear. We compared relative oscillatory power from electroencephalographic studies (EEGs of 17 patients with subcortical ischemic vascular dementia, based on extensive white matter hyperintensities (SIVD-WMH with 17 controls to investigate physiological changes underlying this diagnosis. Results Differences between the groups were large, with a decrease of relative power of fast activity in patients (alpha power 0.25 ± 0.12 versus 0.38 ± 0.13, p = 0.01; beta power 0.08 ± 0.04 versus 0.19 ± 0.07; p Conclusions This pattern of disturbance in oscillatory brain activity indicate loss of connections between neurons, providing a first step in the understanding of cognitive dysfunction in SIVD-WMH.

  15. Bias-dependent oscillatory electron transport of monatomic sulfur chains

    KAUST Repository

    Yu, Jing-Xin; Cheng, Yan; Sanvito, Stefano; Chen, Xiang-Rong


    The bias-dependent oscillatory electron transport of monatomic sulfur chains sandwiched between gold electrodes is investigated with density functional theory and non-equilibrium Green's function method. At zero bias, in contrast to the typical odd-even oscillations observed in most metallic chains, we find that the conductance oscillates with a period of four atoms. However, as the bias voltage is increased the current displays a two-atom periodicity. This emerges gradually, first for the longer chains and then, at voltages larger than 0.7 V, for lengths. The oscillatory behaviors are analyzed by the density of states and the energy-dependent and bias-dependent transmission coefficients. © 2012 American Institute of Physics.

  16. Oscillatory wake potential with exchange-correlation in plasmas (United States)

    Khan, Arroj A.; Zeba, I.; Jamil, M.; Asif, M.


    The oscillatory wake potential of a moving test charge is studied in quantum dusty plasmas. The plasma system consisting of electrons, ions and negatively charged dust species is embedded in an ambient magnetic field. The modified equation of dispersion is derived using a Quantum Hydrodynamic Model for magnetized plasmas. The quantum effects are inculcated through Fermi degenerate pressure, the tunneling effect and exchange-correlation effects. The study of oscillatory wake is important to know the existence of silence zones in space and astrophysical objects as well as for crystal formation. The graphical description of the potential depicts the significance of the exchange and correlation effects arising through spin and other variables on the wake potential.

  17. A simple mechanical system for studying adaptive oscillatory neural networks

    DEFF Research Database (Denmark)

    Jouffroy, Guillaume; Jouffroy, Jerome

    Central Pattern Generators (CPG) are oscillatory systems that are responsible for generating rhythmic patterns at the origin of many biological activities such as for example locomotion or digestion. These systems are generally modelled as recurrent neural networks whose parameters are tuned so...... that the network oscillates in a suitable way, this tuning being a non trivial task. It also appears that the link with the physical body that these oscillatory entities control has a fundamental importance, and it seems that most bodies used for experimental validation in the literature (walking robots, lamprey...... a brief description of the Roller-Racer, we present as a preliminary study an RNN-based feed-forward controller whose parameters are obtained through the well-known teacher forcing learning algorithm, extended to learn signals with a continuous component....

  18. Bias-dependent oscillatory electron transport of monatomic sulfur chains

    KAUST Repository

    Yu, Jing-Xin


    The bias-dependent oscillatory electron transport of monatomic sulfur chains sandwiched between gold electrodes is investigated with density functional theory and non-equilibrium Green\\'s function method. At zero bias, in contrast to the typical odd-even oscillations observed in most metallic chains, we find that the conductance oscillates with a period of four atoms. However, as the bias voltage is increased the current displays a two-atom periodicity. This emerges gradually, first for the longer chains and then, at voltages larger than 0.7 V, for lengths. The oscillatory behaviors are analyzed by the density of states and the energy-dependent and bias-dependent transmission coefficients. © 2012 American Institute of Physics.

  19. Role of synchronized oscillatory brain activity for human pain perception. (United States)

    Hauck, Michael; Lorenz, Jürgen; Engel, Andreas K


    The understanding of cortical pain processing in humans has significantly improved since the development of modern neuroimaging techniques. Non-invasive electrophysiological approaches such as electro- and magnetoencephalography have proven to be helpful tools for the real-time investigation of neuronal signals and synchronous communication between cortical areas. In particular, time-frequency decomposition of signals recorded with these techniques seems to be a promising approach because different pain-related oscillatory changes can be observed within different frequency bands, which are likely to be linked to specific sensory and motor functions. In this review we discuss the latest evidence on pain-induced time-frequency signals and propose that changes in oscillatory activity reflect an essential communication mechanism in the brain that is modulated during pain processing. The importance of synchronization processes for normal and pathological pain processing, such as chronic pain states, is discussed.

  20. Changes of spontaneous oscillatory activity to tonic heat pain. (United States)

    Peng, Weiwei; Hu, Li; Zhang, Zhiguo; Hu, Yong


    Transient painful stimuli could induce suppression of alpha oscillatory activities and enhancement of gamma oscillatory activities that also could be greatly modulated by attention. Here, we attempted to characterize changes in cortical activities during tonic heat pain perception and investigated the influence of directed/distracted attention on these responses. We collected 5-minute long continuous Electroencephalography (EEG) data from 38 healthy volunteers during four conditions presented in a counterbalanced order: (A) resting condition; (B) innoxious-distracted condition; (C) noxious-distracted condition; (D) noxious-attended condition. The effects of tonic heat pain stimulation and selective attention on oscillatory activities were investigated by comparing the EEG power spectra among the four experimental conditions and assessing the relationship between spectral power difference and subjective pain intensity. The change of oscillatory activities in condition D was characterized by stable and persistent decrease of alpha oscillation power over contralateral-central electrodes and widespread increase of gamma oscillation power, which were even significantly correlated with subjective pain intensity. Since EEG responses in the alpha and gamma frequency band were affected by attention in different manners, they are likely related to different aspects of the multidimensional sensory experience of pain. The observed contralateral-central alpha suppression (conditions D vs. B and D vs. C) may reflect primarily a top-down cognitive process such as attention, while the widespread gamma enhancement (conditions D vs. A) may partly reflect tonic pain processing, representing the summary effects of bottom-up stimulus-related and top-down subject-driven cognitive processes.

  1. Changes of spontaneous oscillatory activity to tonic heat pain.

    Directory of Open Access Journals (Sweden)

    Weiwei Peng

    Full Text Available Transient painful stimuli could induce suppression of alpha oscillatory activities and enhancement of gamma oscillatory activities that also could be greatly modulated by attention. Here, we attempted to characterize changes in cortical activities during tonic heat pain perception and investigated the influence of directed/distracted attention on these responses. We collected 5-minute long continuous Electroencephalography (EEG data from 38 healthy volunteers during four conditions presented in a counterbalanced order: (A resting condition; (B innoxious-distracted condition; (C noxious-distracted condition; (D noxious-attended condition. The effects of tonic heat pain stimulation and selective attention on oscillatory activities were investigated by comparing the EEG power spectra among the four experimental conditions and assessing the relationship between spectral power difference and subjective pain intensity. The change of oscillatory activities in condition D was characterized by stable and persistent decrease of alpha oscillation power over contralateral-central electrodes and widespread increase of gamma oscillation power, which were even significantly correlated with subjective pain intensity. Since EEG responses in the alpha and gamma frequency band were affected by attention in different manners, they are likely related to different aspects of the multidimensional sensory experience of pain. The observed contralateral-central alpha suppression (conditions D vs. B and D vs. C may reflect primarily a top-down cognitive process such as attention, while the widespread gamma enhancement (conditions D vs. A may partly reflect tonic pain processing, representing the summary effects of bottom-up stimulus-related and top-down subject-driven cognitive processes.

  2. On oscillatory magnetoconvection in a nanofluid layer in the presence of internal heat source and Soret effect (United States)

    Khalid, Izzati Khalidah; Mokhtar, Nor Fadzillah Mohd; Bakri, Nur Amirah; Siri, Zailan; Ibrahim, Zarina Bibi; Gani, Siti Salwa Abd


    The onset of oscillatory magnetoconvection for an infinite horizontal nanofluid layer subjected to Soret effect and internal heat source heated from below is examined theoretically with the implementation of linear stability theory. Two important properties that are thermophoresis and Brownian motion are included in the model and three types of lower-upper bounding systems of the model: rigid-rigid, rigid-free as well as free-free boundaries are examined. Eigenvalue equations are gained from a normal mode analysis and executed using Galerkin technique. Magnetic field effect, internal heat source effect, Soret effect and other nanofluid parameters on the oscillatory convection are presented graphically. For oscillatory mode, it is found that the effect of internal heat source is quite significant for small values of the non-dimensional parameter and elevating the internal heat source speed up the onset of convection. Meanwhile, the increasing of the strength of magnetic field in a nanofluid layer reduced the rate of thermal instability and sustain the stabilization of the system. For the Soret effect, the onset of convection in the system is accelerated when the values of the Soret effect is increased.

  3. Abnormal language-related oscillatory responses in primary progressive aphasia

    Directory of Open Access Journals (Sweden)

    A. Kielar

    Full Text Available Patients with Primary Progressive Aphasia (PPA may react to linguistic stimuli differently than healthy controls, reflecting degeneration of language networks and engagement of compensatory mechanisms. We used magnetoencephalography (MEG to evaluate oscillatory neural responses in sentence comprehension, in patients with PPA and age-matched controls. Participants viewed sentences containing semantically and syntactically anomalous words that evoke distinct oscillatory responses. For age-matched controls, semantic anomalies elicited left-lateralized 8–30 Hz power decreases distributed along ventral brain regions, whereas syntactic anomalies elicited bilateral power decreases in both ventral and dorsal regions. In comparison to controls, patients with PPA showed altered patterns of induced oscillations, characterized by delayed latencies and attenuated amplitude, which were correlated with linguistic impairment measured offline. The recruitment of right hemisphere temporo-parietal areas (also found in controls was correlated with preserved semantic processing abilities, indicating that preserved neural activity in these regions was able to support successful semantic processing. In contrast, syntactic processing was more consistently impaired in PPA, regardless of neural activity patterns, suggesting that this domain of language is particularly vulnerable to the neuronal loss. In addition, we found that delayed peak latencies of oscillatory responses were associated with lower accuracy for detecting semantic anomalies, suggesting that language deficits observed in PPA may be linked to delayed or slowed information processing. Keywords: MEG oscillations, Primary progressive aphasia (PPA, Sentence comprehension

  4. Effects from Unsaturated Zone Flow during Oscillatory Hydraulic Testing (United States)

    Lim, D.; Zhou, Y.; Cardiff, M. A.; Barrash, W.


    In analyzing pumping tests on unconfined aquifers, the impact of the unsaturated zone is often neglected. Instead, desaturation at the water table is often treated as a free-surface boundary, which is simple and allows for relatively fast computation. Richards' equation models, which account for unsaturated flow, can be compared with saturated flow models to validate the use of Darcy's Law. In this presentation, we examine the appropriateness of using fast linear steady-periodic models based on linearized water table conditions in order to simulate oscillatory pumping tests in phreatic aquifers. We compare oscillatory pumping test models including: 1) a 2-D radially-symmetric phreatic aquifer model with a partially penetrating well, simulated using both Darcy's Law and Richards' Equation in COMSOL; and 2) a linear phase-domain numerical model developed in MATLAB. Both COMSOL and MATLAB models are calibrated to match oscillatory pumping test data collected in the summer of 2013 at the Boise Hydrogeophysical Research Site (BHRS), and we examine the effect of model type on the associated parameter estimates. The results of this research will aid unconfined aquifer characterization efforts and help to constrain the impact of the simplifying physical assumptions often employed during test analysis.

  5. [Recent results in research on oscillatory chemical reactions]. (United States)

    Poros, Eszter; Kurin-Csörgei, Krisztina


    The mechanisms of the complicated periodical phenomenas in the nature (e.g. hearth beat, sleep cycle, circadian rhythms, etc) could be understood with using the laws of nonlinear chemical systems. In this article the newest result in the research of the subfield of nonlinear chemical dynamics aimed at constructing oscillatory chemical reactions, which are novel either in composition or in configuration, are presented. In the introductory part the concept of chemical periodicity is defined, then the forms as it can appear in time and space and the methods of their study are discussed. Detailed description of the experimental work that has resulted in two significant discoveries is provided. A method was developed to design pH-oscillators which are capable of operating under close conditions. The batch pH-oscillators are more convenient to use in some proposed applications than the equivalent CSTR variant. A redox oscillator that is new in composition was found. The permanganate oxidation of some amino acids was shown to take place according to oscillatory kinetics in a narrow range of the experimental parameters. The KMnO4 - glycine - Na2HPO4 system represents the first example in the family of manganese based oscillators where amino acids is involved. In the conclusion formal analogies between the simple chemical and some more complicated biological oscillatory phenomena are mentioned and the possibility of modeling periodic processes with the use of information gained from the studies of chemical oscillations is pointed out.

  6. Cerebral oscillatory activity during simulated driving using MEG

    Directory of Open Access Journals (Sweden)

    Kotoe eSakihara


    Full Text Available We aimed to examine cerebral oscillatory differences associated with psychological processes during simulated car driving. We recorded neuromagnetic signals in 14 healthy volunteers using magnetoencephalography (MEG during simulated driving. MEG data were analyzed using synthetic aperture magnetometry to detect the spatial distribution of cerebral oscillations. Group effects between subjects were analyzed statistically using a nonparametric permutation test. Oscillatory differences were calculated by comparison between passive viewing and active driving. Passive viewing was the baseline, and oscillatory differences during active driving showed an increase or decrease in comparison with a baseline. Power increase in the theta band was detected in the superior frontal gyrus (SFG during active driving. Power decreases in the alpha, beta, and low gamma bands were detected in the right inferior parietal lobe (IPL, left postcentral gyrus (PoCG, middle temporal gyrus (MTG, and posterior cingulate gyrus (PCiG during active driving. Power increase in the theta band in the SFG may play a role in attention. Power decrease in the right IPL may reflect selectively divided attention and visuospatial processing, whereas that in the left PoCG reflects sensorimotor activation related to driving manipulation. Power decreases in the MTG and PCiG may be associated with object recognition.

  7. Bray–Liebhafsky oscillatory reaction in the radiofrequency electromagnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Stanisavljev, Dragomir R., E-mail: [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, P.O. Box 473, 11001 Belgrade (Serbia); Velikić, Zoran [Institute of Physics, University of Belgrade, Pregrevica 118, Zemun (Serbia); Veselinović, Dragan S.; Jacić, Nevena V.; Milenković, Maja C. [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, P.O. Box 473, 11001 Belgrade (Serbia)


    Highlights: • Oscillatory Bray–Liebhafsky reaction is coupled with the radiofrequency radiation. • The effects of radiofrequency field on oscillatory parameters are investigated. • Radiofrequency power of up to the 0.2 W did not produced observable changes. • The explanation related with dissipative and capacitive effects is given. • Open the possibility of investigations of reactive effects on biological systems. - Abstract: Oscillatory Bray–Liebhafsky (BL) reaction is capacitively coupled with the electromagnetic radiation in the frequency range 60–110 MHz. Because of the specific reaction dynamics characterized by several characteristic parameters (induction period, period between chemical oscillations and their amplitude) it served as a good model system for the investigation of the effects of radiofrequent (RF) radiation. RF power of up to 0.2 W did not produce observable changes of the BL reaction parameters in the limit of the experiment reproductivity. Results indicate that, under the given experimental conditions, both dissipative and reactive properties of the solution are not considerably coupled with the RF electrical field.

  8. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo


    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  9. Power thresholds for fast oscillatory instabilities in nuclear reactors: a simple mathematical model

    International Nuclear Information System (INIS)

    Suarez-Antola, Roberto; Uruguay)


    The cores of nuclear reactors, including its structural parts and cooling fluids, are complex mechanical systems able to vibrate in a set of normal modes and frequencies, if suitable perturbed. The cyclic variations in the strain state of the core materials may modify the reactivity, and thus thermal power, producing variations in strain due to thermal-elastic effects. If the variation of the temperature field is fast enough and if the Doppler Effect and other stabilizing prompt effects in the fuel are weak enough, a fast oscillatory instability could be produced, coupled with mechanical vibrations of small enough amplitude that they will not be excluded by the procedures of conventional mechanical design. After a careful discussion of the time scales of neutron kinetics, thermal-elastic and vibration phenomena, a simple lumped parameter mathematical model is constructed in order to study, in a first approximation, the stability of the reactor. An integro-differential equation for power kinetics is derived. Under certain conditions, fast oscillatory instabilities are found when power is greater than a threshold value, and the delay in the global power feedback loop is big enough. Approximate analytical formulae are given for the power threshold, critical delay and power oscillation frequency. It is shown that if prompt stabilizing fuel effects are strong enough, dangerous fast power oscillations due to mechanical thermal-nuclear coupling phenomena can not appear at any power level. (author)

  10. Verification of an interaction model of an ultrasonic oscillatory system with periodontal tissues

    Directory of Open Access Journals (Sweden)

    V. A. Karpuhin


    Full Text Available Verification of an interaction model of an ultrasonic oscillatory system with biological tissues which was developed in COMSOL Multiphysics was carried out. It was shown that calculation results in COMSOL Multiphysics obtained using the “Finer” grid (the ratio of the grid step to a minimum transversal section area of the model ≤ 0.3 mm-1 best of all qualitatively and quantitatively corresponded to practical results. The average relative error of the obtained results in comparison with the experimental ones did not exceed 4.0%. Influence of geometrical parameters (thickness of load on electrical admittance of the ultrasonic oscillatory system interacting with biological tissues was investigated. It was shown that increase in thickness of load within the range from 0 to 95 mm led to decrease in calculated values of natural resonance frequency of longitudinal fluctuations and electrical admittance from 26,58 to 26,35 kHz and from 0,86 to 0,44 mS.

  11. Direct Numerical Simulation of Oscillatory Flow Over a Wavy, Rough, and Permeable Bottom (United States)

    Mazzuoli, Marco; Blondeaux, Paolo; Simeonov, Julian; Calantoni, Joseph


    The results of a direct numerical simulation of oscillatory flow over a wavy bottom composed of different layers of spherical particles are described. The amplitude of wavy bottom is much smaller in scale than typical bed forms such as sand ripples. The spherical particles are packed in such a way to reproduce a bottom profile observed during an experiment conducted in a laboratory flow tunnel with well-sorted coarse sand. The amplitude and period of the external forcing flow as well as the size of the particles are set equal to the experimental values and the computed velocity field is compared with the measured velocity profiles. The direct numerical simulation allows for the evaluation of quantities, which are difficult to measure in a laboratory experiment (e.g., vorticity, seepage flow velocity, and hydrodynamic force acting on sediment particles). In particular, attention is focused on the coherent vortex structures generated by the vorticity shed by both the spherical particles and the bottom waviness. Results show that the wavy bottom triggers transition to turbulence. Moreover, the forces acting on the spherical particles are computed to investigate the mechanisms through which they are possibly mobilized by the oscillatory flow. It was found that forces capable of mobilizing surface particles are strongly correlated with the particle position above the mean bed elevation and the passage of coherent vortices above them.

  12. Abnormal Task Modulation of Oscillatory Neural Activity in Schizophrenia

    Directory of Open Access Journals (Sweden)

    Elisa C Dias


    Full Text Available Schizophrenia patients have deficits in cognitive function that are a core feature of the disorder. AX-CPT is commonly used to study cognition in schizophrenia, and patients have characteristic pattern of behavioral and ERP response. In AX-CPT subjects respond when a flashed cue A is followed by a target X, ignoring other letter combinations. Patients show reduced hit rate to go trials, and increased false alarms to sequences that require inhibition of a prepotent response. EEG recordings show reduced sensory (P1/N1, as well as later cognitive components (N2, P3, CNV. Behavioral deficits correlate most strongly with sensory dysfunction. Oscillatory analyses provide critical information regarding sensory/cognitive processing over and above standard ERP analyses. Recent analyses of induced oscillatory activity in single trials during AX-CPT in healthy volunteers showed characteristic response patterns in theta, alpha and beta frequencies tied to specific sensory and cognitive processes. Alpha and beta modulated during the trials and beta modulation over the frontal cortex correlated with reaction time. In this study, EEG data was obtained from 18 schizophrenia patients and 13 controls during AX-CPT performance, and single trial decomposition of the signal yielded power in the target wavelengths.Significant task-related event-related desynchronization (ERD was observed in both alpha and beta frequency bands over parieto-occipital cortex related to sensory encoding of the cue. This modulation was reduced in patients for beta, but not for alpha. In addition, significant beta ERD was observed over motor cortex, related to motor preparation for the response, and was also reduced in patients. These findings demonstrate impaired dynamic modulation of beta frequency rhythms in schizophrenia, and suggest that failures of oscillatory activity may underlie impaired sensory information processing in schizophrenia that in turn contributes to cognitive deficits.

  13. The Oscillatory Nature of Rotating Convection in Liquid Metal (United States)

    Aurnou, J. M.; Bertin, V. L.; Grannan, A. M.


    Earth's magnetic field is assumed to be generated by fluid motions in its liquid metal core. In this fluid, the heat diffuses significantly more than momentum and thus, the ratio of these two diffusivities, the Prandtl number Pr=ν/Κ, is well below unity. The convective flow dynamics of liquid metal is very different from Pr ≈ 1 fluids like water and those used in current dynamo simulations. In order to characterize rapidly rotating thermal convection in low Pr number fluids, we have performed laboratory experiments in a cylinder using liquid gallium (Pr ≈ 0.023) as the working fluid. The Ekman number, which characterizes the effect of rotation, varies from E = 4 10-5 to 4 10-6 and the dimensionless buoyancy forcing (Rayleigh number, Ra) varies from Ra =3 105 to 2 107. Using heat transfer measurements (Nusselt number, Nu) as well as temperature measurements within the fluid, we characterize the different styles of low Pr rotating convective flow. The convection threshold is first overcome in the form of a container scale inertial oscillatory mode. At stronger forcing, wall-localized modes are identified for the first time in liquid metal laboratory experiments. These wall modes coexist with the bulk inertial oscillatory modes. When the strengh of the buoyancy increases, the bulk flow becomes turbulent while the wall modes remain. Our results imply that rotating convective flows in liquid metals do not develop in the form of quasi-steady columns, as in Pr ≈ 1 dynamo models, but in the form of oscillatory motions. Therefore, the flows that drive thermally-driven dynamo action in low Pr geophysical and astrophysical fluids can differ substantively than those occuring in current-day Pr ≈ 1 numerical models. In addition, our results suggest that relatively low wavenumber, wall-attached modes may be dynamically important in rapidly-rotating convection in liquid metals.

  14. Characterization of vertical mixing in oscillatory vegetated flows (United States)

    Abdolahpour, M.; Ghisalberti, M.; Lavery, P.; McMahon, K.


    Seagrass meadows are primary producers that provide important ecosystem services, such as improved water quality, sediment stabilisation and trapping and recycling of nutrients. Most of these ecological services are strongly influenced by the vertical exchange of water across the canopy-water interface. That is, vertical mixing is the main hydrodynamic process governing the large-scale ecological and environmental impact of seagrass meadows. The majority of studies into mixing in vegetated flows have focused on steady flow environments whereas many coastal canopies are subjected to oscillatory flows driven by surface waves. It is known that the rate of mass transfer will vary greatly between unidirectional and oscillatory flows, necessitating a specific investigation of mixing in oscillatory canopy flows. In this study, we conducted an extensive laboratory investigation to characterise the rate of vertical mixing through a vertical turbulent diffusivity (Dt,z). This has been done through gauging the evolution of vertical profiles of concentration (C) of a dye sheet injected into a wave-canopy flow. Instantaneous measurement of the variance of the vertical concentration distribution ( allowed the estimation of a vertical turbulent diffusivity (). Two types of model canopies, rigid and flexible, with identical heights and frontal areas, were subjected to a wide and realistic range of wave height and period. The results showed two important mechanisms that dominate vertical mixing under different conditions: a shear layer that forms at the top of the canopy and wake turbulence generated by the stems. By allowing a coupled contribution of wake and shear layer mixing, we present a relationship that can be used to predict the rate of vertical mixing in coastal canopies. The results further showed that the rate of vertical mixing within flexible vegetation was always lower than the corresponding rigid canopy, confirming the impact of plant flexibility on canopy

  15. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe


    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  16. A design method of oscillatory De-Qing circuit

    International Nuclear Information System (INIS)

    Feng Wenquan


    With some particular advantages the oscillatory De-Qing circuit now is widely used. However its design is very complex. By means of a quantitative analysis for this circuit a group of design formulas is obtained. According to these design formulas the maximum allowable charging inductance L c , the De-Qing network resistance R and capacitance C can easily be determined, if the PFN capacitance C N , the maximum pulse frequency F max , and percentage regulation η are given. Simple and direct formulas for specific situation are listed. Finally, a design example is given and a comparison with experimental result is made, which shows that the design method is feasible and reliable

  17. Chaotic wave trains in an oscillatory/excitable medium

    International Nuclear Information System (INIS)

    Rabinovitch, A.; Gutman, M.; Biton, Y.; Aviram, I.


    We study the chaotic dynamics of a heterogeneous reaction-diffusion medium composed of two uniform regions: one oscillatory, and the other excitable. It is shown that, by altering the diffusion coefficient, local chaotic oscillations can be induced at the interface between regions, which in turn, generate different chaotic sequences of pulses traveling in the excitable region. We analyze the properties of the local chaotic driver, as well as the diffusion-induced transitions. A procedure based on the abnormal frequency-locking phenomenon is proposed for controlling such sequences. Relevance of the obtained results to cardiac dynamics is briefly discussed

  18. Dynamics of a population of oscillatory and excitable elements. (United States)

    O'Keeffe, Kevin P; Strogatz, Steven H


    We analyze a variant of a model proposed by Kuramoto, Shinomoto, and Sakaguchi for a large population of coupled oscillatory and excitable elements. Using the Ott-Antonsen ansatz, we reduce the behavior of the population to a two-dimensional dynamical system with three parameters. We present the stability diagram and calculate several of its bifurcation curves analytically, for both excitatory and inhibitory coupling. Our main result is that when the coupling function is broad, the system can display bistability between steady states of constant high and low activity, whereas when the coupling function is narrow and inhibitory, one of the states in the bistable regime can show persistent pulsations in activity.

  19. Oscillatory squeeze flow for the study of linear viscoelastic behavior

    DEFF Research Database (Denmark)

    Wingstrand, Sara Lindeblad; Alvarez, Nicolas J.; Hassager, Ole


    of molten polymers and suspensions. The principal advantage of squeeze flow rheometer over rotational devices is the simplicity of the apparatus. It has no air bearing and is much less expensive and easier to use. Accuracy may be somewhat reduced, but for quality control purposes, it could be quite useful....... It might also find application as the central component of a high-throughput rheometer for evaluating experimental materials. The deformation is not simple shear, but equations have been derived to show that the oscillatory compressive (normal) force that is measured can serve as a basis for calculating...

  20. Molecular dynamics simulations of oscillatory flows in microfluidic channels

    DEFF Research Database (Denmark)

    Hansen, J.S.; Ottesen, Johnny T.


    In this paper we apply the direct non-equilibrium molecular dynamics technique to oscillatory flows of fluids in microscopic channels. Initially, we show that the microscopic simulations resemble the macroscopic predictions based on the Navier–Stokes equation very well for large channel width, high...... density and low temperature. Further simulations for high temperature and low density show that the non-slip boundary condition traditionally used in the macroscopic equation is greatly compromised when the fluid–wall interactions are the same as the fluid–fluid interactions. Simulations of a system...

  1. Ultrafine grained Cu processed by compression with oscillatory torsion


    K. Rodak


    Purpose: The aim of this work is a study of Cu microstructure after severe plastic deformation process by usingcompression with oscillatory torsion test.Design/methodology/approach: Cu samples were deformed at torsion frequency (f) changed from 0 Hz(compression) to 1.8 Hz under a constant torsion angle (α) ≈8° and compression speed (v)=0.1mm/s. Structuralinvestigations were conducted by using light microscopy (LM) and transmission electron microscopy (TEM).Findings: The structural analysis ma...

  2. Abelian Chern-Simons theory and linking numbers via oscillatory integrals

    International Nuclear Information System (INIS)

    Albeverio, S.; Schaefer, J.


    We introduce a rigorous mathematical model of abelian Chern-Simons theory based on the theory of infinite dimensional oscillatory integrals developed by Albeverio and Hoeegh-Krohn. We construct a gauge-fixed Chern-Simons path integral as a Fresnel integral in a certain Hilbert space. Wilson loop variables are defined as Fresnel integrable functions and it is shown in this context that the expectation value of products of Wilson loops w.r.t. the Chern-Simons path integral is a topological invariant which can be computed in terms of pairwise linking numbers of the loops, as conjectured by Witten. We also propose a lattice Chern-Simons action which converges to the continuum limit. (orig.)

  3. A learning algorithm for oscillatory cellular neural networks. (United States)

    Ho, C Y.; Kurokawa, H


    We present a cellular type oscillatory neural network for temporal segregation of stationary input patterns. The model comprises an array of locally connected neural oscillators with connections limited to a 4-connected neighborhood. The architecture is reminiscent of the well-known cellular neural network that consists of local connection for feature extraction. By means of a novel learning rule and an initialization scheme, global synchronization can be accomplished without incurring any erroneous synchrony among uncorrelated objects. Each oscillator comprises two mutually coupled neurons, and neurons share a piecewise-linear activation function characteristic. The dynamics of traditional oscillatory models is simplified by using only one plastic synapse, and the overall complexity for hardware implementation is reduced. Based on the connectedness of image segments, it is shown that global synchronization and desynchronization can be achieved by means of locally connected synapses, and this opens up a tremendous application potential for the proposed architecture. Furthermore, by using special grouping synapses it is demonstrated that temporal segregation of overlapping gray-level and color segments can also be achieved. Finally, simulation results show that the learning rule proposed circumvents the problem of component mismatches, and hence facilitates a large-scale integration.

  4. Evidence of nonuniqueness and oscillatory solutions in computational fluid mechanics

    International Nuclear Information System (INIS)

    Nunziato, J.W.; Gartling, D.K.; Kipp, M.E.


    We will review some of our recent experiences in computing solutions for nonlinear fluids in relatively simple, two-dimensional geometries. The purpose of this discussion will be to display by example some of the interesting but difficult questions that arise when ill-behaved solutions are obtained numerically. We will consider two examples. As the first example, we will consider a nonlinear elastic (compressible) fluid with chemical reactions and discuss solutions for detonation and detonation failure in a two-dimensional cylinder. In this case, the numerical algorithm utilizes a finite-difference method with artificial viscosity (von Neumann-Richtmyer method) and leads to two, distinctly different, stable solutions depending on the time step criterion used. The second example to be considered involves the convection of a viscous fluid in a rectangular container as a result of an exothermic polymerization reaction. A solidification front develops near the top of the container and propagates down through the fluid, changing the aspect ratio of the region ahead of the front. Using a Galerkin-based finite element method, a numerical solution of the partial differential equations is obtained which tracks the front and correctly predicts the fluid temperatures near the walls. However, the solution also exhibits oscillatory behavior with regard to the number of cells in the fluid ahead of the front and in the strength of the cells. More definitive experiments and analysis are required to determine whether this oscillatory phenomena is a numerical artifact or a physical reality. 20 refs., 14 figs

  5. Propulsion of a microsubmarine using a thermally oscillatory approach

    International Nuclear Information System (INIS)

    Qiao, Lei; Luo, Cheng


    In this paper, motivated by the driving mechanism of a putt-putt toy boat, we explore the feasibility to propel a microsubmarine using a thermally oscillatory approach, which only requires a simple design and does not involve any complicated propulsive systems. We investigate the design, fabrication, actuation and horizontal motions of the corresponding microsubmarines. Based on the understanding gained through preliminary tests on two manually fabricated putt-putt boats, we designed and fabricated the prototype of a microsubmarine. Similar to a putt-putt boat, the prototype also uses a thermally oscillatory process for propulsion. In a cyclic period of this process, due to the expansion and shrinkage of a vapor bubble inside the reservoir of the submarine, liquid is first ejected outside and then sucked into the reservoir. Due to the difference in liquid flow directions between ejection and suction stages, a thrust is produced to propel the submarine. At an applied voltage of 16 V and pulse frequency of 100 Hz, the submarine was found to have the highest speed of 1.8 mm s −1 and longest travel distance of 12.6 mm. The corresponding thrust was estimated to be 67.6 nN. (paper)

  6. Frequency-dependent oscillatory neural profiles during imitation. (United States)

    Sugata, Hisato; Hirata, Masayuki; Tamura, Yuichi; Onishi, Hisao; Goto, Tetsu; Araki, Toshihiko; Yorifuji, Shiro


    Imitation is a complex process that includes higher-order cognitive and motor function. This process requires an observation-execution matching system that transforms an observed action into an identical movement. Although the low-gamma band is thought to reflect higher cognitive processes, no studies have focused on it. Here, we used magnetoencephalography (MEG) to examine the neural oscillatory changes including the low-gamma band during imitation. Twelve healthy, right-handed participants performed a finger task consisting of four conditions (imitation, execution, observation, and rest). During the imitation and execution conditions, significant event-related desynchronizations (ERDs) were observed at the left frontal, central, and parietal MEG sensors in the alpha, beta, and low-gamma bands. Functional connectivity analysis at the sensor level revealed an imitation-related connectivity between a group of frontal sensors and a group of parietal sensors in the low-gamma band. Furthermore, source reconstruction with synthetic aperture magnetometry showed significant ERDs in the low-gamma band in the left sensorimotor area and the middle frontal gyrus (MFG) during the imitation condition when compared with the other three conditions. Our results suggest that the oscillatory neural activities of the low-gamma band at the sensorimotor area and MFG play an important role in the observation-execution matching system related to imitation.

  7. Reflood modeling under oscillatory flow conditions with Cathare

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, J M; Bartak, J; Janicot, A


    The problems and the current status in oscillatory reflood modelling with the CATHARE code are presented. The physical models used in CATHARE for reflood modelling predicted globally very well the forced reflood experiments. Significant drawbacks existed in predicting experiments with oscillatory flow (both forced and gravity driven). First, the more simple case of forced flow oscillations was analyzed. Modelling improvements within the reflooding package resolved the problem of quench front blockages and unphysical oscillations. Good agreements with experiment for the ERSEC forced oscillations reflood tests is now obtained. For gravity driven reflood, CATHARE predicted sustained flow oscillations during 100-150 s after the start of the reflood, whereas in the experiment flow oscillations were observed only during 25-30 s. Possible areas of modeling improvements are identified and several new correlations are suggested. The first test calculations of the BETHSY test 6.7A4 have shown that the oscillations are mostly sensitive to heat flux modeling downstream of the quench front. A much better agreement between CATHARE results and the experiment was obtained. However, further effort is necessary to obtain globally satisfactory predictions of gravity driven system reflood tests. (authors) 6 figs., 35 refs.

  8. Cellular and oscillatory substrates of fear extinction learning. (United States)

    Davis, Patrick; Zaki, Yosif; Maguire, Jamie; Reijmers, Leon G


    The mammalian brain contains dedicated circuits for both the learned expression and suppression of fear. These circuits require precise coordination to facilitate the appropriate expression of fear behavior, but the mechanisms underlying this coordination remain unclear. Using a combination of chemogenetics, activity-based neuronal-ensemble labeling and in vivo electrophysiology, we found that fear extinction learning confers on parvalbumin-expressing (PV) interneurons in the basolateral amygdala (BLA) a dedicated role in the selective suppression of a previously encoded fear memory and BLA fear-encoding neurons. In addition, following extinction learning, PV interneurons enable a competing interaction between a 6-12 Hz oscillation and a fear-associated 3-6 Hz oscillation within the BLA. Loss of this competition increases a 3-6 Hz oscillatory signature, with BLA→medial prefrontal cortex directionality signaling the recurrence of fear expression. The discovery of cellular and oscillatory substrates of fear extinction learning that critically depend on BLA PV interneurons could inform therapies aimed at preventing the pathological recurrence of fear following extinction learning.

  9. Brain oscillatory substrates of visual short-term memory capacity. (United States)

    Sauseng, Paul; Klimesch, Wolfgang; Heise, Kirstin F; Gruber, Walter R; Holz, Elisa; Karim, Ahmed A; Glennon, Mark; Gerloff, Christian; Birbaumer, Niels; Hummel, Friedhelm C


    The amount of information that can be stored in visual short-term memory is strictly limited to about four items. Therefore, memory capacity relies not only on the successful retention of relevant information but also on efficient suppression of distracting information, visual attention, and executive functions. However, completely separable neural signatures for these memory capacity-limiting factors remain to be identified. Because of its functional diversity, oscillatory brain activity may offer a utile solution. In the present study, we show that capacity-determining mechanisms, namely retention of relevant information and suppression of distracting information, are based on neural substrates independent of each other: the successful maintenance of relevant material in short-term memory is associated with cross-frequency phase synchronization between theta (rhythmical neural activity around 5 Hz) and gamma (> 50 Hz) oscillations at posterior parietal recording sites. On the other hand, electroencephalographic alpha activity (around 10 Hz) predicts memory capacity based on efficient suppression of irrelevant information in short-term memory. Moreover, repetitive transcranial magnetic stimulation at alpha frequency can modulate short-term memory capacity by influencing the ability to suppress distracting information. Taken together, the current study provides evidence for a double dissociation of brain oscillatory correlates of visual short-term memory capacity.

  10. Reflood modeling under oscillatory flow conditions with Cathare

    International Nuclear Information System (INIS)

    Kelly, J.M.; Bartak, J.; Janicot, A.


    The problems and the current status in oscillatory reflood modelling with the CATHARE code are presented. The physical models used in CATHARE for reflood modelling predicted globally very well the forced reflood experiments. Significant drawbacks existed in predicting experiments with oscillatory flow (both forced and gravity driven). First, the more simple case of forced flow oscillations was analyzed. Modelling improvements within the reflooding package resolved the problem of quench front blockages and unphysical oscillations. Good agreements with experiment for the ERSEC forced oscillations reflood tests is now obtained. For gravity driven reflood, CATHARE predicted sustained flow oscillations during 100-150 s after the start of the reflood, whereas in the experiment flow oscillations were observed only during 25-30 s. Possible areas of modeling improvements are identified and several new correlations are suggested. The first test calculations of the BETHSY test 6.7A4 have shown that the oscillations are mostly sensitive to heat flux modeling downstream of the quench front. A much better agreement between CATHARE results and the experiment was obtained. However, further effort is necessary to obtain globally satisfactory predictions of gravity driven system reflood tests. (authors) 6 figs., 35 refs

  11. Understanding the Generation of Network Bursts by Adaptive Oscillatory Neurons

    Directory of Open Access Journals (Sweden)

    Tanguy Fardet


    Full Text Available Experimental and numerical studies have revealed that isolated populations of oscillatory neurons can spontaneously synchronize and generate periodic bursts involving the whole network. Such a behavior has notably been observed for cultured neurons in rodent's cortex or hippocampus. We show here that a sufficient condition for this network bursting is the presence of an excitatory population of oscillatory neurons which displays spike-driven adaptation. We provide an analytic model to analyze network bursts generated by coupled adaptive exponential integrate-and-fire neurons. We show that, for strong synaptic coupling, intrinsically tonic spiking neurons evolve to reach a synchronized intermittent bursting state. The presence of inhibitory neurons or plastic synapses can then modulate this dynamics in many ways but is not necessary for its appearance. Thanks to a simple self-consistent equation, our model gives an intuitive and semi-quantitative tool to understand the bursting behavior. Furthermore, it suggests that after-hyperpolarization currents are sufficient to explain bursting termination. Through a thorough mapping between the theoretical parameters and ion-channel properties, we discuss the biological mechanisms that could be involved and the relevance of the explored parameter-space. Such an insight enables us to propose experimentally-testable predictions regarding how blocking fast, medium or slow after-hyperpolarization channels would affect the firing rate and burst duration, as well as the interburst interval.

  12. Frequency-dependent oscillatory neural profiles during imitation (United States)

    Sugata, Hisato; Hirata, Masayuki; Tamura, Yuichi; Onishi, Hisao; Goto, Tetsu; Araki, Toshihiko; Yorifuji, Shiro


    Imitation is a complex process that includes higher-order cognitive and motor function. This process requires an observation-execution matching system that transforms an observed action into an identical movement. Although the low-gamma band is thought to reflect higher cognitive processes, no studies have focused on it. Here, we used magnetoencephalography (MEG) to examine the neural oscillatory changes including the low-gamma band during imitation. Twelve healthy, right-handed participants performed a finger task consisting of four conditions (imitation, execution, observation, and rest). During the imitation and execution conditions, significant event-related desynchronizations (ERDs) were observed at the left frontal, central, and parietal MEG sensors in the alpha, beta, and low-gamma bands. Functional connectivity analysis at the sensor level revealed an imitation-related connectivity between a group of frontal sensors and a group of parietal sensors in the low-gamma band. Furthermore, source reconstruction with synthetic aperture magnetometry showed significant ERDs in the low-gamma band in the left sensorimotor area and the middle frontal gyrus (MFG) during the imitation condition when compared with the other three conditions. Our results suggest that the oscillatory neural activities of the low-gamma band at the sensorimotor area and MFG play an important role in the observation-execution matching system related to imitation. PMID:28393878

  13. An improved weighted essentially non-oscillatory scheme for hyperbolic conservation laws (United States)

    Borges, Rafael; Carmona, Monique; Costa, Bruno; Don, Wai Sun


    In this article we develop an improved version of the classical fifth-order weighted essentially non-oscillatory finite difference scheme of [G.S. Jiang, C.W. Shu, Efficient implementation of weighted ENO schemes, J. Comput. Phys. 126 (1996) 202-228] (WENO-JS) for hyperbolic conservation laws. Through the novel use of a linear combination of the low order smoothness indicators already present in the framework of WENO-JS, a new smoothness indicator of higher order is devised and new non-oscillatory weights are built, providing a new WENO scheme (WENO-Z) with less dissipation and higher resolution than the classical WENO. This new scheme generates solutions that are sharp as the ones of the mapped WENO scheme (WENO-M) of Henrick et al. [A.K. Henrick, T.D. Aslam, J.M. Powers, Mapped weighted essentially non-oscillatory schemes: achieving optimal order near critical points, J. Comput. Phys. 207 (2005) 542-567], however with a 25% reduction in CPU costs, since no mapping is necessary. We also provide a detailed analysis of the convergence of the WENO-Z scheme at critical points of smooth solutions and show that the solution enhancements of WENO-Z and WENO-M at problems with shocks comes from their ability to assign substantially larger weights to discontinuous stencils than the WENO-JS scheme, not from their superior order of convergence at critical points. Numerical solutions of the linear advection of discontinuous functions and nonlinear hyperbolic conservation laws as the one dimensional Euler equations with Riemann initial value problems, the Mach 3 shock-density wave interaction and the blastwave problems are compared with the ones generated by the WENO-JS and WENO-M schemes. The good performance of the WENO-Z scheme is also demonstrated in the simulation of two dimensional problems as the shock-vortex interaction and a Mach 4.46 Richtmyer-Meshkov Instability (RMI) modeled via the two dimensional Euler equations.

  14. On oscillatory microstructure during cellular growth of directionally solidified Sn–36at.%Ni peritectic alloy (United States)

    Peng, Peng; Li, Xinzhong; Li, Jiangong; Su, Yanqing; Guo, Jingjie


    An oscillatory microstructure has been observed during deep-cellular growth of directionally solidified Sn–36at.%Ni hyperperitectic alloy containing intermetallic compounds with narrow solubility range. This oscillatory microstructure with a dimension of tens of micrometers has been observed for the first time. The morphology of this wave-like oscillatory structure is similar to secondary dendrite arms, and can be observed only in some local positions of the sample. Through analysis such as successive sectioning of the sample, it can be concluded that this oscillatory microstructure is caused by oscillatory convection of the mushy zone during solidification. And the influence of convection on this oscillatory microstructure was characterized through comparison between experimental and calculations results on the wavelength. Besides, the change in morphology of this oscillatory microstructure has been proved to be caused by peritectic transformation during solidification. Furthermore, the melt concentration increases continuously during solidification of intermetallic compounds with narrow solubility range, which helps formation of this oscillatory microstructure. PMID:27066761

  15. Experimental study of the turbulent boundary layer in acceleration-skewed oscillatory flow

    NARCIS (Netherlands)

    van der A, D.A.; O' Donoghue, T.; Davies, A.G; Ribberink, Jan S.


    Experiments have been conducted in a large oscillatory flow tunnel to investigate the effects of acceleration skewness on oscillatory boundary layer flow over fixed beds. As well as enabling experimental investigation of the effects of acceleration skewness, the new experiments add substantially to

  16. Modelling and measurements of sand transport processes over full-scale ripples in oscillatory flow

    NARCIS (Netherlands)

    van der Werf, Jebbe J.; Ribberink, Jan S.; O'Donoghue, Tom; Doucette, Jeffrey C.


    A new series of laboratory experiments was performed in the Aberdeen Oscillatory Flow Tunnel (AOFT) and the Large Oscillating Water Tunnel (LOWT) to investigate time-averaged suspended sand concentrations and transport rates over rippled beds in regular and irregular oscillatory flow. The

  17. Study on boiling heat transfer of subcooled flow under oscillatory flow condition

    International Nuclear Information System (INIS)

    Ohtake, Hiroyasu; Yamazaki, Satoshi; Koizumi, Yasuo


    The Onset of Nucleate Boiling, the point of Net Vapor Generation and Critical Heat Flux on subcooled flow boiling under oscillatory flow, focusing on liquid velocity, amplitude and frequency of oscillatory flow were investigated experimentally and analytically. Experiments were conducted using a copper thin-film and subcooled water in a range of the liquid velocity from 0.27 to 4.07 m/s at 0.10MPa. The liquid subcooling was 20K. Frequency of oscillatory flow was 2 and 4 Hz, respectively; amplitude of oscillatory flow was 25 and 50% in a ratio of main flow rate, respectively. Temperatures at Onset of Nuclear Boiling and Critical Heat Flux obtained in the experiments decreased with the oscillatory flow. The decrease of liquid velocity by oscillatory flow caused the ONB and the CHF to decrease. On the other hand, heat flux at Net Vapor Generation decreased with oscillatory flow; the increase of liquid velocity by oscillatory flow caused the NVG to decrease. (author)

  18. Entropic transport without external force in confined channel with oscillatory boundary

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Huai; Jiang, Huijun; Hou, Zhonghuai, E-mail: [Department of Chemical Physics & Hefei National Laboratory for Physical Sciences at Microscales, University of Science and Technology of China, Hefei, Anhui 230026 (China)


    The dynamics of point-like Brownian particles in a periodic confined channel with oscillating boundaries has been studied. Directional transport (DT) behavior, characterized by net displacement along the horizontal direction, is observed even without external force which is necessary for the conventional DT where the boundaries are static. For typical parameter values, the average velocity V{sub t} of DT reaches a maximum with the variation of the noise intensity D, being alike to the phenomenon of stochastic resonance. Interestingly, we find that V{sub t} shows nontrivial dependences on the particle gravity G depending on the noise level. When the noise is large, V{sub t} increases monotonically with G indicating that heavier particle moves faster, while for small noise, V{sub t} shows a bell-shape dependence on G, suggesting that a particle with an intermediate weight may move the fastest. Such results were not observed for DT in a channel with static boundaries. To understand these findings, we have adopted an effective one-dimensional coarsening description, which facilitates us to introduce an effective entropic force along the horizontal direction. The average force is apparently nonzero due to the oscillatory boundary, hence leading to the net transport, and it shows similar dependences as V{sub t} on the noise intensity D and particle gravity G. The dependences of the DT behavior on other parameters describing the oscillatory channel have also been investigated, showing that DT is more pronounced for larger oscillation amplitude and frequency, and asymmetric geometry within a channel period and phase difference between neighboring periods are both necessary for the occurrence of DT.

