WorldWideScience

Sample records for vaccinia virus-related nucleic

  1. Immune Modulation in Primary Vaccinia virus Zoonotic Human Infections

    Directory of Open Access Journals (Sweden)

    Juliana Assis Silva Gomes

    2012-01-01

    Full Text Available In 2010, the WHO celebrated the 30th anniversary of the smallpox eradication. Ironically, infections caused by viruses related to smallpox are being increasingly reported worldwide, including Monkeypox, Cowpox, and Vaccinia virus (VACV. Little is known about the human immunological responses elicited during acute infections caused by orthopoxviruses. We have followed VACV zoonotic outbreaks taking place in Brazil and analyzed cellular immune responses in patients acutely infected by VACV. Results indicated that these patients show a biased immune modulation when compared to noninfected controls. Amounts of B cells are low and less activated in infected patients. Although present, T CD4+ cells are also less activated when compared to noninfected individuals, and so are monocytes/macrophages. Similar results were obtained when Balb/C mice were experimentally infected with a VACV sample isolated during the zoonotic outbreaks. Taking together, the data suggest that zoonotic VACVs modulate specific immune cell compartments during an acute infection in humans.

  2. The Nucleic Acid Database.

    Science.gov (United States)

    Berman, Helen M; Westbrook, John; Feng, Zukang; Iype, Lisa; Schneider, Bohdan; Zardecki, Christine

    2002-06-01

    The Nucleic Acid Database was established in 1991 as a resource to assemble and distribute structural information about nucleic acids. Over the years, the NDB has developed generalized software for processing, archiving, querying and distributing structural data for nucleic acid-containing structures. The architecture and capabilities of the Nucleic Acid Database, as well as some of the research enabled by this resource, are presented in this article.

  3. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin

    National Research Council Canada - National Science Library

    Jones-Trower, Agnes; Garcia, Alonzo; Meseda, Clement A; He, Yong; Weiss, Carol; Kumar, Arunima; Weir, Jerry P; Merchlinsky, Michael

    2005-01-01

    Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain...

  4. Oncolytic vaccinia virotherapy of anaplastic thyroid cancer in vivo.

    Science.gov (United States)

    Lin, Shu-Fu; Price, Daniel L; Chen, Chun-Hao; Brader, Peter; Li, Sen; Gonzalez, Lorena; Zhang, Qian; Yu, Yong A; Chen, Nanhai; Szalay, Aladar A; Fong, Yuman; Wong, Richard J

    2008-11-01

    Anaplastic thyroid carcinoma (ATC) is a fatal disease with a median survival of only 6 months. Novel therapies are needed to improve dismal outcomes. A mutated, replication-competent, vaccinia virus (GLV-1h68) has oncolytic effects on human ATC cell lines in vitro. We assessed the utility of GLV-1h68 in treating anaplastic thyroid cancer in vivo. Athymic nude mice with xenograft flank tumors of human ATCs (8505C and DRO90-1) were treated with a single intratumoral injection of GLV-1h68 at low dose (5x10(5) plaque-forming unit), high dose (5x10(6) plaque-forming unit), or PBS. Virus-mediated marker gene expression (luciferase, green fluorescent protein, and beta-galactosidase), viral biodistribution, and flank tumor volumes were measured. Luciferase expression was detected 2 d after injection. Continuous viral replication within tumors was reflected by increasing luciferase activity to d 9. At d 10, tumor viral recovery was increased more than 50-fold as compared with the injected dose, and minimal virus was recovered from the lung, liver, brain, heart, spleen, and kidneys. High-dose virus directly injected into normal tissues was undetectable at d 10. The mean volume of control 8505C tumors increased 50.8-fold by d 45, in contrast to 10.5-fold (low dose) and 2.1-fold (high dose; P=0.028) increases for treated tumors. DRO90-1 tumors also showed significant growth inhibition by high-dose virus. No virus-related toxicity was observed throughout the study. GLV-1h68 efficiently infects, expresses transgenes within, and inhibits the growth of ATC in vivo. These promising findings support future clinical trials for patients with ATC.

  5. Susceptibility of Vaccinia Virus to Chemical Disinfectants

    Science.gov (United States)

    de Oliveira, Tércia Moreira Ludolfo; Rehfeld, Izabelle Silva; Coelho Guedes, Maria Isabel Maldonado; Ferreira, Jaqueline Maria Siqueira; Kroon, Erna Geessien; Lobato, Zélia Inês Portela

    2011-01-01

    Vaccinia virus (VACV) is the cause of bovine vaccinia (BV), an emerging zoonotic disease that affects dairy cows and milkers. Some chemical disinfectants have been used on farms affected by BV to disinfect cow teats and milkers' hands. To date, there is no information about the efficacy of disinfectants against VACV. Therefore, this study aimed to assess the virucidal activity of some active disinfectants commonly used in the field. Sodium hypochlorite, quaternary ammonium combined with chlorhexidine, and quaternary ammonium combined with glutaraldehyde were effective in inactivating the virus at all concentrations tested. Iodine and quaternary ammonium as the only active component were partially effective. The presence of bovine feces as organic matter and light decreased the effectiveness of sodium hypochlorite. These results show that an appropriated disinfection and asepsis of teats and hands may be helpful in the control and prevention of BV and other infections with VACV. PMID:21734141

  6. Vaccinia virus as an expression vector.

    Science.gov (United States)

    Talavera, A; Rodriguez, J M

    1992-01-01

    Vaccinia virus (Vv) is a member of the genus Orthopoxvirus, one of seven genera included in the family Poxviridae. Most of these viruses infect vertebrates (Orthopoxvirus, Avipoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Parapoxvirus), but one genus, Entomopoxvirus, infects insects. It is interesting to note that the Fibroma and Mixoma viruses of the leporipoxvirus genus cause tumors in their hosts (rabbits), these being the only tumorigenic viruses in the family (1,2).

  7. Brazilian Vaccinia Viruses and Their Origins

    Centers for Disease Control (CDC) Podcasts

    2007-07-30

    Smallpox was eradicated more than 25 years ago, but live viruses used in vaccines may have survived to cause animal and human illness today. Dr. Inger Damon, Acting Branch Chief of the Poxvirus and Rabies Branch at CDC, discusses efforts to determine origins and spread of vaccinia viruses in Brazil.  Created: 7/30/2007 by Emerging Infectious Diseases.   Date Released: 7/30/2007.

  8. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2003-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  9. Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    2002-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  10. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  11. Locked nucleic acid

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Sørensen, Mads D; Wengel, Jesper

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing very high affinity and excellent specificity toward complementary DNA and RNA, and LNA oligonucleotides have been applied as antisense molecules both in vitro and in vivo. In this review, we briefly describe the basic physioc...

  12. Peptide Nucleic Acid Synthons

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  13. Oncolytic vaccinia therapy of squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Yong A

    2009-07-01

    Full Text Available Abstract Background Novel therapies are necessary to improve outcomes for patients with squamous cell carcinomas (SCC of the head and neck. Historically, vaccinia virus was administered widely to humans as a vaccine and led to the eradication of smallpox. We examined the therapeutic effects of an attenuated, replication-competent vaccinia virus (GLV-1h68 as an oncolytic agent against a panel of six human head and neck SCC cell lines. Results All six cell lines supported viral transgene expression (β-galactosidase, green fluorescent protein, and luciferase as early as 6 hours after viral exposure. Efficient transgene expression and viral replication (>150-fold titer increase over 72 hrs were observed in four of the cell lines. At a multiplicity of infection (MOI of 1, GLV-1h68 was highly cytotoxic to the four cell lines, resulting in ≥ 90% cytotoxicity over 6 days, and the remaining two cell lines exhibited >45% cytotoxicity. Even at a very low MOI of 0.01, three cell lines still demonstrated >60% cell death over 6 days. A single injection of GLV-1h68 (5 × 106 pfu intratumorally into MSKQLL2 xenografts in mice exhibited localized intratumoral luciferase activity peaking at days 2–4, with gradual resolution over 10 days and no evidence of spread to normal organs. Treated animals exhibited near-complete tumor regression over a 24-day period without any observed toxicity, while control animals demonstrated rapid tumor progression. Conclusion These results demonstrate significant oncolytic efficacy by an attenuated vaccinia virus for infecting and lysing head and neck SCC both in vitro and in vivo, and support its continued investigation in future clinical trials.

  14. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds known as peptide nucleic acids, bind complementary DNA and RNA strands, and generally do so more strongly than the corresponding DNA or RNA strands while exhibiting increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from a...... a group consisting of naturally-occurring nucleobases and non-naturally-occurring nucleobases, including 2,6-diaminopurine, attached to a polyamide backbone, and contain alkyl amine side chains....

  15. Vulvar vaccinia infection after sexual contact with a smallpox vaccinee.

    Science.gov (United States)

    Muzny, Christina A; King, Heather; Byers, Paul; Currier, Mary; Nolan, Rathel; Mena, Leandro

    2009-04-01

    Vaccinia (smallpox) vaccine is an effective immunizing agent that brought about global eradication of naturally occurring smallpox, as declared by the World Health Organization in 1980. The United States ceased generalized smallpox vaccination in 1972 but reinstated it in 2002 for military personnel and selected healthcare workers (first responders who may be investigating possible cases of smallpox or caring for patients in selected hospitals) after the 2001 bioterrorism attacks. Since reinstitution of the vaccine, reports of transmission of vaccinia virus through contact with military smallpox vaccinees have been published, including four cases of female genital infection. We report a subsequent case of vulvar vaccinia infection acquired during sexual contact with a military vaccinee.

  16. Vaccinia virus, a promising new therapeutic agent for pancreatic cancer.

    Science.gov (United States)

    Al Yaghchi, Chadwan; Zhang, Zhongxian; Alusi, Ghassan; Lemoine, Nicholas R; Wang, Yaohe

    2015-01-01

    The poor prognosis of pancreatic cancer patients signifies a need for radically new therapeutic strategies. Tumor-targeted oncolytic viruses have emerged as attractive therapeutic candidates for cancer treatment due to their inherent ability to specifically target and lyse tumor cells as well as induce antitumor effects by multiple action mechanisms. Vaccinia virus has several inherent features that make it particularly suitable for use as an oncolytic agent. In this review, we will discuss the potential of vaccinia virus in the management of pancreatic cancer in light of our increased understanding of cellular and immunological mechanisms involved in the disease process as well as our extending knowledge in the biology of vaccinia virus.

  17. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice.

    Science.gov (United States)

    Andrew, M E

    1989-10-01

    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34.

  18. Vaccinia Virus Infections in a Martial Arts Gym

    Centers for Disease Control (CDC) Podcasts

    2011-04-04

    This podcast discusses an outbreak of vaccinia virus in Maryland in 2008. Christine Hughes, a health scientist with the Poxvirus and Rabies Branch at CDC, and co-author of a paper in the April 2011 issue of CDC's journal, discusses vaccinia virus infections in a martial arts gym.  Created: 4/4/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/5/2011.

  19. Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?

    DEFF Research Database (Denmark)

    Jespersen, Sanne; Hønge, Bo Langhoff; Medina, Candida

    Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?......Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?...

  20. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    Science.gov (United States)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  1. Zika-Virus-Related Photo Sharing on Pinterest and Instagram.

    Science.gov (United States)

    Fung, Isaac Chun-Hai; Blankenship, Elizabeth B; Goff, M Elizabeth; Mullican, Lindsay A; Chan, Kwun Cheung; Saroha, Nitin; Duke, Carmen H; Eremeeva, Marina E; Fu, King-Wa; Tse, Zion Tsz Ho

    2017-12-01

    Pinterest (San Francisco, CA) and Instagram (Menlo Park, CA) are 2 popular photo-sharing social media platforms among young individuals. We assessed differences between Instagram and Pinterest in relaying photographic information regarding Zika virus. Specifically, we investigated whether the percentage of Zika-virus-related photos with Spanish or Portuguese texts embedded therein was higher for Instagram than for Pinterest and whether the contents of Zika-virus-related photos shared on Pinterest were different from those shared on Instagram. We retrieved and manually coded 616 Pinterest (key words: "zika" AND "virus") and 616 Instagram (hashtag: #zikavirus) photos. Among the manually coded samples, 47% (290/616) of Pinterest photos and 23% (144/616) of Instagram photos were relevant to Zika virus. Words were embedded in 57% (164/290) of relevant Pinterest photos and all 144 relevant Instagram photos. Among the photos with embedded words, photos in Spanish or Portuguese were more prevalent on Instagram (77/144, 53%) than on Pinterest (14/164, 9%). There were more Zika-virus-related photos on Instagram than on Pinterest pertinent to Zika virus prevention (59/144, 41%, versus 41/290, 14%; PInstagram are similar platforms for Zika virus prevention communication. (Disaster Med Public Health Preparedness. 2017;11:656-659).

  2. Cryo-electron tomography of vaccinia virus

    Science.gov (United States)

    Cyrklaff, Marek; Risco, Cristina; Fernández, Jose Jesús; Jiménez, Maria Victoria; Estéban, Mariano; Baumeister, Wolfgang; Carrascosa, José L.

    2005-01-01

    The combination of cryo-microscopy and electron tomographic reconstruction has allowed us to determine the structure of one of the more complex viruses, intracellular mature vaccinia virus, at a resolution of 4–6 nm. The tomographic reconstruction allows us to dissect the different structural components of the viral particle, avoiding projection artifacts derived from previous microscopic observations. A surface-rendering representation revealed brick-shaped viral particles with slightly rounded edges and dimensions of ≈360 × 270 × 250 nm. The outer layer was consistent with a lipid membrane (5–6 nm thick), below which usually two lateral bodies were found, built up by a heterogeneous material without apparent ordering or repetitive features. The internal core presented an inner cavity with electron dense coils of presumptive DNA–protein complexes, together with areas of very low density. The core was surrounded by two layers comprising an overall thickness of ≈18–19 nm; the inner layer was consistent with a lipid membrane. The outer layer was discontinuous, formed by a periodic palisade built by the side interaction of T-shaped protein spikes that were anchored in the lower membrane and were arranged into small hexagonal crystallites. It was possible to detect a few pore-like structures that communicated the inner side of the core with the region outside the layer built by the T-shaped spike palisade. PMID:15699328

  3. Membrane remodelling during vaccinia virus morphogenesis.

    Science.gov (United States)

    Chichón, Francisco Javier; Rodríguez, María Josefa; Risco, Cristina; Fraile-Ramos, Alberto; Fernández, José Jesús; Esteban, Mariano; Carrascosa, José L

    2009-07-01

    VACV (vaccinia virus) is one of the most complex viruses, with a size exceeding 300 nm and more than 100 structural proteins. Its assembly involves sequential interactions and important rearrangements of its structural components. We have used electron tomography of sections of VACV-infected cells to follow, in three dimensions, the remodelling of the membrane components of the virus during envelope maturation. The tomograms obtained suggest that a number of independent 'crescents' interact with each other to enclose the volume of an incomplete ellipsoid in the viral factory area, attaining the overall shape and size characteristic of the first immature form of the virus [IV (immature virus)]. The incorporation of the DNA into these forms leads to particles with a nucleoid [IVN (IV with nucleoid)] that results in local disorganization of the envelope in regions near the condensed DNA. These particles suffer the progressive disappearance of the membrane outer spikes with a change in the shape of the membrane, becoming locally curled. The transformation of the IVN into the mature virus involves an extreme rearrangement of the particle envelope, which becomes fragmented and undulated. During this process, we also observed connections between the outer membranes with internal ones, suggesting that the latter originate from internalization of the IV envelope. The main features observed for VACV membrane maturation during morphogenesis resemble the breakdown and reassembly of cellular endomembranes.

  4. Incongruencies in Vaccinia Virus Phylogenetic Trees

    Directory of Open Access Journals (Sweden)

    Chad Smithson

    2014-10-01

    Full Text Available Over the years, as more complete poxvirus genomes have been sequenced, phylogenetic studies of these viruses have become more prevalent. In general, the results show similar relationships between the poxvirus species; however, some inconsistencies are notable. Previous analyses of the viral genomes contained within the vaccinia virus (VACV-Dryvax vaccine revealed that their phylogenetic relationships were sometimes clouded by low bootstrapping confidence. To analyze the VACV-Dryvax genomes in detail, a new tool-set was developed and integrated into the Base-By-Base bioinformatics software package. Analyses showed that fewer unique positions were present in each VACV-Dryvax genome than expected. A series of patterns, each containing several single nucleotide polymorphisms (SNPs were identified that were counter to the results of the phylogenetic analysis. The VACV genomes were found to contain short DNA sequence blocks that matched more distantly related clades. Additionally, similar non-conforming SNP patterns were observed in (1 the variola virus clade; (2 some cowpox clades; and (3 VACV-CVA, the direct ancestor of VACV-MVA. Thus, traces of past recombination events are common in the various orthopoxvirus clades, including those associated with smallpox and cowpox viruses.

  5. Absence of xenotropic murine leukaemia virus-related virus in UK patients with chronic fatigue syndrome

    Directory of Open Access Journals (Sweden)

    Breuer Judith

    2010-02-01

    Full Text Available Abstract Background Detection of a retrovirus, xenotropic murine leukaemia virus-related virus (XMRV, has recently been reported in 67% of patients with chronic fatigue syndrome. We have studied a total of 170 samples from chronic fatigue syndrome patients from two UK cohorts and 395 controls for evidence of XMRV infection by looking either for the presence of viral nucleic acids using quantitative PCR (limit of detection Results We have not identified XMRV DNA in any samples by PCR (0/299. Some serum samples showed XMRV neutralising activity (26/565 but only one of these positive sera came from a CFS patient. Most of the positive sera were also able to neutralise MLV particles pseudotyped with envelope proteins from other viruses, including vesicular stomatitis virus, indicating significant cross-reactivity in serological responses. Four positive samples were specific for XMRV. Conclusions No association between XMRV infection and CFS was observed in the samples tested, either by PCR or serological methodologies. The non-specific neutralisation observed in multiple serum samples suggests that it is unlikely that these responses were elicited by XMRV and highlights the danger of over-estimating XMRV frequency based on serological assays. In spite of this, we believe that the detection of neutralising activity that did not inhibit VSV-G pseudotyped MLV in at least four human serum samples indicates that XMRV infection may occur in the general population, although with currently uncertain outcomes.

  6. Enteric Immunization of Mice Against Influenza with Recombinant Vaccinia

    Science.gov (United States)

    Meitin, Catherine A.; Bender, Bradley S.; Small, Parker A., Jr.

    1994-11-01

    Intrajejunal administration to mice of a recombinant vaccinia virus containing the influenza virus hemagglutinin gene induced IgA antibody in nasal, gut, and vaginal secretions. It also induced IgG antibody in serum and cell-mediated immunity. The immunization provided significant protection against an influenza virus challenge. This work suggests that enteric-coated recombinant vaccinia could be an orally administered, inexpensive, multivalent, temperature-stable, safe, and effective vaccine for children that could be particularly useful in developing nations, where multiple injections are not easily administered. Oral administration of vaccines should also reduce children's fear of shots at the doctor's office.

  7. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  8. Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001

    Science.gov (United States)

    Lederman, Edith R.; Davidson, Whitni; Groff, Harold L.; Smith, Scott K.; Warkentien, Tyler; Li, Yu; Wilkins, Kimberly A.; Karem, Kevin L.; Akondy, Rama S.; Ahmed, Rafi; Frace, Michael; Shieh, Wun-Ju; Zaki, Sherif; Hruby, Dennis E.; Painter, Wendy P.; Bergman, Kimberly L.; Cohen, Jeffrey I.; Damon, Inger K.

    2012-01-01

    Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV. PMID:22904336

  9. Vaccinia virus as a subhelper for AAV replication and packaging

    Directory of Open Access Journals (Sweden)

    Andrea R Moore

    Full Text Available Adeno-associated virus (AAV has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  10. Vaccinia virus encodes a polypeptide with DNA ligase activity.

    Science.gov (United States)

    Kerr, S M; Smith, G L

    1989-11-25

    Vaccinia virus gene SalF 15R potentially encodes a polypeptide of 63 kD which shares 30% amino acid identity with S. pombe and S. cerevisiae DNA ligases. DNA ligase proteins can be identified by incubation with alpha-(32P)ATP, resulting in the formation of a covalent DNA ligase-AMP adduct, an intermediate in the enzyme reaction. A novel radio-labelled polypeptide of approximately 61 kD appears in extracts from vaccinia virus infected cells after incubation with alpha-(32P)ATP. This protein is present throughout infection and is a DNA ligase as the radioactivity is discharged in the presence of either DNA substrate or pyrophosphate. DNA ligase assays show an increase in enzyme activity in cell extracts after vaccinia virus infection. A rabbit antiserum, raised against a bacterial fusion protein of beta-galactosidase and a portion of SalF 15R, immune-precipitates polypeptides of 61 and 54 kD from extracts of vaccinia virus-infected cells. This antiserum also immune-precipitates the novel DNA ligase-AMP adduct, thus proving that the observed DNA ligase is encoded by SalF 15R.

  11. Vaccinia virus as a subhelper for AAV replication and packaging.

    Science.gov (United States)

    Moore, Andrea R; Dong, Biao; Chen, Lingxia; Xiao, Weidong

    2015-01-01

    Adeno-associated virus (AAV) has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV) has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  12. Nucleic Acid-Based Nanoconstructs

    Science.gov (United States)

    Focuses on the design, synthesis, characterization, and development of spherical nucleic acid constructs as effective nanotherapeutic, single-entity agents for the treatment of glioblastoma multiforme and prostate cancers.

  13. Cytoplasmic ATR Activation Promotes Vaccinia Virus Genome Replication

    Directory of Open Access Journals (Sweden)

    Antonio Postigo

    2017-05-01

    Full Text Available In contrast to most DNA viruses, poxviruses replicate their genomes in the cytoplasm without host involvement. We find that vaccinia virus induces cytoplasmic activation of ATR early during infection, before genome uncoating, which is unexpected because ATR plays a fundamental nuclear role in maintaining host genome integrity. ATR, RPA, INTS7, and Chk1 are recruited to cytoplasmic DNA viral factories, suggesting canonical ATR pathway activation. Consistent with this, pharmacological and RNAi-mediated inhibition of canonical ATR signaling suppresses genome replication. RPA and the sliding clamp PCNA interact with the viral polymerase E9 and are required for DNA replication. Moreover, the ATR activator TOPBP1 promotes genome replication and associates with the viral replisome component H5. Our study suggests that, in contrast to long-held beliefs, vaccinia recruits conserved components of the eukaryote DNA replication and repair machinery to amplify its genome in the host cytoplasm.

  14. Experimental and natural weed host-virus relations.

    Science.gov (United States)

    Kazinczi, G; Horváth, J; Takács, A P; Gáborjányi, R; Béres, I

    2004-01-01

    Weeds, as alternative hosts of plant viruses and nutrient plants of virus vectors play important role in virus ecology and epidemiology. The aim of our study was to discover new weed-virus relations. Therefore some weed species were mechanically inoculated with 28 viruses (strains or isolates) maintained in our glasshouse. Different weed species with and without visible symptoms were collected from agro-, water ecosystems and wastelands of Hungary between 1997 and 2003. Virus infections were evaluated by biotests, DAS ELISA serological methods, electronmicroscopy and immunosorbent electronmicroscopy (ISEM). Under glasshouse conditions Ambrosia artemisifolia was considered as a virophob species, showing resistance to all viruses listed above. A series of new artificial (Chenopodium album--SoMV (LH+SH)*, AMV (LH+SH); C. berlandieri--PVY(NTN) (LH), AMV (LH+SH), CMV (LH), SoMV (LH+SH), ObPV (LH+SH), ZYMV-10 (LH): C. ugandae--ObPV (LH), SoMV (L); C. glaucum--ObPV (LH), SoMV (L); Echinocystis lobata--PVX (L), ZYMV (LH+SH); Solanum nigrum--MYFV (LH+SH), PVY(N) (L), PVY(NTN) (LH+SH), SoMV (LH), TMV (SH), CMV (SH); S. dulcamara--CMV-U/246 (SH), PVY(NTN) (LH), SoMV-H (L), TMV-O (L); S. luteum--PVY(N) (SH), PVY(NTN) (LH+L), TMV(SH).) and natural (Asclepias syriaca--TMV, AMV, TSWV; Alisma plantago-aquatica--PVY, SoMV; Ambrosia artemisiifolia--CMV; Chenopodium album--CMV, PVS, PLRV; C. hybridum--CMV; Cirsium canum--CMV, PVM; Carex vulpina--CMV; Comium maculatum--PVY; Datura stramonium--PVA, PVX, PVS, PVM, CMV, TMV; Lysimachia vulgaris--ArMV, BNYVV, CMV, TMV; Lythrum salicaria--ArMV; Malva neglecta--CMV; Mercurialis annua--SoMV; Solanum nigrum--CMV, PVY, PVY(N); Solidago gigantea--CMV, RpRSV, BNYVV; Stenactis annua--PVM, PVA) weed--virus relations were detected. The epidemiological role of perennial hosts (A. syriaca, A. planlago aquatica, C. canurm, L. vulgaris, L. salicaria, S. gigantea) is especially high, because they can serve as infection sources as well as overwintering

  15. Frequency of adverse events after vaccination with different vaccinia strains.

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2006-08-01

    Full Text Available BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of vaccination-related adverse events, compared to the risk of contracting an infection. Although considerable effort has been made to understand the dynamics of smallpox transmission in modern societies, little attention has been paid to estimating the frequency of adverse events due to smallpox vaccination. Studies exploring the consequences of smallpox vaccination strategies have commonly used a frequency of approximately one death per million vaccinations, which is based on a study of vaccination with the New York City Board of Health (NYCBH strain of vaccinia virus. However, a multitude of historical studies of smallpox vaccination with other vaccinia strains suggest that there are strain-related differences in the frequency of adverse events after vaccination. Because many countries have stockpiled vaccine based on the Lister strain of vaccinia virus, a quantitative evaluation of the adverse effects of such vaccines is essential for emergency response planning. We conducted a systematic review and statistical analysis of historical data concerning vaccination against smallpox with different strains of vaccinia virus. METHODS AND FINDINGS: We analyzed historical vaccination data extracted from the literature. We extracted data on the frequency of postvaccinal encephalitis and death with respect to vaccinia strain and age of vaccinees. Using a hierarchical Bayesian approach for meta-analysis, we estimated the expected frequencies of postvaccinal encephalitis and death with respect to age at vaccination for smallpox vaccines based on the NYCBH and Lister vaccinia strains. We found large heterogeneity between findings from different studies and a time-period effect

  16. Nucleic acid based molecular devices.

    Science.gov (United States)

    Krishnan, Yamuna; Simmel, Friedrich C

    2011-03-28

    In biology, nucleic acids are carriers of molecular information: DNA's base sequence stores and imparts genetic instructions, while RNA's sequence plays the role of a messenger and a regulator of gene expression. As biopolymers, nucleic acids also have exciting physicochemical properties, which can be rationally influenced by the base sequence in myriad ways. Consequently, in recent years nucleic acids have also become important building blocks for bottom-up nanotechnology: as molecules for the self-assembly of molecular nanostructures and also as a material for building machinelike nanodevices. In this Review we will cover the most important developments in this growing field of nucleic acid nanodevices. We also provide an overview of the biochemical and biophysical background of this field and the major "historical" influences that shaped its development. Particular emphasis is laid on DNA molecular motors, molecular robotics, molecular information processing, and applications of nucleic acid nanodevices in biology. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Modified vaccinia virus Ankara protects macaques against respiratory challenge with monkeypox virus.

    NARCIS (Netherlands)

    K.J. Stittelaar (Koert); G. van Amerongen (Geert); I. Kondova (Ivanela); R.F. van Lavieren (Rob); F.H. Pistoor (Frank); H.G.M. Niesters (Bert); G.J.J. van Doornum (Gerard); B.A.M. van der Zeijst (Ben); L. Mateo (Luis); P.J. Chaplin (Paul); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2005-01-01

    textabstractThe use of classical smallpox vaccines based on vaccinia virus (VV) is associated with severe complications in both naive and immune individuals. Modified vaccinia virus Ankara (MVA), a highly attenuated replication-deficient strain of VV, has been proven to be safe in humans and

  18. In vitro recognition of an orf virus early promoter in a vaccinia virus extract

    NARCIS (Netherlands)

    Vos, J C; Mercer, R. A.; Fleming, S B; Robinson, A J

    1992-01-01

    DNA fragments containing varying lengths of the 5' end of an orf virus early gene (ORF3) and its associated promoter were introduced into sodium deoxycholate-solubilized vaccinia virus extracts capable of initiating transcription in vitro from vaccinia virus early promoters. After separation of the

  19. Analysis of variola and vaccinia virus neutralization assays for smallpox vaccines.

    Science.gov (United States)

    Hughes, Christine M; Newman, Frances K; Davidson, Whitni B; Olson, Victoria A; Smith, Scott K; Holman, Robert C; Yan, Lihan; Frey, Sharon E; Belshe, Robert B; Karem, Kevin L; Damon, Inger K

    2012-07-01

    Possible smallpox reemergence drives research for third-generation vaccines that effectively neutralize variola virus. A comparison of neutralization assays using different substrates, variola and vaccinia (Dryvax and modified vaccinia Ankara [MVA]), showed significantly different 90% neutralization titers; Dryvax underestimated while MVA overestimated variola neutralization. Third-generation vaccines may rely upon neutralization as a correlate of protection.

  20. In silico-accelerated identification of conserved and immunogenic variola/vaccinia T-cell epitopes

    DEFF Research Database (Denmark)

    Moise, Leonard; McMurry, Julie A; Buus, Søren

    2009-01-01

    Epitopes shared by the vaccinia and variola viruses underlie the protective effect of vaccinia immunization against variola infection. We set out to identify a subset of cross-reactive epitopes using bioinformatics and immunological methods. Putative T-cell epitopes were computationally predicted...

  1. [Circulating nucleic acids and infertility].

    Science.gov (United States)

    Scalici, E; Mullet, T; Ferrières Hoa, A; Gala, A; Loup, V; Anahory, T; Belloc, S; Hamamah, S

    2015-09-01

    Circulating nucleic acids (cell-free DNA and microRNAs) have for particularity to be easily detectable in the biological fluids of the body. Therefore, they constitute biomarkers of interest in female and male infertility care. Indeed, in female, they can be used to detect ovarian reserve disorders (polycystic ovary syndrome and low functional ovarian reserve) as well as to assess follicular microenvironment quality. Moreover, in men, their expression levels can vary in case of spermatogenesis abnormalities. Finally, circulating nucleic acids have also the ability to predict successfully the quality of in vitro embryo development. Their multiple contributions during assisted reproductive technology (ART) make of them biomarkers of interest, for the development of new diagnostic and/or prognostic tests, applied to our specialty. Circulating nucleic acids would so offer the possibility of personalized medical care for infertile couples in ART. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. Exosomes as nucleic acid nanocarriers.

    Science.gov (United States)

    van den Boorn, Jasper G; Dassler, Juliane; Coch, Christoph; Schlee, Martin; Hartmann, Gunther

    2013-03-01

    Exosomes are nano-sized vesicles produced naturally by many cell types. They are specifically loaded with nucleic acid cargo, dependent on the exosome-producing cell and its homeostatic state. As natural intercellular shuttles of miRNA, exosomes influence an array of developmental, physiological and pathological processes in the recipient cell or tissue to which they can be selectively targeted by their tetraspanin surface-domains. By a review of current research, we illustrate here why exosomes are ideal nanocarriers for use in the targeted in vivo delivery of nucleic acids. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Molecular Structure of Nucleic Acids

    Indian Academy of Sciences (India)

    A structure for nucleic acid has already been proposed by Pauling and Corey [1]. They kindly made'their manuscript available to us in advance of publication. Their model consists of three inter-twined chains, with the phosphates near the fibre axis, and the bases on the outside. In our opinion, this structure is unsatisfactory ...

  4. Histidine-Containing Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2000-01-01

    Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics.......Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics....

  5. Protein Primary Structure of the Vaccinia Virion at Increased Resolution

    Science.gov (United States)

    Ngo, Tuan; Mirzakhanyan, Yeva; Moussatche, Nissin; Gershon, Paul David

    2016-11-01

    Here we examine the protein covalent structure of the vaccinia virus virion. Within two virion preparations, >88% of the theoretical vaccinia virus-encoded proteome was detected with high confidence, including the first detection of products from 27 open reading frames (ORFs) previously designated "predicted," "uncharacterized," "inferred," or "hypothetical" polypeptides containing as few as 39 amino acids (aa) and six proteins whose detection required nontryptic proteolysis. We also detected the expression of four short ORFs, each of which was located within an ORF ("ORF-within-ORF"), including one not previously recognized or known to be expressed. Using quantitative mass spectrometry (MS), between 58 and 74 proteins were determined to be packaged. A total of 63 host proteins were also identified as candidates for packaging. Evidence is provided that some portion of virion proteins are "nicked" via a combination of endoproteolysis and concerted exoproteolysis in a manner, and at sites, independent of virus origin or laboratory procedures. The size of the characterized virion phosphoproteome was doubled from 189 (J. Matson, W. Chou, T. Ngo, and P. D. Gershon, Virology 452-453:310-323, 2014, doi:http://dx.doi.org/10.1016/j.virol.2014.01.012) to 396 confident, unique phosphorylation sites, 268 of which were within the packaged proteome. This included the unambiguous identification of phosphorylation "hot spots" within virion proteins. Using isotopically enriched ATP, 23 sites of intravirion kinase phosphorylation were detected within nine virion proteins, all at sites already partially occupied within the virion preparations. The clear phosphorylation of proteins RAP94 and RP19 was consistent with the roles of these proteins in intravirion early gene transcription. In a blind search for protein modifications, cysteine glutathionylation and O-linked glycosylation featured prominently. We provide evidence for the phosphoglycosylation of vaccinia virus proteins

  6. Isolation and characterization of cidofovir resistant vaccinia viruses

    Directory of Open Access Journals (Sweden)

    Prichard Mark N

    2008-05-01

    Full Text Available Abstract Background The emergence of drug resistant viruses, together with the possibility of increased virulence, is an important concern in the development of new antiviral compounds. Cidofovir (CDV is a phosphonate nucleotide that is approved for use against cytomegalovirus retinitis and for the emergency treatment of smallpox or complications following vaccination. One mode of action for CDV has been demonstrated to be the inhibition of the viral DNA polymerase. Results We have isolated several CDV resistant (CDVR vaccinia viruses through a one step process, two of which have unique single mutations within the DNA polymerase. An additional resistant virus isolate provides evidence of a second site mutation within the genome involved in CDV resistance. The CDVR viruses were 3–7 fold more resistant to the drug than the parental viruses. The virulence of the CDVR viruses was tested in mice inoculated intranasally and all were found to be attenuated. Conclusion Resistance to CDV in vaccinia virus can be conferred individually by at least two different mutations within the DNA polymerase gene. Additional genes may be involved. This one step approach for isolating resistant viruses without serial passage and in the presence of low doses of drug minimizes unintended secondary mutations and is applicable to other potential antiviral agents.

  7. Higher Order Structure and Binding of Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    Peptide nucleic acids and analogues of peptide nucleic acids are used to form duplex, triplex, and other structures with nucleic acids and to modify nucleic acids. The peptide nucleic acids and analogues thereof also are used to modulate protein activity through, for example, transcription arrest......, transcription initiation, and site specific cleavage of nucleic acids....

  8. The mechanisms of genetically modified vaccinia viruses for the treatment of cancer.

    Science.gov (United States)

    Jefferson, Artrish; Cadet, Valerie E; Hielscher, Abigail

    2015-09-01

    The use of oncolytic viruses for the treatment of cancer is an emerging field of cancer research and therapy. Oncolytic viruses are designed to induce tumor specific immunity while replicating selectively within cancer cells to cause lysis of the tumor cells. While there are several forms of oncolytic viruses, the use of vaccinia viruses for oncolysis may be more beneficial than other forms of oncolytic viruses. For example, vaccinia viruses have been shown to exert their anti-tumor effects through genetic engineering strategies which enhance their therapeutic efficacy. This paper will address some of the most common forms of genetically modified vaccinia viruses and will explore the mechanisms whereby they selectively target, enter and destroy cancer cells. Furthermore, this review will highlight how vaccinia viruses activate host immune responses against cancer cells and will address clinical trials evaluating the tumor-directed and killing efficacy of these viruses against solid tumors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins

    Directory of Open Access Journals (Sweden)

    Vemulapalli Srilakshmi

    2006-03-01

    Full Text Available Abstract Background Although many vaccinia virus proteins have been identified and studied in detail, only a few studies have attempted a comprehensive survey of the protein composition of the vaccinia virion. These projects have identified the major proteins of the vaccinia virion, but little has been accomplished to identify the unknown or less abundant proteins. Obtaining a detailed knowledge of the viral proteome of vaccinia virus will be important for advancing our understanding of orthopoxvirus biology, and should facilitate the development of effective antiviral drugs and formulation of vaccines. Results In order to accomplish this task, purified vaccinia virions were fractionated into a soluble protein enriched fraction (membrane proteins and lateral bodies and an insoluble protein enriched fraction (virion cores. Each of these fractions was subjected to further fractionation by either sodium dodecyl sulfate-polyacrylamide gel electophoresis, or by reverse phase high performance liquid chromatography. The soluble and insoluble fractions were also analyzed directly with no further separation. The samples were prepared for mass spectrometry analysis by digestion with trypsin. Tryptic digests were analyzed by using either a matrix assisted laser desorption ionization time of flight tandem mass spectrometer, a quadrupole ion trap mass spectrometer, or a quadrupole-time of flight mass spectrometer (the latter two instruments were equipped with electrospray ionization sources. Proteins were identified by searching uninterpreted tandem mass spectra against a vaccinia virus protein database created by our lab and a non-redundant protein database. Conclusion Sixty three vaccinia proteins were identified in the virion particle. The total number of peptides found for each protein ranged from 1 to 62, and the sequence coverage of the proteins ranged from 8.2% to 94.9%. Interestingly, two vaccinia open reading frames were confirmed as being expressed

  10. Vaccinia scars associated with better survival for adults. An observational study from Guinea-Bissau

    DEFF Research Database (Denmark)

    Aaby, Peter; Gustafson, Per; Roth, Adam Anders Edvin

    2006-01-01

    Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality.......Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality....

  11. Human CD4+ T cell epitopes from vaccinia virus induced by vaccination or infection.

    Directory of Open Access Journals (Sweden)

    J Mauricio Calvo-Calle

    2007-10-01

    Full Text Available Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4(+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4(+ T cell responses have been poorly characterized, and CD4(+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens.

  12. Human CD4+ T Cell Epitopes from Vaccinia Virus Induced by Vaccination or Infection

    Science.gov (United States)

    Calvo-Calle, J. Mauricio; Strug, Iwona; Nastke, Maria-Dorothea; Baker, Stephen P; Stern, Lawrence J

    2007-01-01

    Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4+ T cell responses have been poorly characterized, and CD4+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens. PMID:17937498

  13. Low-resolution structure of vaccinia virus DNA replication machinery.

    Science.gov (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas

    2013-02-01

    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  14. Self-assembling multimeric nucleic acid constructs

    Science.gov (United States)

    Cantor, C.R.; Niemeyer, C.M.; Smith, C.L.; Sano, Takeshi; Hnatowich, D.J.; Rusckowski, M.

    1996-10-01

    The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products. 5 figs.

  15. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

    National Research Council Canada - National Science Library

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures...

  16. Protection of Mice from Lethal Vaccinia Virus Infection by Vaccinia Virus Protein Subunits with a CpG Adjuvant

    Directory of Open Access Journals (Sweden)

    Sarah Reeman

    2017-12-01

    Full Text Available Smallpox vaccination carries a high risk of adverse events in recipients with a variety of contra-indications for live vaccines. Although alternative non-replicating vaccines have been described in the form of replication-deficient vaccine viruses, DNA vaccines, and subunit vaccines, these are less efficacious than replicating vaccines in animal models. DNA and subunit vaccines in particular have not been shown to give equivalent protection to the traditional replicating smallpox vaccine. We show here that combinations of the orthopoxvirus A27, A33, B5 and L1 proteins give differing levels of protection when administered in different combinations with different adjuvants. In particular, the combination of B5 and A27 proteins adjuvanted with CpG oligodeoxynucleotides (ODN gives a level of protection in mice that is equivalent to the Lister traditional vaccine in a lethal vaccinia virus challenge model.

  17. Reactions of Cre with methylphosphonate DNA: similarities and contrasts with Flp and vaccinia topoisomerase.

    Directory of Open Access Journals (Sweden)

    Chien-Hui Ma

    2009-09-01

    Full Text Available Reactions of vaccinia topoisomerase and the tyrosine site-specific recombinase Flp with methylphosphonate (MeP substituted DNA substrates, have provided important insights into the electrostatic features of the strand cleavage and strand joining steps catalyzed by them. A conserved arginine residue in the catalytic pentad, Arg-223 in topoisomerase and Arg-308 in Flp, is not essential for stabilizing the MeP transition state. Topoisomerase or its R223A variant promotes cleavage of the MeP bond by the active site nucleophile Tyr-274, followed by the rapid hydrolysis of the MeP-tyrosyl intermediate. Flp(R308A, but not wild type Flp, mediates direct hydrolysis of the activated MeP bond. These findings are consistent with a potential role for phosphate electrostatics and active site electrostatics in protecting DNA relaxation and site-specific recombination, respectively, against abortive hydrolysis.We have examined the effects of DNA containing MeP substitution in the Flp related Cre recombination system. Neutralizing the negative charge at the scissile position does not render the tyrosyl intermediate formed by Cre susceptible to rapid hydrolysis. Furthermore, combining the active site R292A mutation in Cre (equivalent to the R223A and R308A mutations in topoisomerase and Flp, respectively with MeP substitution does not lead to direct hydrolysis of the scissile MeP bond in DNA. Whereas Cre follows the topoisomerase paradigm during the strand cleavage step, it follows the Flp paradigm during the strand joining step.Collectively, the Cre, Flp and topoisomerase results highlight the contribution of conserved electrostatic complementarity between substrate and active site towards transition state stabilization during site-specific recombination and DNA relaxation. They have potential implications for how transesterification reactions in nucleic acids are protected against undesirable abortive side reactions. Such protective mechanisms are significant

  18. Uses of Nucleic Acid Analogues in the Inhibition of Nucleic Acid Amplification

    DEFF Research Database (Denmark)

    1999-01-01

    The present invention relates to the use of nucleic acid analogues in blocking nucleic acid ampli?cation procedures and to diagnostic and analytical techniques based thereon. Also included are kits for use in the conduct of nucleic acid ampli?cation reactions....

  19. Synthetic Procedures for Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  20. Double-Stranded Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2001-01-01

    A novel class of compounds, known as peptide nucleic acids, form double-stranded structures with one another and with ssDNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  1. The Nucleic Acid Database: Present and Future

    OpenAIRE

    Berman, Helen M.; Gelbin, Anke; Clowney, Lester; Hsieh, Shu-Hsin; Zardecki, Christine; Westbrook, John

    1996-01-01

    The Nucleic Acid Database is a relational database containing information about three-dimensional nucleic acid structures. The methods used for data processing, structure validation, database management and information retrieval, as well as the various services available via the World Wide Web, are described. Plans for the future include greater reliance on the Macromolecular Crystallographic Information File for both data processing and data management.

  2. An introduction to peptide nucleic acid

    DEFF Research Database (Denmark)

    Nielsen, P E; Egholm, M

    1999-01-01

    Peptide Nucleic Acid (PNA) is a powerful new biomolecular tool with a wide range of important applications. PNA mimics the behaviour of DNA and binds complementary nucleic acid strands. The unique chemical, physical and biological properties of PNA have been exploited to produce powerful biomolec...

  3. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...... for pharmacological intervention with pathophysiological functions of proteases. Aptamers can be selected so that they bind their targets highly specifically and with affinities corresponding to K(D) values in the nM range. Aptamers can be selected so that they recognize their targets conformation...

  4. Methods for Identifying Ligands that Target Nucleic Acid Molecules and Nucleic Acid Structural Motifs

    Science.gov (United States)

    Disney, Matthew D. (Inventor); Childs-Disney, Jessica L. (Inventor)

    2017-01-01

    Disclosed are methods for identifying a nucleic acid (e.g., RNA, DNA, etc.) motif which interacts with a ligand. The method includes providing a plurality of ligands immobilized on a support, wherein each particular ligand is immobilized at a discrete location on the support; contacting the plurality of immobilized ligands with a nucleic acid motif library under conditions effective for one or more members of the nucleic acid motif library to bind with the immobilized ligands; and identifying members of the nucleic acid motif library that are bound to a particular immobilized ligand. Also disclosed are methods for selecting, from a plurality of candidate ligands, one or more ligands that have increased likelihood of binding to a nucleic acid molecule comprising a particular nucleic acid motif, as well as methods for identifying a nucleic acid which interacts with a ligand.

  5. Protective effect of Toll-like receptor 4 in pulmonary vaccinia infection.

    Directory of Open Access Journals (Sweden)

    Martha A Hutchens

    2008-09-01

    Full Text Available Innate immune responses are essential for controlling poxvirus infection. The threat of a bioterrorist attack using Variola major, the smallpox virus, or zoonotic transmission of other poxviruses has renewed interest in understanding interactions between these viruses and their hosts. We recently determined that TLR3 regulates a detrimental innate immune response that enhances replication, morbidity, and mortality in mice in response to vaccinia virus, a model pathogen for studies of poxviruses. To further investigate Toll-like receptor signaling in vaccinia infection, we first focused on TRIF, the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more susceptible to vaccinia infection than wild-type mice. We then focused on TLR4, the other Toll-like receptor that signals through TRIF. Following respiratory infection with vaccinia, mice lacking TLR4 signaling had greater viral replication, hypothermia, and mortality than control animals. The mechanism of TLR4-mediated protection was not due to increased release of proinflammatory cytokines or changes in total numbers of immune cells recruited to the lung. Challenge of primary bone marrow macrophages isolated from TLR4 mutant and control mice suggested that TLR4 recognizes a viral ligand rather than an endogenous ligand. These data establish that TLR4 mediates a protective innate immune response against vaccinia virus, which informs development of new vaccines and therapeutic agents targeted against poxviruses.

  6. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)

    2014-11-07

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  7. Assembly of vaccinia virus: Role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks

    NARCIS (Netherlands)

    Sodeik, B.; Doms, R.W.; Ericsson, M.; Hiller, G.; Machamer, C.E.; van 't Hof, W.J.; van Meer, G.|info:eu-repo/dai/nl/068570368; Moss, B.; Griffiths, G.

    1993-01-01

    Vaccinia virus, the prototype of the Poxviridae, is a large DNA virus which replicates in the cytoplasm of the host cell. The assembly pathway of vaccinia virus displays several unique features, such as the production of two structurally distinct, infectious forms. One of these, termed intracellular

  8. The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop

    NARCIS (Netherlands)

    J.P. Stoye (Jonathan); R.H. Silverman (Robert); C.A.B. Boucher (Charles); S.F.J. Le Grice

    2010-01-01

    textabstractThe 1stInternational Workshop on Xenotropic Murine Leukemia Virus-Related Retrovirus (XMRV), co-sponsored by the National Institutes of Health, The Department of Health and Human Services and Abbott Diagnostics, was convened on September 7/8, 2010 on the NIH campus, Bethesda, MD.

  9. Mopeia Virus-related Arenavirus in Natal Multimammate Mice, Morogoro, Tanzania

    DEFF Research Database (Denmark)

    Günther, Stephan; Hoofd, Guy; Charrel, Remi

    2009-01-01

    A serosurvey involving 2,520 small mammals from Tanzania identified a hot spot of arenavirus circulation in Morogoro. Molecular screening detected a new arenavirus in Natal multimammate mice (Mastomys natalensis), Morogoro virus, related to Mopeia virus. Only a small percentage of mice carry Moro...

  10. In a nutshell: structure and assembly of the vaccinia virion.

    Science.gov (United States)

    Condit, Richard C; Moussatche, Nissin; Traktman, Paula

    2006-01-01

    Poxviruses comprise a large family of viruses characterized by a large, linear dsDNA genome, a cytoplasmic site of replication and a complex virion morphology. The most notorious member of the poxvirus family is variola, the causative agent of smallpox. The laboratory prototype virus used for the study of poxviruses is vaccinia, the virus that was used as a live, naturally attenuated vaccine for the eradication of smallpox. Both the morphogenesis and structure of poxvirus virions are unique among viruses. Poxvirus virions apparently lack any of the symmetry features common to other viruses such as helical or icosahedral capsids or nucleocapsids. Instead poxvirus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a walled, biconcave core flanked by "lateral bodies." The virion assembly pathway involves a remarkable fabrication of membrane-containing crescents and immature virions, which evolve into mature virions in a process that is unparalleled in virology. As a result of significant advances in poxvirus genetics and molecular biology during the past 15 years, we can now positively identify over 70 specific gene products contained in poxvirus virions, and we can describe the effects of mutations in over 50 specific genes on poxvirus assembly. This review summarizes these advances and attempts to assemble them into a comprehensible and thoughtful picture of poxvirus structure and assembly.

  11. An ultrasensitive photoelectrochemical nucleic acid biosensor

    Science.gov (United States)

    Gao, Zhiqiang; Tansil, Natalia C.

    2005-01-01

    A simple and ultrasensitive procedure for non-labeling detection of nucleic acids is described in this study. It is based on the photoelectrochemical detection of target nucleic acids by forming a nucleic acid/photoreporter adduct layer on an ITO electrode. The target nucleic acids were hybridized with immobilized oligonucleotide capture probes on the ITO electrode. A subsequent binding of a photoreporter—a photoactive threading bis-intercalator consisting of two N,N′-bis(3-propyl-imidazole)-1,4,5,8-naphthalene diimides (PIND) linked by a Ru(bpy)22+ (bpy = 2,2′-bipyridine) complex (PIND–Ru–PIND)—allowed for photoelectrochemical detection of the target nucleic acids. The extremely low dissociation rate of the adduct and the highly reversible photoelectrochemical response under visible light illumination (490 nm) make it possible to conduct nucleic acid detection, with a sensitivity enhancement of four orders of magnitude over voltammetry. These results demonstrate for the first time the potential of photoelectrochemical biosensors for PCR-free ultrasensitive detection of nucleic acids. PMID:16061935

  12. Doxycycline Inducible Melanogenic Vaccinia Virus as Theranostic Anti-Cancer Agent.

    Science.gov (United States)

    Kirscher, Lorenz; Deán-Ben, Xosé Luis; Scadeng, Miriam; Zaremba, Angelika; Zhang, Qian; Kober, Christina; Fehm, Thomas Felix; Razansky, Daniel; Ntziachristos, Vasilis; Stritzker, Jochen; Szalay, Aladar A

    2015-01-01

    We reported earlier the diagnostic potential of a melanogenic vaccinia virus based system in magnetic resonance (MRI) and optoacoustic deep tissue imaging (MSOT). Since melanin overproduction lead to attenuated virus replication, we constructed a novel recombinant vaccinia virus strain (rVACV), GLV-1h462, which expressed the key enzyme of melanogenesis (tyrosinase) under the control of an inducible promoter-system. In this study melanin production was detected after exogenous addition of doxycycline in two different tumor xenograft mouse models. Furthermore, it was confirmed that this novel vaccinia virus strain still facilitated signal enhancement as detected by MRI and optoacoustic tomography. At the same time we demonstrated an enhanced oncolytic potential compared to the constitutively melanin synthesizing rVACV system.

  13. Horizontal study of vaccinia virus infections in an endemic area: epidemiologic, phylogenetic and economic aspects.

    Science.gov (United States)

    Assis, Felipe L; Franco-Luiz, Ana Paula M; Paim, Luis M; Oliveira, Graziele P; Pereira, Alexandre F; de Almeida, Gabriel M F; Figueiredo, Leandra B; Tanus, Adriano; Trindade, Giliane S; Ferreira, Paulo P; Kroon, Erna G; Abrahão, Jônatas S

    2015-11-01

    Vaccinia virus (VACV), the etiological agent of bovine vaccinia (BV), is widespread in Brazil and present in most of the milk-producing regions. We conducted a horizontal study of BV in Bahia, a state of Brazil in which the production of milk is increasing. During 2011, human and bovine clinical samples were collected during outbreaks for BV diagnosis, virus isolation and molecular analysis. We collected data for epidemiological inferences. Vaccinia virus was detected in 87.7% of the analyzed outbreaks, highlighting the effective circulation of VACV in Bahia. The molecular data showed the spreading of group 1 Brazilian VACV to Bahia. We observed a seasonal profile of BV, with its peak in the drier and cooler season. Manual milking was observed in 96 % of the visited properties, showing its importance to viral spread in herds. Under-notification of BV, ineffective animal trade surveillance, and bad milking practices have contributed to the spread of VACV in Brazil.

  14. Nucleic acid diagnostic approaches in parasitology.

    Science.gov (United States)

    Kerttula, Anne-Marie; Lavikainen, Antti

    Nucleic acid diagnostic technologies are partly replacing traditional microscopy and antigen detection methods in parasitological diagnostics. In particular, the diagnostics of parasitic diarrhea is undergoing a transformation due to the application of polymerase chain reaction (PCR) tests. Diagnostics of malaria is still based on microscopy, but rapid nucleic acid tests are emerging. Laboratories of clinical microbiology in Finland currently provide PCR tests e.g. for intestinal protozoa, Toxoplasma and Trichomonas. Nucleic acid diagnostic methods are superior in specificity and sensitivity, but may give false positive results after a treated infection.

  15. Chip-based sequencing nucleic acids

    Science.gov (United States)

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  16. INTERFERENCE INDUCED AGAINST VACCINIA IN AN ADENOVIRUS-RHF-1 SYSTEM.

    Science.gov (United States)

    KHOOBYARIAN, N

    1964-01-01

    Khoobyarian, Newton (University of Illinois, Chicago). Interference induced against vaccinia in an adenovirus-RHF-1 system. J. Bacteriol. 87:24-32. 1964.-It was observed that a continuous line of rabbit heart cell culture (strain RHF-1), when overlaid with growth medium after infection of cultures with adenovirus types 2, 3, 4, and 7, would develop resistance to vaccinia plaque formation. Data are presented to provide some information on the nature of such resistance observed specifically in an adenovirus 2-RHF-1 system. An analysis of this phenomenon indicated the following. (i) At least 6 hr were required before the start of vaccinia inhibition, and 15 to 18 hr were necessary for the maximal occurrence of inhibition; the degree of interference established varied with the concentration of adenovirus. (ii) The site of interference action was inside rather than outside the cells, since hardly any difference could be shown in the rate of vaccinia adsorption on resistant and susceptible cells. (iii) The interaction of adenovirus with RHF-1 cells not only would inhibit cell infection with vaccinia but would also suppress the 24- to 48-hr yield of virus. (iv) When RHF-1 cells were overlaid with maintenance medium after their infection with a low multiplicity of RHF-1 passaged adenovirus 2 (to establish sublethal infection), an inhibitory substance of varied activity could be detected daily over a period of at least 10 days which, when transferred to normal RHF-1 cultures, would render them resistant to vaccinia infection. (v) Although limited growth of virus appeared to be responsible for the production of the inhibitor, increase in inhibitory activity did not seem to coincide with increase in virus titer. (vi) The inhibitor seemed to resemble interferons in inhibiting virus plaque production, but its exact identity and the mode of action remain to be determined.

  17. Effects of poliovirus 2A(pro) on vaccinia virus gene expression.

    Science.gov (United States)

    Feduchi, E; Aldabe, R; Novoa, I; Carrasco, L

    1995-12-15

    The effects of transient expression of poliovirus 2A(pro) on p220 cleavage in COS cells have been analyzed. When 2A(pro) was cloned in plasmid pTM1 and transiently expressed in COS cells, efficient cleavage of p220 occurred after infection of these cells with a recombinant vaccinia virus bearing phage T7 RNA polymerase. High numbers of COS cells were transfected with pTM1-2A, as judged by p220 cleavage, thereby allowing an analysis of the effects of poliovirus 2A(pro) on vaccinia virus gene expression. A 40-50% cleavage of p220 by transfected poliovirus 2A(pro) was observed ten hours post infection and cleavage was almost complete (80-90%) 20-25 hours post infection with vaccinia virus. Profound inhibition of vaccinia virus protein synthesis was detectable ten hours post infection and was maximal 20-25 hours post infection. This inhibition resulted from neither a blockade of transcription of vaccinia virus nor a lack of translatability of the mRNAs present in cells that synthesize poliovirus 2A(pro). Addition of ara-C inhibited the replication of vaccinia virus and allowed the continued synthesis of cellular proteins. Under these conditions, 2A(pro) is expressed and blocks cellular translation. Finally, p220 cleavage by 2A(pro) did not inhibit the translation of a mRNA encoding poliovirus protein 2C, as directed by the 5' leader sequences of encephalomiocarditis virus. Therefore, these findings show a correlation between p220 cleavage and inhibition of translation from newly made mRNAs. Our results are discussed in the light of present knowledge of p220 function, and new approaches are considered that might provide further insights into the function(s) of initiation factor eIF-4F.

  18. Vaccinia Virus Recombinants: Expression of VSV Genes and Protective Immunization of Mice and Cattle

    Science.gov (United States)

    Mackett, M.; Yilma, T.; Rose, J. K.; Moss, B.

    1985-01-01

    Vesicular stomatitis virus (VSV) causes a contagious disease of horses, cattle, and pigs. When DNA copies of messenger RNA's for the G or N proteins of VSV were linked to a vaccinia virus promoter and inserted into the vaccinia genome, the recombinants retained infectivity and synthesized VSV polypeptides. After intradermal vaccination with live recombinant virus expressing the G protein, mice produced VSV-neutralizing antibodies and were protected against lethal encephalitis upon intravenous challenge with VSV. In cattle, the degree of protection against intradermalingually injected VSV was correlated with the level of neutralizing antibody produced following vaccination.

  19. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

    OpenAIRE

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular f...

  20. Halogen Bonding in Nucleic Acid Complexes.

    Science.gov (United States)

    Kolář, Michal H; Tabarrini, Oriana

    2017-11-09

    Halogen bonding (X-bonding) has attracted notable attention among noncovalent interactions. This highly directional attraction between a halogen atom and an electron donor has been exploited in knowledge-based drug design. A great deal of information has been gathered about X-bonds in protein-ligand complexes, as opposed to nucleic acid complexes. Here we provide a thorough analysis of nucleic acid complexes containing either halogenated building blocks or halogenated ligands. We analyzed close contacts between halogens and electron-rich moieties. The phosphate backbone oxygen is clearly the most common halogen acceptor. We identified 21 X-bonds within known structures of nucleic acid complexes. A vast majority of the X-bonds is formed by halogenated nucleobases, such as bromouridine, and feature excellent geometries. Noncovalent ligands have been found to form only interactions with suboptimal interaction geometries. Hence, the first X-bonded nucleic acid binder remains to be discovered.

  1. Nanoparticulate systems for nucleic acid delivery

    NARCIS (Netherlands)

    Varkouhi, A.K.

    2011-01-01

    Development of carrier systems with controllable physicochemical and delivery properties has opened up the possibility of nanomedicines containing nucleic acids. In the last decades, much effort has been dedicated to two exciting approaches in biomedicine, namely gene and RNA interference

  2. Perfect Strangers: Inorganic Photochemistry and Nucleic Acids

    Science.gov (United States)

    Carter, Pamela J.; Ciftan, Suzanne A.; Sistare, Mark F.; Holden Thorp, H.

    1997-06-01

    The applications of inorganic photochemistry to nucleic acid chemistry are discussed. A brief review of nucleic acid structure is given. Methods for probing DNA using emissive inorganic complexes are discussed. Photoreactions that damage DNA by hydrogen atom transfer from sugar or electron abstraction from guanine are presented. The method of photochemical footprinting using a diplatinum photocatalyst is described. The final section discusses advances in combinatorial selection experiments that increase the urgency for rapid screening methods such as those derived from inorganic photochemistry.

  3. NPIDB: nucleic acid?protein interaction database

    OpenAIRE

    Kirsanov, Dmitry D.; Zanegina, Olga N.; Aksianov, Evgeniy A.; Spirin, Sergei A.; Karyagina, Anna S.; Alexeevski, Andrei V

    2012-01-01

    The Nucleic acid?Protein Interaction DataBase (http://npidb.belozersky.msu.ru/) contains information derived from structures of DNA?protein and RNA?protein complexes extracted from the Protein Data Bank (3846 complexes in October 2012). It provides a web interface and a set of tools for extracting biologically meaningful characteristics of nucleoprotein complexes. The content of the database is updated weekly. The current version of the Nucleic acid?Protein Interaction DataBase is an upgrade ...

  4. Carbohydrate Polymers for Nonviral Nucleic Acid Delivery

    OpenAIRE

    Sizovs, Antons; McLendon, Patrick M.; Srinivasachari, Sathya; Reineke, Theresa M.

    2010-01-01

    Carbohydrates have been investigated and developed as delivery vehicles for shuttling nucleic acids into cells. In this review, we present the state of the art in carbohydrate-based polymeric vehicles for nucleic acid delivery, with the focus on the recent successes in preclinical models, both in vitro and in vivo. Polymeric scaffolds based on the natural polysaccharides chitosan, hyaluronan, pullulan, dextran, and schizophyllan each have unique properties and potential for modification, and ...

  5. Live-Cell Imaging of Vaccinia Virus Recombination.

    Directory of Open Access Journals (Sweden)

    Patrick Paszkowski

    2016-08-01

    Full Text Available Recombination between co-infecting poxviruses provides an important mechanism for generating the genetic diversity that underpins evolution. However, poxviruses replicate in membrane-bound cytoplasmic structures known as factories or virosomes. These are enclosed structures that could impede DNA mixing between co-infecting viruses, and mixing would seem to be essential for this process. We hypothesize that virosome fusion events would be a prerequisite for recombination between co-infecting poxviruses, and this requirement could delay or limit viral recombination. We have engineered vaccinia virus (VACV to express overlapping portions of mCherry fluorescent protein fused to a cro DNA-binding element. In cells also expressing an EGFP-cro fusion protein, this permits live tracking of virus DNA and genetic recombination using confocal microscopy. Our studies show that different types of recombination events exhibit different timing patterns, depending upon the relative locations of the recombining elements. Recombination between partly duplicated sequences is detected soon after post-replicative genes are expressed, as long as the reporter gene sequences are located in cis within an infecting genome. The same kinetics are also observed when the recombining elements are divided between VACV and transfected DNA. In contrast, recombination is delayed when the recombining sequences are located on different co-infecting viruses, and mature recombinants aren't detected until well after late gene expression is well established. The delay supports the hypothesis that factories impede inter-viral recombination, but even after factories merge there remain further constraints limiting virus DNA mixing and recombinant gene assembly. This delay could be related to the continued presence of ER-derived membranes within the fused virosomes, membranes that may once have wrapped individual factories.

  6. Myxoma and vaccinia viruses bind differentially to human leukocytes.

    Science.gov (United States)

    Chan, Winnie M; Bartee, Eric C; Moreb, Jan S; Dower, Ken; Connor, John H; McFadden, Grant

    2013-04-01

    Myxoma virus (MYXV) and vaccinia virus (VACV), two distinct members of the family Poxviridae, are both currently being developed as oncolytic virotherapeutic agents. Recent studies have demonstrated that ex vivo treatment with MYXV can selectively recognize and kill contaminating cancerous cells from autologous bone marrow transplants without perturbing the engraftment of normal CD34(+) hematopoietic stem and progenitor cells. However, the mechanism(s) by which MYXV specifically recognizes and eliminates the cancer cells in the autografts is not understood. While little is known about the cellular attachment factor(s) exploited by MYXV for entry into any target cells, VACV has been shown to utilize cell surface glycosaminoglycans such as heparan sulfate (HS), the extracellular matrix protein laminin, and/or integrin β1. We have constructed MYXV and VACV virions tagged with the Venus fluorescent protein and compared their characteristics of binding to various human cancer cell lines as well as to primary human leukocytes. We report that the binding of MYXV or VACV to some adherent cell lines could be partially inhibited by heparin, but laminin blocked only VACV binding. In contrast to cultured fibroblasts, the binding of MYXV and VACV to a wide spectrum of primary human leukocytes could not be competed by either HS or laminin. Additionally, MYXV and VACV exhibited very different binding characteristics against certain select human leukocytes, suggesting that the two poxviruses utilize different cell surface determinants for the attachment to these cells. These results indicate that VACV and MYXV can exhibit very different oncolytic tropisms against some cancerous human leukocytes.

  7. Efficacy and Safety of Doubly-Regulated Vaccinia Virus in a Mouse Xenograft Model of Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Muneyoshi Futami

    2017-09-01

    Full Text Available Multiple myeloma is a malignancy of plasma cells of the bone marrow. Although the prognosis is variable, no curative therapy has been defined. Vaccinia virus infects cancer cells and kills such cells in a variety of ways. These include direct infection, triggering of immunomediated cell death, and vascular collapse. The potential of the vaccinia virus as an anti-tumor therapy has attracted the attention of oncologists. Interestingly, our preliminary experiments revealed that myeloma cells were particularly susceptible to vaccinia virus. To exploit this susceptibility and to render vaccinia more myeloma specific, we generated thymidine-kinase-deleted microRNA (miRNA-regulated vaccinia viruses in which the essential viral gene B5R was regulated by miRNAs of normal human cells. Of the miRNAs examined, let-7a was found to be the most reliable in terms of regulating viral transmission. Exposure to unregulated vaccinia virus killed myeloma-transplanted severe combined immunodeficiency (SCID mice; the animals succumbed to viral toxicity. In contrast, the thymidine-kinase-deleted let-7a-regulated virus remained localized within myeloma cells, triggering tumor regression and improving overall survival. In conclusion, a thymidine-kinase-deleted let-7a-regulated vaccinia virus was safe and effective for mice, warranting clinical trials in humans.

  8. Use of a recombinant vaccinia virus expressing interferon gamma for post-exposure protection against vaccinia and ectromelia viruses.

    Directory of Open Access Journals (Sweden)

    Susan A Holechek

    Full Text Available Post-exposure vaccination with vaccinia virus (VACV has been suggested to be effective in minimizing death if administered within four days of smallpox exposure. While there is anecdotal evidence for efficacy of post-exposure vaccination this has not been definitively studied in humans. In this study, we analyzed post-exposure prophylaxis using several attenuated recombinant VACV in a mouse model. A recombinant VACV expressing murine interferon gamma (IFN-γ was most effective for post-exposure protection of mice infected with VACV and ectromelia virus (ECTV. Untreated animals infected with VACV exhibited severe weight loss and morbidity leading to 100% mortality by 8 to 10 days post-infection. Animals treated one day post-infection had milder symptoms, decreased weight loss and morbidity, and 100% survival. Treatment on days 2 or 3 post-infection resulted in 40% and 20% survival, respectively. Similar results were seen in ECTV-infected mice. Despite the differences in survival rates in the VACV model, the viral load was similar in both treated and untreated mice while treated mice displayed a high level of IFN-γ in the serum. These results suggest that protection provided by IFN-γ expressed by VACV may be mediated by its immunoregulatory activities rather than its antiviral effects. These results highlight the importance of IFN-γ as a modulator of the immune response for post-exposure prophylaxis and could be used potentially as another post-exposure prophylaxis tool to prevent morbidity following infection with smallpox and other orthopoxviruses.

  9. Derepression of a novel class of vaccinia virus genes upon DNA replication

    NARCIS (Netherlands)

    Vos, J C; Stunnenberg, H.G.

    1988-01-01

    A novel class of vaccinia virus genes, called intermediate, is expressed immediately post-replication and prior to the onset of late gene transcription. Intermediate transcription is dependent on trans-acting factors which are present in an active state in virus-infected cells prior to the onset of

  10. The development of a monolith-based purification process for Orthopoxvirus vaccinia virus Lister strain.

    Science.gov (United States)

    Vincent, David; Kramberger, Petra; Hudej, Rosana; Štrancar, Aleš; Wang, Yaohe; Zhou, Yuhong; Velayudhan, Ajoy

    2017-11-17

    The purification of large viruses remains an important field of research and development. The development of efficient purification trains is restricted by limited analytical methods, as well as by the complexity of large viruses, as well as the high variability in starting material from cell culture. Vaccinia virus holds great potential as an oncolytic and immunotherapeutic vaccine against a broad spectrum of cancers. In this work, monolith-based capture and polishing chromatographic steps for vaccinia virus Lister strain has been developed. Virus produced in CV-1 cells was harvested and passed through a 0.8μm pre-filter before loading onto CIEX, AIEX and HIC CIM monoliths. Without the need for nuclease treatment, up to 99% of the total DNA loaded can be removed from the vaccinia feed stream by the CIM OH monolith, which also reduces the total protein concentration in the product pool to LLOQ levels, and achieves infectious virus recoveries of 90%. Binding capacities of greater than 1×109pfu of vaccinia per mL of matrix were obtained on both CIM SO3 and CIM OH monoliths. Multiple orthogonal analytical methods have been used to develop process knowledge and understanding. Copyright © 2017. Published by Elsevier B.V.

  11. Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector

    NARCIS (Netherlands)

    Bernards, R.A.; Destree, A.; McKenzie, S.; Gordon, E.; Weinberg, R.A.; Panicali, D.

    1987-01-01

    We have constructed a vaccinia virus recombinant that expresses the extracellular domain of the rat neu oncogene-encoded protein, a 185-kDa transmembrane glycoprotein termed p185. Strain NFS mice immunized with this recombinant virus developed a strong antibody response against the neu oncogene

  12. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Czech Academy of Sciences Publication Activity Database

    Žurková, K.; Hainz, P.; Kryštofová, J.; Kutinová, L.; Šanda, Miloslav; Němečková, Š.

    2010-01-01

    Roč. 7, č. 1 (2010), 109/1-109/15 ISSN 1743-422X Institutional research plan: CEZ:AV0Z40550506 Keywords : vaccinia virus * antibodies * virulence Subject RIV: CE - Biochemistry Impact factor: 2.546, year: 2010

  13. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    OpenAIRE

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in...

  14. Lack of efficacy of aurintricarboxylic acid and ethacrynic acid against vaccinia virus respiratory infections in mice.

    Science.gov (United States)

    Smee, Donald F; Hurst, Brett L; Wong, Min-Hui

    2010-04-14

    Aurintricarboxylic acid (ATA) and ethacrynic acid (ECA) have been reported to exhibit antiviral activity against vaccinia virus infections in cell culture by inhibiting early and late gene transcription, respectively. The purpose of this work was to determine if these inhibitors would effectively treat vaccinia virus infections in mice, which has not previously been studied. ECA was investigated by cell culture plaque reduction assay for the inhibition of cowpox and vaccinia virus infections to clarify issues regarding its potency and selectivity. Mice infected intranasally with vaccinia virus were treated by intraperitoneal route twice daily for 5 days with ATA (10 and 30 mg/kg/day) and ECA (15 and 30 mg/kg/day) or once daily for 2 days with cidofovir (100 mg/kg/day). ECA caused 50% inhibition of virus plaque formation at 20-79 muM in four cultured cell lines, with 50% cytotoxicity at 84-173 muM, giving low (1.3-4.2) selectivity index values. Preliminary toxicity tests in uninfected mice indicated that ATA and ECA were both overtly toxic at 100 mg/kg/day. No protection from mortality was afforded by treatment of vaccinia virus infections with ATA or ECA, but 100% survival was achieved in the cidofovir group. ATA- and ECA-treated mice died significantly sooner than placebo-treated animals, indicating that these compounds exacerbated the infection. Both ATA and ECA lack antiviral potency and selectivity in cell culture. The compounds were ineffective in treating mice at intraperitoneal doses of

  15. Novel Biochip Platform for Nucleic Acid Analysis

    Directory of Open Access Journals (Sweden)

    Juan J. Diaz-Mochon

    2012-06-01

    Full Text Available This manuscript describes the use of a novel biochip platform for the rapid analysis/identification of nucleic acids, including DNA and microRNAs, with very high specificity. This approach combines a unique dynamic chemistry approach for nucleic acid testing and analysis developed by DestiNA Genomics with the STMicroelectronics In-Check platform, which comprises two microfluidic optimized and independent PCR reaction chambers, and a sequential microarray area for nucleic acid capture and identification by fluorescence. With its compact bench-top “footprint” requiring only a single technician to operate, the biochip system promises to transform and expand routine clinical diagnostic testing and screening for genetic diseases, cancers, drug toxicology and heart disease, as well as employment in the emerging companion diagnostics market.

  16. Imaging Functional Nucleic Acid Delivery to Skin.

    Science.gov (United States)

    Kaspar, Roger L; Hickerson, Robyn P; González-González, Emilio; Flores, Manuel A; Speaker, Tycho P; Rogers, Faye A; Milstone, Leonard M; Contag, Christopher H

    2016-01-01

    Monogenic skin diseases arise from well-defined single gene mutations, and in some cases a single point mutation. As the target cells are superficial, these diseases are ideally suited for treatment by nucleic acid-based therapies as well as monitoring through a variety of noninvasive imaging technologies. Despite the accessibility of the skin, there remain formidable barriers for functional delivery of nucleic acids to the target cells within the dermis and epidermis. These barriers include the stratum corneum and the layered structure of the skin, as well as more locally, the cellular, endosomal and nuclear membranes. A wide range of technologies for traversing these barriers has been described and moderate success has been reported for several approaches. The lessons learned from these studies include the need for combinations of approaches to facilitate nucleic acid delivery across these skin barriers and then functional delivery across the cellular and nuclear membranes for expression (e.g., reporter genes, DNA oligonucleotides or shRNA) or into the cytoplasm for regulation (e.g., siRNA, miRNA, antisense oligos). The tools for topical delivery that have been evaluated include chemical, physical and electrical methods, and the development and testing of each of these approaches has been greatly enabled by imaging tools. These techniques allow delivery and real time monitoring of reporter genes, therapeutic nucleic acids and also triplex nucleic acids for gene editing. Optical imaging is comprised of a number of modalities based on properties of light-tissue interaction (e.g., scattering, autofluorescence, and reflectance), the interaction of light with specific molecules (e.g., absorbtion, fluorescence), or enzymatic reactions that produce light (bioluminescence). Optical imaging technologies operate over a range of scales from macroscopic to microscopic and if necessary, nanoscopic, and thus can be used to assess nucleic acid delivery to organs, regions, cells

  17. Multifunctional Nucleic Acids for Tumor Cell Treatment

    DEFF Research Database (Denmark)

    Pofahl, Monika; Wengel, Jesper; Mayer, Günter

    2014-01-01

    -proliferative and antimiR function in one 37-nucleotide nucleic acid molecule. It inhibits cancer cell growth and induces gene expression that is pathologically damped by an oncomir. These findings will have a strong impact on future developments regarding aptamer- and antimiR-related applications for tumor targeting......We report on a multifunctional nucleic acid, termed AptamiR, composed of an aptamer domain and an antimiR domain. This composition mediates cell specific delivery of antimiR molecules for silencing of endogenous micro RNA. The introduced multifunctional molecule preserves cell targeting, anti...

  18. A locked nucleic Acid-based nanocrawler

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Pasternak, Karol; Campbell, Meghan A

    2013-01-01

    Herein we introduce a novel fluorescent LNA/DNA machine, a nanocrawler, which reversibly moves along a directionally polar complementary road controlled by affinity-enhancing locked nucleic acid (LNA) monomers and additional regulatory strands. Polyaromatic hydrocarbon (PAH) dyes attached to 2...

  19. Thermodynamic Analysis of Nylon Nucleic Acids

    Science.gov (United States)

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Ruojie; Lukeman, Philip S.

    2010-01-01

    The stability and structure of nylon nucleic acid duplexes with complementary DNA and RNA strands was examined. Thermal denaturing studies of a series of oligonucleotides containing nylon nucleic acids (1 to 5 amide linkages) revealed that the amide linkage enhanced significantly the binding affinity of nylon nucleic acids towards both complementary DNA (up to 26°C increase in the thermal transition temperature (Tm) for 5 linkages) and RNA (around 15°C increase in Tm for 5 linkages) when compared with non-amide linked precursor strands. For both DNA and RNA complements, increasing derivatization decreased the melting temperatures of uncoupled molecules relative to unmodified strands; by contrast, increasing lengths of coupled copolymer raised Tm from less to slightly greater than Tm of unmodified strands. Thermodynamic data extracted from melting curves and CD spectra of nylon nucleic acid duplexes were consistent with loss of stability due to incorporation of pendent groups on the 2′ position of ribose, and recovery of stability upon linkage of the side chains. PMID:18543259

  20. Recent progress in nucleic acids isotachophoresis

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Schlecht, U.; Berka, J.; Foret, František

    2018-01-01

    Roč. 41, č. 1 (2018), s. 236-247 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.557, year: 2016

  1. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Felipe L Assis

    Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

  2. Locked and unlocked nucleosides in functional nucleic acids

    DEFF Research Database (Denmark)

    Doessing, Holger; Vester, Birte

    2011-01-01

    Nucleic acids are able to adopt a plethora of structures, many of which are of interest in therapeutics, bio- or nanotechnology. However, structural and biochemical stability is a major concern which has been addressed by incorporating a range of modifications and nucleoside derivatives. This rev....... This review summarizes the use of locked nucleic acid (LNA) and un-locked nucleic acid (UNA) monomers in functional nucleic acids such as aptamers, ribozymes, and DNAzymes....

  3. The Nucleic Acid Database: new features and capabilities

    OpenAIRE

    Coimbatore Narayanan, Buvaneswari; Westbrook, John; Ghosh, Saheli; Petrov, Anton I.; Sweeney, Blake; Zirbel, Craig L.; Leontis, Neocles B.; Berman, Helen M.

    2013-01-01

    The Nucleic Acid Database (NDB) (http://ndbserver.rutgers.edu) is a web portal providing access to information about 3D nucleic acid structures and their complexes. In addition to primary data, the NDB contains derived geometric data, classifications of structures and motifs, standards for describing nucleic acid features, as well as tools and software for the analysis of nucleic acids. A variety of search capabilities are available, as are many different types of reports. This article descri...

  4. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains

    Directory of Open Access Journals (Sweden)

    Byrd Chelsea M

    2006-08-01

    Full Text Available Abstract As an approach to initiating a structure-function analysis of the vaccinia virus I7L core protein proteinase, a collection of conditional-lethal mutants in which the mutation had been mapped to the I7L locus were subjected to genomic sequencing and phenotypic analyses. Mutations in six vaccinia virus I7L temperature sensitive mutants fall into two groups: changes at three positions at the N-terminal end between amino acids 29 and 37 and two different substitutions at amino acid 344, near the catalytic domain. Regardless of the position of the mutation, mutants at the non-permissive temperature failed to cleave core protein precursors and had their development arrested prior to core condensation. Thus it appears that the two clusters of mutations may affect two different functional domains required for proteinase activity.

  5. Protection from rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene.

    OpenAIRE

    Wiktor, T. J.; Macfarlan, R I; Reagan, K J; Dietzschold, B; Curtis, P. J.; Wunner, W. H.; Kieny, M P; Lathe, R; Lecocq, J P; Mackett, M.

    1984-01-01

    Inoculation of rabbits and mice with a vaccinia-rabies glycoprotein recombinant (V-RG) virus resulted in rapid induction of high concentrations of rabies virus-neutralizing antibodies and protection from severe intracerebral challenge with several strains of rabies virus. Protection from virus challenge also was achieved against the rabies-related Duvenhage virus but not against the Mokola virus. Effective immunization by V-RG depended on the expression of a rabies glycoprotein that registere...

  6. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  7. Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes▿

    OpenAIRE

    Husain, Matloob; Weisberg, Andrea S.; Moss, Bernard

    2006-01-01

    The primary membrane of vaccinia virus, as well as those of other poxviruses, forms within a discrete cytoplasmic factory region. We recently determined the existence of an operative pathway from the endoplasmic reticulum within the virus factory to nascent viral membranes and demonstrated that a viral protein could be diverted from this pathway to Golgi membranes by the addition of COPII-binding sites (M. Husain, A. S. Weisberg, and B. Moss, Proc. Natl. Acad. Sci. USA, 103:19506-19511, 2006)...

  8. Modulation of the Myxoma Virus Plaque Phenotype by Vaccinia Virus Protein F11

    OpenAIRE

    Irwin, Chad R; Evans, David H.

    2012-01-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments...

  9. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Bedognetti Davide

    2011-10-01

    Full Text Available Abstract Background Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. Methods In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. Results We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Conclusions Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection.

  10. Dairy production practices and associated risks for bovine vaccinia exposure in cattle, Brazil

    Directory of Open Access Journals (Sweden)

    I.A. Borges

    2017-11-01

    Full Text Available A cross-sectional serosurvey was performed to identify environmental features or practices of dairy farms associated with risk for exposure to vaccinia-like viruses in dairy cattle in Brazil. Sera from 103 cows from 18 farms in Minas Gerais state were examined for Orthopoxvirus-neutralizing antibodies. A database of 243 binary or multiple-selection categorical variables regarding the physical features and surrounding ecology of each property was obtained. Thirteen of 46 presumptive predictor variables were found to be significantly associated with Orthopoxvirus serostatus by univariate logistic regression methods. Use of teat sanitizer and having felids on the property were independently associated with virus exposure by multivariable analysis. Rodents have long been suspected of serving as maintenance reservoirs for vaccinia-like viruses in Brazil. Therefore, domestic felids are not only effective predators of small rodent pests, but also their urine can serve as a deterrent to rodent habitation in buildings such as stables and barns. These results corroborate previous evidence of the high significance of rodents in the Vaccinia virus transmission cycle, and they also raise questions regarding the common use of teat sanitizers in dairy production areas.

  11. The vaccinia virus E6 protein influences virion protein localization during virus assembly

    Energy Technology Data Exchange (ETDEWEB)

    Condit, Richard C., E-mail: condit@mgm.ufl.edu; Moussatche, Nissin

    2015-08-15

    Vaccinia virus mutants in which expression of the virion core protein gene E6R is repressed are defective in virion morphogenesis. E6 deficient infections fail to properly package viroplasm into viral membranes, resulting in an accumulation of empty immature virions and large aggregates of viroplasm. We have used immunogold electron microscopy and immunofluorescence confocal microscopy to assess the intracellular localization of several virion structural proteins and enzymes during E6R mutant infections. We find that during E6R mutant infections virion membrane proteins and virion transcription enzymes maintain a normal localization within viral factories while several major core and lateral body proteins accumulate in aggregated virosomes. The results support a model in which vaccinia virions are assembled from at least three substructures, the membrane, the viroplasm and a “pre-nucleocapsid”, and that the E6 protein is essential for maintaining proper localization of the seven-protein complex and the viroplasm during assembly. - Highlights: • Mutation of E6 disrupts association of viral membranes with viral core proteins • Mutation of E6 does not perturb viral membrane biosynthesis • Mutation of E6 does not perturb localization of viral transcription enzymes • Mutation of E6 causes mis-localization and aggregation of viral core proteins • Vaccinia assembly uses three subassemblies: membranes, viroplasm, prenucleocapsid.

  12. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Science.gov (United States)

    Slike, Bonnie M; Creegan, Matthew; Marovich, Mary; Ngauy, Viseth

    2017-01-01

    Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years) and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity) may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb) responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT) of 250 to baseline (vaccination. This contrasted with a comparator group of adults, ages 35-49, who were vaccinated with Dryvax® as children. In the childhood vaccinees, titers persisted for >30 years with a GMT of 210 (range 112-3234). This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  13. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Directory of Open Access Journals (Sweden)

    Bonnie M Slike

    Full Text Available Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT of 250 to baseline (30 years with a GMT of 210 (range 112-3234. This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  14. Spectrofluorimetric study of the binding of codeine to nucleic acids

    Science.gov (United States)

    Wang, Feng; Huang, Wei; Su, Liang; Dong, Zijia; Zhang, Shuai

    2009-06-01

    The characteristics of the interaction between codeine (CD) and nucleic acids were studied by ultraviolet-visible spectra and fluorescent spectra. It shows that there is a powerful ability in nucleic acids to quench the fluorescence intensity of codeine. The fluorescence quenching data were analyzed according to Stern-Volmer equation and Förster's nonradiative energy transfer mechanism. Thus the binding constant and the thermodynamic parameters between codeine and nucleic acids were obtained. The results show that codeine interacts with nucleic acids in a mode of groove binding and -OCH 3 of the codeine molecular combines with the groove of nucleic acids through hydrogen bond or van der Waals force.

  15. The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop

    Directory of Open Access Journals (Sweden)

    Boucher Charles A

    2010-12-01

    Full Text Available Abstract The 1st International Workshop on Xenotropic Murine Leukemia Virus-Related Retrovirus (XMRV, co-sponsored by the National Institutes of Health, The Department of Health and Human Services and Abbott Diagnostics, was convened on September 7/8, 2010 on the NIH campus, Bethesda, MD. Attracting an international audience of over 200 participants, the 2-day event combined a series of plenary talks with updates on different aspects of XMRV research, addressing basic gammaretrovirus biology, host response, association of XMRV with chronic fatigue syndrome and prostate cancer, assay development and epidemiology. The current status of XMRV research, concerns among the scientific community and suggestions for future actions are summarized in this meeting report.

  16. Detection of a virus related to betacoronaviruses in Italian greater horseshoe bats.

    Science.gov (United States)

    Balboni, A; Palladini, A; Bogliani, G; Battilani, M

    2011-02-01

    The association between coronaviruses and bats is a worldwide phenomenon and bats belonging to genus Rhinolophus are the reservoir host for several coronaviruses, including a large number of viruses closely related genetically to severe acute respiratory syndrome-coronavirus (SARS-CoV). We carried out a survey in colonies of Italian bats (Rhinolophus ferrumequinum) for the presence of coronaviruses. Two of 52 R. ferrumequinum captured from different Italian areas tested positive by reverse transcription-PCR for a fragment of RNA-dependent RNA polymerase (RdRp) gene of viruses related to Coronavirus. Phylogenetic analysis revealed close correlations between one of the positive samples and SARS-related CoV belonging to the genus Betacoronavirus.

  17. The xenotropic murine leukemia virus-related retrovirus debate continues at first international workshop.

    Science.gov (United States)

    Stoye, Jonathan P; Silverman, Robert H; Boucher, Charles A; Le Grice, Stuart F J

    2010-12-22

    The 1st International Workshop on Xenotropic Murine Leukemia Virus-Related Retrovirus (XMRV), co-sponsored by the National Institutes of Health, The Department of Health and Human Services and Abbott Diagnostics, was convened on September 7/8, 2010 on the NIH campus, Bethesda, MD. Attracting an international audience of over 200 participants, the 2-day event combined a series of plenary talks with updates on different aspects of XMRV research, addressing basic gammaretrovirus biology, host response, association of XMRV with chronic fatigue syndrome and prostate cancer, assay development and epidemiology. The current status of XMRV research, concerns among the scientific community and suggestions for future actions are summarized in this meeting report.

  18. Digital Microfluidics for Nucleic Acid Amplification.

    Science.gov (United States)

    Coelho, Beatriz; Veigas, Bruno; Fortunato, Elvira; Martins, Rodrigo; Águas, Hugo; Igreja, Rui; Baptista, Pedro V

    2017-06-25

    Digital Microfluidics (DMF) has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.

  19. Digital Microfluidics for Nucleic Acid Amplification

    Directory of Open Access Journals (Sweden)

    Beatriz Coelho

    2017-06-01

    Full Text Available Digital Microfluidics (DMF has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.

  20. Nucleic acid compositions and the encoding proteins

    Science.gov (United States)

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  1. Detection of nucleic acids by multiple sequential invasive cleavages

    Energy Technology Data Exchange (ETDEWEB)

    Hall, Jeff G; Lyamichev, Victor I; Mast, Andrea L; Brow, Mary Ann D

    2012-10-16

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.

  2. NAPP: the Nucleic Acid Phylogenetic Profile Database

    OpenAIRE

    Ott, Alban; Idali, Anouar; Marchais, Antonin; Gautheret, Daniel

    2017-01-01

    Nucleic acid phylogenetic profiling (NAPP) classifies coding and non-coding sequences in a genome according to their pattern of conservation across other genomes. This procedure efficiently distinguishes clusters of functional non-coding elements in bacteria, particularly small RNAs and cis-regulatory RNAs, from other conserved sequences. In contrast to other non-coding RNA detection pipelines, NAPP does not require the presence of conserved RNA secondary structure and therefore is likely to ...

  3. Prediction of protein and nucleic acid interactions

    OpenAIRE

    Cirillo, Davide

    2016-01-01

    The purpose of my doctoral studies has been the development of bioinformatics methods to quantitatively evaluate associations between proteins and nucleic acids (NAs). This thesis aims at providing insights into molecular features and still relatively unknown mechanisms of protein-NAs associations, such as RNA-binding proteins and long noncoding RNAs as well as transcription factors and regulatory DNA elements. In this work, I present two algorithms, catRAPID omics express and PAnDA, for the ...

  4. Carbohydrate Polymers for Nonviral Nucleic Acid Delivery

    Science.gov (United States)

    Sizovs, Antons; McLendon, Patrick M.; Srinivasachari, Sathya

    2014-01-01

    Carbohydrates have been investigated and developed as delivery vehicles for shuttling nucleic acids into cells. In this review, we present the state of the art in carbohydrate-based polymeric vehicles for nucleic acid delivery, with the focus on the recent successes in preclinical models, both in vitro and in vivo. Polymeric scaffolds based on the natural polysaccharides chitosan, hyaluronan, pullulan, dextran, and schizophyllan each have unique properties and potential for modification, and these results are discussed with the focus on facile synthetic routes and favorable performance in biological systems. Many of these carbohydrates have been used to develop alternative types of biomaterials for nucleic acid delivery to typical polyplexes, and these novel materials are discussed. Also presented are polymeric vehicles that incorporate copolymerized carbohydrates into polymer backbones based on polyethylenimine and polylysine and their effect on transfection and biocompatibility. Unique scaffolds, such as clusters and polymers based on cyclodextrin (CD), are also discussed, with the focus on recent successes in vivo and in the clinic. These results are presented with the emphasis on the role of carbohydrate and charge on transfection. Use of carbohydrates as molecular recognition ligands for cell-type specific delivery is also briefly reviewed. We contend that carbohydrates have contributed significantly to progress in the field of non-viral DNA delivery, and these new discoveries are impactful for developing new vehicles and materials for treatment of human disease. PMID:21504102

  5. Detection and cloning of murine leukemia virus-related sequences from African green monkey liver DNA.

    OpenAIRE

    Martin, M. A.; Bryan, T; McCutchan, T F; Chan, H W

    1981-01-01

    By using low-stringency nucleic acid hybridization conditions and specific subgenomic segments of the AKR ecotropic provirus as probes, murine leukemia virus (MuLV)-related sequences were detected in African green monkey (AGM) liver DNA. The MuLV-reactive segments present in restricted AGM DNA ranged from 1.9 kilobases (kb) to greater than 10 kb in size. On the basis of this finding, a 17-kb segment was cloned from a partial EcoRI AGM library in lambda Charon 4A which shared nearly 5 kb of ho...

  6. Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9.

    Science.gov (United States)

    Deng, Lili; Fan, Jun; Guo, Mingming; Huang, Biao

    2016-03-28

    Targeted oncolytic vaccinia viruses are being developed as a novel strategy in cancer therapy. Arming vaccinia viruses with immunostimulatory cytokines can enhance antitumor efficacy. Such engineered oncolytic viruses, like JX-594, a Wyeth strain vaccinia virus modified with human granulocyte-macrophage colony-stimulating factor (GM-CSF), have shown promising results and have proceeded rapidly in clinical trials. However, the oncolytic potential of the Chinese vaccine strain Tian Tan (VTT) has not been explored. In this study, we constructed a targeted oncolytic vaccinia virus of Tian Tan strain Guang9 (VG9) expressing murine GM-CSF (VG9-GMCSF) and evaluated the antitumor effect of this recombinant vaccinia virus in a murine melanoma model. In vitro, viral replication and cytotoxicity of VG9-GMCSF was as potent as VG9; in vivo, VG9-GMCSF significantly inhibited the growth of subcutaneously implanted melanoma tumors, prolonged the survival of tumor-bearing mice, and produced an antitumor cytotoxic response. Such antitumor effect may be due to the lytic nature of virus as well as the stimulation of immune activity by GM-CSF production. Our results indicate that VG9-GMCSF induces strong tumoricidal activity, providing a potential therapeutic strategy for combating cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  8. Scaffolding along Nucleic Acid Duplexes Using 2'-Amino-Locked Nucleic Acids

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2014-01-01

    Conspectus Incorporation of chemically modified nucleotide scaffolds into nucleic acids to form assemblies rich in function is an innovative area with great promise for nanotechnology and biomedical and material science applications. The intrinsic biorecognition potential of nucleic acids combined...... depends on the chemical nature of the modification, its price, its availability, and applications of the product. One of the most useful applications of the product LNA/DNA scaffolds containing 2'-amino-LNA is to detect complementary DNA and RNA targets. Examples of these applications include sensing...... functionalized 2'-amino-LNA scaffolds offer great opportunities for material science, diagnostics, and medicine of the future....

  9. Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus.

    Science.gov (United States)

    Aldabe, R; Feduchi, E; Novoa, I; Carrasco, L

    1995-10-24

    Poliovirus protease 2A cleaves p220, a component of initiation factor eIF-4F. Polyclonal antibodies that recognize p220 and the cleaved products from different species have been raised. Transfection of several cell lines with poliovirus 2Apro cloned in different plasmids leads to efficient cleavage of p220 upon infection with VT7, a recombinant vaccinia virus that expresses the T7 RNA polymerase. Under these conditions vaccinia virus protein synthesis is severely inhibited, while expression of poliovirus protein 2C from a similar plasmid has no effect. These results show by the first time the effects of p220 cleavage on vaccinia virus translation in the infected cells.

  10. A novel high-throughput vaccinia virus neutralization assay and preexisting immunity in populations from different geographic regions in China.

    Directory of Open Access Journals (Sweden)

    Qiang Liu

    Full Text Available BACKGROUND: Pre-existing immunity to Vaccinia Tian Tan virus (VTT resulting from a large vaccination campaign against smallpox prior to the early 1980s in China, has been a major issue for application of VTT-vector based vaccines. It is essential to establish a sensitive and high-throughput neutralization assay to understand the epidemiology of Vaccinia-specific immunity in current populations in China. METHODOLOGY/PRINCIPAL FINDINGS: A new anti-Vaccinia virus (VACV neutralization assay that used the attenuated replication-competent VTT carrying the firefly luciferase gene of Photinus pyralis (rTV-Fluc was established and standardized for critical parameters that included the choice of cell line, viral infection dose, and the infection time. The current study evaluated the maintenance of virus-specific immunity after smallpox vaccination by conducting a non-randomized, cross-sectional analysis of antiviral antibody-mediated immune responses in volunteers examined 30-55 years after vaccination. The rTV-Fluc neutralization assay was able to detect neutralizing antibodies (NAbs against Vaccinia virus without the ability to differentiate strains of Vaccinia virus. We showed that the neutralizing titers measured by our assay were similar to those obtained by the traditional plaque reduction neutralization test (PRNT. Using this assay, we found a low prevalence of NAb to VTT (7.6% in individuals born before 1980 from Beijing and Anhui provinces in China, and when present, anti-VTT NAb titers were low. No NAbs were detected in all 222 samples from individuals born after 1980. There was no significant difference observed for titer or prevalence by gender, age range and geographic origin. CONCLUSION: A simplified, sensitive, standardized, reproducible, and high-throughput assay was developed for the quantitation of NAbs against different Vaccinia strains. The current study provides useful insights for the future development of VTT-based vaccination in

  11. Conjunctival tumor caused by Epstein-Barr virus-related infectious mononucleosis: Case report and review of literature.

    Science.gov (United States)

    Vaivanijkul, Juntarut; Boonsiri, Kreopun

    2017-04-01

    The conjunctival tumor associated with Epstein-Barr virus related infectious mononucleosis is a rare ocular manifestation. Only a few cases have been reported in the literature. We reported this rare condition that presented in a 5-year-old boy.

  12. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Directory of Open Access Journals (Sweden)

    Sanda Miloslav

    2010-05-01

    Full Text Available Abstract Background Vaccinia virus, one of the best known members of poxvirus family, has a wide host range both in vivo and in vitro. The expression of Flt3 ligand (FL by recombinant vaccinia virus (rVACV highly influenced properties of the virus in dependence on the level of expression. Results High production of FL driven by the strong synthetic promoter decreased the growth of rVACV in macrophage cell line J774.G8 in vitro as well as its multiplication in vivo when inoculated in mice. The inhibition of replication in vivo was mirrored in low levels of antibodies against vaccinia virus (anti-VACV which nearly approached to the negative serum level in non-infected mice. Strong FL expression changed not only the host range of the recombinant but also the basic protein contents of virions. The major proteins - H3L and D8L - which are responsible for the virus binding to the cells, and 28 K protein that serves as a virulence factor, were changed in the membrane portion of P13-E/L-FL viral particles. The core virion fraction contained multiple larger, uncleaved proteins and a higher amount of cellular proteins compared to the control virus. The overexpression of FL also resulted in its incorporation into the viral core of P13-E/L-FL IMV particles. In contrary to the equimolar ratio of glycosylated and nonglycosylated FL forms found in cells transfected with the expression plasmid, the recombinant virus incorporated mainly the smaller, nonglycosylated FL. Conclusions It has been shown that the overexpression of the Flt3L gene in VACV results in the attenuation of the virus in vivo.