  19. The Situated HKB Model: how sensorimotor spatial coupling can alter oscillatory brain dynamics

    Directory of Open Access Journals (Sweden)

    Miguel eAguilera


    Full Text Available Despite the increase both of dynamic and embodied/situated approaches in cognitive science, there is still little research on how coordination dynamics under a closed sensorimotor loop might induce qualitatively different patterns of neural oscillations compared to those found in isolated systems. We take as a departure point the HKB model, a generic model for dynamic coordination between two oscillatory components, which has proven useful for a vast range of applications in cognitive science and whose dynamical properties are well understood. In order to explore the properties of this model under closed sensorimotor conditions we present what we call the situated HKB model: a robotic model that performs a gradient climbing task and whose "brain" is modelled by the HKB equation. We solve the differential equations that define the agent-environment coupling for increasing values of the agent's sensitivity (sensor gain, finding different behavioural strategies. These results are compared with two different models: a decoupled HKB with no sensory input and a passively-coupled HKB that is also decoupled but receives a structured input generated by a situated agent. We can precisely quantify and qualitatively describe how the properties of the system, when studied in coupled conditions, radically change in a manner that cannot be deduced from the decoupled HKB models alone. We also present the notion of neurodynamic signature as the dynamic pattern that correlates with a specific behaviour and we show how only a situated agent can display this signature compared to an agent that simply receives the exact same sensory input.To our knowledge, this is the first analytical solution of the HKB equation in a sensorimotor loop and qualitative and quantitative analytic comparison of spatially coupled vs. decoupled oscillatory controllers. Finally, we discuss the limitations and possible generalization of our model to contemporary neuroscience and philosophy

  20. The situated HKB model: how sensorimotor spatial coupling can alter oscillatory brain dynamics (United States)

    Aguilera, Miguel; Bedia, Manuel G.; Santos, Bruno A.; Barandiaran, Xabier E.


    Despite the increase of both dynamic and embodied/situated approaches in cognitive science, there is still little research on how coordination dynamics under a closed sensorimotor loop might induce qualitatively different patterns of neural oscillations compared to those found in isolated systems. We take as a departure point the Haken-Kelso-Bunz (HKB) model, a generic model for dynamic coordination between two oscillatory components, which has proven useful for a vast range of applications in cognitive science and whose dynamical properties are well understood. In order to explore the properties of this model under closed sensorimotor conditions we present what we call the situated HKB model: a robotic model that performs a gradient climbing task and whose “brain” is modeled by the HKB equation. We solve the differential equations that define the agent-environment coupling for increasing values of the agent's sensitivity (sensor gain), finding different behavioral strategies. These results are compared with two different models: a decoupled HKB with no sensory input and a passively-coupled HKB that is also decoupled but receives a structured input generated by a situated agent. We can precisely quantify and qualitatively describe how the properties of the system, when studied in coupled conditions, radically change in a manner that cannot be deduced from the decoupled HKB models alone. We also present the notion of neurodynamic signature as the dynamic pattern that correlates with a specific behavior and we show how only a situated agent can display this signature compared to an agent that simply receives the exact same sensory input. To our knowledge, this is the first analytical solution of the HKB equation in a sensorimotor loop and qualitative and quantitative analytic comparison of spatially coupled vs. decoupled oscillatory controllers. Finally, we discuss the limitations and possible generalization of our model to contemporary neuroscience and

  1. Biological timing and the clock metaphor: oscillatory and hourglass mechanisms. (United States)

    Rensing, L; Meyer-Grahle, U; Ruoff, P


    Living organisms have developed a multitude of timing mechanisms--"biological clocks." Their mechanisms are based on either oscillations (oscillatory clocks) or unidirectional processes (hourglass clocks). Oscillatory clocks comprise circatidal, circalunidian, circadian, circalunar, and circannual oscillations--which keep time with environmental periodicities--as well as ultradian oscillations, ovarian cycles, and oscillations in development and in the brain, which keep time with biological timescales. These clocks mainly determine time points at specific phases of their oscillations. Hourglass clocks are predominantly found in development and aging and also in the brain. They determine time intervals (duration). More complex timing systems combine oscillatory and hourglass mechanisms, such as the case for cell cycle, sleep initiation, or brain clocks, whereas others combine external and internal periodicities (photoperiodism, seasonal reproduction). A definition of a biological clock may be derived from its control of functions external to its own processes and its use in determining temporal order (sequences of events) or durations. Biological and chemical oscillators are characterized by positive and negative feedback (or feedforward) mechanisms. During evolution, living organisms made use of the many existing oscillations for signal transmission, movement, and pump mechanisms, as well as for clocks. Some clocks, such as the circadian clock, that time with environmental periodicities are usually compensated (stabilized) against temperature, whereas other clocks, such as the cell cycle, that keep time with an organismic timescale are not compensated. This difference may be related to the predominance of negative feedback in the first class of clocks and a predominance of positive feedback (autocatalytic amplification) in the second class. The present knowledge of a compensated clock (the circadian oscillator) and an uncompensated clock (the cell cycle), as well

  2. Separation of transient and oscillatory cerebral activities using over-complete rational dilation wavelet transforms

    International Nuclear Information System (INIS)

    Chaibi, S.; Lajnef, T.; Samet, M.; Kachouri, A.


    Many natural signals EEG are comprised frequency overlapping of oscillatory and transient components. In our study the intracranial EEG signals of epilepsy are composed of the superposition of oscillatory signals (HFOs: High Frequency oscillations) and a transient signals (spikes and sharp waves, etc.). The oscillatory components (HFOs) exist in the frequency band 80-500Hz. The transient components comes from nonrhythmic brain activities (spikes, sharp waves and vertex waves of varying amplitude, shape and duration) and cover a continuous wide bandwidth from low to high frequencies and resemble an HFOs events when filtered using a band pass classical filter. The classical filtering methods based on FIR filters, Wavelet transforms and the Matching Pursuit cannot separate the oscillatory from transient activities. This paper describes an approach for decomposing an iEEG signals of epilepsy into the sum of oscillatory components and a transient components based on overcomplete rational dilation wavelet transforms (overcomplete RADWT) in conjunction with morphological component analysis (MCA).

  3. Oscillatory instabilities in the electrooxidation of borohydride on platinum

    Energy Technology Data Exchange (ETDEWEB)

    Machado, Eduardo G.; Varela, Hamilton, E-mail: [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Quimica


    The borohydride ion has been pointed as a promising alternative fuel. Most of the investigation on its electrochemistry is devoted to the electrocatalytic aspects of its electrooxidation on platinum and gold surfaces. Besides the known kinetic limitations and intricate mechanism, our Group has recently found the occurrence of two regions of bi-stability and autocatalysis in the electrode potential during the open circuit interaction of borohydride and oxidized platinum surfaces. Following this previous contribution, the occurrence of more complicated phenomena is here presented: namely the presence of electrochemical oscillations during the electrooxidation of borohydride on platinum in alkaline media. Current oscillations were found to be associated to two distinct instability windows and characterized in the resistance-potential parameter plane. The dynamic features of such oscillations suggest the existence of distinct mechanisms according to the potential region. Previously published results obtained under non-oscillatory regime were used to give some hints on the surface chemistry behind the observed dynamics. (author)

  4. Model of oscillatory instability in vertically-homogeneous atmosphere

    Directory of Open Access Journals (Sweden)

    P. B. Rutkevich


    Full Text Available Existence and repeatability of tornadoes could be straightforwardly explained if there existed instability, responsible for their formation. However, it is well known that convection is the only instability in initially stable air, and the usual convective instability is not applicable for these phenomena. In the present paper we describe an instability in the atmosphere, which can be responsible for intense vortices. This instability appears in a fluid with Coriolis force and dissipation and has oscillatory behaviour, where the amplitude growth is accompanied by oscillations with frequency comparable to the growth rate of the instability. In the paper, both analytical analysis of the linear phase of the instability and nonlinear simulation of the developed stage of the air motion are addressed. This work was supported by the RFBR grant no. 09-05-00374-a.

  5. Structure-preserving algorithms for oscillatory differential equations II

    CERN Document Server

    Wu, Xinyuan; Shi, Wei


    This book describes a variety of highly effective and efficient structure-preserving algorithms for second-order oscillatory differential equations. Such systems arise in many branches of science and engineering, and the examples in the book include systems from quantum physics, celestial mechanics and electronics. To accurately simulate the true behavior of such systems, a numerical algorithm must preserve as much as possible their key structural properties: time-reversibility, oscillation, symplecticity, and energy and momentum conservation. The book describes novel advances in RKN methods, ERKN methods, Filon-type asymptotic methods, AVF methods, and trigonometric Fourier collocation methods.  The accuracy and efficiency of each of these algorithms are tested via careful numerical simulations, and their structure-preserving properties are rigorously established by theoretical analysis. The book also gives insights into the practical implementation of the methods. This book is intended for engineers and sc...

  6. An analytic data analysis method for oscillatory slug tests. (United States)

    Chen, Chia-Shyun


    An analytical data analysis method is developed for slug tests in partially penetrating wells in confined or unconfined aquifers of high hydraulic conductivity. As adapted from the van der Kamp method, the determination of the hydraulic conductivity is based on the occurrence times and the displacements of the extreme points measured from the oscillatory data and their theoretical counterparts available in the literature. This method is applied to two sets of slug test response data presented by Butler et al.: one set shows slow damping with seven discernable extremities, and the other shows rapid damping with three extreme points. The estimates of the hydraulic conductivity obtained by the analytic method are in good agreement with those determined by an available curve-matching technique.

  7. Introduction to the oscillatory movement based on the rediscovery

    International Nuclear Information System (INIS)

    Concari, S.B.; Carreri, R.A.; Giorgi, S.M.; Camara, C.N.; Alzugaray, G.E.; Pozzo, R.L.


    In this work we present a proposal of a classroom in treating the them oscillatory movement for a basic university physics course for engineering students at university. The proposal is based on the rediscovery strategy and the active participation of the students. It is oriented to promote in the students the development of his/her operating capacities through the systematic application of a scientific method to the study of the dynamics of different types of pendulums. The criteria used to design the proposal have their fundament in the identification of psychological, didactic and epistemological variables that determine the way the student makes his/her learning process. The epistemological Gowin's V was applied as a tool to determine goals and to organizer activities. (Author) 23 refs

  8. Coherent structures in wave boundary layers. Part 1. Oscillatory motion

    DEFF Research Database (Denmark)

    Carstensen, Stefan; Sumer, B. Mutlu; Fredsøe, Jørgen


    This work concerns oscillatory boundary layers over smooth beds. It comprises combined visual and quantitative techniques including bed shear stress measurements. The experiments were carried out in an oscillating water tunnel. The experiments reveal two significant coherent flow structures: (i......) Vortex tubes, essentially two-dimensional vortices close to the bed extending across the width of the boundary-layer flow, caused by an inflectional-point shear layer instability. The imprint of these vortices in the bed shear stress is a series of small, insignificant kinks and dips. (ii) Turbulent...... spots, isolated arrowhead-shaped areas close to the bed in an otherwise laminar boundary layer where the flow ‘bursts’ with violent oscillations. The emergence of the turbulent spots marks the onset of turbulence. Turbulent spots cause single or multiple violent spikes in the bed shear stress signal...

  9. Inhomogeneous oscillatory electric field time-of-flight mass spectrometer

    International Nuclear Information System (INIS)

    Carrico, J.P.


    The mass-to-charge ratio of an ion can be determined from the measurement of its flight time in an inhomogeneous, oscillatory electric field produced by the potential distribution V(x, y, t) = Vsub(DC) + Vsub(AC) cos ωt) (αsub(x)X 2 + αsub(y)Y 2 + αsub(z)Z 2 ). The governing equation of motion is the Mathieu equation. The principle of operation of this novel mass spectrometer is described and results of computer calculations of the flight time and resolution are reported. An experimental apparatus and results and results demonstrating the feasibility of this mass spectrometer principle are described. (author)

  10. Rapid production of biodiesel in mesoscale oscillatory baffled reactors

    Energy Technology Data Exchange (ETDEWEB)

    Phan, A.N.; Harvey, A.P.; Eze, V. [School of Chemical Engineering and Advanced Materials, Newcastle Upon Tyne (United Kingdom)


    Continuous alkali-catalyzed transesterification of rapeseed oil with methanol was carried out in three mesoreactor designs. The induction time decreased with oscillatory Reynolds number for all three reactors. Stable steady states were achieved within induction times of 1.5, 2.5, and 4.0 residence times for the integral, wire wool, and helical baffle designs, respectively. Both experimental and simulated results indicated that under the given conditions there is an optimal residence time for homogeneous transesterification. Higher residence times resulted in reduced fatty acid methyl ester content due to the saponification side reaction. The results demonstrate that biodiesel can be produced at an industrially acceptable level of conversion (> 95 %) in < 5 min residence time. This requires a combination of high catalyst concentration and good mixing. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Oscillatory bistability of real-space transfer in semiconductor heterostructures (United States)

    Do˙ttling, R.; Scho˙ll, E.


    Charge transport parallel to the layers of a modulation-doped GaAs/AlxGa1-xAs heterostructure is studied theoretically. The heating of electrons by the applied electric field leads to real-space transfer of electrons from the GaAs into the adjacent AlxGa1-xAs layer. For sufficiently large dc bias, spontaneous periodic 100-GHz current oscillations, and bistability and hysteretic switching transitions between oscillatory and stationary states are predicted. We present a detailed investigation of complex bifurcation scenarios as a function of the bias voltage U0 and the load resistance RL. For large RL subcritical Hopf bifurcations and global bifurcations of limit cycles are displayed.

  12. Waves spontaneously generated by heterogeneity in oscillatory media (United States)

    Cui, Xiaohua; Huang, Xiaodong; Hu, Gang


    Wave propagation is an important characteristic for pattern formation and pattern dynamics. To date, various waves in homogeneous media have been investigated extensively and have been understood to a great extent. However, the wave behaviors in heterogeneous media have been studied and understood much less. In this work, we investigate waves that are spontaneously generated in one-dimensional heterogeneous oscillatory media governed by complex Ginzburg-Landau equations; the heterogeneity is modeled by multiple interacting homogeneous media with different system control parameters. Rich behaviors can be observed by varying the control parameters of the systems, whereas the behavior is incomparably simple in the homogeneous cases. These diverse behaviors can be fully understood and physically explained well based on three aspects: dispersion relation curves, driving-response relations, and wave competition rules in homogeneous systems. Possible applications of heterogeneity-generated waves are anticipated.

  13. Oscillatory Dynamics of One-Dimensional Homogeneous Granular Chains (United States)

    Starosvetsky, Yuli; Jayaprakash, K. R.; Hasan, Md. Arif; Vakakis, Alexander F.

    The acoustics of the homogeneous granular chains has been studied extensively both numerically and experimentally in the references cited in the previous chapters. This chapter focuses on the oscillatory behavior of finite dimensional homogeneous granular chains. It is well known that normal vibration modes are the building blocks of the vibrations of linear systems due to the applicability of the principle of superposition. One the other hand, nonlinear theory is deprived of such a general superposition principle (although special cases of nonlinear superpositions do exist), but nonlinear normal modes ‒ NNMs still play an important role in the forced and resonance dynamics of these systems. In their basic definition [1], NNMs were defined as time-periodic nonlinear oscillations of discrete or continuous dynamical systems where all coordinates (degrees-of-freedom) oscillate in-unison with the same frequency; further extensions of this definition have been considered to account for NNMs of systems with internal resonances [2]...

  14. Observations of the vertical structure of turbulent oscillatory boundary layers above fixed roughness beds using a prototype wideband coherent Doppler profiler: 1. The oscillatory component of the flow (United States)

    Hay, Alex E.; Zedel, Len; Cheel, Richard; Dillon, Jeremy


    Results are presented from an experimental investigation of rough turbulent oscillatory boundary layers using a prototype wideband bistatic coherent Doppler profiler. The profiler operates in the 1.2 MHz to 2.3 MHz frequency band and uses software-defined radio technologies for digital control of the frequency content and shape of the transmit pulse and for digital complex demodulation of the received signals. Velocity profiles are obtained at sub-millimeter range resolution and 100 Hz profiling rates (each profile being an ensemble average of 10 pulse pairs). The measurements were carried out above beds of fixed sand or gravel particles, with median grain diameters of 0.37 mm and 3.9 mm, respectively, oscillating sinusoidally at a 10 s period through excursions of 0.75 m to 1.5 m. The resulting vertical profiles of horizontal velocity magnitude and phase, with the vertical axis scaled by ℓ = κu∗m/ω, are comparable to similarly scaled profiles obtained using laser Doppler anemometry by Sleath (1987) and Jensen (1988). A key objective of the comparisons between the previous experiments and those reported here was to establish how close to the bed reliable velocity measurements can be made with the sonar. This minimum distance above the bed is estimated to be 5 ± 1 mm, a value approaching the 3 to 4 mm limit set by the path of least time.

  15. Detection of oscillatory components in noise signals and its application to fast detection of sodium boiling in LMFBR's

    International Nuclear Information System (INIS)

    Ehrhardt, J.


    In general, the surveillance of technical plants is performed by observating the mean value of measured signals. In this method not all information included in these signals is used. On the other hand - for example in a reactor - disturbances are possible which generate small oscillatory components in the measured signals. In general, these oscillatory components do not influence the mean value of the signals and consequently do not activate the conventional control system; however they can be found by analysis of the signal's noise component. For the detection of these oscillatory signals the observation of the frequency spectra of the noise signals is particularly advantageous because they produce peaks at the oscillation frequencies. In this paper a new detection system for the fast detection of suddenly appearing peaks in the frequency spectra of noise signals is presented. The prototype of a compact detection unit was developed which continuously computes the power spectral density (PSD) of noise signals and simultaneously supervises the PSD for peaks in the relevant frequency range. The detection method is not affected by the frequency dependance of the PSD and is applicable to any noise signal. General criteria were developed to enable the determination of the optimal detection system and its sensitivity. The upper limits of false alarm rate and detection time were taken into account. The detection criteria are applicable to all noise signals with approximately normally distributed amplitudes. Theoretical results were confirmed in a number of experiments; special experimental and theoretical parameter studies were done for the optimal detection of sodium boiling in LMFBR's. Computations based on these results showed that local and integral sodium boiling can be detected in a wide core range of SNR 300 by observing fluctuations of the neutron flux. In this connection it is important to point out that no additional core instrumentation is necessary because the

  16. Understanding Epileptiform After-Discharges as Rhythmic Oscillatory Transients. (United States)

    Baier, Gerold; Taylor, Peter N; Wang, Yujiang


    Electro-cortical activity in patients with epilepsy may show abnormal rhythmic transients in response to stimulation. Even when using the same stimulation parameters in the same patient, wide variability in the duration of transient response has been reported. These transients have long been considered important for the mapping of the excitability levels in the epileptic brain but their dynamic mechanism is still not well understood. To investigate the occurrence of abnormal transients dynamically, we use a thalamo-cortical neural population model of epileptic spike-wave activity and study the interaction between slow and fast subsystems. In a reduced version of the thalamo-cortical model, slow wave oscillations arise from a fold of cycles (FoC) bifurcation. This marks the onset of a region of bistability between a high amplitude oscillatory rhythm and the background state. In vicinity of the bistability in parameter space, the model has excitable dynamics, showing prolonged rhythmic transients in response to suprathreshold pulse stimulation. We analyse the state space geometry of the bistable and excitable states, and find that the rhythmic transient arises when the impending FoC bifurcation deforms the state space and creates an area of locally reduced attraction to the fixed point. This area essentially allows trajectories to dwell there before escaping to the stable steady state, thus creating rhythmic transients. In the full thalamo-cortical model, we find a similar FoC bifurcation structure. Based on the analysis, we propose an explanation of why stimulation induced epileptiform activity may vary between trials, and predict how the variability could be related to ongoing oscillatory background activity. We compare our dynamic mechanism with other mechanisms (such as a slow parameter change) to generate excitable transients, and we discuss the proposed excitability mechanism in the context of stimulation responses in the epileptic cortex.

  17. Oscillatory fluid flow influences primary cilia and microtubule mechanics. (United States)

    Espinha, Lina C; Hoey, David A; Fernandes, Paulo R; Rodrigues, Hélder C; Jacobs, Christopher R


    Many tissues are sensitive to mechanical stimuli; however, the mechanotransduction mechanism used by cells remains unknown in many cases. The primary cilium is a solitary, immotile microtubule-based extension present on nearly every mammalian cell which extends from the basal body. The cilium is a mechanosensitive organelle and has been shown to transduce fluid flow-induced shear stress in tissues, such as the kidney and bone. The majority of microtubules assemble from the mother centriole (basal body), contributing significantly to the anchoring of the primary cilium. Several studies have attempted to quantify the number of microtubules emanating from the basal body and the results vary depending on the cell type. It has also been shown that cellular response to shear stress depends on microtubular integrity. This study hypothesizes that changing the microtubule attachment of primary cilia in response to a mechanical stimulus could change primary cilia mechanics and, possibly, mechanosensitivity. Oscillatory fluid flow was applied to two different cell types and the microtubule attachment to the ciliary base was quantified. For the first time, an increase in microtubules around primary cilia both with time and shear rate in response to oscillatory fluid flow stimulation was demonstrated. Moreover, it is presented that the primary cilium is required for this loading-induced cellular response. This study has demonstrated a new role for the cilium in regulating alterations in the cytoplasmic microtubule network in response to mechanical stimulation, and therefore provides a new insight into how cilia may regulate its mechanics and thus the cells mechanosensitivity. Copyright © 2014 Wiley Periodicals, Inc.

  18. Oscillatory EEG correlates of arithmetic strategies: A training study

    Directory of Open Access Journals (Sweden)

    Roland H. Grabner


    Full Text Available There has been a long tradition of research on mathematics education showing that children and adults use different strategies to solve arithmetic problems. Neurophysiological studies have recently begun to investigate the brain correlates of these strategies. The existing body of data, however, reflect static end points of the learning process and do not provide information on how brain activity changes in response to training or intervention. In this study, we explicitly address this issue by training participants in using fact retrieval strategies. We also investigate whether brain activity related to arithmetic fact learning is domain-specific or whether this generalizes to other learning materials, such as the solution of figural-spatial problems. Twenty adult students were trained on sets of two-digit multiplication problems and figural-spatial problems. After the training, they were presented with the trained and untrained problems while their brain activity was recorded by means of electroencephalography (EEG . In both problem types, the training resulted in accuracies over 90 % and significant decreases in solution times. Analyses of the oscillatory EEG data also revealed training effects across both problem types. Specifically, we observed training-related activity increases in the theta band (3-6 Hz and decreases in the lower alpha band (8-10 Hz, especially over parieto-occipital and parietal brain regions. These results provide the first evidence that a short term fact retrieval training results in significant changes in oscillatory EEG activity. These findings further corroborate the role of the theta band in the retrieval of semantic information from memory and suggest that theta activity is not only sensitive to fact retrieval in mental arithmetic but also in other domains.

  19. High frequency oscillatory ventilation in meconium aspiration syndrome

    Directory of Open Access Journals (Sweden)

    José Nona


    Full Text Available Objective: To evaluate and compare the management and associated morbidity in inborn and outborn babies with meconium aspiration syndrome admitted to the Neonatal Intensive Care Unit and ventilated with high frequency oscillatory ventilation. Methods: A retrospective cohort study with a review of clinical data from newborns, admitted to the Neonatal Intensive Care Unit during a six-year period (from 1999 to 2004 and ventilated with early high frequency oscillatory ventilation, first intention in inborns and immediately after Neonatal Intensive Care Unit arrival in outborns. Rresults: In the present study, 27 newborns were included: 12 inborn and 15 outborn infants. Severity criteria were similar in both groups. The pulmonary morbidity associated was severe persistent pulmonary hypertension - 12 (seven outborns, pneumothorax - five (three outborns, interstitial emphysema – two (one outborn and pulmonary hemorrhage – one outborn. Hypoxic-ischemic encephalopathy II-III occurred in six newborns (four outborns. The therapeutic procedures were surfactant administration in 22 newborns (13 outborns, nitric oxide in 12 newborns (7 outborns and magnesium sulphate in four newborns (three outborns. The median length of ventilation was six days (inborn infants: four and half days; outborn infants: ten days and the median length of oxygenation supply was ten days (inborn infants: four and half days; outborn infants: 15 days. The median length of stay was 13 days (inborn infants: 11 days; outborn infants: 16 days. One outborn infant died. Cconclusions: With this ventilation strategy, we have found no significant statistical differences between the two newborn groups, except for the length of oxygenation supply that was longer in the Outborn Group.

  20. Time-separated oscillatory fields for high-precision mass measurements on short-lived Al and Ca nuclides

    CERN Document Server

    George, Simon; Blank, B.; Blaum, K.; Breitenfeldt, M.; Hager, U.; Herfurth, F.; Herlert, A.; Kellerbauer, A.; Kluge, H.J.; Kretzschmar, M.; Lunney, D.; Savreux, R.; Schwarz, Andreas S.; Schweikhard, L.; Yazidjian, C.


    High-precision Penning trap mass measurements on the stable nuclide $^{27}$Al as well as on the short-lived radionuclides $^{26}$Al and $^{38,39}$Ca have been performed by use of radio-frequency excitation with time-separated oscillatory fields, i.e. Ramsey's method, as recently introduced for the excitation of the ion motion in a Penning trap, was applied. A comparison with the conventional method of a single continuous excitation demonstrates its advantage of up to ten times shorter measurements. The new mass values of $^{26,27}$Al clarify conflicting data in this specific mass region. In addition, the resulting mass values of the superallowed $\\beta$-emitter $^{38}$Ca as well as of the groundstate of the $\\beta$-emitter $^{26}$Al$^{m}$ confirm previous measurements and corresponding theoretical corrections of the ft-values.

  1. Solvent Fermentation From Palm Oil Mill Effluent Using Clostridium acetobutylicum In Oscillatory Flow Bioreactor

    International Nuclear Information System (INIS)

    Takriff, M.S.; Masngut, N.; Kadhum, A.A.H.; Kalil, M.S.; Mohammad, A.W.


    Acetone-butanol-ethanol (ABE) fermentation from Palm Oil Mill Effluent (POME) by C. acetobutylicum NCIMB 13357 in an oscillatory flow bioreactor was investigated. Experimental works were conducted in a U-shaped stainless steel oscillatory flow bioreactor at oscillation frequency between 0.45-0.78 Hz and a constant amplitude of 12.5 mm. Fermentations were carried out for 72 hr at 35 degree Celsius using palm oil mill effluent and reinforced clostridia medium as a growth medium in batch culture. Result of this investigation showed that POME is a viable media for ABE fermentation and oscillatory flow bioreactor has an excellent potential as an alternative fermentation device. (author)

  2. Activation energies as the validity criterion of a model for complex reactions that can be in oscillatory states

    Directory of Open Access Journals (Sweden)

    Anić S.


    Full Text Available Modeling of any complex reaction system is a difficult task. If the system under examination can be in various oscillatory dynamic states, the apparent activation energies corresponding to different pathways may be of crucial importance for this purpose. In that case the activation energies can be determined by means of the main characteristics of an oscillatory process such as pre-oscillatory period, duration of the oscillatory period, the period from the beginning of the process to the end of the last oscillation, number of oscillations and others. All is illustrated on the Bray-Liebhafsky oscillatory reaction.

  3. Advanced device for testing the electrical behavior of conductive coatings on flexible polymer substrates under oscillatory bending: comparison of coatings of sputtered indium-tin oxide and poly3,4ethylenedioxythiophene

    International Nuclear Information System (INIS)

    Königer, Tobias; Münstedt, Helmut


    A special device was designed and set up to investigate the electrical behavior of conductive layers on flexible substrates under oscillatory bending. The resistance of conductive coatings can be measured during various oscillatory bending conditions. The bending radius, the amplitude and the frequency can be set to well-defined values. Furthermore, the setup allows us to apply tensile or compressive stress to the coating as well as both stresses alternately. Thus, various bending loads occurring in printable electronics applications can be simulated to investigate the electrical reliability of conductive coatings. In addition, it is possible to simulate different environmental conditions during oscillatory bending by running the device in an environmental chamber. Characterizations of the electrical behavior under oscillatory bending were carried out on commercially available polyethyleneterephthalate (PET) films sputtered with indium-tin oxide (ITO) and coated with poly3,4ethylenedioxythiophene (PEDOT). For coatings of sputtered ITO, a dramatic increase of the resistance is observed for bending radii smaller than 14 mm due to cracks spanning the whole sample width. The higher the amplitude, the more pronounced is the increase of the resistance. Coatings of PEDOT show high stability under oscillatory bending. There is no change in resistance observed for all bending radii and amplitudes applied over a large number of cycles

  4. Onset of oscillatory binary fluid convection in three-dimensional cells

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Arantxa; Batiste, Oriol [Universitat Politecnica de Catalunya, Departament de Fisica Aplicada, Barcelona (Spain)


    The purpose of this work is to investigate the influence of the transverse walls on the onset of convection in a horizontal rectangular cavity of infinite length filled with a binary mixture when heated from below. For the first time we take into account the effect of the third dimension without making any approximation and considering realistic boundary conditions. In previous numerical works the width of the cell was either taken to be infinity (bulk mixtures) or different approximations usually valid in the narrow cell limit were assumed (i.e., Hele-Shaw and non-ideal Hele-Shaw approximations). The results we find show that the presence of the walls has a considerable effect on the onset of convection even for intermediate transverse aspect ratio cells. They also show that the approximations generally assumed fail to reproduce the correct behaviour of the critical parameters in an important range of aspect ratio values when the primary bifurcation is oscillatory. We have compared the critical values of the Rayleigh number and the frequency with those reported in the literature (Ohlsen et al. [1]) and we find a quantitative agreement within the experimental error. (orig.)

  5. A Legendre Wavelet Spectral Collocation Method for Solving Oscillatory Initial Value Problems

    Directory of Open Access Journals (Sweden)

    A. Karimi Dizicheh


    wavelet suitable for large intervals, and then the Legendre-Guass collocation points of the Legendre wavelet are derived. Using this strategy, the iterative spectral method converts the differential equation to a set of algebraic equations. Solving these algebraic equations yields an approximate solution for the differential equation. The proposed method is illustrated by some numerical examples, and the result is compared with the exponentially fitted Runge-Kutta method. Our proposed method is simple and highly accurate.

  6. [Emotional intelligence and oscillatory responses on the emotional facial expressions]. (United States)

    Kniazev, G G; Mitrofanova, L G; Bocharov, A V


    Emotional intelligence-related differences in oscillatory responses to emotional facial expressions were investigated in 48 subjects (26 men and 22 women) in age 18-30 years. Participants were instructed to evaluate emotional expression (angry, happy and neutral) of each presented face on an analog scale ranging from -100 (very hostile) to + 100 (very friendly). High emotional intelligence (EI) participants were found to be more sensitive to the emotional content of the stimuli. It showed up both in their subjective evaluation of the stimuli and in a stronger EEG theta synchronization at an earlier (between 100 and 500 ms after face presentation) processing stage. Source localization using sLORETA showed that this effect was localized in the fusiform gyrus upon the presentation of angry faces and in the posterior cingulate gyrus upon the presentation of happy faces. At a later processing stage (500-870 ms) event-related theta synchronization in high emotional intelligence subject was higher in the left prefrontal cortex upon the presentation of happy faces, but it was lower in the anterior cingulate cortex upon presentation of angry faces. This suggests the existence of a mechanism that can be selectively increase the positive emotions and reduce negative emotions.

  7. Oscillatory frontal theta responses are increased upon bisensory stimulation. (United States)

    Sakowitz, O W; Schürmann, M; Başar, E


    To investigate the functional correlation of oscillatory EEG components with the interaction of sensory modalities following simultaneous audio-visual stimulation. In an experimental study (15 subjects) we compared auditory evoked potentials (AEPs) and visual evoked potentials (VEPs) to bimodal evoked potentials (BEPs; simultaneous auditory and visual stimulation). BEPs were assumed to be brain responses to complex stimuli as a marker for intermodal associative functioning. Frequency domain analysis of these EPs showed marked theta-range components in response to bimodal stimulation. These theta components could not be explained by linear addition of the unimodal responses in the time domain. Considering topography the increased theta-response showed a remarkable frontality in proximity to multimodal association cortices. Referring to methodology we try to demonstrate that, even if various behavioral correlates of brain oscillations exist, common patterns can be extracted by means of a systems-theoretical approach. Serving as an example of functionally relevant brain oscillations, theta responses could be interpreted as an indicator of associative information processing.

  8. The Voice of Anger: Oscillatory EEG Responses to Emotional Prosody.

    Directory of Open Access Journals (Sweden)

    Renata Del Giudice

    Full Text Available Emotionally relevant stimuli and in particular anger are, due to their evolutionary relevance, often processed automatically and able to modulate attention independent of conscious access. Here, we tested whether attention allocation is enhanced when auditory stimuli are uttered by an angry voice. We recorded EEG and presented healthy individuals with a passive condition where unfamiliar names as well as the subject's own name were spoken both with an angry and neutral prosody. The active condition instead, required participants to actively count one of the presented (angry names. Results revealed that in the passive condition the angry prosody only elicited slightly stronger delta synchronization as compared to a neutral voice. In the active condition the attended (angry target was related to enhanced delta/theta synchronization as well as alpha desynchronization suggesting enhanced allocation of attention and utilization of working memory resources. Altogether, the current results are in line with previous findings and highlight that attention orientation can be systematically related to specific oscillatory brain responses. Potential applications include assessment of non-communicative clinical groups such as post-comatose patients.

  9. Bright to dim oscillatory response of the Neurospora circadian oscillator. (United States)

    Gooch, Van D; Johnson, Alicia E; Larrondo, Luis F; Loros, Jennifer J; Dunlap, Jay C


    The fungus Neurospora crassa constitutes an important model system extensively used in chronobiology. Several studies have addressed how environmental cues, such as light, can reset or synchronize a circadian system. By means of an optimized firefly luciferase reporter gene and a controllable lighting system, we show that Neurospora can display molecular circadian rhythms in dim light when cultures receive bright light prior to entering dim light conditions. We refer to this behavior as the "bright to dim oscillatory response" (BDOR). The bright light treatment can be applied up to 76 h prior to dim exposure, and it can be as short as 15 min in duration. We have characterized this response in respect to the duration of the light pulse, the time of the light pulse before dim, the intensity of dim light, and the oscillation dynamics in dim light. Although the molecular mechanism that drives the BDOR remains obscure, these findings suggest that a long-term memory of bright light exists as part of the circadian molecular components. It is important to consider the ecological significance of such dim light responses in respect to how organisms naturally maintain their timing mechanism in moonlight.

  10. Exactly complete solutions of the Schroedinger equation with a spherically harmonic oscillatory ring-shaped potential

    International Nuclear Information System (INIS)

    Zhang Mincang; Sun Guohua; Dong Shihai


    A spherically harmonic oscillatory ring-shaped potential is proposed and its exactly complete solutions are presented by the Nikiforov-Uvarov method. The effect of the angle-dependent part on the radial solutions is discussed.

  11. Numerical calculation of a class of highly oscillatory integrals with the Mathieu function

    International Nuclear Information System (INIS)

    Long Yongxing


    The author describes a method for computing highly oscillatory integrals with the Mathieu function. The practice proves that not only the results are highly satisfactory, but also the method is time-saving

  12. Noise measurements during high-frequency oscillatory and conventional mechanical ventilation. (United States)

    Berens, R J; Weigle, C G


    To evaluate the noise levels with high-frequency oscillatory ventilation and conventional mechanical ventilation. An observational, prospective study. Pediatric intensive care unit. The caretakers and environment of the pediatric intensive care unit. High-frequency oscillatory and conventional mechanical ventilation. Caretakers evaluated noise using a visual analog scale. Noise was measured with a decibel meter and an octave band frequency filter. There was twice as much noise perceived by the caretakers and as measured on the decibel A scale. All measures showed significantly greater noise, especially at low frequencies, with high-frequency oscillatory ventilation. High-frequency oscillatory ventilation exposes the patient to twice as much noise as does the use of conventional mechanical ventilation.

  13. Oscillatory integrals on Hilbert spaces and Schroedinger equation with magnetic fields

    International Nuclear Information System (INIS)

    Albeverio, S.; Brzezniak, Z.


    We extend the theory of oscillatory integrals on Hilbert spaces (the mathematical version of ''Feynman path integrals'') to cover more general integrable functions, preserving the property of the integrals to have converging finite dimensional approximations. We give an application to the representation of solutions of the time dependent Schroedinger equation with a scalar and a magnetic potential by oscillatory integrals on Hilbert spaces. A relation with Ramer's functional in the corresponding probabilistic setting is found. (orig.)

  14. Repetitive transcranial magnetic stimulation induces oscillatory power changes in chronic tinnitus

    Directory of Open Access Journals (Sweden)

    Martin eSchecklmann


    Full Text Available Chronic tinnitus is associated with neuroplastic changes in auditory and non-auditory cortical areas. About ten years ago, repetitive transcranial magnetic stimulation (rTMS of auditory and prefrontal cortex was introduced as potential treatment for tinnitus. The resulting changes in tinnitus loudness are interpreted in the context of rTMS induced activity changes (neuroplasticity. Here, we investigate the effect of single rTMS sessions on oscillatory power to probe the capacity of rTMS to interfere with tinnitus-specific cortical plasticity. We measured 20 patients with bilateral chronic tinnitus and 20 healthy controls comparable for age, sex, handedness, and hearing level with a 63-channel EEG system. Educational level, intelligence, depressivity and hyperacusis were controlled for by analysis of covariance. Different rTMS protocols were tested: Left and right temporal and left and right prefrontal cortices were each stimulated with 200 pulses at 1Hz and with an intensity of 60% stimulator output. Stimulation of central parietal cortex with 6-fold reduced intensity (inverted passive-cooled coil served as sham condition. Before and after each rTMS protocol five minutes of resting state EEG were recorded. The order of rTMS protocols was randomized over two sessions with one week interval in between.Analyses on electrode level showed that people with and without tinnitus differed in their response to left temporal and right frontal stimulation. In tinnitus patients left temporal rTMS decreased frontal theta and delta and increased beta2 power, whereas right frontal rTMS decreased right temporal beta3 and gamma power. No changes or increases were observed in the control group. Only non-systematic changes in tinnitus loudness were induced by single sessions of rTMS.This is the first study to show tinnitus-related alterations of neuroplasticity that were specific to stimulation site and oscillatory frequency. The observed effects can be interpreted

  15. Repetitive transcranial magnetic stimulation induces oscillatory power changes in chronic tinnitus (United States)

    Schecklmann, Martin; Lehner, Astrid; Gollmitzer, Judith; Schmidt, Eldrid; Schlee, Winfried; Langguth, Berthold


    Chronic tinnitus is associated with neuroplastic changes in auditory and non-auditory cortical areas. About 10 years ago, repetitive transcranial magnetic stimulation (rTMS) of auditory and prefrontal cortex was introduced as potential treatment for tinnitus. The resulting changes in tinnitus loudness are interpreted in the context of rTMS induced activity changes (neuroplasticity). Here, we investigate the effect of single rTMS sessions on oscillatory power to probe the capacity of rTMS to interfere with tinnitus-specific cortical plasticity. We measured 20 patients with bilateral chronic tinnitus and 20 healthy controls comparable for age, sex, handedness, and hearing level with a 63-channel electroencephalography (EEG) system. Educational level, intelligence, depressivity and hyperacusis were controlled for by analysis of covariance. Different rTMS protocols were tested: Left and right temporal and left and right prefrontal cortices were each stimulated with 200 pulses at 1 Hz and with an intensity of 60% stimulator output. Stimulation of central parietal cortex with 6-fold reduced intensity (inverted passive-cooled coil) served as sham condition. Before and after each rTMS protocol 5 min of resting state EEG were recorded. The order of rTMS protocols was randomized over two sessions with 1 week interval in between. Analyses on electrode level showed that people with and without tinnitus differed in their response to left temporal and right frontal stimulation. In tinnitus patients left temporal rTMS decreased frontal theta and delta and increased beta2 power, whereas right frontal rTMS decreased right temporal beta3 and gamma power. No changes or increases were observed in the control group. Only non-systematic changes in tinnitus loudness were induced by single sessions of rTMS. This is the first study to show tinnitus-related alterations of neuroplasticity that were specific to stimulation site and oscillatory frequency. The observed effects can be

  16. Plain and oscillatory solitons of the cubic complex Ginzburg-Landau equation with nonlinear gradient terms (United States)

    Facão, M.; Carvalho, M. I.


    In this work, we present parameter regions for the existence of stable plain solitons of the cubic complex Ginzburg-Landau equation (CGLE) with higher-order terms associated with a fourth-order expansion. Using a perturbation approach around the nonlinear Schrödinger equation soliton and a full numerical analysis that solves an ordinary differential equation for the soliton profiles and using the Evans method in the search for unstable eigenvalues, we have found that the minimum equation allowing these stable solitons is the cubic CGLE plus a term known in optics as Raman-delayed response, which is responsible for the redshift of the spectrum. The other favorable term for the occurrence of stable solitons is a term that represents the increase of nonlinear gain with higher frequencies. At the stability boundary, a bifurcation occurs giving rise to stable oscillatory solitons for higher values of the nonlinear gain. These oscillations can have very high amplitudes, with the pulse energy changing more than two orders of magnitude in a period, and they can even exhibit more complex dynamics such as period-doubling.

  17. Characterization of Human Dental Pulp Tissue Under Oscillatory Shear and Compression. (United States)

    Ozcan, Burak; Bayrak, Ece; Erisken, Cevat


    Availability of material as well as biological properties of native tissues is critical for biomaterial design and synthesis for regenerative engineering. Until recently, selection of biomaterials and biomolecule carriers for dental pulp regeneration has been done randomly or based on experience mainly due to the absence of benchmark data for dental pulp tissue. This study, for the first time, characterizes the linear viscoelastic material functions and compressive properties of human dental pulp tissue harvested from wisdom teeth, under oscillatory shear and compression. The results revealed a gel-like behavior of the pulp tissue over the frequency range of 0.1-100 rps. Uniaxial compression tests generated peak normal stress and compressive modulus values of 39.1 ± 20.4 kPa and 5.5 ± 2.8 kPa, respectively. Taken collectively, the linear viscoelastic and uniaxial compressive properties of the human dental pulp tissue reported here should enable the better tailoring of biomaterials or biomolecule carriers to be employed in dental pulp regeneration.

  18. Instantaneous sediment transport model for asymmetric oscillatory sheet flow.

    Directory of Open Access Journals (Sweden)

    Xin Chen

    Full Text Available On the basis of advanced concentration and velocity profiles above a mobile seabed, an instantaneous analytical model is derived for sediment transport in asymmetric oscillatory flow. The applied concentration profile is obtained from the classical exponential law based on mass conservation, and asymmetric velocity profile is developed following the turbulent boundary layer theory and the asymmetric wave theory. The proposed model includes two parts: the basic part that consists of erosion depth and free stream velocity, and can be simplified to the total Shields parameter power 3/2 in accordance with the classical empirical models, and the extra vital part that consists of phase-lead, boundary layer thickness and erosion depth. The effects of suspended sediment, phase-lag and asymmetric boundary layer development are considered particularly in the model. The observed instantaneous transport rate proportional to different velocity exponents due to phase-lag is unified and summarised by the proposed model. Both instantaneous and half period empirical formulas are compared with the developed model, using extensive data on a wide range of flow and sediment conditions. The synchronous variation in instantaneous transport rate with free stream velocity and its decrement caused by increased sediment size are predicted correctly. Net transport rates, especially offshore transport rates with large phase-lag under velocity skewed flows, which existing instantaneous type formulas failed to predict, are predicted correctly in both direction and magnitude by the proposed model. Net sediment transport rates are affected not only by suspended sediment and phase-lag, but also by the boundary layer difference between onshore and offshore.

  19. Large amplitude oscillatory motion along a solar filament (United States)

    Vršnak, B.; Veronig, A. M.; Thalmann, J. K.; Žic, T.


    Context: Large amplitude oscillations of solar filaments is a phenomenon that has been known for more than half a century. Recently, a new mode of oscillations, characterized by periodical plasma motions along the filament axis, was discovered. Aims: We analyze such an event, recorded on 23 January 2002 in Big Bear Solar Observatory Hα filtergrams, to infer the triggering mechanism and the nature of the restoring force. Methods: Motion along the filament axis of a distinct buldge-like feature was traced, to quantify the kinematics of the oscillatory motion. The data were fitted by a damped sine function to estimate the basic parameters of the oscillations. To identify the triggering mechanism, morphological changes in the vicinity of the filament were analyzed. Results: The observed oscillations of the plasma along the filament were characterized by an initial displacement of 24 Mm, an initial velocity amplitude of 51 km s-1, a period of 50 min, and a damping time of 115 min. We interpret the trigger in terms of poloidal magnetic flux injection by magnetic reconnection at one of the filament legs. The restoring force is caused by the magnetic pressure gradient along the filament axis. The period of oscillations, derived from the linearized equation of motion (harmonic oscillator) can be expressed as P=π√{2}L/v_Aϕ≈4.4L/v_Aϕ, where v_Aϕ =Bϕ0/√μ_0ρ represents the Alfvén speed based on the equilibrium poloidal field Bϕ0. Conclusions: Combination of our measurements with some previous observations of the same kind of oscillations shows good agreement with the proposed interpretation. Movie to Fig. 1 is only available in electronic form at

  20. Rheological changes of polyamide 12 under oscillatory shear (United States)

    Mielicki, C.; Gronhoff, B.; Wortberg, J.