  13. Cambios en virus vaccinia durante la síntesis de RNA in vitro

    Directory of Open Access Journals (Sweden)

    Julio Enrique Ospina

    1971-01-01

    Full Text Available Observaciones al microscopio electrónico de virus vaccinia previamente incubados en una mezcla para la reacción de RNA polimerasa in vitro, demuestran características alteraciones morfológicas en los virus. Estructuras similares a vesículas y ocasionalmente túbulos se formaron a partir de la membrana externa del virus. Uno de los sustituyentes de la reacción de RNA polimerasa in vitro, mercaptoetanol 0.007M, es el causante de esta alteración. El cambio morfológico se acompaña de pérdida de la infectividad viral. La presencia de grupos sulfhidrilo en la mezcla de la reacción enzimática es esencial para la ocurrencia de la síntesis de RNA de vaccinia in vitro. Esta condición no se pudo sustituir por choque térmico a 70C. ni por digestión parcial del virus por tripsina. Una gran variedad de compuestos con grupos sulfhidrilo pueden reemplazar el mercaptoetanol con efectividad variable. El más activo de ellos fué el ditiotreitol. Un período de latencia de 8 minutos ocurre entre la adición de vaccinia a la mezcla completa para la reacción de RNA polimerasa y la detección de síntesis de RNA. Los datos recolectados sugieren que cambios dependientes del mercaptoetanol ocurren durante este período.

  14. The role of signalling and the cytoskeleton during Vaccinia Virus egress.

    Science.gov (United States)

    Leite, Flavia; Way, Michael

    2015-11-02

    Viruses are obligate intracellular parasites that are critically dependent on their hosts to replicate and generate new progeny. To achieve this goal, viruses have evolved numerous elegant strategies to subvert and utilise the different cellular machineries and processes of their unwilling hosts. Moreover, they often accomplish this feat with a surprisingly limited number of proteins. Among the different systems of the cell, the cytoskeleton is often one of the first to be hijacked as it provides a convenient transport system for viruses to reach their site of replication with relative ease. At the latter stages of their replication cycle, the cytoskeleton also provides an efficient means for newly assembled viral progeny to reach the plasma membrane and leave the infected cell. In this review we discuss how Vaccinia virus takes advantage of the microtubule and actin cytoskeletons of its host to promote the spread of infection into neighboring cells. In particular, we highlight how analysis of actin-based motility of Vaccinia has provided unprecedented insights into how a phosphotyrosine-based signalling network is assembled and functions to stimulate Arp2/3 complex-dependent actin polymerization. We also suggest that the formin FHOD1 promotes actin-based motility of the virus by capping the fast growing ends of actin filaments rather than directly promoting filament assembly. We have come a long way since 1976, when electron micrographs of vaccinia-infected cells implicated the actin cytoskeleton in promoting viral spread. Nevertheless, there are still many unanswered questions concerning the role of signalling and the host cytoskeleton in promoting viral spread and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development.

    Science.gov (United States)

    Volz, A; Sutter, G

    2017-01-01

    Safety tested Modified Vaccinia virus Ankara (MVA) is licensed as third-generation vaccine against smallpox and serves as a potent vector system for development of new candidate vaccines against infectious diseases and cancer. Historically, MVA was developed by serial tissue culture passage in primary chicken cells of vaccinia virus strain Ankara, and clinically used to avoid the undesirable side effects of conventional smallpox vaccination. Adapted to growth in avian cells MVA lost the ability to replicate in mammalian hosts and lacks many of the genes orthopoxviruses use to conquer their host (cell) environment. As a biologically well-characterized mutant virus, MVA facilitates fundamental research to elucidate the functions of poxvirus host-interaction factors. As extremely safe viral vectors MVA vaccines have been found immunogenic and protective in various preclinical infection models. Multiple recombinant MVA currently undergo clinical testing for vaccination against human immunodeficiency viruses, Mycobacterium tuberculosis or Plasmodium falciparum. The versatility of the MVA vector vaccine platform is readily demonstrated by the swift development of experimental vaccines for immunization against emerging infections such as the Middle East Respiratory Syndrome. Recent advances include promising results from the clinical testing of recombinant MVA-producing antigens of highly pathogenic avian influenza virus H5N1 or Ebola virus. This review summarizes our current knowledge about MVA as a unique strain of vaccinia virus, and discusses the prospects of exploiting this virus as research tool in poxvirus biology or as safe viral vector vaccine to challenge existing and future bottlenecks in vaccinology. © 2017 Elsevier Inc. All rights reserved.

  16. Can vaccinia virus be replaced by MVA virus for testing virucidal activity of chemical disinfectants?

    Directory of Open Access Journals (Sweden)

    Rapp Ingrid

    2010-06-01

    Full Text Available Abstract Background Vaccinia virus strain Lister Elstree (VACV is a test virus in the DVV/RKI guidelines as representative of the stable enveloped viruses. Since the potential risk of laboratory-acquired infections with VACV persists and since the adverse effects of vaccination with VACV are described, the replacement of VACV by the modified vaccinia Ankara strain (MVA was studied by testing the activity of different chemical biocides in three German laboratories. Methods The inactivating properties of different chemical biocides (peracetic acid, aldehydes and alcohols were tested in a quantitative suspension test according to the DVV/RKI guideline. All tests were performed with a protein load of 10% fetal calf serum with both viruses in parallel using different concentrations and contact times. Residual virus was determined by endpoint dilution method. Results The chemical biocides exhibited similar virucidal activity against VACV and MVA. In three cases intra-laboratory differences were determined between VACV and MVA - 40% (v/v ethanol and 30% (v/v isopropanol are more active against MVA, whereas MVA seems more stable than VACV when testing with 0.05% glutardialdehyde. Test accuracy across the three participating laboratories was high. Remarkably inter-laboratory differences in the reduction factor were only observed in two cases. Conclusions Our data provide valuable information for the replacement of VACV by MVA for testing chemical biocides and disinfectants. Because MVA does not replicate in humans this would eliminate the potential risk of inadvertent inoculation with vaccinia virus and disease in non-vaccinated laboratory workers.

  17. Nucleic acid-based fluorescent probes and their analytical potential

    OpenAIRE

    Juskowiak, Bernard

    2010-01-01

    It is well known that nucleic acids play an essential role in living organisms because they store and transmit genetic information and use that information to direct the synthesis of proteins. However, less is known about the ability of nucleic acids to bind specific ligands and the application of oligonucleotides as molecular probes or biosensors. Oligonucleotide probes are single-stranded nucleic acid fragments that can be tailored to have high specificity and affinity for different targets...

  18. An E2?F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    OpenAIRE

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 ?m s?1, consistent with...

  19. Vectores recombinantes basados en el virus Vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis

    OpenAIRE

    Pérez Jiménez, Eva; Larraga, Vicente; Esteban, Mariano

    2005-01-01

    Vectores recombinantes basados en el virus vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis. Los vectores de la invención contienen secuencias codificantes de la proteína LACK, preferentemente insertadas en el locus de hemaglutinina del virus y bajo el control de un promotor que permite su expresión a lo largo del ciclo de infección del virus. Son vectores seguros, estables, que dan lugar a una potente respuesta inmune que confiere protección frente a la leishmaniasis,...

  20. CD69 Deficiency Enhances the Host Response to Vaccinia Virus Infection through Altered NK Cell Homeostasis.

    Science.gov (United States)

    Notario, Laura; Alari-Pahissa, Elisenda; de Molina, Antonio; Lauzurica, Pilar

    2016-07-15

    During the host response to viral infection, the transmembrane CD69 protein is highly upregulated in all immune cells. We have studied the role of CD69 in the murine immune response to vaccinia virus (VACV) infection, and we report that the absence of CD69 enhances protection against VACV at both short and long times postinfection in immunocompetent and immunodeficient mice. Natural killer (NK) cells were implicated in the increased infection control, since the differences were greatly diminished when NK cells were depleted. This role of NK cells was not based on an altered NK cell reactivity, since CD69 did not affect the NK cell activation threshold in response to major histocompatibility complex class I NK cell targets or protein kinase C activation. Instead, NK cell numbers were increased in the spleen and peritoneum of CD69-deficient infected mice. That was not just secondary to better infection control in CD69-deficient mice, since NK cell numbers in the spleens and the blood of uninfected CD69(-/-) mice were already augmented. CD69-deficient NK cells from infected mice did not have an altered proliferation capacity. However, a lower spontaneous cell death rate was observed for CD69(-/-) lymphocytes. Thus, our results suggest that CD69 limits the innate immune response to VACV infection at least in part through cell homeostatic survival. We show that increased natural killer (NK) cell numbers augment the host response and survival after infection with vaccinia virus. This phenotype is found in the absence of CD69 in immunocompetent and immunodeficient hosts. As part of the innate immune system, NK lymphocytes are activated and participate in the defense against infection. Several studies have focused on the contribution of NK cells to protection against infection with vaccinia virus. In this study, it was demonstrated that the augmented early NK cell response in the absence of CD69 is responsible for the increased protection seen during infection with

  1. The Nucleic Acid Database: new features and capabilities.

    Science.gov (United States)

    Coimbatore Narayanan, Buvaneswari; Westbrook, John; Ghosh, Saheli; Petrov, Anton I; Sweeney, Blake; Zirbel, Craig L; Leontis, Neocles B; Berman, Helen M

    2014-01-01

    The Nucleic Acid Database (NDB) (http://ndbserver.rutgers.edu) is a web portal providing access to information about 3D nucleic acid structures and their complexes. In addition to primary data, the NDB contains derived geometric data, classifications of structures and motifs, standards for describing nucleic acid features, as well as tools and software for the analysis of nucleic acids. A variety of search capabilities are available, as are many different types of reports. This article describes the recent redesign of the NDB Web site with special emphasis on new RNA-derived data and annotations and their implementation and integration into the search capabilities.

  2. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

    Science.gov (United States)

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php PMID:26896846

  3. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid.

    Science.gov (United States)

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php. © The Author(s) 2016. Published by Oxford University Press.

  4. Comparative Proteomics of Human Monkeypox and Vaccinia Intracellular Mature and Extracellular Enveloped Virions

    Energy Technology Data Exchange (ETDEWEB)

    Manes, Nathan P.; Estep, Ryan D.; Mottaz, Heather M.; Moore, Ronald J.; Clauss, Therese RW; Monroe, Matthew E.; Du, Xiuxia; Adkins, Joshua N.; Wong, Scott; Smith, Richard D.

    2008-03-07

    Orthopoxviruses are the largest and most complex of the animal viruses. In response to the recent emergence of monkeypox in Africa and the threat of smallpox bioterrorism, virulent (monkeypox virus) and benign (vaccinia virus) orthopoxviruses were proteomically compared with the goal of identifying proteins required for pathogenesis. Orthopoxviruses were grown in HeLa cells to two different viral forms (intracellular mature virus and extracellular enveloped virus), purified by sucrose gradient ultracentrifugation, denatured using RapiGest™ surfactant, and digested with trypsin. Unfractionated samples and strong cation exchange HPLC fractions were analyzed by reversed-phase LC-MS/MS, and analyses of the MS/MS spectra using SEQUEST® and X! Tandem resulted in the identification of hundreds of monkeypox, vaccinia, and copurified host proteins. The unfractionated samples were additionally analyzed by LC-MS on an LTQ-Orbitrap™, and the accurate mass and elution time tag approach was used to perform quantitative comparisons. Possible pathophysiological roles of differentially expressed orthopoxvirus genes are discussed.

  5. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2017-05-01

    Full Text Available Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy.

  6. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246

    Directory of Open Access Journals (Sweden)

    Earl R. Kern

    2010-12-01

    Full Text Available Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  7. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36.

    Science.gov (United States)

    Johnston, Sara C; Ward, Brian M

    2009-02-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress.

  8. Vaccinia Virus Natural Infections in Brazil: The Good, the Bad, and the Ugly

    Directory of Open Access Journals (Sweden)

    Jaqueline Silva de Oliveira

    2017-11-01

    Full Text Available The orthopoxviruses (OPV comprise several emerging viruses with great importance to human and veterinary medicine, including vaccinia virus (VACV, which causes outbreaks of bovine vaccinia (BV in South America. Historically, VACV is the most comprehensively studied virus, however, its origin and natural hosts remain unknown. VACV was the primary component of the smallpox vaccine, largely used during the smallpox eradication campaign. After smallpox was declared eradicated, the vaccination that conferred immunity to OPV was discontinued, favoring a new contingent of susceptible individuals to OPV. VACV infections occur naturally after direct contact with infected dairy cattle, in recently vaccinated individuals, or through alternative routes of exposure. In Brazil, VACV outbreaks are frequently reported in rural areas, affecting mainly farm animals and humans. Recent studies have shown the role of wildlife in the VACV transmission chain, exploring the role of wild rodents as reservoirs that facilitate VACV spread throughout rural areas. Furthermore, VACV circulation in urban environments and the significance of this with respect to public health, have also been explored. In this review, we discuss the history, epidemiological, ecological and clinical aspects of natural VACV infections in Brazil, also highlighting alternative routes of VACV transmission, the factors involved in susceptibility to infection, and the natural history of the disease in humans and animals, and the potential for dissemination to urban environments.

  9. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Science.gov (United States)

    Haddad, Dana

    2017-01-01

    Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV) strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy. PMID:28589082

  10. Expression of CCL19 from Oncolytic Vaccinia Enhances Immunotherapeutic Potential while Maintaining Oncolytic Activity

    Directory of Open Access Journals (Sweden)

    Jun Li

    2012-12-01

    Full Text Available Promising phase II clinical results have been reported recently for several oncolytic viral therapeutics, including strains based on vaccinia virus. One reason for this has been an increased appreciation of the critical therapeutic importance of the immune response raised by these viruses. However, the most commonly used approaches to enhance these immunotherapeutic effects in oncolytic viruses, typically though expression of cytokine transgenes, often also result in a reduction in oncolytic activity and premature clearance of the virotherapy from the tumor. Approaches that enhance the immunotherapeutic effects while maintaining oncolytic activity would therefore be beneficial. Here, it is demonstrated that the expression of the chemokine CCL19 (ELC from an oncolytic vaccinia virus (vvCCL19 results in increased antitumor effects in syngeneic mouse tumor models. This corresponded with increased t cell and dendritic cell infiltration into the tumor. However, vvCCL19 persisted in the tumor at equivalent levels to a control virus without CCL19, demonstrating that oncolytic activity was not curtailed. Instead, vvCCL19 was cleared rapidly and selectively from normal tissues and organs, indicating a potentially increased safety profile. The therapeutic activity of vvCCL19 could be further significantly increased through combination with adoptive transfer of therapeutic immune cells expressing CCR7, the receptor for CCL19. This approach therefore represents a means to increase the safety and therapeutic benefit of oncolytic viruses, used alone or in combination with immune cell therapies.

  11. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246.

    Science.gov (United States)

    Quenelle, Debra C; Kern, Earl R

    2010-12-01

    Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  12. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  13. Crosstalk between immune cell and oncolytic vaccinia therapy enhances tumor trafficking and antitumor effects.

    Science.gov (United States)

    Sampath, Padma; Li, Jun; Hou, Weizhou; Chen, Hannah; Bartlett, David L; Thorne, Steve H

    2013-03-01

    The combination of an oncolytic virus, that directly destroys tumor cells and mediates an acute immune response, with an immune cell therapy, capable of further enlisting and enhancing the host immune response, has the potential to create a potent therapeutic effect. We have previously developed several strategies for optimizing the delivery of oncolytic vaccinia virus vectors to their tumor targets, including the use of immune cell-based carrier vehicles and the incorporation of mutations that increase production of the enveloped form of vaccinia (extracellular enveloped viral (EEV)) that is better adapted to spread within a host. Here, we initially combine these approaches to create a novel therapeutic, consisting of an immune cell (cytokine-induced killer, CIK) preloaded with an oncolytic virus that is EEV enhanced. This resulted in direct interaction between the viral and immune cell components with each assisting the other in directing the therapy to the tumor and so enhancing the antitumor effects. This effect could be further improved through CCL5 expression from the virus. The resulting multicomponent therapy displays the ability for synergistic crosstalk between components, so significantly enhancing tumor trafficking and antitumor effects.

  14. Whole cell cryo-electron tomography reveals distinct disassembly intermediates of vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Marek Cyrklaff

    Full Text Available At each round of infection, viruses fall apart to release their genome for replication, and then reassemble into stable particles within the same host cell. For most viruses, the structural details that underlie these disassembly and assembly reactions are poorly understood. Cryo-electron tomography (cryo-ET, a unique method to investigate large and asymmetric structures at the near molecular resolution, was previously used to study the complex structure of vaccinia virus (VV. Here we study the disassembly of VV by cryo-ET on intact, rapidly frozen, mammalian cells, infected for up to 60 minutes. Binding to the cell surface induced distinct structural rearrangements of the core, such as a shape change, the rearrangement of its surface spikes and de-condensation of the viral DNA. We propose that the cell surface induced changes, in particular the decondensation of the viral genome, are a prerequisite for the subsequent release of the vaccinia DNA into the cytoplasm, which is followed by its cytoplasmic replication. Generally, this is the first study that employs whole cell cryo-ET to address structural details of pathogen-host cell interaction.

  15. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune response and tumor imaging.

    Science.gov (United States)

    Parviainen, S; Ahonen, M; Diaconu, I; Hirvinen, M; Karttunen, Å; Vähä-Koskela, M; Hemminki, A; Cerullo, V

    2014-02-01

    Oncolytic vaccinia virus is an attractive platform for immunotherapy. Oncolysis releases tumor antigens and provides co-stimulatory danger signals. However, arming the virus can improve efficacy further. CD40 ligand (CD40L, CD154) can induce apoptosis of tumor cells and it also triggers several immune mechanisms. One of these is a T-helper type 1 (Th1) response that leads to activation of cytotoxic T-cells and reduction of immune suppression. Therefore, we constructed an oncolytic vaccinia virus expressing hCD40L (vvdd-hCD40L-tdTomato), which in addition features a cDNA expressing the tdTomato fluorochrome for detection of virus, potentially important for biosafety evaluation. We show effective expression of functional CD40L both in vitro and in vivo. In a xenograft model of bladder carcinoma sensitive to CD40L treatment, we show that growth of tumors was significantly inhibited by the oncolysis and apoptosis following both intravenous and intratumoral administration. In a CD40-negative model, CD40L expression did not add potency to vaccinia oncolysis. Tumors treated with vvdd-mCD40L-tdtomato showed enhanced efficacy in a syngenic mouse model and induced recruitment of antigen-presenting cells and lymphocytes at the tumor site. In summary, oncolytic vaccinia virus coding for CD40L mediates multiple antitumor effects including oncolysis, apoptosis and induction of Th1 type T-cell responses.

  16. Mutations Conferring Resistance to Viral DNA Polymerase Inhibitors in Camelpox Virus Give Different Drug-Susceptibility Profiles in Vaccinia Virus

    Czech Academy of Sciences Publication Activity Database

    Duraffour, S.; Andrei, G.; Topalis, D.; Krečmerová, Marcela; Crance, J. M.; Garin, D.; Snoeck, R.

    2012-01-01

    Roč. 86, č. 13 (2012), s. 7310-7325 ISSN 0022-538X Institutional support: RVO:61388963 Keywords : camelpox virus * CMLV * vaccinia virus VACV * acyclic nucleoside phosphonates * HPMPDAP * cidofovir * drug resistance Subject RIV: CC - Organic Chemistry Impact factor: 5.076, year: 2012

  17. Safety and immunogenicity of LC16m8, an attenuated smallpox vaccine in vaccinia-naive adults.

    Science.gov (United States)

    Kennedy, Jeffrey S; Gurwith, Marc; Dekker, Cornelia L; Frey, Sharon E; Edwards, Kathryn M; Kenner, Julie; Lock, Michael; Empig, Cyril; Morikawa, Shigeru; Saijo, Masayuki; Yokote, Hiroyuki; Karem, Kevin; Damon, Inger; Perlroth, Mark; Greenberg, Richard N

    2011-11-01

    LC16m8 is an attenuated cell culture-adapted Lister vaccinia smallpox vaccine missing the B5R protein and licensed for use in Japan. We conducted a phase I/II clinical trial that compared the safety and immunogenicity of LC16m8 with Dryvax in vaccinia-naive participants. Adverse events were assessed, as were electrocardiography and laboratory testing for cardiotoxicity and viral culturing of the vaccination sites. Neutralization titers to vaccinia, monkeypox, and variola major were assessed and cell-mediated immune responses were measured by interferon (IFN)-γ enzyme-linked immunosorbent spot and lymphoproliferation assays. Local and systemic reactions after vaccination with LC16m8 were similar to those reported after Dryvax. No clinically significant abnormalities consistent with cardiac toxicity were seen for either vaccine. Both vaccines achieved antivaccinia, antivariola, and antimonkeypox neutralizing antibody titers >1:40, although the mean plaque reduction neutralization titer of LC16m8 at day 30 after vaccination was significantly lower than Dryvax for anti-NYCBH vaccinia (P smallpox. Clinical Trials Registration. NCT00103584.

  18. Chemical inactivation of recombinant vaccinia viruses and the effects on antigenicity and immunogenicity of recombinant simian immunodeficiency virus envelope glycoproteins.

    NARCIS (Netherlands)

    E.G.J. Hulskotte (Ellen); M.E.M. Dings (Marlinda); S.G. Norley (Stephen); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractThe efficiency of paraformaldehyde (PFA) and binary ethylenimine (BEI) in inactivating recombinant vaccinia virus (rVV), present in baby hamster kidney cells expressing simian immunodeficiency virus envelope glycoproteins (SIV-Env), was measured in a series of inactivation studies. Both

  19. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader

    NARCIS (Netherlands)

    Schwer, B; Visca, P.; Vos, J C; Stunnenberg, H.G.

    1987-01-01

    We have demonstrated by primer elongation and cap analysis that mature vaccinia virus late transcripts are discontinuously synthesized. We have shown that RNA transcripts from a translocated 11K and from the authentic 11K and 4b late promoters are extended by approximately 35 nucleotides beyond the

  20. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens

    NARCIS (Netherlands)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Pijlman, Gorben P.

    2016-01-01

    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious

  1. Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R

    Directory of Open Access Journals (Sweden)

    Hardie Grahame

    2000-09-01

    Full Text Available Abstract Background Vaccinia virus gene B1R encodes a serine/threonine protein kinase. In vitro this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions. Results Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase in vitro, digested with V8 protease, and phosphopeptides separated by HPLC. The N-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala. Conclusions We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated in vivo.

  2. Concanavalin A-mediated cell agglutinability induced by Vaccinia virions. [Uv radiation, /sup 125/I tracer technique

    Energy Technology Data Exchange (ETDEWEB)

    Mbuy, G.; Bubel, H.C.

    1978-12-01

    The induction of enhanced concanavalin A (Con A)-mediated cellular agglutinability by purified vaccinia virus was examined quantitatively. Increased HEp-2 cell agglutinability by the lectin occurred within the first hour of infection and persisted without further change throughout the virus infectious cycle. Ultraviolet, but not heat-inactivated, virus was as effective as infectious virus in causing increased Con A agglutinability. Inhibition of viral and host cell protein synthesis by Streptovitacin A failed to alter the lectin response to vaccinia virus infection. Fluorescein-labeled Con A was observed to form clusters and large fluorescent patches on the infected cell surface during the earliest stage of infection. Studies with /sup 125/I-labeled Con A revealed an early but minimal increase in lectin binding to infected cells. After the first hour of infection, no further increase in Con A binding was observed. When cells were exposed to purified vaccinia virus surface tubules increased Con A agglutinability comparable to that obtained with native virus was demonstrated. Con A-mediated agglutinability of cells was temperature-dependent and displayed a higher temperature transition in infected cells. These data suggest that upon contact with the host cell, vaccinia virions or surface tubules induce alterations in the plasma membrane which are reflected in an enhanced agglutinability by Con A.

  3. Antibody responses against xenotropic murine leukemia virus-related virus envelope in a murine model.

    Directory of Open Access Journals (Sweden)

    Natalia Makarova

    2011-04-01

    Full Text Available Xenotropic murine leukemia virus-related virus (XMRV was recently discovered to be the first human gammaretrovirus that is associated with chronic fatigue syndrome and prostate cancer (PC. Although a mechanism for XMRV carcinogenesis is yet to be established, this virus belongs to the family of gammaretroviruses well known for their ability to induce cancer in the infected hosts. Since its original identification XMRV has been detected in several independent investigations; however, at this time significant controversy remains regarding reports of XMRV detection/prevalence in other cohorts and cell type/tissue distribution. The potential risk of human infection, coupled with the lack of knowledge about the basic biology of XMRV, warrants further research, including investigation of adaptive immune responses. To study immunogenicity in vivo, we vaccinated mice with a combination of recombinant vectors expressing codon-optimized sequences of XMRV gag and env genes and virus-like particles (VLP that had the size and morphology of live infectious XMRV.Immunization elicited Env-specific binding and neutralizing antibodies (NAb against XMRV in mice. The peak titers for ELISA-binding antibodies and NAb were 1:1024 and 1:464, respectively; however, high ELISA-binding and NAb titers were not sustained and persisted for less than three weeks after immunizations.Vaccine-induced XMRV Env antibody titers were transiently high, but their duration was short. The relatively rapid diminution in antibody levels may in part explain the differing prevalences reported for XMRV in various prostate cancer and chronic fatigue syndrome cohorts. The low level of immunogenicity observed in the present study may be characteristic of a natural XMRV infection in humans.

  4. No association of xenotropic murine leukemia virus-related viruses with prostate cancer.

    Science.gov (United States)

    Switzer, William M; Jia, Hongwei; Zheng, Haoqiang; Tang, Shaohua; Heneine, Walid

    2011-05-04

    The association of the xenotropic murine leukemia virus-related virus (XMRV) with prostate cancer continues to receive heightened attention as studies report discrepant XMRV prevalences ranging from zero up to 23%. It is unclear if differences in the diagnostic testing, disease severity, geography, or other factors account for the discordant results. We report here the prevalence of XMRV in a population with well-defined prostate cancers and RNase L polymorphism. We used broadly reactive PCR and Western blot (WB) assays to detect infection with XMRV and related murine leukemia viruses (MLV). We studied specimens from 162 US patients diagnosed with prostate cancer with a intermediate to advanced stage (Gleason Scores of 5-10; moderate (46%) poorly differentiated tumors (54%)). Prostate tissue DNA was tested by PCR assays that detect XMRV and MLV variants. To exclude contamination with mouse DNA, we also designed and used a mouse-specific DNA PCR test. Detailed phylogenetic analysis was used to infer evolutionary relationships. RNase L typing showed that 9.3% were homozygous (QQ) for the R462Q RNase L mutation, while 45.6% and 45.1% were homozygous or heterozygous, respectively. Serologic testing was performed by a WB test. Three of 162 (1.9%) prostate tissue DNA were PCR-positive for XMRV and had undetectable mouse DNA. None was homozygous for the QQ mutation. Plasma from all three persons was negative for viral RNA by RT-PCR. All 162 patients were WB negative. Phylogenetic analysis inferred a distinct XMRV. We found a very low prevalence of XMRV in prostate cancer patients. Infection was confirmed by phylogenetic analysis and absence of contaminating mouse DNA. The finding of undetectable antibodies and viremia in all three patients may reflect latent infection. Our results do not support an association of XMRV or MLV variants with prostate cancer.

  5. Variation of the virus-related elements within syntenic genomes of the hyperthermophilic Archaeon Aeropyrum.

    Science.gov (United States)

    Daifuku, Takashi; Yoshida, Takashi; Kitamura, Takayuki; Kawaichi, Satoshi; Inoue, Takahiro; Nomura, Keigo; Yoshida, Yui; Kuno, Sotaro; Sako, Yoshihiko

    2013-10-01

    The increasing number of genome sequences of archaea and bacteria show their adaptation to different environmental conditions at the genomic level. Aeropyrum spp. are aerobic and hyperthermophilic archaea. Aeropyrum camini was isolated from a deep-sea hydrothermal vent, and Aeropyrum pernix was isolated from a coastal solfataric vent. To investigate the adaptation strategy in each habitat, we compared the genomes of the two species. Shared genome features were a small genome size, a high GC content, and a large portion of orthologous genes (86 to 88%). The genomes also showed high synteny. These shared features may have been derived from the small number of mobile genetic elements and the lack of a RecBCD system, a recombinational enzyme complex. In addition, the specialized physiology (aerobic and hyperthermophilic) of Aeropyrum spp. may also contribute to the entire-genome similarity. Despite having stable genomes, interference of synteny occurred with two proviruses, A. pernix spindle-shaped virus 1 (APSV1) and A. pernix ovoid virus 1 (APOV1), and clustered regularly interspaced short palindromic repeat (CRISPR) elements. Spacer sequences derived from the A. camini CRISPR showed significant matches with protospacers of the two proviruses infecting A. pernix, indicating that A. camini interacted with viruses closely related to APSV1 and APOV1. Furthermore, a significant fraction of the nonorthologous genes (41 to 45%) were proviral genes or ORFans probably originating from viruses. Although the genomes of A. camini and A. pernix were conserved, we observed nonsynteny that was attributed primarily to virus-related elements. Our findings indicated that the genomic diversification of Aeropyrum spp. is substantially caused by viruses.

  6. EGVI endoglucanase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

    2010-10-05

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  7. EGVI endoglucanase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

    2010-10-12

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  8. Molecular Structure of Nucleic Acids–A Structure for Deoxyribose ...

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Resonance – Journal of Science Education; Volume 9; Issue 11. Molecular Structure of Nucleic Acids – A Structure for Deoxyribose Nucleic Acid. J D Watson F H C Crick. Classics Volume 9 Issue 11 November 2004 pp 96-98 ...

  9. Unlocked nucleic acid - an RNA modification with broad potential

    DEFF Research Database (Denmark)

    Pasternak, Anna; Wengel, Jesper

    2011-01-01

    The first unlocked nucleic acid (UNA) monomer was described more than a decade ago, but only recent reports have revealed the true potential applications of this acyclic RNA mimic. UNA monomers enable the modulation of the thermodynamic stability of various nucleic acid structures such as RNA and...

  10. Nucleic acid drugs: a novel approach | Jarald | African Journal of ...

    African Journals Online (AJOL)

    Nucleic acid base sequence of proteins plays a crucial role in the expression of gene. The gene is responsible for the synthesis of proteins and these proteins, which are synthesized, are responsible for the biological process and also for dreadful diseases as well. Once if the nucleic acid sequence is altered, we would be ...

  11. Nucleic Acid Therapy: from humble beginnings a dynamic technology

    CSIR Research Space (South Africa)

    Millroy, L

    2011-02-01

    Full Text Available The term “nucleic acid therapy” encompasses a wide range of technologies for the treatment of a range of plant and animal ailments. As the name implies, it makes use of nucleic acid (either DNA or RNA) as a therapeutic agent. There are six branches...

  12. Nucleic Acid Amplification Testing in Suspected Child Sexual Abuse

    Science.gov (United States)

    Esernio-Jenssen, Debra; Barnes, Marilyn

    2011-01-01

    The American Academy of Pediatrics recommends that site-specific cultures be obtained, when indicated, for sexually victimized children. Nucleic acid amplification testing is a highly sensitive and specific methodology for identifying sexually transmitted infections. Nucleic acid amplification tests are also less invasive than culture, and this…

  13. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  14. Gene Targeting and Expression Modulation by Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2010-01-01

    Peptide nucleic acids (PNA) are artificial structural mimics of nucleic acids capable of sequence specific hybridization to both RNA and DNA. Thus they have obvious potential as gene targeting agents for drug discovery approaches. An overview with emphasis on recent progress on RNA "interference"...

  15. Detecting Microbial Nucleic Acids within Nematode Bodies: A Photo Essay

    Science.gov (United States)

    We developed a taxa-specific, fluorescence in situ hybridization (FISH) technique to localize microbial nucleic acids within nematode bodies. This technique involves hybridization of a nucleic acid probe to target microbial sequences. Hybridization is detected microscopically, as the probes have f...

  16. Peptide Nucleic Acids Having Enhanced Binding Affinity and Sequence Specificity

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than a corresponding DNA strand, and exhibit increased sequence specificity and binding affinity. Methods of increasing binding affinity and sequence specificity of peptide nucleic acids...

  17. Nucleic acid based fluorescent sensor for mercury detection

    Science.gov (United States)

    Lu, Yi; Liu, Juewen

    2013-02-05

    A nucleic acid enzyme comprises an oligonucleotide containing thymine bases. The nucleic acid enzyme is dependent on both Hg.sup.2+and a second ion as cofactors, to produce a product from a substrate. The substrate comprises a ribonucleotide, a deoxyribonucleotide, or both.

  18. Circulating nucleic acids damage DNA of healthy cells by integrating ...

    Indian Academy of Sciences (India)

    Whether nucleic acids that circulate in blood have any patho-physiological functions in the host have not been explored. We report here that far from being inert molecules, circulating nucleic acids have significant biological activities of their own that are deleterious to healthy cells of the body. Fragmented DNA and ...

  19. EGVI endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  20. EGVII endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  1. EGVII endoglucanase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2012-02-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  2. Use of Nucleic Acid Analogues in Diagnostics and Analytical Procedures

    DEFF Research Database (Denmark)

    2002-01-01

    Methods of capture, recognition, detection, identification or quantitation of nucleic acids and diagnostics uses generally are described in which are used: (a) a peptide nucleic acid (PNA) comprising a polyamide backbone bearing a plurality of ligands at respective spaced locations along said...

  3. Cytosolic nucleic acid sensors and innate immune regulation.

    Science.gov (United States)

    Ori, Daisuke; Murase, Motoya; Kawai, Taro

    2017-03-04

    During viral and bacterial infections, pathogen-derived cytosolic nucleic acids are recognized by the intracellular RNA sensors retinoic acid-inducible gene I and melanoma-differentiated gene 5 and intracellular DNA sensors, including cyclic-di-GMP-AMP synthase, absent in melanoma 2, interferon (IFN)-gamma inducible protein 16, polymerase III, and so on. Binding of intracellular nucleic acids to these sensors activates downstream signaling cascades, resulting in the production of type I IFNs and pro-inflammatory cytokines to induce appropriate systematic immune responses. While these sensors also recognize endogenous nucleic acids and activate immune responses, they can discriminate between self- and non-self-nucleic acids. However, dysfunction of these sensors or failure of regulatory mechanisms causes aberrant activation of immune response and autoimmune disorders. In this review, we focus on how intracellular immune sensors recognize exogenous nucleic acids and activate the innate immune system, and furthermore, how autoimmune diseases result from dysfunction of these sensors.

  4. Nucleic Acid Aptamers for Living Cell Analysis

    Science.gov (United States)

    Xiong, Xiangling; Lv, Yifan; Chen, Tao; Zhang, Xiaobing; Wang, Kemin; Tan, Weihong

    2014-06-01

    Cells as the building blocks of life determine the basic functions and properties of a living organism. Understanding the structure and components of a cell aids in the elucidation of its biological functions. Moreover, knowledge of the similarities and differences between diseased and healthy cells is essential to understanding pathological mechanisms, identifying diagnostic markers, and designing therapeutic molecules. However, monitoring the structures and activities of a living cell remains a challenging task in bioanalytical and life science research. To meet the requirements of this task, aptamers, as “chemical antibodies,” have become increasingly powerful tools for cellular analysis. This article reviews recent advances in the development of nucleic acid aptamers in the areas of cell membrane analysis, cell detection and isolation, real-time monitoring of cell secretion, and intracellular delivery and analysis with living cell models. Limitations of aptamers and possible solutions are also discussed.

  5. Electrical properties of nucleic acid bases

    Science.gov (United States)

    Basch, Harold; Garmer, D. R.; Jasien, P. G.; Krauss, M.; Stevens, W. J.

    1989-11-01

    The dipole polarizabilities for the five nucleic acid bases, uracil, cytosine, thymine, guanine, and adenine have been determined by the coupled perturbed Hartree-Fock (CPHF) method using a polarized double-zeta basis set. Electronic correlation corrections from second-order Møller-Plesset (MP2) perturbation theory are given. The treatment required to obtain accurate polarizabilities of these π systems was estimated from calculations on imidazole, benzene, and pyridine, giving results that are in good agreement with experiment. Similarly, optimal basis sets for static electrical properties were determined and applied to calculations of the dipole moments of the bases. With correlation corrections, these agree with experiment within 5% for all molecules except adenine.

  6. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    toward detailed studies of the inherent dynamics of nucleic acid structures. Moreover, the placement of FRET-pair chromophores inside the base stack will be a great advantage in studies where other (biomacro)molecules interact with the nucleic acid. Lastly, our study gives possibly the first truly solid...... distances covering up to more than one turn of the DNA duplex. Importantly, we show that the rigid stacking of the two base analogs, and consequently excellent control of their exact positions and orientations, results in a high control of the orientation factor and hence very distinct FRET changes...... as the number of bases separating tCO and tC(nitro) is varied. A set of DNA strands containing the FRET-pair at wisely chosen locations will, thus, make it possible to accurately distinguish distance- from orientation-changes using FRET. In combination with the good nucleobase analog properties, this points...

  7. Intumescent features of nucleic acids and proteins

    Energy Technology Data Exchange (ETDEWEB)

    Alongi, Jenny, E-mail: jenny.alongi@polito.it; Cuttica, Fabio; Blasio, Alessandro Di; Carosio, Federico; Malucelli, Giulio

    2014-09-10

    Highlights: • The combustion resistance of DNA and caseins to different heat fluxes was studied. • Upon heating, DNA and caseins exhibited an intumescent behaviour. • The char derived from DNA was more stable and coherent than that from caseins. - Abstract: Are nucleic acids and proteins intumescent molecules? In order to get an answer, in the present manuscript, powders of deoxyribose nucleic acids (DNA) and caseins have been exposed to different heat fluxes under a cone calorimeter source and to the direct application of a propane flame. Under these conditions, DNA and caseins exhibited a typical intumescent behaviour, generating a coherent expanded cellular carbonaceous residue (char), extremely resistant to heat exposure. The resulting volumetric expansion as well as the resistance of the formed char turned out to be dependent on (i) the chemical structure of the chosen biomacromolecule, (ii) the evolution of ammonia and (iii) the adopted heat flux in cone calorimetry tests (namely, 25, 35, 50 and 75 kW/m{sup 2}). The presence of ribose units within the DNA backbone determined the formation of highly expanded and coherent residues as compared to those obtained from caseins. Indeed, under a heat flux of 35 kW/m{sup 2}, when a carbon source (i.e. common cane sugar) was added to caseins, the resulting char was similar to that formed by DNA. Furthermore, the char expansion was ascribed to the evolution of ammonia released by these biomacromolecules upon heating, as detected by thermogravimetry coupled to infrared spectroscopy, and confirmed by scanning electron microscopy experiments performed on the bubbles present in the residues of flammability tests.

  8. Structural and biochemical characterization of the inhibitor complexes of xenotropic murine leukemia virus-related virus protease

    Energy Technology Data Exchange (ETDEWEB)

    Li, Mi; Gustchina, Alla; Matúz, Krisztina; Tözsér, Jozsef; Namwong, Sirilak; Goldfarb, Nathan E.; Dunn, Ben M.; Wlodawer, Alexander (Debrecen); (NCI); (Florida); (Suan Sunandha)

    2012-10-23

    Interactions between the protease (PR) encoded by the xenotropic murine leukemia virus-related virus and a number of potential inhibitors have been investigated by biochemical and structural techniques. It was observed that several inhibitors used clinically against HIV PR exhibit nanomolar or even subnanomolar values of K{sub i}, depending on the exact experimental conditions. Both TL-3, a universal inhibitor of retroviral PRs, and some inhibitors originally shown to inhibit plasmepsins were also quite potent, whereas inhibition by pepstatin A was considerably weaker. Crystal structures of the complexes of xenotropic murine leukemia virus-related virus PR with TL-3, amprenavir and pepstatin A were solved at high resolution and compared with the structures of complexes of these inhibitors with other retropepsins. Whereas TL-3 and amprenavir bound in a predictable manner, spanning the substrate-binding site of the enzyme, two molecules of pepstatin A bound simultaneously in an unprecedented manner, leaving the catalytic water molecule in place.

  9. Infecções humanas causadas por poxvirus relacionados ao vírus vaccinia no Brasil Human infections caused by vaccinia-like poxviruses in Brazil

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr

    2009-12-01

    Full Text Available A partir de 1999, infecções humanas por Orthopoxvirus vem sendo observadas em pelo menos oito estados no país, com a formação de vesículas as quais evoluem para pústulas e crostas, principalmente nos membros superiores e face, após contacto com bovinos apresentando lesões semelhantes no úbere. Alem das lesões na pele, foram descritas nos pacientes reações ganglionares axilares por vezes dolorosas, febre, cefaléia, fadiga, desidratação, anorexia, sudorese, artralgia e mialgia, evoluindo o quadro por três a quatro semanas. Lesão vulvar bem como transmissão intrafamiliar foram igualmente descritas. Estudos moleculares demonstraram que os poxvirus identificados são geneticamente relacionados a amostras do vírus vaccinia utilizadas no passado, nas campanhas de vacinação. Especimens clínicos de 80 infecções humanas foram estudados no laboratório e a infecção por orthopoxvirus confirmada em 68 casos. São apresentadas lesões observadas em pacientes bem como discutidas as implicações desta zoonose no Brasil.Since 1999, human infection caused by Orthopoxvirus has been observed in at least eight Brazilian states, with the presence of vesicles that evolve to pustules and crusts, especially on the hands, arms and face, after contact with cows showing comparable lesions on the udder. In addition to the skin lesions, there have been descriptions of patients with axillary ganglionic reactions that are sometimes painful, along with fever, headache, fatigue, dehydration, anorexia, sudoresis, arthralgia and muscle pain. The condition evolves over a three to four-week period. Vulvar lesions and transmission within families have also been described. Molecular studies have shown that the poxviruses identified are genetically related to vaccinia virus samples that were used in vaccination campaigns in the past. Clinical specimens from 80 human infections were studied in the laboratory, and orthopoxvirus infections were confirmed in 68

  10. Genomics-enabled sensor platform for rapid detection of viruses related to disease outbreak.

    Energy Technology Data Exchange (ETDEWEB)

    Brozik, Susan M; Manginell, Ronald P; Moorman, Matthew W; Xiao, Xiaoyin; Edwards, Thayne L.; Anderson, John Moses; Pfeifer, Kent Bryant; Branch, Darren W.; Wheeler, David Roger; Polsky, Ronen; Lopez, DeAnna M.; Ebel, Gregory D.; Prasad, Abhishek N.; Brozik, James A.; Rudolph, Angela R.; Wong, Lillian P.

    2013-09-01

    Bioweapons and emerging infectious diseases pose growing threats to our national security. Both natural disease outbreak and outbreaks due to a bioterrorist attack are a challenge to detect, taking days after the outbreak to identify since most outbreaks are only recognized through reportable diseases by health departments and reports of unusual diseases by clinicians. In recent decades, arthropod-borne viruses (arboviruses) have emerged as some of the most significant threats to human health. They emerge, often unexpectedly, from cryptic transmission foci causing localized outbreaks that can rapidly spread to multiple continents due to increased human travel and trade. Currently, diagnosis of acute infections requires amplification of viral nucleic acids, which can be costly, highly specific, technically challenging and time consuming. No diagnostic devices suitable for use at the bedside or in an outbreak setting currently exist. The original goals of this project were to 1) develop two highly sensitive and specific diagnostic assays for detecting RNA from a wide range of arboviruses; one based on an electrochemical approach and the other a fluorescent based assay and 2) develop prototype microfluidic diagnostic platforms for preclinical and field testing that utilize the assays developed in goal 1. We generated and characterized suitable primers for West Nile Virus RNA detection. Both optical and electrochemical transduction technologies were developed for DNA-RNA hybridization detection and were implemented in microfluidic diagnostic sensing platforms that were developed in this project.

  11. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    Science.gov (United States)

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Effects of Helicobacter pylori infection on common lethal factors for hepatitis B virus-related cirrhosis

    Directory of Open Access Journals (Sweden)

    LI Yuling

    2015-09-01

    Full Text Available ObjectiveTo study the relationship between Helicobacter pylori (H. pylori infection and common lethal factors for hepatitis B virus-related cirrhosis (HBC. MethodsA total of 235 patients with HBC who were admitted to our hospitals from October 2008 to October 2014 were retrospectively analyzed. The infection rate of H. pylori in those patients was calculated. In the 155 patients with esophagogastric varices and 97 patients with portal hypertensive gastropathy (PHG, the infection rate of H. pylori was compared between those with different degrees of esophagogastric varices or PHG. In the 32 patients whose blood ammonia was determined, the level of blood ammonia was compared between H. pylori-positive and -negative groups. Between-group comparison of continuous data was performed by t test and analysis of variance, and between-group comparison of categorical data was performed by χ2 test. ResultsThe infection rate of H. pylori in the 235 patients with HBC was 80.85% (190/235. In the 155 patients with esophagogastric varices, who had tortuous serpentine uplift or bead-like changes of esophageal varices and tumor-like changes (with or without gastric erosion of gastric varices visible under endoscopy, there was significant difference in infection rate of H. pylori between patients with mild, moderate, and severe varices (50.55% (46/91 vs 43.59% (17/39 vs 76% (19/25, χ2=6.913, P<0.05. In the 97 patients with PHG, who had snake skin-like changes, cherry red spots, scarlet rash, and erosion bleeding of gastric mucosa visible under endoscopy, there was significant difference in infection rate of H. pylori between patients with mild and severe PHG (43.33% (26/60 vs 67.57% (25/37, χ2=5.391, P<005.In patients whose blood ammonia was determined, patients in H. pylori-positive group had a significantly higher average concentration of blood ammonia than those in H. pylori-negative group (62.76±13.43 vs 47.20±12.51 μmol/L, t= 3.39, P<0

  13. NMR study of xenotropic murine leukemia virus-related virus protease in a complex with amprenavir

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, Ayako; Okamura, Hideyasu [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Morishita, Ryo [CellFree Sciences Co. Ltd., Ehime University, Venture Business Laboratory, Matsuyama 790-8577 (Japan); Department of Microbiology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004 (Japan); Matsunaga, Satoko [Department of Microbiology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004 (Japan); Kobayashi, Naohiro; Ikegami, Takahisa [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kodaki, Tsutomu [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Takaori-Kondo, Akifumi [Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, Sakyo-ku, Kyoto 606-8507 (Japan); Ryo, Akihide [Department of Microbiology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004 (Japan); Nagata, Takashi, E-mail: nagatat@iae.kyoto-u.ac.jp [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Katahira, Masato, E-mail: katahira@iae.kyoto-u.ac.jp [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); CREST, JST, 5-3 Yonban-cho, Chiyoda-ku, Tokyo 102-8666 (Japan)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Protease (PR) of XMR virus (XMRV) was successfully synthesized with cell-free system. Black-Right-Pointing-Pointer Interface of XMRV PR with an inhibitor, amprenavir (APV), was identified with NMR. Black-Right-Pointing-Pointer Structural heterogeneity is induced for two PR protomers in the APV:PR = 1:2 complex. Black-Right-Pointing-Pointer Structural heterogeneity is transmitted even to distant regions from the interface. Black-Right-Pointing-Pointer Long-range transmission of structural change may be utilized for drug discovery. -- Abstract: Xenotropic murine leukemia virus-related virus (XMRV) is a virus created through recombination of two murine leukemia proviruses under artificial conditions during the passage of human prostate cancer cells in athymic nude mice. The homodimeric protease (PR) of XMRV plays a critical role in the production of functional viral proteins and is a prerequisite for viral replication. We synthesized XMRV PR using the wheat germ cell-free expression system and carried out structural analysis of XMRV PR in a complex with an inhibitor, amprenavir (APV), by means of NMR. Five different combinatorially {sup 15}N-labeled samples were prepared and backbone resonance assignments were made by applying Otting's method, with which the amino acid types of the [{sup 1}H, {sup 15}N] HSQC resonances were automatically identified using the five samples (Wu et al., 2006) . A titration experiment involving APV revealed that one APV molecule binds to one XMRV PR dimer. For many residues, two distinct resonances were observed, which is thought to be due to the structural heterogeneity between the two protomers in the APV:XMRV PR = 1:2 complex. PR residues at the interface with APV have been identified on the basis of chemical shift perturbation and identification of the intermolecular NOEs by means of filtered NOE experiments. Interestingly, chemical shift heterogeneity between the two protomers of XMRV PR

  14. Thy1+ Nk Cells from Vaccinia Virus-Primed Mice Confer Protection against Vaccinia Virus Challenge in the Absence of Adaptive Lymphocytes

    Science.gov (United States)

    Gillard, Geoffrey O.; Bivas-Benita, Maytal; Hovav, Avi-Hai; Grandpre, Lauren E.; Panas, Michael W.; Seaman, Michael S.; Haynes, Barton F.; Letvin, Norman L.

    2011-01-01

    While immunological memory has long been considered the province of T- and B- lymphocytes, it has recently been reported that innate cell populations are capable of mediating memory responses. We now show that an innate memory immune response is generated in mice following infection with vaccinia virus, a poxvirus for which no cognate germline-encoded receptor has been identified. This immune response results in viral clearance in the absence of classical adaptive T and B lymphocyte populations, and is mediated by a Thy1+ subset of natural killer (NK) cells. We demonstrate that immune protection against infection from a lethal dose of virus can be adoptively transferred with memory hepatic Thy1+ NK cells that were primed with live virus. Our results also indicate that, like classical immunological memory, stronger innate memory responses form in response to priming with live virus than a highly attenuated vector. These results demonstrate that a defined innate memory cell population alone can provide host protection against a lethal systemic infection through viral clearance. PMID:21829360

  15. Nucleic acid-binding polymers as anti-inflammatory agents

    Science.gov (United States)

    Lee, Jaewoo; Sohn, Jang Wook; Zhang, Ying; Leong, Kam W.; Pisetsky, David; Sullenger, Bruce A.

    2011-01-01

    Dead and dying cells release nucleic acids. These extracellular RNAs and DNAs can be taken up by inflammatory cells and activate multiple nucleic acid-sensing toll-like receptors (TLR3, 7, 8, and 9). The inappropriate activation of these TLRs can engender a variety of inflammatory and autoimmune diseases. The redundancy of the TLR family encouraged us to seek materials that can neutralize the proinflammatory effects of any nucleic acid regardless of its sequence, structure or chemistry. Herein we demonstrate that certain nucleic acid-binding polymers can inhibit activation of all nucleic acid-sensing TLRs irrespective of whether they recognize ssRNA, dsRNA or hypomethylated DNA. Furthermore, systemic administration of such polymers can prevent fatal liver injury engendered by proinflammatory nucleic acids in an acute toxic shock model in mice. Therefore these polymers represent a novel class of anti-inflammatory agent that can act as molecular scavengers to neutralize the proinflammatory effects of various nucleic acids. PMID:21844380

  16. Phosphorus SAD Phasing for Nucleic Acid Structures: Limitations and Potential

    Directory of Open Access Journals (Sweden)

    Joel M. Harp

    2016-10-01

    Full Text Available Phasing of nucleic acid crystal diffraction data using the anomalous signal of phosphorus, P-SAD, at Cukα wavelength has been previously demonstrated using Z-DNA. Since the original work on P-SAD with Z-DNA there has been, with a notable exception, a conspicuous absence of applications of the technique to additional nucleic acid crystal structures. We have reproduced the P-SAD phasing of Z-DNA using a rotating-anode source and have attempted to phase a variety of nucleic acid crystals using P-SAD without success. A comparison of P-SAD using Z-DNA and a representative nucleic acid, the Dickerson-Drew dodecamer, is presented along with a S-SAD using only two sulfurs to phase a 2’-thio modified DNA decamer. A theoretical explanation for the limitation of P-SAD applied to nucleic acids is presented to show that the relatively high atomic displacement parameter of phosphorus in the nucleic acid backbone is responsible for the lack of success in applying P-SAD to nucleic acid diffraction data.

  17. Lateral flow biosensors for the detection of nucleic acid.

    Science.gov (United States)

    Zeng, Lingwen; Lie, Puchang; Fang, Zhiyuan; Xiao, Zhuo

    2013-01-01

    The detection of nucleic acid is of central importance for the diagnosis of genetic diseases, infectious agents, and biowarfare agents. Traditional strategies and technologies for nucleic acid detection are time-consuming and labor-intensive. Recently, isothermal strand-displacement reaction-based lateral flow biosensors have attracted a great deal of research interest because they are sensitive, simple, fast, and easy to use. Here, we describe a lateral flow biosensor based on isothermal strand-displacement polymerase reaction and gold nanoparticles for the visual detection of nucleic acid.

  18. Nucleic acid detection system and method for detecting influenza

    Science.gov (United States)

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  19. Prevalence of antibodies to Vaccinia virus after smallpox vaccination in Italy.

    Science.gov (United States)

    Pütz, Mike M; Alberini, Isabella; Midgley, Claire M; Manini, Ilaria; Montomoli, Emanuele; Smith, Geoffrey L

    2005-11-01

    Decades after smallpox was eradicated and vaccination discontinued, the level of residual immunity in today's population is largely unknown. This study describes an epidemiological assessment in Italians of antibodies against the intracellular mature virus (IMV) and extracellular envelope virus (EEV) forms of Vaccinia virus. Serum samples (n = 642) were taken in 1993 and 2003 from people between 11 and 102 years old. Most citizens >27 years old were positive for antibodies to IMV and EEV. These antibodies were long-lasting and similar titres were present in citizens between 30 and 100 years old. Serum samples from 1993 and 2003 displayed very similar EEV- and IMV-specific antibody titres. By using these data and demographic considerations, it was predicted that, in 2003, 46 % of the Italian population were positive for both IMV and EEV, 42 % were negative for both and 12 % were positive for one antigen.

  20. Successful pseudorabies vaccination in maternally immune piglets using recombinant vaccinia virus vaccines.

    Science.gov (United States)

    Brockmeier, S I; Lager, K M; Mengeling, W L

    1997-01-01

    Three gilts were vaccinated with a NYVAC vaccinia recombinant expressing glycoprotein gD of pseudorabies virus (PRV) (NYVAC/gD). After farrowing, the piglets were allowed to nurse normally to obtain colostral immunity and then were divided into four groups, receiving NYVAC/gD, a NYVAC recombinant expressing glycoprotein gB of PRV (NYVAC/gB), an inactivated PRV vaccine (iPRV), or no vaccine. The piglets were vaccinated twice, three weeks apart beginning at approximately two weeks of age and later challenged with virulent PRV oronasally. Piglets that received NYVAC/gB or iPRV were the best protected based on lack of mortality, lower temperature responses, decreased weight loss and decreased viral shedding after challenge. These results indicate effective strategies for stimulating active immune response while still under the protection of maternal immunity.

  1. Myxoma and vaccinia virus exploit different mechanisms to enter and infect human cancer cells

    Science.gov (United States)

    Villa, Nancy Y.; Bartee, Eric; Mohamed, Mohamed R.; Rahman, Masmudur M.; Barrett, John W.; McFadden, Grant

    2010-01-01

    Myxoma (MYXV) and vaccinia virus (VACV) have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1- Low pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2- The tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3- Knockdown of PAK1 revealed that it is required for a late stage downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. PMID:20334889

  2. RNAi Screening Reveals Proteasome- and Cullin3-Dependent Stages in Vaccinia Virus Infection

    Directory of Open Access Journals (Sweden)

    Jason Mercer

    2012-10-01

    Full Text Available A two-step, automated, high-throughput RNAi silencing screen was used to identify host cell factors required during vaccinia virus infection. Validation and analysis of clustered hits revealed previously unknown processes during virus entry, including a mechanism for genome uncoating. Viral core proteins were found to be already ubiquitinated during virus assembly. After entering the cytosol of an uninfected cell, the viral DNA was released from the core through the activity of the cell’s proteasomes. Next, a Cullin3-based ubiquitin ligase mediated a further round of ubiquitination and proteasome action. This was needed in order to initiate viral DNA replication. The results accentuate the value of large-scale RNAi screens in providing directions for detailed cell biological investigation of complex pathways. The list of cell functions required during poxvirus infection will, moreover, provide a resource for future virus-host cell interaction studies and for the discovery of antivirals.

  3. Vaccinia virus G8R protein: a structural ortholog of proliferating cell nuclear antigen (PCNA.

    Directory of Open Access Journals (Sweden)

    Melissa Da Silva

    Full Text Available BACKGROUND: Eukaryotic DNA replication involves the synthesis of both a DNA leading and lagging strand, the latter requiring several additional proteins including flap endonuclease (FEN-1 and proliferating cell nuclear antigen (PCNA in order to remove RNA primers used in the synthesis of Okazaki fragments. Poxviruses are complex viruses (dsDNA genomes that infect eukaryotes, but surprisingly little is known about the process of DNA replication. Given our previous results that the vaccinia virus (VACV G5R protein may be structurally similar to a FEN-1-like protein and a recent finding that poxviruses encode a primase function, we undertook a series of in silico analyses to identify whether VACV also encodes a PCNA-like protein. RESULTS: An InterProScan of all VACV proteins using the JIPS software package was used to identify any PCNA-like proteins. The VACV G8R protein was identified as the only vaccinia protein that contained a PCNA-like sliding clamp motif. The VACV G8R protein plays a role in poxvirus late transcription and is known to interact with several other poxvirus proteins including itself. The secondary and tertiary structure of the VACV G8R protein was predicted and compared to the secondary and tertiary structure of both human and yeast PCNA proteins, and a high degree of similarity between all three proteins was noted. CONCLUSIONS: The structure of the VACV G8R protein is predicted to closely resemble the eukaryotic PCNA protein; it possesses several other features including a conserved ubiquitylation and SUMOylation site that suggest that, like its counterpart in T4 bacteriophage (gp45, it may function as a sliding clamp ushering transcription factors to RNA polymerase during late transcription.

  4. Vaccinia virus Transmission through Experimentally Contaminated Milk Using a Murine Model.

    Directory of Open Access Journals (Sweden)

    Izabelle Silva Rehfeld

    Full Text Available Bovine vaccinia (BV is a zoonosis caused by Vaccinia virus (VACV, which affects dairy cattle and humans. Previous studies have detected the presence of viable virus particles in bovine milk samples naturally and experimentally contaminated with VACV. However, it is not known whether milk contaminated with VACV could be a route of viral transmission. However, anti-Orthopoxvirus antibodies were detected in humans from BV endemic areas, whom had no contact with affected cows, which suggest that other VACV transmission routes are possible, such as consumption of contaminated milk and dairy products. Therefore, it is important to study the possibility of VACV transmission by contaminated milk. This study aimed to examine VACV transmission, pathogenesis and shedding in mice orally inoculated with experimentally contaminated milk. Thirty mice were orally inoculated with milk containing 107 PFU/ml of VACV, and ten mice were orally inoculated with uncontaminated milk. Clinical examinations were performed for 30 consecutive days, and fecal samples and oral swabs (OSs were collected every other day. Mice were euthanized on predetermined days, and tissue and blood samples were collected. Nested-PCR, plaque reduction neutralization test (PRNT, viral isolation, histopathology, and immunohistochemistry (IHC methods were performed on the collected samples. No clinical changes were observed in the animals. Viral DNA was detected in feces, blood, OSs and tissues, at least in one of the times tested. The lungs displayed moderate to severe interstitial lymphohistiocytic infiltrates, and only the heart, tonsils, tongue, and stomach did not show immunostaining at the IHC analysis. Neutralizing antibodies were detected at the 20th and 30th days post infection in 50% of infected mice. The results revealed that VACV contaminated milk could be a route of viral transmission in mice experimentally infected, showing systemic distribution and shedding through feces and oral

  5. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA*

    Science.gov (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric

    2015-01-01

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  6. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Science.gov (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Modulation of the myxoma virus plaque phenotype by vaccinia virus protein F11.

    Science.gov (United States)

    Irwin, Chad R; Evans, David H

    2012-07-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments that promote VACV exit and spread. This suggested that although MYXV carries homologs of the required genes (A33R, A34R, A36R, and B5R), they are dysfunctional. To test this, we produced MYXV recombinants expressing these genes, but we could not enhance actin projectile formation even in cells expressing all four VACV proteins. Another notable difference between these viruses is that MYXV lacks a homolog of the F11L gene. F11 inhibits the RhoA-mDia signaling that maintains the integrity of the cortical actin layer. We constructed an MYXV strain encoding F11L and observed that, unlike wild-type MYXV, the recombinant virus disrupted actin stress fibers and produced plaques up to 4-fold larger than those of controls, and these plaques expanded ∼6-fold faster. These viruses also grew to higher titers in multistep growth conditions, produced higher levels of actin projectiles, and promoted infected cell movement, although neither process was to the extent of that observed in VACV-infected cells. Thus, one reason for why MYXV produces small plaques is that it cannot spread via actin filaments, although the reason for this deficiency remains obscure. A second reason is that leporipoxviruses lack vaccinia's capacity to disrupt cortical actin.

  8. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar

    2007-03-01

    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  9. Fluorescent hybridization probes for nucleic acid detection.

    Science.gov (United States)

    Guo, Jia; Ju, Jingyue; Turro, Nicholas J

    2012-04-01

    Due to their high sensitivity and selectivity, minimum interference with living biological systems, and ease of design and synthesis, fluorescent hybridization probes have been widely used to detect nucleic acids both in vivo and in vitro. Molecular beacons (MBs) and binary probes (BPs) are two very important hybridization probes that are designed based on well-established photophysical principles. These probes have shown particular applicability in a variety of studies, such as mRNA tracking, single nucleotide polymorphism (SNP) detection, polymerase chain reaction (PCR) monitoring, and microorganism identification. Molecular beacons are hairpin oligonucleotide probes that present distinctive fluorescent signatures in the presence and absence of their target. Binary probes consist of two fluorescently labeled oligonucleotide strands that can hybridize to adjacent regions of their target and generate distinctive fluorescence signals. These probes have been extensively studied and modified for different applications by modulating their structures or using various combinations of fluorophores, excimer-forming molecules, and metal complexes. This review describes the applicability and advantages of various hybridization probes that utilize novel and creative design to enhance their target detection sensitivity and specificity.

  10. Continuously Tunable Nucleic Acid Hybridization Probes

    Science.gov (United States)

    Wu, Lucia R.; Wang, J. Sherry; Fang, John Z.; Reiser, Emily; Pinto, Alessandro; Pekker, Irena; Boykin, Richard; Ngouenet, Celine; Webster, Philippa J.; Beechem, Joseph; Zhang, David Yu

    2015-01-01

    In silico designed nucleic acid probes and primers often fail to achieve favorable specificity and sensitivity tradeoffs on the first try, and iterative empirical sequence-based optimization is needed, particularly in multiplexed assays. Here, we present a novel, on-the-fly method of tuning probe affinity and selectivity via the stoichiometry of auxiliary species, allowing independent and decoupled adjustment of hybridization yield for different probes in multiplexed assays. Using this method, we achieve near-continuous tuning of probe effective free energy (0.03 kcal·mol−1 granularity). As applications, we enforced uniform capture efficiency of 31 DNA molecules (GC content 0% – 100%), maximized signal difference for 11 pairs of single nucleotide variants, and performed tunable hybrid-capture of mRNA from total RNA. Using the Nanostring nCounter platform, we applied stoichiometric tuning to simultaneously adjust yields for a 24-plex assay, and we show multiplexed quantitation of RNA sequences and variants from formalin-fixed, paraffin-embedded samples (FFPE). PMID:26480474

  11. NAPP: the Nucleic Acid Phylogenetic Profile Database.

    Science.gov (United States)

    Ott, Alban; Idali, Anouar; Marchais, Antonin; Gautheret, Daniel

    2012-01-01

    Nucleic acid phylogenetic profiling (NAPP) classifies coding and non-coding sequences in a genome according to their pattern of conservation across other genomes. This procedure efficiently distinguishes clusters of functional non-coding elements in bacteria, particularly small RNAs and cis-regulatory RNAs, from other conserved sequences. In contrast to other non-coding RNA detection pipelines, NAPP does not require the presence of conserved RNA secondary structure and therefore is likely to identify previously undetected RNA genes or elements. Furthermore, as NAPP clusters contain both coding and non-coding sequences with similar occurrence profiles, they can be analyzed under a functional perspective. We recently improved the NAPP pipeline and applied it to a collection of 949 bacterial and 68 archaeal species. The database and web interface available at http://napp.u-psud.fr/ enable detailed analysis of NAPP clusters enriched in non-coding RNAs, graphical display of phylogenetic profiles, visualization of predicted RNAs in their genome context and extraction of predicted RNAs for use with genome browsers or other software.

  12. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4......-(1-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  13. Symmetry in nucleic acid structure and its role in protein--nucleic acid interactions

    Energy Technology Data Exchange (ETDEWEB)

    Sobell, H.M.

    1976-01-01

    It is clear that symmetry concepts will play an increasingly important role in understanding the structural aspects of many protein--nucleic acid interactions. This review summarizes current data and concepts along these lines. Exact crystallographic symmetries are rarely expected to occur in biological systems, and the departures from symmetry that occur may eventually prove to play important roles in modulating physiological function. In this respect, x-ray crystallography can make important additions to our understanding of the atomic nature of these associations, and it is hoped that the next review in this area will describe these.

  14. Assessment for Melting Temperature Measurement of Nucleic Acid by HRM

    National Research Council Canada - National Science Library

    Jing Wang; Xiaoming Pan; Xingguo Liang

    2016-01-01

    High resolution melting (HRM), with a high sensitivity to distinguish the nucleic acid species with small variations, has been widely applied in the mutation scanning, methylation analysis, and genotyping...

  15. Nanopore biosensors for detection of proteins and nucleic acids

    NARCIS (Netherlands)

    Maglia, Giovanni; Soskine, Mikhael

    2014-01-01

    Described herein are nanopore biosensors based on a modified cytolysin protein. The nanopore biosensors accommodate macromoiecules including proteins and nucleic acids, and may additionally comprise ligands with selective binding properties.

  16. NPIDB: Nucleic acid-Protein Interaction DataBase

    National Research Council Canada - National Science Library

    Kirsanov, Dmitry D; Zanegina, Olga N; Aksianov, Evgeniy A; Spirin, Sergei A; Karyagina, Anna S; Alexeevski, Andrei V

    2013-01-01

    The Nucleic acid-Protein Interaction DataBase (http://npidb.belozersky.msu.ru/) contains information derived from structures of DNA-protein and RNA-protein complexes extracted from the Protein Data Bank...

  17. Analyzing and Building Nucleic Acid Structures with 3DNA

    OpenAIRE

    Colasanti, Andrew V.; Lu, Xiang-Jun; Olson, Wilma K.

    2013-01-01

    The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures. Protocol 1 lists the set of instructions needed to download and install the software. This is followed, in Protocol 2, by the analysis of a nucleic...

  18. Biological activity and biotechnological aspects of locked nucleic acids

    DEFF Research Database (Denmark)

    Lundin, Karin E; Højland, Torben; Hansen, Bo

    2013-01-01

    Locked nucleic acid (LNA) is one of the most promising new nucleic acid analogues that has been produced under the past two decades. In this chapter, we have tried to cover many of the different areas, where this molecule has been used to improve the function of synthetic oligonucleotides (ONs). ...... and the adaptation of enzymes for LNA incorporation are reviewed. Such enzymes may become important for the development of stabilized LNA-containing aptamers....

  19. Peptide Nucleic Acids Having 2,6-Diaminopurine Nucleobases

    DEFF Research Database (Denmark)

    2003-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than a corresponding DNA strand, and exhibit increased sequence specificity and binding affinity. The peptide nucleic acids of the invention comprise ligands selected from a group cons...... consisting of naturally-occurring nucleobases and non-naturally-occurring nucleobases attached to a polyamide backbone. Some PNAs of the invention also contain C1-C8 alkylamine side chains....

  20. Peptide Nucleic Acids Having Amino Acid Side Chains

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than the corresponding DNA or RNA strands, and exhibit increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from a group consisting of nat...... of naturally-occurring nucleobases and non-naturally-occurring nucleobases attached to a polyamide backbone, and contain alkylamine side chains....

  1. Nucleic acid-functionalized transition metal nanosheets for biosensing applications.

    Science.gov (United States)

    Mo, Liuting; Li, Juan; Liu, Qiaoling; Qiu, Liping; Tan, Weihong

    2017-03-15

    In clinical diagnostics, as well as food and environmental safety practices, biosensors are powerful tools for monitoring biological or biochemical processes. Two-dimensional (2D) transition metal nanomaterials, including transition metal chalcogenides (TMCs) and transition metal oxides (TMOs), are receiving growing interest for their use in biosensing applications based on such unique properties as high surface area and fluorescence quenching abilities. Meanwhile, nucleic acid probes based on Watson-Crick base-pairing rules are also being widely applied in biosensing based on their excellent recognition capability. In particular, the emergence of functional nucleic acids in the 1980s, especially aptamers, has substantially extended the recognition capability of nucleic acids to various targets, ranging from small organic molecules and metal ions to proteins and cells. Based on π-π stacking interaction between transition metal nanosheets and nucleic acids, biosensing systems can be easily assembled. Therefore, the combination of 2D transition metal nanomaterials and nucleic acids brings intriguing opportunities in bioanalysis and biomedicine. In this review, we summarize recent advances of nucleic acid-functionalized transition metal nanosheets in biosensing applications. The structure and properties of 2D transition metal nanomaterials are first discussed, emphasizing the interaction between transition metal nanosheets and nucleic acids. Then, the applications of nucleic acid-functionalized transition metal nanosheet-based biosensors are discussed in the context of different signal transducing mechanisms, including optical and electrochemical approaches. Finally, we provide our perspectives on the current challenges and opportunities in this promising field. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era.

    Science.gov (United States)

    Figueiredo, Poliana de Oliveira; Silva-Fernandes, André Tavares da; Mota, Bruno Eduardo Fernandes; Costa, Galileu Barbosa; Borges, Iara Apolinário; Ferreira, Paulo César Peregrino; Abrahão, Jônatas Santos; Braga, Erika Martins; Kroon, Erna Geessien; Trindade, Giliane de Souza

    2015-09-01

    Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV). We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132) with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  3. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era

    Directory of Open Access Journals (Sweden)

    Poliana de Oliveira Figueiredo

    2015-09-01

    Full Text Available Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV. We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132 with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  4. Vaccinia virus-mediated melanin production allows MR and optoacoustic deep tissue imaging and laser-induced thermotherapy of cancer.

    Science.gov (United States)

    Stritzker, Jochen; Kirscher, Lorenz; Scadeng, Miriam; Deliolanis, Nikolaos C; Morscher, Stefan; Symvoulidis, Panagiotis; Schaefer, Karin; Zhang, Qian; Buckel, Lisa; Hess, Michael; Donat, Ulrike; Bradley, William G; Ntziachristos, Vasilis; Szalay, Aladar A

    2013-02-26

    We reported earlier the delivery of antiangiogenic single chain antibodies by using oncolytic vaccinia virus strains to enhance their therapeutic efficacy. Here, we provide evidence that gene-evoked production of melanin can be used as a therapeutic and diagnostic mediator, as exemplified by insertion of only one or two genes into the genome of an oncolytic vaccinia virus strain. We found that produced melanin is an excellent reporter for optical imaging without addition of substrate. Melanin production also facilitated deep tissue optoacoustic imaging as well as MRI. In addition, melanin was shown to be a suitable target for laser-induced thermotherapy and enhanced oncolytic viral therapy. In conclusion, melanin as a mediator for thermotherapy and reporter for different imaging modalities may soon become a versatile alternative to replace fluorescent proteins also in other biological systems. After ongoing extensive preclinical studies, melanin overproducing oncolytic virus strains might be used in clinical trials in patients with cancer.

  5. Significant Growth Inhibition of Canine Mammary Carcinoma Xenografts following Treatment with Oncolytic Vaccinia Virus GLV-1h68

    Science.gov (United States)

    Gentschev, Ivaylo; Ehrig, Klaas; Donat, Ulrike; Hess, Michael; Rudolph, Stephan; Chen, Nanhai; Yu, Yong A.; Zhang, Qian; Bullerdiek, Jörn; Nolte, Ingo; Stritzker, Jochen; Szalay, Aladar A.

    2010-01-01

    Canine mammary carcinoma is a highly metastatic tumor that is poorly responsive to available treatment. Therefore, there is an urgent need to identify novel agents for therapy of this disease. Recently, we reported that the oncolytic vaccinia virus GLV-1h68 could be a useful tool for therapy of canine mammary adenoma in vivo. In this study we analyzed the therapeutic effect of GLV-1h68 against canine mammary carcinoma. Cell culture data demonstrated that GLV-1h68 efficiently infected and destroyed cells of the mammary carcinoma cell line MTH52c. Furthermore, after systemic administration, this attenuated vaccinia virus strain primarily replicated in canine tumor xenografts in nude mice. Finally, infection with GLV-1h68 led to strong inflammatory and oncolytic effects resulting in significant growth inhibition of the tumors. In summary, the data showed that the GLV-1h68 virus strain has promising potential for effective treatment of canine mammary carcinoma. PMID:20631910

  6. Nucleic acid in-situ hybridization detection of infectious agents

    Science.gov (United States)

    Thompson, Curtis T.

    2000-04-01

    Limitations of traditional culture methods and newer polymerase chain reaction (PCR)-based methods for detection and speciation of infectious agents demonstrate the need for more rapid and better diagnostics. Nucleic acid hybridization is a detection technology that has gained wide acceptance in cancer and prenatal cytogenetics. Using a modification of the nucleic acid hybridization technique known as fluorescence in-situ hybridization, infectious agents can be detected in a variety of specimens with high sensitivity and specificity. The specimens derive from all types of human and animal sources including body fluids, tissue aspirates and biopsy material. Nucleic acid hybridization can be performed in less than one hour. The result can be interpreted either using traditional fluorescence microscopy or automated platforms such as micro arrays. This paper demonstrates proof of concept for nucleic acid hybridization detection of different infectious agents. Interpretation within a cytologic and histologic context is possible with fluorescence microscopic analysis, thereby providing confirmatory evidence of hybridization. With careful probe selection, nucleic acid hybridization promises to be a highly sensitive and specific practical diagnostic alternative to culture, traditional staining methods, immunohistochemistry and complicated nucleic acid amplification tests.

  7. Highly fluorescent conjugated pyrenes in nucleic acid probes: (phenylethynyl)pyrenecarbonyl-functionalized locked nucleic acids.

    Science.gov (United States)

    Astakhova, Irina V; Korshun, Vladimir A; Wengel, Jesper

    2008-01-01

    In recent years, fluorescently labeled oligonucleotides have become a widely used tool in diagnostics, DNA sequencing, and nanotechnology. The recently developed (phenylethynyl)pyrenes are attractive dyes for nucleic acid labeling, with the advantages of long-wave emission relative to the parent pyrene, high fluorescence quantum yields, and the ability to form excimers. Herein, the synthesis of six (phenylethynyl)pyrene-functionalized locked nucleic acid (LNA) monomers M(1)-M(6) and their incorporation into DNA oligomers is described. Multilabeled duplexes display higher thermal stabilities than singly modified analogues. An increase in the number of phenylethynyl substituents attached to the pyrene results in decreased binding affinity towards complementary DNA and RNA and remarkable bathochromic shifts of absorption/emission maxima relative to the parent pyrene fluorochrome. This bathochromic shift leads to the bright fluorescence colors of the probes, which differ drastically from the blue emission of unsubstituted pyrene. The formation of intra- and interstrand excimers was observed for duplexes that have monomers M(1)-M(6) in both complementary strands and in numerous single-stranded probes. If more phenylethynyl groups are inserted, the detected excimer signals become more intense. In addition, (phenylethynyl)pyrenecarbonyl-LNA monomers M(4), M(5), and M(6) proved highly useful for the detection of single mismatches in DNA/RNA targets.

  8. Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors

    Directory of Open Access Journals (Sweden)

    Moss Bernard

    2005-03-01

    Full Text Available Abstract Background Replication of the vaccinia virus genome occurs in cytoplasmic factory areas and is dependent on the virus-encoded DNA polymerase and at least four additional viral proteins. DNA synthesis appears to start near the ends of the genome, but specific origin sequences have not been defined. Surprisingly, transfected circular DNA lacking specific viral sequences is also replicated in poxvirus-infected cells. Origin-independent plasmid replication depends on the viral DNA polymerase, but neither the number of additional viral proteins nor the site of replication has been determined. Results Using a novel real-time polymerase chain reaction assay, we detected a >400-fold increase in newly replicated plasmid in cells infected with vaccinia virus. Studies with conditional lethal mutants of vaccinia virus indicated that each of the five proteins known to be required for viral genome replication was also required for plasmid replication. The intracellular site of replication was determined using a plasmid containing 256 repeats of the Escherichia coli lac operator and staining with an E. coli lac repressor-maltose binding fusion protein followed by an antibody to the maltose binding protein. The lac operator plasmid was localized in cytoplasmic viral factories delineated by DNA staining and binding of antibody to the viral uracil DNA glycosylase, an essential replication protein. In addition, replication of the lac operator plasmid was visualized continuously in living cells infected with a recombinant vaccinia virus that expresses the lac repressor fused to enhanced green fluorescent protein. Discrete cytoplasmic fluorescence was detected in cytoplasmic juxtanuclear sites at 6 h after infection and the area and intensity of fluorescence increased over the next several hours. Conclusion Replication of a circular plasmid lacking specific poxvirus DNA sequences mimics viral genome replication by occurring in cytoplasmic viral factories

  9. Oral immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein recombinant virus vaccine.

    OpenAIRE

    Rupprecht, C. E.; Wiktor, T. J.; Johnston, D H; Hamir, A. N.; Dietzschold, B; Wunner, W. H.; Glickman, L T; Koprowski, H

    1986-01-01

    Animal rabies control has been frustrated by the existence of multiple wildlife reservoirs and the lack of efficacious oral vaccines. In this investigation, raccoons fed a vaccinia-rabies glycoprotein recombinant virus in a sponge bait developed rabies virus-neutralizing antibody (0.6-54.0 units) and resisted street rabies virus infection 28 and 205 days after feeding. Additional raccoons immunized by oral infusion with attenuated antigenic variants of rabies virus strains CVS-11 and ERA fail...

  10. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Directory of Open Access Journals (Sweden)

    Marnie L Elizaga

    Full Text Available Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines.Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls, and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine.Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12% had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine.Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants.ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  11. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Science.gov (United States)

    Elizaga, Marnie L; Vasan, Sandhya; Marovich, Mary A; Sato, Alicia H; Lawrence, Dale N; Chaitman, Bernard R; Frey, Sharon E; Keefer, Michael C

    2013-01-01

    Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax) campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA) has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines. Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls), and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine. Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12%) had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine. Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants. ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  12. [Modified vaccinia virus ankara (MVA)--development as recombinant vaccine and prospects for use in veterinary medicine].

    Science.gov (United States)

    Volz, Asisa; Fux, Robert; Langenmayer, Martin C; Sutter, Gerd

    2015-01-01

    Poxviruses as expression vectors are widely used in medical research for the development of recombinant vaccines and molecular therapies. Here we review recent accomplishments in vaccine research using recombinant modified vaccinia virus ankara (MVA). MVA is a highly attenuated vaccinia virus strain that originated from serial tissue culture passage in chicken embryo fibroblasts more than 40 years ago. Growth adaptation to avian host cells caused deletions and mutations in the viral genome affecting about 15% of the original genetic information. In consequence, MVA is replication-deficient in cells of mammalian origin and fails to produce many of the virulence factors encoded by conventional vaccinia virus. Because of its safety for the general environment MVA can be handled under conditions of biosafety level one. Non-replicating MVA can enter any target cell and activate its molecular life cycle to express all classes of viral and recombinant genes. Therefore, recombinant MVA have been established as an extremely safe and efficient vector system for vaccine development in medical research. By now, various recombinant MVA vaccines have been found safe and immunogenic when used for phase I/II clinical testing in humans, and suitable for industrial scale production following good practice of manufacturing. Thus, there is an obvious usefulness of recombinant MVA vaccines for novel prophylactic and therapeutic approaches also in veterinary medicine. Results from first studies in companion and farm animals are highly promising.

  13. Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination.

    Science.gov (United States)

    Verheust, Céline; Goossens, Martine; Pauwels, Katia; Breyer, Didier

    2012-03-30

    The modified vaccinia virus Ankara (MVA) strain is a highly attenuated strain of vaccinia virus that has been demonstrated to be safe for humans. MVA is widely considered as the vaccinia virus strain of choice for clinical investigation because of its high safety profile. It also represents an excellent candidate for use as vector system in recombinant vaccine development for gene delivery or vaccination against infectious diseases or tumours, even in immunocompromised individuals. The use of MVA and recombinant MVA vectors must comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The purpose of the present paper is to highlight some biological characteristics of MVA and MVA-based recombinant vectors and to discuss these from a biosafety point of view in the context of the European regulatory framework for genetically modified organisms with emphasis on the assessment of potential risks associated with environmental release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Retrograde Transport from Early Endosomes to the trans-Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions.

    Science.gov (United States)

    Sivan, Gilad; Weisberg, Andrea S; Americo, Jeffrey L; Moss, Bernard

    2016-10-01

    The anterograde pathway, from the endoplasmic reticulum through the trans-Golgi network to the cell surface, is utilized by trans-membrane and secretory proteins. The retrograde pathway, which directs traffic in the opposite direction, is used following endocytosis of exogenous molecules and recycling of membrane proteins. Microbes exploit both routes: viruses typically use the anterograde pathway for envelope formation prior to exiting the cell, whereas ricin and Shiga-like toxins and some nonenveloped viruses use the retrograde pathway for cell entry. Mining a human genome-wide RNA interference (RNAi) screen revealed a need for multiple retrograde pathway components for cell-to-cell spread of vaccinia virus. We confirmed and extended these results while discovering that retrograde trafficking was required for virus egress rather than entry. Retro-2, a specific retrograde trafficking inhibitor of protein toxins, potently prevented spread of vaccinia virus as well as monkeypox virus, a human pathogen. Electron and confocal microscopy studies revealed that Retro-2 prevented wrapping of virions with an additional double-membrane envelope that enables microtubular transport, exocytosis, and actin polymerization. The viral B5 and F13 protein components of this membrane, which are required for wrapping, normally colocalize in the trans-Golgi network. However, only B5 traffics through the secretory pathway, suggesting that F13 uses another route to the trans-Golgi network. The retrograde route was demonstrated by finding that F13 was largely confined to early endosomes and failed to colocalize with B5 in the presence of Retro-2. Thus, vaccinia virus makes novel use of the retrograde transport system for formation of the viral wrapping membrane. Efficient cell-to-cell spread of vaccinia virus and other orthopoxviruses depends on the wrapping of infectious particles with a double membrane that enables microtubular transport, exocytosis, and actin polymerization

  15. Reverse Genetics of SARS-Related Coronavirus Using Vaccinia Virus-Based Recombination

    Science.gov (United States)

    Zevenhoven, Jessika C.; Weber, Friedemann; Züst, Roland; Kuri, Thomas; Dijkman, Ronald; Chang, Guohui; Siddell, Stuart G.; Snijder, Eric J.; Thiel, Volker; Davidson, Andrew D.

    2012-01-01

    Severe acute respiratory syndrome (SARS) is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV) that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime) as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV). Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs). In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E). Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs. PMID:22412934

  16. Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

    Directory of Open Access Journals (Sweden)

    He Yong

    2012-09-01

    Full Text Available Abstract Background A33 is a type II integral membrane protein expressed on the extracellular enveloped form of vaccinia virus (VACV. Passive transfer of A33-directed monoclonal antibodies or vaccination with an A33 subunit vaccine confers protection against lethal poxvirus challenge in animal models. Homologs of A33 are highly conserved among members of the Orthopoxvirus genus and are potential candidates for inclusion in vaccines or assays targeting extracellular enveloped virus activity. One monoclonal antibody directed against VACV A33, MAb-1G10, has been shown to target a conformation-dependent epitope. Interestingly, while it recognizes VACV A33 as well as the corresponding variola homolog, it does not bind to the monkeypox homolog. In this study, we utilized a random phage display library to investigate the epitope recognized by MAb-1G10 that is critical for facilitating cell-to-cell spread of the vaccinia virus. Results By screening with linear or conformational random phage libraries, we found that phages binding to MAb-1G10 display the consensus motif CEPLC, with a disulfide bond formed between two cysteine residues required for MAb-1G10 binding. Although the phage motif contained no linear sequences homologous to VACV A33, structure modeling and analysis suggested that residue D115 is important to form the minimal epitope core. A panel of point mutants expressing the ectodomain of A33 protein was generated and analyzed by either binding assays such as ELISA and immunoprecipitation or a functional assessment by blocking MAb-1G10 mediated comet inhibition in cell culture. Conclusions These results confirm L118 as a component of the MAb-1G10 binding epitope, and further identify D115 as an essential residue. By defining the minimum conformational structure, as well as the conformational arrangement of a short peptide sequence recognized by MAb-1G10, these results introduce the possibility of designing small molecule mimetics that may

  17. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Science.gov (United States)

    Mota, Bruno E F; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A; Vieira, Leda Q; da Fonseca, Flávio G; Ferreira, Paulo C P; Bonjardim, Cláudio A; Damon, Inger K; Kroon, Erna G

    2011-04-15

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/-)) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/-) with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-), and passive transfer of WT T cells to Rag1(-/-) animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals with

  18. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Bruno E F Mota

    Full Text Available Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/- produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/- with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-, and passive transfer of WT T cells to Rag1(-/- animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify

  19. Adverse Events Post Smallpox-Vaccination: Insights from Tail Scarification Infection in Mice with Vaccinia virus

    Science.gov (United States)

    Mota, Bruno E. F.; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M. Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A.; Vieira, Leda Q.; da Fonseca, Flávio G.; Ferreira, Paulo C. P.; Bonjardim, Cláudio A.; Damon, Inger K.; Kroon, Erna G.

    2011-01-01

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1−/−) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1−/− with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1−/−, and passive transfer of WT T cells to Rag1−/− animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals

  20. Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination.

    Directory of Open Access Journals (Sweden)

    Sjoerd H E van den Worm

    Full Text Available Severe acute respiratory syndrome (SARS is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV. Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs. In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E. Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs.

  1. Extraction of viral nucleic acids: comparison of five automated nucleic acid extraction platforms.

    Science.gov (United States)

    Verheyen, Jens; Kaiser, Rolf; Bozic, Michael; Timmen-Wego, Monika; Maier, Barbara K; Kessler, Harald H

    2012-07-01

    Nucleic acid extraction has a major impact on the reliability of results in routine molecular diagnostics. Optimal isolation of nucleic acids and removal of inhibitors are essential. This study compares five different automated extraction platforms for the extraction of norovirus RNA from stool and cytomegalovirus (CMV) DNA from plasma samples. Norovirus positive stool samples and CMV positive plasma samples were aliquoted and analyzed using five different automated platforms (easyMAG, bioMerieux; m2000sp, Abbott; MagNA Pure LC 2.0, Roche; QiaSymphony, Qiagen; sample preparation module of the VERSANT kPCR Molecular System, Siemens). Similar sample input and output volumes, the identical real-time PCR cycler, and the identical assays for amplification and detection for norovirus RNA and CMV DNA, respectively, were chosen. Of 39 stool samples, 36 tested positive for norovirus RNA with all extraction platforms. The three discrepant samples showed inhibition after extraction with at least one platform. Only with the VERSANT platform all samples tested positive for both the target RNA and the internal controls. Of 42 plasma samples, 27 gave quantifiable results for CMV DNA with all extraction platforms. There was significant variance between viral concentrations when different extraction platforms were compared. The majority of the 15 discrepant samples showed low viral concentrations. The internal control of the CMV assay gave positive results for all samples tested below the limit of quantification. The five automated extraction platforms yielded comparable results. However, the extraction performance was found to be impaired by inhibitory substances in stool samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  3. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain

    Science.gov (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang

    2012-01-01

    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  4. Molecular dynamics simulation of nucleic acids: successes, limitations, and promise.

    Science.gov (United States)

    Cheatham, T E; Young, M A

    In the last five years we have witnessed a significant increase in the number publications describing accurate and reliable all-atom molecular dynamics simulations of nucleic acids. This increase has been facilitated by the development of fast and efficient methods for treating the long-range electrostatic interactions, the availability of faster parallel computers, and the development of well-validated empirical molecular mechanical force fields. With these technologies, it has been demonstrated that simulation is not only capable of consistently reproducing experimental observations of sequence specific fine structure of DNA, but also can give detailed insight into prevalent problems in nucleic acid structure, ion association and specific hydration of nucleic acids, polyadenine tract bending, and the subtle environmental dependence of the A-DNA-B-DNA duplex equilibrium. Despite the advances, there are still issues with the methods that need to be resolved through rigorous controlled testing. In general, these relate to deficiencies of the underlying molecular mechanical potentials or applied methods (such as the imposition of true periodicity in Ewald simulations and the need for energy conservation), and significant limits in effective conformational sampling. In this perspective, we provide an overview of our experiences, provide some cautionary notes, and provide recommendations for further study in molecular dynamics simulation of nucleic acids. Copyright 2001 John Wiley & Sons, Inc. Biopolymers (Nucleic Acid Sci) 56: 232-256, 2001

  5. Multiple sequence alignments of partially coding nucleic acid sequences

    Directory of Open Access Journals (Sweden)

    Fried Claudia

    2005-06-01

    Full Text Available Abstract Background High quality sequence alignments of RNA and DNA sequences are an important prerequisite for the comparative analysis of genomic sequence data. Nucleic acid sequences, however, exhibit a much larger sequence heterogeneity compared to their encoded protein sequences due to the redundancy of the genetic code. It is desirable, therefore, to make use of the amino acid sequence when aligning coding nucleic acid sequences. In many cases, however, only a part of the sequence of interest is translated. On the other hand, overlapping reading frames may encode multiple alternative proteins, possibly with intermittent non-coding parts. Examples are, in particular, RNA virus genomes. Results The standard scoring scheme for nucleic acid alignments can be extended to incorporate simultaneously information on translation products in one or more reading frames. Here we present a multiple alignment tool, codaln, that implements a combined nucleic acid plus amino acid scoring model for pairwise and progressive multiple alignments that allows arbitrary weighting for almost all scoring parameters. Resource requirements of codaln are comparable with those of standard tools such as ClustalW. Conclusion We demonstrate the applicability of codaln to various biologically relevant types of sequences (bacteriophage Levivirus and Vertebrate Hox clusters and show that the combination of nucleic acid and amino acid sequence information leads to improved alignments. These, in turn, increase the performance of analysis tools that depend strictly on good input alignments such as methods for detecting conserved RNA secondary structure elements.

  6. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

    1986-07-15

    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.

  7. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  8. Vaccinia-Related Kinase 2 Modulates the Stress Response to Hypoxia Mediated by TAK1▿

    Science.gov (United States)

    Blanco, Sandra; Santos, Claudio; Lazo, Pedro A.

    2007-01-01

    Hypoxia represents a major stress that requires an immediate cellular response in which different signaling pathways participate. Hypoxia induces an increase in the activity of TAK1, an atypical mitogen-activated protein kinase kinase kinase (MAPKKK), which responds to oxidative stress by triggering cascades leading to the activation of c-Jun N-terminal kinase (JNK). JNK activation by hypoxia requires assembly with the JIP1 scaffold protein, which might also interact with other intracellular proteins that are less well known but that might modulate MAPK signaling. We report that TAK1 is able to form a stable complex with JIP1 and thus regulate the activation of JNK, which in turn determines the cellular stress response to hypoxia. This activation of TAK1-JIP1-JNK is suppressed by vaccinia-related kinase 2 (VRK2). VRK2A is able to interact with TAK1 by its C-terminal region, forming stable complexes. The kinase activity of VRK2 is not necessary for this interaction or the downregulation of AP1-dependent transcription. Furthermore, reduction of the endogenous VRK2 level with short hairpin RNA can increase the response induced by hypoxia, suggesting that the intracellular levels of VRK2 can determine the magnitude of this stress response. PMID:17709393

  9. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization.

    Science.gov (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A

    1992-10-01

    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  10. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Science.gov (United States)

    Salgado, Ana Paula Carneiro; Soares-Martins, Jamária Adriana Pinheiro; Andrade, Luciana Garcia; Albarnaz, Jonas Dutra; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien; Bonjardim, Cláudio Antônio

    2013-01-01

    Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV) and Cowpox (CPXV) and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN) Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication. PMID:23903969

  11. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Carneiro Salgado

    2013-08-01

    Full Text Available Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV and Cowpox (CPXV and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication.

  12. Potential effect of prior raccoonpox virus infection in raccoons on vaccinia-based rabies immunization

    Directory of Open Access Journals (Sweden)

    MacCarthy Kathleen A

    2008-10-01

    Full Text Available Abstract Background The USDA, Wildlife Services cooperative oral rabies vaccination (ORV program uses a live vaccinia virus-vectored (genus Orthopoxvirus vaccine, Raboral V-RG® (V-RG, to vaccinate specific wildlife species against rabies virus in several regions of the U.S. Several naturally occurring orthopoxviruses have been found in North America, including one isolated from asymptomatic raccoons (Procyon lotor. The effect of naturally occurring antibodies to orthopoxviruses on successful V-RG vaccination in raccoons is the focus of this study. Results Overall, raccoons pre-immunized (n = 10 with a recombinant raccoonpox virus vaccine (RCN-F1 responded to vaccination with V-RG with lower rabies virus neutralizing antibody (VNA titers than those which were not pre-immunized (n = 10 and some failed to seroconvert for rabies VNA to detectable levels. Conclusion These results suggest that the success of some ORV campaigns may be hindered where raccoonpox virus or possibly other orthopoxvirus antibodies are common in wildlife species targeted for ORV. If these areas are identified, different vaccination strategies may be warranted.

  13. Increased ATP generation in the host cell is required for efficient vaccinia virus production

    Directory of Open Access Journals (Sweden)

    Hsu Che-Fang

    2009-09-01

    Full Text Available Abstract To search for cellular genes up-regulated by vaccinia virus (VV infection, differential display-reverse transcription-polymerase chain reaction (ddRT-PCR assays were used to examine the expression of mRNAs from mock-infected and VV-infected HeLa cells. Two mitochondrial genes for proteins that are part of the electron transport chain that generates ATP, ND4 and CO II, were up-regulated after VV infection. Up-regulation of ND4 level by VV infection was confirmed by Western blotting analysis. Up-regulation of ND4 was reduced by the MAPK inhibitor, apigenin, which has been demonstrated elsewhere to inhibit VV replication. The induction of ND4 expression occurred after viral DNA replication since ara C, an inhibitor of poxviral DNA replication, could block this induction. ATP production was increased in the host cells after VV infection. Moreover, 4.5 μM oligomycin, an inhibitor of ATP production, reduced the ATP level 13 hr after virus infection to that of mock-infected cells and inhibited viral protein expression and virus production, suggesting that increased ATP production is required for efficient VV production. Our results further suggest that induction of ND4 expression is through a Bcl-2 independent pathway.

  14. Genomic identification of human vaccinia virus keratoconjunctivitis and its importance as a laboratory-acquired infection

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi Motlagh

    2016-01-01

    Full Text Available Context: Vaccinia virus (VACV is a member of orthopoxvirus genus of the family Poxviridae. VACVs are enveloped, double-stranded DNA viruses. Several species of this family, for example, molluscum contagiosum, smallpox, deerpox, horsepox, rabbitpox, and VACVs may cause conjunctivitis. Aims: Given the high incidence of keratoconjunctivitis in Iran (approximately 3.6%-53.9% and insufficient clinical diagnostic measures, laboratory tests for detection of its causes and determination of accurate keratoconjunctivitis/conjunctivitis prevalence due to different pathogens are essential. Settings and Design: In this research, conjunctival samples collected from 100 patients with keratoconjunctivitis signs were referred to an eye hospital of Iran. Subjects and Methods: After DNA extraction, polymerase chain reaction (PCR was carried out for detection of VACV. PCR-positive products were further subjected to DNA sequencing. Statistical Analysis Used: The results were analyzed using Chi-square test. Results: In this study, 28% of the samples were positive and a statistically significant relationship obtained between working in medical or research laboratories and VACV prevalence (P < 0.05. Conclusions: This study showed a high rate of VACV keratoconjunctivitis, and therefore, further studies for its prevention and control are necessary.

  15. Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps?