    Changes in material properties as well as process deviation prevent Laser Sintering (LS) technology from manufacturing of quality assured parts in a series production. In this context, the viscosity of Polyamide 12 (PA12) is assumed to possess the most significant influence, as it determines the sintering velocity, the resistance towards melt formation and the bonding strength of sintered layers. Moreover, the viscosity is directly related to the structure of the molten polymer. In particular, it has been recently reported that LS process conditions lead to structural changes of PA12 affecting viscosity and coalescence of adjacent polymer particles, i.e. melt formation significantly. Structural change of PA12 was understood as a post condensation. Its influence on viscosity was described by a time and temperature depending rheological model whereas time dependence was considered by a novel structural change shift factor which was derived from melt volume rate data. In combination with process data that was recorded using online thermal imaging, the model is suitable to control the viscosity (processability of the material) as result of material and process properties. However, as soon as laser energy is exposed to the powder bed PA12 undergoes a phase transition from solid to molten state. Above the melting point, structural change is expected to occur faster due to a higher kinetic energy and free volume of the molten polymer. Oscillatory shear results were used to study the influence of aging time and for validation of the novel structural change shift factor and its model parameters which were calibrated based on LS processing condition.

  1. Psychoacoustic Tinnitus Loudness and Tinnitus-Related Distress Show Different Associations with Oscillatory Brain Activity (United States)

    Balkenhol, Tobias; Wallhäusser-Franke, Elisabeth; Delb, Wolfgang


    Background The phantom auditory perception of subjective tinnitus is associated with aberrant brain activity as evidenced by magneto- and electroencephalographic studies. We tested the hypotheses (1) that psychoacoustically measured tinnitus loudness is related to gamma oscillatory band power, and (2) that tinnitus loudness and tinnitus-related distress are related to distinct brain activity patterns as suggested by the distinction between loudness and distress experienced by tinnitus patients. Furthermore, we explored (3) how hearing impairment, minimum masking level, and (4) psychological comorbidities are related to spontaneous oscillatory brain activity in tinnitus patients. Methods and Findings Resting state oscillatory brain activity recorded electroencephalographically from 46 male tinnitus patients showed a positive correlation between gamma band oscillations and psychoacoustic tinnitus loudness determined with the reconstructed tinnitus sound, but not with the other psychoacoustic loudness measures that were used. Tinnitus-related distress did also correlate with delta band activity, but at electrode positions different from those associated with tinnitus loudness. Furthermore, highly distressed tinnitus patients exhibited a higher level of theta band activity. Moreover, mean hearing loss between 0.125 kHz and 16 kHz was associated with a decrease in gamma activity, whereas minimum masking levels correlated positively with delta band power. In contrast, psychological comorbidities did not express significant correlations with oscillatory brain activity. Conclusion Different clinically relevant tinnitus characteristics show distinctive associations with spontaneous brain oscillatory power. Results support hypothesis (1), but exclusively for the tinnitus loudness derived from matching to the reconstructed tinnitus sound. This suggests to preferably use the reconstructed tinnitus spectrum to determine psychoacoustic tinnitus loudness. Results also support

  2. Interactions among oscillatory pathways in NF-kappa B signaling

    Directory of Open Access Journals (Sweden)

    White Michael RH


    Full Text Available Abstract Background Sustained stimulation with tumour necrosis factor alpha (TNF-alpha induces substantial oscillations—observed at both the single cell and population levels—in the nuclear factor kappa B (NF-kappa B system. Although the mechanism has not yet been elucidated fully, a core system has been identified consisting of a negative feedback loop involving NF-kappa B (RelA:p50 hetero-dimer and its inhibitor I-kappa B-alpha. Many authors have suggested that this core oscillator should couple to other oscillatory pathways. Results First we analyse single-cell data from experiments in which the NF-kappa B system is forced by short trains of strong pulses of TNF-alpha. Power spectra of the ratio of nuclear-to-cytoplasmic concentration of NF-kappa B suggest that the cells' responses are entrained by the pulsing frequency. Using a recent model of the NF-kappa B system due to Caroline Horton, we carried out extensive numerical simulations to analyze the response frequencies induced by trains of pulses of TNF-alpha stimulation having a wide range of frequencies and amplitudes. These studies suggest that for sufficiently weak stimulation, various nonlinear resonances should be observable. To explore further the possibility of probing alternative feedback mechanisms, we also coupled the model to sinusoidal signals with a wide range of strengths and frequencies. Our results show that, at least in simulation, frequencies other than those of the forcing and the main NF-kappa B oscillator can be excited via sub- and superharmonic resonance, producing quasiperiodic and even chaotic dynamics. Conclusions Our numerical results suggest that the entrainment phenomena observed in pulse-stimulated experiments is a consequence of the high intensity of the stimulation. Computational studies based on current models suggest that resonant interactions between periodic pulsatile forcing and the system's natural frequencies may become evident for sufficiently

  3. Effect of sp3-hybridized defects on the oscillatory behavior of carbon nanotube oscillators

    International Nuclear Information System (INIS)

    Guo, Taiyu; Ding, Tony Weixi; Pei, Qing-Xiang; Zhang, Yong-Wei


    Using molecular dynamics simulations, we investigate the oscillatory behaviors of carbon nanotube oscillators containing sp 3 -hybridized defects formed by hydrogen chemisorption. It is found that the presence of these defects significantly affects the kinetic and potential energies of the nanotube systems, which in turn affects their oscillation periods and frequencies. We have also studied the oscillatory characteristics of the oscillators containing sp 3 -hybridized Stone-Wales defects. Our results show that it is possible to control the motion of the inner nanotube by introducing sp 3 -hybridized defects on the outer nanotube, which provides a potential way to tune the oscillatory behavior of nanotube oscillators. -- Highlights: → sp 3 -hybridized defects increase energy dissipation. → sp 3 -hybridized defects arranged in a row have stronger effect than that in a ring. → sp 3 -hybridized defects reduces the effect of SW defects.

  4. Shear and loading in channels: Oscillatory shearing and edge currents of superconducting vortices (United States)

    Wambaugh, J. F.; Marchesoni, F.; Nori, Franco


    Via computer simulations we study the motion of quantized magnetic flux-lines, or vortices, confined to a straight pin-free channel in a strong-pinning superconducting sample. We find that, when a constant current is applied across this system, a very unusual oscillatory shearing appears, in which the vortices moving at the edges of the channel periodically trail behind and then suddenly leapfrog past the vortices moving in the inner rows. For small enough driving forces, this oscillatory shearing dynamic phase is replaced by a continuous shearing phase in which the distance between initially-nearby vortices grows in time, quickly destroying the order of the lattice. An animation of this novel “oscillatory leapfrogging shear” effect of the vortex edge currents appears in˜nori/channel/

  5. The effect of a laser beam displacement on parametric oscillatory instabilities for Advanced LIGO

    International Nuclear Information System (INIS)

    Heinert, D.; Strigin, S.E.


    The arm cavities of real gravitational wave detectors can show small deviations like a tilt or a spatial shift between the cavity mirrors. These deviations lead to a separation of the optical mode centres with respect to the mirror's centre. In this Letter we perform the computation of parametric instable modes considering the described displacement. We further analyse the possibility of parametric oscillatory instability in the Advanced LIGO interferometer for the case of a displaced arm cavity. Our results reveal an additional number of optical and elastic mode combinations due to a displacement that can give rise to the undesirable effect of parametric oscillatory instability. -- Highlights: → We analyse the possibility of parametric oscillatory instability in the Advanced LIGO interferometer. → We perform the computation of parametric instable modes considering the mirror displacement. → Our results reveal an additional number of optical and elastic mode unstable combinations.

  6. Approximate damped oscillatory solutions and error estimates for the perturbed Klein–Gordon equation

    International Nuclear Information System (INIS)

    Ye, Caier; Zhang, Weiguo


    Highlights: • Analyze the dynamical behavior of the planar dynamical system corresponding to the perturbed Klein–Gordon equation. • Present the relations between the properties of traveling wave solutions and the perturbation coefficient. • Obtain all explicit expressions of approximate damped oscillatory solutions. • Investigate error estimates between exact damped oscillatory solutions and the approximate solutions and give some numerical simulations. - Abstract: The influence of perturbation on traveling wave solutions of the perturbed Klein–Gordon equation is studied by applying the bifurcation method and qualitative theory of dynamical systems. All possible approximate damped oscillatory solutions for this equation are obtained by using undetermined coefficient method. Error estimates indicate that the approximate solutions are meaningful. The results of numerical simulations also establish our analysis

  7. Oscillatory regime in the multidimensional homogeneous cosmological models induced by a vector field

    International Nuclear Information System (INIS)

    Benini, R; Kirillov, A A; Montani, Giovanni


    We show that in multidimensional gravity, vector fields completely determine the structure and properties of singularity. It turns out that in the presence of a vector field the oscillatory regime exists in all spatial dimensions and for all homogeneous models. By analysing the Hamiltonian equations we derive the Poincare return map associated with the Kasner indexes and fix the rules according to which the Kasner vectors rotate. In correspondence to a four-dimensional spacetime, the oscillatory regime here constructed overlaps the usual Belinski-Khalatnikov-Liftshitz one

  8. Capacity of oscillatory associative-memory networks with error-free retrieval

    International Nuclear Information System (INIS)

    Nishikawa, Takashi; Lai Yingcheng; Hoppensteadt, Frank C.


    Networks of coupled periodic oscillators (similar to the Kuramoto model) have been proposed as models of associative memory. However, error-free retrieval states of such oscillatory networks are typically unstable, resulting in a near zero capacity. This puts the networks at disadvantage as compared with the classical Hopfield network. Here we propose a simple remedy for this undesirable property and show rigorously that the error-free capacity of our oscillatory, associative-memory networks can be made as high as that of the Hopfield network. They can thus not only provide insights into the origin of biological memory, but can also be potentially useful for applications in information science and engineering

  9. Sterol synthesis and cell size distribution under oscillatory growth conditions in Saccharomyces cerevisiae scale-down cultivations. (United States)

    Marbà-Ardébol, Anna-Maria; Bockisch, Anika; Neubauer, Peter; Junne, Stefan


    Physiological responses of yeast to oscillatory environments as they appear in the liquid phase in large-scale bioreactors have been the subject of past studies. So far, however, the impact on the sterol content and intracellular regulation remains to be investigated. Since oxygen is a cofactor in several reaction steps within sterol metabolism, changes in oxygen availability, as occurs in production-scale aerated bioreactors, might have an influence on the regulation and incorporation of free sterols into the cell lipid layer. Therefore, sterol and fatty acid synthesis in two- and three-compartment scale-down Saccharomyces cerevisiae cultivation were studied and compared with typical values obtained in homogeneous lab-scale cultivations. While cells were exposed to oscillating substrate and oxygen availability in the scale-down cultivations, growth was reduced and accumulation of carboxylic acids was increased. Sterol synthesis was elevated to ergosterol at the same time. The higher fluxes led to increased concentrations of esterified sterols. The cells thus seem to utilize the increased availability of precursors to fill their sterol reservoirs; however, this seems to be limited in the three-compartment reactor cultivation due to a prolonged exposure to oxygen limitation. Besides, a larger heterogeneity within the single-cell size distribution was observed under oscillatory growth conditions with three-dimensional holographic microscopy. Hence the impact of gradients is also observable at the morphological level. The consideration of such a single-cell-based analysis provides useful information about the homogeneity of responses among the population. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Grasping hand verbs: oscillatory beta and alpha correlates of action-word processing.

    Directory of Open Access Journals (Sweden)

    Valentina Niccolai

    Full Text Available The grounded cognition framework proposes that sensorimotor brain areas, which are typically involved in perception and action, also play a role in linguistic processing. We assessed oscillatory modulation during visual presentation of single verbs and localized cortical motor regions by means of isometric contraction of hand and foot muscles. Analogously to oscillatory activation patterns accompanying voluntary movements, we expected a somatotopically distributed suppression of beta and alpha frequencies in the motor cortex during processing of body-related action verbs. Magnetoencephalographic data were collected during presentation of verbs that express actions performed using the hands (H or feet (F. Verbs denoting no bodily movement (N were used as a control. Between 150 and 500 msec after visual word onset, beta rhythms were suppressed in H and F in comparison with N in the left hemisphere. Similarly, alpha oscillations showed left-lateralized power suppression in the H-N contrast, although at a later stage. The cortical oscillatory activity that typically occurs during voluntary movements is therefore found to somatotopically accompany the processing of body-related verbs. The combination of a localizer task with the oscillatory investigation applied to verb reading as in the present study provides further methodological possibilities of tracking language processing in the brain.

  11. Oscillatory behaviors and hierarchical assembly of contractile structures in intercalating cells

    International Nuclear Information System (INIS)

    Fernandez-Gonzalez, Rodrigo; Zallen, Jennifer A


    Fluctuations in the size of the apical cell surface have been associated with apical constriction and tissue invagination. However, it is currently not known if apical oscillatory behaviors are a unique property of constricting cells or if they constitute a universal feature of the force balance between cells in multicellular tissues. Here, we set out to determine whether oscillatory cell behaviors occur in parallel with cell intercalation during the morphogenetic process of axis elongation in the Drosophila embryo. We applied multi-color, time-lapse imaging of living embryos and SIESTA, an integrated tool for automated and semi-automated cell segmentation, tracking, and analysis of image sequences. Using SIESTA, we identified cycles of contraction and expansion of the apical surface in intercalating cells and characterized them at the molecular, cellular, and tissue scales. We demonstrate that apical oscillations are anisotropic, and this anisotropy depends on the presence of intact cell–cell junctions and spatial cues provided by the anterior–posterior patterning system. Oscillatory cell behaviors during axis elongation are associated with the hierarchical assembly and disassembly of contractile actomyosin structures at the medial cortex of the cell, with actin localization preceding myosin II and with the localization of both proteins preceding changes in cell shape. We discuss models to explain how the architecture of cytoskeletal networks regulates their contractile behavior and the mechanisms that give rise to oscillatory cell behaviors in intercalating cells

  12. The Nonlinear Distortions in the Oscillatory System of Generator on CFOA

    Directory of Open Access Journals (Sweden)

    Yuriy Konstantinovich Rybin


    Full Text Available In recent years, many articles came out where one could find the analysis of oscillatory systems of electric sinusoid signals generators with amplifiers called CFOA—current feedback operational amplifiers. As a rule, the analysis of such systems is made by applying mathematical modeling methods on the basis of the amplifier linear model, which does not allow estimating advantages and disadvantages of the systems realized with those amplifiers in comparison with classical systems. A nonlinear model of a current feedback operational amplifier (CFOA is introduced in the paper; nonlinearity of “current mirror” is reflected in the form of current double limiting. The analysis of two known oscillatory systems has been carried out with the use of this non-linear model. Dependence between current limiting level, output voltage amplitude, and maximum oscillation frequency has been obtained. The paper shows that output current limiting under current output connection of capacitive load reduces frequency range and output voltage amplitude considerably and increases harmonic distortions in comparison with classical oscillatory systems. The research done has found that the application of new amplifiers does not give considerable advantages to the oscillatory systems with CFOA.

  13. The influence of low-grade glioma on resting state oscillatory brain activity: a magnetoencephalography study

    NARCIS (Netherlands)

    Bosma, I.; Stam, C.; Douw, L.; Bartolomei, F.; Heimans, J.; Dijk, van B.; Postma, T.; Klein, M.; Reijneveld, J.


    Purpose: In the present MEG-study, power spectral analysis of oscillatory brain activity was used to compare resting state brain activity in both low-grade glioma (LGG) patients and healthy controls. We hypothesized that LGG patients show local as well as diffuse slowing of resting state brain

  14. Impact of Heat and Mass Transfer on MHD Oscillatory Flow of Jeffery ...

    African Journals Online (AJOL)

    The objective of this paper is to study Dufour, Soret and thermal conductivity on unsteady heat and mass transfer of magneto hydrodynamic (MHD) oscillatory flow of Jeffery fluid through a porous medium in a channel. The partial differential equations governing the flow have been solved numerically using semi-implicit ...

  15. Heat transfer to MHD oscillatory dusty fluid flow in a channel filled ...

    Indian Academy of Sciences (India)

    In this paper, we examine the combined effects of thermal radiation, buoyancy force and magnetic field on oscillatory flow of a conducting optically thin dusty fluid through a vertical channel filled with a saturated porous medium. The governing partial differential equations are obtained and solved analytically by variable ...

  16. Spontaneous oscillatory rhythms in the degenerating mouse retina modulate retinal ganglion cell responses to electrical stimulation

    Directory of Open Access Journals (Sweden)

    Yong Sook eGoo


    Full Text Available Characterization of the electrical activity of the retina in the animal models of retinal degeneration has been carried out in part to understand the progression of retinal degenerative diseases like age-related macular degeneration (AMD and retinitis pigmentosa (RP, but also to determine optimum stimulus paradigms for use with retinal prosthetic devices. The models most studied in this regard have been the two lines of mice deficient in the β-subunit of phosphodiesterase (rd1 and rd10 mice, where the degenerating retinas exhibit characteristic spontaneous hyperactivity and oscillatory local field potentials (LFPs. Additionally, there is a robust ~10 Hz rhythmic burst of retinal ganglion cell (RGC spikes on the trough of the oscillatory LFP. In rd1 mice, the rhythmic burst of RGC spikes is always phase-locked with the oscillatory LFP and this phase-locking property is preserved regardless of postnatal ages. However, in rd10 mice, the frequency of the oscillatory rhythm changes according to postnatal age, suggesting that this rhythm might be a marker of the stage of degeneration. Furthermore when a biphasic current stimulus is applied to rd10 mice degenerate retina, distinct RGC response patterns that correlate with the stage of degeneration emerge. This review also considers the significance of these response properties.

  17. Oscillatory phase dynamics in neural entrainment underpin illusory percepts of time. (United States)

    Herrmann, Björn; Henry, Molly J; Grigutsch, Maren; Obleser, Jonas


    Neural oscillatory dynamics are a candidate mechanism to steer perception of time and temporal rate change. While oscillator models of time perception are strongly supported by behavioral evidence, a direct link to neural oscillations and oscillatory entrainment has not yet been provided. In addition, it has thus far remained unaddressed how context-induced illusory percepts of time are coded for in oscillator models of time perception. To investigate these questions, we used magnetoencephalography and examined the neural oscillatory dynamics that underpin pitch-induced illusory percepts of temporal rate change. Human participants listened to frequency-modulated sounds that varied over time in both modulation rate and pitch, and judged the direction of rate change (decrease vs increase). Our results demonstrate distinct neural mechanisms of rate perception: Modulation rate changes directly affected listeners' rate percept as well as the exact frequency of the neural oscillation. However, pitch-induced illusory rate changes were unrelated to the exact frequency of the neural responses. The rate change illusion was instead linked to changes in neural phase patterns, which allowed for single-trial decoding of percepts. That is, illusory underestimations or overestimations of perceived rate change were tightly coupled to increased intertrial phase coherence and changes in cerebro-acoustic phase lag. The results provide insight on how illusory percepts of time are coded for by neural oscillatory dynamics.

  18. Slowing of oscillatory brain activity is a stable characteristic of Parkinson's disease without dementia

    NARCIS (Netherlands)

    Stoffers, D.; Bosboom, JL; Deijen, J.B.; Wolters, E.C.M.J.; Berendse, H.W.; Stam, L.


    Extensive changes in resting-state oscillatory brain activity have recently been demonstrated using magnetoencephalography (MEG) in moderately advanced, non-demented Parkinson's disease patients relative to age-matched controls. The aim of the present study was to determine the onset and evolution

  19. Determination of crystal oscillatory spectra by internal friction data spectroscopic analysis

    International Nuclear Information System (INIS)

    Zaykin, Yu.A.


    Technique for relaxation spectra determination on the basis of internal friction averaging over relaxation frequencies is developed. It is shown that mathematically the problem is reduced to solution of the first type Fredholm integral equation. Impurity oscillatory spectra in alpha-iron, molybdenum and Fe-Cr-Ni alloy are obtained. (author)

  20. Oscillatory water sorption test for determining water uptake behavior in bread crust

    NARCIS (Netherlands)

    Nieuwenhuijzen, N.H. van; Tromp, R.H.; Hamer, R.J.; Vliet, T. van


    In this work, water sorption kinetics of bread crust are described using an oscillatory sorption test in combination with a Langmuir type equation. Both kinetic and thermodynamic information could be obtained at the same time. An advantage of applying a Langmuir type equation for a quantitative

  1. Severity of Hypoxemia and Effect of High-Frequency Oscillatory Ventilation in Acute Respiratory Distress Syndrome

    NARCIS (Netherlands)

    Meade, Maureen O; Young, Duncan; Hanna, Steven; Zhou, Qi; Bachman, Thomas E; Bollen, Casper; Slutsky, Arthur S; Lamb, Sarah E; Adhikari, Neill K J; Mentzelopoulos, Spyros D; Cook, Deborah J; Sud, Sachin; Brower, Roy G; Thompson, B Taylor; Shah, Sanjoy; Stenzler, Alex; Guyatt, Gordon; Ferguson, Niall D


    RATIONALE: High-frequency oscillatory ventilation (HFOV) is theoretically beneficial for lung protection, but the results of clinical trials are inconsistent, with study-level meta-analyses suggesting no significant effect on mortality. OBJECTIVES: The aim of this individual patient data

  2. Finite-size scaling for quantum chains with an oscillatory energy gap

    International Nuclear Information System (INIS)

    Hoeger, C.; Gehlen, G. von; Rittenberg, V.


    We show that the existence of zeroes of the energy gap for finite quantum chains is related to a nonvanishing wavevector. Finite-size scaling ansaetze are formulated for incommensurable and oscillatory structures. The ansaetze are verified in the one-dimensional XY model in a transverse field. (orig.)

  3. Stability of oscillatory solutions of differential equations with a general piecewise constant argument

    Directory of Open Access Journals (Sweden)

    Kuo-Shou Chiu


    Full Text Available We examine scalar differential equations with a general piecewise constant argument, in short DEPCAG, that is, the argument is a general step function. Criteria of existence of the oscillatory and nonoscillatory solutions of such equations are proposed. Necessary and sufficient conditions for stability of the zero solution are obtained. Appropriate examples are given to show our results.

  4. Information-geometric measures estimate neural interactions during oscillatory brain states

    Directory of Open Access Journals (Sweden)

    Yimin eNie


    Full Text Available The characterization of functional network structures among multiple neurons is essential to understanding neural information processing. Information geometry (IG, a theory developed for investigating a space of probability distributions has recently been applied to spike-train analysis and has provided robust estimations of neural interactions. Although neural firing in the equilibrium state is often assumed in these studies, in reality, neural activity is non-stationary. The brain exhibits various oscillations depending on cognitive demands or when an animal is asleep. Therefore, the investigation of the IG measures during oscillatory network states is important for testing how the IG method can be applied to real neural data. Using model networks of binary neurons or more realistic spiking neurons, we studied how the single- and pairwise-IG measures were influenced by oscillatory neural activity. Two general oscillatory mechanisms, externally driven oscillations and internally induced oscillations, were considered. In both mechanisms, we found that the single-IG measure was linearly related to the magnitude of the external input, and that the pairwise-IG measure was linearly related to the sum of connection strengths between two neurons. We also observed that the pairwise-IG measure was not dependent on the oscillation frequency. These results are consistent with the previous findings that were obtained under the equilibrium conditions. Therefore, we demonstrate that the IG method provides useful insights into neural interactions under the oscillatory condition that can often be observed in the real brain.

  5. Oscillatory Critical Amplitudes in Hierarchical Models and the Harris Function of Branching Processes (United States)

    Costin, Ovidiu; Giacomin, Giambattista


    Oscillatory critical amplitudes have been repeatedly observed in hierarchical models and, in the cases that have been taken into consideration, these oscillations are so small to be hardly detectable. Hierarchical models are tightly related to iteration of maps and, in fact, very similar phenomena have been repeatedly reported in many fields of mathematics, like combinatorial evaluations and discrete branching processes. It is precisely in the context of branching processes with bounded off-spring that T. Harris, in 1948, first set forth the possibility that the logarithm of the moment generating function of the rescaled population size, in the super-critical regime, does not grow near infinity as a power, but it has an oscillatory prefactor (the Harris function). These oscillations have been observed numerically only much later and, while the origin is clearly tied to the discrete character of the iteration, the amplitude size is not so well understood. The purpose of this note is to reconsider the issue for hierarchical models and in what is arguably the most elementary setting—the pinning model—that actually just boils down to iteration of polynomial maps (and, notably, quadratic maps). In this note we show that the oscillatory critical amplitude for pinning models and the Harris function coincide. Moreover we make explicit the link between these oscillatory functions and the geometry of the Julia set of the map, making thus rigorous and quantitative some ideas set forth in Derrida et al. (Commun. Math. Phys. 94:115-132, 1984).

  6. Measurement of transmitted power in untapered multifibre unions oscillatory spectral behaviour


    Rodriguez Horche, Paloma; Muriel Fernández, Miguel Ángel; Martín Pereda, José Antonio


    Shows a new structure, the untapered multifibre union, with similar oscillation behaviour to that of tapered single-mode fibres. As a consequences conical regions are not relevant to the final results. This oscillatory behaviour opens the way to low-cost all-fibre devices such as optical filters

  7. Phase lags in oscillatory sheet flow: experiments and bed load modelling

    NARCIS (Netherlands)

    Dohmen-Janssen, Catarine M.; Kroekenstoel, D.F.; Kroekenstoel, D.F.; Hassan, Wael; Ribberink, Jan S.


    Sheet flow corresponds to the high velocity regime when small bed ripples are washed out and sand is transported in a thin layer close to the bed. Therefore, it is often assumed that sand transport in oscillatory sheet flow behaves quasi-steady: time-dependent transport rates are assumed to be

  8. Reversibility and hysteresis of the sharp yielding transition of a colloidal glass under oscillatory shear

    NARCIS (Netherlands)

    Dang, M. T.; Denisov, D.; Struth, B.; Zaccone, A.; Schall, P.

    The mechanical response of glasses remains challenging to understand. Recent results indicate that the oscillatory rheology of soft glasses is accompanied by a sharp non-equilibrium transition in the microscopic dynamics. Here, we use simultaneous x-ray scattering and rheology to investigate the

  9. Shadows of Music-Language Interaction on Low Frequency Brain Oscillatory Patterns (United States)

    Carrus, Elisa; Koelsch, Stefan; Bhattacharya, Joydeep


    Electrophysiological studies investigating similarities between music and language perception have relied exclusively on the signal averaging technique, which does not adequately represent oscillatory aspects of electrical brain activity that are relevant for higher cognition. The current study investigated the patterns of brain oscillations…

  10. The influence of low-grade glioma on resting state oscillatory brain activity: a magnetoencephalography study

    NARCIS (Netherlands)

    Bosma, I.; Stam, C. J.; Douw, L.; Bartolomei, F.; Heimans, J. J.; van Dijk, B. W.; Postma, T. J.; Klein, M.; Reijneveld, J. C.


    In the present MEG-study, power spectral analysis of oscillatory brain activity was used to compare resting state brain activity in both low-grade glioma (LGG) patients and healthy controls. We hypothesized that LGG patients show local as well as diffuse slowing of resting state brain activity

  11. Structural state diagram of concentrated suspensions of jammed soft particles in oscillatory shear flow (United States)

    Khabaz, Fardin; Cloitre, Michel; Bonnecaze, Roger T.


    In a recent study [Khabaz et al., Phys. Rev. Fluids 2, 093301 (2017), 10.1103/PhysRevFluids.2.093301], we showed that jammed soft particle glasses (SPGs) crystallize and order in steady shear flow. Here we investigate the rheology and microstructures of these suspensions in oscillatory shear flow using particle-dynamics simulations. The microstructures in both types of flows are similar, but their evolutions are very different. In both cases the monodisperse and polydisperse suspensions form crystalline and layered structures, respectively, at high shear rates. The crystals obtained in the oscillatory shear flow show fewer defects compared to those in the steady shear. SPGs remain glassy for maximum oscillatory strains less than about the yield strain of the material. For maximum strains greater than the yield strain, microstructural and rheological transitions occur for SPGs. Polydisperse SPGs rearrange into a layered structure parallel to the flow-vorticity plane for sufficiently high maximum shear rates and maximum strains about 10 times greater than the yield strain. Monodisperse suspensions form a face-centered cubic (FCC) structure when the maximum shear rate is low and hexagonal close-packed (HCP) structure when the maximum shear rate is high. In steady shear, the transition from a glassy state to a layered one for polydisperse suspensions included a significant induction strain before the transformation. In oscillatory shear, the transformation begins to occur immediately and with different microstructural changes. A state diagram for suspensions in large amplitude oscillatory shear flow is found to be in close but not exact agreement with the state diagram for steady shear flow. For more modest amplitudes of around one to five times the yield strain, there is a transition from a glassy structure to FCC and HCP crystals, at low and high frequencies, respectively, for monodisperse suspensions. At moderate frequencies, the transition is from glassy to HCP via

  12. Oscillatory lower body negative pressure impairs working memory task-related functional hyperemia in healthy volunteers. (United States)

    Merchant, Sana; Medow, Marvin S; Visintainer, Paul; Terilli, Courtney; Stewart, Julian M


    Neurovascular coupling (NVC) describes the link between an increase in task-related neural activity and increased cerebral blood flow denoted "functional hyperemia." We previously showed induced cerebral blood flow oscillations suppressed functional hyperemia; conversely functional hyperemia also suppressed cerebral blood flow oscillations. We used lower body negative pressure (OLBNP) oscillations to force oscillations in middle cerebral artery cerebral blood flow velocity (CBFv). Here, we used N-back testing, an intellectual memory challenge as a neural activation task, to test the hypothesis that OLBNP-induced oscillatory cerebral blood flow can reduce functional hyperemia and NVC produced by a working memory task and can interfere with working memory. We used OLBNP (-30 mmHg) at 0.03, 0.05, and 0.10 Hz and measured spectral power of CBFv at all frequencies. Neither OLBNP nor N-back, alone or combined, affected hemodynamic parameters. 2-Back power and OLBNP individually were compared with 2-back power during OLBNP. 2-Back alone produced a narrow band increase in oscillatory arterial pressure (OAP) and oscillatory cerebral blood flow power centered at 0.0083 Hz. Functional hyperemia in response to 2-back was reduced to near baseline and 2-back memory performance was decreased by 0.03-, 0.05-, and 0.10-Hz OLBNP. OLBNP alone produced increased oscillatory power at frequencies of oscillation not suppressed by added 2-back. However, 2-back preceding OLBNP suppressed OLBNP power. OLBNP-driven oscillatory CBFv blunts NVC and memory performance, while memory task reciprocally interfered with forced CBFv oscillations. This shows that induced cerebral blood flow oscillations suppress functional hyperemia and functional hyperemia suppresses cerebral blood flow oscillations. NEW & NOTEWORTHY We show that induced cerebral blood flow oscillations suppress functional hyperemia produced by a working memory task as well as memory task performance. We conclude that oscillatory

  13. Assessing the Contribution of the Oscillatory Potentials to the Genesis of the Photopic ERG with the Discrete Wavelet Transform. (United States)

    Gauvin, Mathieu; Dorfman, Allison L; Trang, Nataly; Gauthier, Mercedes; Little, John M; Lina, Jean-Marc; Lachapelle, Pierre


    The electroretinogram (ERG) is composed of slow (i.e., a-, b-waves) and fast (i.e., oscillatory potentials: OPs) components. OPs have been shown to be preferably affected in some diseases (such as diabetic retinopathy), while the a- and b-waves remain relatively intact. The purpose of this study was to determine the contribution of OPs to the building of the ERG and to examine whether a signal mostly composed of OPs could also exist. DWT analyses were performed on photopic ERGs (flash intensities: -2.23 to 2.64 log cd·s·m -2 in 21 steps) obtained from normal subjects ( n = 40) and patients ( n = 21) affected with a retinopathy. In controls, the %OP value (i.e., OPs energy/ERG energy) is stimulus- and amplitude-independent (range: 56.6-61.6%; CV = 6.3%). In contrast, the %OPs measured from the ERGs of our patients varied significantly more (range: 35.4%-89.2%; p pathology, some presenting with ERGs that are almost solely composed of OPs. In conclusion, patients may present with a wide range of %OP values. Findings herein also support the hypothesis that, in certain conditions, the photopic ERG can be mostly composed of high-frequency components.

  14. Assessing the Contribution of the Oscillatory Potentials to the Genesis of the Photopic ERG with the Discrete Wavelet Transform

    Directory of Open Access Journals (Sweden)

    Mathieu Gauvin


    Full Text Available The electroretinogram (ERG is composed of slow (i.e., a-, b-waves and fast (i.e., oscillatory potentials: OPs components. OPs have been shown to be preferably affected in some diseases (such as diabetic retinopathy, while the a- and b-waves remain relatively intact. The purpose of this study was to determine the contribution of OPs to the building of the ERG and to examine whether a signal mostly composed of OPs could also exist. DWT analyses were performed on photopic ERGs (flash intensities: −2.23 to 2.64 log cd·s·m−2 in 21 steps obtained from normal subjects (n=40 and patients (n=21 affected with a retinopathy. In controls, the %OP value (i.e., OPs energy/ERG energy is stimulus- and amplitude-independent (range: 56.6–61.6%; CV = 6.3%. In contrast, the %OPs measured from the ERGs of our patients varied significantly more (range: 35.4%–89.2%; p<0.05 depending on the pathology, some presenting with ERGs that are almost solely composed of OPs. In conclusion, patients may present with a wide range of %OP values. Findings herein also support the hypothesis that, in certain conditions, the photopic ERG can be mostly composed of high-frequency components.

  15. [Clinical efficacy of high-frequency oscillatory ventilation combined with pulmonary surfactant in treatment of neonatal pulmonary hemorrhage]. (United States)

    Lin, Xin-Zhu; Lai, Ji-Dong; Lv, Mei; Zhu, Yao; Wang, Lian; Chen, Chao


    To explore the clinical efficacy of high-frequency oscillatory ventilation (HFOV) combined with pulmonary surfactant (PS) in the treatment of neonatal pulmonary hemorrhage (NPH). A total of 122 neonates diagnosed with NPH between January 2010 and June 2014 were enrolled. After being stratified by gestational age, the neonates were randomly divided into treatment (HFOV+PS) and control (HFOV alone) groups (n=61 each). Both groups were treated with HFOV after the onset of NPH. After 2-4 hours of HFOV treatment, the treatment group received PS via intratracheal injections, followed by continuous use of HFOV. Dynamic changes in the blood gas, oxygenation index (OI), and PaO2/FiO2 (P/F) values of the neonates were determined before HFOV treatment and after 6, 12, and 24 hours of HFOV treatment. The time to hemostasis, duration of ventilation, incidence of complications, and cure rate were compared between groups. After 6, 12, and 24 hours of HFOV treatment, the treatment group had significantly improved PaO2, PaCO2, O/I, and P/F values compared with the control group (P0.05). HFOV combined with PS is an effective treatment to improve oxygenation, shorten the time to hemostasis and the duration of ventilation, and reduce the incidence of complications in neonates with NPH. However, the dual therapy is unable to reduce the mortality of neonates compared with HFOV monotherapy.

  16. Analysis for the amplitude oscillatory movements of the ship in response to the incidence wave (United States)

    Chiţu, M. G.; Zăgan, R.; Manea, E.


    Event of major accident navigation near offshore drilling rigs remains unacceptably high, known as the complications arising from the problematic of the general motions of the ship sailing under real sea. Dynamic positioning system is an effective instrument used on board of the ships operating in the extraction of oil and gas in the continental shelf of the seas and oceans, being essential that the personnel on board of the vessel can maintain position and operating point or imposed on a route with high precision. By the adoption of a strict safety in terms of handling and positioning of the vessel in the vicinity of the drilling platform, the risk of accidents can be reduced to a minimum. Possibilities in anticipation amplitudes of the oscillatory movements of the ships navigating in real sea, is a challenge for naval architects and OCTOPUS software is a tool used increasingly more in this respect, complementing navigational facilities offered by dynamic positioning systems. This paper presents a study on the amplitudes of the oscillations categories of supply vessels in severe hydro meteorological conditions of navigation. The study provides information on the RAO (Response Amplitude Operator) response operator of the ship, for the amplitude of the roll movements, in some incident wave systems, interpreted using the energy spectrum Jonswap and whose characteristics are known (significant height of the wave, wave period, pulsation of the wave). Ship responses are analyzed according to different positioning of the ship in relation to the wave front (incident angle ranging from 10 to 10 degree from 0 to 180), highlighting the value of the ship roll motion amplitude. For the study, was used, as a tool for modeling and simulation, the features offered by OCTOPUS software that allows the study of the computerized behavior of the ship on the waves, in the real conditions of navigation. Program library was used for both the vessel itself and navigation modeling

  17. Linearly and nonlinearly optimized weighted essentially non-oscillatory methods for compressible turbulence (United States)

    Taylor, Ellen Meredith

    Weighted essentially non-oscillatory (WENO) methods have been developed to simultaneously provide robust shock-capturing in compressible fluid flow and avoid excessive damping of fine-scale flow features such as turbulence. This is accomplished by constructing multiple candidate numerical stencils that adaptively combine so as to provide high order of accuracy and high bandwidth-resolving efficiency in continuous flow regions while averting instability-provoking interpolation across discontinuities. Under certain conditions in compressible turbulence, however, numerical dissipation remains unacceptably high even after optimization of the linear optimal stencil combination that dominates in smooth regions. The remaining nonlinear error arises from two primary sources: (i) the smoothness measurement that governs the application of adaptation away from the optimal stencil and (ii) the numerical properties of individual candidate stencils that govern numerical accuracy when adaptation engages. In this work, both of these sources are investigated, and corrective modifications to the WENO methodology are proposed and evaluated. Excessive nonlinear error due to the first source is alleviated through two separately considered procedures appended to the standard smoothness measurement technique that are designated the "relative smoothness limiter" and the "relative total variation limiter." In theory, appropriate values of their associated parameters should be insensitive to flow configuration, thereby sidestepping the prospect of costly parameter tuning; and this expectation of broad effectiveness is assessed in direct numerical simulations (DNS) of one-dimensional inviscid test problems, three-dimensional compressible isotropic turbulence of varying Reynolds and turbulent Mach numbers, and shock/isotropic-turbulence interaction (SITI). In the process, tools for efficiently comparing WENO adaptation behavior in smooth versus shock-containing regions are developed. The

  18. Modulated anharmonic ADPs are intrinsic to aperiodic crystals: a case study on incommensurate Rb2ZnCl4

    International Nuclear Information System (INIS)

    Li, Liang; Wölfel, Alexander; Schönleber, Andreas; Mondal, Swastik; Schreurs, Antoine M. M.; Kroon-Batenburg, Loes M. J.; Smaalen, Sander van


    The superspace maximum entropy method (MEM) density in combination with structure refinements has been used to uncover the modulation in incommensurate Rb 2 ZnCl 4 close to the lock-in transition. Modulated atomic displacement parameters (ADPs) and modulated anharmonic ADPs are found to form an intrinsic part of the modulation. Refined values for the displacement modulation function depend on the presence or absence of modulated ADPs in the model. A combination of structure refinements, analysis of the superspace MEM density and interpretation of difference-Fourier maps has been used to characterize the incommensurate modulation of rubidium tetrachlorozincate, Rb 2 ZnCl 4 , at a temperature of T = 196 K, close to the lock-in transition at T lock-in = 192 K. The modulation is found to consist of a combination of displacement modulation functions, modulated atomic displacement parameters (ADPs) and modulated third-order anharmonic ADPs. Up to fifth-order Fourier coefficients could be refined against diffraction data containing up to fifth-order satellite reflections. The center-of-charge of the atomic basins of the MEM density and the displacive modulation functions of the structure model provide equivalent descriptions of the displacive modulation. Modulations of the ADPs and anharmonic ADPs are visible in the MEM density, but extracting quantitative information about these modulations appears to be difficult. In the structure refinements the modulation parameters of the ADPs form a dependent set, and ad hoc restrictions had to be introduced in the refinements. It is suggested that modulated harmonic ADPs and modulated third-order anharmonic ADPs form an intrinsic part, however small, of incommensurately modulated structures in general. Refinements of alternate models with and without parameters for modulated ADPs lead to significant differences between the parameters of the displacement modulation in these two types of models, thus showing the modulation of ADPs to

  19. Simulations of oscillatory systems with award-winning software, physics of oscillations

    CERN Document Server

    Butikov, Eugene I


    Deepen Your Students' Understanding of Oscillations through Interactive Experiments Simulations of Oscillatory Systems: with Award-Winning Software, Physics of Oscillations provides a hands-on way of visualizing and understanding the fundamental concepts of the physics of oscillations. Both the textbook and software are designed as exploration-oriented supplements for courses in general physics and the theory of oscillations. The book is conveniently structured according to mathematical complexity. Each chapter in Part I contains activities, questions, exercises, and problems of varying levels of difficulty, from straightforward to quite challenging. Part II presents more sophisticated, highly mathematical material that delves into the serious theoretical background for the computer-aided study of oscillations. The software package allows students to observe the motion of linear and nonlinear mechanical oscillatory systems and to obtain plots of the variables that describe the systems along with phase diagram...

  20. Acute changes in motor cortical excitability during slow oscillatory and constant anodal transcranial direct current stimulation

    DEFF Research Database (Denmark)

    Bergmann, Til Ole; Groppa, Sergiu; Seeger, Markus


    Transcranial oscillatory current stimulation has recently emerged as a noninvasive technique that can interact with ongoing endogenous rhythms of the human brain. Yet, there is still little knowledge on how time-varied exogenous currents acutely modulate cortical excitability. In ten healthy...... individuals we used on-line single-pulse transcranial magnetic stimulation (TMS) to search for systematic shifts in corticospinal excitability during anodal sleeplike 0.8-Hz slow oscillatory transcranial direct current stimulation (so-tDCS). In separate sessions, we repeatedly applied 30-s trials (two blocks...... at 20 min) of either anodal so-tDCS or constant tDCS (c-tDCS) to the primary motor hand area during quiet wakefulness. Simultaneously and time-locked to different phase angles of the slow oscillation, motor-evoked potentials (MEPs) as an index of corticospinal excitability were obtained...

  1. Warm inflation with an oscillatory inflaton in the non-minimal kinetic coupling model

    International Nuclear Information System (INIS)

    Goodarzi, Parviz; Sadjadi, H.M.


    In the cold inflation scenario, the slow roll inflation and reheating via coherent rapid oscillation, are usually considered as two distinct eras. When the slow roll ends, a rapid oscillation phase begins and the inflaton decays to relativistic particles reheating the Universe. In another model dubbed warm inflation, the rapid oscillation phase is suppressed, and we are left with only a slow roll period during which the reheating occurs. Instead, in this paper, we propose a new picture for inflation in which the slow roll era is suppressed and only the rapid oscillation phase exists. Radiation generation during this era is taken into account, so we have warm inflation with an oscillatory inflaton. To provide enough e-folds, we employ the non-minimal derivative coupling model. We study the cosmological perturbations and compute the temperature at the end of warm oscillatory inflation. (orig.)

  2. Oscillatory blood pressure response to the onset of cycling exercise in men

    DEFF Research Database (Denmark)

    Barbosa, Thales C; Fernandes, Igor A; Magalhães-Jr, Nisval


    to this pattern is unclear. What is the main finding and its importance? We demonstrate that attenuation of group III/IV muscle afferent feedback by spinal fentanyl impairs the pressor response after 10 s of moderate leg cycling exercise, but this afferent feedback does not appear to be necessary for induction...... of the oscillatory pattern of blood pressure at the onset of exercise. We investigated whether attenuation of the central projections of group III/IV skeletal muscle afferents via lumbar intrathecal administration of the μ-opioid receptor agonist fentanyl affects the oscillatory blood pressure (BP) response...... to the onset of dynamic exercise. Eight healthy, recreationally active men (28 ± 3 years old) performed 40 s of cycling at 80 W (60 r.p.m.) before (control) and after fentanyl administration, while heart rate, stroke volume, cardiac output, systolic, mean and diastolic BP and total vascular conductance were...

  3. Unzip instabilities: Straight to oscillatory transitions in the cutting of thin polymer sheets (United States)

    Reis, P. M.; Kumar, A.; Shattuck, M. D.; Roman, B.


    We report an experimental investigation of the cutting of a thin brittle polymer sheet with a blunt tool. It was recently shown that the fracture path becomes oscillatory when the tool is much wider than the sheet thickness. Here we uncover two novel transitions from straight to oscillatory fracture by varying either the tilt angle of the tool or the speed of cutting, respectively. We denote these by angle and speed unzip instabilities and analyze them by quantifying both the dynamics of the crack tip and the final shapes of the fracture paths. Moreover, for the speed unzip instability, the straight crack lip obtained at low speeds exhibits out-of-plane buckling undulations (as opposed to being flat above the instability threshold) suggesting a transition from ductile to brittle fracture.

  4. Warm inflation with an oscillatory inflaton in the non-minimal kinetic coupling model

    Energy Technology Data Exchange (ETDEWEB)

    Goodarzi, Parviz [University of Ayatollah Ozma Borujerdi, Department of Science, Boroujerd (Iran, Islamic Republic of); Sadjadi, H.M. [University of Tehran, Department of Physics, Tehran (Iran, Islamic Republic of)


    In the cold inflation scenario, the slow roll inflation and reheating via coherent rapid oscillation, are usually considered as two distinct eras. When the slow roll ends, a rapid oscillation phase begins and the inflaton decays to relativistic particles reheating the Universe. In another model dubbed warm inflation, the rapid oscillation phase is suppressed, and we are left with only a slow roll period during which the reheating occurs. Instead, in this paper, we propose a new picture for inflation in which the slow roll era is suppressed and only the rapid oscillation phase exists. Radiation generation during this era is taken into account, so we have warm inflation with an oscillatory inflaton. To provide enough e-folds, we employ the non-minimal derivative coupling model. We study the cosmological perturbations and compute the temperature at the end of warm oscillatory inflation. (orig.)

  5. Throughflow and non-uniform heating effects on double diffusive oscillatory convection in a porous medium

    Directory of Open Access Journals (Sweden)

    Palle Kiran


    Full Text Available A weak nonlinear oscillatory mode of thermal instability is investigated while deriving a non autonomous complex Ginzburg–Landau equation. Darcy porous medium is considered in the presence of vertical throughflow and time periodic thermal boundaries. Only infinitesimal disturbances are considered. The disturbances in velocity, temperature and solutal fields are treated by a perturbation expansion in powers of amplitude of applied temperature field. The effect of throughflow has either to stabilize or to destabilize the system for stress free and isothermal boundary conditions. Nusselt and Sherwood numbers are obtained numerically and presented the results on heat and mass transfer. It is found that, throughflow and thermal modulation can be used alternatively to control the heat and mass transfer. Further, it is also found that oscillatory flow enhances the heat and mass transfer than stationary flow. Effect of modulation frequency and phase angle on mean Nusselt number is also discussed.