    Directory of Open Access Journals (Sweden)

    Malachy I. Okeke

    2017-10-01

    Full Text Available Modified vaccinia virus Ankara (MVA is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health. However, key aspects of MVA biology require further research in order to provide data needed to evaluate the potential risks that may occur due to the use of MVA and MVA-vectored vaccines. The purpose of this paper is to identify knowledge gaps in the biology of MVA and recombinant MVA that are of relevance to its hazard characterization and discuss ongoing and future experiments aimed at providing data necessary to fill in the knowledge gaps. In addition, we presented arguments for the inclusion of uncertainty analysis and experimental investigation of verifiable worst-case scenarios in the environmental risk assessment of MVA and recombinant MVA. These will contribute to improved risk assessment of MVA and recombinant MVA vaccines.

  16. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  17. Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

    Science.gov (United States)

    Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

    2013-09-17

    Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

  18. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism.

    Science.gov (United States)

    Trefry, John C; Wooley, Dawn P

    2013-09-01

    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  19. Oncolytic vaccinia virus as an adjuvant treatment to cytoreductive surgery for malignant peritoneal mesothelioma.

    Science.gov (United States)

    Acuna, Sergio A; Ottolino-Perry, Kathryn; Çako, Besmira; Tang, Nan; Angarita, Fernando A; McCart, J Andrea

    2014-07-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive cancer with a dismal prognosis. Oncolytic viruses are a promising new therapy for cancer because of their ability to kill tumor cells with minimal toxicity to normal tissues. This experimental study aimed to examine the potential of modified vaccinia virus (VV) to treat MPM when administered alone or as an adjuvant treatment to surgery. Two aggressive murine mesothelioma cell lines (AC29, AB12), were used. Cell viability and viral cytopathic effects were assessed using MTS and crystal violet assays. Immunocompetent mice were injected intraperitoneally with MPM cells and treated with intraperitoneal VV. Tumor-bearing mice also underwent cytoreductive surgery (CRS) followed by VV (or control) therapy. The cytotoxic effects of VV on MPM cell lines was significantly increased compared with the control non-cancer cell line. In both orthotopic models, VV induced tumor regression, prolonging median and long-term survival. VV treatment after incomplete CRS was not superior to VV alone; however, when mice with microscopic disease were treated with VV, further prolongation of median and long-term survivals was observed. VV selectively kills MPM cells in vitro and leads to improved survival and cures in immunocompetent murine models. Higher efficacy of the virus in the microscopic disease context suggests the use of the virus as an adjuvant treatment to complete surgical resection. These promising results justify further studies of VV in humans as a novel treatment for MPM.

  20. Brazilian vaccinia virus strains show a classical orthopoxvirus in-fection course and cross-protection

    Institute of Scientific and Technical Information of China (English)

    Betania Paiva Drumond; Jonatas Santos Abraho; Zlia Ins Portela Lobato; Cludio Antonio Bonjardim; Paulo Csar Peregrino Ferreira; Erna Geessien Kroon

    2009-01-01

    Objectives:The purpose of this work was to study the infection course and cross-protection in mice after intra-dermal injection of Vaccinia virus (VACV ) strain Western Reserve and three Brazilian VACV strains:Araatuba,Muriaéand BeAn58058 isolated from cow,human and rodent,respectively.Methods:Balb /c mice were inoculated by footpad and back scarification and daily monitored regarding lesion development and weight loss.To check cross protection after intradermal VACV inoculation,mice were subsequently infected with different VACV strains and monitored to check lesion development.Serum neutralization assays were per-formed to check for the presence of antibodies against Orthopoxvirus.Results:After VACV intradermal inocu-lation the lesion development pattern was similar in mice infected with the different virus strains.By using the footpad scarification model,cross-protection among VACV strains was observed.Moreover,neutralizing anti-bodies against Orthopoxvirus were detected in sera from mice infected with all VACV strains.Conclusion:Al-though it was not possible to observe virulence differences among VACV strains isolated from cow,rodent and human using the murine model,this inoculation route showed to be an appropriated model to study lesions de-velopment since it mimics natural infections by VACV in nature.

  1. Myxoma and vaccinia viruses exploit different mechanisms to enter and infect human cancer cells.

    Science.gov (United States)

    Villa, Nancy Y; Bartee, Eric; Mohamed, Mohamed R; Rahman, Masmudur M; Barrett, John W; McFadden, Grant

    2010-06-05

    Myxoma (MYXV) and vaccinia (VACV) viruses have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1--low-pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2--the tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3--knockdown of PAK1 revealed that it is required for a late stage event downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. 2010 Elsevier Inc. All rights reserved.

  2. Oncolytic gene therapy with recombinant vaccinia strain GLV-2b372 efficiently kills hepatocellular carcinoma.

    Science.gov (United States)

    Ady, Justin W; Johnsen, Clark; Mojica, Kelly; Heffner, Jacqueline; Love, Damon; Pugalenthi, Amudhan; Belin, Laurence J; Chen, Nanhai G; Yu, Yong A; Szalay, Aladar A; Fong, Yuman

    2015-08-01

    Hepatocellular carcinoma (HCC) commonly presents at a late stage when surgery is no longer a curative option. As such, novel therapies for advanced HCC are needed. Oncolytic viruses are a viable option for cancer therapy owing to their ability to specifically infect, replicate within, and kill cancer cells. In this study, we have investigated the ability of GLV-2b372, a novel light-emitting recombinant vaccinia virus derived from a wild-type Lister strain, to kill HCC. Four human HCC cell lines were assayed in vitro for infectivity and cytotoxicity. Viral replication was quantified via standard viral plaque assays. Flank HCC xenografts generated in athymic nude mice were treated with intratumoral GLV-2b372 to assess for tumor growth inhibition and viral biodistribution. Infectivity occurred in a time- and concentration-dependent manner with 70% cell death in all cell lines by day 5. All cell lines supported efficient viral replication. At 25 days after infection, flank tumor volumes decreased by 50% whereas controls increased by 400%. Tumor tissue demonstrated substantial GLV-2b372 infection at 24 hours, 48 hours, and 2 weeks. We demonstrate that GLV-2b372 efficiently kills human HCC in vitro and in vivo and is a viable treatment option for patients with HCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

    Energy Technology Data Exchange (ETDEWEB)

    Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: pip.beard@roslin.ed.ac.uk [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)

    2015-01-15

    Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

  4. Antigen Gene Transfer to Human Plasmacytoid Dendritic Cells Using Recombinant Adenovirus and Vaccinia Virus Vectors

    Directory of Open Access Journals (Sweden)

    Hetty J. Bontkes

    2005-01-01

    Full Text Available Recombinant adenoviruses (RAd and recombinant vaccinia viruses (RVV expressing tumour-associated antigens (TAA are used as anti-tumour vaccines. It is important that these vaccines deliver the TAA to dendritic cells (DC for the induction of a strong immune response. Infection of myeloid DC (MDC with RAd alone is relatively inefficient but CD40 retargeting significantly increases transduction efficiency and DC maturation. Infection with RVV is efficient without DC maturation. Plasmacytoid dendritic cells (PDC play a role in the innate immune response to viral infections through the secretion of IFNα but may also play a role in specific T-cell induction. The aim of our study was to investigate whether PDC are better targets for RAd and RVV based vaccines. RAd alone hardly infected PDC (2% while CD40 retargeting did not improve transduction efficiency, but it did increase PDC maturation (25% CD83 positive cells. Accordingly, specific CTL activation by RAd infected PDC was limited (the number of IFNγ producing CTL was reduced by 75% compared to stimulation with peptide loaded PDC. RVV infected PDC specifically stimulated CTL but PDC were not activated. These Results indicate that PDC are not ideal targets for RAd and RVV based vaccines. However, PDC induced specific CTL activation after pulsing with recombinant protein, indicating that PDC can also cross-present antigens released from surrounding infected cells.

  5. Inorganic nanoparticles as nucleic acid transporters into eukaryotic cells

    Science.gov (United States)

    Amirkhanov, R. N.; Zarytova, V. F.; Zenkova, M. A.

    2017-02-01

    The review is concerned with inorganic nanoparticles (gold, titanium dioxide, silica, iron oxides, calcium phosphate) used as nucleic acid transporters into mammalian cells. Methods for the synthesis of nanoparticles and approaches to surface modification through covalent or noncovalent attachment of low- or high-molecular-weight compounds are considered. The data available from the literature on biological action of nucleic acids delivered into the cells by nanoparticles and on the effect of nanoparticles and their conjugates and complexes on the cell survival are summarized. Pathways of cellular internalization of nanoparticles and the mechanism of their excretion, as well as the ways of release of nucleic acids from their complexes with nanoparticles after the cellular uptake are described. The bibliography includes 161 references.

  6. Beyond DNA origami: the unfolding prospects of nucleic acid nanotechnology.

    Science.gov (United States)

    Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J; Walter, Nils G

    2012-01-01

    Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA 'staples'. This revolutionary approach has led to the creation of a multitude of two-dimensional and three-dimensional scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy. Copyright © 2011 Wiley Periodicals, Inc.

  7. Amino-containing magnetic nanoemulsions: elaboration and nucleic acid extraction

    Energy Technology Data Exchange (ETDEWEB)

    Veyret, Raphael [Unite Mixte CNRS-bioMerieux-2714, Ecole Normale Superieure de Lyon, 46 allee d' Italie, 69364 Lyon (France); Delair, Thierry [Unite Mixte CNRS-bioMerieux-2714, Ecole Normale Superieure de Lyon, 46 allee d' Italie, 69364 Lyon (France); Pichot, Christian [Unite Mixte CNRS-bioMerieux-2714, Ecole Normale Superieure de Lyon, 46 allee d' Italie, 69364 Lyon (France); Elaissari, Abdelhamid [Unite Mixte CNRS-bioMerieux-2714, Ecole Normale Superieure de Lyon, 46 allee d' Italie, 69364 Lyon (France)]. E-mail: hamid.elaissari@ens-lyon.fr

    2005-08-15

    Amino-containing magnetic colloids were prepared from highly magnetic oil-in-water (O/W) emulsions. The functionalization was performed by controlling the adsorption of polyethyleneimine onto negatively charged magnetic emulsions. The cationic magnetic nanodroplets were characterized in terms of chemical composition, particle size, size distribution, zeta potential and colloidal stability as a function of storage time. These amino-containing magnetic emulsions were assessed as a new tool for nucleic acid extraction and amplification. The adsorption of nucleic acids was mostly controlled by attractive electrostatic interactions. The adsorption efficiency of a model RNA was found to be encouraging and the captured nucleic acid molecules were directly enzymatically amplified in the presence of the magnetic particles without any elution step.

  8. Soni-removal of nucleic acids from inclusion bodies.

    Science.gov (United States)

    Neerathilingam, Muniasamy; Mysore, Sumukh; Gandham, Sai Hari A

    2014-05-23

    Inclusion bodies (IBs) are commonly formed in Escherichia coli due to over expression of recombinant proteins in non-native state. Isolation, denaturation and refolding of these IBs is generally performed to obtain functional protein. However, during this process IBs tend to form non-specific interactions with sheared nucleic acids from the genome, thus getting carried over into downstream processes. This may hinder the refolding of IBs into their native state. To circumvent this, we demonstrate a methodology termed soni-removal which involves disruption of nucleic acid-inclusion body interaction using sonication; followed by solvent based separation. As opposed to conventional techniques that use enzymes and column-based separations, soni-removal is a cost effective alternative for complete elimination of buried and/or strongly bound short nucleic acid contaminants from IBs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Xenotropic murine leukemia virus-related virus-associated chronic fatigue syndrome reveals a distinct inflammatory signature.

    Science.gov (United States)

    Lombardi, Vincent C; Hagen, Kathryn S; Hunter, Kenneth W; Diamond, John W; Smith-Gagen, Julie; Yang, Wei; Mikovits, Judy A

    2011-01-01

    The recent identification of xenotropic murine leukemia virus-related virus (XMRV) in the blood of patients with chronic fatigue syndrome (CFS) establishes that a retrovirus may play a role in the pathology in this disease. Knowledge of the immune response might lead to a better understanding of the role XMRV plays in this syndrome. Our objective was to investigate the cytokine and chemokine response in XMRV-associated CFS. Using Luminex multi-analyte profiling technology, we measured cytokine and chemokine values in the plasma of XMRV-infected CFS patients and compared these data to those of healthy controls. Analysis was performed using the Gene Expression Pattern Analysis Suite and the Random Forest tree classification algorithm. This study identifies a signature of 10 cytokines and chemokines which correctly identifies XMRV/CFS patients with 93% specificity and 96% sensitivity. These data show, for the first time, an immunological pattern associated with XMRV/CFS.

  10. Biomimetic High Density Lipoprotein Nanoparticles For Nucleic Acid Delivery

    Science.gov (United States)

    McMahon, Kaylin M.; Mutharasan, R. Kannan; Tripathy, Sushant; Veliceasa, Dorina; Bobeica, Mariana; Shumaker, Dale K.; Luthi, Andrea J.; Helfand, Brian T.; Ardehali, Hossein; Mirkin, Chad A.; Volpert, Olga; Thaxton, C. Shad

    2014-01-01

    We report a gold nanoparticle-templated high density lipoprotein (HDL AuNP) platform for gene therapy which combines lipid-based nucleic acid transfection strategies with HDL biomimicry. For proof-of-concept, HDL AuNPs are shown to adsorb antisense cholesterylated DNA. The conjugates are internalized by human cells, can be tracked within cells using transmission electron microscopy (TEM), and regulate target gene expression. Overall, the ability to directly image the AuNP core within cells, the chemical tailorability of the HDL AuNP platform, and the potential for cell-specific targeting afforded by HDL biomimicry make this platform appealing for nucleic acid delivery. PMID:21319839

  11. Recent Advances in Chemical Modification of Peptide Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Eriks Rozners

    2012-01-01

    Full Text Available Peptide nucleic acid (PNA has become an extremely powerful tool in chemistry and biology. Although PNA recognizes single-stranded nucleic acids with exceptionally high affinity and sequence selectivity, there is considerable ongoing effort to further improve properties of PNA for both fundamental science and practical applications. The present paper discusses selected recent studies that improve on cellular uptake and binding of PNA to double-stranded DNA and RNA. The focus is on chemical modifications of PNA's backbone and heterocyclic nucleobases. The paper selects representative recent studies and does not attempt to provide comprehensive coverage of the broad and vibrant field of PNA modification.

  12. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  13. [Construction and identification of non-replication recombinant vaccinia virus co-expressing human papillomavirus type 16 L1/L2/E6/E7 proteins].

    Science.gov (United States)

    Huang, Wei; Tian, Hou-wen; Ren, Jiao; Fan, Jiang-tao; Zhao, Li; Bian, Tao; Lu, Zhen-hua; Ruan, Li

    2005-09-01

    To generate a human papillomavirus (HPV16) prophylactic and therapeutic vaccine candidate for cervical cancer. HPV16 major capsid protein L1 gene/minor capsid protein L2 gene and HPV16 early E6/E7 genes were inserted into a vaccinia virus expression vector. A strain of non-recombinant vaccinia virus containing the sequences was obtained through a homologous recombination and identified. DNA hybridization confirmed that the HPV16L1/L2/E6/E7 genes were integrated into vaccinia virus DNA. Western Blot result showed that full-length L1/L2/E6/E7 proteins were co-expressed in CEF cells infected with the recombinant virus. NTVJE6E7CKL1L2 could be taken as a candidate of prophylactic and therapeutic vaccine for HPV-associated tumors and their precancerous transformations.

  14. Nucleic acid-binding glycoproteins which solubilize nucleic acids in dilute acid: re-examination of the Ustilago maydis glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Unrau, P.; Champ, D.R.; Young, J.L.; Grant, C.E.

    1980-01-01

    Holloman reported the isolation from Ustilago maydis of a glycoprotein which prevented the precipitation of nucleic acids in cold 5% trichloroacetic acid. Two glycoprotein fractions from U. maydis with this nucleic acid-solubilizing activity were isolated in our laboratory using improved purification procedures. The activity was not due to nuclease contamination. The glycoproteins are distinguished by: their ability to bind to concanavalin A-Sepharose; their differential binding to double- and single-stranded deoxyribonucleic acid, and to ribonucleic acid; their molecular weights (46,000 and 69,000); and the relative amounts present in growing versus nongrowing cells. Both fractions required sulfhydryl-reducing conditions for optimal yields, specific activity, and stability. Nucleic acid binding was cooperative, the minimum number of glycoproteins required to make a native T7 DNA molecule soluble in dilute acid being estimated at 2 and 15, respectively.

  15. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  16. Unintentional transfer of vaccinia virus associated with smallpox vaccines: ACAM2000(®) compared with Dryvax(®).

    Science.gov (United States)

    Tack, Danielle M; Karem, Kevin L; Montgomery, Jay R; Collins, Limone; Bryant-Genevier, Marthe G; Tiernan, Rosemary; Cano, Maria; Lewis, Paige; Engler, Renata J M; Damon, Inger K; Reynolds, Mary G

    2013-07-01

    Routine vaccination against smallpox (variola) ceased in the US in 1976. However, in 2002 limited coverage for military personnel and some healthcare workers was reinstituted. In March 2008, ACAM2000® replaced Dryvax® as the vaccine used in the United States against smallpox. Unintentional transfer of vaccinia virus from a vaccination site by autoinoculation or contact transmission, can have significant public health implications. We summarize unintentional virus transfer AEs associated with ACAM2000® since March 2008 and compare with Dryvax®. We identified 309 reports for ACAM2000® with skin or ocular involvement, of which 93 were autoinoculation cases and 20 were contact transmission cases. The rate for reported cases of autoinoculation was 20.6 per 100,000 vaccinations and for contact transmission was 4.4 per 100,000 vaccinations. Eighteen contact transmission cases could be attributed to contact during a sporting activity (45%) or intimate contact (45%). Of the 113 unintentional transfer cases, 6 met the case definition for ocular vaccinia. The most common locations for all autoinoculation and contact cases were arm/elbow/shoulder (35/113; 31%) and face (24/113; 21%). Methods We reviewed 753 reports associated with smallpox in the Vaccine Adverse Event Reporting System and CDC Poxvirus consultation log, reported from March 2008 to August 2010. Reports were classified into categories based upon standard case definitions. Overall, unintentional transfer events for ACAM2000® and Dryvax® are similar. We recommend continued efforts to prevent transfer events and continuing education for healthcare providers focused on recognition of vaccinia lesions, proper sample collection, and laboratory testing to confirm diagnosis.

  17. Enhancing and targeting nucleic acid delivery by magnetic force.

    Science.gov (United States)

    Plank, Christian; Anton, Martina; Rudolph, Carsten; Rosenecker, Joseph; Krötz, Florian

    2003-08-01

    Insufficient contact of inherently highly active nucleic acid delivery systems with target cells is a primary reason for their often observed limited efficacy. Physical methods of targeting can overcome this limitation and reduce the risk of undesired side effects due to non-target site delivery. The authors and others have developed a novel means of physical targeting, exploiting magnetic force acting on nucleic acid vectors associated with magnetic particles in order to mediate the rapid contact of vectors with target cells. Here, the principles of magnetic drug and nucleic acid delivery are reviewed, and the facts and potentials of the technique for research and therapeutic applications are discussed. Magnetically enhanced nucleic acid delivery - magnetofection - is universally applicable to viral and non-viral vectors, is extraordinarily rapid, simple and yields saturation level transfection at low dose in vitro. The method is useful for site-specific vector targeting in vivo. Exploiting the full potential of the technique requires an interdisciplinary research effort in magnetic field physics, magnetic particle chemistry, pharmaceutical formulation and medical application.

  18. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) were performed in Zantedeschia aethiopica and Zantedeschia elliottiana. Mitotic metaphase in both species showed 2n=32. The chromosomes of both species were quite similar ...

  20. Cell cycle nucleic acids, polypeptides and uses thereof

    Science.gov (United States)

    Gordon-Kamm, William J.; Lowe, Keith S.; Larkins, Brian A.; Dilkes, Brian R.; Sun, Yuejin

    2007-08-14

    The invention provides isolated nucleic acids and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content, cell cycle progression, cell number and/or composition of plants.

  1. Predicting nucleic acid binding interfaces from structural models of proteins

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2011-01-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared to patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. PMID:22086767

  2. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-07-03

    Jul 3, 2012 ... Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) were performed in Zantedeschia aethiopica and. Zantedeschia elliottiana. Mitotic metaphase in both species showed 2n=32. The chromosomes of both species ...

  3. Mosaic protein and nucleic acid vaccines against hepatitis C virus

    Science.gov (United States)

    Yusim, Karina; Korber, Bette T. M.; Kuiken, Carla L.; Fischer, William M.

    2013-06-11

    The invention relates to immunogenic compositions useful as HCV vaccines. Provided are HCV mosaic polypeptide and nucleic acid compositions which provide higher levels of T-cell epitope coverage while minimizing the occurrence of unnatural and rare epitopes compared to natural HCV polypeptides and consensus HCV sequences.

  4. Peptide nucleic acids and their potential applications in biotechnology

    DEFF Research Database (Denmark)

    Buchardt, O.; Egholm, M.; Berg, R.H.

    1993-01-01

    Peptide nucleic acids (PNAs) are novel DNA mimics in which the sugar-phosphate backbone has been replaced with a backbone based on amino acids1-3. PNAs exhibit sequence-specific binding to DNA and RNA with higher affinities and specificities than unmodified DNA. They,are resistant to nuclease...

  5. Modulating gene function with peptide nucleic acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Crooke, Stanley T.

    2008-01-01

    A review on peptide nucleic acid (PNA) oligomers as modulators of gene expression ranging from gene silencing at the mRNAor the dsDNA (antigene) level, and redirection of mRNA splicing to gene activation through transcription bubble mimicking. PNA chem., anti-infective agents, cellular delivery, ......, and in vivo bioavailability of PNA are briefly discussed. [on SciFinder (R)]...

  6. Assessment for Melting Temperature Measurement of Nucleic Acid by HRM

    Directory of Open Access Journals (Sweden)

    Jing Wang

    2016-01-01

    Full Text Available High resolution melting (HRM, with a high sensitivity to distinguish the nucleic acid species with small variations, has been widely applied in the mutation scanning, methylation analysis, and genotyping. For the aim of extending HRM for the evaluation of thermal stability of nucleic acid secondary structures on sequence dependence, we investigated effects of the dye of EvaGreen, metal ions, and impurities (such as dNTPs on melting temperature (Tm measurement by HRM. The accuracy of HRM was assessed as compared with UV melting method, and little difference between the two methods was found when the DNA Tm was higher than 40°C. Both insufficiency and excessiveness of EvaGreen were found to give rise to a little bit higher Tm, showing that the proportion of dye should be considered for precise Tm measurement of nucleic acids. Finally, HRM method was also successfully used to measure Tms of DNA triplex, hairpin, and RNA duplex. In conclusion, HRM can be applied in the evaluation of thermal stability of nucleic acid (DNA or RNA or secondary structural elements (even when dNTPs are present.

  7. A simple and rapid nucleic acid preparation method for reverse ...

    African Journals Online (AJOL)

    USER

    2010-03-29

    Mar 29, 2010 ... Key words: Nucleic acid preparation, reverse transcription polymerase chain reaction, dormant tubers, potato leafroll virus, potato virus S. INTRODUCTION. The vegetative propagation of potato (Solano tuberous. L.) presents ample opportunity for .... were amplified in 35 cycles. Annealing temperature was ...

  8. Non-enzymatic Polymerization of Nucleic Acids from Monomers

    DEFF Research Database (Denmark)

    Dörr, Mark; Löffler, Philipp M. G.; Monnard, Pierre-Alain

    2012-01-01

    This review deals with the state-of-the-art techniques in non-enzymatic nucleic acid condensation from monomers. In particular, the procedures called \\emph{monomer self-condensation} and \\emph{template-directed monomer condensation} are described, which have been developed to achieve efficient...

  9. Circulating nucleic acids as a diagnostic and prognostic marker in ...

    African Journals Online (AJOL)

    Elevated levels of circulating nucleic acids have been found in a variety of benign and malignant pathological conditions. The ability to detect and quantitate specific DNA, RNA and micro-RNA sequences in serum/ plasma has opened up the possibilities of non-invasive diagnosis and monitoring of diseases. Circulating ...

  10. PYRENE INTERCALATING NUCLEIC ACIDS WITH A CARBON LINKER

    DEFF Research Database (Denmark)

    Østergaard, Michael E.; Wamberg, Michael Chr.; Pedersen, Erik Bjerregaard

    2011-01-01

    geminally attached. Fluorescence studies of this intercalating nucleic acid with the pyrene moieties inserted as a bulge showed formation of an excimer band. When a mismatch was introduced at the site of the intercalator, an excimer band was formed for the destabilized duplexes whereas an exciplex band...

  11. Nucleic acid therapy for lifespan prolongation: Present and future

    Indian Academy of Sciences (India)

    Lifespan prolongation is a common desire of the human race. With advances in biotechnology, the mechanism of aging has been gradually unraveled, laying the theoretical basis of nucleic acid therapy for lifespan prolongation. Regretfully, clinically applicable interventions do not exist without the efforts of converting theory ...

  12. Prediction of molecular alignment of nucleic acids in aligned media

    NARCIS (Netherlands)

    Wu, B.; Petersen, M.; Girard, F.C.; Tessari, M.; Wijmenga, S.S.

    2006-01-01

    We demonstrate - using the data base of all deposited DNA and RNA structures aligned in Pf1-medium and RDC refined - that for nucleic acids in a Pf1-medium the electrostatic alignment tensor can be predicted reliably and accurately via a simple and fast calculation based on the gyration tensor

  13. Predicting nucleic acid binding interfaces from structural models of proteins.

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2012-02-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However, the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three-dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared with patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. Copyright © 2011 Wiley Periodicals, Inc.

  14. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2017-09-05

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  15. Surface plasmon resonance sensing of nucleic acids: A review

    Czech Academy of Sciences Publication Activity Database

    Šípová, Hana; Homola, Jiří

    -, č. 773 (2013), s. 9-23 ISSN 0003-2670 R&D Projects: GA MŠk(CZ) LH11102 Institutional support: RVO:67985882 Keywords : Surface plasmon resonance * Nucleic acid * Biosensor Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 4.517, year: 2013

  16. Nucleic acid detection with surface plasmon resonance using cationic latex

    NARCIS (Netherlands)

    de Vries, E.F.A.; Schasfoort, Richardus B.M.; van der Plas, J.; Greve, Jan

    1994-01-01

    An affinity sensor based on Surface Plasmon Resonance (SPR) was used to detect nucleic acids. SPR is an optical technique that is able to detect small changes in the refractive index of the immediate vicinity of a metal surface. After a specific amplification of DNA, achieved using the polymerase

  17. nucleic acid amplification as used in the diagnosis and management ...

    African Journals Online (AJOL)

    DR. AMINU

    2014-06-01

    Jun 1, 2014 ... thus, amplification based methods offer superior performance ... self-sustaining sequence replication), Amplification of nucleic acid probe (e.g., ligase chain reaction and Q-beta replicase) and Signal amplification (e.g., branched-probe DNA assay). PCR ... advantages, limitations and clinical utility (Fredricks.

  18. DNA-like double helix formed by peptide nucleic acid

    DEFF Research Database (Denmark)

    Wittung, P; Nielsen, Peter E.; Buchardt, O

    1994-01-01

    Although the importance of the nucleobases in the DNA double helix is well understood, the evolutionary significance of the deoxyribose phosphate backbone and the contribution of this chemical entity to the overall helical structure and stability of the double helix is not so clear. Peptide nucleic...

  19. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  20. A nucleic acid dependent chemical photocatalysis in live human cells

    DEFF Research Database (Denmark)

    Arian, Dumitru; Cló, Emiliano; Gothelf, Kurt V

    2010-01-01

    Only two nucleic acid directed chemical reactions that are compatible with live cells have been reported to date. Neither of these processes generate toxic species from nontoxic starting materials. Reactions of the latter type could be applied as gene-specific drugs, for example, in the treatment...

  1. Modeling nucleic acid structure in the presence of single-stranded binding proteins

    Science.gov (United States)

    Forties, Robert; Bundschuh, Ralf

    2009-03-01

    There are many important proteins which bind single-stranded nucleic acids, such as the nucleocapsid protein in HIV, the RecA DNA repair protein in bacteria, and all proteins involved in mRNA splicing and translation. We extend the Vienna Package for quantitatively modeling the secondary structure of nucleic acids to include proteins which bind to unpaired portions of the nucleic acid. All parameters needed to model nucleic acid secondary structures in the absence of proteins have been previously measured. This leaves the footprint and sequence dependent binding affinity of the protein as adjustable parameters of our model. Using this model we are able to predict the probability of the protein binding at any position in the nucleic acid sequence, the impact of the protein on nucleic acid base pairing, the end-to-end distance distribution for the nucleic acid, and FRET distributions for fluorophores attached to the nucleic acid.

  2. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  3. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques.

    Science.gov (United States)

    Burgers, Wendy A; Ginbot, Zekarias; Shen, Yen-Ju; Chege, Gerald K; Soares, Andreia P; Müller, Tracey L; Bunjun, Rubina; Kiravu, Agano; Munyanduki, Henry; Douglass, Nicola; Williamson, Anna-Lise

    2014-10-01

    Poxvirus vectors represent promising human immunodeficiency virus (HIV) vaccine candidates and were a component of the only successful HIV vaccine efficacy trial to date. We tested the immunogenicity of a novel recombinant capripoxvirus vector, lumpy skin disease virus (LSDV), in combination with modified vaccinia Ankara (MVA), both expressing genes from HIV-1. Here, we demonstrated that the combination regimen was immunogenic in rhesus macaques, inducing high-magnitude, broad and balanced CD4(+) and CD8(+) T-cell responses, and transient activation of the immune response. These studies support further development of LSDV as a vaccine vector. © 2014 The Authors.

  4. Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans.

    Science.gov (United States)

    1996-05-01

    selected antigens is through fractionation of Brucella strain RB51 or E.coli recombinants expressing the appropriateBrucella antigen. Briefly, the method...animal species infected with Brucella spp. It is also able to induce the in vitro production of INF-y with lymphocytes of RB51 vaccinated mice (Table...SOD RB51 1IkDa 20 15 x0 0- 10 E 0- Uve Acetone Buffer Void 0-0.1 0.1-0-25 0.25->0.5 0.5-0.75 0.75->1.0 Klled 14 Preparation of new vaccinia/ Brucella

  5. The use of solid supports to generate nucleic acid carriers.

    Science.gov (United States)

    Unciti-Broceta, Asier; Díaz-Mochón, Juan José; Sánchez-Martín, Rosario M; Bradley, Mark

    2012-07-17

    Nucleic acids are the foundation stone of all cellular processes. Consequently, the use of DNA or RNA to treat genetic and acquired disorders (so called gene therapy) offers enormous potential benefits. The restitution of defective genes or the suppression of malignant genes could target a range of diseases, including cancers, inherited diseases (cystic fibrosis, muscular dystrophy, etc.), and viral infections. However, this strategy has a major barrier: the size and charge of nucleic acids largely restricts their transit into eukaryotic cells. Potential strategies to solve this problem include the use of a variety of natural and synthetic nucleic acid carriers. Driven by the aim and ambition of translating this promising therapeutic approach into the clinic, researchers have been actively developing advanced delivery systems for nucleic acids for more than 20 years. A decade ago we began our investigations of solid-phase techniques to construct families of novel nucleic acid carriers for transfection. We envisaged that the solid-phase synthesis of polycationic dendrimers and derivatized polyamimes would offer distinct advantages over solution phase techniques. Notably in solid phase synthesis we could take advantage of mass action and streamlined purification procedures, while simplifying the handling of compounds with high polarities and plurality of functional groups. Parallel synthesis methods would also allow rapid access to libraries of compounds with improved purities and yields over comparable solution methodologies and facilitate the development of structure activity relationships. We also twisted the concept of the solid-phase support on its head: we devised miniaturized solid supports that provided an innovative cell delivery vehicle in their own right, carrying covalently conjugated cargos (biomolecules) into cells. In this Account, we summarize the main outcomes of this series of chemically related projects.

  6. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  7. A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference.

    Directory of Open Access Journals (Sweden)

    Philippa M Beard

    Full Text Available Vaccinia virus (VACV is a large, cytoplasmic, double-stranded DNA virus that requires complex interactions with host proteins in order to replicate. To explore these interactions a functional high throughput small interfering RNA (siRNA screen targeting 6719 druggable cellular genes was undertaken to identify host factors (HF influencing the replication and spread of an eGFP-tagged VACV. The experimental design incorporated a low multiplicity of infection, thereby enhancing detection of cellular proteins involved in cell-to-cell spread of VACV. The screen revealed 153 pro- and 149 anti-viral HFs that strongly influenced VACV replication. These HFs were investigated further by comparisons with transcriptional profiling data sets and HFs identified in RNAi screens of other viruses. In addition, functional and pathway analysis of the entire screen was carried out to highlight cellular mechanisms involved in VACV replication. This revealed, as anticipated, that many pro-viral HFs are involved in translation of mRNA and, unexpectedly, suggested that a range of proteins involved in cellular transcriptional processes and several DNA repair pathways possess anti-viral activity. Multiple components of the AMPK complex were found to act as pro-viral HFs, while several septins, a group of highly conserved GTP binding proteins with a role in sequestering intracellular bacteria, were identified as strong anti-viral VACV HFs. This screen has identified novel and previously unexplored roles for cellular factors in poxvirus replication. This advancement in our understanding of the VACV life cycle provides a reliable knowledge base for the improvement of poxvirus-based vaccine vectors and development of anti-viral theraputics.

  8. Antibody against extracellular vaccinia virus (EV protects mice through complement and Fc receptors.

    Directory of Open Access Journals (Sweden)

    Matthew E Cohen

    Full Text Available Protein-based subunit smallpox vaccines have shown their potential as effective alternatives to live virus vaccines in animal model challenge studies. We vaccinated mice with combinations of three different vaccinia virus (VACV proteins (A33, B5, L1 and examined how the combined antibody responses to these proteins cooperate to effectively neutralize the extracellular virus (EV infectious form of VACV. Antibodies against these targets were generated in the presence or absence of CpG adjuvant so that Th1-biased antibody responses could be compared to Th2-biased responses to the proteins with aluminum hydroxide alone, specifically with interest in looking at the ability of anti-B5 and anti-A33 polyclonal antibodies (pAb to utilize complement-mediated neutralization in vitro. We found that neutralization of EV by anti-A33 or anti-B5 pAb can be enhanced in the presence of complement if Th1-biased antibody (IgG2a is generated. Mechanistic differences found for complement-mediated neutralization showed that anti-A33 antibodies likely result in virolysis, while anti-B5 antibodies with complement can neutralize by opsonization (coating. In vivo studies found that mice lacking the C3 protein of complement were less protected than wild-type mice after passive transfer of anti-B5 pAb or vaccination with B5. Passive transfer of anti-B5 pAb or monoclonal antibody into mice lacking Fc receptors (FcRs found that FcRs were also important in mediating protection. These results demonstrate that both complement and FcRs are important effector mechanisms for antibody-mediated protection from VACV challenge in mice.

  9. Structure of vaccinia virus thymidine kinase in complex with dTTP: insights for drug design

    Directory of Open Access Journals (Sweden)

    Balzarini Jan

    2006-10-01

    Full Text Available Abstract Background Development of countermeasures to bioterrorist threats such as those posed by the smallpox virus (variola, include vaccination and drug development. Selective activation of nucleoside analogues by virus-encoded thymidine (dThd kinases (TK represents one of the most successful strategies for antiviral chemotherapy as demonstrated for anti-herpes drugs. Vaccinia virus TK is a close orthologue of variola TK but also shares a relatively high sequence identity to human type 2 TK (hTK, thus achieving drug selectivity relative to the host enzyme is challenging. Results In order to identify any differences compared to hTK that may be exploitable in drug design, we have determined the crystal structure of VVTK, in complex with thymidine 5'-triphosphate (dTTP. Although most of the active site residues are conserved between hTK and VVTK, we observe a difference in conformation of residues Asp-43 and Arg-45. The equivalent residues in hTK hydrogen bond to dTTP, whereas in subunit D of VVTK, Asp-43 and Arg-45 adopt a different conformation preventing interaction with this nucleotide. Asp-43 and Arg-45 are present in a flexible loop, which is disordered in subunits A, B and C. The observed difference in conformation and flexibility may also explain the ability of VVTK to phosphorylate (South-methanocarbathymine whereas, in contrast, no substrate activity with hTK is reported for this compound. Conclusion The difference in conformation for Asp-43 and Arg-45 could thus be used in drug design to generate VVTK/Variola TK-selective nucleoside analogue substrates and/or inhibitors that have lower affinity for hTK.

  10. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication.

    Science.gov (United States)

    Verardi, Paulo H; Titong, Allison; Hagen, Caitlin J

    2012-07-01

    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies.

  11. Tagging of the vaccinia virus protein F13 with mCherry causes aberrant virion morphogenesis.

    Science.gov (United States)

    Carpentier, David C J; Hollinshead, Michael S; Ewles, Helen A; Lee, Stacey-Ann; Smith, Geoffrey L

    2017-09-20

    Vaccinia virus produces two distinct infectious virions; the single-enveloped intracellular mature virus (IMV), which remains in the cell until cell lysis, and the double-enveloped extracellular enveloped virus (EEV), which mediates virus spread. The latter is derived from a triple-enveloped intracellular enveloped virus (IEV) precursor, which is transported to the cell periphery by the kinesin-1 motor complex. This transport involves the viral protein A36 as well as F12 and E2. A36 is an integral membrane protein associated with the outer virus envelope and is the only known direct link between virion and kinesin-1 complex. Yet in the absence of A36 virion egress still occurs on microtubules, albeit at reduced efficiency. In this paper double-fluorescent labelling of the capsid protein A5 and outer-envelope protein F13 was exploited to visualize IEV transport by live-cell imaging in the absence of either A36 or F12. During the generation of recombinant viruses expressing both A5-GFP and F13-mCherry a plaque size defect was identified that was particularly severe in viruses lacking A36. Electron microscopy showed that this phenotype was caused by abnormal wrapping of IMV to form IEV, and this resulted in reduced virus egress to the cell surface. The aberrant wrapping phenotype suggests that the fluorescent fusion protein interferes with an interaction of F13 with the IMV surface that is required for tight association between IMVs and wrapping membranes. The severity of this defect suggests that these viruses are imperfect tools for characterizing virus egress.

  12. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection.

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-05-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s(-1) , consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  13. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence

    2007-07-01

    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  14. Cellular expression of a functional nodavirus RNA replicon from vaccinia virus vectors.

    Science.gov (United States)

    Ball, L A

    1992-04-01

    RNA replication provides a powerful means for the amplification of RNA, but to date it has been found to occur naturally only among RNA viruses. In an attempt to harness this process for the amplification of heterologous mRNAs, both an RNA replicase and its corresponding RNA templates have been expressed in functional form, using vaccinia virus-bacteriophage T7 RNA polymerase vectors. Plasmids were constructed which contained in 5'-to-3' order (i) a bacteriophage T7 promoter; (ii) a full-length cDNA encoding either the RNA replicase (RNA 1) or the coat protein (RNA 2) of flock house virus (FHV), (iii) a cDNA sequence that encoded the self-cleaving ribozyme of satellite tobacco ringspot virus, and (iv) a T7 transcriptional terminator. Both in vitro and in vivo, circular plasmids of this structure were transcribed by T7 RNA polymerase to produce RNAs with sizes that closely resembled those of the two authentic FHV genomic RNAs, RNA 1 and RNA 2. In baby hamster kidney cells that expressed authentic FHV RNA replicase, the RNA 2 (coat protein) transcripts were accurately replicated. Moreover, the RNA 1 (replicase) transcripts directed the synthesis of an enzyme that could replicate not only authentic virion-derived FHV RNA but also the plasmid-derived transcripts themselves. Under the latter conditions, replicative amplification of the RNA transcripts ensued and resulted in a high rate of synthesis of the encoded proteins. This successful expression from a DNA vector of the complex biological process of RNA replication will greatly facilitate studies of its mechanism and is a major step towards the goal of harnessing RNA replication for mRNA amplification.

  15. Cleavage of Dicer protein by I7 protease during vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Jhih-Si Chen

    Full Text Available Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

  16. Vaccinia viruses isolated from cutaneous disease in horses are highly virulent for rabbits.

    Science.gov (United States)

    Felipetto Cargnelutti, Juliana; Schmidt, Candice; Masuda, Eduardo Kenji; Braum, Lisiane Danusa; Weiblen, Rudi; Furtado Flores, Eduardo

    2012-03-01

    Two genotypically distinct Vaccinia viruses (VACV), named P1V and P2V, were isolated from an outbreak of cutaneous disease in horses in Southern Brazil. We herein investigated the susceptibility of rabbits, a proposed animal model, to P1V and P2V infection. Groups of weanling rabbits were inoculated intranasally (IN) with P1V or P2V at low (10(2.5) TCID50), medium (10(4.5)TCID50), or high titer (10(6.5)TCID50). Rabbits inoculated with medium and high titers shed virus in nasal secretions and developed serous to hemorrhagic nasal discharge and severe respiratory distress, followed by progressive apathy and high lethality. Clinical signs appeared around days 3-6 post-inoculation (pi) and lasted up to the day of death or euthanasia (around days 5-10). Virus shedding and clinical signs were less frequent in rabbits inoculated with low virus titers. Viremia was detected in all groups, with different frequencies. Viral DNA was detected in the feces of a few animals inoculated with P1V and P2V, low titer, and with P2V at high titer. Gross necropsy findings and histological examination showed diffuse interstitial fibrousing pneumonia with necrosuppurative bronchopneumonia and intestinal liquid content. Neutralizing antibodies were detected in all inoculated animals surviving beyond day 9 pi. These results show that rabbits are highly susceptible to VACV isolated from horses, and develop severe respiratory and systemic disease upon IN inoculation. Thus, rabbits may be used to study selected aspects of VACV infection and disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Apoptosis and necrosis in vaccinia virus-infected HeLa G and BSC-40 cells.

    Science.gov (United States)

    Liskova, Jana; Knitlova, Jarmila; Honner, Richard; Melkova, Zora

    2011-09-01

    In most cells, vaccinia virus (VACV) infection is considered to cause a lytic cell death, an equivalent of necrosis. However, upon infection of the epithelial cell lines HeLa G and BSC-40 with VACV strain Western Reserve (WR), we have previously observed an increased activation of and activity attributable to caspases, a typical sign of apoptosis. In this paper, we have further analyzed the type of cell death in VACV-infected cells HeLa G and BSC-40. In a cell-based flow cytometric assay, we showed a specific activation of caspase-2 and 4 in HeLa G and BSC-40 cells infected with VACV, strain WR, while we did not find any effects of inhibitors of calpain and cathepsin D and E. The actual activity of the two caspases, but also of caspase-3, was then confirmed in lysates of infected HeLa G, but not in BSC-40 cells. Accordingly, poly(ADP)-ribose polymerase (PARP) cleavage was found increased only in infected HeLa G cells. Consequently, we have determined morphological features of apoptosis and/or activity of the executioner caspase-3 in infected HeLa G cells in situ, while only a background apoptosis was observed in infected BSC-40 cells. Finally, vaccination strains Dryvax and Praha were found to induce apoptosis in both HeLa G and BSC-40 cells, as characterized morphologically and by PARP cleavage. These findings may be important for understanding the differences in VACV-host interactions and post-vaccination complications in different individuals. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. 78 FR 36698 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Science.gov (United States)

    2013-06-19

    ... Nucleic Acid-Based Systems for Mycobacterium tuberculosis Complex in Respiratory Specimens AGENCY: Food...) is proposing to reclassify nucleic acid-based in vitro diagnostic devices for the detection of... Controls Guideline: Nucleic Acid-Based In Vitro Diagnostic Devices for the Detection of Mycobacterium...

  19. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015.

    Science.gov (United States)

    Petersen, Brett W; Harms, Tiara J; Reynolds, Mary G; Harrison, Lee H

    2016-03-18

    On June 25, 2015, the Advisory Committee on Immunization Practices (ACIP) recommended routine vaccination with live smallpox (vaccinia) vaccine (ACAM2000) for laboratory personnel who directly handle 1) cultures or 2) animals contaminated or infected with replication-competent vaccinia virus, recombinant vaccinia viruses derived from replication-competent vaccinia strains (i.e., those that are capable of causing clinical infection and producing infectious virus in humans), or other orthopoxviruses that infect humans (e.g., monkeypox, cowpox, and variola) (recommendation category: A, evidence type 2 [Box]). Health care personnel (e.g., physicians and nurses) who currently treat or anticipate treating patients with vaccinia virus infections and whose contact with replication-competent vaccinia viruses is limited to contaminated materials (e.g., dressings) and persons administering ACAM2000 smallpox vaccine who adhere to appropriate infection prevention measures can be offered vaccination with ACAM2000 (recommendation category: B, evidence type 2 [Box]). These revised recommendations update the previous ACIP recommendations for nonemergency use of vaccinia virus smallpox vaccine for laboratory and health care personnel at risk for occupational exposure to orthopoxviruses (1). Since 2001, when the previous ACIP recommendations were developed, ACAM2000 has replaced Dryvax as the only smallpox vaccine licensed by the U.S. Food and Drug Administration (FDA) and available for use in the United States (2). These recommendations contain information on ACAM2000 and its use in laboratory and health care personnel at risk for occupational exposure to orthopoxviruses.

  20. Prevalence of xenotropic murine leukaemia virus-related virus in patients with chronic fatigue syndrome in the Netherlands: retrospective analysis of samples from an established cohort.

    NARCIS (Netherlands)

    Kuppeveld, F.J.M. van; Jong, A.S. de; Lanke, K.H.W.; Verhaegh, G.W.C.T.; Melchers, W.J.G.; Swanink, C.M.A.; Bleijenberg, G.; Netea, M.G.; Galama, J.M.D.; Meer, J.W.M. van der

    2010-01-01

    OBJECTIVE: The presence of the retrovirus xenotropic murine leukaemia virus-related virus (XMRV) has been reported in peripheral blood mononuclear cells of patients with chronic fatigue syndrome. Considering the potentially great medical and social relevance of such a discovery, we investigated

  1. Protective Effect of Surfactant Protein D in Pulmonary Vaccinia Virus Infection: Implication of A27 Viral Protein

    Directory of Open Access Journals (Sweden)

    Julien Perino

    2013-03-01

    Full Text Available Vaccinia virus (VACV was used as a surrogate of variola virus (VARV (genus Orthopoxvirus, the causative agent of smallpox, to study Orthopoxvirus infection. VARV is principally transmitted between humans by aerosol droplets. Once inhaled, VARV first infects the respiratory tract where it could encounter surfactant components, such as soluble pattern recognition receptors. Surfactant protein D (SP-D, constitutively present in the lining fluids of the respiratory tract, plays important roles in innate host defense against virus infection. We investigated the role of SP-D in VACV infection and studied the A27 viral protein involvement in the interaction with SP-D. Interaction between SP-D and VACV caused viral inhibition in a lung cell model. Interaction of SP-D with VACV was mediated by the A27 viral protein. Binding required Ca2+ and interactions were blocked in the presence of excess of SP-D saccharide ligands. A27, which lacks glycosylation, directly interacted with SP-D. The interaction between SP-D and the viral particle was also observed using electron microscopy. Infection of mice lacking SP-D (SP-D-/- resulted in increased mortality compared to SP-D+/+ mice. Altogether, our data show that SP-D participates in host defense against the vaccinia virus infection and that the interaction occurs with the viral surface protein A27.

  2. Safety and biodistribution of a double-deleted oncolytic vaccinia virus encoding CD40 ligand in laboratory Beagles

    Directory of Open Access Journals (Sweden)

    Karoliina Autio

    2014-01-01

    Full Text Available We evaluated adverse events, biodistribution and shedding of oncolytic vaccinia virus encoding CD40 ligand in two Beagles, in preparation for a phase 1 trial in canine cancer patients. Dog 1 received one dose of vaccinia virus and was euthanized 24 hours afterwards, while dog 2 received virus four times once weekly and was euthanized 7 days after that. Dogs were monitored for adverse events and underwent a detailed postmortem examination. Blood, saliva, urine, feces, and organs were collected for virus detection. Dog 1 had mild fever and lethargy while dog 2 experienced a possible seizure 5.5 hours after first virus administration. Viral DNA declined quickly in the blood after virus administration in both dogs but was still detectable 1 week later by quantitative polymerase chain reaction. Only samples taken directly after virus infusion contained infectious virus. Small amounts of viral DNA, but no infectious virus, were detected in a few saliva and urine samples. Necropsies did not reveal any relevant pathological changes and virus DNA was detected mainly in the spleen. The dogs in the study did not have cancer, and thus adverse events could be more common and viral load higher in dogs with tumors which allow viral amplification.

  3. Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36▿

    Science.gov (United States)

    Johnston, Sara C.; Ward, Brian M.

    2009-01-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress. PMID:19052096

  4. Expression of DAI by an oncolytic vaccinia virus boosts the immunogenicity of the virus and enhances antitumor immunity

    Directory of Open Access Journals (Sweden)

    Mari Hirvinen

    2016-01-01

    Full Text Available In oncolytic virotherapy, the ability of the virus to activate the immune system is a key attribute with regard to long-term antitumor effects. Vaccinia viruses bear one of the strongest oncolytic activities among all oncolytic viruses. However, its capacity for stimulation of antitumor immunity is not optimal, mainly due to its immunosuppressive nature. To overcome this problem, we developed an oncolytic VV that expresses intracellular pattern recognition receptor DNA-dependent activator of IFN-regulatory factors (DAI to boost the innate immune system and to activate adaptive immune cells in the tumor. We showed that infection with DAI-expressing VV increases expression of several genes related to important immunological pathways. Treatment with DAI-armed VV resulted in significant reduction in the size of syngeneic melanoma tumors in mice. When the mice were rechallenged with the same tumor, DAI-VV-treated mice completely rejected growth of the new tumor, which indicates immunity established against the tumor. We also showed enhanced control of growth of human melanoma tumors and elevated levels of human T-cells in DAI-VV-treated mice humanized with human peripheral blood mononuclear cells. We conclude that expression of DAI by an oncolytic VV is a promising way to amplify the vaccine potency of an oncolytic vaccinia virus to trigger the innate—and eventually the long-lasting adaptive immunity against cancer.

  5. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer.

    Science.gov (United States)

    Yoo, So Young; Bang, Seo Young; Jeong, Su-Nam; Kang, Dae Hwan; Heo, Jeong

    2016-03-29

    Stem cell-like colon cancer cells (SCCs) pose a major challenge in colon cancer treatment because of their resistance to chemotherapy and radiotherapy. Oncolytic virus-based therapy has shown promising results in uncured cancer patients; however, its effects on SCCs are not well studied yet. Here, we engineered a cancer-favoring oncolytic vaccinia virus (CVV) as a potent biotherapeutic and investigated its therapeutic efficacy in terms of killing SCCs. CVV is an evolved Wyeth strain vaccinia virus (EVV) lacking the viral thymidine kinase. SCC models were established using human or mouse colon cancer spheres, which continuously expressed stemness markers. The cancer-favoring characteristics and different cytotoxic pathways for killing cancer cells successfully overrode general drug resistance, thereby killing colon cancer cells regardless of the presence of SCCs. Subcutaneously injected HT29 spheres showed lower growth in CVV-treated models than in 5-Fu-treated models. Intraperitoneally injected CT26 spheres induced tumor masses in the abdominal region. CVV-treated groups showed higher survival rates and smaller tumor mass formation, compared to 5-Fu-treated groups. Interestingly, the combined treatment of CVV with 5-Fu showed improved survival rates and complete suppression of tumor mass. The CVV developed in this study, thus, effectively suppresses SCCs, which can be synergistically enhanced by simultaneous treatment with the anticancer drug 5-Fu. Our novel CVV is highly advantageous as a next-generation therapeutic for treating colon cancer.

  6. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)

    2013-05-01

    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  7. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  8. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole

    2009-01-01

    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human...

  9. Molecular network, pathway, and functional analysis of time-dependent gene changes associated with pancreatic cancer susceptibility to oncolytic vaccinia virotherapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2016-01-01

    Conclusions: Our study reveals the ability to assess time-dependent changes in gene expression patterns in pancreatic cancer cells associated with infection and susceptibility to vaccinia viruses. This suggests that molecular assays may be useful to develop safer and more efficacious oncolyticvirotherapies and support the idea that these treatments may target pathways implicated in pancreatic cancer resistance to conventional therapies.

  10. Primary Effusion Lymphoma Involving both Pleural and Abdominal Cavities in a Patient with Hepatitis B Virus-related Liver Cirrhosis

    Directory of Open Access Journals (Sweden)

    Pei-Ying Hsieh

    2007-01-01

    Full Text Available Primary effusion lymphoma (PEL is an unusual form of non-Hodgkin's lymphoma, which is characterized by lymphomatous effusion in body cavities, but no associated mass lesions. It is usually associated with an immunodeficient state most often with the human immunodeficiency virus (HIV. We describe a 54-year-old man with HIV-negative PEL, with a history of hepatitis B virus-related liver cirrhosis. Both abdominal and pleural cavities were involved; no solid tumor masses were found and bone marrow investigations were normal. The ascites and pleural effusion contained numerous pleomorphic lymphoid cells. Immunophenotyping was positive for CD138. Chromosome study showed complex cytogenetics. The genomic human herpesvirus-8 was detected in the lymphoma cells. It is postulated that the immuno-suppressed state in this patient may have been caused by cirrhosis. The patient received four cycles of chemotherapy of CHOP and Picibanil (OK-432 intraperitoneal administration. However, no durable remission was achieved. Adefovir failed to halt the progressive liver failure after the development of YMDD mutant related to lamivudine. He died of sepsis and hepatic failure.

  11. A novel dynamic model for predicting outcome in patients with hepatitis B virus related acute-on-chronic liver failure.

    Science.gov (United States)

    Xue, Ran; Duan, Zhonghui; Liu, Haixia; Chen, Li; Yu, Hongwei; Ren, Meixin; Zhu, Yueke; Jin, Chenggang; Han, Tao; Gao, Zhiliang; Meng, Qinghua

    2017-12-12

    It is challenging to predict the outcome of patients with hepatitis B virus related acute-on-chronic liver failure (HBV-ACLF) through existing prognostic models. Our aim was to establish a novel dynamic model to improve the predictive efficiency of 30-day mortality in HBV-ACLF patients. 305 patients who were diagnosed as HBV-ACLF (derivation cohort, n=211; validation cohort, n=94) were included in this study. The HBV-ACLF dynamic (HBV-ACLFD) model was constructed based on the daily levels of predictive variables in 7 days after diagnosis combined with baseline risk factors by multivariate logistic regression analysis. The HBV-ACLFD model was compared with the Child-Turcotte-Pugh (CTP) score, end-stage liver disease (MELD) score, and MELD within corporation of serum sodium (MELD-Na) score by the area under the receiver-operating characteristic curves (AUROC). The HBV-ACLFD model demonstrated excellent discrimination with AUROC of 0.848 in the derivation cohort and of 0.813 in the validation cohort (p=0.620). The performance of the HBV-ACLFD model appeared to be superior to MELD score, MELD-Na score and CTP score (P<0.0001). The HBV-ACLFD model can accurately predict 30-day mortality in patients with HBV-ACLF, which is helpful to select appropriate clinical procedures, so as to relieve the social and economic burden.

  12. PCR and serology find no association between xenotropic murine leukemia virus-related virus (XMRV and autism

    Directory of Open Access Journals (Sweden)

    Satterfield Brent C

    2010-10-01

    Full Text Available Abstract Xenotropic murine leukemia virus-related virus (XMRV is a retrovirus implicated in prostate cancer and chronic fatigue syndrome (CFS. Press releases have suggested that it could contribute to autism spectrum disorder (ASD. In this study we used two PCR assays and one antibody assay to screen 25 blood samples from autistic children born to mothers with CFS and from 20 mixed controls including family members of the children assayed, people with fibromyalgia and people with chronic Lyme disease. Using a real-time PCR assay, we screened an additional 48 South Carolina autism disorder samples, 96 Italian ASD samples, 61 South Carolina ASD samples and 184 healthy controls. Despite having the ability to detect low copy number XMRV DNA in a large background of cellular DNA, none of the PCR assays found any evidence of XMRV infection in blood cells from patients or controls. Further, no anti-XMRV antibodies were detected, ruling out possible low level or abortive infections in blood or in other reservoirs. These results imply that XMRV is not associated with autism.

  13. No detection of xenotropic murine leukemia virus-related viruses in prostate cancer in Sanandaj, west of Iran.

    Science.gov (United States)

    Khodabandehloo, Mazaher; Hosseini, Weria; Rahmani, Mohammad-Reza; Rezaee, Mohammad-Ali; Hakhamaneshi, Mohammad-Saied; Nikkhoo, Bahram; Jalili, Ali

    2013-01-01

    Multiple etiologies have been hypothesized for prostate cancer, including genetic defects and infectious agents. A recently reported gamaretrovirus, xenotropic murine leukemia virus-related virus (XMRV) has been reported to be detected in prostate cancer. However, this virus has not been detected in similar groups of patients in other studies. Herein, we sought to detect XMRV in prostate cancers and benign controls in Sanandaj, west of Iran. In a case-control study, genomic DNA was extracted from formalin fixed and paraffin embedded prostate tissues from a total of 163 Iranian patients. We developed a conventional and a nested PCR assay using primers targeting to an env specific sequence of XMRV. PCR assays were carried out on 63 prostate cancers and 100 benign prostate hyperplasias. Beta-actin sequences were successfully detected in the DNA extracts from all prostate tissues, confirming DNA extraction integrity. We did not detect XMRV in samples either from prostate cancers or benign prostate hyperplasias using XMRV specific primers. We conclude that in our population XMRV does not play a role in genesis of prostate cancer.

  14. Crystal structures of the reverse transcriptase-associated ribonuclease H domain of xenotropic murine leukemia-virus related virus

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Dongwen; Chung, Suhman; Miller, Maria; Le Grice, Stuart F.J.; Wlodawer, Alexander (NCI)

    2012-06-19

    The ribonuclease H (RNase H) domain of retroviral reverse transcriptase (RT) plays a critical role in the life cycle by degrading the RNA strands of DNA/RNA hybrids. In addition, RNase H activity is required to precisely remove the RNA primers from nascent (-) and (+) strand DNA. We report here three crystal structures of the RNase H domain of xenotropic murine leukemia virus-related virus (XMRV) RT, namely (i) the previously identified construct from which helix C was deleted, (ii) the intact domain, and (iii) the intact domain complexed with an active site {alpha}-hydroxytropolone inhibitor. Enzymatic assays showed that the intact RNase H domain retained catalytic activity, whereas the variant lacking helix C was only marginally active, corroborating the importance of this helix for enzymatic activity. Modeling of the enzyme-substrate complex elucidated the essential role of helix C in binding a DNA/RNA hybrid and its likely mode of recognition. The crystal structure of the RNase H domain complexed with {beta}-thujaplicinol clearly showed that coordination by two divalent cations mediates recognition of the inhibitor.

  15. Androgen-independent proliferation of LNCaP prostate cancer cells infected by xenotropic murine leukemia virus-related virus

    Energy Technology Data Exchange (ETDEWEB)

    Kakoki, Katsura [Division of Cytokine Signaling, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523 (Japan); Department of Urology, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Kamiyama, Haruka [Division of Cytokine Signaling, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523 (Japan); Izumida, Mai; Yashima, Yuka; Hayashi, Hideki [Division of Cytokine Signaling, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Yamamoto, Naoki [Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523 (Japan); Department of Microbiology, National University of Singapore (Singapore); Matsuyama, Toshifumi [Division of Cytokine Signaling, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Igawa, Tsukasa; Sakai, Hideki [Department of Urology, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Kubo, Yoshinao, E-mail: yoshinao@nagasaki-u.ac.jp [Division of Cytokine Signaling, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523 (Japan); Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523 (Japan)

    2014-04-25

    Highlights: • XMRV infection induces androgen-independent growth in LNCaP cells. • XMRV infection reduces expression of androgen receptor. • XMRV promotes appearance of androgen blocker-resistant prostate cancer cells. - Abstract: Xenotropic murine leukemia virus-related virus (XMRV) is a novel gammaretrovirus that was originally isolated from human prostate cancer. It is now believed that XMRV is not the etiologic agent of prostate cancer. An analysis of murine leukemia virus (MLV) infection in various human cell lines revealed that prostate cancer cell lines are preferentially infected by XMRV, and this suggested that XMRV infection may confer some sort of growth advantage to prostate cancer cell lines. To examine this hypothesis, androgen-dependent LNCaP cells were infected with XMRV and tested for changes in certain cell growth properties. We found that XMRV-infected LNCaP cells can proliferate in the absence of the androgen dihydrotestosterone. Moreover, androgen receptor expression is significantly reduced in XMRV-infected LNCaP cells. Such alterations were not observed in uninfected and amphotropic MLV-infected LNCaP cells. This finding explains why prostate cancer cell lines are preferentially infected with XMRV.

  16. Detection of target DNA using fluorescent cationic polymer and peptide nucleic acid probes on solid support

    Directory of Open Access Journals (Sweden)

    Leclerc Mario

    2005-04-01

    Full Text Available Abstract Background Nucleic acids detection using microarrays requires labelling of target nucleic acids with fluorophores or other reporter molecules prior to hybridization. Results Using surface-bound peptide nucleic acids (PNA probes and soluble fluorescent cationic polythiophenes, we show a simple and sensitive electrostatic approach to detect and identify unlabelled target nucleic acid on microarray. Conclusion This simple methodology opens exciting possibilities for applied genetic analysis for the diagnosis of infections, identification of genetic mutations, and forensic inquiries. This electrostatic strategy could also be used with other nucleic acid detection methods such as electrochemistry, silver staining, metallization, quantum dots, or electrochemical dyes.

  17. Detection of target DNA using fluorescent cationic polymer and peptide nucleic acid probes on solid support

    Science.gov (United States)

    Raymond, Frédéric R; Ho, Hoang-Anh; Peytavi, Régis; Bissonnette, Luc; Boissinot, Maurice; Picard, François J; Leclerc, Mario; Bergeron, Michel G

    2005-01-01

    Background Nucleic acids detection using microarrays requires labelling of target nucleic acids with fluorophores or other reporter molecules prior to hybridization. Results Using surface-bound peptide nucleic acids (PNA) probes and soluble fluorescent cationic polythiophenes, we show a simple and sensitive electrostatic approach to detect and identify unlabelled target nucleic acid on microarray. Conclusion This simple methodology opens exciting possibilities for applied genetic analysis for the diagnosis of infections, identification of genetic mutations, and forensic inquiries. This electrostatic strategy could also be used with other nucleic acid detection methods such as electrochemistry, silver staining, metallization, quantum dots, or electrochemical dyes. PMID:15850478

  18. Present status of protein and nucleic acid database activities in the world

    Science.gov (United States)

    Tsugita, Akira

    The first protein database was founded in 1965, followed by the establishment of nucleic acid databases from 1971. Presently there are six major sequence databases, located in Japan, USA and the FRG-three for protein data and three for nucleic acid data. International cooperation between the protein databases and between the nucleic acid databases have greatly facilitated compilation and dissemination of data. Coordination between these protein and nucleic acid databases have progressed with the support of the CODATA Task Group and the International Advisory Board for Nucleic Acid Databases. In the protein field, several additional database activities are initiated to contribute to protein engineering and structure-activity relationships.

  19. Nucleic acid tool enzymes-aided signal amplification strategy for biochemical analysis: status and challenges.

    Science.gov (United States)

    Qing, Taiping; He, Dinggeng; He, Xiaoxiao; Wang, Kemin; Xu, Fengzhou; Wen, Li; Shangguan, Jingfang; Mao, Zhengui; Lei, Yanli

    2016-04-01

    Owing to their highly efficient catalytic effects and substrate specificity, the nucleic acid tool enzymes are applied as 'nano-tools' for manipulating different nucleic acid substrates both in the test-tube and in living organisms. In addition to the function as molecular scissors and molecular glue in genetic engineering, the application of nucleic acid tool enzymes in biochemical analysis has also been extensively developed in the past few decades. Used as amplifying labels for biorecognition events, the nucleic acid tool enzymes are mainly applied in nucleic acids amplification sensing, as well as the amplification sensing of biorelated variations of nucleic acids. With the introduction of aptamers, which can bind different target molecules, the nucleic acid tool enzymes-aided signal amplification strategies can also be used to sense non-nucleic targets (e.g., ions, small molecules, proteins, and cells). This review describes and discusses the amplification strategies of nucleic acid tool enzymes-aided biosensors for biochemical analysis applications. Various analytes, including nucleic acids, ions, small molecules, proteins, and cells, are reviewed briefly. This work also addresses the future trends and outlooks for signal amplification in nucleic acid tool enzymes-aided biosensors.

  20. Fool's Gold Footprinting: microfluidic probing of nucleic acids

    Science.gov (United States)

    Jones, Christopher D.; Schlatterer, Joerg C.; Brenowitz, Michael; Pollack, Lois

    2012-02-01

    We describe a microfluidic device containing a mineral matrix capable of rapidly generating hydroxyl radicals that enables high-resolution structural studies of nucleic acids. Hydroxyl radicals cleave the solvent accessible backbone of DNA and RNA; the cleavage products can be detected with as fine as single nucleotide resolution. Protection from hydroxyl radical cleavage (footprinting) can identify sites of protein binding or the presence of tertiary structure. Here we report preparation of micron sized particles of iron sulfide (pyrite) and fabrication of a microfluidic prototype that together generate enough hydroxyl radicals within 20 ms to cleave DNA sufficiently for a footprinting analysis to be conducted. This prototype enables the development of high-throughput and/or rapid reaction devices with which to probe nucleic acid folding dynamics and ligand binding.

  1. NPIDB: Nucleic acid-Protein Interaction DataBase.

    Science.gov (United States)

    Kirsanov, Dmitry D; Zanegina, Olga N; Aksianov, Evgeniy A; Spirin, Sergei A; Karyagina, Anna S; Alexeevski, Andrei V

    2013-01-01

    The Nucleic acid-Protein Interaction DataBase (http://npidb.belozersky.msu.ru/) contains information derived from structures of DNA-protein and RNA-protein complexes extracted from the Protein Data Bank (3846 complexes in October 2012). It provides a web interface and a set of tools for extracting biologically meaningful characteristics of nucleoprotein complexes. The content of the database is updated weekly. The current version of the Nucleic acid-Protein Interaction DataBase is an upgrade of the version published in 2007. The improvements include a new web interface, new tools for calculation of intermolecular interactions, a classification of SCOP families that contains DNA-binding protein domains and data on conserved water molecules on the DNA-protein interface.

  2. Devices, systems, and methods for detecting nucleic acids using sedimentation

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.

    2017-10-24

    Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.

  3. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    Science.gov (United States)

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-08

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  4. Surface plasmon resonance sensing of nucleic acids: A review

    Energy Technology Data Exchange (ETDEWEB)

    Šípová, Hana [Institute of Photonics and Electronics, Academy of Sciences of the Czech Republic, Chaberská 57, Prague (Czech Republic); Homola, Jiří, E-mail: homola@ufe.cz [Institute of Photonics and Electronics, Academy of Sciences of the Czech Republic, Chaberská 57, Prague (Czech Republic)

    2013-04-22

    Highlights: ► Advances of nucleic acid (NA) surface plasmon resonance (SPR) sensors are presented. ► Bioanalytical applications of NA SPR biosensors are reviewed. ► Applications for study of molecular interactions involving NAs are also discussed. -- Abstract: Biosensors based on surface plasmon resonance (SPR) have become a central tool for the investigation and quantification of biomolecules and their interactions. Nucleic acids (NAs) play a vital role in numerous biological processes and therefore have been one of the major groups of biomolecules targeted by the SPR biosensors. This paper discusses the advances of NA SPR biosensor technology and reviews its applications both in the research of molecular interactions involving NAs (NA–NA, NA–protein, NA–small molecule), as well as for the field of bioanalytics in the areas of food safety, medical diagnosis and environmental monitoring.

  5. An extended IUPAC nomenclature code for polymorphic nucleic acids.

    Science.gov (United States)

    Johnson, Andrew D

    2010-05-15

    The International Union of Pure and Applied Chemistry (IUPAC) code specified nearly 25 years ago provides a nomenclature for incompletely specified nucleic acids. However, no system currently exists that allows for the informatics representation of the relative abundance at polymorphic nucleic acids (e.g. single nucleotide polymorphisms) in a single specified character, or a string of characters. Here, I propose such an information code as a natural extension to the IUPAC nomenclature code, and present some potential uses and limitations to such a code. The primary anticipated use of this extended nomenclature code is to assist in the representation of the rapidly growing space of information in human genetic variation. johnsonad2@nhlbi.nih.gov Supplementary data are available at Bioinformatics online.

  6. Universal nucleic acids sample preparation method for cells, spores and their mixture

    Science.gov (United States)

    Bavykin, Sergei [Darien, IL

    2011-01-18

    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

  7. Nucleic acid-based fluorescent probes and their analytical potential.

    Science.gov (United States)

    Juskowiak, Bernard

    2011-03-01

    It is well known that nucleic acids play an essential role in living organisms because they store and transmit genetic information and use that information to direct the synthesis of proteins. However, less is known about the ability of nucleic acids to bind specific ligands and the application of oligonucleotides as molecular probes or biosensors. Oligonucleotide probes are single-stranded nucleic acid fragments that can be tailored to have high specificity and affinity for different targets including nucleic acids, proteins, small molecules, and ions. One can divide oligonucleotide-based probes into two main categories: hybridization probes that are based on the formation of complementary base-pairs, and aptamer probes that exploit selective recognition of nonnucleic acid analytes and may be compared with immunosensors. Design and construction of hybridization and aptamer probes are similar. Typically, oligonucleotide (DNA, RNA) with predefined base sequence and length is modified by covalent attachment of reporter groups (one or more fluorophores in fluorescence-based probes). The fluorescent labels act as transducers that transform biorecognition (hybridization, ligand binding) into a fluorescence signal. Fluorescent labels have several advantages, for example high sensitivity and multiple transduction approaches (fluorescence quenching or enhancement, fluorescence anisotropy, fluorescence lifetime, fluorescence resonance energy transfer (FRET), and excimer-monomer light switching). These multiple signaling options combined with the design flexibility of the recognition element (DNA, RNA, PNA, LNA) and various labeling strategies contribute to development of numerous selective and sensitive bioassays. This review covers fundamentals of the design and engineering of oligonucleotide probes, describes typical construction approaches, and discusses examples of probes used both in hybridization studies and in aptamer-based assays.

  8. Silicon Dioxide Thin Film Mediated Single Cell Nucleic Acid Isolation

    Science.gov (United States)

    Bogdanov, Evgeny; Dominova, Irina; Shusharina, Natalia; Botman, Stepan; Kasymov, Vitaliy; Patrushev, Maksim

    2013-01-01

    A limited amount of DNA extracted from single cells, and the development of single cell diagnostics make it necessary to create a new highly effective method for the single cells nucleic acids isolation. In this paper, we propose the DNA isolation method from biomaterials with limited DNA quantity in sample, and from samples with degradable DNA based on the use of solid-phase adsorbent silicon dioxide nanofilm deposited on the inner surface of PCR tube. PMID:23874571

  9. Developing nucleic acid-based electrical detection systems.

    Science.gov (United States)

    Gabig-Ciminska, Magdalena

    2006-03-02

    Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in nucleic acid-based electrical

  10. Development of Sorbents for Extraction and Stabilization of Nucleic Acids

    Science.gov (United States)

    2016-09-13

    biomolecules, espe - cially DNA and RNA. The goal was to provide stabilization methods for reagents and targets in order to allow for a wider range of...within the scaffolds, and optimal methodologies for using the systems to capture, stabilize, and recover nucleic acids. Sorbent design...currently in use. In addition, stabilizing technologies can provide new sampling methodologies that can enhance the capacity for obtaining environmental

  11. Watson-Crick hydrogen bonding of unlocked nucleic acids.

    Science.gov (United States)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-11-15

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Los Alamos sequence analysis package for nucleic acids and proteins.

    OpenAIRE

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  13. Developing nucleic acid-based electrical detection systems

    Directory of Open Access Journals (Sweden)

    Gabig-Ciminska Magdalena

    2006-03-01

    Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in

  14. Developing nucleic acid-based electrical detection systems

    Science.gov (United States)

    Gabig-Ciminska, Magdalena

    2006-01-01

    Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in nucleic acid-based electrical

  15. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes.

    Science.gov (United States)

    Bourquain, Daniel; Dabrowski, Piotr Wojtek; Nitsche, Andreas

    2013-02-20

    Animal-borne orthopoxviruses, like monkeypox, vaccinia and the closely related cowpox virus, are all capable of causing zoonotic infections in humans, representing a potential threat to human health. The disease caused by each virus differs in terms of symptoms and severity, but little is yet know about the reasons for these varying phenotypes. They may be explained by the unique repertoire of immune and host cell modulating factors encoded by each virus. In this study, we analysed the specific modulation of the host cell's gene expression profile by cowpox, monkeypox and vaccinia virus infection. We aimed to identify mechanisms that are either common to orthopoxvirus infection or specific to certain orthopoxvirus species, allowing a more detailed description of differences in virus-host cell interactions between individual orthopoxviruses. To this end, we analysed changes in host cell gene expression of HeLa cells in response to infection with cowpox, monkeypox and vaccinia virus, using whole-genome gene expression microarrays, and compared these to each other and to non-infected cells. Despite a dominating non-responsiveness of cellular transcription towards orthopoxvirus infection, we could identify several clusters of infection-modulated genes. These clusters are either commonly regulated by orthopoxvirus infection or are uniquely regulated by infection with a specific orthopoxvirus, with major differences being observed in immune response genes. Most noticeable was an induction of genes involved in leukocyte migration and activation in cowpox and monkeypox virus-infected cells, which was not observed following vaccinia virus infection. Despite their close genetic relationship, the expression profiles induced by infection with different orthopoxviruses vary significantly. It may be speculated that these differences at the cellular level contribute to the individual characteristics of cowpox, monkeypox and vaccinia virus infections in certain host species.

  16. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis.

    Directory of Open Access Journals (Sweden)

    Don B Gammon

    2010-07-01

    Full Text Available Ribonucleotide reductases (RRs are evolutionarily-conserved enzymes that catalyze the rate-limiting step during dNTP synthesis in mammals. RR consists of both large (R1 and small (R2 subunits, which are both required for catalysis by the R1(2R2(2 heterotetrameric complex. Poxviruses also encode RR proteins, but while the Orthopoxviruses infecting humans [e.g. vaccinia (VACV, variola, cowpox, and monkeypox viruses] encode both R1 and R2 subunits, the vast majority of Chordopoxviruses encode only R2 subunits. Using plaque morphology, growth curve, and mouse model studies, we investigated the requirement of VACV R1 (I4 and R2 (F4 subunits for replication and pathogenesis using a panel of mutant viruses in which one or more viral RR genes had been inactivated. Surprisingly, VACV F4, but not I4, was required for efficient replication in culture and virulence in mice. The growth defects of VACV strains lacking F4 could be complemented by genes encoding other Chordopoxvirus R2 subunits, suggesting conservation of function between poxvirus R2 proteins. Expression of F4 proteins encoding a point mutation predicted to inactivate RR activity but still allow for interaction with R1 subunits, caused a dominant negative phenotype in growth experiments in the presence or absence of I4. Co-immunoprecipitation studies showed that F4 (as well as other Chordopoxvirus R2 subunits form hybrid complexes with cellular R1 subunits. Mutant F4 proteins that are unable to interact with host R1 subunits failed to rescue the replication defect of strains lacking F4, suggesting that F4-host R1 complex formation is critical for VACV replication. Our results suggest that poxvirus R2 subunits form functional complexes with host R1 subunits to provide sufficient dNTPs for viral replication. Our results also suggest that R2-deficient poxviruses may be selective oncolytic agents and our bioinformatic analyses provide insights into how poxvirus nucleotide metabolism proteins may

  17. Molecular modeling of nucleic Acid structure: electrostatics and solvation.

    Science.gov (United States)

    Bergonzo, Christina; Galindo-Murillo, Rodrigo; Cheatham, Thomas E

    2014-12-19

    This unit presents an overview of computer simulation techniques as applied to nucleic acid systems, ranging from simple in vacuo molecular modeling techniques to more complete all-atom molecular dynamics treatments that include an explicit representation of the environment. The third in a series of four units, this unit focuses on critical issues in solvation and the treatment of electrostatics. UNITS 7.5 & 7.8 introduced the modeling of nucleic acid structure at the molecular level. This included a discussion of how to generate an initial model, how to evaluate the utility or reliability of a given model, and ultimately how to manipulate this model to better understand its structure, dynamics, and interactions. Subject to an appropriate representation of the energy, such as a specifically parameterized empirical force field, the techniques of minimization and Monte Carlo simulation, as well as molecular dynamics (MD) methods, were introduced as a way of sampling conformational space for a better understanding of the relevance of a given model. This discussion highlighted the major limitations with modeling in general. When sampling conformational space effectively, difficult issues are encountered, such as multiple minima or conformational sampling problems, and accurately representing the underlying energy of interaction. In order to provide a realistic model of the underlying energetics for nucleic acids in their native environments, it is crucial to include some representation of solvation (by water) and also to properly treat the electrostatic interactions. These subjects are discussed in detail in this unit. Copyright © 2014 John Wiley & Sons, Inc.

  18. Varicella zoster virus related deaths and hospitalizations before the introduction of universal vaccination with the tetraviral vaccine

    Directory of Open Access Journals (Sweden)

    Alessandra de Martino Mota

    2016-08-01

    Full Text Available Abstract Objective: To characterize varicella zoster virus-related deaths and hospitalizations in Brazil before universal vaccination with the tetravalent (measles, mumps, rubella, and varicella vaccine, attempting to collect baseline data on varicella morbidity and mortality in order to evaluate the impact of the varicella vaccination program. Methods: Varicella-associated mortality data were evaluated between 1996 and 2011 and varicella zoster virus-associated hospitalizations between 1998 and 2013. Data were gathered from the Informatics Department of the Unified Health System, considering the International Classification of Diseases, 10th Revision, code B01. All age groups were assessed. Varicella-specific mortality rates were calculated and seasonality of varicella-zoster virus-associated hospitalizations was described. Results: There were 2334 varicella deaths between 1996 and 2011, 19.3% in infants aged less than 1 year and 36% in children from 1 to 4 years. In infants under 1 year, varicella mortality rates reached 3.2/100,000/year. In children aged 1–4 years, varicella mortality rates reach 1.64/100,000/year. Average annual mortality rates for varicella in Brazil are 0.88/100,000 in infants under 1 year and 0.40/100,000 in children aged 1–4 years. The total number of hospitalizations associated with varicella zoster virus was 62,246 from 2008 to 2013. Varicella-associated hospitalizations have a seasonal distribution in children, peaking in November. In the elderly, monthly averages of herpes zoster-associated hospitalizations present no significant seasonal variation. Conclusions: Varicella is associated, in the pre-vaccine period, to significant morbidity and mortality in Brazil. The universal vaccination program is expected to decrease the disease burden from varicella.

  19. Varicella zoster virus related deaths and hospitalizations before the introduction of universal vaccination with the tetraviral vaccine.

    Science.gov (United States)

    de Martino Mota, Alessandra; Carvalho-Costa, Filipe Anibal

    2016-01-01

    To characterize varicella zoster virus-related deaths and hospitalizations in Brazil before universal vaccination with the tetravalent (measles, mumps, rubella, and varicella) vaccine, attempting to collect baseline data on varicella morbidity and mortality in order to evaluate the impact of the varicella vaccination program. Varicella-associated mortality data were evaluated between 1996 and 2011 and varicella zoster virus-associated hospitalizations between 1998 and 2013. Data were gathered from the Informatics Department of the Unified Health System, considering the International Classification of Diseases, 10th Revision, code B01. All age groups were assessed. Varicella-specific mortality rates were calculated and seasonality of varicella-zoster virus-associated hospitalizations was described. There were 2334 varicella deaths between 1996 and 2011, 19.3% in infants aged less than 1 year and 36% in children from 1 to 4 years. In infants under 1 year, varicella mortality rates reached 3.2/100,000/year. In children aged 1-4 years, varicella mortality rates reach 1.64/100,000/year. Average annual mortality rates for varicella in Brazil are 0.88/100,000 in infants under 1 year and 0.40/100,000 in children aged 1-4 years. The total number of hospitalizations associated with varicella zoster virus was 62,246 from 2008 to 2013. Varicella-associated hospitalizations have a seasonal distribution in children, peaking in November. In the elderly, monthly averages of herpes zoster-associated hospitalizations present no significant seasonal variation. Varicella is associated, in the pre-vaccine period, to significant morbidity and mortality in Brazil. The universal vaccination program is expected to decrease the disease burden from varicella. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  20. Seroprevalence of xenotropic murine leukemia virus-related virus in normal and retrovirus-infected blood donors.

    Science.gov (United States)

    Qiu, Xiaoxing; Swanson, Priscilla; Tang, Ning; Leckie, Gregor W; Devare, Sushil G; Schochetman, Gerald; Hackett, John

    2012-02-01

    Xenotropic murine leukemia virus-related virus (XMRV) has been reported in patients with prostate cancer and chronic fatigue syndrome. Although results have been conflicting, the potential of XMRV as an infectious human retrovirus has raised concerns about transfusion safety. To address this issue, normal and retrovirus-infected blood donors were screened for evidence of XMRV infection. Plasma from 1000 US, 100 human immunodeficiency virus Type 1-infected Cameroonian, and 642 human T-lymphotropic virus Type I (HTLV-I)-infected or uninfected Japanese blood donors as well as 311 sexually transmitted disease diagnostic specimens were screened for antibodies to XMRV gp70 and p15E using chemiluminescent immunoassays (CMIAs). CMIA-reactive samples were evaluated by p30 CMIA, Western blot, and real-time reverse transcriptase polymerase chain reaction. XMRV seroreactivity was low (0%-0.6%) with the exception of the HTLV-I-infected donors (4.9%). Antibody was detected against only a single XMRV protein (p15E or gp70); none of the seroreactive samples had detectable XMRV pol or env sequences. The elevated seroreactivity in HTLV-I-infected donors was due to an increased p15E seroreactive rate (4.1%). Inspection of XMRV and HTLV sequences revealed a high level of conservation within the immunodominant region (IDR) of the transmembrane protein. In some cases, HTLV IDR peptide competitively reduced the XMRV p15E signal. Based on the low prevalence of seroreactivity, detection of antibody to only a single XMRV protein and the absence of XMRV sequences, this study finds no compelling evidence of XMRV in normal or retrovirus-infected blood donors. The increased p15E seroreactivity observed in HTLV infection is likely due to cross-reactive antibodies. © 2012 American Association of Blood Banks.

  1. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    Science.gov (United States)

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in actin tail formation. In this study we have sought to understand how these proteins, all of which are predicted to have small cytoplasmic domains, are involved in IEV assembly and actin tail formation. Our data reveal that while deletion of A34R, B5R, or F13L resulted in a severe reduction in IEV particle assembly, IEVs formed by the ΔB5R and ΔF13L deletion strains, but not ΔA34R, were still able to induce actin tails. The ΔA36R deletion strain produced normal amounts of IEV particles, although these were unable to induce actin tails. Using several different approaches, we demonstrated that A36R is a type Ib membrane protein with a large, 195-amino-acid cytoplasmic domain exposed on the surface of IEV particles. Finally, coimmunoprecipitation experiments demonstrated that A36R interacts with A33R and A34R but not with B5R and that B5R forms a complex with A34R but not with A33R or A36R. Using extracts from ΔA34R- and ΔA36R-infected cells, we found that the interaction of A36R with A33R and that of A34R with B5R are independent of A34R and A36R, respectively. We conclude from our observations that multiple interactions between IEV membrane proteins exist which have important implications for IEV assembly and actin tail formation. Furthermore, these data suggest that while A34R is involved in IEV assembly and organization, A36R is critical for actin tail formation. PMID:10074134

  2. Comparative analysis of viral gene expression programs during poxvirus infection: a transcriptional map of the vaccinia and monkeypox genomes.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    2008-07-01

    Full Text Available Poxviruses engage in a complex and intricate dialogue with host cells as part of their strategy for replication. However, relatively little molecular detail is available with which to understand the mechanisms behind this dialogue.We designed a specialized microarray that contains probes specific to all predicted ORFs in the Monkeypox Zaire (MPXV and Vaccinia Western Reserve (VACV genomes, as well as >18,000 human genes, and used this tool to characterize MPXV and VACV gene expression responses in vitro during the course of primary infection of human monocytes, primary human fibroblasts and HeLa cells. The two viral transcriptomes show distinct features of temporal regulation and species-specific gene expression, and provide an early foundation for understanding global gene expression responses during poxvirus infection.The results provide a temporal map of the transcriptome of each virus during infection, enabling us to compare viral gene expression across species, and classify expression patterns of previously uncharacterized ORFs.

  3. Protective properties of vaccinia virus-based vaccines: skin scarification promotes a nonspecific immune response that protects against orthopoxvirus disease.

    Science.gov (United States)

    Rice, Amanda D; Adams, Mathew M; Lindsey, Scott F; Swetnam, Daniele M; Manning, Brandi R; Smith, Andrew J; Burrage, Andrew M; Wallace, Greg; MacNeill, Amy L; Moyer, Richard W

    2014-07-01

    The process of vaccination introduced by Jenner generated immunity against smallpox and ultimately led to the eradication of the disease. Procedurally, in modern times, the virus is introduced into patients via a process called scarification, performed with a bifurcated needle containing a small amount of virus. What was unappreciated was the role that scarification itself plays in generating protective immunity. In rabbits, protection from lethal disease is induced by intradermal injection of vaccinia virus, whereas a protective response occurs within the first 2 min after scarification with or without virus, suggesting that the scarification process itself is a major contributor to immunoprotection. importance: These results show the importance of local nonspecific immunity in controlling poxvirus infections and indicate that the process of scarification should be critically considered during the development of vaccination protocols for other infectious agents. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  4. Vaccinia viruses isolated from skin infection in horses produced cutaneous and systemic disease in experimentally infected rabbits.

    Science.gov (United States)

    Cargnelutti, Juliana Felipetto; Schmidt, Candice; Masuda, Eduardo Kenji; Nogueira, Paula Rochelle Kurrle; Weiblen, Rudi; Flores, Eduardo Furtado

    2012-10-01

    The susceptibility of rabbits to two isolates of Vaccinia virus (VACV) recovered from cutaneous disease in horses in Southern Brazil was investigated. Rabbits were inoculated in the ear skin with both VACV isolates, either in single or mixed infection. All inoculated animals presented local skin lesions characterized by hyperaemia, papules, vesicles, pustules and ulcers. Infectious virus was detected in the lungs and intestine of rabbits that died during acute disease. Histological examination of the skin revealed changes characteristic of those associated with members of the genus Orthopoxvirus. These results demonstrate that rabbits develop skin disease accompanied by systemic signs upon intradermal inoculation of these two equine VACV isolates, either alone or in combination, opening the way for using rabbits to study selected aspects of the biology and pathogenesis of VACV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Myristoylation increases the CD8+T-cell response to a GFP prototype antigen delivered by modified vaccinia virus Ankara.

    Science.gov (United States)

    Marr, Lisa; Lülf, Anna-Theresa; Freudenstein, Astrid; Sutter, Gerd; Volz, Asisa

    2016-04-01

    Activation of CD8(+)T-cells is an essential part of immune responses elicited by recombinant modified vaccinia virus Ankara (MVA). Strategies to enhance T-cell responses to antigens may be particularly necessary for broadly protective immunization against influenza A virus infections or for candidate vaccines targeting chronic infections and cancer. Here, we tested recombinant MVAs that targeted a model antigen, GFP, to different localizations in infected cells. In vitro characterization demonstrated that GFP accumulated in the nucleus (MVA-nls-GFP), associated with cellular membranes (MVA-myr-GFP) or was equally distributed throughout the cell (MVA-GFP). On vaccination, we found significantly higher levels of GFP-specific CD8(+)T-cells in MVA-myr-GFP-vaccinated BALB/c mice than in those immunized with MVA-GFP or MVA-nls-GFP. Thus, myristoyl modification may be a useful strategy to enhance CD8(+)T-cell responses to MVA-delivered target antigens.

  6. Separate worlds set to collide: smallpox, vaccinia virus vaccination, and human immunodeficiency virus and acquired immunodeficiency syndrome.

    Science.gov (United States)

    Amorosa, Valerianna K; Isaacs, Stuart N

    2003-08-01

    Concerns about the possible release of smallpox by bioterrorists has led to policies that recommend smallpox vaccination of some health care providers, and, in the near future, the vaccine may become available to the general population on a voluntary basis. Both smallpox virus (variola virus) and the smallpox vaccine (vaccinia virus) will have a significant impact on people infected with human immunodeficiency virus (HIV). Given that populations with acquired immunodeficiency syndrome and populations with immunosuppressed conditions due to solid organ and bone marrow transplantation were not present in the days when smallpox was prevalent, we will speculate on how smallpox might present in immunodeficient patients, and we will review the adverse events expected from the smallpox vaccine in hosts with HIV infection.

  7. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA)

    DEFF Research Database (Denmark)

    Cottingham, Matthew G; Andersen, Rikke F; Spencer, Alexandra J

    2008-01-01

    -length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering) of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A...... to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA), now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full......-2006). In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+) T cells against an epitope from Plasmodium berghei was created using Gal...

  8. Both NK cell-intrinsic and -extrinsic STAT1 signaling are required for NK cell response against vaccinia virus.

    Science.gov (United States)

    Fortin, Carl; Huang, Xiaopei; Yang, Yiping

    2013-07-01

    NK cells play an important role in innate immune control of the infection with vaccinia virus (VV). However, it remains incompletely defined how the activation of NK cells in response to VV is regulated. In this study, we showed that STAT1 was critical for NK cell activation upon VV infection and the subsequent clearance of VV infection in vivo. We further demonstrated that STAT1 signaling in both NK and accessory cells such as dendritic cells was required for efficient NK cell activation upon VV infection. Mechanistically, STAT1 signaling in dendritic cells promoted the expression of NKG2D ligands, which is required for NK cell activation via the NKG2D pathway. Taken together, our data suggest that STAT1 mediates anti-VV effect by promoting NK cell activation through both NK-intrinsic and extrinsic mechanisms and may provide insights into the design of effective NK cell-based therapies for viral infections.

  9. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy

    Science.gov (United States)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)

    1998-01-01

    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  10. Ribonuclease activity of vaccinia DNA topoisomerase IB: kinetic and high-throughput inhibition studies using a robust continuous fluorescence assay.

    Science.gov (United States)

    Kwon, Keehwan; Nagarajan, Rajesh; Stivers, James T

    2004-11-30

    Vaccinia type I DNA topoisomerase exhibits a strong site-specific ribonuclease activity when provided a DNA substrate that contains a single uridine ribonucleotide within a duplex DNA containing the sequence 5' CCCTU 3'. The reaction involves two steps: attack of the active site tyrosine nucleophile of topo I at the 3' phosphodiester of the uridine nucleotide to generate a covalent enzyme-DNA adduct, followed by nucleophilic attack of the uridine 2'-hydroxyl to release the covalently tethered enzyme. Here we report the first continuous spectroscopic assay for topoisomerase that allows monitoring of the ribonuclease reaction under multiple-turnover conditions. The assay is especially robust for high-throughput screening applications because sensitive molecular beacon technology is utilized, and the topoisomerase is released during the reaction to allow turnover of multiple substrate molecules by a single molecule of enzyme. Direct computer simulation of the fluorescence time courses was used to obtain the rate constants for substrate binding and release, covalent complex formation, and formation of the 2',3'-cyclic phosphodiester product of the ribonuclease reaction. The assay allowed rapid screening of a 500 member chemical library from which several new inhibitors of topo I were identified with IC(50) values in the range of 2-100 microM. Three of the most potent hits from the high-throughput screening were also found to inhibit plasmid supercoil relaxation by the enzyme, establishing the utility of the assay in identifying inhibitors of the biologically relevant DNA relaxation reaction. One of the most potent inhibitors of the vaccinia enzyme, 3-benzo[1,3]dioxol-5-yl-2-oxoproprionic acid, did not inhibit the closely related human enzyme. The inhibitory mechanism of this compound is unique and involves a step required for recycling the enzyme for steady-state turnover.

  11. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  12. HIV-1 vaccines based on replication-competent Tiantan vaccinia protected Chinese rhesus macaques from simian HIV infection.

    Science.gov (United States)

    Liu, Qiang; Li, Yue; Luo, Zhenwu; Yang, Guibo; Liu, Yong; Liu, Ying; Sun, Maosheng; Dai, Jiejie; Li, Qihan; Qin, Chuan; Shao, Yiming

    2015-03-27

    To assess the efficacy of HIV vaccines constructed from replication-competent Tiantan vaccinia virus (rTV) alone or combined with DNA in protecting Chinese rhesus macaques from homologous Simian/Human Immunodeficiency Virus (SHIV)-CN97001 challenge. The nef, gag, pol, and gp140 genes from strain CRF07_BC HIV-1 CN54 were selected to construct an HIV vaccine using the rTV or rTV/DNA vaccine. After vaccination, the vaccine and control groups were intravenously challenged with SHIV-CN97001 (32 MID50). HIV-specific antibodies and neutralizing antibodies, gp70 V1V2 binding antibodies, and cytotoxic T-lymphocyte responses were measured prospectively after vaccination with an ELISA, a virus infectivity assay in TZM-bl cells, and ELISPOT assays, respectively. Viral RNA was quantified after challenge with real-time reverse transcriptase-PCR (RT-PCR), and protection efficacy was determined with an analysis of CD8 lymphocyte depletion in vivo. Both rTV and DNA/rTV vaccine groups developed strong cellular and humoral responses against HIV-1 CN54 antigens, including Gag and Env, and also developed significant and persistent anti-Env antibodies and neutralizing antibodies after immunization. Both the rTV and DNA/rTV groups were significantly protected against SHIV-CN97001 or displayed lower viremia than the controls. After CD8 lymphocyte depletion, no viremia was detectable in the vaccinated monkeys, but rebounded rapidly in the control animals. Protection against infection correlated with vaccine-elicited neutralizing antibodies specific for homologous HIV-1 viruses. An rTV-based HIV-1 vaccine, with or without a DNA primer, provided protection from SHIV challenge in a macaque model. Replication-competent Tiantan vaccinia is a promising vector and should enable advances in HIV-1 vaccine development.

  13. Expanding the repertoire of Modified Vaccinia Ankara-based vaccine vectors via genetic complementation strategies.

    Directory of Open Access Journals (Sweden)

    David A Garber

    Full Text Available Modified Vaccinia virus Ankara (MVA is a safe, highly attenuated orthopoxvirus that is being developed as a recombinant vaccine vector for immunization against a number of infectious diseases and cancers. However, the expression by MVA vectors of large numbers of poxvirus antigens, which display immunodominance over vectored antigens-of-interest for the priming of T cell responses, and the induction of vector-neutralizing antibodies, which curtail the efficacy of subsequent booster immunizations, remain as significant impediments to the overall utility of such vaccines. Thus, genetic approaches that enable the derivation of MVA vectors that are antigenically less complex may allow for rational improvement of MVA-based vaccines.We have developed a genetic complementation system that enables the deletion of essential viral genes from the MVA genome, thereby allowing us to generate MVA vaccine vectors that are antigenically less complex. Using this system, we deleted the essential uracil-DNA-glycosylase (udg gene from MVA and propagated this otherwise replication-defective variant on a complementing cell line that constitutively expresses the poxvirus udg gene and that was derived from a newly identified continuous cell line that is permissive for growth of wild type MVA. The resulting virus, MVADeltaudg, does not replicate its DNA genome or express late viral gene products during infection of non-complementing cells in culture. As proof-of-concept for immunological 'focusing', we demonstrate that immunization of mice with MVADeltaudg elicits CD8+ T cell responses that are directed against a restricted repertoire of vector antigens, as compared to immunization with parental MVA. Immunization of rhesus macaques with MVADeltaudg-gag, a udg(- recombinant virus that expresses an HIV subtype-B consensus gag transgene, elicited significantly higher frequencies of Gag-specific CD8 and CD4 T cells following both primary (2-4-fold and booster (2-fold

  14. Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes.

    Science.gov (United States)

    Marras, Salvatore A E; Tyagi, Sanjay; Kramer, Fred Russell

    2006-01-01

    A number of formats for nucleic acid hybridization have been developed to identify DNA and RNA sequences that are involved in cellular processes and that aid in the diagnosis of genetic and infectious diseases. The introduction of hybridization probes with interactive fluorophore pairs has enabled the development of homogeneous hybridization assays for the direct identification of nucleic acids. A change in the fluorescence of these probes indicates the presence of a target nucleic acid, and there is no need to separate unbound probes from hybridized probes. The advantages of homogeneous hybridization assays are their speed and simplicity. In addition, homogeneous assays can be combined with nucleic acid amplification, enabling the detection of rare target nucleic acids. These assays can be followed in real time, providing quantitative determination of target nucleic acids over a broad range of concentrations.