  6. Wave fronts, pulses and wave trains in photoexcited superlattices behaving as excitable or oscillatory media

    International Nuclear Information System (INIS)

    Arana, J I; Bonilla, L L; Grahn, H T


    Undoped and strongly photoexcited semiconductor superlattices with field-dependent recombination behave as excitable or oscillatory media with spatially discrete nonlinear convection and diffusion. Infinitely long, dc-current-biased superlattices behaving as excitable media exhibit wave fronts with increasing or decreasing profiles, whose velocities can be calculated by means of asymptotic methods. These superlattices can also support pulses of the electric field. Pulses moving downstream with the flux of electrons can be constructed from their component wave fronts, whereas pulses advancing upstream do so slowly and experience saltatory motion: they change slowly in long intervals of time separated by fast transitions during which the pulses jump to the previous superlattice period. Photoexcited superlattices can also behave as oscillatory media and exhibit wave trains. (paper)

  7. Oscillatory electroosmotic flow in a parallel-plate microchannel under asymmetric zeta potentials (United States)

    Peralta, M.; Arcos, J.; Méndez, F.; Bautista, O.


    In this work, we conduct a theoretical analysis of the start-up of an oscillatory electroosmotic flow (EOF) in a parallel-plate microchannel under asymmetric zeta potentials. It is found that the transient evolution of the flow field is controlled by the parameters {R}ω , {R}\\zeta , and \\bar{κ }, which represent the dimensionless frequency, the ratio of the zeta potentials of the microchannel walls, and the electrokinetic parameter, which is defined as the ratio of the microchannel height to the Debye length. The analysis is performed for both low and high zeta potentials; in the former case, an analytical solution is derived, whereas in the latter, a numerical solution is obtained. These solutions provide the fundamental characteristics of the oscillatory EOFs for which, with suitable adjustment of the zeta potential and the dimensionless frequency, the velocity profiles of the fluid flow exhibit symmetric or asymmetric shapes.

  8. Energy exchange and transition to localization in the asymmetric Fermi-Pasta-Ulam oscillatory chain (United States)

    Smirnov, Valeri V.; Shepelev, Denis S.; Manevitch, Leonid I.


    A finite (periodic) FPU chain is chosen as a convenient model for investigating the energy exchange phenomenon in nonlinear oscillatory systems. As we have recently shown, this phenomenon may occur as a consequence of the resonant interaction between high-frequency nonlinear normal modes. This interaction determines both the complete energy exchange between different parts of the chain and the transition to energy localization in an excited group of particles. In the paper, we demonstrate that this mechanism can exist in realistic (asymmetric) models of atomic or molecular oscillatory chains. Also, we study the resonant interaction of conjugated nonlinear normal modes and prove a possibility of linearization of the equations of motion. The theoretical constructions developed in this paper are based on the concepts of "effective particles" and Limiting Phase Trajectories. In particular, an analytical description of energy exchange between the "effective particles" in the terms of non-smooth functions is presented. The analytical results are confirmed with numerical simulations.

  9. Dynamics of the stochastic low concentration trimolecular oscillatory chemical system with jumps (United States)

    Wei, Yongchang; Yang, Qigui


    This paper is devoted to discern long time dynamics through the stochastic low concentration trimolecular oscillatory chemical system with jumps. By Lyapunov technique, this system is proved to have a unique global positive solution, and the asymptotic stability in mean square of such model is further established. Moreover, the existence of random attractor and Lyapunov exponents are obtained for the stochastic homeomorphism flow generated by the corresponding global positive solution. And some numerical simulations are given to illustrate the presented results.

  10. EEG neural oscillatory dynamics reveal semantic and response conflict at difference levels of conflict awareness


    Jun Jiang; Qinglin Zhang; Simon Van Gaal


    Although previous work has shown that conflict can be detected in the absence of awareness, it is unknown how different sources of conflict (i.e., semantic, response) are processed in the human brain and whether these processes are differently modulated by conflict awareness. To explore this issue, we extracted oscillatory power dynamics from electroencephalographic (EEG) data recorded while human participants performed a modified version of the Stroop task. Crucially, in this task conflict a...

  11. Brachial Artery Flow-mediated Dilation Following Exercise with Augmented Oscillatory and Retrograde Shear Rate

    Directory of Open Access Journals (Sweden)

    Johnson Blair D


    Full Text Available Abstract Background Acute doses of elevated retrograde shear rate (SR appear to be detrimental to endothelial function in resting humans. However, retrograde shear increases during moderate intensity exercise which also enhances post-exercise endothelial function. Since SR patterns differ with the modality of exercise, it is important to determine if augmented retrograde SR during exercise influences post-exercise endothelial function. This study tested the hypothesis that (1 increased doses of retrograde SR in the brachial artery during lower body supine cycle ergometer exercise would attenuate post-exercise flow-mediated dilation (FMD in a dose-dependent manner, and (2 antioxidant vitamin C supplementation would prevent the attenuated post-exercise FMD response. Methods Twelve men participated in four randomized exercise sessions (90 W for 20 minutes on separate days. During three of the sessions, one arm was subjected to increased oscillatory and retrograde SR using three different forearm cuff pressures (20, 40, 60 mmHg (contralateral arm served as the control and subjects ingested placebo capsules prior to exercise. A fourth session with 60 mmHg cuff pressure was performed with 1 g of vitamin C ingested prior to the session. Results Post-exercise FMD following the placebo conditions were lower in the cuffed arm versus the control arm (arm main effect: P P > 0.05. Following vitamin C treatment, post-exercise FMD in the cuffed and control arm increased from baseline (P P > 0.05. Conclusions These results indicate that augmented oscillatory and retrograde SR in non-working limbs during lower body exercise attenuates post-exercise FMD without an evident dose–response in the range of cuff pressures evaluated. Vitamin C supplementation prevented the attenuation of FMD following exercise with augmented oscillatory and retrograde SR suggesting that oxidative stress contributes to the adverse effects of oscillatory and

  12. Low-frequency acoustic atomization with oscillatory flow around micropillars in a microfluidic device

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Yin Nee, E-mail:, E-mail:; Wong, Teck Neng, E-mail:, E-mail: [School of Mechanical and Aerospace Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore, Singapore 639798 (Singapore); Nguyen, Nam Trung, E-mail: [Queensland Micro- and Nanotechnology Centre, Griffith University, Brisbane QLD 4111 (Australia)


    This letter reports a low frequency acoustic atomization technique with oscillatory extensional flow around micropillars. Large droplets passing through two micropillars are elongated. Small droplets are then produced through the pinch-off process at the spindle-shape ends. As the actuation frequency increases, the droplet size decreases with increasing monodispersity. This method is suitable for in-situ mass production of fine droplets in a multi-phase environment without external pumping. Small particles encapsulation was demonstrated with the current technique.

  13. Two types of mental fatigue affect spontaneous oscillatory brain activities in different ways


    Shigihara, Yoshihito; Tanaka, Masaaki; Ishii, Akira; Kanai, Etsuko; Funakura, Masami; Watanabe, Yasuyoshi


    Abstract Background Fatigue has a multi-factorial nature. We examined the effects of two types of mental fatigue on spontaneous oscillatory brain activity using magnetoencephalography (MEG). Methods Participants were randomly assigned to two groups in a single-blinded, crossover fashion to perform two types of mental fatigue-inducing experiments. Each experiment consisted of a 30-min fatigue-inducing 0- or 2-back test session and two evaluation sessions performed just before and after the fat...

  14. Analysis of Oscillatory Neural Activity in Series Network Models of Parkinson's Disease During Deep Brain Stimulation. (United States)

    Davidson, Clare M; de Paor, Annraoi M; Cagnan, Hayriye; Lowery, Madeleine M


    Parkinson's disease is a progressive, neurodegenerative disorder, characterized by hallmark motor symptoms. It is associated with pathological, oscillatory neural activity in the basal ganglia. Deep brain stimulation (DBS) is often successfully used to treat medically refractive Parkinson's disease. However, the selection of stimulation parameters is based on qualitative assessment of the patient, which can result in a lengthy tuning period and a suboptimal choice of parameters. This study explores fourth-order, control theory-based models of oscillatory activity in the basal ganglia. Describing function analysis is applied to examine possible mechanisms for the generation of oscillations in interacting nuclei and to investigate the suppression of oscillations with high-frequency stimulation. The theoretical results for the suppression of the oscillatory activity obtained using both the fourth-order model, and a previously described second-order model, are optimized to fit clinically recorded local field potential data obtained from Parkinsonian patients with implanted DBS. Close agreement between the power of oscillations recorded for a range of stimulation amplitudes is observed ( R(2)=0.69-0.99 ). The results suggest that the behavior of the system and the suppression of pathological neural oscillations with DBS is well described by the macroscopic models presented. The results also demonstrate that in this instance, a second-order model is sufficient to model the clinical data, without the need for added complexity. Describing the system behavior with computationally efficient models could aid in the identification of optimal stimulation parameters for patients in a clinical environment.

  15. EEG Oscillatory States: Universality, Uniqueness and Specificity across Healthy-Normal, Altered and Pathological Brain Conditions (United States)

    Fingelkurts, Alexander A.; Fingelkurts, Andrew A.


    For the first time the dynamic repertoires and oscillatory types of local EEG states in 13 diverse conditions (examined over 9 studies) that covered healthy-normal, altered and pathological brain states were quantified within the same methodological and conceptual framework. EEG oscillatory states were assessed by the probability-classification analysis of short-term EEG spectral patterns. The results demonstrated that brain activity consists of a limited repertoire of local EEG states in any of the examined conditions. The size of the state repertoires was associated with changes in cognition and vigilance or neuropsychopathologic conditions. Additionally universal, optional and unique EEG states across 13 diverse conditions were observed. It was demonstrated also that EEG oscillations which constituted EEG states were characteristic for different groups of conditions in accordance to oscillations’ functional significance. The results suggested that (a) there is a limit in the number of local states available to the cortex and many ways in which these local states can rearrange themselves and still produce the same global state and (b) EEG individuality is determined by varying proportions of universal, optional and unique oscillatory states. The results enriched our understanding about dynamic microstructure of EEG-signal. PMID:24505292

  16. LES-based characterization of a suction and oscillatory blowing fluidic actuator (United States)

    Kim, Jeonglae; Moin, Parviz


    Recently, a novel fluidic actuator using steady suction and oscillatory blowing was developed for control of turbulent flows. The suction and oscillatory blowing (SaOB) actuator combines steady suction and pulsed oscillatory blowing into a single device. The actuation is based upon a self-sustained mechanism of confined jets and does not require any moving parts. The control output is determined by a pressure source and the geometric details, and no additional input is needed. While its basic mechanisms have been investigated to some extent, detailed characteristics of internal turbulent flows are not well understood. In this study, internal flows of the SaOB actuator are simulated using large-eddy simulation (LES). Flow characteristics within the actuator are described in detail for a better understanding of the physical mechanisms and improving the actuator design. LES predicts the self-sustained oscillations of the turbulent jet. Switching frequency, maximum velocity at the actuator outlets, and wall pressure distribution are in good agreement with the experimental measurements. The computational results are used to develop simplified boundary conditions for numerical experiments of active flow control. Supported by the Boeing company.

  17. Beta and gamma oscillatory activities associated with olfactory memory tasks: different rhythms for different functional networks? (United States)

    Martin, Claire; Ravel, Nadine


    Olfactory processing in behaving animals, even at early stages, is inextricable from top down influences associated with odor perception. The anatomy of the olfactory network (olfactory bulb, piriform, and entorhinal cortices) and its unique direct access to the limbic system makes it particularly attractive to study how sensory processing could be modulated by learning and memory. Moreover, olfactory structures have been early reported to exhibit oscillatory population activities easy to capture through local field potential recordings. An attractive hypothesis is that neuronal oscillations would serve to "bind" distant structures to reach a unified and coherent perception. In relation to this hypothesis, we will assess the functional relevance of different types of oscillatory activity observed in the olfactory system of behaving animals. This review will focus primarily on two types of oscillatory activities: beta (15-40 Hz) and gamma (60-100 Hz). While gamma oscillations are dominant in the olfactory system in the absence of odorant, both beta and gamma rhythms have been reported to be modulated depending on the nature of the olfactory task. Studies from the authors of the present review and other groups brought evidence for a link between these oscillations and behavioral changes induced by olfactory learning. However, differences in studies led to divergent interpretations concerning the respective role of these oscillations in olfactory processing. Based on a critical reexamination of those data, we propose hypotheses on the functional involvement of beta and gamma oscillations for odor perception and memory.

  18. Beta and gamma oscillatory activities associated with olfactory memory tasks: Different rhythms for different functional networks?

    Directory of Open Access Journals (Sweden)

    Claire eMartin


    Full Text Available Olfactory processing in behaving animals, even at early stages, is inextricable from top down influences associated with odor perception. The anatomy of the olfactory network (olfactory bulb, piriform and entorhinal cortices and its unique direct access to the limbic system makes it particularly attractive to study how sensory processing could be modulated by learning and memory. Moreover, olfactory structures have been early reported to exhibit oscillatory population activities easy to capture through local field potential recordings. An attractive hypothesis is that neuronal oscillations would serve to ‘bind’ distant structures to reach a unified and coherent perception. In relation to this hypothesis, we will assess the functional relevance of different types of oscillatory activity observed in the olfactory system of behaving animals. This review will focus primarily on two types of oscillatory activities: beta (15-40 Hz and gamma (60-100 Hz. While gamma oscillations are dominant in the olfactory system in the absence of odorant, both beta and gamma rhythms have been reported to be modulated depending on the nature of the olfactory task. Studies from the authors of the present review and other groups brought evidence for a link between these oscillations and behavioral changes induced by olfactory learning. However, differences in studies led to divergent interpretations concerning the respective role of these oscillations in olfactory processing. Based on a critical reexamination of those data, we propose hypotheses on the functional involvement of beta and gamma oscillations for odor perception and memory.

  19. Entropic stochastic resonance without external force in oscillatory confined space

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Huai; Jiang, Huijun; Hou, Zhonghuai, E-mail: [Department of Chemical Physics and Hefei National Laboratory for Physical Sciences at Microscales, iChEM, University of Science and Technology of China, Hefei, Anhui 230026 (China)


    We have studied the dynamics of Brownian particles in a confined geometry of dumbbell-shape with periodically oscillating walls. Entropic stochastic resonance (ESR) behavior, characterizing by a maximum value of the coherent factor Q at some optimal level of noise, is observed even without external periodic force in the horizontal direction, which is necessary for conventional ESR where the wall is static and the particle is subjected to the force. Interestingly, the ESR can be remarkably enhanced by the particle gravity G, in contrast to the conventional case. In addition, Q decreases (increases) with G in the small (large) noise limit, respectively, while it non-monotonically changes with G for moderate noise levels. We have applied an effective 1D coarsening description to illustrate such a nontrivial dependence on G, by investigating the property of the 1D effective potential of entropic nature and paying special attention to the excess part resulting from the boundary oscillation. Dependences of the ESR strength with other related parameters are also discussed.

  20. Fluid mechanics experiments in oscillatory flow. Volume 2: Tabulated data (United States)

    Seume, J.; Friedman, G.; Simon, T. W.


    Results of a fluid mechanics measurement program in oscillating flow within a circular duct are presented. The program began with a survey of transition behavior over a range of oscillation frequency and magnitude and continued with a detailed study at a single operating point. Such measurements were made in support of Stirling engine development. Values of three dimensionless parameters, Re sub max, Re sub w, and A sub R, embody the velocity amplitude, frequency of oscillation, and mean fluid displacement of the cycle, respectively. Measurements were first made over a range of these parameters that are representative of the heat exchanger tubes in the heater section of NASA's Stirling cycle Space Power Research Engine (SPRE). Measurements were taken of the axial and radial components of ensemble-averaged velocity and rms velocity fluctuation and the dominant Reynolds shear stress, at various radial positions for each of four axial stations. In each run, transition from laminar to turbulent flow, and its reverse, were identified and sufficient data was gathered to propose the transition mechanism. Volume 2 contains data reduction program listings and tabulated data (including its graphics).

  1. Oscillatory Dynamics of Gestalt Perception in Schizophrenia Revisited

    Directory of Open Access Journals (Sweden)

    Kevin M Spencer


    Full Text Available Background: Abnormalities in γ oscillations (30-100 Hz in the scalp-recorded electroencephalogram (EEG have been proposed to reflect neural circuitry abnormalities in schizophrenia. Oscillations in the γ band are thought to play an important role in visual perception, mediating the binding of visual features into coherent objects. However, there is relatively little evidence to date of deficits in γ-mediated processes associated with Gestalt perception in schizophrenia.Methods: Fourteen healthy control subjects (HC and 17 chronic schizophrenia patients (SZ discriminated between illusory Kanisza Squares and No-Square control stimuli, indicating their judgment with a manual button press. Time-frequency decomposition of the EEG was computed with the Morlet wavelet transform. Time-frequency maps of phase locking factor (PLF values were calculated for stimulus- and response-locked oscillations.Results: HC and SZ did not differ in reaction time, error rate, an early ERP effect associated with Gestalt processing, nor an early visual-evoked γ oscillation. Two response-locked high γ effects had greater PLF for Square than No-Square stimuli in HC, and the reverse pattern in SZ. One of these effects was correlated with thought disorder symptom ratings in SZ.Conclusions: SZ demonstrated abnormalities in γ oscillations associated with the perception of Gestalt objects, while their early visual-evoked γ activity was mostly normal, contrary to previous results. This study supports the hypothesis that high-frequency oscillations are sensitive to aspects of psychosis.

  2. Oscillatory patterns in the light curves of five long-term monitored type 1 active galactic nuclei (United States)

    Kovačević, Andjelka B.; Pérez-Hernández, Ernesto; Popović, Luka Č.; Shapovalova, Alla I.; Kollatschny, Wolfram; Ilić, Dragana


    New combined data of five well-known type 1 active galactic nuclei (AGNs) are probed with a novel hybrid method in a search for oscillatory behaviour. Additional analysis of artificial light curves obtained from the coupled oscillatory models gives confirmation for detected periods that could have a physical background. We find periodic variations in the long-term light curves of 3C 390.3, NGC 4151 and NGC 5548, and E1821 + 643, with correlation coefficients larger than 0.6. We show that the oscillatory patterns of two binary black hole candidates, NGC 5548 and E1821 + 643, correspond to qualitatively different dynamical regimes of chaos and stability, respectively. We demonstrate that the absence of oscillatory patterns in Arp 102B could be the result of a weak coupling between oscillatory mechanisms. This is the first good evidence that 3C 390.3 and Arp 102B, categorized as double-peaked Balmer line objects, have qualitative different dynamics. Our analysis shows a novelty in the oscillatory dynamical patterns of the light curves of these type 1 AGNs.

  3. Valuing Essays: Essaying Values (United States)

    Badley, Graham


    The essay regularly comes under attack. It is criticised for being rigidly linear rather than flexible and reflective. I first challenge this view by examining reasons why the essay should be valued as an important genre. Secondly, I propose that in using the essay form students and academics necessarily exemplify their own critical values. Essays…

  4. Mixed convection flow of couple stress nanofluid over oscillatory stretching sheet with heat absorption/generation effects

    Directory of Open Access Journals (Sweden)

    Sami Ullah Khan


    Full Text Available The aim of this article is to highlight the unsteady mixed convective couple stress nanoliquid flow passed through stretching surface. The flow is generated due to periodic oscillations of sheet. An appropriate set of dimensionless variables are used to reduce the independent variables in governing equations arising from mathematical modeling. An analytical solution has been computed by employing the technique of homotopy method. The outcomes of various sundry parameters like couple stress parameter, the ratio of angular velocity to stretching rate, thermophoresis parameter, Hartmann number, Prandtl number, heat source/sink parameter, Schmidt number described graphically and in tabular form. It is observed that the velocity profile increases by increasing mixed convection parameter and concentration buoyancy parameter. The temperature enhances for larger values of Hartmann number and Brownian. The concentration profile increases by increasing thermophoresis parameter. Results show that wall shear stress increases by increasing couple stress parameter and ratio of oscillating frequency to stretching rate. Keywords: Oscillatory surface, Couple stress fluid, Nanoparticles, Heat absorption/generation

  5. [Clinical efficacy of preferred use of high-frequency oscillatory ventilation in treatment of neonatal pulmonary hemorrhage]. (United States)

    Wang, Hua; Du, Li-Zhong; Tang, Jun; Wu, Jin-Lin; Mu, De-Zhi


    To investigate the clinical efficacy and safety of preferred use of high-frequency oscillatory ventilation (HFOV) in the treatment of neonatal pulmonary hemorrhage. The clinical efficacy of preferred use of HFOV (preferred use group) and rescue use of HFOV after conventional mechanical ventilation proved ineffective (rescue use group) in the treatment of 26 cases of neonatal pulmonary hemorrhage was retrospectively analyzed. The oxygenation index (OI), pulmonary hemorrhage time, hospitalization time, ventilation time, oxygen therapy time, complications, and outcome of the two groups were compared. Compared with the rescue use group, the preferred use group had significantly lower IO values at 1, 6, 12, 24, 48, and 72 hours after treatment (Phemorrhage, and digestive tract hemorrhage between the two groups (P>0.05). Compared with those in the rescue use group, children who survived in the preferred use group had significantly shorter pulmonary hemorrhage time, hospitalization time, ventilation time, and oxygen therapy time (P<0.05). Compared with the rescue use of HFOV, preferred use of HFOV can better improve oxygenation function, reduce the incidence of VAP, shorten the course of disease, and increase cure rate while not increasing the incidence of adverse effects.

  6. The impact of the perception of rhythmic music on self-paced oscillatory movements. (United States)

    Peckel, Mathieu; Pozzo, Thierry; Bigand, Emmanuel


    Inspired by theories of perception-action coupling and embodied music cognition, we investigated how rhythmic music perception impacts self-paced oscillatory movements. In a pilot study, we examined the kinematic parameters of self-paced oscillatory movements, walking and finger tapping using optical motion capture. In accordance with biomechanical constraints accounts of motion, we found that movements followed a hierarchical organization depending on the proximal/distal characteristic of the limb used. Based on these findings, we were interested in knowing how and when the perception of rhythmic music could resonate with the motor system in the context of these constrained oscillatory movements. In order to test this, we conducted an experiment where participants performed four different effector-specific movements (lower leg, whole arm and forearm oscillation and finger tapping) while rhythmic music was playing in the background. Musical stimuli consisted of computer-generated MIDI musical pieces with a 4/4 metrical structure. The musical tempo of each song increased from 60 BPM to 120 BPM by 6 BPM increments. A specific tempo was maintained for 20 s before a 2 s transition to the higher tempo. The task of the participant was to maintain a comfortable pace for the four movements (self-paced) while not paying attention to the music. No instruction on whether to synchronize with the music was given. Results showed that participants were distinctively influenced by the background music depending on the movement used with the tapping task being consistently the most influenced. Furthermore, eight strategies put in place by participants to cope with the task were unveiled. Despite not instructed to do so, participants also occasionally synchronized with music. Results are discussed in terms of the link between perception and action (i.e., motor/perceptual resonance). In general, our results give support to the notion that rhythmic music is processed in a motoric

  7. Dissociable influences of auditory object vs. spatial attention on visual system oscillatory activity.

    Directory of Open Access Journals (Sweden)

    Jyrki Ahveninen

    Full Text Available Given that both auditory and visual systems have anatomically separate object identification ("what" and spatial ("where" pathways, it is of interest whether attention-driven cross-sensory modulations occur separately within these feature domains. Here, we investigated how auditory "what" vs. "where" attention tasks modulate activity in visual pathways using cortically constrained source estimates of magnetoencephalograpic (MEG oscillatory activity. In the absence of visual stimuli or tasks, subjects were presented with a sequence of auditory-stimulus pairs and instructed to selectively attend to phonetic ("what" vs. spatial ("where" aspects of these sounds, or to listen passively. To investigate sustained modulatory effects, oscillatory power was estimated from time periods between sound-pair presentations. In comparison to attention to sound locations, phonetic auditory attention was associated with stronger alpha (7-13 Hz power in several visual areas (primary visual cortex; lingual, fusiform, and inferior temporal gyri, lateral occipital cortex, as well as in higher-order visual/multisensory areas including lateral/medial parietal and retrosplenial cortices. Region-of-interest (ROI analyses of dynamic changes, from which the sustained effects had been removed, suggested further power increases during Attend Phoneme vs. Location centered at the alpha range 400-600 ms after the onset of second sound of each stimulus pair. These results suggest distinct modulations of visual system oscillatory activity during auditory attention to sound object identity ("what" vs. sound location ("where". The alpha modulations could be interpreted to reflect enhanced crossmodal inhibition of feature-specific visual pathways and adjacent audiovisual association areas during "what" vs. "where" auditory attention.

  8. Exact solutions for oscillatory shear sweep behaviors of complex fluids from the Oldroyd 8-constant framework (United States)

    Saengow, Chaimongkol; Giacomin, A. Jeffrey


    In this paper, we provide a new exact framework for analyzing the most commonly measured behaviors in large-amplitude oscillatory shear flow (LAOS), a popular flow for studying the nonlinear physics of complex fluids. Specifically, the strain rate sweep (also called the strain sweep) is used routinely to identify the onset of nonlinearity. By the strain rate sweep, we mean a sequence of LAOS experiments conducted at the same frequency, performed one after another, with increasing shear rate amplitude. In this paper, we give exact expressions for the nonlinear complex viscosity and the corresponding nonlinear complex normal stress coefficients, for the Oldroyd 8-constant framework for oscillatory shear sweeps. We choose the Oldroyd 8-constant framework for its rich diversity of popular special cases (we list 18 of these). We evaluate the Fourier integrals of our previous exact solution to get exact expressions for the real and imaginary parts of the complex viscosity, and for the complex normal stress coefficients, as functions of both test frequency and shear rate amplitude. We explore the role of infinite shear rate viscosity on strain rate sweep responses for the special case of the corotational Jeffreys fluid. We find that raising η∞ raises the real part of the complex viscosity and lowers the imaginary. In our worked examples, we thus first use the corotational Jeffreys fluid, and then, for greater accuracy, we use the Johnson-Segalman fluid, to describe the strain rate sweep response of molten atactic polystyrene. For our comparisons with data, we use the Spriggs relations to generalize the Oldroyd 8-constant framework to multimode. Our generalization yields unequivocally, a longest fluid relaxation time, used to assign Weissenberg and Deborah numbers to each oscillatory shear flow experiment. We then locate each experiment in the Pipkin space.

  9. Spatiotemporal oscillatory dynamics of visual selective attention during a flanker task. (United States)

    McDermott, Timothy J; Wiesman, Alex I; Proskovec, Amy L; Heinrichs-Graham, Elizabeth; Wilson, Tony W


    The flanker task is a test of visual selective attention that has been widely used to probe error monitoring, response conflict, and related constructs. However, to date, few studies have focused on the selective attention component of this task and imaged the underlying oscillatory dynamics serving task performance. In this study, 21 healthy adults successfully completed an arrow-based version of the Eriksen flanker task during magnetoencephalography (MEG). All MEG data were pre-processed and transformed into the time-frequency domain. Significant oscillatory brain responses were imaged using a beamforming approach, and voxel time series were extracted from the peak responses to identify the temporal dynamics. Across both congruent and incongruent flanker conditions, our results indicated robust decreases in alpha (9-12Hz) activity in medial and lateral occipital regions, bilateral parietal cortices, and cerebellar areas during task performance. In parallel, increases in theta (3-7Hz) oscillatory activity were detected in dorsal and ventral frontal regions, and the anterior cingulate. As per conditional effects, stronger alpha responses (i.e., greater desynchronization) were observed in parietal, occipital, and cerebellar cortices during incongruent relative to congruent trials, whereas the opposite pattern emerged for theta responses (i.e., synchronization) in the anterior cingulate, left dorsolateral prefrontal, and ventral prefrontal cortices. Interestingly, the peak latency of theta responses in these latter brain regions was significantly correlated with reaction time, and may partially explain the amplitude difference observed between congruent and incongruent trials. Lastly, whole-brain exploratory analyses implicated the frontal eye fields, right temporoparietal junction, and premotor cortices. These findings suggest that regions of both the dorsal and ventral attention networks contribute to visual selective attention processes during incongruent trials

  10. Oscillatory brain correlates of live joint attention: a dual-EEG study

    Directory of Open Access Journals (Sweden)

    Fanny eLachat


    Full Text Available Joint attention consists in following another’s gaze onto an environmental object, which leads to the alignment of both subjects' attention onto this object. It is a fundamental mechanism of non-verbal communication, and it is essential for dynamic, online, interindividual synchronization during interactions. We aimed at investigating the oscillatory brain correlates of joint attention in a face-to-face paradigm where dyads of participants dynamically oriented their attention toward objects during joint and no-joint attention periods respectively. We also manipulated task instruction: in socially-driven instructions, the participants had to follow explicitly their partner’s gaze, while in color-driven instructions, the objects to be looked at were designated at by their color so that no explicit gaze following was required. We focused on oscillatory activities in the 10 Hz frequency range, where parieto-occipital alpha and the centro-parietal mu rhythms have been described, as these rhythms have been associated with attention and social coordination processes respectively. We tested the hypothesis of a modulation of these oscillatory activities by joint attention. We used dual EEG to record simultaneously the brain activities of the participant dyads during our live, face-to-face joint attention paradigm. We showed that joint attention periods – as compared to the no-joint attention periods – were associated with a decrease of signal power between 11 and 13 Hz over a large set of left centro-parieto-occipital electrodes, encompassing the scalp regions where alpha and mu rhythms have been described. This 11-13 Hz signal power decrease was observed independently of the task instruction: it was similar when joint versus no-joint attention situations were socially-driven and when they were color-driven. These results are interpreted in terms of the processes of attention mirroring, social coordination, and mutual attentiveness associated

  11. Oscillatory neuronal dynamics associated with manual acupuncture: a magnetoencephalography study using beamforming analysis

    Directory of Open Access Journals (Sweden)

    Aziz eAsghar


    Full Text Available Magnetoencephalography (MEG enables non-invasive recording of neuronal activity, with reconstruction methods providing estimates of underlying brain source locations and oscillatory dynamics from externally recorded neuromagnetic fields. The aim of our study was to use MEG to determine the effect of manual acupuncture on neuronal oscillatory dynamics. A major problem in MEG investigations of manual acupuncture is the absence of onset times for each needle manipulation. Given that beamforming (spatial filtering analysis is not dependent upon stimulus-driven responses being phase-locked to stimulus onset, we postulated that beamforming could reveal source locations and induced changes in neuronal activity during manual acupuncture. In a beamformer analysis, a two-minute period of manual acupuncture needle manipulation delivered to the ipsilateral right LI-4 (Hegu acupoint was contrasted with a two-minute baseline period. We considered oscillatory power changes in the theta (4-8Hz, alpha (8-13Hz, beta (13-30Hz and gamma (30-100Hz frequency bands. We found significant decreases in beta band power in the contralateral primary somatosensory cortex and superior frontal gyrus. In the ipsilateral cerebral hemisphere, we found significant power decreases in beta and gamma frequency bands in only the superior frontal gyrus. No significant power modulations were found in theta and alpha bands. Our results indicate that beamforming is a useful analytical tool to reconstruct underlying neuronal activity associated with manual acupuncture. Our main finding was of beta power decreases in primary somatosensory cortex and superior frontal gyrus, which opens up a line of future investigation regarding whether this contributes towards an underlying mechanism of acupuncture.

  12. The impact of the perception of rhythmic music on oscillatory self-paced movements

    Directory of Open Access Journals (Sweden)

    Mathieu ePeckel


    Full Text Available Inspired by theories of perception-action coupling and embodied music cognition, we investigated how rhythmic music perception impacts self-paced oscillatory movements. In a pilot study, we examined the kinematic parameters of self-paced oscillatory movements, walking and finger tapping using optical motion capture. In accordance with biomechanical constraints accounts of motion, we found that movements followed a hierarchical organization depending on the proximal/distal characteristic of the limb used. Based on these findings, we were interested in knowing how and when the perception of rhythmic music could resonate with the motor system in the context of these constrained oscillatory movements. In order to test this, we conducted an experiment where participants performed four different effector-specific movements (lower leg, whole arm and forearm oscillation and finger tapping while rhythmic music was playing in the background. Musical stimuli consisted of computer-generated MIDI musical pieces with a 4/4 metrical structure. The musical tempo of each song increased from 60 BPM to 120 BPM by 6 BPM increments. A specific tempo was maintained for 20s before a 2s transition to the higher tempo. The task of the participant was to maintain a comfortable pace for the four movements (self-paced while not paying attention to the music. No instruction on whether to synchronize with the music was given. Results showed that participants were distinctively influenced by the background music depending on the movement used with the tapping task being consistently the most influenced. Furthermore, eight strategies put in place by participants to cope with task were unveiled. Despite not instructed to do so, participants also occasionally synchronized with music. Results are discussed in terms of the link between perception and action (i.e. motor/perceptual resonance. In general, our results give support to the notion that rhythmic music is processed in a

  13. Oscillatory activity in neocortical networks during tactile discrimination near the limit of spatial acuity. (United States)

    Adhikari, Bhim M; Sathian, K; Epstein, Charles M; Lamichhane, Bidhan; Dhamala, Mukesh


    Oscillatory interactions within functionally specialized but distributed brain regions are believed to be central to perceptual and cognitive functions. Here, using human scalp electroencephalography (EEG) recordings combined with source reconstruction techniques, we study how oscillatory activity functionally organizes different neocortical regions during a tactile discrimination task near the limit of spatial acuity. While undergoing EEG recordings, blindfolded participants felt a linear three-dot array presented electromechanically, under computer control, and reported whether the central dot was offset to the left or right. The average brain response differed significantly for trials with correct and incorrect perceptual responses in the timeframe approximately between 130 and 175ms. During trials with correct responses, source-level peak activity appeared in the left primary somatosensory cortex (SI) at around 45ms, in the right lateral occipital complex (LOC) at 130ms, in the right posterior intraparietal sulcus (pIPS) at 160ms, and finally in the left dorsolateral prefrontal cortex (dlPFC) at 175ms. Spectral interdependency analysis of activity in these nodes showed two distinct distributed networks, a dominantly feedforward network in the beta band (12-30Hz) that included all four nodes and a recurrent network in the gamma band (30-100Hz) that linked SI, pIPS and dlPFC. Measures of network activity in both bands were correlated with the accuracy of task performance. These findings suggest that beta and gamma band oscillatory networks coordinate activity between neocortical regions mediating sensory and cognitive processing to arrive at tactile perceptual decisions. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Heat and mass transfer of a fuel droplet evaporating in oscillatory flow

    International Nuclear Information System (INIS)

    Jangi, M.; Kobayashi, H.


    A numerical study of the heat and mass transfer from an evaporating fuel droplet in oscillatory flow was performed. The flow was assumed to be laminar and axisymmetric, and the droplet was assumed to maintain its spherical shape during its lifetime. Based on these assumptions, the conservation equations in a general curvilinear coordinate were solved numerically. The behaviors of droplet evaporation in the oscillatory flow were investigated by analyzing the effects of flow oscillation on the evaporation process of a n-heptane fuel droplet at high pressure. The response of the time history of the square of droplet diameter and space-averaged Nusselt numbers to the main flow oscillation were investigated in frequency band of 1-75 Hz with various oscillation amplitudes. Results showed that, depending on the frequency and amplitude of the oscillation, there are different modes of response of the evaporation process to the flow oscillation. One response mode is synchronous with the main flow oscillation, and thus the quasi-steady condition is attained. Another mode is asynchronous with the flow oscillation and is highly unsteady. As for the evaporation rate, however, in all conditions is more greatly enhanced in oscillatory flow than in quiescent air. To quantify the conditions of the transition from quasi-steady to unsteady, the response of the boundary layer around the droplet surface to the flow oscillation was investigated. The results led to including the oscillation Strouhal number as a criteria for the transition. The numerical results showed that at a low Strouhal number, a quasi-steady boundary layer is formed in response to the flow oscillation, whereas by increasing the oscillation Strouhal number, the phenomena become unsteady.

  15. Effects of biaxial oscillatory shear stress on endothelial cell proliferation and morphology. (United States)

    Chakraborty, Amlan; Chakraborty, Sutirtha; Jala, Venkatakrishna R; Haribabu, Bodduluri; Sharp, M Keith; Berson, R Eric


    Wall shear stress (WSS) on anchored cells affects their responses, including cell proliferation and morphology. In this study, the effects of the directionality of pulsatile WSS on endothelial cell proliferation and morphology were investigated for cells grown in a Petri dish orbiting on a shaker platform. Time and location dependent WSS was determined by computational fluid dynamics (CFD). At low orbital speed (50 rpm), WSS was shown to be uniform (0-1 dyne/cm(2)) across the bottom of the dish, while at higher orbital speed (100 and 150 rpm), WSS remained fairly uniform near the center and fluctuated significantly (0-9 dyne/cm(2)) near the side walls of the dish. Since WSS on the bottom of the dish is two-dimensional, a new directional oscillatory shear index (DOSI) was developed to quantify the directionality of oscillating shear. DOSI approached zero for biaxial oscillatory shear of equal magnitudes near the center and approached one for uniaxial pulsatile shear near the wall, where large tangential WSS dominated a much smaller radial component. Near the center (low DOSI), more, smaller and less elongated cells grew, whereas larger cells with greater elongation were observed in the more uniaxial oscillatory shear (high DOSI) near the periphery of the dish. Further, cells aligned with the direction of the largest component of shear but were randomly oriented in low magnitude biaxial shear. Statistical analyses of the individual and interacting effects of multiple factors (DOSI, shear magnitudes and orbital speeds) showed that DOSI significantly affected all the responses, indicating that directionality is an important determinant of cellular responses. Copyright © 2011 Wiley Periodicals, Inc.

  16. Oscillatory behaviour of isomers of hydroxybenzoic acid with and without catalyst

    Energy Technology Data Exchange (ETDEWEB)

    Nath, Masood A.; Rastogi, R.P.; Peerzada, G.M. [University of Kashmir, Srinagar (India). Dept. of Chemistry]. E-mail:


    The present work establishes and compares the oscillatory behaviour of mono-, di- and trihydroxybenzoic acids as organic substrates in acidic bromate (1.0 mol L{sup -1} H{sub 2}SO{sub 4}) without catalyst and in the presence of Mn{sup 2+} ion as the main catalyst. The oscillations are also affected by other catalyst such as Fe{sup 2+} ion. Further, the oscillations start diminishing in mixed catalyst systems. The experimental parameters were obtained potentiometrically and the results have been interpreted on the basis of FKN mechanism. (author)

  17. Diffusion-induced periodic transition between oscillatory modes in amplitude-modulated patterns

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Xiaodong; He, Yuxiu; Wang, Shaorong; Gao, Qingyu, E-mail: [College of Chemical Engineering, China University of Mining and Technology, Xuzhou 221008 (China); Epstein, Irving R., E-mail: [Department of Chemistry and Volen Center for Complex Systems, MS 015, Brandeis University, Waltham, Massachusetts 02454-9110 (United States); Wang, Qun [School of Physics and Electronic Engineering, Jiangsu Normal University, Xuzhou 221116 (China)


    We study amplitude-modulated waves, e.g., wave packets in one dimension, overtarget spirals and superspirals in two dimensions, under mixed-mode oscillatory conditions in a three-variable reaction-diffusion model. New transition zones, not seen in the homogeneous system, are found, in which periodic transitions occur between local 1{sup N−1} and 1{sup N} oscillations. Amplitude-modulated complex patterns result from periodic transition between (N − 1)-armed and N-armed waves. Spatial recurrence rates provide a useful guide to the stability of these modulated patterns.

  18. Sensitivity analysis of the noise-induced oscillatory multistability in Higgins model of glycolysis (United States)

    Ryashko, Lev


    A phenomenon of the noise-induced oscillatory multistability in glycolysis is studied. As a basic deterministic skeleton, we consider the two-dimensional Higgins model. The noise-induced generation of mixed-mode stochastic oscillations is studied in various parametric zones. Probabilistic mechanisms of the stochastic excitability of equilibria and noise-induced splitting of randomly forced cycles are analysed by the stochastic sensitivity function technique. A parametric zone of supersensitive Canard-type cycles is localized and studied in detail. It is shown that the generation of mixed-mode stochastic oscillations is accompanied by the noise-induced transitions from order to chaos.

  19. Simultaneous heat and mass transfer on oscillatory free convection boundary layer flow

    International Nuclear Information System (INIS)

    Hossain, M.A.


    The problem of simultaneous heat and mass transfer in two-dimensional free convection from a semi-infinite vertical flat plate is investigated. An integral method is used to find a solution for zero wall velocity and for a mass transfer velocity at the wall with small-amplitude oscillatory wall temperature. Low and high-frequency solutions are developed separately and are discussed graphically with the effects of the parameters Gr (the Grashof number for heat transfer), Gc (the Grashof number for mass transfer) and Sc (the Schmidt number) for Pr=0.71 representing aid at 20 deg. C. (author)

  20. Open-end tube dynamic flow model with an oscillatory extortion

    Directory of Open Access Journals (Sweden)

    Tulwin Tytus


    Full Text Available This paper presents a derivation of dynamic 2d mathematical model for open end tube with oscillatory extortion in the region of the closed end. The aim the research is to investigate possible uses of the increased pressure in the enclosed tube chamber, especially for energy efficient lift generation. The mathematical model allows to test and predict how flow modifications impact the resultant lifting force. A derivation of the proposed mathematical model is shown. The mathematical model is then compared to the computational fluid dynamics discrete model. The results prove the accuracy of the mathematical physical model.

  1. Simple and complex chimera states in a nonlinearly coupled oscillatory medium (United States)

    Bolotov, Maxim; Smirnov, Lev; Osipov, Grigory; Pikovsky, Arkady


    We consider chimera states in a one-dimensional medium of nonlinear nonlocally coupled phase oscillators. In terms of a local coarse-grained complex order parameter, the problem of finding stationary rotating nonhomogeneous solutions reduces to a third-order ordinary differential equation. This allows finding chimera-type and other inhomogeneous states as periodic orbits of this equation. Stability calculations reveal that only some of these states are stable. We demonstrate that an oscillatory instability leads to a breathing chimera, for which the synchronous domain splits into subdomains with different mean frequencies. Further development of instability leads to turbulent chimeras.

  2. Coexistence of synchrony and incoherence in oscillatory media under nonlinear global coupling

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Lennart; García-Morales, Vladimir [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany); Institute for Advanced Study, Technische Universität München, Lichtenbergstr. 2a, D-85748 Garching (Germany); Schönleber, Konrad; Krischer, Katharina, E-mail: [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany)


    We report a novel mechanism for the formation of chimera states, a peculiar spatiotemporal pattern with coexisting synchronized and incoherent domains found in ensembles of identical oscillators. Considering Stuart-Landau oscillators, we demonstrate that a nonlinear global coupling can induce this symmetry breaking. We find chimera states also in a spatially extended system, a modified complex Ginzburg-Landau equation. This theoretical prediction is validated with an oscillatory electrochemical system, the electro-oxidation of silicon, where the spontaneous formation of chimeras is observed without any external feedback control.

  3. Incremental Adaptive Fuzzy Control for Sensorless Stroke Control of A Halbach-type Linear Oscillatory Motor (United States)

    Lei, Meizhen; Wang, Liqiang


    The halbach-type linear oscillatory motor (HT-LOM) is multi-variable, highly coupled, nonlinear and uncertain, and difficult to get a satisfied result by conventional PID control. An incremental adaptive fuzzy controller (IAFC) for stroke tracking was presented, which combined the merits of PID control, the fuzzy inference mechanism and the adaptive algorithm. The integral-operation is added to the conventional fuzzy control algorithm. The fuzzy scale factor can be online tuned according to the load force and stroke command. The simulation results indicate that the proposed control scheme can achieve satisfied stroke tracking performance and is robust with respect to parameter variations and external disturbance.

  4. Dopaminergic modulation of the spectral characteristics in the rat brain oscillatory activity

    International Nuclear Information System (INIS)

    Valencia, Miguel; López-Azcárate, Jon; Nicolás, María Jesús; Alegre, Manuel; Artieda, Julio


    Highlights: ► The oscillatory activity recorded at different locations of the rat brain present a power law characteristic (PLC). ► Dopaminergic drugs are able to modify the power law spectral characteristic of the oscillatory activity. ► Drugs with opposite effects over the dopaminergic system (agonists/antagonists), induce opposite changes in the PLC. ► There is a fulcrum point for the modulation of the PLC around 20 Hz. ► The brain operates in a state of self-organized criticality (SOC) sensitive to dopaminergic modulation. - Abstract: Oscillatory activity can be widely recorded in the brain. It has been demonstrated to play an important role not only in the physiology of movement, perception and cognition, but also in the pathophysiology of a variety of diseases. In frequency domain, neurophysiological recordings show a power spectrum (PSD) following a log (PSD) ∝ log (f) −β , that reveals an intrinsic feature of many complex systems in nature: the presence of a scale-free dynamics characterized by a power-law component (PLC). Here we analyzed the influence of dopaminergic drugs over the PLC of the oscillatory activity recorded from different locations of the rat brain. Dopamine (DA) is a neurotransmitter that is required for a number of physiological functions like normal feeding, locomotion, posturing, grooming and reaction time. Alterations in the dopaminergic system cause vast effects in the dynamics of the brain activity, that may be crucial in the pathophysiology of neurological (like Parkinson’s disease) or psychiatric (like schizophrenia) diseases. Our results show that drugs with opposite effects over the dopaminergic system, induce opposite changes in the characteristics of the PLC: DA agonists/antagonists cause the PLC to swing around a fulcrum point in the range of 20 Hz. Changes in the harmonic component of the spectrum were also detected. However, differences between recordings are better explained by the modulation of the PLC

  5. Oscillatory Stability and Eigenvalue Sensitivity Analysis of A DFIG Wind Turbine System

    DEFF Research Database (Denmark)

    Yang, Lihui; Xu, Zhao; Østergaard, Jacob


    This paper focuses on modeling and oscillatory stability analysis of a wind turbine with doubly fed induction generator (DFIG). A detailed mathematical model of DFIG wind turbine with vector-control loops is developed, based on which the loci of the system Jacobian's eigenvalues have been analyzed......, showing that, without appropriate controller tuning a Hopf bifurcation can occur in such a system due to various factors, such as wind speed. Subsequently, eigenvalue sensitivity with respect to machine and control parameters is performed to assess their impacts on system stability. Moreover, the Hopf...


    Directory of Open Access Journals (Sweden)

    V. A. Tomilo


    Full Text Available Various schemes of ultrasonic oscillatory system are developed: with a «force nonsensitive» support, with a «force sensitive» support, with the deforming steel balls in bulk. Results of the ultrasonic treatment showed that hardening of a surface of the samples took place when the vibration amplitude of a radiator exceeds a certain level. The level of hardening increases with increase in amplitude of fluctuations of a radiator. Higher level of hardening is registered when the surface is treated by steel balls.