  15. Introduction of structural affinity handles as a tool in selective nucleic acid separations

    Science.gov (United States)

    Willson, III, Richard Coale (Inventor); Cano, Luis Antonio (Inventor)

    2011-01-01

    The method is used for separating nucleic acids and other similar constructs. It involves selective introduction, enhancement, or stabilization of affinity handles such as single-strandedness in the undesired (or desired) nucleic acids as compared to the usual structure (e.g., double-strandedness) of the desired (or undesired) nucleic acids. The undesired (or desired) nucleic acids are separated from the desired (or undesired) nucleic acids due to capture by methods including but not limited to immobilized metal affinity chromatography, immobilized single-stranded DNA binding (SSB) protein, and immobilized oligonucleotides. The invention is useful to: remove contaminating genomic DNA from plasmid DNA; remove genomic DNA from plasmids, BACs, and similar constructs; selectively separate oligonucleotides and similar DNA fragments from their partner strands; purification of aptamers, (deoxy)-ribozymes and other highly structured nucleic acids; Separation of restriction fragments without using agarose gels; manufacture recombinant Taq polymerase or similar products that are sensitive to host genomic DNA contamination; and other applications.

  16. Assays for urinary biomarkers of oxidatively damaged nucleic acids

    DEFF Research Database (Denmark)

    Weimann, Allan; Broedbaek, Kasper; Henriksen, Trine

    2012-01-01

    -linked immunosorbent assay). The major analytical challenge is specificity. The best combination of selectivity and speed of analysis can be obtained by liquid chromatography coupled with tandem mass spectrometric detection. This, however, is also the most demanding technique with regard to price, complexity...... and skills requirement. The available ELISA methods present considerable specificity problems and cannot be recommended at present. The oxidized nucleic acid metabolites in urine are assumed to originate from the DNA and RNA. However, direct evidence is not available. A possible contribution from...

  17. Boronic acid-based autoligation of nucleic acids

    DEFF Research Database (Denmark)

    Barbeyron, R.; Vasseur, J.-J.; Smietana, M.

    2013-01-01

    Abstract: The development of synthetic systems displaying dynamic and adaptive characteristics is a formidable challenge with wide applications from biotechnology to therapeutics. Recently, we described a dynamic and programmable nucleic acid-based system relying on the formation of reversible...... boronate internucleosidic linkages. The DNA- or RNA-templated system comprises a 5′-ended boronic acid probe connecting a 3′-ended ribonucleosidic oligonucleotide partner. To explore the dominant factors that control the reversible linkage, we synthesized a series of 3′-end modified ribonucleotidic strands...

  18. Advances in nucleic acid-based diagnostics of bacterial infections

    DEFF Research Database (Denmark)

    Barken, Kim Bundvig; Haagensen, Janus Anders Juul; Tolker-Nielsen, Tim

    2007-01-01

    Methods for rapid detection of infectious bacteria and antimicrobial-resistant pathogens have evolved significantly over the last decade. Many of the new procedures are nucleic acid-based and replace conventional diagnostic methods like culturing which is time consuming especially with fastidious...... of these pathogens is important to isolate patients and prevent further spreading of the diseases. Newly developed diagnostic procedures are superior with respect to turnaround time, sensitivity and specificity. Methods like multiplex real time PCR and different array-based technologies offer the possibility...

  19. Efficient liposome fusion mediated by lipid-nucleic acid conjugates

    DEFF Research Database (Denmark)

    Ries, O; Löffler, P M G; Rabe, A

    2017-01-01

    The fusion of biomembranes with release of encapsulated content in a controlled way is crucial for cell signaling, endo- and exocytosis and intracellular trafficking. Programmable fusion of liposomes and an efficient mixing of their contents have the potential to enable the study of chemical...... and enzymatic processes in a confined environment and under crowded conditions outside biological systems. We report on DNA-controlled fusion of lipid bilayer membranes using lipid-nucleic acid conjugates (LiNAs) to mediate lipid and content mixing of liposomes. Screening of different membrane anchor and linker...

  20. Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

    Energy Technology Data Exchange (ETDEWEB)

    Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

    2017-08-29

    The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

  1. Studies on Nucleic Acids – Structure and Dynamics

    OpenAIRE

    Isaksson, Johan

    2005-01-01

    This thesis is based on six papers, Papers I-VI, focusing on the interplay between the stabilizing elements of nucleic acids self-assembly; hydrogen bonding, stacking and solvent effects. In Paper I we investigate how the substitution of the O4' for CH2 in the sugar moiety of adenosine (2'-deoxyaristeromycin) at the A6 position of the Dickerson-Drew dodecamer makes the two modified bases exist in a dynamic equilibrium between Hoogsteen and Watson-Crick base pairing in the NMR time scale. Pape...

  2. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    OpenAIRE

    Heemstra, Jennifer M.; Liu, David R.

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  3. Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control

    Science.gov (United States)

    Cary, Robert E.

    2015-12-08

    Highly simplified lateral flow chromatographic nucleic acid sample preparation methods, devices, and integrated systems are provided for the efficient concentration of trace samples and the removal of nucleic acid amplification inhibitors. Methods for capturing and reducing inhibitors of nucleic acid amplification reactions, such as humic acid, using polyvinylpyrrolidone treated elements of the lateral flow device are also provided. Further provided are passive fluid control methods and systems for use in lateral flow assays.

  4. Versatile phosphoramidation reactions for nucleic acid conjugations with peptides, proteins, chromophores, and biotin derivatives.

    Science.gov (United States)

    Wang, Tzu-Pin; Chiou, Yi-Jang; Chen, Yi; Wang, Eng-Chi; Hwang, Long-Chih; Chen, Bing-Hung; Chen, Yen-Hsu; Ko, Chun-Han

    2010-09-15

    Chemical conjugations of nucleic acids with macromolecules or small molecules are common approaches to study nucleic acids in chemistry and biology and to exploit nucleic acids for medical applications. The conjugation of nucleic acids such as oligonucleotides with peptides is especially useful to circumvent cell delivery and specificity problems of oligonucleotides as therapeutic agents. However, current approaches are limited and inefficient in their ability to afford peptide-oligonucleotide conjugates (POCs). Here, we report an effective and reproducible approach to prepare POCs and other nucleic acid conjugates based on a newly developed nucleic acid phosphoramidation method. The development of a new nucleic acid phosphoramidation reaction was achieved by our successful synthesis of a novel amine-containing biotin derivative used to systematically optimize the reactions. The improved phosphoramidation reactions dramatically increased yields of nucleic acid-biotin conjugates up to 80% after 3 h reaction. Any nucleic acids with a terminal phosphate group are suitable reactants in phosphoramidation reactions to conjugate with amine-containing molecules such as biotin and fluorescein derivatives, proteins, and, most importantly, peptides to enable the synthesis of POCs for therapeutic applications. Polymerase chain reactions (PCRs) to study incorporation of biotin or fluorescein-tagged DNA primers into the reaction products demonstrated that appropriate controls of nucleic acid phosphoramidation reactions incur minimum adverse effects on inherited base-pairing characteristics of nucleotides in nucleic acids. The phosphoramidation approach preserves the integrity of hybridization specificity in nucleic acids when preparing POCs. By retaining integrity of the nucleic acids, their effectiveness as therapeutic reagents for gene silencing, gene therapy, and RNA interference is ensured. The potential for POC use was demonstrated by two-step phosphoramidation reactions to

  5. Nucleic acid sample preparation for in vitro molecular diagnosis: from conventional techniques to biotechnology.

    Science.gov (United States)

    Rahman, Md Mahbubor; Elaissari, Abdelhamid

    2012-11-01

    Nucleic acid (DNA and RNA)-based molecular diagnosis is a promising laboratory technique because of its ability to identify disease accurately. However, one of its disadvantages is the inevitable purification and detection of nucleic acids from other contaminated entities. Different nano- and microparticles have been developed for use in an advanced, efficient high-throughput autosystem for the purification and detection of nucleic acid samples for use in molecular diagnoses. In this review, we discuss recent advances in the development of particle-based nucleic acid purification and detection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Modeling the interplay of single-stranded binding proteins and nucleic acid secondary structure.

    Science.gov (United States)

    Forties, Robert A; Bundschuh, Ralf

    2010-01-01

    There are many important proteins which bind single-stranded nucleic acids, such as the nucleocapsid protein in HIV and the RecA DNA repair protein in bacteria. The presence of such proteins can strongly alter the secondary structure of the nucleic acid molecules. Therefore, accurate modeling of the interaction between single-stranded nucleic acids and such proteins is essential to fully understand many biological processes. We develop a model for predicting nucleic acid secondary structure in the presence of single-stranded binding proteins, and implement it as an extension of the Vienna RNA Package. All parameters needed to model nucleic acid secondary structures in the absence of proteins have been previously determined. This leaves the footprint and sequence-dependent binding affinity of the protein as adjustable parameters of our model. Using this model we are able to predict the probability of the protein binding at any position in the nucleic acid sequence, the impact of the protein on nucleic acid base pairing, the end-to-end distance distribution for the nucleic acid and FRET distributions for fluorophores attached to the nucleic acid. Source code for our modified version of the Vienna RNA package is freely available at http://bioserv.mps.ohio-state.edu/Vienna+P, implemented in C and running on Linux.

  7. Regression of Human Prostate Tumors and Metastases in Nude Mice following Treatment with the Recombinant Oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2010-01-01

    Full Text Available Virotherapy using oncolytic vaccinia virus strains is one of the most promising new strategies for cancer therapy. In the current study, we analyzed the therapeutic efficacy of the oncolytic vaccinia virus GLV-1h68 against two human prostate cancer cell lines DU-145 and PC-3 in cell culture and in tumor xenograft models. By viral proliferation assays and cell survival tests, we demonstrated that GLV-1h68 was able to infect, replicate in, and lyse these prostate cancer cells in culture. In DU-145 and PC-3 tumor xenograft models, a single intravenous injection with GLV-1h68 resulted in a significant reduction of primary tumor size. In addition, the GLV-1h68-infection led to strong inflammatory and oncolytic effects resulting in drastic reduction of regional lymph nodes with PC-3 metastases. Our data documented that the GLV-1h68 virus has a great potential for treatment of human prostate carcinoma.

  8. Easily denaturing nucleic acids derived from intercalating nucleic acids: thermal stability studies, dual duplex invasion and inhibition of transcription start

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Vester, Birte; Hansen, Lykke Haastrup

    2005-01-01

    The bulged insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (monomer P) in two complementary 8mer DNA strands (intercalating nucleic acids) opposite to each other resulted in the formation of an easily denaturing duplex, which had lower thermal stability (21.0 degrees C) than the wild-type double......-stranded DNA (dsDNA, 26.0 degrees C), but both modified oligodeoxynucleotides had increased binding affinity toward complementary single-stranded DNA (ssDNA) (41.5 and 39.0 degrees C). Zipping of pyrene moieties in an easily denaturing duplex gave formation of a strong excimer band at 480 nm upon excitation...

  9. Constrained Multistate Sequence Design for Nucleic Acid Reaction Pathway Engineering.

    Science.gov (United States)

    Wolfe, Brian R; Porubsky, Nicholas J; Zadeh, Joseph N; Dirks, Robert M; Pierce, Niles A

    2017-03-01

    We describe a framework for designing the sequences of multiple nucleic acid strands intended to hybridize in solution via a prescribed reaction pathway. Sequence design is formulated as a multistate optimization problem using a set of target test tubes to represent reactant, intermediate, and product states of the system, as well as to model crosstalk between components. Each target test tube contains a set of desired "on-target" complexes, each with a target secondary structure and target concentration, and a set of undesired "off-target" complexes, each with vanishing target concentration. Optimization of the equilibrium ensemble properties of the target test tubes implements both a positive design paradigm, explicitly designing for on-pathway elementary steps, and a negative design paradigm, explicitly designing against off-pathway crosstalk. Sequence design is performed subject to diverse user-specified sequence constraints including composition constraints, complementarity constraints, pattern prevention constraints, and biological constraints. Constrained multistate sequence design facilitates nucleic acid reaction pathway engineering for diverse applications in molecular programming and synthetic biology. Design jobs can be run online via the NUPACK web application.

  10. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    Science.gov (United States)

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability.

  11. Nucleic Acid Drugs for Prevention of Cardiac Rejection

    Directory of Open Access Journals (Sweden)

    Jun-ichi Suzuki

    2009-01-01

    Full Text Available Heart transplantation has been broadly performed in humans. However, occurrence of acute and chronic rejection has not yet been resolved. Several inflammatory factors, such as cytokines and adhesion molecules, enhance the rejection. The graft arterial disease (GAD, which is a type of chronic rejection, is characterized by intimal thickening comprised of proliferative smooth muscle cells. Specific treatments that target the attenuation of acute rejection and GAD formation have not been well studied in cardiac transplantation. Recent progress in the nucleic acid drugs, such as antisense oligodeoxynucleotides (ODNs to regulate the transcription of disease-related genes, has important roles in therapeutic applications. Transfection of cis-element double-stranded DNA, named as “decoy,” has been also reported to be a useful nucleic acid drug. This decoy strategy has been not only a useful method for the experimental studies of gene regulation but also a novel clinical strategy. In this paper, we reviewed the experimental results of NF-κB, E2F, AP-1, and STAT-1 decoy and other ODNs using the experimental heart transplant models.

  12. Functional nucleic acids as in vivo metabolite and ion biosensors.

    Science.gov (United States)

    Alsaafin, Alaa; McKeague, Maureen

    2017-08-15

    Characterizing the role of metabolites, metals, and proteins is required to understand normal cell function, and ultimately, elucidate the mechanism of disease. Metabolite concentration and transformation results collected from cell lysates or fixed-cells conceal important dynamic information and differences between individual cells that often have profound functional consequences. Functional nucleic acid-based biosensors are emerging tools that are capable of monitoring ions and metabolites in cell populations or whole animals. Functional nucleic acids (FNAs) are a class of biomolecules that can exhibit either ligand binding or enzymatic activity. Unlike their protein analogues or the use of instrument-based analysis, FNA-based biosensors are capable of entering cells without disruption to the cellular environment and can report on the concentration, dynamics, and spatial localization of molecules in cells. Here, we review the types of FNAs that have been used as in vivo biosensors, and how FNAs can be coupled to transduction systems and delivered inside cells. We also provide examples from the literature that demonstrate their impact in practical applications. Finally, we comment on the critical limitations that need to be addressed to enable their use for single-cell dynamic tracking of metabolites and ions in vivo. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  13. Archaeal Nucleic Acid Ligases and Their Potential in Biotechnology.

    Science.gov (United States)

    Chambers, Cecilia R; Patrick, Wayne M

    2015-01-01

    With their ability to catalyse the formation of phosphodiester linkages, DNA ligases and RNA ligases are essential tools for many protocols in molecular biology and biotechnology. Currently, the nucleic acid ligases from bacteriophage T4 are used extensively in these protocols. In this review, we argue that the nucleic acid ligases from Archaea represent a largely untapped pool of enzymes with diverse and potentially favourable properties for new and emerging biotechnological applications. We summarise the current state of knowledge on archaeal DNA and RNA ligases, which makes apparent the relative scarcity of information on in vitro activities that are of most relevance to biotechnologists (such as the ability to join blunt- or cohesive-ended, double-stranded DNA fragments). We highlight the existing biotechnological applications of archaeal DNA ligases and RNA ligases. Finally, we draw attention to recent experiments in which protein engineering was used to modify the activities of the DNA ligase from Pyrococcus furiosus and the RNA ligase from Methanothermobacter thermautotrophicus, thus demonstrating the potential for further work in this area.

  14. Characterization of a crosslinked nucleic acid - helix destabilizing protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Karpel, R.L.; Levin, V.Y.; Haley, B.E.

    1986-05-01

    They have enzymatically synthesized /sup 3/H- and /sup 32/P-poly(A,8N/sub 3/A) from 8-N/sub 3/ADP and radiolabeled ADP, and have used this polynucleotide to photoaffinity label T4 gene 32 protein, as well as several other helix-destabilizing proteins (HDPs). Irradiation of /sup 32/P-/sup 3/H-poly(A,N/sub 3/A) mixtures for short durations produces a covalent complex, seen as a high molecular weight, radioactive band on SDS-polyacrylamide gels. Preliminary experiments on other HDPs, from prokaryotic, eukaryotic and animal viral sources, show analogous results. Several successful control experiments indicate that this system is suitable for binding site localization on /sup 32/P. Single-stranded nucleic acids competitively inhibit photolabeling. The effect of NaCl on photolabeling parallels the salt-dependence of /sup 32/P-poly(A,N/sub 3/A) binding. Photolabeling reaches a plateau after approx.1 min, and the formation of the high molecular weight complex parallels the reduction of free /sup 32/P on SDS gels. Staph. nuclease digestion of crosslinked complexes produces a diffuse, radioactive band on SDS gels, migrating just behind free /sup 32/P. When these digested complexes are subjected to reverse-phase HPLC on a C3 Ultrapore column, the nucleic acid /sup 32/P-label is seen to coelute with protein. They are currently employing RP-HPLC methods to locate the label on tryptic peptides of nuclease-digested complexes.

  15. Origin of Overstretching Transitions in Single-Stranded Nucleic Acids

    Science.gov (United States)

    Scholl, Zackary N.; Rabbi, Mahir; Lee, David; Manson, Laura; S-Gracz, Hanna; Marszalek, Piotr E.

    2013-11-01

    We combined single-molecule force spectroscopy with nuclear magnetic resonance measurements and molecular mechanics simulations to examine overstretching transitions in single-stranded nucleic acids. In single-stranded DNA and single-stranded RNA there is a low-force transition that involves unwinding of the helical structure, along with base unstacking. We determined that the high-force transition that occurs in polydeoxyadenylic acid single-stranded DNA is caused by the cooperative forced flipping of the dihedral angle formed between four atoms, O5’-C5’-C4’-C3’ (γ torsion), in the nucleic acid backbone within the canonical B-type helix. The γ torsion also flips under force in A-type helices, where the helix is shorter and wider as compared to the B-type helix, but this transition is less cooperative than in the B type and does not generate a high-force plateau in the force spectrums of A-type helices. We find that a similar high-force transition can be induced in polyadenylic acid single-stranded RNA by urea, presumably due to disrupting the intramolecular hydrogen bonding in the backbone. We hypothesize that a pronounced high-force transition observed for B-type helices of double stranded DNA also involves a cooperative flip of the γ torsion. These observations suggest new fundamental relationships between the canonical structures of single-and double-stranded DNA and the mechanism of their molecular elasticity.

  16. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses

    OpenAIRE

    Dowall, Stuart D.; Graham, Victoria A.; Emma Rayner; Laura Hunter; Robert Watson; Irene Taylor; Antony Rule; Carroll, Miles W.; Roger Hewson

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. I...

  17. Nucleic acid delivery: the missing pieces of the puzzle?

    Science.gov (United States)

    Nguyen, Juliane; Szoka, Francis C

    2012-07-17

    The delivery of genes or RNA interference (RNAi) agents can increase or decrease the expression of virtually any protein in a cell, and this process opens the path for cures to most diseases that afflict humans. However, the high molecular weight, anionic nature, and instability of nucleic acids in the presence of enzymes pose major obstacles to their delivery and frustrates their use as human therapies. This Account describes current ideas about the mechanisms in nonviral nucleic acid delivery and how lipidic and polymeric carriers can overcome some of the critical barriers to delivery. Over the last 20 years, researchers have developed a multitude of polymeric and lipidic vectors, but only a small fraction of these have progressed into clinical trials. None of these vectors has received FDA approval, which indicates that the current vectors do not yet have suitable properties for effective in vivo nucleic acid delivery. Nucleic acid delivery is a multistep process and inefficiencies at any stage result in a dramatic decrease in gene delivery or gene silencing. However, the majority of studies investigating synthetic vectors focus solely on optimization of endosomal escape. A small number of studies address how to improve uptake via targeted delivery, and an even smaller fraction examine the intracellular fate of the delivery systems and nucleic acid cargo. The internalization of genes into the cell nucleus remains an inefficient and mysterious process. In the case of DNA delivery, strategies are needed to increase and accelerate the migration of DNA through the cytoplasm and transport it through the nuclear membrane. siRNA delivery involves fewer barriers. siRNA is more readily released from the carrier and more resistant to enzymatic degradation, and its target is in the cytoplasm; hence, siRNA delivery systems are becoming a clinical reality. With regard to siRNA therapy, the exact cytoplasmic location of RNA-induced silencing complex (RISC) formation and

  18. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene.

    Science.gov (United States)

    Heine, H G; Stevens, M P; Foord, A J; Boyle, D B

    1999-07-30

    Sheeppoxvirus (SPV), goatpoxvirus (GPV) and lumpy skin disease virus (LSDV) of cattle belong to the Capripoxvirus genus of the Poxviridae family and can cause significant economic losses in countries where they are endemic. Capripox diagnosis by classical virological methods dependent on live capripox virus is not suitable in countries such as Australia where the virus is exotic and live virus is not available. To develop diagnostic tests based on recombinant material, we cloned and sequenced a 3.7 kb viral DNA fragment of SPV that contained open reading frames homologous to the vaccinia virus J6R, H1L, H2R, H3L and H4L genes. A capripoxvirus specific PCR assay was developed that differentiated between SPV and LSDV on the basis of unique restriction sites in the corresponding PCR fragments. The vaccinia virus H3L homolog was identified as the capripoxvirus P32 antigen. The P32 proteins of SPV and LSDV were expressed in Escherichia coli as a fusion protein with a poly-histidine tag and affinity purified on metal binding resin. The full-length P32 protein contained a transmembrane region close to the carboxy terminus and was membrane associated but could be solubilised in detergent and used as trapping antigen in an antibody detection ELISA. The ELISA was specific for capripoxvirus as only sera from sheep infected with capripoxvirus but not orf or vaccinia virus reacted with the capripoxvirus P32 antigen.

  19. Vaccinia virus outperforms a panel of other poxviruses as a potent oncolytic agent for the control of head and neck squamous cell carcinoma cell lines.

    Science.gov (United States)

    Nichols, Anthony C; Yoo, John; Um, Sung; Mundi, Neil; Palma, David A; Fung, Kevin; Macneil, S Danielle; Koropatnick, James; Mymryk, Joe S; Barrett, John W

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) is the fifth most common cancer worldwide. Existing therapies for advanced tumors have high failure rates and can have severe consequences in terms of pain, disfigurement, and poor speech and swallowing function. New treatment strategies are needed to improve outcomes for patients suffering with this disease and oncolytic viruses represent a promising approach. We infected six well-characterized HNSCC cell lines (Cal27, Detroit562, FaDu, SCC4, SCC15, SCC25), with increasing doses of a panel of poxviruses (including myxoma, vaccinia, raccoonpox and tanapox viruses) modified to express green fluorescence protein to determine which virus was the most effective oncolytic agent in cell-based assays. While myxoma, raccoonpox and tanapox displayed differing efficacy in the panel of cell lines, vaccinia virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all cell lines. Oncolytic poxviruses, particularly vaccinia virus, were effective in killing HNSCC in vitro and hold promise as potential treatments for patients with HNSCC. Copyright © 2013 S. Karger AG, Basel.

  20. Immunogenicity and virulence of attenuated vaccinia virus Tian Tan encoding HIV-1 muti-epitope genes, p24 and cholera toxin B subunit in mice.

    Science.gov (United States)

    Du, Shouwen; Wang, Yuhang; Liu, Cunxia; Wang, Maopeng; Zhu, Yilong; Tan, Peng; Ren, Dayong; Li, Xiao; Tian, Mingyao; Yin, Ronglan; Li, Chang; Jin, Ningyi

    2015-07-01

    No effective prophylactic or therapeutic vaccine against HIV-1 in humans is currently available. This study analyzes the immunogenicity and safety of a recombinant attenuated vaccinia virus. A chimeric gene of HIV-1 multi-epitope genes containing CpG ODN and cholera toxin B subunit (CTB) was inserted into Chinese vaccinia virus Tian Tan strain (VTT) mutant strain. The recombinant virus rddVTT(-CCMp24) was assessed for immunogenicity and safety in mice. Results showed that the protein CCMp24 was expressed stably in BHK-21 infected with rddVTT(-CCMp24). And the recombinant virus induced the production of HIV-1 p24 specific immunoglobulin G (IgG), IL-2 and IL-4. The recombinant vaccine induced γ-interferon secretion against HIV peptides, and elicited a certain levels of immunological memory. Results indicated that the recombinant virus had certain immunogenicity to HIV-1. Additionally, the virulence of the recombinant virus was been attenuated in vivo of mice compared with wild type VTT (wtVTT), and the introduction of CTB and HIV Mp24 did not alter the infectivity and virulence of defective vaccinia virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. BGL4 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-01-22

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  2. 21 CFR 866.5910 - Quality control material for cystic fibrosis nucleic acid assays.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Quality control material for cystic fibrosis... Test Systems § 866.5910 Quality control material for cystic fibrosis nucleic acid assays. (a) Identification. Quality control material for cystic fibrosis nucleic acid assays. A quality control material for...

  3. Covering all the bases : Coarse-grained model design and application for nucleic acids

    NARCIS (Netherlands)

    Uusitalo, Jaakko Juhani

    2016-01-01

    Nucleic acids play a crucial role in the storage, transportation and expression of our genetic information. They have also become an interesting tool for many applications in nanotechnology. Studying biomolecular systems containing nucleic acids using experimental and imaging techniques has its

  4. Novel fluorescent nanoparticles for ultrasensitive identification of nucleic acids by optical methods

    DEFF Research Database (Denmark)

    Mulberg, Mads Westergaard; Taskova, Maria; Thomsen, Rasmus P.

    2017-01-01

    For decades, the detection of nucleic acids and their interactions at low abundances has been a challenging task. Present nucleic acid diagnostics are primarily based on enzymatic reactions including sequencing, polymerase-chain reaction and microarrays. However, the use of enzymatic amplificatio...

  5. 21 CFR 866.3980 - Respiratory viral panel multiplex nucleic acid assay.

    Science.gov (United States)

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents... panel multiplex nucleic acid assay is a qualitative in vitro diagnostic device intended to...: Respiratory Viral Panel Multiplex Nucleic Acid Assay;” (2) For a device that detects and identifies Human...

  6. Mesoporous Silica Nanoparticles as Carriers for Intracellular Delivery of Nucleic Acids and Subsequent Therapeutic Applications

    Directory of Open Access Journals (Sweden)

    Wenzhang Cha

    2017-05-01

    Full Text Available Nucleic acids, including DNA, microRNA (miRNA, small interfering RNA (siRNA, and antisense oligonucleotide (ASO, are powerful gene regulators, which have been demonstrated as promising drug candidates for therapeutic treatments. Nevertheless, poor cellular membrane permeability and serum stability have greatly hindered the applications of nucleic acids in biomedicine. To address these issues, associate carriers that can encapsulate and protect nucleic acids are urgently required. Mesoporous silica nanoparticles (MSNs or MSNPs, which are nanomaterials with excellent biocompatibility, large surface area for functionalization, and tunable pore size for encapsulating different cargos, are emerging as novel and ideal biomaterials for different biomedical applications. In this review paper, we focus on the applications of MSNs in nucleic acid delivery and nucleic acid-guided therapeutic treatments. General strategies for the preparation of nucleic acid-MSN complexes will be firstly introduced, followed by a summary of recent applications of MSNs in nucleic acid delivery and nucleic acid-guided therapeutics.

  7. BGL7 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Ward, Michael

    2013-01-29

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  8. BGL6 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel; Ward, Michael

    2015-08-11

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  9. BGL6 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-04

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  10. BGL3 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-10-30

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  11. BGL7 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel; Ward, Michael

    2015-04-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  12. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel; Ward, Michael

    2012-10-02

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  13. BGL7 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-25

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  14. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-03-18

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  15. BGL6 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

    2009-09-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  16. BGL3 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  17. BGL3 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-06-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  18. BGL4 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-12-06

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  19. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens

    Science.gov (United States)

    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H

    2015-04-21

    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  20. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    Science.gov (United States)

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  1. Nucleic Acids Research annual Database Issue and the NAR online Molecular Biology Database Collection in 2009.

    Science.gov (United States)

    Galperin, Michael Y; Cochrane, Guy R

    2009-01-01

    The current issue of Nucleic Acids Research includes descriptions of 179 databases, of which 95 are new. These databases (along with several molecular biology databases described in other journals) have been included in the Nucleic Acids Research online Molecular Biology Database Collection, bringing the total number of databases in the collection to 1170. In this introductory comment, we briefly describe some of these new databases and review the principles guiding the selection of databases for inclusion in the Nucleic Acids Research annual Database Issue and the Nucleic Acids Research online Molecular Biology Database Collection. The complete database list and summaries are available online at the Nucleic Acids Research web site (http://nar.oxfordjournals.org/).

  2. [Application status of circulating nucleic acids as biomarkers in gastric cancer].

    Science.gov (United States)

    Li, Lin; Zhang, Lianhai; Ji, Jiafu

    2014-01-01

    Considerable concentrations of circulating nucleic acids have been reported in peripheral blood from cancer patients. These circulating nucleic acids bear a variety of tumor-specific information and potentially represent a stable source of non-invasive tumor biomarkers. The assessable genetic and epigenetic changes of circulating nucleic acids include DNA mutations, copy number alterations, abnormal methylation and disruption of microRNA. Such alterations reflecting molecular characteristics of tumor tissues, provide a new clue for noninvasive, real-time and monitoring test. In the present article, the main findings of research status related to the utility of circulating nucleic acids for early diagnosis, prognosis and monitoring of gastric cancer are reviewed. In addition, the advantage, the examination technique and the application prospection of circulating nucleic acids as tumor markers are also reviewed.

  3. Locked nucleic acid: modality, diversity, and drug discovery

    DEFF Research Database (Denmark)

    Hagedorn, Peter H.; Persson, Robert; Funder, Erik D.

    2017-01-01

    (LNA), which exhibits high binding affinity and potency, is widely used. Our understanding of RNA biology has also expanded tremendously, resulting in new approaches to engage RNA as a therapeutic target. Recent observations indicate that each oligonucleotide compound is a unique entity, and small...... structural differences between oligonucleotides can often lead to substantial differences in their pharmacological properties. Here, we outline new principles for drug discovery exploiting oligonucleotide diversity to identify rare molecules with unique pharmacological properties.......Over the past 20 years, the field of RNA-targeted therapeutics has advanced based on discoveries of modified oligonucleotide chemistries, and an ever-increasing understanding of how to apply cellular assays to identify oligonucleotides with pharmacological properties in vivo. Locked nucleic acid...

  4. Rapid genotyping using pyrene-perylene locked nucleic acid complexes

    DEFF Research Database (Denmark)

    Kumar, Santhosh T.; Myznikova, Anna; Samokhina, Evgeniya

    2013-01-01

    We have developed an assay for single strand DNA and RNA detection which is based on novel pyrene-perylene FRET pairs attached to short LNA/DNA probes. The assay is based on ratiometric emission upon binding of target DNA/RNA by three combinations of fluorescent LNA/DNA reporter strands. Specific...... is achieved with advantages of large Stokes shift (115 nm), high fluorescence quantum yields and low limit of target detection values (... geometry of the pyrene fluorophore attached to the 2'-amino group of 2'-amino-LNA in position 4 allows for the first time to efficiently utilize dipole-dipole orientation parameter for sensing of single-nucleotide polymorphisms (SNPs) in nucleic acid targets by FRET. Using novel probes, SNP detection...

  5. Multi-chamber nucleic acid amplification and detection device

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, Lawrence

    2017-10-25

    A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element which is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.

  6. Intriguing nucleic-acid-binding features of mammalian prion protein.

    Science.gov (United States)

    Silva, Jerson L; Lima, Luís Maurício T R; Foguel, Debora; Cordeiro, Yraima

    2008-03-01

    In transmissible spongiform encephalopathies, the infectious material consists chiefly of a protein, the scrapie prion protein PrP(Sc), that carries no genetic coding material; however, prions are likely to have accomplices that chaperone their activity and promote the conversion of the cellular prion protein PrP(C) into the disease-causing isoform (PrP(Sc)). Recent studies from several laboratories indicate that PrP(C) recognizes many nucleic acids (NAs) with high affinities, and we correlate these findings with a possible pathophysiological role for this interaction. Thus, of the chaperones, NA is the most likely candidate for prions. The participation of NAs in prion propagation opens new avenues for developing new diagnostic tools and therapeutics to target prion diseases, as well as for understanding the function of PrP(C), probably as a NA chaperone.

  7. NTDB: Thermodynamic Database for Nucleic Acids, Version 2.0.

    Science.gov (United States)

    Chiu, Wing Lok Abe Kurtz; Sze, Chun Ngai; Ma, Nap Tak; Chiu, Lai Fan; Leung, Chung Wai; Au-Yeung, Steve Chik Fun

    2003-01-01

    The second release of Thermodynamic Database for Nucleic Acids, NTDB 2.0, includes more than 4600 entries (250% increase over release 1.0). It contains sequence types and details of several thermodynamic parameters (enthalpy, DeltaH; entropy, DeltaS; Gibbs free energy, DeltaG; melting temperature, T(m)), experimental models and methods for extracting thermodynamic parameters, buffer conditions as well as all relevant literature information. In addition, the database statistics and references related to NTDB are included. Information on normal and modified nucleobases and nucleosides are collected in a new section 'Nucleoside' whereby data collected thus far will be release in NTDB 2.0. The NTDB is freely available at http://ntdb.chem.cuhk.edu.hk.

  8. Nucleic acid-metal organic framework (MOF) nanoparticle conjugates.

    Science.gov (United States)

    Morris, William; Briley, William E; Auyeung, Evelyn; Cabezas, Maria D; Mirkin, Chad A

    2014-05-21

    Nanoparticles of a metal-organic framework (MOF), UiO-66-N3 (Zr6O4OH4(C8H3O4-N3)6), were synthesized. The surface of the MOF was covalently functionalized with oligonucleotides, utilizing a strain promoted click reaction between DNA appended with dibenzylcyclooctyne and azide-functionalized UiO-66-N3 to create the first MOF nanoparticle-nucleic acid conjugates. The structure of the framework was preserved throughout the chemical transformation, and the surface coverage of DNA was quantified. Due to the small pore sizes, the particles are only modified on their surfaces. When dispersed in aqueous NaCl, they exhibit increased stability and enhanced cellular uptake when compared with unfunctionalized MOF particles of comparable size.

  9. Nucleic Acid-Based Approaches for Detection of Viral Hepatitis

    Science.gov (United States)

    Behzadi, Payam; Ranjbar, Reza; Alavian, Seyed Moayed

    2014-01-01

    Context: To determining suitable nucleic acid diagnostics for individual viral hepatitis agent, an extensive search using related keywords was done in major medical library and data were collected, categorized, and summarized in different sections. Results: Various types of molecular biology tools can be used to detect and quantify viral genomic elements and analyze the sequences. These molecular assays are proper technologies for rapidly detecting viral agents with high accuracy, high sensitivity, and high specificity. Nonetheless, the application of each diagnostic method is completely dependent on viral agent. Conclusions: Despite rapidity, automation, accuracy, cost-effectiveness, high sensitivity, and high specificity of molecular techniques, each type of molecular technology has its own advantages and disadvantages. PMID:25789132

  10. Peptide nucleic acid (PNA) antisense effects in Escherichia coli

    DEFF Research Database (Denmark)

    Good, L; Nielsen, P E

    1999-01-01

    Antisense peptide nucleic acid (PNA) can be used to control cell growth, gene expression and growth phenotypes in the bacteria Escherichia coli. PNAs targeted to the RNA components of the ribosome can inhibit translation and cell growth, and PNAs targeted to mRNA can limit gene expression with gene...... and sequence specificity. In an E. coli cell extract, efficient inhibition is observed when using PNA concentrations in the nanomolar range, whereas micromolar concentrations are required for inhibition in growing cells. A mutant strain of E. coli that is more permeable to antibiotics also is more susceptible...... to antisense PNAs than the wild type. This chapter details methods for testing the antisense activities of PNA in E. coli. As an example of the specific antisense inhibition possible, we show the effects of an anti-beta-galactosidase PNA in comparison to control PNAs. With improvements in cell uptake...

  11. Linear Epitopes in Vaccinia Virus A27 Are Targets of Protective Antibodies Induced by Vaccination against Smallpox.

    Science.gov (United States)

    Kaever, Thomas; Matho, Michael H; Meng, Xiangzhi; Crickard, Lindsay; Schlossman, Andrew; Xiang, Yan; Crotty, Shane; Peters, Bjoern; Zajonc, Dirk M

    2016-05-01

    Vaccinia virus (VACV) A27 is a target for viral neutralization and part of the Dryvax smallpox vaccine. A27 is one of the three glycosaminoglycan (GAG) adhesion molecules and binds to heparan sulfate. To understand the function of anti-A27 antibodies, especially their protective capacity and their interaction with A27, we generated and subsequently characterized 7 murine monoclonal antibodies (MAbs), which fell into 4 distinct epitope groups (groups I to IV). The MAbs in three groups (groups I, III, and IV) bound to linear peptides, while the MAbs in group II bound only to VACV lysate and recombinant A27, suggesting that they recognized a conformational and discontinuous epitope. Only group I antibodies neutralized the mature virion in a complement-dependent manner and protected against VACV challenge, while a group II MAb partially protected against VACV challenge but did not neutralize the mature virion. The epitope for group I MAbs was mapped to a region adjacent to the GAG binding site, a finding which suggests that group I MAbs could potentially interfere with the cellular adhesion of A27. We further determined the crystal structure of the neutralizing group I MAb 1G6, as well as the nonneutralizing group IV MAb 8E3, bound to the corresponding linear epitope-containing peptides. Both the light and the heavy chains of the antibodies are important in binding to their antigens. For both antibodies, the L1 loop seems to dominate the overall polar interactions with the antigen, while for MAb 8E3, the light chain generally appears to make more contacts with the antigen. Vaccinia virus is a powerful model to study antibody responses upon vaccination, since its use as the smallpox vaccine led to the eradication of one of the world's greatest killers. The immunodominant antigens that elicit the protective antibodies are known, yet for many of these antigens, little information about their precise interaction with antibodies is available. In an attempt to better

  12. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

    Directory of Open Access Journals (Sweden)

    Matthew G Cottingham

    2008-02-01

    Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

  13. A novel nucleic acid analogue shows strong angiogenic activity

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Ikuko, E-mail: tukamoto@med.kagawa-u.ac.jp [Department of Pharmaco-Bio-Informatics, Faculty of Medicine, Kagawa University, 1750-1 Ikenobe, Miki, Kita, Kagawa 761-0793 (Japan); Sakakibara, Norikazu; Maruyama, Tokumi [Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, 1314-1 Shido, Sanuki, Kagawa 769-2193 (Japan); Igarashi, Junsuke; Kosaka, Hiroaki [Department of Cardiovascular Physiology, Faculty of Medicine, Kagawa University, 1750-1 Ikenobe, Miki, Kita, Kagawa 761-0793 (Japan); Kubota, Yasuo [Department of Dermatology, Faculty of Medicine, Kagawa University, 1750-1 Ikenobe, Miki, Kita, Kagawa 761-0793 (Japan); Tokuda, Masaaki [Department of Cell Physiology, Faculty of Medicine, Kagawa University, 1750-1 Ikenobe, Miki, Kita, Kagawa 761-0793 (Japan); Ashino, Hiromi [The Tokyo Metropolitan Institute of Medical Science, 1-6 Kamikitazawa2-chome, Setagaya-ku, Tokyo 156-8506 (Japan); Hattori, Kenichi; Tanaka, Shinji; Kawata, Mitsuhiro [Teikoku Seiyaku Co., Ltd., Sanbonmatsu, Higashikagawa, Kagawa 769-2695 (Japan); Konishi, Ryoji [Department of Pharmaco-Bio-Informatics, Faculty of Medicine, Kagawa University, 1750-1 Ikenobe, Miki, Kita, Kagawa 761-0793 (Japan)

    2010-09-03

    Research highlights: {yields} A novel nucleic acid analogue (2Cl-C.OXT-A, m.w. 284) showed angiogenic potency. {yields} It stimulated the tube formation, proliferation and migration of HUVEC in vitro. {yields} 2Cl-C.OXT-A induced the activation of ERK1/2 and MEK in HUVEC. {yields} Angiogenic potency in vivo was confirmed in CAM assay and rabbit cornea assay. {yields} A synthesized small angiogenic agent would have great clinical therapeutic value. -- Abstract: A novel nucleic acid analogue (2Cl-C.OXT-A) significantly stimulated tube formation of human umbilical endothelial cells (HUVEC). Its maximum potency at 100 {mu}M was stronger than that of vascular endothelial growth factor (VEGF), a positive control. At this concentration, 2Cl-C.OXT-A moderately stimulated proliferation as well as migration of HUVEC. To gain mechanistic insights how 2Cl-C.OXT-A promotes angiogenic responses in HUVEC, we performed immunoblot analyses using phospho-specific antibodies as probes. 2Cl-C.OXT-A induced robust phosphorylation/activation of MAP kinase ERK1/2 and an upstream MAP kinase kinase MEK. Conversely, a MEK inhibitor PD98059 abolished ERK1/2 activation and tube formation both enhanced by 2Cl-C.OXT-A. In contrast, MAP kinase responses elicited by 2Cl-C.OXT-A were not inhibited by SU5416, a specific inhibitor of VEGF receptor tyrosine kinase. Collectively these results suggest that 2Cl-C.OXT-A-induces angiogenic responses in HUVEC mediated by a MAP kinase cascade comprising MEK and ERK1/2, but independently of VEGF receptor tyrosine kinase. In vivo assay using chicken chorioallantoic membrane (CAM) and rabbit cornea also suggested the angiogenic potency of 2Cl-C.OXT-A.

  14. Design of peptide-targeted liposomes containing nucleic acids.

    Science.gov (United States)

    Santos, Adriana O; da Silva, Lígia C Gomes; Bimbo, Luís M; de Lima, Maria C Pedroso; Simões, Sérgio; Moreira, João N

    2010-03-01

    Anticancer systemic gene silencing therapy has been so far limited by the inexistence of adequate carrier systems that ultimately provide an efficient intracellular delivery into target tumor cells. In this respect, one promising strategy involves the covalent attachment of internalizing-targeting ligands at the extremity of PEG chains grafted onto liposomes. Therefore, the present work aims at designing targeted liposomes containing nucleic acids, with small size, high encapsulation efficiency and able to be actively internalized by SCLC cells, using a hexapeptide (antagonist G) as a targeting ligand. For this purpose, the effect of the liposomal preparation method, loading material (ODN versus siRNA) and peptide-coupling procedure (direct coupling versus post-insertion) on each of the above-mentioned parameters was assessed. Post-insertion of DSPE-PEG-antagonist G conjugates into preformed liposomes herein named as stabilized lipid particles, resulted in targeted vesicles with a mean size of about 130 nm, encapsulation efficiency close to 100%, and a loading capacity of approximately 5 nmol siRNA/mumol of total lipid. In addition, the developed targeted vesicles showed increased internalization in SCLC cells, as well as in other tumor cells and HMEC-1 microvascular endothelial cells. The improved cellular association, however, did not correlate with enhanced downregulation of the target protein (Bcl-2) in SCLC cells. These results indicate that additional improvements need to be performed in the future, namely by ameliorating the access of the nucleic acids to the cytoplasm of the tumor cells following receptor-mediated endocytosis. Copyright 2009 Elsevier B.V. All rights reserved.

  15. Integrated Microfluidic Nucleic Acid Isolation, Isothermal Amplification, and Amplicon Quantification

    Directory of Open Access Journals (Sweden)

    Michael G. Mauk

    2015-10-01

    Full Text Available Microfluidic components and systems for rapid (<60 min, low-cost, convenient, field-deployable sequence-specific nucleic acid-based amplification tests (NAATs are described. A microfluidic point-of-care (POC diagnostics test to quantify HIV viral load from blood samples serves as a representative and instructive example to discuss the technical issues and capabilities of “lab on a chip” NAAT devices. A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1 nucleic acids (NAs are extracted from relatively large (~mL volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase (“membrane” to capture sample NAs in a flow-through, filtration mode; (2 NAs captured on the membrane are isothermally (~65 °C amplified; (3 amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4 paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD better than 103 virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed.

  16. DMPD: Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune diseases. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18641647 Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune... (.csml) Show Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimmune diseases.... PubmedID 18641647 Title Plasmacytoid dendritic cells: sensing nucleic acids in viral infection andautoimm...une diseases. Authors Gilliet M, Cao W, Liu YJ. Publication Nat Rev Immunol. 2008 A

  17. Human and animal infections by vaccinia-like viruses in the state of Rio de Janeiro: a novel expanding zoonosis.

    Science.gov (United States)

    Schatzmayr, H G; Costa, R V C; Gonçalves, M C R; D'Andréa, P S; Barth, O M

    2011-12-30

    Since 1999, vesicular infections caused by Orthopoxvirus in humans and animals, mainly in dairy cattle, have been identified in 20 municipalities in the Rio de Janeiro state of Brazil. This paper describes studies conducted in counties of the northwestern, middle-Paraíba Valley and southern regions of the Rio de Janeiro state where 77 human, 346 bovine and 78 rodent samples were collected over the past ten years. Laboratory investigations using virus isolation, electron microscopy, molecular biology (PCR) and serological analysis confirmed Orthopoxvirus infections in 77.9% of human, 49.2% of dairy cattle and 17.9% of rodent samples. The characterisation of the Cantagalo/IOC strain reconfirmed that this virus was a vaccinia-like virus. In other regions of the Rio de Janeiro state, vesicular/pustular infections in animals and humans are suspected but these have not yet been confirmed. A continuous surveillance system has been established to monitor these regions in addition to several other states of the Brazilian Federation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

    Science.gov (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

    2017-10-01

    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  19. Comparison of the Cowpox Virus and Vaccinia Virus Mature Virion Proteome: Analysis of the Species- and Strain-Specific Proteome.

    Directory of Open Access Journals (Sweden)

    Joerg Doellinger

    Full Text Available Cowpox virus (CPXV causes most zoonotic orthopoxvirus (OPV infections in Europe and Northern as well as Central Asia. The virus has the broadest host range of OPV and is transmitted to humans from rodents and other wild or domestic animals. Increasing numbers of human CPXV infections in a population with declining immunity have raised concerns about the virus' zoonotic potential. While there have been reports on the proteome of other human-pathogenic OPV, namely vaccinia virus (VACV and monkeypox virus (MPXV, the protein composition of the CPXV mature virion (MV is unknown. This study focused on the comparative analysis of the VACV and CPXV MV proteome by label-free single-run proteomics using nano liquid chromatography and high-resolution tandem mass spectrometry (nLC-MS/MS. The presented data reveal that the common VACV and CPXV MV proteome contains most of the known conserved and essential OPV proteins and is associated with cellular proteins known to be essential for viral replication. While the species-specific proteome could be linked mainly to less genetically-conserved gene products, the strain-specific protein abundance was found to be of high variance in proteins associated with entry, host-virus interaction and protein processing.

  20. A marker-free system for highly efficient construction of vaccinia virus vectors using CRISPR Cas9

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    Full Text Available The current method for creation of vaccinia virus (VACV vectors involves using a selection and purification marker, however inclusion of a gene without therapeutic value in the resulting vector is not desirable for clinical use. The Cre-LoxP system has been used to make marker-free Poxviruses, but the efficiency was very low. To obtain a marker-free VACV vector, we developed marker gene excision systems to modify the thymidine kinase (TK region and N1L regions using Cre-Loxp and Flp-FRET systems respectively. CRISPR-Cas9 system significantly resulted in a high efficiency (∼90% in generation of marker gene-positive TK-mutant VACV vector. The marker gene (RFP could be excised from the recombinant virus using Cre recombinase. To make a marker-free VV vector with double gene deletions targeting the TK and N1L gene, we constructed a donor repair vector targeting the N1L gene, which can carry a therapeutic gene and the marker (RFP that could be excised from the recombinant virus using Flp recombinase. The marker-free system developed here can be used to efficiently construct VACV vectors armed with any therapeutic genes in the TK region or N1L region without marker genes. Our marker-free system platform has significant potential for development of new marker-free VACV vectors for clinical application.