  7. DC-driven plasma gun: self-oscillatory operation mode of atmospheric-pressure helium plasma jet comprised of repetitive streamer breakdowns (United States)

    Wang, Xingxing; Shashurin, Alexey


    This paper presents and studies helium atmospheric pressure plasma jet comprised of a series of repetitive streamer breakdowns, which is driven by pure DC high voltage (self-oscillatory behavior). The repetition frequency of the breakdowns is governed by the geometry of discharge electrodes/surroundings and gas flow rate. Each next streamer is initiated when the electric field on the anode tip recovers after the previous breakdown and reaches the breakdown threshold value of about 2.5 kV cm-1. One type of the helium plasma gun designed using this operational principle is demonstrated. The gun operates on about 3 kV DC high voltage and is comprised of the series of the repetitive streamer breakdowns at a frequency of about 13 kHz.

  8. Recovery of oscillatory magneto-resistance in phase separated La0.3Pr0.4Ca0.3MnO3 epitaxial thin films

    International Nuclear Information System (INIS)

    Alagoz, H. S.; Jeon, J.; Mahmud, S. T.; Saber, M. M.; Chow, K. H.; Jung, J.; Prasad, B.; Egilmez, M.


    In-plane angular dependent magneto-resistance has been studied in La 0.3 Pr 0.4 Ca 0.3 MnO 3 (LPCMO) manganite thin films deposited on the (100) oriented NdGaO 3 , and (001) oriented SrTiO 3 and LaAlO 3 substrates. At temperatures where the electronic phase separation is the strongest, a metastable irreversible state exists in the films whose resistivity ρ attains a large time dependent value. The ρ decreases sharply with an increasing angle θ between the magnetic field and the current, and does not display an expected oscillatory cos 2 θ/sin 2 θ dependence for all films. The regular oscillations are recovered during repetitive sweeping of θ between 0° and 180°. We discuss possible factors that could produce these unusual changes in the resistivity

  9. Theoretical analysis of oscillatory terms in lattice heat-current time correlation functions and their contributions to thermal conductivity (United States)

    Pereverzev, Andrey; Sewell, Tommy


    Lattice heat-current time correlation functions for insulators and semiconductors obtained using molecular dynamics (MD) simulations exhibit features of both pure exponential decay and oscillatory-exponential decay. For some materials the oscillatory terms contribute significantly to the lattice heat conductivity calculated from the correlation functions. However, the origin of the oscillatory terms is not well understood, and their contribution to the heat conductivity is accounted for by fitting them to empirical functions. Here, a translationally invariant expression for the heat current in terms of creation and annihilation operators is derived. By using this full phonon-picture definition of the heat current and applying the relaxation-time approximation we explain, at least in part, the origin of the oscillatory terms in the lattice heat-current correlation function. We discuss the relationship between the crystal Hamiltonian and the magnitude of the oscillatory terms. A solvable one-dimensional model is used to illustrate the potential importance of terms that are omitted in the commonly used phonon-picture expression for the heat current. While the derivations are fully quantum mechanical, classical-limit expressions are provided that enable direct contact with classical quantities obtainable from MD.

  10. The Value of Value

    DEFF Research Database (Denmark)

    Sørensen, Asger

    parts of business ethics given prominence to especially one term, namely `value'. The question that interests me is the following: What does the articulation of ethics and morality in terms of values mean for ethics and morality as such. Or, to put the question in a more fashionably way: What......As a social scientist of ethics and morality, Luhmann has noticed the ethical wave that has recently swept across the western world, and states that this particular kind of wave seems to have a wavelength of about one hundred years (cf. Luhmann 1989: 9 ff.). Even though the frequency...... and the regularity of such a phenomenon is both hard to verify and, if true, difficult to explain, it seems fair to say that since the Enlightenment, an approaching fin-de-siecle has brought an increased interest in matters concerning morality and ethics.1 The present peak has in public-political discourse and some...

  11. Normal force of magnetorheological fluids with foam metal under oscillatory shear modes

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Xingyan, E-mail: [Research Center of System Health Maintenance, Chongqing Technology and Business University, Chongqing 400067 (China); Chongqing Engineering Laboratory for Detection Control and Integrated System, Chongqing 400067 (China); Liu, Chuanwen; Liang, Huang; Qin, Huafeng [Chongqing Engineering Laboratory for Detection Control and Integrated System, Chongqing 400067 (China); Yu, Qibing; Li, Chuan [Research Center of System Health Maintenance, Chongqing Technology and Business University, Chongqing 400067 (China); Chongqing Engineering Laboratory for Detection Control and Integrated System, Chongqing 400067 (China)


    The normal force of magnetorheological (MR) fluids in porous foam metal was investigated in this paper. The dynamic repulsive normal force was studied using an advanced commercial rheometer under oscillatory shear modes. In the presence of magnetic fields, the influences of time, strain amplitude, frequency and shear rate on the normal force of MR fluids drawn from the porous foam metal were systematically analysed. The experimental results indicated that the magnetic field had the greatest effect on the normal force, and the effect increased incrementally with the magnetic field. Increasing the magnetic field produced a step-wise increase in the shear gap. However, other factors in the presence of a constant magnetic field only had weak effects on the normal force. This behaviour can be regarded as a magnetic field-enhanced normal force, as increases in the magnetic field resulted in more MR fluids being released from the porous foam metal, and the chain-like magnetic particles in the MR fluids becoming more elongated with aggregates spanning the gap between the shear plates. - Highlights: • Normal force of MR fluids with metal foam under oscillatory shear modes was studied. • The shear gap was step-wise increased with magnetic fields. • The magnetic field has a greater impact on the normal force.

  12. Normal force of magnetorheological fluids with foam metal under oscillatory shear modes

    International Nuclear Information System (INIS)

    Yao, Xingyan; Liu, Chuanwen; Liang, Huang; Qin, Huafeng; Yu, Qibing; Li, Chuan


    The normal force of magnetorheological (MR) fluids in porous foam metal was investigated in this paper. The dynamic repulsive normal force was studied using an advanced commercial rheometer under oscillatory shear modes. In the presence of magnetic fields, the influences of time, strain amplitude, frequency and shear rate on the normal force of MR fluids drawn from the porous foam metal were systematically analysed. The experimental results indicated that the magnetic field had the greatest effect on the normal force, and the effect increased incrementally with the magnetic field. Increasing the magnetic field produced a step-wise increase in the shear gap. However, other factors in the presence of a constant magnetic field only had weak effects on the normal force. This behaviour can be regarded as a magnetic field-enhanced normal force, as increases in the magnetic field resulted in more MR fluids being released from the porous foam metal, and the chain-like magnetic particles in the MR fluids becoming more elongated with aggregates spanning the gap between the shear plates. - Highlights: • Normal force of MR fluids with metal foam under oscillatory shear modes was studied. • The shear gap was step-wise increased with magnetic fields. • The magnetic field has a greater impact on the normal force.

  13. Oscillatory brain activity in spontaneous and induced sleep stages in flies. (United States)

    Yap, Melvyn H W; Grabowska, Martyna J; Rohrscheib, Chelsie; Jeans, Rhiannon; Troup, Michael; Paulk, Angelique C; van Alphen, Bart; Shaw, Paul J; van Swinderen, Bruno


    Sleep is a dynamic process comprising multiple stages, each associated with distinct electrophysiological properties and potentially serving different functions. While these phenomena are well described in vertebrates, it is unclear if invertebrates have distinct sleep stages. We perform local field potential (LFP) recordings on flies spontaneously sleeping, and compare their brain activity to flies induced to sleep using either genetic activation of sleep-promoting circuitry or the GABA A agonist Gaboxadol. We find a transitional sleep stage associated with a 7-10 Hz oscillation in the central brain during spontaneous sleep. Oscillatory activity is also evident when we acutely activate sleep-promoting neurons in the dorsal fan-shaped body (dFB) of Drosophila. In contrast, sleep following Gaboxadol exposure is characterized by low-amplitude LFPs, during which dFB-induced effects are suppressed. Sleep in flies thus appears to involve at least two distinct stages: increased oscillatory activity, particularly during sleep induction, followed by desynchronized or decreased brain activity.


    Directory of Open Access Journals (Sweden)



    Full Text Available The concept of a continuous process in producing biodiesel from jatropha oil by using an Oscillatory Flow Biodiesel Reactor (OFBR is discussed in this paper. It has been recognized that the batch stirred reactor is a primary mode used in the synthesis of biodiesel. However, pulsatile flow has been extensively researcehed and the fundamental principles have been successfully developed upon which its hydrodynamics are based. Oscillatory flow biodiesel reactor offers precise control of mixing by means of the baffle geometry and pulsation which facilitates to continuous operation, giving plug flow residence time distribution with high turbulence and enhanced mass and heat transfer. In conjunction with the concept of reactor design, parameters such as reactor dimensions, the hydrodynamic studies and physical properties of reactants must be considered prior to the design work initiated recently. The OFBR reactor design involves the use of simulation software, ASPEN PLUS and the reactor design fundamentals. Following this, the design parameters shall be applied in fabricating the OFBR for laboratory scale biodiesel production.

  15. EEG neural oscillatory dynamics reveal semantic and response conflict at difference levels of conflict awareness. (United States)

    Jiang, Jun; Zhang, Qinglin; Van Gaal, Simon


    Although previous work has shown that conflict can be detected in the absence of awareness, it is unknown how different sources of conflict (i.e., semantic, response) are processed in the human brain and whether these processes are differently modulated by conflict awareness. To explore this issue, we extracted oscillatory power dynamics from electroencephalographic (EEG) data recorded while human participants performed a modified version of the Stroop task. Crucially, in this task conflict awareness was manipulated by masking a conflict-inducing color word preceding a color patch target. We isolated semantic from response conflict by introducing four color words/patches, of which two were matched to the same response. We observed that both semantic as well as response conflict were associated with mid-frontal theta-band and parietal alpha-band power modulations, irrespective of the level of conflict awareness (high vs. low), although awareness of conflict increased these conflict-related power dynamics. These results show that both semantic and response conflict can be processed in the human brain and suggest that the neural oscillatory mechanisms in EEG reflect mainly "domain general" conflict processing mechanisms, instead of conflict source specific effects.

  16. EEG neural oscillatory dynamics reveal semantic and response conflict at difference levels of conflict awareness (United States)

    Jiang, Jun; Zhang, Qinglin; Van Gaal, Simon


    Although previous work has shown that conflict can be detected in the absence of awareness, it is unknown how different sources of conflict (i.e., semantic, response) are processed in the human brain and whether these processes are differently modulated by conflict awareness. To explore this issue, we extracted oscillatory power dynamics from electroencephalographic (EEG) data recorded while human participants performed a modified version of the Stroop task. Crucially, in this task conflict awareness was manipulated by masking a conflict-inducing color word preceding a color patch target. We isolated semantic from response conflict by introducing four color words/patches, of which two were matched to the same response. We observed that both semantic as well as response conflict were associated with mid-frontal theta-band and parietal alpha-band power modulations, irrespective of the level of conflict awareness (high vs. low), although awareness of conflict increased these conflict-related power dynamics. These results show that both semantic and response conflict can be processed in the human brain and suggest that the neural oscillatory mechanisms in EEG reflect mainly “domain general” conflict processing mechanisms, instead of conflict source specific effects. PMID:26169473

  17. EEG Mu (µ) rhythm spectra and oscillatory activity differentiate stuttering from non-stuttering adults. (United States)

    Saltuklaroglu, Tim; Harkrider, Ashley W; Thornton, David; Jenson, David; Kittilstved, Tiffani


    Stuttering is linked to sensorimotor deficits related to internal modeling mechanisms. This study compared spectral power and oscillatory activity of EEG mu (μ) rhythms between persons who stutter (PWS) and controls in listening and auditory discrimination tasks. EEG data were analyzed from passive listening in noise and accurate (same/different) discrimination of tones or syllables in quiet and noisy backgrounds. Independent component analysis identified left and/or right μ rhythms with characteristic alpha (α) and beta (β) peaks localized to premotor/motor regions in 23 of 27 people who stutter (PWS) and 24 of 27 controls. PWS produced μ spectra with reduced β amplitudes across conditions, suggesting reduced forward modeling capacity. Group time-frequency differences were associated with noisy conditions only. PWS showed increased μ-β desynchronization when listening to noise and early in discrimination events, suggesting evidence of heightened motor activity that might be related to forward modeling deficits. PWS also showed reduced μ-α synchronization in discrimination conditions, indicating reduced sensory gating. Together these findings indicate spectral and oscillatory analyses of μ rhythms are sensitive to stuttering. More specifically, they can reveal stuttering-related sensorimotor processing differences in listening and auditory discrimination that also may be influenced by basal ganglia deficits. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Nanofluid bioconvection in water-based suspensions containing nanoparticles and oxytactic microorganisms: oscillatory instability

    Directory of Open Access Journals (Sweden)

    Kuznetsov Andrey


    Full Text Available Abstract The aim of this article is to propose a novel type of a nanofluid that contains both nanoparticles and motile (oxytactic microorganisms. The benefits of adding motile microorganisms to the suspension include enhanced mass transfer, microscale mixing, and anticipated improved stability of the nanofluid. In order to understand the behavior of such a suspension at the fundamental level, this article investigates its stability when it occupies a shallow horizontal layer. The oscillatory mode of nanofluid bioconvection may be induced by the interaction of three competing agencies: oxytactic microorganisms, heating or cooling from the bottom, and top or bottom-heavy nanoparticle distribution. The model includes equations expressing conservation of total mass, momentum, thermal energy, nanoparticles, microorganisms, and oxygen. Physical mechanisms responsible for the slip velocity between the nanoparticles and the base fluid, such as Brownian motion and thermophoresis, are accounted for in the model. An approximate analytical solution of the eigenvalue problem is obtained using the Galerkin method. The obtained solution provides important physical insights into the behavior of this system; it also explains when the oscillatory mode of instability is possible in such system.

  19. The application of large amplitude oscillatory stress in a study of fully formed fibrin clots (United States)

    Lamer, T. F.; Thomas, B. R.; Curtis, D. J.; Badiei, N.; Williams, P. R.; Hawkins, K.


    The suitability of controlled stress large amplitude oscillatory shear (LAOStress) for the characterisation of the nonlinear viscoelastic properties of fully formed fibrin clots is investigated. Capturing the rich nonlinear viscoelastic behaviour of the fibrin network is important for understanding the structural behaviour of clots formed in blood vessels which are exposed to a wide range of shear stresses. We report, for the first time, that artefacts due to ringing exist in both the sample stress and strain waveforms of a LAOStress measurement which will lead to errors in the calculation of nonlinear viscoelastic properties. The process of smoothing the waveforms eliminates these artefacts whilst retaining essential rheological information. Furthermore, we demonstrate the potential of LAOStress for characterising the nonlinear viscoelastic properties of fibrin clots in response to incremental increases of applied stress up to the point of fracture. Alternating LAOStress and small amplitude oscillatory shear measurements provide detailed information of reversible and irreversible structural changes of the fibrin clot as a consequence of elevated levels of stress. We relate these findings to previous studies involving large scale deformations of fibrin clots. The LAOStress technique may provide useful information to help understand why some blood clots formed in vessels are stable (such as in deep vein thrombosis) and others break off (leading to a life threatening pulmonary embolism).

  20. Self-Sustained Oscillatory Sliding Movement of Doublet Microtubules and Flagellar Bend Formation.

    Directory of Open Access Journals (Sweden)

    Sumio Ishijima

    Full Text Available It is well established that the basis for flagellar and ciliary movements is ATP-dependent sliding between adjacent doublet microtubules. However, the mechanism for converting microtubule sliding into flagellar and ciliary movements has long remained unresolved. The author has developed new sperm models that use bull spermatozoa divested of their plasma membrane and midpiece mitochondrial sheath by Triton X-100 and dithiothreitol. These models enable the observation of both the oscillatory sliding movement of activated doublet microtubules and flagellar bend formation in the presence of ATP. A long fiber of doublet microtubules extruded by synchronous sliding of the sperm flagella and a short fiber of doublet microtubules extruded by metachronal sliding exhibited spontaneous oscillatory movements and constructed a one beat cycle of flagellar bending by alternately actuating. The small sliding displacement generated by metachronal sliding formed helical bends, whereas the large displacement by synchronous sliding formed planar bends. Therefore, the resultant waveform is a half-funnel shape, which is similar to ciliary movements.

  1. Oscillatory flow at the end of parallel-plate stacks: phenomenological and similarity analysis

    International Nuclear Information System (INIS)

    Mao Xiaoan; Jaworski, Artur J


    This paper addresses the physics of the oscillatory flow in the vicinity of a series of parallel plates forming geometrically identical channels. This type of flow is particularly relevant to thermoacoustic engines and refrigerators, where a reciprocating flow is responsible for the desirable energy transfer, but it is also of interest to general fluid mechanics of oscillatory flows past bluff bodies. In this paper, the physics of an acoustically induced flow past a series of plates in an isothermal condition is studied in detail using the data provided by PIV imaging. Particular attention is given to the analysis of the wake flow during the ejection part of the flow cycle, where either closed recirculating vortices or alternating vortex shedding can be observed. This is followed by a similarity analysis of the governing Navier-Stokes equations in order to derive the similarity criteria governing the wake flow behaviour. To this end, similarity numbers including two types of Reynolds number, the Keulegan-Carpenter number and a non-dimensional stack configuration parameter, d/h, are considered and their influence on the phenomena are discussed.

  2. Variational method enabling simplified solutions to the linearized Boltzmann equation for oscillatory gas flows (United States)

    Ladiges, Daniel R.; Sader, John E.


    Nanomechanical resonators and sensors, operated in ambient conditions, often generate low-Mach-number oscillating rarefied gas flows. Cercignani [C. Cercignani, J. Stat. Phys. 1, 297 (1969), 10.1007/BF01007482] proposed a variational principle for the linearized Boltzmann equation, which can be used to derive approximate analytical solutions of steady (time-independent) flows. Here we extend and generalize this principle to unsteady oscillatory rarefied flows and thus accommodate resonating nanomechanical devices. This includes a mathematical approach that facilitates its general use and allows for systematic improvements in accuracy. This formulation is demonstrated for two canonical flow problems: oscillatory Couette flow and Stokes' second problem. Approximate analytical formulas giving the bulk velocity and shear stress, valid for arbitrary oscillation frequency, are obtained for Couette flow. For Stokes' second problem, a simple system of ordinary differential equations is derived which may be solved to obtain the desired flow fields. Using this framework, a simple and accurate formula is provided for the shear stress at the oscillating boundary, again for arbitrary frequency, which may prove useful in application. These solutions are easily implemented on any symbolic or numerical package, such as Mathematica or matlab, facilitating the characterization of flows produced by nanomechanical devices and providing insight into the underlying flow physics.

  3. Oscillatory-rotational processes in the Earth motion about the center of mass: Interpolation and forecast (United States)

    Akulenko, L. D.; Klimov, D. M.; Markov, Yu. G.; Perepelkin, V. V.


    The celestial-mechanics approach (the spatial version of the problem for the Earth-Moon system in the field of gravity of the Sun) is used to construct a mathematical model of the Earth's rotational-oscillatory motions. The fundamental aspects of the processes of tidal inhomogeneity in the Earth rotation and the Earth's pole oscillations are studied. It is shown that the presence of the perturbing component of gravitational-tidal forces, which is orthogonal to the Moon's orbit plane, also allows one to distinguish short-period perturbations in the Moon's motion. The obtained model of rotational-oscillatory motions of the nonrigid Earth takes into account both the basic perturbations of large amplitudes and the more complicated small-scale properties of the motion due to the Moon short-period perturbations with combination frequencies. The astrometric data of the International Earth Rotation and Reference Systems Service (IERS) are used to perform numerical simulation (interpolation and forecast) of the Earth rotation parameters (ERP) on various time intervals.

  4. Investigation on premature occurrence of critical heat flux under oscillatory flow and power conditions

    International Nuclear Information System (INIS)

    Vishnoi, A.K.; Dasgupta, A.; Chandraker, D.K.; Nayak, A.K.; Vijayan, P.K.


    Two-phase natural circulation loops have extensive applications in nuclear and process industries. One of the major concerns with natural circulation is the occurrence of the various types of flow instabilities, which can cause premature boiling crisis due to flow and power oscillations. In this work a transient computer code COPCOS (Code for Prediction of CHF under Oscillating flow and power condition) has been developed to predict the premature occurrence of CHF (critical heat flux) under oscillating flow and power. The code incorporates conduction equation of the fuel and coolant energy equation. For CHF prediction, CHF look-up table developed by Groeneveld is used. A facility named CHF and Instability Loop (CHIL) has been set up to study the effect of oscillatory flow on CHF. CHF and Instability Loop (CHIL) is a simple rectangular loop having a 10.5 mm ID and 1.2 m long test section. The flow through the test section is controlled by a canned motor pump using a Variable Frequency Drive (VFD). This leads to the ability of having a very precise control over flow oscillations which can be induced in the test section. The effect of frequency and amplitude of flow oscillation on occurrence of premature CHF has been investigated in this facility using COPCOS. Full paper covers details of COPCOS code, description of the facility and effect of frequency and the effect of oscillatory flow on CHF in the facility. (author)

  5. Valproic acid disrupts the oscillatory expression of core circadian rhythm transcription factors. (United States)

    Griggs, Chanel A; Malm, Scott W; Jaime-Frias, Rosa; Smith, Catharine L


    Valproic acid (VPA) is a well-established therapeutic used in treatment of seizure and mood disorders as well as migraines and a known hepatotoxicant. About 50% of VPA users experience metabolic disruptions, including weight gain, hyperlipidemia, and hyperinsulinemia, among others. Several of these metabolic abnormalities are similar to the effects of circadian rhythm disruption. In the current study, we examine the effect of VPA exposure on the expression of core circadian transcription factors that drive the circadian clock via a transcription-translation feedback loop. In cells with an unsynchronized clock, VPA simultaneously upregulated the expression of genes encoding core circadian transcription factors that regulate the positive and negative limbs of the feedback loop. Using low dose glucocorticoid, we synchronized cultured fibroblast cells to a circadian oscillatory pattern. Whether VPA was added at the time of synchronization or 12h later at CT12, we found that VPA disrupted the oscillatory expression of multiple genes encoding essential transcription factors that regulate circadian rhythm. Therefore, we conclude that VPA has a potent effect on the circadian rhythm transcription-translation feedback loop that may be linked to negative VPA side effects in humans. Furthermore, our study suggests potential chronopharmacology implications of VPA usage. Copyright © 2017. Published by Elsevier Inc.

  6. Oscillatory signatures of crossmodal congruence effects: An EEG investigation employing a visuotactile pattern matching paradigm. (United States)

    Göschl, Florian; Friese, Uwe; Daume, Jonathan; König, Peter; Engel, Andreas K


    Coherent percepts emerge from the accurate combination of inputs from the different sensory systems. There is an ongoing debate about the neurophysiological mechanisms of crossmodal interactions in the brain, and it has been proposed that transient synchronization of neurons might be of central importance. Oscillatory activity in lower frequency ranges (congruence. Analysis of the behavioral data showed benefits for congruent visuotactile stimulus combinations. Differences in oscillatory dynamics related to crossmodal congruence within the two tasks were observed in the beta-band for crossmodal target detection, as well as in the theta-band for congruence evaluation. Contrasting ongoing activity preceding visuotactile stimulation between the two tasks revealed differences in the alpha- and beta-bands. Source reconstruction of between-task differences showed prominent involvement of premotor cortex, supplementary motor area, somatosensory association cortex and the supramarginal gyrus. These areas not only exhibited more involvement in the pre-stimulus interval for target detection compared to congruence evaluation, but were also crucially involved in post-stimulus differences related to crossmodal stimulus congruence within the detection task. These results add to the increasing evidence that low frequency oscillations are functionally relevant for integration in distributed brain networks, as demonstrated for crossmodal interactions in visuotactile pattern matching in the current study. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Continuum study on the oscillatory characteristics of carbon nanocones inside single-walled carbon nanotubes

    International Nuclear Information System (INIS)

    Ansari, R.; Sadeghi, F.; Darvizeh, M.


    This article aims to present a comprehensive study on the oscillatory behavior of concentric carbon nanocones (CNCs) inside carbon nanotubes (CNTs) using a continuum approach. To this end, the optimum radius of nanotube for which the nanocone lies on the tube axis is determined based on the distribution of suction energy. Using the Runge–Kutta numerical integration scheme, the equation of motion is solved numerically to attain the time history of displacement and velocity of nanocone. It is observed that the oscillation of nanocone occurs with respect to its axial equilibrium distance which moves further away from the middle axis of nanotube as the number of pentagons increases. A novel semi-analytical expression as a function of geometrical parameters, initial conditions and cone vertex direction is also proposed for the precise evaluation of oscillation frequency. With respect to the proposed frequency expression, a detailed parametric study is conducted to get an insight into the effects of number of pentagons, cone vertex direction and initial conditions on the oscillatory behavior of CNC–CNT oscillators. It is found that nanocones with more pentagons generate greater maximum frequencies inside nanotubes. Furthermore, it is shown that higher maximum frequencies can be achieved if the nanocone enters the nanotube from base.

  8. Oscillatory brain dynamics during sentence reading: A Fixation-related spectral perturbation analysis.

    Directory of Open Access Journals (Sweden)

    Lorenzo eVignali


    Full Text Available The present study investigated oscillatory brain dynamics during self-paced sentence-level processing. Participants read fully correct sentences, sentences containing a semantic violation and sentences in which the order of the words was randomized. At the target word level, fixations on semantically unrelated words elicited a lower-beta band (13-18 Hz desynchronization. At the sentence level, gamma power (31-55 Hz increased linearly for syntactically correct sentences, but not when the order of the words was randomized. In the 300 to 900 ms time window after sentence onsets, theta power (4-7 Hz was greater for syntactically correct sentences as compared to sentences where no syntactic structure was preserved (random words condition. We interpret our results as conforming with a recently formulated predictive-coding framework for oscillatory neural dynamics during sentence-level language comprehension. Additionally, we discuss how our results relate to previous findings with serial visual presentation versus self-paced reading.

  9. Oscillatory motion in layered materials: graphene, boron nitride, and molybdenum disulfide

    International Nuclear Information System (INIS)

    Ye, Zhijiang; Martini, Ashlie; Otero-de-la-Roza, Alberto; Johnson, Erin R


    Offset-driven self-retraction and oscillatory motion of bilayer graphene has been observed experimentally and is potentially relevant for nanoscale technological applications. In a previous article, we showed that friction between laterally offset graphene layers is controlled by roughness and proposed a simple reduced-order model based on density-functional theory (DFT) and molecular dynamics (MD) data, with which predictions on the experimental size-scale could be made. In this article, we extend our study to other layered materials, with emphasis on boron nitride (BN) and molybdenum disulfide (MoS 2 ). Using MD and DFT simulations of these systems and a generalized version of the reduced-order model, we predict that BN will exhibit behavior similar to graphene (heavily-damped oscillation with a decay rate that increases with roughness) and that MoS 2 shows no oscillatory behavior even in the absence of roughness. This is attributed to the higher energy barrier for sliding in MoS 2 as well as the surface structure. Our generalized reduced-order model provides a guide to predicting and tuning experimental oscillation behavior using a few parameters that can be derived from simulation data. (paper)

  10. Padé approximant for normal stress differences in large-amplitude oscillatory shear flow (United States)

    Poungthong, P.; Saengow, C.; Giacomin, A. J.; Kolitawong, C.; Merger, D.; Wilhelm, M.


    Analytical solutions for the normal stress differences in large-amplitude oscillatory shear flow (LAOS), for continuum or molecular models, normally take the inexact form of the first few terms of a series expansion in the shear rate amplitude. Here, we improve the accuracy of these truncated expansions by replacing them with rational functions called Padé approximants. The recent advent of exact solutions in LAOS presents an opportunity to identify accurate and useful Padé approximants. For this identification, we replace the truncated expansion for the corotational Jeffreys fluid with its Padé approximants for the normal stress differences. We uncover the most accurate and useful approximant, the [3,4] approximant, and then test its accuracy against the exact solution [C. Saengow and A. J. Giacomin, "Normal stress differences from Oldroyd 8-constant framework: Exact analytical solution for large-amplitude oscillatory shear flow," Phys. Fluids 29, 121601 (2017)]. We use Ewoldt grids to show the stunning accuracy of our [3,4] approximant in LAOS. We quantify this accuracy with an objective function and then map it onto the Pipkin space. Our two applications illustrate how to use our new approximant reliably. For this, we use the Spriggs relations to generalize our best approximant to multimode, and then, we compare with measurements on molten high-density polyethylene and on dissolved polyisobutylene in isobutylene oligomer.

  11. Effect of Temperature on Oscillatory Behaviour of the System Containing Isomers of Hydroxybenzoic Acid in Batch Reactor

    Directory of Open Access Journals (Sweden)

    Masood A. Nath


    Full Text Available In the present paper a thorough study of temperature dependence on oscillatory behaviour of the Belousov-Zhabotinsky (BZ system containing the isomers of hydroxybenzoic acids + BrO3-+ Mn(II in aqueous acid medium (1.0 M H2SO4 at a fixed concentration of reacting species has been reported. On varying temperature, the oscillatory parameters like induction time, time period and number of oscillations show marked changes. These changes arise due to the position and number of hydroxyl groups in these isomers which affect the oscillations. Experimental observations have satisfactorily been explained by FKN mechanism and kinetic parameters. The oscillatory characteristics depend on the temperature dependence of the rate constant of the reaction controlling the inhibitory reaction steps (negative feedback

  12. Nonlinear oscillatory rheology and structure of wormlike micellar solutions and colloidal suspensions (United States)

    Gurnon, Amanda Kate

    The complex, nonlinear flow behavior of soft materials transcends industrial applications, smart material design and non-equilibrium thermodynamics. A long-standing, fundamental challenge in soft-matter science is establishing a quantitative connection between the deformation field, local microstructure and macroscopic dynamic flow properties i.e., the rheology. Soft materials are widely used in consumer products and industrial processes including energy recovery, surfactants for personal healthcare (e.g. soap and shampoo), coatings, plastics, drug delivery, medical devices and therapeutics. Oftentimes, these materials are processed by, used during, or exposed to non-equilibrium conditions for which the transient response of the complex fluid is critical. As such, designing new dynamic experiments is imperative to testing these materials and further developing micromechanical models to predict their transient response. Two of the most common classes of these soft materials stand as the focus of the present research; they are: solutions of polymer-like micelles (PLM or also known as wormlike micelles, WLM) and concentrated colloidal suspensions. In addition to their varied applications these two different classes of soft materials are also governed by different physics. In contrast, to the shear thinning behavior of the WLMs at high shear rates, the near hard-sphere colloidal suspensions are known to display increases, sometimes quite substantial, in viscosity (known as shear thickening). The stress response of these complex fluids derive from the shear-induced microstructure, thus measurements of the microstructure under flow are critical for understanding the mechanisms underlying the complex, nonlinear rheology of these complex fluids. A popular micromechanical model is reframed from its original derivation for predicting steady shear rheology of polymers and WLMs to be applicable to weakly nonlinear oscillatory shear flow. The validity, utility and limits of

  13. Design and analysis of linear oscillatory single-phase permanent magnet generator for free-piston stirling engine systems (United States)

    Kim, Jeong-Man; Choi, Jang-Young; Lee, Kyu-Seok; Lee, Sung-Ho


    This study focuses on the design and analysis of a linear oscillatory single-phase permanent magnet generator for free-piston stirling engine (FPSE) systems. In order to implement the design of linear oscillatory generator (LOG) for suitable FPSEs, we conducted electromagnetic analysis of LOGs with varying design parameters. Then, detent force analysis was conducted using assisted PM. Using the assisted PM gave us the advantage of using mechanical strength by detent force. To improve the efficiency, we conducted characteristic analysis of eddy-current loss with respect to the PM segment. Finally, the experimental result was analyzed to confirm the prediction of the FEA.

  14. Design and analysis of linear oscillatory single-phase permanent magnet generator for free-piston stirling engine systems

    Directory of Open Access Journals (Sweden)

    Jeong-Man Kim


    Full Text Available This study focuses on the design and analysis of a linear oscillatory single-phase permanent magnet generator for free-piston stirling engine (FPSE systems. In order to implement the design of linear oscillatory generator (LOG for suitable FPSEs, we conducted electromagnetic analysis of LOGs with varying design parameters. Then, detent force analysis was conducted using assisted PM. Using the assisted PM gave us the advantage of using mechanical strength by detent force. To improve the efficiency, we conducted characteristic analysis of eddy-current loss with respect to the PM segment. Finally, the experimental result was analyzed to confirm the prediction of the FEA.

  15. Numerical Predictions of Early Stage Turbulence in Oscillatory Flow across Parallel-Plate Heat Exchangers of a Thermoacoustic System

    Directory of Open Access Journals (Sweden)

    Fatimah A. Z. Mohd Saat


    Full Text Available This work focuses on the predictions of turbulent transition in oscillatory flow subjected to temperature gradients, which often occurs within heat exchangers of thermoacoustic devices. A two-dimensional computational fluid dynamics (CFD model was developed in ANSYS FLUENT and validated using the earlier experimental data. Four drive ratios (defined as maximum pressure amplitude to mean pressure were investigated: 0.30%, 0.45%, 0.65% and 0.83%. It has been found that the introduction of the turbulence model at a drive ratio as low as 0.45% improves the predictions of flow structure compared to experiments, which indicates that turbulent transition may occur at much smaller flow amplitudes than previously thought. In the current investigation, the critical Reynolds number based on the thickness of Stokes’ layer falls in the range between 70 and 100. The models tested included four variants of the RANS (Reynolds-Averaged Navier–Stokes equations: k-ε, k-ω, shear-stress-transport (SST-k-ω and transition-SST, the laminar model being used as a reference. Discussions are based on velocity profiles, vorticity plots, viscous dissipation and the resulting heat transfer and their comparison with experimental results. The SST-k-ω turbulence model and, in some cases, transition-SST provide the best fit of the velocity profile between numerical and experimental data (the value of the introduced metric measuring the deviation of the CFD velocity profiles from experiment is up to 43% lower than for the laminar model and also give the best match in terms of calculated heat flux. The viscous dissipation also increases with an increase of the drive ratio. The results suggest that turbulence should be considered when designing thermoacoustic devices even in low-amplitude regimes in order to improve the performance predictions of thermoacoustic systems.

  16. Oscillatory activity in the infant brain and the representation of small numbers

    Directory of Open Access Journals (Sweden)

    Sumie eLeung


    Full Text Available Gamma-band oscillatory activity (GBA is an established neural signature of sustained occluded object representation in infants and adults. However, it is not yet known whether the magnitude of GBA in the infant brain reflects the quantity of occluded items held in memory. To examine this, we compared GBA of 6- to 8-month-old infants during occlusion periods after the representation of two objects versus that of one object. We found that maintaining a representation of two objects during occlusion resulted in significantly greater GBA relative to maintaining a single object. Further, this enhancement was located in the right occipital region, which is consistent with previous object representation research in adults and infants. We conclude that enhanced GBA reflects neural processes underlying infants’ representation of small numbers.

  17. Oscillatory Activity in the Infant Brain and the Representation of Small Numbers. (United States)

    Leung, Sumie; Mareschal, Denis; Rowsell, Renee; Simpson, David; Iaria, Leon; Grbic, Amanda; Kaufman, Jordy


    Gamma-band oscillatory activity (GBA) is an established neural signature of sustained occluded object representation in infants and adults. However, it is not yet known whether the magnitude of GBA in the infant brain reflects the quantity of occluded items held in memory. To examine this, we compared GBA of 6-8 month-old infants during occlusion periods after the representation of two objects vs. that of one object. We found that maintaining a representation of two objects during occlusion resulted in significantly greater GBA relative to maintaining a single object. Further, this enhancement was located in the right occipital region, which is consistent with previous object representation research in adults and infants. We conclude that enhanced GBA reflects neural processes underlying infants' representation of small numbers.

  18. Functional localization and effective connectivity of cortical theta and alpha oscillatory activity during an attention task

    Directory of Open Access Journals (Sweden)

    Yuichi Kitaura

    Full Text Available Objectives: The aim of this paper is to investigate cortical electric neuronal activity as an indicator of brain function, in a mental arithmetic task that requires sustained attention, as compared to the resting state condition. The two questions of interest are the cortical localization of different oscillatory activities, and the directional effective flow of oscillatory activity between regions of interest, in the task condition compared to resting state. In particular, theta and alpha activity are of interest here, due to their important role in attention processing. Methods: We adapted mental arithmetic as an attention ask in this study. Eyes closed 61-channel EEG was recorded in 14 participants during resting and in a mental arithmetic task (“serial sevens subtraction”. Functional localization and connectivity analyses were based on cortical signals of electric neuronal activity estimated with sLORETA (standardized low resolution electromagnetic tomography. Functional localization was based on the comparison of the cortical distributions of the generators of oscillatory activity between task and resting conditions. Assessment of effective connectivity was based on the iCoh (isolated effective coherence method, which provides an appropriate frequency decomposition of the directional flow of oscillatory activity between brain regions. Nine regions of interest comprising nodes from the dorsal and ventral attention networks were selected for the connectivity analysis. Results: Cortical spectral density distribution comparing task minus rest showed significant activity increase in medial prefrontal areas and decreased activity in left parietal lobe for the theta band, and decreased activity in parietal-occipital regions for the alpha1 band. At a global level, connections among right hemispheric nodes were predominantly decreased during the task condition, while connections among left hemispheric nodes were predominantly increased. At more

  19. Analysis of relationship among visual evoked potential, oscillatory potential and visual acuity under stimulated weightlessness

    Directory of Open Access Journals (Sweden)

    Jun Zhao


    Full Text Available AIM: To observe the influence of head-down tilt simulated weightlessness on visual evoked potential(VEP, oscillatory potentials(OPsand visual acuity, and analyse the relationship among them. METHODS: Head-down tilt for -6° was adopted in 14 healthy volunteers. Distant visual acuity, near visual acuity, VEP and OPs were recorded before, two days and five days after trial. The record procedure of OPs followed the ISCEV standard for full-field clinical electroretinography(2008 update. RESULTS: Significant differences were detected in the amplitude of P100 waves and ∑OPs among various time points(P<0.05. But no relationship was observed among VEP, OPs and visual acuity. CONCLUSION: Head-down tilt simulated weightlessness induce the rearrange of blood of the whole body including eyes, which can make the change of visual electrophysiology but not visual acuity.

  20. Irreducible Representations of Oscillatory and Swirling Flows in Active Soft Matter (United States)

    Ghose, Somdeb; Adhikari, R.


    Recent experiments imaging fluid flow around swimming microorganisms have revealed complex time-dependent velocity fields that differ qualitatively from the stresslet flow commonly employed in theoretical descriptions of active matter. Here we obtain the most general flow around a finite sized active particle by expanding the surface stress in irreducible Cartesian tensors. This expansion, whose first term is the stresslet, must include, respectively, third-rank polar and axial tensors to minimally capture crucial features of the active oscillatory flow around translating Chlamydomonas and the active swirling flow around rotating Volvox. The representation provides explicit expressions for the irreducible symmetric, antisymmetric, and isotropic parts of the continuum active stress. Antisymmetric active stresses do not conserve orbital angular momentum and our work thus shows that spin angular momentum is necessary to restore angular momentum conservation in continuum hydrodynamic descriptions of active soft matter.

  1. Steady, Oscillatory and Unsteady, Subsonic and Supersonic Aerodynamics (SOUSSA) for complex aircraft configurations (United States)

    Morino, L.; Tseng, K.


    The Green's function method and the computer program SOUSSA (Steady Oscillatory and Unsteady Subsonic and Supersonic Aerodynamics) are reviewed. The Green's function method is applied to the fully unsteady potential equation yielding an integro-differential-delay equation. This equation is approximated by a set of differential-delay equations in time using the finite element method. The Laplace transform is used to yield a matrix relating the velocity potential to the normal wash. The matrix of the generalized aerodynamic forces is obtained by premultiplying and postmultiplying the matrices relating generalized forces to the potential and the normal wash by the generalized coordinates. The program SOUSSA is compared with existing numerical results. Results indicate that the program is not only general, flexible, and easy to use, but also accurate and fast.

  2. Oscillatory decoupling differentiates auditory encoding deficits in children with listening problems. (United States)

    Gilley, Phillip M; Sharma, Mridula; Purdy, Suzanne C


    We sought to examine whether oscillatory EEG responses to a speech stimulus in both quiet and noise were different in children with listening problems than in children with normal hearing. We employed a high-resolution spectral-temporal analysis of the cortical auditory evoked potential in response to a 150 ms speech sound /da/ in quiet and 3 dB SNR in 21 typically developing children (mean age=10.7 years, standard deviation=1.7) and 44 children with reported listening problems (LP) with absence of hearing loss (mean age=10.3 years, standard deviation=1.6). Children with LP were assessed for auditory processing disorder (APD) by which 24 children had APD, and 20 children did not. Peak latencies, magnitudes, and frequencies were compared between these groups. Children with LP had frequency shifts in the theta, and alpha bands (plistening problems in this population of children. Published by Elsevier Ireland Ltd.

  3. Methods for parameter identification in oscillatory networks and application to cortical and thalamic 600 Hz activity. (United States)

    Leistritz, L; Suesse, T; Haueisen, J; Hilgenfeld, B; Witte, H


    Directed information transfer in the human brain occurs presumably by oscillations. As of yet, most approaches for the analysis of these oscillations are based on time-frequency or coherence analysis. The present work concerns the modeling of cortical 600 Hz oscillations, localized within the Brodmann Areas 3b and 1 after stimulation of the nervus medianus, by means of coupled differential equations. This approach leads to the so-called parameter identification problem, where based on a given data set, a set of unknown parameters of a system of ordinary differential equations is determined by special optimization procedures. Some suitable algorithms for this task are presented in this paper. Finally an oscillatory network model is optimally fitted to the data taken from ten volunteers.

  4. Oscillatory pulses and wave trains in a bistable reaction-diffusion system with cross diffusion. (United States)

    Zemskov, Evgeny P; Tsyganov, Mikhail A; Horsthemke, Werner


    We study waves with exponentially decaying oscillatory tails in a reaction-diffusion system with linear cross diffusion. To be specific, we consider a piecewise linear approximation of the FitzHugh-Nagumo model, also known as the Bonhoeffer-van der Pol model. We focus on two types of traveling waves, namely solitary pulses that correspond to a homoclinic solution, and sequences of pulses or wave trains, i.e., a periodic solution. The effect of cross diffusion on wave profiles and speed of propagation is analyzed. We find the intriguing result that both pulses and wave trains occur in the bistable cross-diffusive FitzHugh-Nagumo system, whereas only fronts exist in the standard bistable system without cross diffusion.

  5. Flap Gap Oscillatory Blowing on 2D and 2.5D Wing

    Directory of Open Access Journals (Sweden)

    Cătălin NAE


    Full Text Available Here we present preliminary results obtained in developing an active flow control system for highlift systems at advanced TRL level. The work is based on theoretical and experimental workperformed in AVERT EU FP6 project where the oscillatory flap gap blowing system was designedand tested on a INCAS F15 2D wing model. Pressure data and global loads have been recorded fora complex evaluation of the basic flow control mechanism. In 2.5D test cases this work has beenextended so that the proposed system may be selected as a mature technology in the JTI Clean Sky,Smart Fixed Wing Aircraft ITD. For this goal, new experimental setup was used and also updatedelectronics for the blowing system have been introduces. This was complemented by a newextension for the data acquisition system and visualization tools. Finally global correlations forbasic lift increments have been compared with the reference 2D case and analysed with respect tothe system efficiency.

  6. Parametric Sensitivity Analysis of Oscillatory Delay Systems with an Application to Gene Regulation. (United States)

    Ingalls, Brian; Mincheva, Maya; Roussel, Marc R


    A parametric sensitivity analysis for periodic solutions of delay-differential equations is developed. Because phase shifts cause the sensitivity coefficients of a periodic orbit to diverge, we focus on sensitivities of the extrema, from which amplitude sensitivities are computed, and of the period. Delay-differential equations are often used to model gene expression networks. In these models, the parametric sensitivities of a particular genotype define the local geometry of the evolutionary landscape. Thus, sensitivities can be used to investigate directions of gradual evolutionary change. An oscillatory protein synthesis model whose properties are modulated by RNA interference is used as an example. This model consists of a set of coupled delay-differential equations involving three delays. Sensitivity analyses are carried out at several operating points. Comments on the evolutionary implications of the results are offered.

  7. Flat super-oscillatory lens for heat-assisted magnetic recording with sub-50 nm resolution. (United States)

    Yuan, Guanghui; Rogers, Edward T F; Roy, Tapashree; Shen, Zexiang; Zheludev, Nikolay I


    Heat-assisted magnetic recording (HAMR) is a future roadmap technology to overcome the superparamagnetic limit in high density magnetic recording. Existing HAMR schemes depend on a simultaneous magnetic stimulation and light-induced local heating of the information carrier. To achieve high-density recorded data, near-field plasmonic transducers have been proposed as light concentrators. Here we suggest and investigate in detail an alternative approach exploiting a far-field focusing device that can focus light into sub-50 nm hot-spots in the magnetic recording layer using a laser source operating at 473 nm. It is based on a recently introduced super-oscillatory flat lens improved with the use of solid immersion, giving an effective numerical aperture as high as 4.17. The proposed solution is robust and easy to integrate with the magnetic recording head thus offering a competitive advantage over plasmonic technology.

  8. Metabolic response of Danaüs archippus and Saccharomyces cerevisiae to weak oscillatory magnetic fields (United States)

    Russell, D. N.; Webb, S. J.


    Respiration of the insect larva, Danaüs archippus, and the yeast, Saccharomyces cerevisiae, in log phase has been monitored before and after an oscillatory magnetic insult of 0.005 Gauss rms amplitude and 40 50 min duration. Frequencies used were 10 16 Hz for the insect and 100 200 Hz for the yeast. Depression of as much as 30% in metabolic rate has been found to occur immediately after the field is both imposed and eliminated with a general recovery over the 30-min period thereafter both in and out of the imposed field, although complete recovery to original levels may take much longer. Evidence is given that the response may depend on the frequency pattern used. This data is used to formulate an hypothesis whereby changes in the geomagnetic field variability pattern may act as a biochronometric zeitgeber.

  9. Understanding oscillatory phenomena in molecular hydrogen generation via sodium borohydride hydrolysis. (United States)

    Budroni, M A; Biosa, E; Garroni, S; Mulas, G R C; Marchettini, N; Culeddu, N; Rustici, M


    The hydrolysis of borohydride salts represents one of the most promising processes for the generation of high purity molecular hydrogen under mild conditions. In this work we show that the sodium borohydride hydrolysis exhibits a fingerprinting periodic oscillatory transient in the hydrogen flow over a wide range of experimental conditions. We disproved the possibility that flow oscillations are driven by supersaturation phenomena of gaseous bubbles in the reactive mixture or by a nonlinear thermal feedback according to a thermokinetic model. Our experimental results indicate that the NaBH4 hydrolysis is a spontaneous inorganic oscillator, in which the hydrogen flow oscillations are coupled to an "oscillophor" in the reactive solution. The discovery of this original oscillator paves the way for a new class of chemical oscillators, with fundamental implications not only for testing the general theory on oscillations, but also with a view to chemical control of borohydride systems used as a source of hydrogen based green fuel.

  10. An obligatory bacterial mutualism in a multi-drug environment exhibits strong oscillatory population dynamics (United States)

    Conwill, Arolyn; Yurtsev, Eugene; Gore, Jeff


    A common mechanism of antibiotic resistance in bacteria involves the production of an enzyme that inactivates the antibiotic. By inactivating the antibiotic, resistant cells can protect other cells in the population that would otherwise be sensitive to the drug. In a multidrug environment, an obligatory mutualism arises because populations of different strains rely on each other to breakdown antibiotics in the environment. Here, we experimentally track the population dynamics of two E. coli strains in the presence of two different antibiotics: ampicillin and chloramphenicol. Together the strains are able to grow in antibiotic concentrations that inhibit growth of either one of the strains alone. Although mutualisms are often thought to stabilize population dynamics, we observe strong oscillatory dynamics even when there is long-term coexistence between the two strains. We expect that our results will provide insight into the evolution of antibiotic resistance and, more generally, the evolutionary origin of phenotypic diversity, cooperation, and ecological stability.

  11. Two phase pressure drop across abrupt area changes in oscillatory flow

    International Nuclear Information System (INIS)

    Weisman, J.; Ake, T.; Knott, R.


    The ability of one-dimensional momentum balances to predict behavior during two-phase oscillatory flow has been examined. Flow oscillations in a Freon-Freon vapor system were induced by cycling a three-way valve so as to divert a varying portion of the total flow from the test section. The data taken included the phase shift between pressure and flow curves and the head fluctuation to flow fluctuation ratio. These data were compared to theoretical predictions. For void fractions below about 0.55, reasonable agreement between predictions and observations was obtained. At the highest void fractions examined, agreement between prediction and measurement was poor. However, at these high void fractions measurement errors may have been very substantial. Further, the simplifying assumptions required by the numerical calculation procedure chosen could no longer be considered valid. No real conclusion could therefore be drawn from the data at high voids

  12. Valley- and spin-polarized oscillatory magneto-optical absorption in monolayer MoS2 quantum rings (United States)

    Oliveira, D.; Villegas-Lelovsky, L.; Soler, M. A. G.; Qu, Fanyao


    Besides optical valley selectivity, strong spin-orbit interaction along with Berry curvature effects also leads to unconventional valley- and spin-polarized Landau levels in monolayer transition metal dichalcogenides (TMDCs) under a perpendicular magnetic field. We find that these unique properties are inherited to the magneto-optical absorption spectrum of the TMDC quantum rings (QRs). In addition, it is robust against variation of the magnetic flux and of the QR geometry. In stark contrast to the monolayer bulk material, the MoS2 QRs manifest themselves in both the optical valley selectivity and unprecedented size tunability of the frequency of the light absorbed. We also find that when the magnetic field setup is changed, the phase transition from Aharonov-Bohm (AB) quantum interference to aperiodic oscillation of magneto-optical absorption spectrum takes place. The exciton spectrum in a realistic finite thickness MoS2 QR is also discussed.

  13. New insights into strobe reactions: An intriguing oscillatory combustion phenomenon (Nieuwe inzichten in strobe reactions: Een intrigerend oscillerend verbrandingsfenomeen)

    NARCIS (Netherlands)

    Corbel, J.M.L.


    Strobes are self-sustained oscillatory combustions that have various applications in the fireworks industry and also in the military area (signaling, missile decoys and crowd control). However, most of the strobe compositions were discovered using trial and error methods. The fundamentals mechanisms

  14. High-frequency oscillatory ventilation is not superior to conventional mechanical ventilation in surfactant-treated rabbits with lung injury

    NARCIS (Netherlands)

    D.A.M.P.J. Gommers (Diederik); A. Hartog (Anneke); R. Schnabel; A. de Jaegere (Anne); B.F. Lachmann (Burkhard)


    textabstractThe aim of this study was to compare high-frequency oscillatory ventilation (HFOV) with conventional mechanical ventilation (CMV) with and without surfactant in the treatment of surfactant-deficient rabbits. A previously described saline lung lavage model of

  15. Delay selection by spike-timing-dependent plasticity in recurrent networks of spiking neurons receiving oscillatory inputs.

    Directory of Open Access Journals (Sweden)

    Robert R Kerr

    Full Text Available Learning rules, such as spike-timing-dependent plasticity (STDP, change the structure of networks of neurons based on the firing activity. A network level understanding of these mechanisms can help infer how the brain learns patterns and processes information. Previous studies have shown that STDP selectively potentiates feed-forward connections that have specific axonal delays, and that this underlies behavioral functions such as sound localization in the auditory brainstem of the barn owl. In this study, we investigate how STDP leads to the selective potentiation of recurrent connections with different axonal and dendritic delays during oscillatory activity. We develop analytical models of learning with additive STDP in recurrent networks driven by oscillatory inputs, and support the results using simulations with leaky integrate-and-fire neurons. Our results show selective potentiation of connections with specific axonal delays, which depended on the input frequency. In addition, we demonstrate how this can lead to a network becoming selective in the amplitude of its oscillatory response to this frequency. We extend this model of axonal delay selection within a single recurrent network in two ways. First, we show the selective potentiation of connections with a range of both axonal and dendritic delays. Second, we show axonal delay selection between multiple groups receiving out-of-phase, oscillatory inputs. We discuss the application of these models to the formation and activation of neuronal ensembles or cell assemblies in the cortex, and also to missing fundamental pitch perception in the auditory brainstem.

  16. The effect of oscillatory mechanical stimulation on osteoblast attachment and proliferation

    International Nuclear Information System (INIS)

    Aryaei, Ashkan; Jayasuriya, Ambalangodage C.


    The aim of this paper is to investigate the effect of the magnitude and duration of oscillatory mechanical stimulation on osteoblast attachment and proliferation as well as the time gap between seeding and applying the stimulation. Cells were exposed to three levels of speed at two different conditions. For the first group, mechanical shear stress was applied after 20 min of cell seeding. For the second group there was no time gap between cell seeding and applying mechanical stimulation. The total area subjected to shear stress was divided into three parts and for each part a comparative study was conducted at defined time points. Our results showed that both shear stress magnitude and the time gap between cell seeding and applying shear stress, are important in further cell proliferation and attachment. The effect of shear stress was not significant at lower speeds for both groups at earlier time points. However, a higher percentage of area was covered by cells at later time points under shear stress. In addition, the time gap can also improve osteoblast attachment. For the best rate of cell attachment and proliferation, the magnitude of shear stress and time gap should be optimized. The results of this paper can be utilized to improve cell attachment and proliferation in bioreactors. - Highlights: • The effect of oscillatory mechanical stimulation on osteoblast functions was studied. • Cells were exposed at three levels of speed to attach cells. • Shear stress magnitude and time gap are important for cell functions. • Cells start developing extracellular components at the early stage of seeding

  17. Efficient estimation of the robustness region of biological models with oscillatory behavior.

    Directory of Open Access Journals (Sweden)

    Mochamad Apri

    Full Text Available Robustness is an essential feature of biological systems, and any mathematical model that describes such a system should reflect this feature. Especially, persistence of oscillatory behavior is an important issue. A benchmark model for this phenomenon is the Laub-Loomis model, a nonlinear model for cAMP oscillations in Dictyostelium discoideum. This model captures the most important features of biomolecular networks oscillating at constant frequencies. Nevertheless, the robustness of its oscillatory behavior is not yet fully understood. Given a system that exhibits oscillating behavior for some set of parameters, the central question of robustness is how far the parameters may be changed, such that the qualitative behavior does not change. The determination of such a "robustness region" in parameter space is an intricate task. If the number of parameters is high, it may be also time consuming. In the literature, several methods are proposed that partially tackle this problem. For example, some methods only detect particular bifurcations, or only find a relatively small box-shaped estimate for an irregularly shaped robustness region. Here, we present an approach that is much more general, and is especially designed to be efficient for systems with a large number of parameters. As an illustration, we apply the method first to a well understood low-dimensional system, the Rosenzweig-MacArthur model. This is a predator-prey model featuring satiation of the predator. It has only two parameters and its bifurcation diagram is available in the literature. We find a good agreement with the existing knowledge about this model. When we apply the new method to the high dimensional Laub-Loomis model, we obtain a much larger robustness region than reported earlier in the literature. This clearly demonstrates the power of our method. From the results, we conclude that the biological system underlying is much more robust than was realized until now.

  18. Oscillatory activity in the human basal ganglia: more than just beta, more than just Parkinson's disease. (United States)

    Alegre, Manuel; Valencia, Miguel


    The implantation of deep brain stimulators in different structures of the basal ganglia to treat neurological and psychiatric diseases has allowed the recording of local field potential activity in these structures. The analysis of these signals has helped our understanding of basal ganglia physiology in health and disease. However, there remain some major challenges and questions for the future. In a recent work, Tan et al. (Tan, H., Pogosyan, A., Anam, A., Foltynie, T., Limousin, P., Zrinzo, L., et al. 2013. Frequency specific activity in subthalamic nucleus correlates with hand bradykinesia in Parkinson's disease. Exp. Neurol. 240,122-129) take profit of these recordings to study the changes in subthalamic oscillatory activity during the hold and release phases of a grasping paradigm, and correlate the changes in different frequency bands with performance parameters. They found that beta activity was related to the release phase, while force maintenance related most to theta and gamma/HFO activity. There was no significant effect of the motor state of the patient on this latter association. These findings suggest that the alterations in the oscillatory activity of the basal ganglia in Parkinson's disease are not limited to the beta band, and they involve aspects different from movement preparation and initiation. Additionally, these results highlight the usefulness of the combination of well-designed paradigms with recordings in off and on motor states (in Parkinson's disease), or in different pathologies, in order to understand not only the pathophysiology of the diseases affecting the patients, but also the normal physiology of the basal ganglia. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Resting-state oscillatory activity in children born small for gestational age: a magnetoencephalographic study

    Directory of Open Access Journals (Sweden)

    Maria eBoersma


    Full Text Available Growth restriction in utero during a period that is critical for normal growth of the brain, has previously been associated with deviations in cognitive abilities and brain anatomical and functional changes. We measured magnetoencephalography (MEG in 4-7 year old children to test if children born small for gestational age (SGA show deviations in resting-state brain oscillatory activity. Children born SGA children with postnatally spontaneous catch-up growth (SGA+; 6 boys, 7 girls; mean age 6.3 y (SD=0.9 and children born appropriate for gestational age (AGA; 7 boys, 3 girls; mean age 6.0 y (SD=1.2 participated in a resting-state MEG study. We calculated absolute and relative power spectra and used nonparametric statistics to test for group differences. SGA+ and AGA born children showed no significant differences in absolute and relative power except for reduced absolute gamma band power in SGA children. At time of MEG investigation, SGA+ children showed was significantly lower head circumference (HC and a trend toward lower IQ, however there was no association of HC or IQ with absolute or relative power. Except for reduced absolute gamma band power, our findings suggest normal brain activity patterns at school age in a group of children born SGA in which spontaneous catch-up growth of bodily length after birth occurred. Although previous findings suggest that being born SGA alters brain oscillatory activity early in neonatal life, we show that these neonatal alterations do not persist at early school age when spontaneous postnatal catch-up growth occurs after birth.

  20. Oscillatory flow in the human airways from the mouth through several bronchial generations

    International Nuclear Information System (INIS)

    Banko, Andrew J.; Coletti, Filippo; Elkins, Christopher J.; Eaton, John K.


    Highlights: • Oscillatory flow in the human airways is studied experimentally. • The realistic anatomy is obtained from the CT scan of a healthy adult. • Integral parameters are calculated to quantify streamwise and lateral dispersion. • Flow in real human anatomy is qualitatively different from idealized models. - Abstract: The time-varying flow is studied experimentally in an anatomically accurate model of the human airways from the mouth through several generations of bronchial branching. The airway geometry is obtained from the CT scan of a healthy adult male of normal height and build. The three-component, three-dimensional mean velocity field is obtained throughout the entire model using phase-locked Magnetic Resonance Velocimetry. A pulsatile pump drives a sinusoidal waveform (inhalation and exhalation) with frequency and stroke-length such that the mean trachea Reynolds number at peak inspiration is 4200 and the Womersley number is 7. Integral parameters are defined to quantify the degree of velocity profile non-uniformity (related to axial dispersion) and secondary flow strength (lateral dispersion). It is found that the extrathoracic airways significantly modify the tracheal flow and that the flow at the first bifurcation is highly asymmetric. The effect of flow oscillation is to produce time dependent flow features which are asymmetric with respect to the acceleration and deceleration periods surrounding peak inhalation and exhalation. This is most pronounced in regions of separation and on the secondary flow structure, which are sensitive to local attributes of the real anatomy. This is reflected in the integral parameters, which behave non-monotonically between successive bronchial generations. In general, the measured oscillatory flow in a realistic anatomy confirms many trends derived from idealized models but also possesses qualitatively different large scale flow structures as compared to idealized representations of the upper airways.

  1. The roles and mechanism of ultradian oscillatory expression of the mouse Hes genes. (United States)

    Harima, Yukiko; Imayoshi, Itaru; Shimojo, Hiromi; Kobayashi, Taeko; Kageyama, Ryoichiro


    Somites, metameric structures, give rise to the vertebral column, ribs, skeletal muscles and subcutaneous tissues. In mouse embryos, a pair of somites is formed every 2h by segmentation of the anterior parts of the presomitic mesoderm. This periodic event is regulated by a biological clock called the segmentation clock, which involves cyclic expression of the basic helix-loop-helix gene Hes7. Hes7 oscillation is regulated by negative feedback with a delayed timing. This process has been mathematically simulated by differential-delay equations, which predict that negative feedback with shorter delays would abolish oscillations or produce dampened but more rapid oscillations. We found that reducing the number of introns within the Hes7 gene shortens the delay and abolishes Hes7 oscillation or results in a more rapid tempo of Hes7 oscillation, increasing the number of somites and vertebrae in the cervical and upper thoracic region. We also found that Hes1, a Hes7-related gene, is expressed in an oscillatory manner by many cell types, including fibroblasts and neural stem cells. In these cells, Hes1 expression oscillates with a period of about 2-3h, and this oscillation is important for cell cycle progression. Furthermore, in neural stem cells, Hes1 oscillation drives cyclic expression of the proneural genes Ascl1 and Neurogenin2 and regulates multipotency. Hes1 expression oscillates more slowly in embryonic stem cells, and Hes1 oscillation regulates their fate preferences. Taken together, these results suggest that oscillatory expression with short periods (ultradian oscillation) is important for many biological events. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Relationship between oscillatory neuronal activity during reward processing and trait impulsivity and sensation seeking.

    Directory of Open Access Journals (Sweden)

    Gregor Leicht

    Full Text Available BACKGROUND: The processing of reward and punishment stimuli in humans appears to involve brain oscillatory activity of several frequencies, probably each with a distinct function. The exact nature of associations of these electrophysiological measures with impulsive or risk-seeking personality traits is not completely clear. Thus, the aim of the present study was to investigate event-related oscillatory activity during reward processing across a wide spectrum of frequencies, and its associations with impulsivity and sensation seeking in healthy subjects. METHODS: During recording of a 32-channel EEG 22 healthy volunteers were characterized with the Barratt Impulsiveness and the Sensation Seeking Scale and performed a computerized two-choice gambling task comprising different feedback options with positive vs. negative valence (gain or loss and high or low magnitude (5 vs. 25 points. RESULTS: We observed greater increases of amplitudes of the feedback-related negativity and of activity in the theta, alpha and low-beta frequency range following loss feedback and, in contrast, greater increase of activity in the high-beta frequency range following gain feedback. Significant magnitude effects were observed for theta and delta oscillations, indicating greater amplitudes upon feedback concerning large stakes. The theta amplitude changes during loss were negatively correlated with motor impulsivity scores, whereas alpha and low-beta increase upon loss and high-beta increase upon gain were positively correlated with various dimensions of sensation seeking. CONCLUSIONS: The findings suggest that the processing of feedback information involves several distinct processes, which are subserved by oscillations of different frequencies and are associated with different personality traits.

  3. A Modified Split Hopkinson Pressure Bar Approach for Mimicking Dynamic Oscillatory Stress Fluctuations During Earthquake Rupture (United States)

    Braunagel, M. J.; Griffith, W. A.


    Past experimental work has demonstrated that rock failure at high strain rates occurs by fragmentation rather than discrete fracture and is accompanied by a dramatic increase in rock strength. However, these observations are difficult to reconcile with the assertion that pulverized rocks in fault zones are the product of impulsive stresses during the passage of earthquake ruptures, as the distance from the principal slip zones of some pulverized rock is too great to exceed fragmentation transition. One potential explanation to this paradox that has been suggested is that repeated loading over the course of multiple earthquake ruptures may gradually reduce the pulverization threshold, in terms of both strain rate and strength. We propose that oscillatory loading during a single earthquake rupture may further lower these pulverization thresholds, and that traditional dynamic experimental approaches, such as the Split Hopkinson Pressure Bar (SHPB) wherein load is applied as a single, smooth, sinusoidal compressive wave, may not reflect natural loading conditions. To investigate the effects of oscillatory compressive loading expected during earthquake rupture propagation, we develop a controlled cyclic loading model on a SHPB apparatus utilizing two striker bars connected by an elastic spring. Unlike traditional SHPB experiments that utilize a gas gun to fire a projectile bar and generate a single compressive wave on impact with the incident bar, our modified striker bar assembly oscillates while moving down the gun barrel and generates two separate compressive pulses separated by a lag time. By modeling the modified assembly as a mass-spring-mass assembly accelerating due to the force of the released gas, we can predict the compression time of the spring upon impact and therefore the time delay between the generation of the first and second compressive waves. This allows us to predictably control load cycles with durations of only a few hundred microseconds. Initial

  4. Word class and context affect alpha-band oscillatory dynamics in an older population

    Directory of Open Access Journals (Sweden)

    Monika eMellem


    Full Text Available Differences in the oscillatory EEG dynamics of reading open class and closed class words have previously been found (Bastiaansen et al., 2005 and are thought to reflect differences in lexical-semantic content between these word classes. In particular, the theta band (4–7 Hz seems to play a prominent role in lexical-semantic retrieval. We tested whether this theta effect is robust in an older population of subjects. Additionally, we examined how the context of a word can modulate the oscillatory dynamics underlying retrieval for the two different classes of words. Older participants (mean age 55 read words presented in either syntactically-correct sentences or in a scrambled order (scrambled sentence while their EEG was recorded. We performed time-frequency analysis to examine how power varied based on the context or class of the word. We observed larger power decreases in the alpha (8–12Hz band between 200–700 ms for the open class compared to closed class words, but this was true only for the scrambled sentence context. We did not observe differences in theta power between these conditions. Context exerted an effect on the alpha and low beta (13–18 Hz bands between 0–700 ms. These results suggest that the previously observed word class effects on theta power changes in a younger participant sample do not seem to be a robust effect in this older population. Though this is an indirect comparison between studies, it may suggest the existence of aging effects on word retrieval dynamics for different populations. Additionally, the interaction between word class and context suggests that word retrieval mechanisms interact with sentence-level comprehension mechanisms in the alpha band.

  5. Brain Oscillatory Correlates of Altered Executive Functioning in Positive and Negative Symptomatic Schizophrenia Patients and Healthy Controls. (United States)

    Berger, Barbara; Minarik, Tamas; Griesmayr, Birgit; Stelzig-Schoeler, Renate; Aichhorn, Wolfgang; Sauseng, Paul


    Working Memory and executive functioning deficits are core characteristics of patients suffering from schizophrenia. Electrophysiological research indicates that altered patterns of neural oscillatory mechanisms underpinning executive functioning are associated with the psychiatric disorder. Such brain oscillatory changes have been found in local amplitude differences at gamma and theta frequencies in task-specific cortical areas. Moreover, interregional interactions are also disrupted as signified by decreased phase coherence of fronto-posterior theta activity in schizophrenia patients. However, schizophrenia is not a one-dimensional psychiatric disorder but has various forms and expressions. A common distinction is between positive and negative symptomatology but most patients have both negative and positive symptoms to some extent. Here, we examined three groups-healthy controls, predominantly negative, and predominantly positive symptomatic schizophrenia patients-when performing a working memory task with increasing cognitive demand and increasing need for executive control. We analyzed brain oscillatory activity in the three groups separately and investigated how predominant symptomatology might explain differences in brain oscillatory patterns. Our results indicate that differences in task specific fronto-posterior network activity (i.e., executive control network) expressed by interregional phase synchronization are able to account for working memory dysfunctions between groups. Local changes in the theta and gamma frequency range also show differences between patients and healthy controls, and more importantly, between the two patient groups. We conclude that differences in oscillatory brain activation patterns related to executive processing can be an indicator for positive and negative symptomatology in schizophrenia. Furthermore, changes in cognitive and especially executive functioning in patients are expressed by alterations in a task-specific fronto

  6. Public Values

    DEFF Research Database (Denmark)

    Beck Jørgensen, Torben; Rutgers, Mark R.


    administration is approached in terms of processes guided or restricted by public values and as public value creating: public management and public policy-making are both concerned with establishing, following and realizing public values. To study public values a broad perspective is needed. The article suggest......This article provides the introduction to a symposium on contemporary public values research. It is argued that the contribution to this symposium represent a Public Values Perspective, distinct from other specific lines of research that also use public value as a core concept. Public...... a research agenda for this encompasing kind of public values research. Finally the contributions to the symposium are introduced....

  7. Oscillatory dynamics in a model of vascular tumour growth - implications for chemotherapy

    Directory of Open Access Journals (Sweden)

    Maini PK


    Full Text Available Abstract Background Investigations of solid tumours suggest that vessel occlusion may occur when increased pressure from the tumour mass is exerted on the vessel walls. Since immature vessels are frequently found in tumours and may be particularly sensitive, such occlusion may impair tumour blood flow and have a negative impact on therapeutic outcome. In order to study the effects that occlusion may have on tumour growth patterns and therapeutic response, in this paper we develop and investigate a continuum model of vascular tumour growth. Results By analysing a spatially uniform submodel, we identify regions of parameter space in which the combination of tumour cell proliferation and vessel occlusion give rise to sustained temporal oscillations in the tumour cell population and in the vessel density. Alternatively, if the vessels are assumed to be less prone to collapse, stable steady state solutions are observed. When spatial effects are considered, the pattern of tumour invasion depends on the dynamics of the spatially uniform submodel. If the submodel predicts a stable steady state, then steady travelling waves are observed in the full model, and the system evolves to the same stable steady state behind the invading front. When the submodel yields oscillatory behaviour, the full model produces periodic travelling waves. The stability of the waves (which can be predicted by approximating the system as one of λ-ω type dictates whether the waves develop into regular or irregular spatio-temporal oscillations. Simulations of chemotherapy reveal that treatment outcome depends crucially on the underlying tumour growth dynamics. In particular, if the dynamics are oscillatory, then therapeutic efficacy is difficult to assess since the fluctuations in the size of the tumour cell population are enhanced, compared to untreated controls. Conclusions We have developed a mathematical model of vascular tumour growth formulated as a system of partial

  8. [Clinical effect of high-frequency oscillatory ventilation combined with pulmonary surfactant in treatment of neonatal severe meconium aspiration syndrome complicated by pulmonary hemorrhage]. (United States)

    Huang, Jing; Lin, Xin-Zhu; Zheng, Zhi


    To study the clinical effect and safety of high-frequency oscillatory ventilation (HFOV) combined with pulmonary surfactant (PS) in the treatment of neonatal severe meconium aspiration syndrome (MAS) complicated by neonatal pulmonary hemorrhage (NPH). A total of 48 children with severe MAS complicated by NPH were enrolled, and a retrospective analysis was performed for the clinical effects of HFOV+PS (trial group, 25 children) and HFOV alone (control group, 23 children). The blood gas parameters, oxygenation index (OI), PaO 2 /FiO 2 (P/F) value, duration of pulmonary hemorrhage, ventilation time, length of hospital stay, incidence of complications, and outcome were compared between the two groups. At 6, 12, 24, and 48 hours after treatment, the trial group had significantly better PaO 2 , OI, and P/F value than the control group (Phemorrhage (P0.05). HFOV combined with PS can better improve oxygenation function and shorten the duration of NPH and ventilation time. Meanwhile, it does not increase the incidence of adverse events. Therefore, it is a safe and effective therapy.

  9. Oscillatory corticospinal activity during static contraction of ankle muscles is reduced in healthy old versus young adults

    DEFF Research Database (Denmark)

    Spedden, Meaghan Elizabeth; Nielsen, Jens Bo; Geertsen, Svend Sparre


    Aging is accompanied by impaired motor function, but age-related changes in neural networks responsible for generating movement are not well understood. We aimed to investigate the functional oscillatory coupling between activity in the sensorimotor cortex and ankle muscles during static contract......Aging is accompanied by impaired motor function, but age-related changes in neural networks responsible for generating movement are not well understood. We aimed to investigate the functional oscillatory coupling between activity in the sensorimotor cortex and ankle muscles during static...... contraction. Fifteen young (20–26 yr) and fifteen older (65–73 yr) subjects were instructed to match a target force by performing static ankle dorsi- or plantar flexion, while electroencephalographic (EEG) activity was recorded from the cortex and electromyographic (EMG) activity was recorded from dorsi...

  10. Pattern deformation and annihilation in two-dimensional excitable media in oscillatory domains

    International Nuclear Information System (INIS)

    Ramos, J.I.


    The effects of oscillatory domains on the dynamics of the FitzHugh-Nagumo equation in two dimensions is investigated as a function of the amplitude and frequency of the boundary motion. It is shown that the moving-boundary problem introduces anisotropy through the diffusion terms and an advection-like term in the direction of the boundary motion. If the advection-like term is neglected, it is shown that spiral wave solutions of the FitzHugh-Nagumo equation are robust and do not lose their integrity under the anisotropic effects induced by the moving domain, albeit undergo stretching and compression in the direction of the boundary motion. However, when the advection-like terms are accounted for, the anisotropy and stretching/compression of the initial spiral wave result in a homogeneous state at high frequencies, and the time required to achieve such a uniformity is mainly a function of the amplitude of the boundary motion. For frequencies comparable to that of the spiral wave in a fixed domain, it is shown that the spiral wave preserves its integrity for low amplitudes of the boundary motion and is annihilated at high amplitudes

  11. Spatio-temporal dynamics of oscillatory heterogeneous catalysis: CO oxidation on platinum (United States)

    Yamamoto, S. Y.; Surko, C. M.; Maple, M. B.; Pina, R. K.


    Reaction-rate oscillations in the oxidation of carbon monoxide on the surface of platinum catalysts are studied in a continuous flow reactor at atmospheric pressure using infrared imaging. Small-amplitude temperature oscillations (0.2-8 K) result in approximately isothermal conditions, where changes in rate constants, for typical activation energies and temperatures, are small. The catalysts are in the form of platinum thin films on quartz substrates and provide highly repeatable oscillatory behavior. The platinum films are fabricated in the form of annular rings which provide a quasi-one-dimensional geometry in order to simplify comparison to theoretical models. Time-series measurements by means of thermocouples are used to characterize the oscillations. The infrared images show that most oscillations are spatially synchronized to within the 0.25 s time resolution of the experiment. The images also show that ``fine structure'' oscillations (i.e., small-amplitude, high frequency oscillations superimposed on larger-amplitude waveforms) are associated with spatially desynchronized patterns.

  12. Coronary oscillatory flow amplitude is more affected by perfusion pressure than ventricular pressure. (United States)

    Krams, R; Sipkema, P; Westerhof, N


    In this study on the isolated, maximally vasodilated, blood-perfused cat heart we investigated the relation between left ventricular developed pressure (delta Piv) and coronary oscillatory flow amplitude (diastolic minus systolic flow, delta F) at different levels of constant perfusion pressure (Pp). We hypothesized that the effect of cardiac contraction on the phasic flow results from the changing elastic properties of cardiac muscle. The coronary vessel compartment can, as can the left ventricular lumen compartment, be described by a time-varying elastance. This concept predicts that the effect of left ventricular pressure on delta F is small, whereas the effect of Pp is considerable. Both the waterfall model and the intramyocardial pump model predict the inverse. The relation between delta Piv and delta F at a Pp of 10 kPa is delta F = (4.71 +/- 3.08).delta Piv + 337 +/- 75 (slope in ml.min-1.100 g-1.kPa-1 and intercept in ml.min-1.100 g-1; n = 7); the relation between (constant levels of) Pp and delta F at a constant delta Piv of 10 kPa is delta F = 51.Pp + 211 (slope in ml.min-1.100 g-1.kPa-1 and intercept in ml.min-1.100 g-1; n = 6). The differences in slope are best predicted by the time-varying elastance concept.

  13. CT study of the performance of reciprocating and oscillatory motions in flattened root canal areas

    Directory of Open Access Journals (Sweden)



    Full Text Available Root canal preparation is an important step in endodontic treatment. The anatomical complexity of the middle third of the root compromises the effective cleaning of this area. Thus, advances have been made in instrumentation techniques and instruments for this purpose. The aim of this study was to evaluate the effects of three different instrumentation systems on the enlargement of the middle thirds of root canals in mandibular incisors. The preparation methods used were the reciprocating systems Reciproc (Group I and WaveOne (Group II and the oscillatory system Tilos (Group III. Comparisons were made by three-dimensional image reconstruction with cone-beam computed tomography before and after instrumentation. Changes in area, perimeter, centering ability, and pattern of preparation were analyzed. The results were subjected to ANOVA complemented by the Tukey’s test. Changes in area, perimeter, and tendency of transportation showed similar results among groups. The transportation index of the Tilos system was significantly lower than that of the other groups. Qualitative analysis of the preparation pattern showed that the Tilos system had a more uniform preparation, although Reciproc and WaveOne preparations appeared more rounded, incompatible with the original canal anatomy. There was similarity in the systems’ performance on flattened areas, although the Tilos system presented a better pattern of root canal preparation and a lower index of transportation.

  14. Dynamic adjustments of cognitive control: oscillatory correlates of the conflict adaptation effect. (United States)

    Pastötter, Bernhard; Dreisbach, Gesine; Bäuml, Karl-Heinz T


    It is a prominent idea that cognitive control mediates conflict adaptation, in that response conflict in a previous trial triggers control adjustments that reduce conflict in a current trial. In the present EEG study, we investigated the dynamics of cognitive control in a response-priming task by examining the effects of previous trial conflict on intertrial and current trial oscillatory brain activities, both on the electrode and the source level. Behavioral results showed conflict adaptation effects for RTs and response accuracy. Physiological results showed sustained intertrial effects in left parietal theta power, originating in the left inferior parietal cortex, and midcentral beta power, originating in the left and right (pre)motor cortex. Moreover, physiological analysis revealed a current trial conflict adaptation effect in midfrontal theta power, originating in the ACC. Correlational analyses showed that intertrial effects predicted conflict-induced midfrontal theta power in currently incongruent trials. In addition, conflict adaptation effects in midfrontal theta power and RTs were positively related. Together, these findings point to a dynamic cognitive control system that, as a function of previous trial type, up- and down-regulates attention and preparatory motor activities in anticipation of the next trial.

  15. Experimental investigation on premature occurrence of critical heat flux under oscillatory flow

    International Nuclear Information System (INIS)

    Vishnoi, A.K.; Dasgupta, A.; Chandraker, D.K.; Nayak, A.K.; Rama Rao, A.; Hegde, Nandan D.


    Two-phase natural circulation loops have extensive applications in nuclear and process industries. One of the major concerns with natural circulation is the occurrence of the various types of flow instabilities, which can cause premature boiling crisis due to flow and power oscillations. In this work, experimental investigation on CHF under oscillatory flow was carried out in a facility named CHF and Instability Loop (CHIL). CHIL is a simple rectangular loop having a 10.5 mm ID and 1.1 m long test section. The flow through the test section is controlled by a canned motor pump using a Variable Frequency Drive (VFD). The effect of frequency and amplitude of flow oscillation on occurrence of premature CHF has been investigated for this facility using a transient computer code COPCOS (Code for Prediction of CHF under Oscillating flow and power condition). The code incorporates conduction equation of the fuel and coolant energy equation. For CHF prediction, CHF look-up table developed by Groeneveld is used. Full paper covers description of the facility, experimental procedure, experimental results and data analysis using COPCOS. (author)

  16. Oscillatory Brain Responses Reflect Anticipation during Comprehension of Speech Acts in Spoken Dialog

    Directory of Open Access Journals (Sweden)

    Rosa S. Gisladottir


    Full Text Available Everyday conversation requires listeners to quickly recognize verbal actions, so-called speech acts, from the underspecified linguistic code and prepare a relevant response within the tight time constraints of turn-taking. The goal of this study was to determine the time-course of speech act recognition by investigating oscillatory EEG activity during comprehension of spoken dialog. Participants listened to short, spoken dialogs with target utterances that delivered three distinct speech acts (Answers, Declinations, Pre-offers. The targets were identical across conditions at lexico-syntactic and phonetic/prosodic levels but differed in the pragmatic interpretation of the speech act performed. Speech act comprehension was associated with reduced power in the alpha/beta bands just prior to Declination speech acts, relative to Answers and Pre-offers. In addition, we observed reduced power in the theta band during the beginning of Declinations, relative to Answers. Based on the role of alpha and beta desynchronization in anticipatory processes, the results are taken to indicate that anticipation plays a role in speech act recognition. Anticipation of speech acts could be critical for efficient turn-taking, allowing interactants to quickly recognize speech acts and respond within the tight time frame characteristic of conversation. The results show that anticipatory processes can be triggered by the characteristics of the interaction, including the speech act type.


    Directory of Open Access Journals (Sweden)

    Davide Vito Moretti


    Full Text Available Background: mild cognitive impairment (MCI is a clinical stage indicating a prodromal phase of dementia. This practical concept could be used also for fronto-temporal dementia (FTD. Progranulin (PGRN has been recently recognized as a useful diagnostic biomarker for fronto-temporal lobe degeneration (FTLD due to GRN null mutations. Electroencephalography (EEG is a reliable tool in detecting brain networks changes. The working hypothesis of the present study is that EEG oscillations could detect different modifications among FTLD stages (FTD-MCI versus overt FTD as well as differences between GRN mutation carriers versus non carriers in patients with overt FTD. Methods: EEG in all patients and PGRN dosage in patients with a clear FTD were detected. The cognitive state has been investigated through mini mental state examination (MMSE. Results: MCI-FTD showed a significant lower spectral power in both alpha and theta oscillations as compared to overt FTD. GRN mutations carriers affected by FTLD show an increase in high alpha and decrease in theta oscillations as compared to non-carriers.Conclusion: EEG frequency rhythms are sensible to different stage of FTD and could detect changes in brain oscillatory activity affected by GRN mutations

  18. CT study of the performance of reciprocating and oscillatory motions in flattened root canal areas

    International Nuclear Information System (INIS)

    Moura-Netto, Cacio; Palo, Renato Miotto; Pinto, Larissa Fernanda; Daltoe, Gisele; Mello-Moura, Anna Carolina Volpi


    Abstract: Root canal preparation is an important step in endodontic treatment. The anatomical complexity of the middle third of the root compromises the effective cleaning of this area. Thus, advances have been made in instrumentation techniques and instruments for this purpose. The aim of this study was to evaluate the effects of three different instrumentation systems on the enlargement of the middle thirds of root canals in mandibular incisors. The preparation methods used were the reciprocating systems Reciproc (Group I) and WaveOne (Group II) and the oscillatory system Tilos (Group III). Comparisons were made by three-dimensional image reconstruction with cone-beam computed tomography before and after instrumentation. Changes in area, perimeter, centering ability, and pattern of preparation were analyzed. The results were subjected to ANOVA complemented by the Tukey’s test. Changes in area, perimeter, and tendency of transportation showed similar results among groups. The transportation index of the Tilos system was significantly lower than that of the other groups. Qualitative analysis of the preparation pattern showed that the Tilos system had a more uniform preparation, although Reciproc and WaveOne preparations appeared more rounded, incompatible with the original canal anatomy. There was similarity in the systems’ performance on flattened areas, although the Tilos system presented a better pattern of root canal preparation and a lower index of transportation. (author)

  19. Large Amplitude Oscillatory Shear (LAOS) of Acrylic Emulsion-Based Pressure Sensitive Adhesives (PSAs) (United States)

    Zhang, Sipei; Nakatani, Alan; Griffith, William

    Large Amplitude Oscillatory Shear (LAOS) testing has recently taken on renewed interest in the rheological community. It is a very useful tool to probe the viscoelastic response of materials in the non-linear regime. Much of the discussion on polymers in the LAOS field has focused on melts in or near the terminal flow regime. Here we present a LAOS study conducted on a commercial rheometer for acrylic emulsion-based pressure sensitive adhesive (PSA) films in the plateau regime. The films behaved qualitatively similar over an oscillation frequency range of 0.5-5 rad/s. From Fourier transform analysis, the fifth or even the seventh order harmonic could be observed at large applied strains. From stress decomposition analysis or Lissajous curves, inter-cycle elastic softening, or type I behavior, was observed for all films as the strain increases, while intra-cycle strain hardening occurred at strains in the LAOS regime. Overall, as acid content increases, it was found that the trend in elasticity under large applied strains agreed very well with the trend in cohesive strength of the films.

  20. Oscillatory brain dynamics associated with the automatic processing of emotion in words. (United States)

    Wang, Lin; Bastiaansen, Marcel


    This study examines the automaticity of processing the emotional aspects of words, and characterizes the oscillatory brain dynamics that accompany this automatic processing. Participants read emotionally negative, neutral and positive nouns while performing a color detection task in which only perceptual-level analysis was required. Event-related potentials and time frequency representations were computed from the concurrently measured EEG. Negative words elicited a larger P2 and a larger late positivity than positive and neutral words, indicating deeper semantic/evaluative processing of negative words. In addition, sustained alpha power suppressions were found for the emotional compared to neutral words, in the time range from 500 to 1000ms post-stimulus. These results suggest that sustained attention was allocated to the emotional words, whereas the attention allocated to the neutral words was released after an initial analysis. This seems to hold even when the emotional content of the words is task-irrelevant. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Local correlations for flap gap oscillatory blowing active flow control technology

    Directory of Open Access Journals (Sweden)

    Cătălin NAE


    Full Text Available Active technology for oscillatory blowing in the flap gap has been tested at INCAS subsonic wind tunnel in order to evaluate this technology for usage in high lift systems with active flow control. The main goal for this investigation was to validate TRL level 4 for this technology and to extend towards flight testing. CFD analysis was performed in order to identify local correlations with experimental data and to better formulate a design criteria so that a maximum increase in lift is possible under given geometrical constraints. Reference to a proposed metric for noise evaluation is also given. This includes basic 2D flow cases and also 2.5D configurations. In 2.5D test cases this work has been extended so that the proposed system may be selected as a mature technology in the JTI Clean Sky, Smart Fixed Wing Aircraft ITD. Complex post-processing of the experimental and CFD data was mainly oriented towards system efficiency and TRL evaluation for this active technology.

  2. Oscillatory slip flow past a spherical inclusion embedded in a Brinkman medium (United States)

    Palaniappan, D.


    Non-steady flow past an impermeable sphere embedded in a porous medium is investigated based on Brinkman model with Navier slip conditions. Exact analytic solution for the stream-function - involving modified Bessel function of the second kind - describing the slow oscillatory flow around a rigid spherical inclusion is obtained in the limit of low-Reynolds-number. The key parameters such as the frequency of oscillation λ, the permeability constant δ, and the slip coefficient ξ control the flow fields and physical quantities in the entire flow domain. Local streamlines for fixed times demonstrate the variations in flow patterns. Closed form expressions for the tangential velocity profile, wall shear stress, and the force acting on the sphere are computed and compared with the existing results. It is noted that the slip parameter in the range 0 <= ξ <= 0 . 5 has a significant effect in reducing the stress and force. The steady-state velocity overshoot behavior in the vicinity of the sphere is re-iterated. In the limit of large permeability, Darcy (potential) flow is recovered outside a boundary layer. The results are of some interest in predicting maximum wall stress and pressure drop associated with biological models in fibrous media.

  3. On fully multidimensional and high order non oscillatory finite volume methods, I

    International Nuclear Information System (INIS)

    Lafon, F.


    A fully multidimensional flux formulation for solving nonlinear conservation laws of hyperbolic type is introduced to perform calculations on unstructured grids made of triangular or quadrangular cells. Fluxes are computed across dual median cells with a multidimensional 2D Riemann Solver (R2D Solver) whose intermediate states depend on either a three (on triangle R2DT solver) of four (on quadrangle, R2DQ solver) state solutions prescribed on the three or four sides of a gravity cell. Approximate Riemann solutions are computed via a linearization process of Roe's type involving multidimensional effects. Moreover, a monotonous scheme using stencil and central Lax-Friedrichs corrections on sonic curves are built in. Finally, high order accurate ENO-like (Essentially Non Oscillatory) reconstructions using plane and higher degree polynomial limitations are defined in the set up of finite element Lagrange spaces P k and Q k for k≥0, on triangles and quadrangles, respectively. Numerical experiments involving both linear and nonlinear conservation laws to be solved on unstructured grids indicate the ability of our techniques when dealing with strong multidimensional effects. An application to Euler's equations for the Mach three step problem illustrates the robustness and usefulness of our techniques using triangular and quadrangular grids. (Author). 33 refs., 13 figs

  4. Oscillatory brain activity related to control mechanisms during laboratory-induced reactive aggression

    Directory of Open Access Journals (Sweden)

    Ulrike M Krämer


    Full Text Available Aggressive behavior is a common reaction in humans after an interpersonal provocation, but little is known about the underlying brain mechanisms. The present study analyzed oscillatory brain activity while participants were involved in an aggressive interaction to examine the neural processes subserving the associated decision and evaluation processes. Participants were selected from a larger sample because of their high scores in trait aggressiveness. We used a competitive reaction time task that induces aggressive behavior through provocation. Each trial is separated in a decision phase, during which the punishment for the opponent is set, and an outcome phase, during which the actual punishment is applied or received. We observed provocation-related differences during the decision phase in the theta band which differed depending on participants’ aggressive behavior: High provocation was associated with an increased frontal theta response in participants refraining from retaliation, but with reduced theta power in those who got back to the opponent. Moreover, more aggressive decisions after being punished were associated with a decrease of frontal theta power. Non-aggressive and aggressive participants differed also in their outcome-related response: Being punished led to an increased frontal theta power compared to win trials in the latter only, pointing to differences in evaluation processes associated with their different behavioral reactions. The data thus support previous evidence for a role of prefrontal areas in the control of reactive aggression and extend behavioral studies on associations between aggression or violence and impaired prefrontal functions.

  5. Aerodynamic damping in oscillatory pitching motion of canard-body combinations in unsteady supersonic regime

    International Nuclear Information System (INIS)

    Mateescu, D.


    A method of solution is developed in the present paper for studying the unsteady supersonic flow past a cruciform canard - conical body system, represented in the figure, which executes an oscillatory pitching motion of rotation. The generality of the analysis permits particular solutions such as the case of symmetrical cruciform canards (for l 1 =l 2 =l) used mainly in missile applications, and tail-body configurations (for l 2 =0 pr l 2 →∞ used in aeronautical applications, as well as more general solutions. Attached supersonic flow past the system, associated with small amplitude oscillations of reasonably low frequency with respect to a mean equilibrium position are assumed in this paper. As a result, the steady flow past the canard-body system at an attitude defined by the mean equilibrium position can be separated from the actual flow; general methods of solution for this steady flow have been established. The aim of the present analysis is to develop a method of solution for the unsteady motion resulting from the actual flow after the above separation, which incorporates the effects of the system oscillations. (author)

  6. The relationship between conflict awareness and behavioral and oscillatory signatures of immediate and delayed cognitive control. (United States)

    Jiang, Jun; Correa, Camile M; Geerts, Jesse; van Gaal, Simon


    Cognitive control over conflict, mediated by the prefrontal cortex, is an important skill for successful decision-making. Although it has been shown that cognitive control may operate unconsciously, it has recently been proposed that control operations may be driven by the metacognitive awareness of conflict, e.g. arising from the feeling of task difficulty or the ease of action selection, and therefore crucially depends on conflict awareness. Behavioral and electroencephalography (EEG) data are presented from 64 subjects performing a masked priming paradigm to test this hypothesis. Although the subjective experience of conflict elicited behavioral adaptation, this was also the case when conflict was present, but not experienced. In EEG, typical oscillatory markers of conflict processing in the theta-, alpha- and beta-band were observed (relative broadband), but these were differentially modulated by conflict experience. This demonstrates that conflict adaptation does not depend on conflict experience, but that conflict experience is associated with increased cognitive control. Copyright © 2018. Published by Elsevier Inc.

  7. Analysis of Wind Tunnel Oscillatory Data of the X-31A Aircraft (United States)

    Smith, Mark S.


    Wind tunnel oscillatory tests in pitch, roll, and yaw were performed on a 19%-scale model of the X-31A aircraft. These tests were used to study the aerodynamic characteristics of the X-31A in response to harmonic oscillations at six frequencies. In-phase and out-of-phase components of the aerodynamic coefficients were obtained over a range of angles of attack from 0 to 90 deg. To account for the effect of frequency on the data, mathematical models with unsteady terms were formulated by use of two different indicial functions. Data from a reduced set of frequencies were used to estimate model parameters, including steady-state static and dynamic stability derivatives. Both models showed good prediction capability and the ability to accurately fit the measured data. Estimated static stability derivatives compared well with those obtained from static wind tunnel tests. The roll and yaw rate derivative estimates were compared with rotary-balanced wind tunnel data and theoretical predictions. The estimates and theoretical predictions were in agreement at small angles of attack. The rotary-balance data showed, in general, acceptable agreement with the steady-state derivative estimates.

  8. Analytical applications of oscillatory chemical reactions: determination of some pharmaceuticaly and biologically important compounds

    Directory of Open Access Journals (Sweden)

    Pejić Nataša D.


    Full Text Available Novel analytical methods for quantitive determination of analytes based on perturbations of oscillatory chemical reactions realized under open reactor conditions (continuosly fed well stirred tank reactor, CSTR, have been developed in the past twenty years. The proposed kinetic methods are generally based on the ability of the analyzed substances to change the kinetics of the chemical reactions matrix. The unambiguous correlation of quantitative characteristics of perturbations, and the amount (concentration of analyte expressed as a regression equation, or its graphics (calibration curve, enable the determination of the unknown analyte concentration. Attention is given to the development of these methods because of their simple experimental procedures, broad range of linear regression ( 10-7 10-4 mol L-1 and low limits of detection of analytes ( 10-6 10-8 mol L1, in some cases even lower than 10-12 mol L-1. Therefore, their application is very convenient for routine analysis of various inorganic and organic compounds as well as gases. This review summarizes progress made in the past 5 years on quantitative determination of pharmaceutically and biologically important compounds.

  9. Bone morphogenic protein 4 produced in endothelial cells by oscillatory shear stress stimulates an inflammatory response (United States)

    Sorescu, George P.; Sykes, Michelle; Weiss, Daiana; Platt, Manu O.; Saha, Aniket; Hwang, Jinah; Boyd, Nolan; Boo, Yong C.; Vega, J. David; Taylor, W. Robert; hide


    Atherosclerosis is now viewed as an inflammatory disease occurring preferentially in arterial regions exposed to disturbed flow conditions, including oscillatory shear stress (OS), in branched arteries. In contrast, the arterial regions exposed to laminar shear (LS) are relatively lesion-free. The mechanisms underlying the opposite effects of OS and LS on the inflammatory and atherogenic processes are not clearly understood. Here, through DNA microarrays, protein expression, and functional studies, we identify bone morphogenic protein 4 (BMP4) as a mechanosensitive and pro-inflammatory gene product. Exposing endothelial cells to OS increased BMP4 protein expression, whereas LS decreased it. In addition, we found BMP4 expression only in the selective patches of endothelial cells overlying foam cell lesions in human coronary arteries. The same endothelial patches also expressed higher levels of intercellular cell adhesion molecule-1 (ICAM-1) protein compared with those of non-diseased areas. Functionally, we show that OS and BMP4 induced ICAM-1 expression and monocyte adhesion by a NFkappaB-dependent mechanism. We suggest that BMP4 is a mechanosensitive, inflammatory factor playing a critical role in early steps of atherogenesis in the lesion-prone areas.

  10. Fractional Fokker-Planck equation and oscillatory behavior of cumulant moments

    International Nuclear Information System (INIS)

    Suzuki, N.; Biyajima, M.


    The Fokker-Planck equation is considered, which is connected to the birth and death process with immigration by the Poisson transform. The fractional derivative in time variable is introduced into the Fokker-Planck equation in order to investigate an origin of oscillatory behavior of cumulant moments. From its solution (the probability density function), the generating function (GF) for the corresponding probability distribution is derived. We consider the case when the GF reduces to that of the negative binomial distribution (NBD), if the fractional derivative is replaced to the ordinary one. The H j moment derived from the GF of the NBD decreases monotonically as the rank j increases. However, the H j moment derived in our approach oscillates, which is contrasted with the case of the NBD. Calculated H j moments are compared with those of charged multiplicities observed in pp-bar, e + e - , and e + p collisions. A phenomenological meaning of introducing the fractional derivative in time variable is discussed

  11. A Hybrid Constant and Oscillatory Field Ion Mobility Analyzer Using Structures for Lossless Ion Manipulations (United States)

    Prabhakaran, Aneesh; Hamid, Ahmed M.; Garimella, Sandilya V. B.; Valenzuela, Blandina R.; Ewing, Robert G.; Ibrahim, Yehia M.; Smith, Richard D.


    Here we explore the combination of constant and oscillatory fields applied in a single device to affect the continuous separation and filtering of ions based on their mobilities. The device explored allows confining and manipulating ions utilizing a combination of radio frequency (rf), direct current (DC) fields, and traveling waves (TW) in a structures for lossless ion manipulations (SLIM) module. We have investigated theoretically and experimentally a concept for continuous filtering of ions based on their mobilities where ions are mobility separated and selected by passage through two regions, both of which incorporated combined TW and constant fields providing opposing forces on the ions. The SLIM module was composed of two surfaces with mirror-image arrays of electrodes and had two regions where the different TW and opposing DC fields could be applied. The filtering capabilities are determined by the applied DC gradient and the TW parameters, such as speed, amplitude, and the TW sequence (i.e., the duty cycle of the traveling wave). The effects of different parameters on the sensitivity and the ion mobility (IM) resolution of the device have been investigated. By appropriately choosing the DC gradient and TW parameters for the two sections, it is possible to transmit ions of a selected mobility while filtering out others of both higher and lower mobility. The novel device described here provides a basis for the targeted analysis of compounds based upon the continuous selection of ions according to their mobility and without the need for high electric fields or pulsed injection.

  12. The Effect of Temperature on Selectivity in the Oscillatory Mode of the Phenylacetylene Oxidative Carbonylation Reaction. (United States)

    Parker, Julie; Novakovic, Katarina


    Reaction temperature plays a major role in product selectivity in the oscillatory mode of the palladium-catalyzed phenylacetylene oxidative carbonylation reaction. At 40 °C, dimethyl (2Z)-2-phenyl-2-butenedioate is the major product whereas at 0 °C the major product is 5,5-dimethoxy-3-phenyl-2(5H)-furanone. The occurrence of oscillations in pH coincides with an increase in the rate of phenylacetylene consumption and associated product formation. Experiments were performed isothermally in a reaction calorimeter to correlate reactant consumption and product formation with the occurrence of pH oscillations and the heat released by the reaction. An increase in the size of the pH drop in a single oscillation correlates with an increase in energy, indicating that this section of a single oscillation relates to reactant consumption. Based on these observations, a reaction pathway responsible for product formation is provided. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  13. Correlation of Infraslow Oscillatory Processes in the Body as an Integral Characteristic of Human Adaptation

    Directory of Open Access Journals (Sweden)

    Doletskiy Aleksey Nikolaevich


    Full Text Available The aim of our study was to assess synchrony infraslow rhythm (frequency of less than 1 Hz when registering the electroencephalogram (EEG, electrocardiogram (ECG and reoentsefalogrammy (REG depending from the psychoemotional state. The severity of the infraslow oscillatory processes in the central nervous system, heart and circulatory system during meditation, biofeedback with heart rate control and rhythmic breathing at a given frequency was performed. The infraslow activity depending on the use of non-pharmacological methods of relaxation was evaluated. The method of determination of the dominant frequencies of the cardiovascular, neural infraslow activity (from 0.07 to 1 Hz was used. We compared dominant frequencies of the infraslow activity in difference relaxation states. The specific frequencies in different types of relaxation in the cardiovascular and neural systems were found. The severity of the infraslow activity correlates with the functional state of the nervous and cardiovascular systems. We found the syncronization frequency of 0.2 Hz, which is different from the frequency of cardiorespiratory synchronization of 0.1 Hz, commonly found in literature.

  14. CT study of the performance of reciprocating and oscillatory motions in flattened root canal areas

    Energy Technology Data Exchange (ETDEWEB)

    Moura-Netto, Cacio, E-mail: [Universidade Cruzeiro do Sul (UNICSUL), Sao Paulo, SP (Brazil). Fac. de Odontologia; Palo, Renato Miotto [Universidade Estadual Paulista Julio de Mesquita Filho (ICT/UNESP), Sao Jose dos Campos, SP (Brazil). Instituto de Ciencia e Tecnologia; Pinto, Larissa Fernanda; Daltoe, Gisele; Mello-Moura, Anna Carolina Volpi [Universidade Ibirapuera (UNIB), Sao Paulo, SP (Brazil). Fac. de Odontologia


    Abstract: Root canal preparation is an important step in endodontic treatment. The anatomical complexity of the middle third of the root compromises the effective cleaning of this area. Thus, advances have been made in instrumentation techniques and instruments for this purpose. The aim of this study was to evaluate the effects of three different instrumentation systems on the enlargement of the middle thirds of root canals in mandibular incisors. The preparation methods used were the reciprocating systems Reciproc (Group I) and WaveOne (Group II) and the oscillatory system Tilos (Group III). Comparisons were made by three-dimensional image reconstruction with cone-beam computed tomography before and after instrumentation. Changes in area, perimeter, centering ability, and pattern of preparation were analyzed. The results were subjected to ANOVA complemented by the Tukey’s test. Changes in area, perimeter, and tendency of transportation showed similar results among groups. The transportation index of the Tilos system was significantly lower than that of the other groups. Qualitative analysis of the preparation pattern showed that the Tilos system had a more uniform preparation, although Reciproc and WaveOne preparations appeared more rounded, incompatible with the original canal anatomy. There was similarity in the systems’ performance on flattened areas, although the Tilos system presented a better pattern of root canal preparation and a lower index of transportation. (author)

  15. Frequency-Dependent Enhancement of Fluid Intelligence Induced by Transcranial Oscillatory Potentials

    Energy Technology Data Exchange (ETDEWEB)

    Santarnecchi, Emiliano [Univ. of Siena (Italy). Dept. of Medicine, Surgery and Neuroscience; Polizzotto, Nicola Riccardo [Univ. of Pittsburgh, PA (United States). Dept. of Psychiatry; Godone, Marco [Univ. of Siena (Italy). Dept. of Medicine, Surgery and Neuroscience; Giovannelli, Fabio [San Giovanni di Dio Hospital, Florence (Italy). Complex Unit of Neurology; Feurra, Matteo [Univ. of Siena (Italy). Dept. of Medicine, Surgery and Neuroscience; Matzen, Laura [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Rossi, Alessandro [Univ. of Siena (Italy). Dept. of Medicine, Surgery and Neuroscience; Rossi, Simone [Univ. of Siena (Italy). Dept. of Medicine, Surgery and Neuroscience


    Everyday problem solving requires the ability to go beyond experience by efficiently encoding and manipulating new information, i.e., fluid intelligence (Gf) [1]. Performance in tasks involving Gf, such as logical and abstract reasoning, has been shown to rely on distributed neural networks, with a crucial role played by prefrontal regions [2]. Synchronization of neuronal activity in the gamma band is a ubiquitous phenomenon within the brain; however, no evidence of its causal involvement in cognition exists to date [3]. Here, we show an enhancement of Gf ability in a cognitive task induced by exogenous rhythmic stimulation within the gamma band. Imperceptible alternating current [4] delivered through the scalp over the left middle frontal gyrus resulted in a frequency-specific shortening of the time required to find the correct solution in a visuospatial abstract reasoning task classically employed to measure Gf abilities (i.e., Raven’s matrices) [5]. Crucially, gamma-band stimulation (γ-tACS) selectively enhanced performance only on more complex trials involving conditional/logical reasoning. The finding presented here supports a direct involvement of gamma oscillatory activity in the mechanisms underlying higher-order human cognition.

  16. Nasal high-frequency oscillatory ventilation impairs heated humidification: A neonatal bench study. (United States)

    Ullrich, Tim L; Czernik, Christoph; Bührer, Christoph; Schmalisch, Gerd; Fischer, Hendrik S


    Nasal high-frequency oscillatory ventilation (nHFOV) is a novel mode of non-invasive ventilation used in neonates. However, upper airway obstructions due to viscous secretions have been described as specific adverse effects. We hypothesized that high-frequency oscillations reduce air humidity in the oropharynx, resulting in upper airway desiccation. Therefore, we aimed to investigate the effects of nHFOV ventilatory settings on oropharyngeal gas conditions. NHFOV or nasal continuous positive airway pressure (nCPAP) was applied, along with heated humidification, to a previously established neonatal bench model that simulates oropharyngeal gas conditions during spontaneous breathing through an open mouth. A digital thermo-hygro sensor measured oropharyngeal temperature (T) and humidity at various nHFOV frequencies (7, 10, 13 Hz), amplitudes (10, 20, 30 cmH 2 O), and inspiratory-to-expiratory (I:E) ratios (25:75, 33:66, 50:50), and also during nCPAP. Relative humidity was always >99%, but nHFOV resulted in lower mean T and absolute humidity (AH) in comparison to nCPAP (P humidification during nHFOV. © 2017 Wiley Periodicals, Inc.


    Energy Technology Data Exchange (ETDEWEB)

    Prasad, S. Krishna; Jess, D.B.; Keys, P.H. [Astrophysics Research Centre, School of Mathematics and Physics, Queen’s University Belfast, Belfast, BT7 1NN (United Kingdom); Jain, R., E-mail: [School of Mathematics and Statistics, University of Sheffield, Sheffield S3 7RH (United Kingdom)


    Oscillation amplitudes are generally smaller within magnetically active regions like sunspots and plage when compared to their surroundings. Such magnetic features, when viewed in spatially resolved power maps, appear as regions of suppressed power due to reductions in the oscillation amplitudes. Employing high spatial- and temporal-resolution observations from the Dunn Solar Telescope (DST) in New Mexico, we study the power suppression in a region of evolving magnetic fields adjacent to a pore. By utilizing wavelet analysis, we study for the first time how the oscillatory properties in this region change as the magnetic field evolves with time. Image sequences taken in the blue continuum, G-band, Ca ii K, and H α filters were used in this study. It is observed that the suppression found in the chromosphere occupies a relatively larger area, confirming previous findings. Also, the suppression is extended to structures directly connected to the magnetic region, and is found to get enhanced as the magnetic field strength increased with time. The dependence of the suppression on the magnetic field strength is greater at longer periods and higher formation heights. Furthermore, the dominant periodicity in the chromosphere was found to be anti-correlated with increases in the magnetic field strength.

  18. What basal ganglia changes underlie the parkinsonian state? The significance of neuronal oscillatory activity (United States)

    Quiroga-Varela, A.; Walters, J.R.; Brazhnik, E.; Marin, C.; Obeso, J.A.


    One well accepted functional feature of the parkinsonian state is the recording of enhanced beta oscillatory activity in the basal ganglia. This has been demonstrated in patients with Parkinson's disease (PD) and in animal models such as the rat with 6-hydroxydopamine (6-OHDA)-induced lesion and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-treated monkeys, all of which are associated with severe striatal dopamine depletion. Neuronal hyper-synchronization in the beta (or any other) band is not present despite the presence of bradykinetic features in the rat and monkey models, suggesting that increased beta band power may arise when nigro-striatal lesion is advanced and that it is not an essential feature of the early parkinsonian state. Similar observations and conclusions have been previously made for increased neuronal firing rate in the subthalamic and globus pallidus pars interna nuclei. Accordingly, it is suggested that early parkinsonism may be associated with dynamic changes in basal ganglia output activity leading to reduced movement facilitation that may be an earlier feature of the parkinsonian state. PMID:23727447

  19. Oscillatory Adaptive Yaw-Plane Control of Biorobotic Autonomous Underwater Vehicles Using Pectoral-Like Fins

    Directory of Open Access Journals (Sweden)

    Mugdha S. Naik


    Full Text Available This article considers the control of a biorobotic autonomous underwater vehicle (BAUV in the yaw plane using biologically inspired oscillatory pectoral-like fins of marine animals. The fins are assumed to be oscillating harmonically with a combined linear (sway and angular (yaw motion producing unsteady forces, which are used for fish-like control of BAUVs. Manoeuvring of the BAUV in the yaw plane is accomplished by altering the bias (mean angle of the angular motion of the fin. For the derivation of the adaptive control system, it is assumed that the physical parameters, the hydrodynamic coefficients, and the fin force and moment are not known. A direct adaptive sampled-data control system for the trajectory control of the yaw-angle using only yaw-angle measurement is derived. The parameter adaptation law is based on the normalised gradient scheme. Simulation results for the set point control, sinusoidal trajectory tracking and turning manoeuvres are presented, which show that the control system accomplishes precise trajectory control in spite of the parameter uncertainties.

  20. Microstructural Origins of Nonlinear Response in Associating Polymers under Oscillatory Shear

    Directory of Open Access Journals (Sweden)

    Mark A. Wilson


    Full Text Available The response of associating polymers with oscillatory shear is studied through large-scale simulations. A hybrid molecular dynamics (MD, Monte Carlo (MC algorithm is employed. Polymer chains are modeled as a coarse-grained bead-spring system. Functionalized end groups, at both ends of the polymer chains, can form reversible bonds according to MC rules. Stress-strain curves show nonlinearities indicated by a non-ellipsoidal shape. We consider two types of nonlinearities. Type I occurs at a strain amplitude much larger than one, type II at a frequency at which the elastic storage modulus dominates the viscous loss modulus. In this last case, the network topology resembles that of the system at rest. The reversible bonds are broken and chains stretch when the system moves away from the zero-strain position. For type I, the chains relax and the number of reversible bonds peaks when the system is near an extreme of the motion. During the movement to the other extreme of the cycle, first a stress overshoot occurs, then a yield accompanied by shear-banding. Finally, the network restructures. Interestingly, the system periodically restores bonds between the same associating groups. Even though major restructuring occurs, the system remembers previous network topologies.

  1. Understanding action language modulates oscillatory mu and beta rhythms in the same way as observing actions. (United States)

    Moreno, Iván; de Vega, Manuel; León, Inmaculada


    The mu rhythms (8-13 Hz) and the beta rhythms (15 up to 30 Hz) of the EEG are observed in the central electrodes (C3, Cz and C4) in resting states, and become suppressed when participants perform a manual action or when they observe another's action. This has led researchers to consider that these rhythms are electrophysiological markers of the motor neuron activity in humans. This study tested whether the comprehension of action language, unlike abstract language, modulates mu and low beta rhythms (15-20 Hz) in a similar way as the observation of real actions. The log-ratios were calculated for each oscillatory band between each condition and baseline resting periods. The results indicated that both action language and action videos caused mu and beta suppression (negative log-ratios), whereas abstract language did not, confirming the hypothesis that understanding action language activates motor networks in the brain. In other words, the resonance of motor areas associated with action language is compatible with the embodiment approach to linguistic meaning. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. A dynamic model for the optimization of oscillatory low grade heat engines

    Energy Technology Data Exchange (ETDEWEB)

    Markides, Christos N., E-mail: [Department of Chemical Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Smith, Thomas C. B. [Department of Engineering Science, University of Oxford, Oxford OX1 3PJ (United Kingdom)


    The efficiency of a thermodynamic system is a key quantity on which its usefulness and wider application relies. This is especially true for a device that operates with marginal energy sources and close to ambient temperatures. Various definitions of efficiency are available, each of which reveals a certain performance characteristic of a device. Of these, some consider only the thermodynamic cycle undergone by the working fluid, whereas others contain additional information, including relevant internal components of the device that are not part of the thermodynamic cycle. Yet others attempt to factor out the conditions of the surroundings with which the device is interfacing thermally during operation. In this paper we present a simple approach for the modeling of complex oscillatory thermal-fluid systems capable of converting low grade heat into useful work. We apply the approach to the NIFTE, a novel low temperature difference heat utilization technology currently under development. We use the results from the model to calculate various efficiencies and comment on the usefulness of the different definitions in revealing performance characteristics. We show that the approach can be applied to make design optimization decisions, and suggest features for optimal efficiency of the NIFTE.

  3. Nonlinear viscoelasticity of pre-compressed layered polymeric composite under oscillatory compression

    KAUST Repository

    Xu, Yangguang


    Describing nonlinear viscoelastic properties of polymeric composites when subjected to dynamic loading is essential for development of practical applications of such materials. An efficient and easy method to analyze nonlinear viscoelasticity remains elusive because the dynamic moduli (storage modulus and loss modulus) are not very convenient when the material falls into nonlinear viscoelastic range. In this study, we utilize two methods, Fourier transform and geometrical nonlinear analysis, to quantitatively characterize the nonlinear viscoelasticity of a pre-compressed layered polymeric composite under oscillatory compression. We discuss the influences of pre-compression, dynamic loading, and the inner structure of polymeric composite on the nonlinear viscoelasticity. Furthermore, we reveal the nonlinear viscoelastic mechanism by combining with other experimental results from quasi-static compressive tests and microstructural analysis. From a methodology standpoint, it is proved that both Fourier transform and geometrical nonlinear analysis are efficient tools for analyzing the nonlinear viscoelasticity of a layered polymeric composite. From a material standpoint, we consequently posit that the dynamic nonlinear viscoelasticity of polymeric composites with complicated inner structures can also be well characterized using these methods.

  4. Oscillatory shear response of moisture barrier coatings containing clay of different shape factor. (United States)

    Kugge, C; Vanderhoek, N; Bousfield, D W


    Oscillatory shear rheology of barrier coatings based on dispersed styrene-butadiene latex and clay of various shape factors or aspect ratio has been explored. Barrier performance of these coatings when applied to paperboard has been assessed in terms of water vapour transmission rates and the results related to shape factor, dewatering and critical strain. It has been shown that a system based on clay with high shape factor gives a lower critical strain, dewatering and water vapour transmission rate compared with clays of lower shape factor. The dissipated energy, as calculated from an amplitude sweep, indicated no attractive interaction between clay and latex implying a critical strain that appears to be solely dependent on the shape factor at a constant volume fraction. Particle size distribution was shown to have no effect on the critical strain while coatings of high elasticity exhibited high yield strains as expected. The loss modulus demonstrated strain hardening before the elastic to viscous transition. The loss modulus peak was identified by a maximum strain which was significantly lower for a coating based on clay with a high shape factor. The characteristic elastic time was found to vary between 0.6 and 1.3s. The zero shear viscosity of barrier dispersion coatings were estimated from the characteristic elastic time and the characteristic modulus to be of the order of 25-100 Pa s. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Oscillatory neural representations in the sensory thalamus predict neuropathic pain relief by deep brain stimulation. (United States)

    Huang, Yongzhi; Green, Alexander L; Hyam, Jonathan; Fitzgerald, James; Aziz, Tipu Z; Wang, Shouyan


    Understanding the function of sensory thalamic neural activity is essential for developing and improving interventions for neuropathic pain. However, there is a lack of investigation of the relationship between sensory thalamic oscillations and pain relief in patients with neuropathic pain. This study aims to identify the oscillatory neural characteristics correlated with pain relief induced by deep brain stimulation (DBS), and develop a quantitative model to predict pain relief by integrating characteristic measures of the neural oscillations. Measures of sensory thalamic local field potentials (LFPs) in thirteen patients with neuropathic pain were screened in three dimensional feature space according to the rhythm, balancing, and coupling neural behaviours, and correlated with pain relief. An integrated approach based on principal component analysis (PCA) and multiple regression analysis is proposed to integrate the multiple measures and provide a predictive model. This study reveals distinct thalamic rhythms of theta, alpha, high beta and high gamma oscillations correlating with pain relief. The balancing and coupling measures between these neural oscillations were also significantly correlated with pain relief. The study enriches the series research on the function of thalamic neural oscillations in neuropathic pain and relief, and provides a quantitative approach for predicting pain relief by DBS using thalamic neural oscillations. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Oscillatory vapour shielding of liquid metal walls in nuclear fusion devices. (United States)

    van Eden, G G; Kvon, V; van de Sanden, M C M; Morgan, T W


    Providing an efficacious plasma facing surface between the extreme plasma heat exhaust and the structural materials of nuclear fusion devices is a major challenge on the road to electricity production by fusion power plants. The performance of solid plasma facing surfaces may become critically reduced over time due to progressing damage accumulation. Liquid metals, however, are now gaining interest in solving the challenge of extreme heat flux hitting the reactor walls. A key advantage of liquid metals is the use of vapour shielding to reduce the plasma exhaust. Here we demonstrate that this phenomenon is oscillatory by nature. The dynamics of a Sn vapour cloud are investigated by exposing liquid Sn targets to H and He plasmas at heat fluxes greater than 5 MW m -2 . The observations indicate the presence of a dynamic equilibrium between the plasma and liquid target ruled by recombinatory processes in the plasma, leading to an approximately stable surface temperature.Vapour shielding is one of the interesting mechanisms for reducing the heat load to plasma facing components in fusion reactors. Here the authors report on the observation of a dynamic equilibrium between the plasma and the divertor liquid Sn surface leading to an overall stable surface temperature.

  7. Generation of net sediment transport by velocity skewness in oscillatory sheet flow (United States)

    Chen, Xin; Li, Yong; Chen, Genfa; Wang, Fujun; Tang, Xuelin


    This study utilizes a qualitative approach and a two-phase numerical model to investigate net sediment transport caused by velocity skewness beneath oscillatory sheet flow and current. The qualitative approach is derived based on the pseudo-laminar approximation of boundary layer velocity and exponential approximation of concentration. The two-phase model can obtain well the instantaneous erosion depth, sediment flux, boundary layer thickness, and sediment transport rate. It can especially illustrate the difference between positive and negative flow stages caused by velocity skewness, which is considerably important in determining the net boundary layer flow and sediment transport direction. The two-phase model also explains the effect of sediment diameter and phase-lag to sediment transport by comparing the instantaneous-type formulas to better illustrate velocity skewness effect. In previous studies about sheet flow transport in pure velocity-skewed flows, net sediment transport is only attributed to the phase-lag effect. In the present study with the qualitative approach and two-phase model, phase-lag effect is shown important but not sufficient for the net sediment transport beneath pure velocity-skewed flow and current, while the asymmetric wave boundary layer development between positive and negative flow stages also contributes to the sediment transport.

  8. Comparison of low-amplitude oscillatory shear in experimental and computational studies of model foams. (United States)

    Lundberg, Micah; Krishan, Kapilanjan; Xu, Ning; O'Hern, Corey S; Dennin, Michael


    A fundamental difference between fluids and solids is their response to applied shear. Solids possess static shear moduli, while fluids do not. Complex fluids such as foams display an intermediate response to shear with nontrivial frequency-dependent shear moduli. In this paper, we conduct coordinated experiments and numerical simulations of model foams subjected to boundary-driven oscillatory planar shear. Our studies are performed on bubble rafts (experiments) and the bubble model (simulations) in two dimensions. We focus on the low-amplitude flow regime in which T1 events, i.e., bubble rearrangement events where originally touching bubbles switch nearest neighbors, do not occur, yet the system transitions from solid- to liquidlike behavior as the driving frequency is increased. In both simulations and experiments, we observe two distinct flow regimes. At low frequencies omega, the velocity profile of the bubbles increases linearly with distance from the stationary wall, and there is a nonzero total phase shift between the moving boundary and interior bubbles. In this frequency regime, the total phase shift scales as a power law Delta approximately omegan with n approximately 3. In contrast, for frequencies above a crossover frequency omega>omegap, the total phase shift Delta scales linearly with the driving frequency. At even higher frequencies above a characteristic frequency omeganl>omegap, the velocity profile changes from linear to nonlinear. We fully characterize this transition from solid- to liquidlike flow behavior in both the simulations and experiments and find qualitative and quantitative agreements for the characteristic frequencies.

  9. Postural stability when walking and exposed to lateral oscillatory motion: benefits from hand supports. (United States)

    Ayık, Hatice Müjde; Griffin, Michael J


    While walking on a treadmill, 20 subjects experienced lateral oscillations: frequencies from 0.5 to 2 Hz and velocities from 0.05 to 0.16 m s(- 1) rms. Postural stability was indicated by ratings of 'discomfort or difficulty in walking', the movement of the centre of pressure beneath the feet and lateral forces applied to a hand support. Hand support improved postural stability with all frequencies and all velocities of oscillatory motion: the lateral velocity of the centre of pressure reduced by 30-50% when using support throughout motion, by 20-30% when instructed to use the support only when required and by 15% during normal walking without oscillation. Improvements in stability, and the forces applied to the hand support, were independent of support height when used continuously throughout motion. When support was used only when required, subjects preferred to hold it 118-134 cm above the surface supporting the feet.

  10. Arteriovenous extracorporeal lung assist allows for maximization of oscillatory frequencies: a large-animal model of respiratory distress

    Directory of Open Access Journals (Sweden)

    Kranke Peter


    Full Text Available Abstract Background Although the minimization of the applied tidal volume (VT during high-frequency oscillatory ventilation (HFOV reduces the risk of alveolar shear stress, it can also result in insufficient CO2-elimination with severe respiratory acidosis. We hypothesized that in a model of acute respiratory distress (ARDS the application of high oscillatory frequencies requires the combination of HFOV with arteriovenous extracorporeal lung assist (av-ECLA in order to maintain or reestablish normocapnia. Methods After induction of ARDS in eight female pigs (56.5 ± 4.4 kg, a recruitment manoeuvre was performed and intratracheal mean airway pressure (mPaw was adjusted 3 cmH2O above the lower inflection point (Plow of the pressure-volume curve. All animals were ventilated with oscillatory frequencies ranging from 3–15 Hz. The pressure amplitude was fixed at 60 cmH2O. At each frequency gas exchange and hemodynamic measurements were obtained with a clamped and de-clamped av-ECLA. Whenever the av-ECLA was de-clamped, the oxygen sweep gas flow through the membrane lung was adjusted aiming at normocapnia. Results Lung recruitment and adjustment of the mPaw above Plow resulted in a significant improvement of oxygenation (p Conclusion In this animal model of ARDS, maximization of oscillatory frequencies with subsequent minimization of VT leads to hypercapnia that can only be reversed by adding av-ECLA. When combined with a recruitment strategy, these high frequencies do not impair oxygenation

  11. Analysis of current-driven oscillatory dynamics of single-layer homoepitaxial islands on crystalline conducting substrates (United States)

    Dasgupta, Dwaipayan; Kumar, Ashish; Maroudas, Dimitrios


    We report results of a systematic study on the complex oscillatory current-driven dynamics of single-layer homoepitaxial islands on crystalline substrate surfaces and the dependence of this driven dynamical behavior on important physical parameters, including island size, substrate surface orientation, and direction of externally applied electric field. The analysis is based on a nonlinear model of driven island edge morphological evolution that accounts for curvature-driven edge diffusion, edge electromigration, and edge diffusional anisotropy. Using a linear theory of island edge morphological stability, we calculate a critical island size at which the island's equilibrium edge shape becomes unstable, which sets a lower bound for the onset of time-periodic oscillatory dynamical response. Using direct dynamical simulations, we study the edge morphological dynamics of current-driven single-layer islands at larger-than-critical size, and determine the actual island size at which the migrating islands undergo a transition from steady to time-periodic asymptotic states through a subcritical Hopf bifurcation. At the highest symmetry of diffusional anisotropy examined, on {111} surfaces of face-centered cubic crystalline substrates, we find that more complex stable oscillatory states can be reached through period-doubling bifurcation at island sizes larger than those at the Hopf points. We characterize in detail the island morphology and dynamical response at the stable time-periodic asymptotic states, determine the range of stability of these oscillatory states terminated by island breakup, and explain the morphological features of the stable oscillating islands on the basis of linear stability theory.

  12. A perturbation model for the oscillatory flow of a Bingham plastic in rigid and periodically displaced tubes. (United States)

    De Chant, L J


    An approximate analytical model for the pulsatile flow of an ideal Bingham plastic fluid in both a rigid and a periodically displaced tube has been developed using regular perturbation methods. Relationships are derived for the velocity field and dimensionless flow rate. The solution compares adequately with available experimentally measured oscillatory non-Newtonian fluid flow data. These solutions provide useful analytical models supporting experimental and computation studies of arterial blood flow.

  13. Working memory load related modulations of the oscillatory brain activity. N-back ERD/ERS study

    International Nuclear Information System (INIS)

    Nakao, Yoshiaki; Tamura, Toshiyo; Kodabashi, Atsushi; Fujimoto, Toshiro; Yarita, Masaru


    In recent cognitive neuroscience, a lot of studies of the human working memory were examined, and electroencephalography (EEG) measurements during n-back task were often used. However, they were almost studied by event related potentials (ERP) analysis. In the ERP study, time-locked components can be elicited, but non time-locked components such as the modulated brain oscillatory activity might be lost by an averaging procedure. To elucidate the contribution of the modulations of the brain oscillatory activity to the human working memory, we examined event related desynchronization (ERD)/event related synchronization (ERS) analysis on the source waveforms during n-back task. Source waveforms were calculated from a source model which was constructed with the sources seeded from fMRI meta-analysis of n-back task and additional sources in the orbitofrontal cortex and the visual cortex estimated with P100 and P360 components in the n-back ERP. Our results suggested the network which included the prefrontal cortex and the parietal lobe had a contribution to human working memory process, and it was mediated by theta oscillatory activity. (author)

  14. Comparison between conventional protective mechanical ventilation and high-frequency oscillatory ventilation associated with the prone position. (United States)

    Fioretto, José Roberto; Klefens, Susiane Oliveira; Pires, Rafaelle Fernandes; Kurokawa, Cilmery Suemi; Carpi, Mario Ferreira; Bonatto, Rossano César; Moraes, Marcos Aurélio; Ronchi, Carlos Fernando


    To compare the effects of high-frequency oscillatory ventilation and conventional protective mechanical ventilation associated with the prone position on oxygenation, histology and pulmonary oxidative damage in an experimental model of acute lung injury. Forty-five rabbits with tracheostomy and vascular access were underwent mechanical ventilation. Acute lung injury was induced by tracheal infusion of warm saline. Three experimental groups were formed: healthy animals + conventional protective mechanical ventilation, supine position (Control Group; n = 15); animals with acute lung injury + conventional protective mechanical ventilation, prone position (CMVG; n = 15); and animals with acute lung injury + high-frequency oscillatory ventilation, prone position (HFOG; n = 15). Ten minutes after the beginning of the specific ventilation of each group, arterial gasometry was collected, with this timepoint being called time zero, after which the animal was placed in prone position and remained in this position for 4 hours. Oxidative stress was evaluated by the total antioxidant performance assay. Pulmonary tissue injury was determined by histopathological score. The level of significance was 5%. Both groups with acute lung injury showed worsening of oxygenation after induction of injury compared with the Control Group. After 4 hours, there was a significant improvement in oxygenation in the HFOG group compared with CMVG. Analysis of total antioxidant performance in plasma showed greater protection in HFOG. HFOG had a lower histopathological lesion score in lung tissue than CMVG. High-frequency oscillatory ventilation, associated with prone position, improves oxygenation and attenuates oxidative damage and histopathological lung injury compared with conventional protective mechanical ventilation.

  15. Modeling oscillatory dynamics in brain microcircuits as a way to help uncover neurological disease mechanisms: A proposal

    Energy Technology Data Exchange (ETDEWEB)

    Skinner, F. K. [Toronto Western Research Institute, University Health Network, Krembil Discovery Tower, Toronto Western Hospital, 60 Leonard Street, 7th floor, 7KD411, Toronto, Ontario M5T 2S8 (Canada); Department of Medicine (Neurology), University of Toronto, 200 Elizabeth Street, Toronto, Ontario M5G 2C4 (Canada); Department of Physiology, University of Toronto Medical Sciences Building, 3rd Floor, 1 King' s College Circle, Toronto, Ontario M5S 1A8 (Canada); Ferguson, K. A. [Toronto Western Research Institute, University Health Network, Krembil Discovery Tower, Toronto Western Hospital, 60 Leonard Street, 7th floor, 7KD411, Toronto, Ontario M5T 2S8 (Canada); Department of Physiology, University of Toronto Medical Sciences Building, 3rd Floor, 1 King' s College Circle, Toronto, Ontario M5S 1A8 (Canada)


    There is an undisputed need and requirement for theoretical and computational studies in Neuroscience today. Furthermore, it is clear that oscillatory dynamical output from brain networks is representative of various behavioural states, and it is becoming clear that one could consider these outputs as measures of normal and pathological brain states. Although mathematical modeling of oscillatory dynamics in the context of neurological disease exists, it is a highly challenging endeavour because of the many levels of organization in the nervous system. This challenge is coupled with the increasing knowledge of cellular specificity and network dysfunction that is associated with disease. Recently, whole hippocampus in vitro preparations from control animals have been shown to spontaneously express oscillatory activities. In addition, when using preparations derived from animal models of disease, these activities show particular alterations. These preparations present an opportunity to address challenges involved with using models to gain insight because of easier access to simultaneous cellular and network measurements, and pharmacological modulations. We propose that by developing and using models with direct links to experiment at multiple levels, which at least include cellular and microcircuit, a cycling can be set up and used to help us determine critical mechanisms underlying neurological disease. We illustrate our proposal using our previously developed inhibitory network models in the context of these whole hippocampus preparations and show the importance of having direct links at multiple levels.

  16. High frequency oscillatory ventilation with lung volume optimization in very low birth weight newborns – a nine-year experience

    Directory of Open Access Journals (Sweden)

    José Nona


    Full Text Available Objective: To evaluate the clinical outcome of very low birth weight newborns, submitted to high frequency oscillatory ventilation with a strategy of early lung volume optimization. Methods: Descriptive prospective study in a nine-year period, between 1999 January 1st to 2008 January 1st. All the very low birth weight newborns were born in Dr. Alfredo da Costa Maternity, Lisbon, Portugal, were admitted to the Neonatal Intensive Care Unit and submitted to high frequency oscillatory ventilation with early lung volume optimization; these newborns were followed-up since birth and their charts were analyzed periodically until hospital discharge. Rresults: From a total population of 730 very low birth weight inborns, 117 babies died (16% and 613 survived (84%. The median of birth weight was 975 g and the gestational age median was 28 weeks. For the survivors, the median ventilation and oxygenation times were 3 and 18 days, respectively. The incidence of chronic lung disease was 9.5%, with nine newborns discharged on oxygen therapy. The incidence of intraventricular hemorrhage III – IV (total population group was 11.5% and the incidence of retinopathy of prematurity grade 3 or higher was 8.0%. Cconclusions: High frequency oscillatory ventilation with early lung volume optimization strategy reduced the need of respiratory support, and improved pulmonary and global outcomes in very low birth weight infants with respiratory distress syndrome.

  17. The Olivo-cerebellar System: A Key to understanding the functional significance of intrinsic oscillatory brain properties

    Directory of Open Access Journals (Sweden)

    Rodolfo R Llinas


    Full Text Available The reflexological view of brain function (Sherrington 1906 has played a crucial role in defining both the nature of connectivity and the role of the synaptic interactions among neuronal circuits. One implicit assumption of this view, however, has been that CNS function is fundamentally driven by sensory input. This view was questioned as early as the beginning of the last century when a possible role for intrinsic activity in CNS function was proposed by Thomas Graham Brow (Brown 1911; Brown 1914. However, little progress was made in addressing intrinsic neuronal properties in vertebrates until the discovery of calcium conductances in vertebrate central neurons leading dendritic electroresponsiveness (Llinas and Hess 1976, Llinas and Sugimori 1980a and b and subthreshold neuronal oscillation in mammalian inferior olive (IO neurons (Llinas and Yarom 1981; Llinas and Yarom 1981.This happened in parallel with a similar set of findings concerning invertebrate neuronal system (Marder and Bucher 2001. The generalization into a more global view of intrinsic rhythmicity, at forebrain level, occurred initially with the demonstration that the thalamus has similar oscillatory properties (Llinas and Jahnsen 1982 and the ionic properties responsible for some oscillatory activity were, in fact, similar to those in the IO (Jahnsen and Llinas 1984; Llinas 1988. Thus lending support to the view that not only motricity, but cognitive properties, are organized as coherent oscillatory states (Pare, deCurtis et al. 1992; Singer 1993; Hardcastle 1997; Llinas, Ribary et al. 1998; Varela, Lachaux et al. 2001.

  18. Values Research (United States)


    that individualistic employees in individualistic organizations and collectivistic employees in collectivistic organizations show greater job...with Parsons’ causal assumption, in the nineties values were recognized on top of the cultural control –values control norms which in turn control...determines intention which may end in behavior. 7 Defining Human Values Cross- cultural theories on values emerged in the 80s developed by three main

  19. Elective high-frequency oscillatory ventilation in preterm infants with respiratory distress syndrome: an individual patient data meta-analysis

    Directory of Open Access Journals (Sweden)

    Offringa Martin


    Full Text Available Abstract Background Despite the considerable amount of evidence from randomized controlled trials and meta-analyses, uncertainty remains regarding the efficacy and safety of high-frequency oscillatory ventilation as compared to conventional ventilation in the early treatment of respiratory distress syndrome in preterm infants. This results in a wide variation in the clinical use of high-frequency oscillatory ventilation for this indication throughout the world. The reasons are an unexplained heterogeneity between trial results and a number of unanswered, clinically important questions. Do infants with different risk profiles respond differently to high-frequency oscillatory ventilation? How does the ventilation strategy affect outcomes? Does the delay – either from birth or from the moment of intubation – to the start of high-frequency oscillation modify the effect of the intervention? Instead of doing new trials, those questions can be addressed by re-analyzing the individual patient data from the existing randomized controlled trials. Methods/Design A systematic review with meta-analysis based on individual patient data. This involves the central collection, validation and re-analysis of the original individual data from each infant included in each randomized controlled trial addressing this question. The study objective is to estimate the effect of high-frequency oscillatory ventilation on the risk for the combined outcome of death or bronchopulmonary dysplasia or a severe adverse neurological event. In addition, it will explore whether the effect of high-frequency oscillatory ventilation differs by the infant's risk profile, defined by gestational age, intrauterine growth restriction, severity of lung disease at birth and whether or not corticosteroids were given to the mother prior to delivery. Finally, it will explore the importance of effect modifying factors such as the ventilator device, ventilation strategy and the delay to the

  20. Default values

    International Nuclear Information System (INIS)


    In making calculations for the purposes of radiation protection, numerical values for parameters used in the calculations are selected. In some cases, data directly applicable to the set of conditions for which the calculations are to be made are unavailable. Therefore, the selection of the values for these parameters may be based on more general data available from the literature or other sources. These values may be referred to as 'default values', that is, values used in default of those based on directly applicable data. The following policy will be applied by Atomic Energy Control Board (AECB) staff in reviewing the radiation protection aspects of submissions associated with licensing, in participating with other organizations in the development of codes and standards, and in any other work which relies to some extent on using default values

  1. Dynamic behavior of dual cross-linked nanoparticle networks under oscillatory shear

    International Nuclear Information System (INIS)

    Iyer, Balaji V S; Yashin, Victor V; Balazs, Anna C


    Via computer simulations, we investigate the linear and nonlinear viscoelastic response of polymer grafted nanoparticle networks subject to oscillatory shear at different amplitudes and frequencies. The individual nanoparticles are composed of a rigid spherical core and a corona of grafted polymers that encompass reactive end groups. With the overlap of the coronas on adjacent particles, the reactive end groups form permanent or labile bonds, and thus form a ‘dual cross-linked’ network. The existing labile bonds between particles can break and reform depending on the bond rupture rate, extent of deformation and the frequency of oscillation. We study how the viscoelastic behavior of the material depends on the energy of the labile bonds and identify the network characteristics that give rise to the observed viscoelastic response. We observe that with an increase in labile bond energy, the storage modulus increases while the loss modulus shows a more complex response depending on the labile bond energy. Specifically, in the case of the samples with the weaker labile bonds, the loss modulus increases monotonically, while for the samples with the stronger labile bonds, the loss modulus exhibits a minimum with an increase in frequency. We show that an increase in the storage modulus corresponds to an enhancement in the average number of bonds in the samples and the characteristics of the loss modulus depend on both the bond kinetics and the mobility of the particles in the network. Furthermore, we determine that the effective contribution of the bonds to the storage modulus decreases with increase in strain amplitude. In particular, while bond formation at small amplitude drives an increase in storage modulus, at large amplitudes it promotes clustering and formation of voids leading to strain softening. Our simulations provide a mesoscopic picture of how the nature of labile bonds affects the performance of cross-linked polymer-grafted nanoparticle networks. (paper)

  2. Visual food stimulus changes resting oscillatory brain activities related to appetitive motive. (United States)

    Yoshikawa, Takahiro; Tanaka, Masaaki; Ishii, Akira; Yamano, Yoko; Watanabe, Yasuyoshi


    Changes of resting brain activities after visual food stimulation might affect the feeling of pleasure in eating food in daily life and spontaneous appetitive motives. We used magnetoencephalography (MEG) to identify brain areas related to the activity changes. Fifteen healthy, right-handed males [age, 25.4 ± 5.5 years; body mass index, 22.5 ± 2.7 kg/m 2 (mean ± SD)] were enrolled. They were asked to watch food or mosaic pictures for 5 min and to close their eyes for 3 min before and after the picture presentation without thinking of anything. Resting brain activities were recorded during two eye-closed sessions. The feeling of pleasure in eating food in daily life and appetitive motives in the study setting were assessed by visual analogue scale (VAS) scores. The γ-band power of resting oscillatory brain activities was decreased after the food picture presentation in the right insula [Brodmann's area (BA) 13], the left orbitofrontal cortex (OFC) (BA11), and the left frontal pole (BA10). Significant reductions of the α-band power were observed in the dorsolateral prefrontal cortex (DLPFC) (BA46). Particularly, the feeling of pleasure in eating food was positively correlated with the power decrease in the insula and negatively with that in the DLPFC. The changes in appetitive motives were associated with the power decrease in the frontal pole. These findings suggest automatic brain mechanics whereby changes of the resting brain activity might be associated with positive feeling in dietary life and have an impact on the irresistible appetitive motives through emotional and cognitive brain functions.

  3. Effects of musical expertise on oscillatory brain activity in response to emotional sounds. (United States)

    Nolden, Sophie; Rigoulot, Simon; Jolicoeur, Pierre; Armony, Jorge L


    Emotions can be conveyed through a variety of channels in the auditory domain, be it via music, non-linguistic vocalizations, or speech prosody. Moreover, recent studies suggest that expertise in one sound category can impact the processing of emotional sounds in other sound categories as they found that musicians process more efficiently emotional musical and vocal sounds than non-musicians. However, the neural correlates of these modulations, especially their time course, are not very well understood. Consequently, we focused here on how the neural processing of emotional information varies as a function of sound category and expertise of participants. Electroencephalogram (EEG) of 20 non-musicians and 17 musicians was recorded while they listened to vocal (speech and vocalizations) and musical sounds. The amplitude of EEG-oscillatory activity in the theta, alpha, beta, and gamma band was quantified and Independent Component Analysis (ICA) was used to identify underlying components of brain activity in each band. Category differences were found in theta and alpha bands, due to larger responses to music and speech than to vocalizations, and in posterior beta, mainly due to differential processing of speech. In addition, we observed greater activation in frontal theta and alpha for musicians than for non-musicians, as well as an interaction between expertise and emotional content of sounds in frontal alpha. The results reflect musicians' expertise in recognition of emotion-conveying music, which seems to also generalize to emotional expressions conveyed by the human voice, in line with previous accounts of effects of expertise on musical and vocal sounds processing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Assessment of UVA-Riboflavin Corneal Cross-Linking Using Small Amplitude Oscillatory Shear Measurements. (United States)

    Aslanides, Ioannis M; Dessi, Claudia; Georgoudis, Panagiotis; Charalambidis, Georgios; Vlassopoulos, Dimitris; Coutsolelos, Athanassios G; Kymionis, George; Mukherjee, Achyut; Kitsopoulos, Theofanis N


    The effect of ultraviolet (UV)-riboflavin cross-linking (CXL) has been measured primarily using the strip extensometry technique. We propose a simple and reliable methodology for the assessment of CXL treatment by using an established rheologic protocol based on small amplitude oscillatory shear (SAOS) measurements. It provides information on the average cross-link density and the elastic modulus of treated cornea samples. Three fresh postmortem porcine corneas were used to study the feasibility of the technique, one serving as control and two receiving corneal collagen cross-linking treatment. Subsequently, five pairs of fresh postmortem porcine corneas received corneal collagen cross-linking treatment with riboflavin and UVA-irradiation (370 nm; irradiance of 3 mW/cm2) for 30 minutes (Dresden protocol); the contralateral porcine corneas were used as control samples. After the treatment, the linear viscoelastic moduli of the corneal samples were measured using SAOS measurements and the average cross-linking densities extracted. For all cases investigated, the dynamic moduli of the cross-linked corneas were higher compared to those of the corresponding control samples. The increase of the elastic modulus of the treated samples was between 122% and 1750%. The difference was statistically significant for all tested samples (P = 0.018, 2-tailed t-test). We report a simple and accurate methodology for quantifying the effects of cross-linking on porcine corneas treated with the Dresden protocol by means of SAOS measurements in the linear regime. The measured dynamic moduli, elastic and viscous modulus, represent the energy storage and energy dissipation, respectively. Hence, they provide a means to assess the changing physical properties of the cross-linked collagen networks after CXL treatment.

  5. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling. (United States)

    Estrada, Javier; Andrew, Natalie; Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy


    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell's environment. This suggests that the external environment may be harnessed to interrogate the cell's internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a "correct" model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology.

  6. Face the hierarchy: ERP and oscillatory brain responses in social rank processing. (United States)

    Breton, Audrey; Jerbi, Karim; Henaff, Marie-Anne; Cheylus, Anne; Baudouin, Jean-Yves; Schmitz, Christina; Krolak-Salmon, Pierre; Van der Henst, Jean-Baptiste


    Recognition of social hierarchy is a key feature that helps us navigate through our complex social environment. Neuroimaging studies have identified brain structures involved in the processing of hierarchical stimuli but the precise temporal dynamics of brain activity associated with such processing remains largely unknown. Here, we used electroencephalography to examine the effect of social hierarchy on neural responses elicited by faces. In contrast to previous studies, the key manipulation was that a hierarchical context was constructed, not by varying facial expressions, but by presenting neutral-expression faces in a game setting. Once the performance-based hierarchy was established, participants were presented with high-rank, middle-rank and low-rank player faces and had to evaluate the rank of each face with respect to their own position. Both event-related potentials and task-related oscillatory activity were investigated. Three main findings emerge from the study. First, the experimental manipulation had no effect on the early N170 component, which may suggest that hierarchy did not modulate the structural encoding of neutral-expression faces. Second, hierarchy significantly modulated the amplitude of the late positive potential (LPP) within a 400-700 ms time-window, with more a prominent LPP occurring when the participants processed the face of the highest-rank player. Third, high-rank faces were associated with the highest reduction of alpha power. Taken together these findings provide novel electrophysiological evidence for enhanced allocation of attentional resource in the presence of high-rank faces. At a broader level, this study brings new insights into the neural processing underlying social categorization.

  7. Selective Reduction of AMPA Currents onto Hippocampal Interneurons Impairs Network Oscillatory Activity (United States)

    Le Magueresse, Corentin; Monyer, Hannah


    Reduction of excitatory currents onto GABAergic interneurons in the forebrain results in impaired spatial working memory and altered oscillatory network patterns in the hippocampus. Whether this phenotype is caused by an alteration in hippocampal interneurons is not known because most studies employed genetic manipulations affecting several brain regions. Here we performed viral injections in genetically modified mice to ablate the GluA4 subunit of the AMPA receptor in the hippocampus (GluA4HC−/− mice), thereby selectively reducing AMPA receptor-mediated currents onto a subgroup of hippocampal interneurons expressing GluA4. This regionally selective manipulation led to a strong spatial working memory deficit while leaving reference memory unaffected. Ripples (125–250 Hz) in the CA1 region of GluA4HC−/− mice had larger amplitude, slower frequency and reduced rate of occurrence. These changes were associated with an increased firing rate of pyramidal cells during ripples. The spatial selectivity of hippocampal pyramidal cells was comparable to that of controls in many respects when assessed during open field exploration and zigzag maze running. However, GluA4 ablation caused altered modulation of firing rate by theta oscillations in both interneurons and pyramidal cells. Moreover, the correlation between the theta firing phase of pyramidal cells and position was weaker in GluA4HC−/− mice. These results establish the involvement of AMPA receptor-mediated currents onto hippocampal interneurons for ripples and theta oscillations, and highlight potential cellular and network alterations that could account for the altered working memory performance. PMID:22675480

  8. Aquifer heterogeneity characterization with oscillatory pumping: Sensitivity analysis and imaging potential (United States)

    Cardiff, M.; Bakhos, T.; Kitanidis, P. K.; Barrash, W.


    Periodic pumping tests, in which a fluid is extracted during half a period, then reinjected, have been used historically to estimate effective aquifer properties. In this work, we suggest a modified approach to periodic pumping test analysis in which one uses several periodic pumping signals of different frequencies as stimulation, and responses are analyzed through inverse modeling using a "steady-periodic" model formulation. We refer to this strategy as multifrequency oscillatory hydraulic imaging. Oscillating pumping tests have several advantages that have been noted, including no net water extraction during testing and robust signal measurement through signal processing. Through numerical experiments, we demonstrate additional distinct advantages that multifrequency stimulations have, including: (1) drastically reduced computational cost through use of a steady-periodic numerical model and (2) full utilization of the aquifer heterogeneity information provided by responses at different frequencies. We first perform fully transient numerical modeling for heterogeneous aquifers and show that equivalent results are obtained using a faster steady-periodic heterogeneous numerical model of the wave phasor. The sensitivities of observed signal response to aquifer heterogeneities are derived using an adjoint state-based approach, which shows that different frequency stimulations provide complementary information. Finally, we present an example 2-D application in which sinusoidal signals at multiple frequencies are used as a data source and are inverted to obtain estimates of aquifer heterogeneity. These analyses show the different heterogeneity information that can be obtained from different stimulation frequencies, and that data from several sinusoidal pumping tests can be rapidly inverted using the steady-periodic framework.

  9. Humidification during high-frequency oscillatory ventilation for adults: a bench study. (United States)

    Chikata, Yusuke; Imanaka, Hideaki; Ueta, Masahiko; Nishimura, Masaji


    High-frequency oscillatory ventilation (HFOV) has recently been applied to acute respiratory distress syndrome patients. However, the issue of humidification during HFOV has not been investigated. In a bench study, we evaluated humidification during HFOV for adults to test if adequate humidification was achieved in 2 different HFOV systems. We tested 2 brands of adult HFOV ventilators, the R100 (Metran, Japan) and the 3100B (SensorMedics, CA), under identical bias flow. A heated humidifier consisting of porous hollow fiber (Hummax II, Metran) was set for the R100, and a passover-type heated humidifier (MR850, Fisher & Paykel) was set for the 3100B, while inspiratory heating wire was applied to both systems. Each ventilator was connected to a lung model in an incubator. Absolute humidity, relative humidity and temperature at the airway opening were measured using a hygrometer under a variety of ventilatory settings: 3 stroke volumes/amplitudes, 3 frequencies, and 2 mean airway pressures. The R100 ventilator showed higher absolute humidity, higher relative humidity, and lower temperature than the 3100B. In the R100, as stroke volume and frequency increased, absolute humidity and temperature increased. In the 3100B, amplitude, frequency, and mean airway pressure minimally affected absolute humidity and temperature. Relative humidity was almost 100% in the R100, while it was 80.5±2.3% in the 3100B. Humidification during HFOV for adults was affected by stroke volume and frequency in the R100, but was not in the 3100B. Absolute humidity was above 33 mgH_2 O/L in these 2 systems under a range of settings.

  10. Skeletal nutrient vascular adaptation induced by external oscillatory intramedullary fluid pressure intervention

    Directory of Open Access Journals (Sweden)

    Qin Yi-Xian


    Full Text Available Abstract Background Interstitial fluid flow induced by loading has demonstrated to be an important mediator for regulating bone mass and morphology. It is shown that the fluid movement generated by the intramedullary pressure (ImP provides a source for pressure gradient in bone. Such dynamic ImP may alter the blood flow within nutrient vessel adjacent to bone and directly connected to the marrow cavity, further initiating nutrient vessel adaptation. It is hypothesized that oscillatory ImP can mediate the blood flow in the skeletal nutrient vessels and trigger vasculature remodeling. The objective of this study was then to evaluate the vasculature remodeling induced by dynamic ImP stimulation as a function of ImP frequency. Methods Using an avian model, dynamics physiological fluid ImP (70 mmHg, peak-peak was applied in the marrow cavity of the left ulna at either 3 Hz or 30 Hz, 10 minutes/day, 5 days/week for 3 or 4 weeks. The histomorphometric measurements of the principal nutrient arteries were done to quantify the arterial wall area, lumen area, wall thickness, and smooth muscle cell layer numbers for comparison. Results The preliminary results indicated that the acute cyclic ImP stimuli can significantly enlarge the nutrient arterial wall area up to 50%, wall thickness up to 20%, and smooth muscle cell layer numbers up to 37%. In addition, 3-week of acute stimulation was sufficient to alter the arterial structural properties, i.e., increase of arterial wall area, whereas 4-week of loading showed only minimal changes regardless of the loading frequency. Conclusions These data indicate a potential mechanism in the interrelationship between vasculature adaptation and applied ImP alteration. Acute ImP could possibly initiate the remodeling in the bone nutrient vasculature, which may ultimately alter blood supply to bone.

  11. Oscillatory theta activity during memory formation and its impact on overnight consolidation: a missing link? (United States)

    Heib, Dominik P J; Hoedlmoser, Kerstin; Anderer, Peter; Gruber, Georg; Zeitlhofer, Josef; Schabus, Manuel


    Sleep has been shown to promote memory consolidation driven by certain oscillatory patterns, such as sleep spindles. However, sleep does not consolidate all newly encoded information uniformly but rather "selects" certain memories for consolidation. It is assumed that such selection depends on salience tags attached to the new memories before sleep. However, little is known about the underlying neuronal processes reflecting presleep memory tagging. The current study sought to address the question of whether event-related changes in spectral theta power (theta ERSP) during presleep memory formation could reflect memory tagging that influences subsequent consolidation during sleep. Twenty-four participants memorized 160 word pairs before sleep; in a separate laboratory visit, they performed a nonlearning control task. Memory performance was tested twice, directly before and after 8 hr of sleep. Results indicate that participants who improved their memory performance overnight displayed stronger theta ERSP during the memory task in comparison with the control task. They also displayed stronger memory task-related increases in fast sleep spindle activity. Furthermore, presleep theta activity was directly linked to fast sleep spindle activity, indicating that processes during memory formation might indeed reflect memory tagging that influences subsequent consolidation during sleep. Interestingly, our results further indicate that the suggested relation between sleep spindles and overnight performance change is not as direct as once believed. Rather, it appears to be mediated by processes beginning during presleep memory formation. We conclude that theta ERSP during presleep memory formation reflects cortico-hippocampal interactions that lead to a better long-term accessibility by tagging memories for sleep spindle-related reprocessing.

  12. Microstructure and nonlinear signatures of yielding in a heterogeneous colloidal gel under large amplitude oscillatory shear

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Juntae; Helgeson, Matthew E., E-mail: [Department of Chemical Engineering, University of California Santa Barbara, Santa Barbara, California 93106 (United States); Merger, Dimitri; Wilhelm, Manfred [Institute for Chemical Technology and Polymer Chemistry, Karlsruhe Institute of Technology, 76131 Karlsruhe (Germany)


    We investigate yielding in a colloidal gel that forms a heterogeneous structure, consisting of a two-phase bicontinuous network of colloid-rich domains of fractal clusters and colloid-poor domains. Combining large amplitude oscillatory shear measurements with simultaneous small and ultra-small angle neutron scattering (rheo-SANS/USANS), we characterize both the nonlinear mechanical processes and strain amplitude-dependent microstructure underlying yielding. We observe a broad, three-stage yielding process that evolves over an order of magnitude in strain amplitude between the onset of nonlinearity and flow. Analyzing the intracycle response as a sequence of physical processes reveals a transition from elastic straining to elastoplastic thinning (which dominates in region I) and eventually yielding (which evolves through region II) and flow (which saturates in region III), and allows quantification of instantaneous nonlinear parameters associated with yielding. These measures exhibit significant strain rate amplitude dependence above a characteristic frequency, which we argue is governed by poroelastic effects. Correlating these results with time-averaged rheo-USANS measurements reveals that the material passes through a cascade of structural breakdown from large to progressively smaller length scales. In region I, compression of the fractal domains leads to the formation of large voids. In regions II and III, cluster-cluster correlations become increasingly homogeneous, suggesting breakage and eventually depercolation of intercluster bonds at the yield point. All significant structural changes occur on the micron-scale, suggesting that large-scale rearrangements of hundreds or thousands of particles, rather than the homogeneous rearrangement of particle-particle bonds, dominate the initial yielding of heterogeneous colloidal gels.

  13. Oscillatory underpinnings of mismatch negativity and their relationship with cognitive function in patients with schizophrenia.

    Directory of Open Access Journals (Sweden)

    Muzaffer Kaser

    Full Text Available BACKGROUND: Impairments in mismatch negativity (MMN generation have been consistently reported in patients with schizophrenia. However, underlying oscillatory activity of MMN deficits in schizophrenia and the relationship with cognitive impairments have not been investigated in detail. Time-frequency power and phase analyses can provide more detailed measures of brain dynamics of MMN deficits in schizophrenia. METHOD: 21 patients with schizophrenia and 21 healthy controls were tested with a roving frequency paradigm to generate MMN. Time-frequency domain power and phase-locking (PL analysis was performed on all trials using short-time Fourier transforms with Hanning window tapering. A comprehensive battery (CANTAB was used to assess neurocognitive functioning. RESULTS: Mean MMN amplitude was significantly lower in patients with schizophrenia (95% CI 0.18 - 0.77. Patients showed significantly lower EEG power (95% CI -1.02 - -0.014 in the ~4-7 Hz frequency range (theta band between 170 and 210 ms. Patients with schizophrenia showed cognitive impairment in multiple domains of CANTAB. However, MMN impairments in amplitude and power were not correlated with clinical measures, medication dose, social functioning or neurocognitive performance. CONCLUSION: The findings from this study suggested that while MMN may be a useful marker to probe NMDA receptor mediated mechanisms and associated impairments in gain control and perceptual changes, it may not be a useful marker in association with clinical or cognitive changes. Trial-by-trial EEG power analysis can be used as a measure of brain dynamics underlying MMN deficits which also can have implications for the use of MMN as a biomarker for drug discovery.

  14. A continuous time-resolved measure decoded from EEG oscillatory activity predicts working memory task performance. (United States)

    Astrand, Elaine


    Working memory (WM), crucial for successful behavioral performance in most of our everyday activities, holds a central role in goal-directed behavior. As task demands increase, inducing higher WM load, maintaining successful behavioral performance requires the brain to work at the higher end of its capacity. Because it is depending on both external and internal factors, individual WM load likely varies in a continuous fashion. The feasibility to extract such a continuous measure in time that correlates to behavioral performance during a working memory task remains unsolved. Multivariate pattern decoding was used to test whether a decoder constructed from two discrete levels of WM load can generalize to produce a continuous measure that predicts task performance. Specifically, a linear regression with L2-regularization was chosen with input features from EEG oscillatory activity recorded from healthy participants while performing the n-back task, [Formula: see text]. The feasibility to extract a continuous time-resolved measure that correlates positively to trial-by-trial working memory task performance is demonstrated (r  =  0.47, p  performance before action (r  =  0.49, p  <  0.05). We show that the extracted continuous measure enables to study the temporal dynamics of the complex activation pattern of WM encoding during the n-back task. Specifically, temporally precise contributions of different spectral features are observed which extends previous findings of traditional univariate approaches. These results constitute an important contribution towards a wide range of applications in the field of cognitive brain-machine interfaces. Monitoring mental processes related to attention and WM load to reduce the risk of committing errors in high-risk environments could potentially prevent many devastating consequences or using the continuous measure as neurofeedback opens up new possibilities to develop novel rehabilitation techniques for

  15. Deep Value

    DEFF Research Database (Denmark)

    Asness, Clifford S.; Liew, John M.; Pedersen, Lasse Heje

    premium. Following these episodes, the value strategy has (1) high average returns; (2) low market betas, but high betas to a global value factor; (3) deteriorating fundamentals; (4) negative news sentiment; (5) selling pressure; (6) increased limits to arbitrage; and (7) increased arbitrage activity...

  16. Forestland values. (United States)

    John H. Beuter; Ralph J. Alig


    This issue of the journal of Forestry is devoted to articles about forestland values. Viewed broadly, natural resources and humans are our two basic resources. An expression of the importance of land as a foundation for forest ecosystems is forestland value. Our attitudes about land and the forest ecosystems that they support have changed considerably in recent years....

  17. The Value of Value Sets

    DEFF Research Database (Denmark)

    Sløk-Madsen, Stefan Kirkegaard; Christensen, Jesper

    The world over classrooms in business schools are being taught that corporate values can impact performance. The argument is typically that culture matter more than strategy plans and culture can be influenced and indeed changed by a shared corporate value set. While the claim seems intuitively a...... a unique contribution to the effects of investment in shared company values, and to whether agent rationality can be fundamentally changed by committed organizational efforts....

  18. Value Representations

    DEFF Research Database (Denmark)

    Rasmussen, Majken Kirkegaard; Petersen, Marianne Graves


    Stereotypic presumptions about gender affect the design process, both in relation to how users are understood and how products are designed. As a way to decrease the influence of stereotypic presumptions in design process, we propose not to disregard the aspect of gender in the design process......, as the perspective brings valuable insights on different approaches to technology, but instead to view gender through a value lens. Contributing to this perspective, we have developed Value Representations as a design-oriented instrument for staging a reflective dialogue with users. Value Representations...

  19. Unravelling Value

    DEFF Research Database (Denmark)

    Walsh, Matthew

    Paper presented in the symposium “What’s It All Worth? Material Possessions and Value in Past Societies” at 22nd Annual Meeting of the European Association of Archaeologists, Vilnius, Lithuania.......Paper presented in the symposium “What’s It All Worth? Material Possessions and Value in Past Societies” at 22nd Annual Meeting of the European Association of Archaeologists, Vilnius, Lithuania....

  20. Interaction between the Stress Phase Angle (SPA and the Oscillatory Shear Index (OSI Affects Endothelial Cell Gene Expression.

    Directory of Open Access Journals (Sweden)

    Ronny Amaya

    Full Text Available Hemodynamic forces play an important role in the non-uniform distribution of atherosclerotic lesions. Endothelial cells are exposed simultaneously to fluid wall shear stress (WSS and solid circumferential stress (CS. Due to variations in impedance (global factors and geometric complexities (local factors in the arterial circulation a time lag arises between these two forces that can be characterized by the temporal phase angle between CS and WSS (stress phase angle-SPA. Asynchronous flows (SPA close to -180° that are most prominent in coronary arteries have been associated with localization of atherosclerosis. Reversing oscillatory flows characterized by an oscillatory shear index (OSI that is great than zero are also associated with atherosclerosis localization. In this study we examined the relationship between asynchronous flows and reversing flows in altering the expression of 37 genes relevant to atherosclerosis development. In the case of reversing oscillatory flow, we observed that the asynchronous condition upregulated 8 genes compared to synchronous hemodynamics, most of them proatherogenic. Upregulation of the pro-inflammatory transcription factor NFκB p65 was confirmed by western blot, and nuclear translocation of NFκB p65 was confirmed by immunofluorescence staining. A comparative study between non-reversing flow and reversing flow found that in the case of synchronous hemodynamics, reversing flow altered the expression of 11 genes, while in the case of asynchronous hemodynamics, reversing flow altered the expression of 17 genes. Reversing flow significantly upregulated protein expression of NFκB p65 for both synchronous and asynchronous conditions. Nuclear translocation of NFκB p65 was confirmed for synchronous and asynchronous conditions in the presence of flow reversal. These data suggest that asynchronous hemodynamics and reversing flow can elicit proatherogenic responses in endothelial cells compared to synchronous

  1. Role of slow oscillatory activity and slow wave sleep in consolidation of episodic-like memory in rats. (United States)

    Oyanedel, Carlos N; Binder, Sonja; Kelemen, Eduard; Petersen, Kimberley; Born, Jan; Inostroza, Marion


    Our previous experiments showed that sleep in rats enhances consolidation of hippocampus dependent episodic-like memory, i.e. the ability to remember an event bound into specific spatio-temporal context. Here we tested the hypothesis that this enhancing effect of sleep is linked to the occurrence of slow oscillatory and spindle activity during slow wave sleep (SWS). Rats were tested on an episodic-like memory task and on three additional tasks covering separately the where (object place recognition), when (temporal memory), and what (novel object recognition) components of episodic memory. In each task, the sample phase (encoding) was followed by an 80-min retention interval that covered either a period of regular morning sleep or sleep deprivation. Memory during retrieval was tested using preferential exploration of novelty vs. familiarity. Consistent with previous findings, the rats which had slept during the retention interval showed significantly stronger episodic-like memory and spatial memory, and a trend of improved temporal memory (although not significant). Object recognition memory was similarly retained across sleep and sleep deprivation retention intervals. Recall of episodic-like memory was associated with increased slow oscillatory activity (0.85-2.0Hz) during SWS in the retention interval. Spatial memory was associated with increased proportions of SWS. Against our hypothesis, a relationship between spindle activity and episodic-like memory performance was not detected, but spindle activity was associated with object recognition memory. The results provide support for the role of SWS and slow oscillatory activity in consolidating hippocampus-dependent memory, the role of spindles in this process needs to be further examined. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Temporal entrainment of cognitive functions: musical mnemonics induce brain plasticity and oscillatory synchrony in neural networks underlying memory. (United States)

    Thaut, Michael H; Peterson, David A; McIntosh, Gerald C


    In a series of experiments, we have begun to investigate the effect of music as a mnemonic device on learning and memory and the underlying plasticity of oscillatory neural networks. We used verbal learning and memory tests (standardized word lists, AVLT) in conjunction with electroencephalographic analysis to determine differences between verbal learning in either a spoken or musical (verbal materials as song lyrics) modality. In healthy adults, learning in both the spoken and music condition was associated with significant increases in oscillatory synchrony across all frequency bands. A significant difference between the spoken and music condition emerged in the cortical topography of the learning-related synchronization. When using EEG measures as predictors during learning for subsequent successful memory recall, significantly increased coherence (phase-locked synchronization) within and between oscillatory brain networks emerged for music in alpha and gamma bands. In a similar study with multiple sclerosis patients, superior learning and memory was shown in the music condition when controlled for word order recall, and subjects were instructed to sing back the word lists. Also, the music condition was associated with a significant power increase in the low-alpha band in bilateral frontal networks, indicating increased neuronal synchronization. Musical learning may access compensatory pathways for memory functions during compromised PFC functions associated with learning and recall. Music learning may also confer a neurophysiological advantage through the stronger synchronization of the neuronal cell assemblies underlying verbal learning and memory. Collectively our data provide evidence that melodic-rhythmic templates as temporal structures in music may drive internal rhythm formation in recurrent cortical networks involved in learning and memory.

  3. The Role of Oscillatory Phase in Determining the Temporal Organization of Perception: Evidence from Sensory Entrainment. (United States)

    Ronconi, Luca; Melcher, David


    Recent behavioral, neuroimaging, and neurophysiological studies have renewed the idea that the information processing within different temporal windows is linked to the phase and/or frequency of the ongoing oscillations, predominantly in the theta/alpha band (∼4-7 and 8-12 Hz, respectively). However, being correlational in nature, this evidence might reflect a nonfunctional byproduct rather than having a causal role. A more direct link can be shown with methods that manipulate oscillatory activity. Here, we used audiovisual entrainment at different frequencies in the prestimulus period of a temporal integration/segregation task. We hypothesized that entrainment would align ongoing oscillations and drive them toward the stimulation frequency. To reveal behavioral oscillations in temporal perception after the entrainment, we sampled the segregation/integration performance densely in time. In Experiment 1, two groups of human participants (both males and females) received stimulation either at the lower or the upper boundary of the alpha band (∼8.5 vs 11.5 Hz). For both entrainment frequencies, we found a phase alignment of the perceptual oscillation across subjects, but with two different power spectra that peaked near the entrainment frequency. These results were confirmed when perceptual oscillations were characterized in the time domain with sinusoidal fittings. In Experiment 2, we replicated the findings in a within-subject design, extending the results for frequencies in the theta (∼6.5 Hz), but not in the beta (∼15 Hz), range. Overall, these findings show that temporal segregation can be modified by sensory entrainment, providing evidence for a critical role of ongoing oscillations in the temporal organization of perception. SIGNIFICANCE STATEMENT The continuous flow of sensory input is not processed in an analog fashion, but rather is grouped by the perceptual system over time. Recent studies pinpointed the phase and/or frequency of the neural

  4. Numerical Simulation of an Oscillatory-Type Tidal Current Powered Generator Based on Robotic Fish Technology

    Directory of Open Access Journals (Sweden)

    Ikuo Yamamoto


    Full Text Available The generation of clean renewable energy is becoming increasingly critical, as pollution and global warming threaten the environment in which we live. While there are many different kinds of natural energy that can be harnessed, marine tidal energy offers reliability and predictability. However, harnessing energy from tidal flows is inherently difficult, due to the harsh environment. Current mechanisms used to harness tidal flows center around propeller-based solutions but are particularly prone to failure due to marine fouling from such as encrustations and seaweed entanglement and the corrosion that naturally occurs in sea water. In order to efficiently harness tidal flow energy in a cost-efficient manner, development of a mechanism that is inherently resistant to these harsh conditions is required. One such mechanism is a simple oscillatory-type mechanism based on robotic fish tail fin technology. This uses the physical phenomenon of vortex-induced oscillation, in which water currents flowing around an object induce transverse motion. We consider two specific types of oscillators, firstly a wing-type oscillator, in which the optimal elastic modulus is being sort. Secondly, the optimal selection of shape from 6 basic shapes for a reciprocating oscillating head-type oscillator. A numerical analysis tool for fluid structure-coupled problems—ANSYS—was used to select the optimum softness of material for the first type of oscillator and the best shape for the second type of oscillator, based on the exhibition of high lift coefficients. For a wing-type oscillator, an optimum elastic modulus for an air-foil was found. For a self-induced vibration-type mechanism, based on analysis of vorticity and velocity distribution, a square-shaped head exhibited a lift coefficient of more than two times that of a cylindrically shaped head. Analysis of the flow field clearly showed that the discontinuous flow caused by a square-headed oscillator results in

  5. Tesla’s high voltage and high frequency generators with oscillatory circuits

    Directory of Open Access Journals (Sweden)

    Cvetić Jovan M.


    Full Text Available The principles that represent the basics of the work of the high voltage and high frequency generator with oscillating circuits will be discussed. Until 1891, Tesla made and used mechanical generators with a large number of extruded poles for the frequencies up to about 20 kHz. The first electric generators based on a new principle of a weakly coupled oscillatory circuits he used for the wireless signal transmission, for the study of the discharges in vacuum tubes, the wireless energy transmission, for the production of the cathode rays, that is x-rays and other experiments. Aiming to transfer the signals and the energy to any point of the surface of the Earth, in the late of 19th century, he had discovered and later patented a new type of high frequency generator called a magnifying transmitter. He used it to examine the propagation of electromagnetic waves over the surface of the Earth in experiments in Colorado Springs in the period 1899-1900. Tesla observed the formation of standing electromagnetic waves on the surface of the Earth by measuring radiated electric field from distant lightning thunderstorm. He got the idea to generate the similar radiation to produce the standing waves. On the one hand, signal transmission, i.e. communication at great distances would be possible and on the other hand, with more powerful and with at least three magnifying transmitters the wireless transmission of energy without conductors at any point of the Earth surface could also be achieved. The discovery of the standing waves on the surface of the Earth and the invention of the magnifying transmitter he claimed his greatest inventions. Less than two years later, at the end of 1901, he designed and started to build a much stronger magnifying transmitter on Long Island near New York City (the Wardenclyffe tower wishing to become a world telecommunication center. During the tower construction, he elaborated the plans for an even stronger transmitter based on

  6. Temporal Variation in Oscillatory Characteristics of Long-period Tremor at Aso Volcano, Japan. (United States)

    Yamamoto, M.; Ohkura, T.; Kaneshima, S.; Kawakatsu, H.


    At Aso volcano, Japan, various kinds of volcanic signals with broad frequency contents have been observed since 1930s. One of these signals is long-period tremor (LPT) with a dominant period of around 15 s, which is intermittently emitted from the volcano regardless of the surface activity. Our broadband seismic observations have revealed that LPTs are a kind of resonance oscillation of a crack-like conduit beneath the crater. In this study, aiming to detect a temporal variation of volcanic system, we analyze the long-term variation of LPTs from 1994 to the present.We first examine the temporal variation of dominant periods of LPTs (fundamental mode of around 15 s and the first overtone of around 7 s) using the continuous data recorded at broadband stations close to the active crater. The result shows a clear temporal change in the dominant periods of LPTs in 2003-2005 and 2014-2015. In 2003-2005, the periods of the two modes show correlated temporal change, and it can be interpreted as compositional and/or thermal change of hydrothermal fluids. On the other hand, in 2014-2015, the period of first overtone is almost constant at around 8 s, while that of the fundamental mode shows relatively large temporal fluctuations between 16 s and 12 s. To explain the different behavior among the two resonant modes, we examine the oscillatory characteristics of a fluid-filled crack having linearly varying thickness. With this model, we find that the ratio between resonance periods becomes smaller than that in the case of a flat crack having constant thickness. This behavior can be understood by considering the effective thickness of the crack depends on the wavelength of each resonant mode. Based on these results, the different temporal variation of dominant periods can be interpreted by depth-dependent thickness of the crack-like conduit which may be caused by pressurization and/or intrusion of magma at deeper portion of the conduit. These results suggest the importance of

  7. Oscillatory dynamics of vasoconstriction and vasodilation identified by time-localized phase coherence

    International Nuclear Information System (INIS)

    Sheppard, L W; McClintock, P V E; Stefanovska, A; Vuksanovic, V


    oscillatory in nature and are independent of central sources of variability.

  8. Complementary roles of different oscillatory activities in the subthalamic nucleus in coding motor effort in Parkinsonism. (United States)

    Tan, Huiling; Pogosyan, Alek; Anzak, Anam; Ashkan, Keyoumars; Bogdanovic, Marko; Green, Alexander L; Aziz, Tipu; Foltynie, Thomas; Limousin, Patricia; Zrinzo, Ludvic; Brown, Peter


    The basal ganglia may play an important role in the control of motor scaling or effort. Recently local field potential (LFP) recordings from patients with deep brain stimulation electrodes in the basal ganglia have suggested that local increases in the synchronisation of neurons in the gamma frequency band may correlate with force or effort. Whether this feature uniquely codes for effort and whether such a coding mechanism holds true over a range of efforts is unclear. Here we investigated the relationship between frequency-specific oscillatory activities in the subthalamic nucleus (STN) and manual grips made with different efforts. The latter were self-rated using the 10 level Borg scale ranging from 0 (no effort) to 10 (maximal effort). STN LFP activities were recorded in patients with Parkinson's Disease (PD) who had undergone functional surgery. Patients were studied while motor performance was improved by dopaminergic medication. In line with previous studies we observed power increase in the theta/alpha band (4-12 Hz), power suppression in the beta band (13-30 Hz) and power increase in the gamma band (55-90 Hz) and high frequency band (101-375 Hz) during voluntary grips. Beta suppression deepened, and then reached a floor level as effort increased. Conversely, gamma and high frequency power increases were enhanced during grips made with greater effort. Multiple regression models incorporating the four different spectral changes confirmed that the modulation of power in the beta band was the only independent predictor of effort during grips made with efforts rated <5. In contrast, increases in gamma band activity were the only independent predictor of effort during grips made with efforts ≥5. Accordingly, the difference between power changes in the gamma and beta bands correlated with effort across all effort levels. These findings suggest complementary roles for changes in beta and gamma band activities in the STN in motor effort coding. The latter function

  9. Oscillatory Dynamics Underlying Perceptual Narrowing of Native Phoneme Mapping from 6 to 12 Months of Age. (United States)

    Ortiz-Mantilla, Silvia; Hämäläinen, Jarmo A; Realpe-Bonilla, Teresa; Benasich, April A


    During the first months of life, human infants process phonemic elements from all languages similarly. However, by 12 months of age, as language-specific phonemic maps are established, infants respond preferentially to their native language. This process, known as perceptual narrowing, supports neural representation and thus efficient processing of the distinctive phonemes within the sound environment. Although oscillatory mechanisms underlying processing of native and non-native phonemic contrasts were recently delineated in 6-month-old infants, the maturational trajectory of these mechanisms remained unclear. A group of typically developing infants born into monolingual English families, were followed from 6 to 12 months and presented with English and Spanish syllable contrasts varying in voice-onset time. Brain responses were recorded with high-density electroencephalogram, and sources of event-related potential generators identified at right and left auditory cortices at 6 and 12 months and also at frontal cortex at 6 months. Time-frequency analyses conducted at source level found variations in both θ and γ ranges across age. Compared with 6-month-olds, 12-month-olds' responses to native phonemes showed smaller and faster phase synchronization and less spectral power in the θ range, and increases in left phase synchrony as well as induced high-γ activity in both frontal and left auditory sources. These results demonstrate that infants become more automatized and efficient in processing their native language as they approach 12 months of age via the interplay between θ and γ oscillations. We suggest that, while θ oscillations support syllable processing, γ oscillations underlie phonemic perceptual narrowing, progressively favoring mapping of native over non-native language across the first year of life. During early language acquisition, typically developing infants gradually construct phonemic maps of their native language in auditory cortex. It is well

  10. Distinct Oscillatory Frequencies Underlie Excitability of Human Occipital and Parietal Cortex. (United States)

    Samaha, Jason; Gosseries, Olivia; Postle, Bradley R


    Transcranial magnetic stimulation (TMS) of human occipital and posterior parietal cortex can give rise to visual sensations called phosphenes. We used near-threshold TMS with concurrent EEG recordings to measure how oscillatory brain dynamics covary, on single trials, with the perception of phosphenes after occipital and parietal TMS. Prestimulus power and phase, predominantly in the alpha band (8-13 Hz), predicted occipital TMS phosphenes, whereas higher-frequency beta-band (13-20 Hz) power (but not phase) predicted parietal TMS phosphenes. TMS-evoked responses related to phosphene perception were similar across stimulation sites and were characterized by an early (200 ms) posterior negativity and a later (>300 ms) parietal positivity in the time domain and an increase in low-frequency (∼5-7 Hz) power followed by a broadband decrease in alpha/beta power in the time-frequency domain. These correlates of phosphene perception closely resemble known electrophysiological correlates of conscious perception of near-threshold visual stimuli. The regionally differential pattern of prestimulus predictors of phosphene perception suggests that distinct frequencies may reflect cortical excitability in occipital versus posterior parietal cortex, calling into question the broader assumption that the alpha rhythm may serve as a general index of cortical excitability. SIGNIFICANCE STATEMENT Alpha-band oscillations are thought to reflect cortical excitability and are therefore ascribed an important role in gating information transmission across cortex. We probed cortical excitability directly in human occipital and parietal cortex and observed that, whereas alpha-band dynamics indeed reflect excitability of occipital areas, beta-band activity was most predictive of parietal cortex excitability. Differences in the state of cortical excitability predicted perceptual outcomes (phosphenes), which were manifest in both early and late patterns of evoked activity, revealing the time

  11. A continuous time-resolved measure decoded from EEG oscillatory activity predicts working memory task performance (United States)

    Astrand, Elaine


    Objective. Working memory (WM), crucial for successful behavioral performance in most of our everyday activities, holds a central role in goal-directed behavior. As task demands increase, inducing higher WM load, maintaining successful behavioral performance requires the brain to work at the higher end of its capacity. Because it is depending on both external and internal factors, individual WM load likely varies in a continuous fashion. The feasibility to extract such a continuous measure in time that correlates to behavioral performance during a working memory task remains unsolved. Approach. Multivariate pattern decoding was used to test whether a decoder constructed from two discrete levels of WM load can generalize to produce a continuous measure that predicts task performance. Specifically, a linear regression with L2-regularization was chosen with input features from EEG oscillatory activity recorded from healthy participants while performing the n-back task, n\\in [1,2] . Main results. The feasibility to extract a continuous time-resolved measure that correlates positively to trial-by-trial working memory task performance is demonstrated (r  =  0.47, p  <  0.05). It is furthermore shown that this measure allows to predict task performance before action (r  =  0.49, p  <  0.05). We show that the extracted continuous measure enables to study the temporal dynamics of the complex activation pattern of WM encoding during the n-back task. Specifically, temporally precise contributions of different spectral features are observed which extends previous findings of traditional univariate approaches. Significance. These results constitute an important contribution towards a wide range of applications in the field of cognitive brain–machine interfaces. Monitoring mental processes related to attention and WM load to reduce the risk of committing errors in high-risk environments could potentially prevent many devastating consequences or

  12. Punctual Pade approximants as a regularization procedure for divergent and oscillatory partial wave expansions of the scattering amplitude

    International Nuclear Information System (INIS)

    Garibotti, C.R.; Grinstein, F.F.


    Previous theorems on the convergence of the [n,n+m] punctual Pade approximants to the scattering amplitude are extended. The new proofs include the cases of nonforward and backward scattering corresponding to potentials having 1/r and 1/r 2 long-range behaviors, for which the partial wave expansions are divergent and oscillatory, respectively. In this way, the ability of the approximation scheme as a summation method is established for all of the long-range potentials of interest in potential scattering

  13. Punctual Pade Approximants as a regularization procedure for divergent and oscillatory partial wave expansions of the scattering amplitude

    International Nuclear Information System (INIS)

    Garibotti, C.R.; Grinstein, F.F.


    Previous theorems on the convergence of the [n, n+m] Punctual Pade Approximants to the scattering amplitude are extended. The new proofs include the cases of non-forward and backward scattering corresponding to potentials having 1/r and 1/r 2 long range behaviours, for which the partial wave expansions are divergent and oscillatory, respectively. In this way, the ability of the approximation scheme as a summation method is established for all of the long range potentials of interest in potential scattering [pt

  14. Recovery of oscillatory magneto-resistance in phase separated La{sub 0.3}Pr{sub 0.4}Ca{sub 0.3}MnO{sub 3} epitaxial thin films

    Energy Technology Data Exchange (ETDEWEB)

    Alagoz, H. S., E-mail:; Jeon, J.; Mahmud, S. T.; Saber, M. M.; Chow, K. H., E-mail:; Jung, J., E-mail: [Department of Physics, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Prasad, B. [Department of Materials Science and Metallurgy, University of Cambridge, Cambridge CB2 3QZ (United Kingdom); Egilmez, M. [Department of Physics, American University of Sharjah, Sharjah (United Arab Emirates)


    In-plane angular dependent magneto-resistance has been studied in La{sub 0.3}Pr{sub 0.4}Ca{sub 0.3}MnO{sub 3} (LPCMO) manganite thin films deposited on the (100) oriented NdGaO{sub 3}, and (001) oriented SrTiO{sub 3} and LaAlO{sub 3} substrates. At temperatures where the electronic phase separation is the strongest, a metastable irreversible state exists in the films whose resistivity ρ attains a large time dependent value. The ρ decreases sharply with an increasing angle θ between the magnetic field and the current, and does not display an expected oscillatory cos{sup 2}θ/sin{sup 2}θ dependence for all films. The regular oscillations are recovered during repetitive sweeping of θ between 0° and 180°. We discuss possible factors that could produce these unusual changes in the resistivity.

  15. Hydrodynamic parameters of micro porous media for steady and oscillatory flow: Application to cryocooler regenerators (United States)

    Cha, Jeesung Jeff

    Pulse Tube Cryocoolers (PTC) are a class of rugged and high-endurance refrigeration systems that operate without a moving part at their low temperature ends, and are capable of easily reaching 120°K. These devices can also be configured in multiple stages to reach temperatures below 10 °K. PTCs are particularly suitable for applications in space, missile guiding systems, cryosurgery, medicine preservation, superconducting electronics, magnetic resonance imaging, weather observation, and liquefaction of nitrogen. Although various designs of PTCs have been in use for a few decades, they represent a dynamic and developmental field. PTCs ruggedness comes at the price of relatively low efficiency, however, and thus far they have been primarily used in high-end applications. They have the potential of extensive use in consumer products, however, should sufficiently higher efficiencies be achieved. Intense research competition is underway worldwide, and newer designs are continuously introduced. Some of the fundamental processes that are responsible for their performance are at best not fully understood, however, and consequently systematic modeling of PTC systems is difficult. Among the challenges facing the PTC research community, besides improvement in terms of system efficiency, is the possible miniaturization (total fluid volume of few cubic centimeters (cc)) of these systems. The operating characteristics of a PTC are significantly different from the conventional refrigeration cycles. A PTC implements the theory of oscillatory compression and expansion of the gas within a closed volume to achieve desired refrigeration. Regenerators and pulse tubes are often viewed as the two most complex and essential components in cryocoolers. An important deficiency with respect to the state of art models dealing with PTCs is the essentially total lack of understanding about the directional hydrodynamic and thermal transport parameters associated with periodic flow in

  16. Public Value: rethinking value creation


    Meynhardt, Timo; Gomez, Peter; Strathoff, Pepe; Hermann, Carolin


    Managers might refute public criticism of their business as an attitude of taking everything for granted in a saturated society, but ignoring Public Value aspects can threaten the success of new products and even the survival of entire firms.

  17. Cortical gamma activity during auditory tone omission provides evidence for the involvement of oscillatory activity in top-down processing. (United States)

    Gurtubay, I G; Alegre, M; Valencia, M; Artieda, J


    Perception is an active process in which our brains use top-down influences to modulate afferent information. To determine whether this modulation might be based on oscillatory activity, we asked seven subjects to detect a silence that appeared randomly in a rhythmic auditory sequence, counting the number of omissions ("count" task), or responding to each omission with a right index finger extension ("move" task). Despite the absence of physical stimuli, these tasks induced a 'non-phase-locked' gamma oscillation in temporal-parietal areas, providing evidence of intrinsically generated oscillatory activity during top-down processing. This oscillation is probably related to the local neural activation that takes place during the process of stimulus detection, involving the functional comparison between the tones and the absence of stimuli as well as the auditory echoic memory processes. The amplitude of the gamma oscillations was reduced with the repetition of the tasks. Moreover, it correlated positively with the number of correctly detected omissions and negatively with the reaction time. These findings indicate that these oscillations, like others described, may be modulated by attentional processes. In summary, our findings support the active and adaptive concept of brain function that has emerged over recent years, suggesting that the match of sensory information with memory contents generates gamma oscillations.

  18. Oscillatory neuronal activity reflects lexical-semantic feature integration within and across sensory modalities in distributed cortical networks. (United States)

    van Ackeren, Markus J; Schneider, Till R; Müsch, Kathrin; Rueschemeyer, Shirley-Ann


    Research from the previous decade suggests that word meaning is partially stored in distributed modality-specific cortical networks. However, little is known about the mechanisms by which semantic content from multiple modalities is integrated into a coherent multisensory representation. Therefore we aimed to characterize differences between integration of lexical-semantic information from a single modality compared with two sensory modalities. We used magnetoencephalography in humans to investigate changes in oscillatory neuronal activity while participants verified two features for a given target word (e.g., "bus"). Feature pairs consisted of either two features from the same modality (visual: "red," "big") or different modalities (auditory and visual: "red," "loud"). The results suggest that integrating modality-specific features of the target word is associated with enhanced high-frequency power (80-120 Hz), while integrating features from different modalities is associated with a sustained increase in low-frequency power (2-8 Hz). Source reconstruction revealed a peak in the anterior temporal lobe for low-frequency and high-frequency effects. These results suggest that integrating lexical-semantic knowledge at different cortical scales is reflected in frequency-specific oscillatory neuronal activity in unisensory and multisensory association networks. Copyright © 2014 the authors 0270-6474/14/3314318-06$15.00/0.

  19. Forced phase-locked states and information retrieval in a two-layer network of oscillatory neurons with directional connectivity

    International Nuclear Information System (INIS)

    Kazantsev, Victor; Pimashkin, Alexey


    We propose two-layer architecture of associative memory oscillatory network with directional interlayer connectivity. The network is capable to store information in the form of phase-locked (in-phase and antiphase) oscillatory patterns. The first (input) layer takes an input pattern to be recognized and their units are unidirectionally connected with all units of the second (control) layer. The connection strengths are weighted using the Hebbian rule. The output (retrieved) patterns appear as forced-phase locked states of the control layer. The conditions are found and analytically expressed for pattern retrieval in response on incoming stimulus. It is shown that the system is capable to recover patterns with a certain level of distortions or noises in their profiles. The architecture is implemented with the Kuramoto phase model and using synaptically coupled neural oscillators with spikes. It is found that the spiking model is capable to retrieve patterns using the spiking phase that translates memorized patterns into the spiking phase shifts at different time scales

  20. The Relationship Between Brain Oscillatory Activity and Therapeutic Effectiveness of Transcranial Magnetic Stimulation in the Treatment of Major Depressive Disorder

    Directory of Open Access Journals (Sweden)

    Andrew Francis Leuchter


    Full Text Available Major Depressive Disorder (MDD is marked by disturbances in brain functional connectivity. This connectivity is modulated by rhythmic oscillations of brain electrical activity, which enable coordinated functions across brain regions. Oscillatory activity plays a central role in regulating thinking and memory, mood, cerebral blood flow, and neurotransmitter levels, and restoration of normal oscillatory patterns is associated with effective treatment of MDD. Repetitive Transcranial Magnetic Stimulation (rTMS is a robust treatment for MDD, but the mechanism of action (MOA of its benefits for mood disorders remains incompletely understood. Benefits of rTMS have been tied to enhanced neuroplasticity in specific brain pathways. We summarize here the evidence that rTMS entrains and resets thalamocortical oscillators, normalizes regulation and facilitates reemergence of intrinsic cerebral rhythms, and through this mechanism restores normal brain function. This entrainment and resetting may be a critical step in engendering neuroplastic changes and the antidepressant effects of rTMS. It may be possible to modify the method of rTMS administration to enhance this mechanism of action and achieve better antidepressant effectiveness. We propose that rTMS can be administered: 1 synchronized to a patient’s individual alpha rhythm (IAF, or synchronized rTMS (sTMS; 2 as a low magnetic field strength sinusoidal wave form; and, 3 broadly to multiple brain areas simultaneously. We present here the theory and evidence indicating that these modifications could enhance the therapeutic effectiveness of rTMS for the treatment of MDD.