  1. An E2–F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s−1, consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. PMID:19207726

  2. NK cell-extrinsic IL-18 signaling is required for efficient NK-cell activation by vaccinia virus.

    Science.gov (United States)

    Brandstadter, Joshua D; Huang, Xiaopei; Yang, Yiping

    2014-09-01

    NK cells are important for the control of vaccinia virus (VV) in vivo. Recent studies have shown that multiple pathways are required for effective activation of NK cells. These include both TLR-dependent and -independent pathways, as well as the NKG2D activating receptor that recognizes host stress-induced NKG2D ligands. However, it remains largely unknown what controls the upregulation of NKG2D ligands in response to VV infection. In this study using C57BL/6 mice, we first showed that IL-18 is critical for NK-cell activation and viral clearance. We then demonstrated that IL-18 signaling on both NK cells and DCs is required for efficient NK-cell activation upon VV infection in vitro. We further showed in vivo that efficient NK-cell activation in response to VV is dependent on DCs and IL-18 signaling in non-NK cells, suggesting an essential role for NK cell-extrinsic IL-18 signaling in NK-cell activation. Mechanistically, IL-18 signaling in DCs promotes expression of Rae-1, an NKG2D ligand. Collectively, our data reveal a previously unrecognized role for NK cell-extrinsic IL-18 signaling in NK-cell activation through upregulation of NKG2D ligands. These observations may provide insights into the design of effective NK-cell-based therapies for viral infections and cancer. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Systemic treatment of xenografts with vaccinia virus GLV-1h68 reveals the immunologic facet of oncolytic therapy

    Directory of Open Access Journals (Sweden)

    Liu Hui

    2009-07-01

    Full Text Available Abstract Background GLV-1h68 is an attenuated recombinant vaccinia virus (VACV that selectively colonizes established human xenografts inducing their complete regression. Results Here, we explored xenograft/VACV/host interactions in vivo adopting organism-specific expression arrays and tumor cell/VACV in vitro comparing VACV replication patterns. There were no clear-cut differences in vitro among responding and non-responding tumors, however, tumor rejection was associated in vivo with activation of interferon-stimulated genes (ISGs and innate immune host's effector functions (IEFs correlating with VACV colonization of the xenografts. These signatures precisely reproduce those observed in humans during immune-mediated tissue-specific destruction (TSD that causes tumor or allograft rejection, autoimmunity or clearance of pathogens. We recently defined these common pathways in the "immunologic constant of rejection" hypothesis (ICR. Conclusion This study provides the first prospective validation of a universal mechanism associated with TSD. Thus, xenograft infection by oncolytic VACV, beyond offering a promising therapy of established cancers, may represent a reliable pre-clinical model to test therapeutic strategies aimed at modulating the central pathways leading to TSD; this information may lead to the identification of principles that could refine the treatment of cancer and chronic infection by immune stimulation or autoimmunity and allograft rejection through immune tolerance.

  4. Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

    Science.gov (United States)

    Marín-López, Alejandro; Ortego, Javier

    2016-01-01

    Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

  5. RNA-Seq Based Transcriptome Analysis of the Type I Interferon Host Response upon Vaccinia Virus Infection of Mouse Cells

    Directory of Open Access Journals (Sweden)

    Bruno Hernáez

    2017-01-01

    Full Text Available Vaccinia virus (VACV encodes the soluble type I interferon (IFN binding protein B18 that is secreted from infected cells and also attaches to the cell surface, as an immunomodulatory strategy to inhibit the host IFN response. By using next generation sequencing technologies, we performed a detailed RNA-seq study to dissect at the transcriptional level the modulation of the IFN based host response by VACV and B18. Transcriptome profiling of L929 cells after incubation with purified recombinant B18 protein showed that attachment of B18 to the cell surface does not trigger cell signalling leading to transcriptional activation. Consistent with its ability to bind type I IFN, B18 completely inhibited the IFN-mediated modulation of host gene expression. Addition of UV-inactivated virus particles to cell cultures altered the expression of a set of 53 cellular genes, including genes involved in innate immunity. Differential gene expression analyses of cells infected with replication competent VACV identified the activation of a broad range of host genes involved in multiple cellular pathways. Interestingly, we did not detect an IFN-mediated response among the transcriptional changes induced by VACV, even after the addition of IFN to cells infected with a mutant VACV lacking B18. This is consistent with additional viral mechanisms acting at different levels to block IFN responses during VACV infection.

  6. Single molecule DNA interaction kinetics of retroviral nucleic acid chaperone proteins

    Science.gov (United States)

    Williams, Mark

    2010-03-01

    Retroviral nucleocapsid (NC) proteins are essential for several viral replication processes including specific genomic RNA packaging and reverse transcription. The nucleic acid chaperone activity of NC facilitates the latter process. In this study, we use single molecule biophysical methods to quantify the DNA interactions of wild type and mutant human immunodeficiency virus type 1 (HIV-1) NC and Gag and human T-cell leukemia virus type 1 (HTLV-1) NC. We find that the nucleic acid interaction properties of these proteins differ significantly, with HIV-1 NC showing rapid protein binding kinetics, significant duplex destabilization, and strong DNA aggregation, all properties that are critical components of nucleic acid chaperone activity. In contrast, HTLV-1 NC exhibits significant destabilization activity but extremely slow DNA interaction kinetics and poor aggregating capability, which explains why HTLV-1 NC is a poor nucleic acid chaperone. To understand these results, we developed a new single molecule method for quantifying protein dissociation kinetics, and applied this method to probe the DNA interactions of wild type and mutant HIV-1 and HTLV-1 NC. We find that mutations to aromatic and charged residues strongly alter the proteins' nucleic acid interaction kinetics. Finally, in contrast to HIV-1 NC, HIV-1 Gag, the nucleic acid packaging protein that contains NC as a domain, exhibits relatively slow binding kinetics, which may negatively impact its ability to act as a nucleic acid chaperone.

  7. Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection.

    Science.gov (United States)

    Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T; Carr, Christopher E

    2017-08-01

    Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars. Key Words: Life-detection instruments-Nucleic acids-Mars-Panspermia. Astrobiology 17, 747-760.

  8. Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection

    Science.gov (United States)

    Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T.

    2017-01-01

    Abstract Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry–dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a “universal” nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars. Key Words: Life-detection instruments—Nucleic acids—Mars—Panspermia. Astrobiology 17, 747–760. PMID:28704064

  9. On-nylon membrane detection of nucleic acid molecules by rolling circle amplification.

    Science.gov (United States)

    Xu, Xinhui; Zhang, Beibei; Gan, Ping; Wu, Jian; Dai, Wei; Zhang, Ling; Wang, Jinke

    2017-09-15

    Positively-charged nylon membrane (NM) is a general solid-phase support for nucleic acid detection due to its convenient immobilization of nucleic acid materials by direct electrostatic adherence and simple UV crosslinking. Rolling circle amplification (RCA) is a widely used isothermal DNA amplification technique for nucleic acid detection. Near-infrared fluorescence (NIRF) is a new fluorescence technique with high sensitivity due to low background. This study developed a simple method for detecting nucleic acid molecules by combining the advantages of NM, RCA and NIRF, named NIRF-based solid phase RCA on nylon membrane (NM-NIRF-sRCA). The detection system of this method only need two kinds of nucleic acid molecules: target-specific probes with a RCA primer (P) at their 3' end and a rolling circle (RC). The detection procedure consists of four steps: (1) immobilizing detected nucleic acids on NM by UV crosslinking; (2) hybridizing NM with specific probes and RC; (3) amplifying by a RCA reaction containing biotin-dUTP; (4) incubating NM with NIRF-labeled streptavidin and imaging with a NIRF imager. The method was fully testified by detecting oligonucleotides, L1 fragments of various HPV subtypes cloned in plasmid, and E.coli genomic DNA. This study thus provides a new facile method for detecting nucleic acid molecules. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Human vaccinia-like virus outbreaks in São Paulo and Goiás States, Brazil: virus detection, isolation and identification Surtos de vírus Vaccinia-like nos Estados de São Paulo e Goiás, Brasil: detecção, isolamento e identificação viral

    Directory of Open Access Journals (Sweden)

    Teresa Keico Nagasse-Sugahara

    2004-04-01

    Full Text Available Since October 2001, the Adolfo Lutz Institute has been receiving vesicular fluids and scab specimens of patients from Paraíba Valley region in the São Paulo and Minas Gerais States and from São Patricio Valley, in the Goiás State. Epidemiological data suggested that the outbreaks were caused by Cowpox virus or Vaccinia virus. Most of the patients are dairy milkers that had vesiculo-pustular lesions on the hands, arms, forearms, and some of them, on the face. Virus particles with orthopoxvirus morphology were detected by direct electron microscopy (DEM in samples of 49 (66.21% patients of a total of 74 analyzed. Viruses were isolated in Vero cell culture and on chorioallantoic membrane (CAM of embryonated chicken eggs. Among 21 samples submitted to PCR using primers for hemagglutinin (HA gene, 19 were positive. Restriction digestion with TaqI resulted in four characteristic Vaccinia virus fragments. HA nucleotide sequences showed 99.9% similarity with Cantagalo virus, described as a strain of Vaccinia virus. The only difference observed was the substitution of one nucleotide in the position 616 leading to change in one amino acid of the protein in the position 206. The phylogenetic analysis showed that the isolates clustered together with Cantagalo virus, other Vaccinia strains and Rabbitpox virus.A partir de outubro de 2001, o Instituto Adolfo Lutz tem recebido amostras de líquido vesicular e crostas de lesões de pele de pacientes das regiões do Vale do Paraíba, Estado de São Paulo e do Vale do São Patricio, Estado de Goiás. Os dados clínicos e epidemiológicos sugeriam que os surtos poderiam ser causados por Cowpox virus ou Vaccinia virus. A maioria dos pacientes era ordenhadores que tinham lesões vesicopustulares nas mãos, braços, antebraços e alguns na face. A análise por microscopia eletrônica direta (MED detectou partículas com morfologia de vírus do gênero Orthopoxvirus em amostras de 49 (66,21% pacientes dos 74

  11. Cell-free nucleic acids as potential markers for preeclampsia.

    Science.gov (United States)

    Hahn, S; Rusterholz, C; Hösli, I; Lapaire, O

    2011-02-01

    Preeclampsia is one of the leading causes of maternal and fetal/neonatal mortality and morbidity worldwide. Therefore, widely applicable and affordable tests are needed to make an early diagnosis before the occurrence of the clinical symptoms. Circulating cell-free nucleic acids in plasma and serum are novel biomarkers with promising clinical applications in different medical fields, including prenatal diagnosis. Quantitative changes of cell-free fetal (cff)DNA in maternal plasma as an indicator for impending preeclampsia have been reported in different studies, using real-time quantitative PCR for the male-specific SRY or DYS 14 loci. In case of early onset preeclampsia, elevated levels may be already seen in the first trimester. The increased levels of cffDNA before the onset of symptoms may be due to hypoxia/reoxygenation within the intervillous space leading to tissue oxidative stress and increased placental apoptosis and necrosis. In addition to the evidence for increased shedding of cffDNA into the maternal circulation, there is also evidence for reduced renal clearance of cffDNA in preeclampsia. As the amount of fetal DNA is currently determined by quantifying Y-chromosome specific sequences, alternative approaches such as the measurement of total cell-free DNA or the use of gender-independent fetal epigenetic markers, such as DNA methylation, offer a promising alternative. Cell-free RNA of placental origin might be another potentially useful biomarker for screening and diagnosis of preeclampsia in clinical practice. Fetal RNA is associated with subcellular placental particles that protect it from degradation. Its levels are ten-fold higher in pregnant women with preeclampsia compared to controls. In conclusion, through the use of gender-independent sequences, the universal incorporation of fetal nucleic acids into routine obstetric care and into screening or diagnostic settings using combined markers may soon become a reality. Effort has now to be put into

  12. Application of locked nucleic acid-based probes in fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Fontenete, Sílvia; Carvalho, Daniel R; Guimarães, Nuno

    2016-01-01

    of nucleic acid mimics used as mixmers in LNA-based probes strongly influence the efficiency of detection. LNA probes with 10 to 15 mers showed the highest efficiency. Additionally, the combination of 2′-OMe RNA with LNA allowed an increase on the fluorescence intensities of the probes. Overall......Fluorescence in situ hybridization (FISH) employing nucleic acid mimics as probes is becoming an emerging molecular tool in the microbiology area for the detection and visualization of microorganisms. However, the impact that locked nucleic acid (LNA) and 2′-O-methyl (2′-OMe) RNA modifications have...

  13. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Antsypovitch, Sergei I; Oretskaya, Tat' yana S [Department of Chemistry, M.V. Lomonosov Moscow State University, Moscow (Russian Federation)

    1998-03-31

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  14. Theranostic Nucleic Acid Binding Nanoprobe Exerts Anti-inflammatory and Cytoprotective Effects in Ischemic Injury.

    Science.gov (United States)

    Chen, Howard H; Yuan, Hushan; Cho, Hoonsung; Feng, Yan; Ngoy, Soeun; Kumar, Anand T N; Liao, Ronglih; Chao, Wei; Josephson, Lee; Sosnovik, David E

    2017-01-01

    Extracellular nucleic acids are proinflammatory molecules that have been implicated in a diverse range of diseases. We report here the development of a multivalent nucleic acid scavenging nanoprobe, where the fluorochrome thiazole orange (TO) is conjugated to a polymeric 40 kDa dextran carrier. Dextran-TO (Dex-TO) has nanomolar affinity for mammalian and bacterial nucleic acids and attenuates the production of inflammatory cytokines from activated macrophages exposed to DNA and RNA. Mice with myocardial ischemia reperfusion that were treated with Dex-TO showed a decrease in myocardial macrophage infiltration at 24 hours (ptheranostic) utility in a broad range of conditions including ischemia, trauma, burns, sepsis and autoimmune disease.

  15. The third annual BRDS on research and development of nucleic acid-based nanomedicines.

    Science.gov (United States)

    Chaudhary, Amit Kumar; Mahato, Ram I

    2017-02-01

    The completion of human genome project, decrease in the sequencing cost, and correlation of genome sequencing data with specific diseases led to the exponential rise in the nucleic acid-based therapeutic approaches. In the third annual Biopharmaceutical Research and Development Symposium (BRDS) held at the Center for Drug Discovery and Lozier Center for Pharmacy Sciences and Education at the University of Nebraska Medical Center (UNMC), we highlighted the remarkable features of the nucleic acid-based nanomedicines, their significance, NIH funding opportunities on nanomedicines and gene therapy research, challenges and opportunities in the clinical translation of nucleic acids into therapeutics, and the role of intellectual property (IP) in drug discovery and development.

  16. Recombinant vaccinia DIs expressing simian immunodeficiency virus gag and pol in mammalian cells induces efficient cellular immunity as a safe immunodeficiency virus vaccine candidate.

    Science.gov (United States)

    Okamura, Tomotaka; Someya, Kenji; Matsuo, Kazuhiro; Hasegawa, Atsuhiko; Yamamoto, Naoki; Honda, Mitsuo

    2006-01-01

    A highly attenuated vaccinia virus substrain of Dairen-I (DIs) shows promise as a candidate vector for eliciting positive immunity against immune deficiency virus. DIs was randomly obtained by serial 1-day egg passages of a chorioarantoic membrane-adapted Dairen strain (DIE), resulting in substantial genomic deletion, including various genes regulating the virus-host-range. To investigate the impact of that deletion and of the subsequent insertion of a foreign gene into that region of DIs on the ability of the DIs recombinant to induce antigen-specific immunity, we generated a recombinant vaccinia DIs expressing fulllength gag and pol genes of simian immunodeficiency virus (SIV) (rDIsSIV gag/pol) and studied the biological and immunological characteristics of the recombinant natural mutant. The rDIsSIV gag/pol developed a tiny plaque on the chick embryo fibroblast (CEF). Viral particles of rDIsSIV gag/pol as well as SIV Gag-like particles were electromicroscopically detected in the cytoplasm. Interestingly, the recombinant DIs strain grows well in CEF cells but not in mammalian cells. While rDIsSIV gag/pol produces SIV proteins in mammalian HeLa and CV-1 cells, recombinant modified vaccinia Ankara strain (MVA) expressing SIV gag and pol genes (MVA/SIV239 gag/pol) clearly replicates in HeLa and CV-1 cell lines under synchronized growth conditions and produces the SIV protein in all cell lines. Moreover, intradermal administration of rDIsSIV gag/pol or of MVA/SIV239 gag/pol elicited similar levels of IFN-gamma spot-forming cells specific for SIV Gag. If the non-productive infection characteristically induced by recombinant DIs is sufficient to trigger immune induction, as we believe it is, then a human immunodeficiency virus vaccine employing the DIs recombinant would have the twin advantages of being both effective and safe.

  17. The NYCBH vaccinia virus deleted for the innate immune evasion gene, E3L, protects rabbits against lethal challenge by rabbitpox virus

    Science.gov (United States)

    Denzler, Karen L; Rice, Amanda D; MacNeill, Amy L; Fukushima, Nobuko; Lindsey, Scott F; Wallace, Greg; Burrage, Andrew M; Smith, Andrew J; Manning, Brandi R; Swetnam, Daniele M; Gray, Stacey A; Moyer, RW; Jacobs, Bertram L

    2011-01-01

    Vaccinia virus deleted for the innate immune evasion gene, E3L, has been shown to be highly attenuated and yet induces a protective immune response against challenge by homologous virus in a mouse model. In this manuscript the NYCBH vaccinia virus vaccine strain was compared to NYCBH vaccinia virus deleted for E3L (NYCBHΔE3L) in a rabbitpox virus (RPV) challenge model. Upon scarification, both vaccines produced a desired skin lesion, although the lesion produced by NYCBHΔE3L was smaller. Both vaccines fully protected rabbits against lethal challenge by escalating doses of RPV, from 10 LD50 to 1,000 LD50. A single dose of NYCBHΔE3L protected rabbits from weight loss, fever, and clinical symptoms following the lowest dose challenge of 10 LD50, however it allowed a moderate level of RPV replication at the challenge site, some spread to external skin and mucosal surfaces, and increased numbers of secondary lesions as compared to vaccination with NYCBH. Alternately, two doses of NYCBHΔE3L fully protected rabbits from weight loss, fever, and clinical symptoms, following challenge with 100 to 1,000 LD50 RPV, and it prevented development of secondary lesions similar to protection seen with NYCBH. Finally, vaccination with either one or two doses of NYCBHΔE3L resulted in similar neutralizing antibody titers following RPV challenge as compared to titers obtained by vaccination with NYCBH. These results support the efficacy of the attenuated NYCBHΔE3L in protection against an orthologous poxvirus challenge. PMID:21840358

  18. Proposed Ancestors of Phage Nucleic Acid Packaging Motors (and Cells

    Directory of Open Access Journals (Sweden)

    Philip Serwer

    2011-07-01

    Full Text Available I present a hypothesis that begins with the proposal that abiotic ancestors of phage RNA and DNA packaging systems (and cells include mobile shells with an internal, molecule-transporting cavity. The foundations of this hypothesis include the conjecture that current nucleic acid packaging systems have imprints from abiotic ancestors. The abiotic shells (1 initially imbibe and later also bind and transport organic molecules, thereby providing a means for producing molecular interactions that are links in the chain of events that produces ancestors to the first molecules that are both information carrying and enzymatically active, and (2 are subsequently scaffolds on which proteins assemble to form ancestors common to both shells of viral capsids and cell membranes. Emergence of cells occurs via aggregation and merger of shells and internal contents. The hypothesis continues by using proposed imprints of abiotic and biotic ancestors to deduce an ancestral thermal ratchet-based DNA packaging motor that subsequently evolves to integrate a DNA packaging ATPase that provides a power stroke.

  19. Physical methods of nucleic acid transfer: general concepts and applications.

    Science.gov (United States)

    Villemejane, Julien; Mir, Lluis M

    2009-05-01

    Physical methods of gene (and/or drug) transfer need to combine two effects to deliver the therapeutic material into cells. The physical methods must induce reversible alterations in the plasma membrane to allow the direct passage of the molecules of interest into the cell cytosol. They must also bring the nucleic acids in contact with the permeabilized plasma membrane or facilitate access to the inside of the cell. These two effects can be achieved in one or more steps, depending upon the methods employed. In this review, we describe and compare several physical methods: biolistics, jet injection, hydrodynamic injection, ultrasound, magnetic field and electric pulse mediated gene transfer. We describe the physical mechanisms underlying these approaches and discuss the advantages and limitations of each approach as well as its potential application in research or in preclinical and clinical trials. We also provide conclusions, comparisons, and projections for future developments. While some of these methods are already in use in man, some are still under development or are used only within clinical trials for gene transfer. The possibilities offered by these methods are, however, not restricted to the transfer of genes and the complementary uses of these technologies are also discussed. As these methods of gene transfer may bypass some of the side effects linked to viral or biochemical approaches, they may find their place in specific clinical applications in the future.

  20. Nucleic acid amplification of individual molecules in a microfluidic device.

    Science.gov (United States)

    Dettloff, Roger; Yang, Esther; Rulison, Aaron; Chow, Andrea; Farinas, Javier

    2008-06-01

    A microfluidic device was developed that enabled rapid polymerase chain reaction (PCR) analysis of individual DNA molecules. The device combined a means for accessing samples serially from a microtiter plate, channels for assembling eight parallel PCR reactions, and integrated resistive heaters for rapid thermocycling (>5 degrees C/s heating, >7 degrees C/s cooling) of samples as they flowed continuously through PCR channels. Amplification was monitored by fluorescence detection of Taqman probes. The long, narrow channels (10 microm x 180 microm x 40 mm) allowed sufficient separation between neighboring DNA templates to enable amplification of discreet DNA molecules. The functionality of the device was demonstrated by reproducibly amplifying a 2D6.6 CYP450 template and distinguishing between wild-type and mutant sequences using Taqman probes. A comparison of the rate of individual amplification events to the expected Poisson distribution confirmed that the device could reliably analyze individual DNA molecules. This work establishes the feasibility of rapid, single-molecule interrogation of nucleic acids.

  1. Monitoring Gene Expression In Vivo with Nucleic Acid Molecular Switches

    Energy Technology Data Exchange (ETDEWEB)

    David C. Ward; Patricia Bray-Ward

    2005-01-26

    The overall objectives of this project were (1) to develop allosteric ribozymes capable of acting as molecular switches for monitoring the levels of both wild-type and mutant mRNA species in living cells and whole animals and (2) to develop highly efficient reagents to deliver nucleic acid molecular switches into living cells, tissues and animals with the ultimate goal of expression profiling specific mRNAs of diagnostic or prognostic value within tumors in animals. During the past year, we have moved our laboratory to Nevada and in the moving process we have lost electronic and paper copies of prior progress reports concerning the construction and biological properties of the molecular switches. Since there was minimal progress during the last year on molecular switches, we are relying on past project reports to provide a summary of our data on this facet of the grant. Here we are summarizing the work done on the delivery reagents and their application to inducing mutations in living cells, which will include work done during the no cost extension.

  2. Integrated Microfluidic Nucleic Acid Isolation, Isothermal Amplification, and Amplicon Quantification

    Science.gov (United States)

    Mauk, Michael G.; Liu, Changchun; Song, Jinzhao; Bau, Haim H.

    2015-01-01

    Microfluidic components and systems for rapid (nucleic acids (NAs) are extracted from relatively large (~mL) volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase (“membrane”) to capture sample NAs in a flow-through, filtration mode; (2) NAs captured on the membrane are isothermally (~65 °C) amplified; (3) amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4) paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD) better than 103 virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed. PMID:27600235

  3. Development of a Capillary-driven, Microfluidic, Nucleic Acid Biosensor

    Directory of Open Access Journals (Sweden)

    Fei HE

    2011-12-01

    Full Text Available An ideal point-of-care device would incorporate the simplicity and reliability of a lateral flow assay with a microfluidic device. Our system consists of self-priming microfluidics with sealed conjugate pads of reagent delivery and an absorbent pad for additional fluid draw. Using poly (methyl methacrylate (PMMA as a substrate, we have developed a single-step surface modification method which allows strong capillary flow within a sealed microchannel. Conjugate pads within the device held trapped complex consisting of the magnetic beads and nucleic-acid-probe-conjugated horseradish peroxidase (HRP. Magnetic beads were released when sample entered the chamber and hybridized with the complex. The complex was immobilized over a magnet while a luminol co-reactant stream containing H2O2 was merged with the channel. A plate reader was able to quantify the chemiluminescence signal. This new format of biosensor will allow for a smaller and more sensitive biosensor, as well as commercial-scale manufacturing and low materials cost.

  4. Safety, immunogenicity, and efficacy of prime-boost immunization with recombinant poxvirus FP9 and modified vaccinia virus Ankara encoding the full-length Plasmodium falciparum circumsporozoite protein.

    Science.gov (United States)

    Walther, Michael; Thompson, Fiona M; Dunachie, Susanna; Keating, Sheila; Todryk, Stephen; Berthoud, Tamara; Andrews, Laura; Andersen, Rikke F; Moore, Anne; Gilbert, Sarah C; Poulton, Ian; Dubovsky, Filip; Tierney, Eveline; Correa, Simon; Huntcooke, Angela; Butcher, Geoffrey; Williams, Jack; Sinden, Robert E; Hill, Adrian V S

    2006-05-01

    Heterologous prime-boost immunization with DNA and various recombinant poxviruses encoding malaria antigens is capable of inducing strong cell-mediated immune responses and partial protection in human sporozoite challenges. Here we report a series of trials assessing recombinant fowlpox virus and modified vaccinia virus Ankara encoding the Plasmodium falciparum circumsporozoite protein in various prime-boost combinations, doses, and application routes. For the first time, these vaccines were administered intramuscularly and at doses of up to 5 x 10(8) PFU. Vaccines containing this antigen proved safe and induced modest immune responses but showed no evidence of efficacy in a sporozoite challenge.

  5. HIVIS-DNA or HIVISopt-DNA priming followed by CMDR vaccinia-based boosts induce both humoral and cellular murine immune responses to HIV

    Directory of Open Access Journals (Sweden)

    J Hinkula

    2017-06-01

    Conclusions: HIVIS-DNA was modified to obtain HIVISopt-DNA that had fewer plasmids, and additional epitopes. Even with one DNA prime followed by two MVA-CMDR boosts, humoral and cell-mediated immune responses were readily induced by priming with either DNA construct composition. Priming by HIV-DNA augmented neutralizing antibody responses revealed by boosting with the vaccinia-based heterologous sequences. Cellular and antibody responses covered selected strains representing HIV-1 subtypes A, B, C and CRF01_AE. We assume this is related to the inclusion of heterologous full genes in the vaccine schedule.

  6. A selective Seoul-Fluor-based bioprobe, SfBP, for vaccinia H1-related phosphatase--a dual-specific protein tyrosine phosphatase.

    Science.gov (United States)

    Jeong, Myeong Seon; Kim, Eunha; Kang, Hyo Jin; Choi, Eun Joung; Cho, Alvin R; Chung, Sang J; Park, Seung Bum

    2012-07-04

    We report a Seoul-Fluor-based bioprobe, SfBP, for selective monitoring of protein tyrosine phosphatases (PTPs). A rational design based on the structures at the active site of dual-specific PTPs can enable SfBP to selectively monitor the activity of these PTPs with a 93-fold change in brightness. Moreover, screening results of SfBP against 30 classical PTPs and 35 dual-specific PTPs show that it is selective toward vaccinia H1-related (VHR) phosphatase, a dual-specific PTP (DUSP-3).

  7. Gene Therapy for Advanced Melanoma: Selective Targeting and Therapeutic Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Joana R. Viola

    2013-01-01

    Full Text Available Despite recent advances, the treatment of malignant melanoma still results in the relapse of the disease, and second line treatment mostly fails due to the occurrence of resistance. A wide range of mutations are known to prevent effective treatment with chemotherapeutic drugs. Hence, approaches with biopharmaceuticals including proteins, like antibodies or cytokines, are applied. As an alternative, regimens with therapeutically active nucleic acids offer the possibility for highly selective cancer treatment whilst avoiding unwanted and toxic side effects. This paper gives a brief introduction into the mechanism of this devastating disease, discusses the shortcoming of current therapy approaches, and pinpoints anchor points which could be harnessed for therapeutic intervention with nucleic acids. We bring the delivery of nucleic acid nanopharmaceutics into perspective as a novel antimelanoma therapeutic approach and discuss the possibilities for melanoma specific targeting. The latest reports on preclinical and already clinical application of nucleic acids in melanoma are discussed.

  8. Polycation cytotoxicity: a delicate matter for nucleic acid therapy-focus on polyethylenimine

    DEFF Research Database (Denmark)

    Parhamifar, Ladan; Larsen, Anna K.; Hunter, A. Christy

    2010-01-01

    This article provides a critical assessment of the major challenges facing nucleic acid therapeutics, focusing on the safety and efficacy of delivery strategies using synthetic polycations and particularly polyethylenimines. Deficiencies in the field and avenues for further research are identified...

  9. Antibacterial Peptide Nucleic Acid-Antimicrobial Peptide (PNA-AMP) Conjugates

    DEFF Research Database (Denmark)

    Hansen, Anna Mette; Bonke, Gitte; Larsen, Camilla Josephine

    2016-01-01

    Antisense peptide nucleic acid (PNA) oligomers constitute a novel class of potential antibiotics that inhibit bacterial growth via specific knockdown of essential gene expression. However, discovery of efficient, nontoxic delivery vehicles for such PNA oligomers has remained a challenge...

  10. Nucleic acid polymeric properties and electrostatics: Directly comparing theory and simulation with experiment.

    Science.gov (United States)

    Sim, Adelene Y L

    2016-06-01

    Nucleic acids are biopolymers that carry genetic information and are also involved in various gene regulation functions such as gene silencing and protein translation. Because of their negatively charged backbones, nucleic acids are polyelectrolytes. To adequately understand nucleic acid folding and function, we need to properly describe its i) polymer/polyelectrolyte properties and ii) associating ion atmosphere. While various theories and simulation models have been developed to describe nucleic acids and the ions around them, many of these theories/simulations have not been well evaluated due to complexities in comparison with experiment. In this review, I discuss some recent experiments that have been strategically designed for straightforward comparison with theories and simulation models. Such data serve as excellent benchmarks to identify limitations in prevailing theories and simulation parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. The 2015 Nucleic Acids Research Database Issue and molecular biology database collection

    National Research Council Canada - National Science Library

    Galperin, Michael Y; Rigden, Daniel J; Fernández-Suárez, Xosé M

    2015-01-01

    The 2015 Nucleic Acids Research Database Issue contains 172 papers that include descriptions of 56 new molecular biology databases, and updates on 115 databases whose descriptions have been previously...

  12. Nucleic acid sensing and innate immunity: signaling pathways controlling viral pathogenesis and autoimmunity

    Science.gov (United States)

    Ahlers, Laura R. H.; Goodman, Alan G.

    2016-01-01

    Innate immunity refers to the body’s initial response to curb infection upon exposure to invading organisms. While the detection of pathogen-associated molecules is an ancient form of host defense, if dysfunctional, autoimmune disease may result. The innate immune response during pathogenic infection is initiated through the activation of receptors recognizing conserved molecular patterns, such as nucleic acids from a virus’ genome or replicative cycle. Additionally, the host’s own nucleic acids are capable of activating an immune response. Therefore, it follows that the nucleic acid-sensing pathways must be tightly controlled to avoid an autoimmune response from recognition of self, yet still be unimpeded to respond to viral infections. In this review, we will describe the nucleic acid sensing pathways and how they respond to virus infection. Moreover, we will discuss autoimmune diseases that develop when these pathways fail to signal properly and identify knowledge gaps that are prime for interrogation. PMID:27857881

  13. Beyond H&E: integration of nucleic acid-based analyses into diagnostic pathology.

    Science.gov (United States)

    Maes, R K; Langohr, I M; Wise, A G; Smedley, R C; Thaiwong, T; Kiupel, M

    2014-01-01

    Veterinary pathology of infectious, particularly viral, and neoplastic diseases has advanced significantly with the advent of newer molecular methodologies that can detect nucleic acid of infectious agents within microscopic lesions, differentiate neoplastic from nonneoplastic cells, or determine the suitability of a targeted therapy by detecting specific mutations in certain cancers. Polymerase chain reaction-based amplification of DNA or RNA and in situ hybridization are currently the most commonly used methods for nucleic acid detection. In contrast, the main methodology used for protein detection within microscopic lesions is immunohistochemistry. Other methods that allow for analysis of nucleic acids within a particular cell type or individual cells, such as laser capture microdissection, are also available in some laboratories. This review gives an overview of the factors that influence the accurate analysis of nucleic acids in formalin-fixed tissues, as well as of different approaches to detect such targets.

  14. THE VARIATION OF NUCLEIC ACIDS CONTENT AFTER SIMAZIN TREATMENT ON VICIA SATIVA L.

    Directory of Open Access Journals (Sweden)

    Odeta Grama-Tiganasu

    2005-08-01

    Full Text Available Simazin has in certain conditions stimulatory effects on nucleic acids biosynthese. The biosyntese and mitotic division stimulation sugest the possibility to use simazin like growing and germination stimulator.

  15. Facial manifestations of Epstein-Barr virus-related lymphoproliferative disease in childhood acute lymphoblastic leukemia in remission: Two atypical presentations.

    Science.gov (United States)

    Lu, Benjamin Y; Kojima, Lisa; Huang, Mary S; Friedmann, Alison M; Ferry, Judith A; Weinstein, Howard J

    2016-11-01

    Epstein-Barr virus-related lymphoproliferative disease (EBV-LPD) rarely occurs in patients with acute lymphoblastic leukemia (ALL), who have not received hematopoietic transplantation. We describe EBV-LPD manifesting as facial lesions in two children with ALL in remission. One patient was a 16-year-old male with T-cell ALL with an EBV-positive angiocentric polymorphous lip lesion presenting as right-sided facial swelling. The other patient was a 12-year-old male with B-cell ALL with an EBV-positive polymorphous lymphoplasmacytic infiltrate presenting as bilateral dacryoadenitis. Neither patient had known primary immunodeficiencies. Both cases improved with immunosuppressant de-escalation. These cases suggest that immunosuppression induced by maintenance chemotherapy is sufficient to promote EBV-LPD. © 2016 Wiley Periodicals, Inc.

  16. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry

    DEFF Research Database (Denmark)

    Steen, Hanno; Jensen, Ole Nørregaard

    2002-01-01

    and for sequencing of peptide-nucleic acid heteroconjugates. The combination of photochemical cross-linking and MS provides a fast screening method to gain insights into the overall structure and formation of protein-oligonucleotide complexes. Because the analytical methods are continuously refined and protein...... structural data are rapidly accumulating in databases, we envision that many protein-nucleic acid assemblies will be initially characterized by combinations of cross-linking methods, MS, and computational molecular modeling....

  17. Features of “All LNA” Duplexes Showing a New Type of Nucleic Acid Geometry

    OpenAIRE

    Charlotte Förster; André Eichert; Dominik Oberthür; Christian Betzel; Reinhard Geßner; Andreas Nitsche; Fürste, Jens P.

    2012-01-01

    “Locked nucleic acids” (LNAs) belong to the backbone-modified nucleic acid family. The 2′-O,4′-C-methylene- β -D-ribofuranose nucleotides are used for single or multiple substitutions in RNA molecules and thereby introduce enhanced bio- and thermostability. This renders LNAs powerful tools for diagnostic and therapeutic applications. RNA molecules maintain the overall canonical A-type conformation upon substitution of single or multiple residues/nucleotides by LNA monomers. The structures of ...

  18. Cleavage and protection of locked nucleic acid-modified DNA by restriction endonucleases

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Wengel, Jesper

    2012-01-01

    Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far. We herein for the first time report cleavage by restriction endonuclease of LNA-modified DNA oligonucleotides. The experiments revealed that RsaI is an efficient enzyme capable of recognizing and cleaving...... LNA-modified DNA oligonucleotides. Furthermore, introduction of LNA nucleotides protects against cleavage by the restriction endonucleases PvuII, PstI, SacI, KpnI and EcoRI....

  19. Microfluidic devices for nucleic acid (NA) isolation, isothermal NA amplification, and real-time detection.

    Science.gov (United States)

    Mauk, Michael G; Liu, Changchun; Sadik, Mohamed; Bau, Haim H

    2015-01-01

    Molecular (nucleic acid)-based diagnostics tests have many advantages over immunoassays, particularly with regard to sensitivity and specificity. Most on-site diagnostic tests, however, are immunoassay-based because conventional nucleic acid-based tests (NATs) require extensive sample processing, trained operators, and specialized equipment. To make NATs more convenient, especially for point-of-care diagnostics and on-site testing, a simple plastic microfluidic cassette ("chip") has been developed for nucleic acid-based testing of blood, other clinical specimens, food, water, and environmental samples. The chip combines nucleic acid isolation by solid-phase extraction; isothermal enzymatic amplification such as LAMP (Loop-mediated AMPlification), NASBA (Nucleic Acid Sequence Based Amplification), and RPA (Recombinase Polymerase Amplification); and real-time optical detection of DNA or RNA analytes. The microfluidic cassette incorporates an embedded nucleic acid binding membrane in the amplification reaction chamber. Target nucleic acids extracted from a lysate are captured on the membrane and amplified at a constant incubation temperature. The amplification product, labeled with a fluorophore reporter, is excited with a LED light source and monitored in situ in real time with a photodiode or a CCD detector (such as available in a smartphone). For blood analysis, a companion filtration device that separates plasma from whole blood to provide cell-free samples for virus and bacterial lysis and nucleic acid testing in the microfluidic chip has also been developed. For HIV virus detection in blood, the microfluidic NAT chip achieves a sensitivity and specificity that are nearly comparable to conventional benchtop protocols using spin columns and thermal cyclers.

  20. Nucleic acid sensing pattern recognition receptors in the development of colorectal cancer and colitis.

    Science.gov (United States)

    He, Liangmei; Chen, Yayun; Wu, Yuanbing; Xu, Ying; Zhang, Zixiang; Liu, Zhiping

    2017-07-01

    Colorectal cancer (CRC) is a leading cause of cancer-related deaths that is often associated with inflammation initiated by activation of pattern recognition receptors (PRRs). Nucleic acid sensing PRRs are one of the major subsets of PRRs that sense nucleic acid (DNA and RNA), mainly including some members of Toll-like receptors (TLR3, 7, 8, 9), AIM2-like receptors (AIM2, IFI16), STING, cGAS, RNA polymerase III, and DExD/H box nucleic acid helicases (such as RIG-I like receptors (RIG-I, MDA5, LPG2), DDX1, 3, 5, 7, 17, 21, 41, 60, and DHX9, 36). Activation of these receptors eventually leads to the release of cytokines and activation of immune cells, which are well known to play crucial roles in host defense against intracellular bacterial and virus infection. However, the functions of these nucleic acid sensing PRRs in the other diseases such as CRC and colitis remain largely unknown. Recent studies indicated that nucleic acid sensing PRRs contribute to CRC and/or colitis development, and therapeutic modulation of nucleic acid sensing PRRs may reduce the risk of CRC development. However, until now, a comprehensive review on the role of nucleic acid sensing PRRs in CRC and colitis is still lacking. This review provided an overview of the roles as well as the mechanisms of these nucleic acid sensing PRRs (AIM2, STING, cGAS, RIG-I and its downstream molecules, DDX3, 5, 6,17, and DHX9, 36) in CRC and colitis, which may aid the diagnosis, therapy, and prognostic prediction of CRC and colitis.

  1. Development of Chemiluminescent Lateral Flow Assay for the Detection of Nucleic Acids

    OpenAIRE

    Sam R. Nugen; Catherine Fill; Yuhong Wang

    2012-01-01

    Rapid, sensitive detection methods are of utmost importance for the identification of pathogens related to health and safety. Herein we report the development of a nucleic acid sequence-based lateral flow assay which achieves a low limit of detection using chemiluminescence. On-membrane enzymatic signal amplification is used to reduce the limit of detection to the sub-femtomol level. To demonstrate this assay, we detected synthetic nucleic acid sequences representative of Trypanosoma mRNA, th...

  2. Peptide Nucleic Acids Having Enhanced Binding Affinity, Sequence Specificity and Solubility

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than a corresponding DNA strand, and exhibit increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from a group consisting of naturally......-occurring nucleobases and non-naturally-occurring nucleobases attached to a polyamide backbone, and contain C1-C8 alkylamine side chains. Methods of enhancing the solubility, binding affinity and sequence specificity of PNAs are provided....

  3. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein.

    Science.gov (United States)

    Remy-Ziller, Christelle; Germain, Claire; Spindler, Anita; Hoffmann, Chantal; Silvestre, Nathalie; Rooke, Ronald; Bonnefoy, Jean-Yves; Préville, Xavier

    2014-02-01

    Women showing normal cytology but diagnosed with a persistent high-risk human papillomavirus (HR-HPV) infection have a higher risk of developing high-grade cervical intraepithelial neoplasia and cervical cancer than noninfected women. As no therapeutic management other than surveillance is offered to these women, there is a major challenge to develop novel targeted therapies dedicated to the treatment of these patients. As such, E1 and E2 antigens, expressed early in the HPV life cycle, represent very interesting candidates. Both proteins are necessary for maintaining coordinated viral replication and gene synthesis during the differentiation process of the epithelium and are essential for the virus to complete its normal and propagative replication cycle. In the present study, we evaluated a new active targeted immunotherapeutic, a modified vaccinia virus Ankara (MVA) vector containing the E1 sequence of HPV16, aimed at inducing cellular immune responses with the potential to help and clear persistent HPV16-related infection. We carried out an extensive comparative time course analysis of the cellular immune responses induced by different schedules of immunization in C57BL/6 mice. We showed that multiple injections of MVA-E1 allowed sustained HPV16 E1-specific cellular immune responses in vaccinated mice and had no impact on the exhaustion phenotype of the generated HPV16 E1-specific CD8⁺ T cells, but they led to the differentiation of multifunctional effector T cells with high cytotoxic capacity. This study provides proof of concept that an MVA expressing HPV16 E1 can induce robust and long-lasting E1-specific responses and warrants further development of this candidate.

  4. The membrane fusion step of vaccinia virus entry is cooperatively mediated by multiple viral proteins and host cell components.

    Directory of Open Access Journals (Sweden)

    Jason P Laliberte

    2011-12-01

    Full Text Available For many viruses, one or two proteins allow cell attachment and entry, which occurs through the plasma membrane or following endocytosis at low pH. In contrast, vaccinia virus (VACV enters cells by both neutral and low pH routes; four proteins mediate cell attachment and twelve that are associated in a membrane complex and conserved in all poxviruses are dedicated to entry. The aim of the present study was to determine the roles of cellular and viral proteins in initial stages of entry, specifically fusion of the membranes of the mature virion and cell. For analysis of the role of cellular components, we used well characterized inhibitors and measured binding of a recombinant VACV virion containing Gaussia luciferase fused to a core protein; viral and cellular membrane lipid mixing with a self-quenching fluorescent probe in the virion membrane; and core entry with a recombinant VACV expressing firefly luciferase and electron microscopy. We determined that inhibitors of tyrosine protein kinases, dynamin GTPase and actin dynamics had little effect on binding of virions to cells but impaired membrane fusion, whereas partial cholesterol depletion and inhibitors of endosomal acidification and membrane blebbing had a severe effect at the later stage of core entry. To determine the role of viral proteins, virions lacking individual membrane components were purified from cells infected with members of a panel of ten conditional-lethal inducible mutants. Each of the entry protein-deficient virions had severely reduced infectivity and except for A28, L1 and L5 greatly impaired membrane fusion. In addition, a potent neutralizing L1 monoclonal antibody blocked entry at a post-membrane lipid-mixing step. Taken together, these results suggested a 2-step entry model and implicated an unprecedented number of viral proteins and cellular components involved in signaling and actin rearrangement for initiation of virus-cell membrane fusion during poxvirus entry.

  5. Mutations conferring resistance to viral DNA polymerase inhibitors in camelpox virus give different drug-susceptibility profiles in vaccinia virus.

    Science.gov (United States)

    Duraffour, Sophie; Andrei, Graciela; Topalis, Dimitri; Krečmerová, Marcela; Crance, Jean-Marc; Garin, Daniel; Snoeck, Robert

    2012-07-01

    Cidofovir or (S)-HPMPC is one of the three antiviral drugs that might be used for the treatment of orthopoxvirus infections. (S)-HPMPC and its 2,6-diaminopurine counterpart, (S)-HPMPDAP, have been described to select, in vitro, for drug resistance mutations in the viral DNA polymerase (E9L) gene of vaccinia virus (VACV). Here, to extend our knowledge of drug resistance development among orthopoxviruses, we selected, in vitro, camelpox viruses (CMLV) resistant to (S)-HPMPDAP and identified a single amino acid change, T831I, and a double mutation, A314V+A684V, within E9L. The production of recombinant CMLV and VACV carrying these amino acid substitutions (T831I, A314V, or A314V+A684V) demonstrated clearly their involvement in conferring reduced sensitivity to viral DNA polymerase inhibitors, including (S)-HPMPDAP. Both CMLV and VACV harboring the A314V change showed comparable drug-susceptibility profiles to various antivirals and similar impairments in viral growth. In contrast, the single change T831I and the double change A314V+A684V in VACV were responsible for increased levels of drug resistance and for cross-resistance to viral DNA polymerase antivirals that were not observed with their CMLV counterparts. Each amino acid change accounted for an attenuated phenotype of VACV in vivo. Modeling of E9L suggested that the T→I change at position 831 might abolish hydrogen bonds between E9L and the DNA backbone and have a direct impact on the incorporation of the acyclic nucleoside phosphonates. Our findings demonstrate that drug-resistance development in two related orthopoxvirus species may impact drug-susceptibility profiles and viral fitness differently.

  6. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  7. Vaccinia Virus Immunomodulator A46: A Lipid and Protein-Binding Scaffold for Sequestering Host TIR-Domain Proteins.

    Directory of Open Access Journals (Sweden)

    Sofiya Fedosyuk

    2016-12-01

    Full Text Available Vaccinia virus interferes with early events of the activation pathway of the transcriptional factor NF-kB by binding to numerous host TIR-domain containing adaptor proteins. We have previously determined the X-ray structure of the A46 C-terminal domain; however, the structure and function of the A46 N-terminal domain and its relationship to the C-terminal domain have remained unclear. Here, we biophysically characterize residues 1-83 of the N-terminal domain of A46 and present the X-ray structure at 1.55 Å. Crystallographic phases were obtained by a recently developed ab initio method entitled ARCIMBOLDO_BORGES that employs tertiary structure libraries extracted from the Protein Data Bank; data analysis revealed an all β-sheet structure. This is the first such structure solved by this method which should be applicable to any protein composed entirely of β-sheets. The A46(1-83 structure itself is a β-sandwich containing a co-purified molecule of myristic acid inside a hydrophobic pocket and represents a previously unknown lipid-binding fold. Mass spectrometry analysis confirmed the presence of long-chain fatty acids in both N-terminal and full-length A46; mutation of the hydrophobic pocket reduced the lipid content. Using a combination of high resolution X-ray structures of the N- and C-terminal domains and SAXS analysis of full-length protein A46(1-240, we present here a structural model of A46 in a tetrameric assembly. Integrating affinity measurements and structural data, we propose how A46 simultaneously interferes with several TIR-domain containing proteins to inhibit NF-κB activation and postulate that A46 employs a bipartite binding arrangement to sequester the host immune adaptors TRAM and MyD88.

  8. Safety and immunogenicity of novel recombinant BCG and modified vaccinia virus Ankara vaccines in neonate rhesus macaques.

    Science.gov (United States)

    Rosario, Maximillian; Fulkerson, John; Soneji, Shamit; Parker, Joe; Im, Eung-Jun; Borthwick, Nicola; Bridgeman, Anne; Bourne, Charles; Joseph, Joan; Sadoff, Jerald C; Hanke, Tomás

    2010-08-01

    Although major inroads into making antiretroviral therapy available in resource-poor countries have been made, there is an urgent need for an effective vaccine administered shortly after birth, which would protect infants from acquiring human immunodeficiency virus type 1 (HIV-1) through breast-feeding. Bacillus Calmette-Guérin (BCG) is given to most infants at birth, and its recombinant form could be used to prime HIV-1-specific responses for a later boost by heterologous vectors delivering the same HIV-1-derived immunogen. Here, two groups of neonate Indian rhesus macaques were immunized with either novel candidate vaccine BCG.HIVA(401) or its parental strain AERAS-401, followed by two doses of recombinant modified vaccinia virus Ankara MVA.HIVA. The HIVA immunogen is derived from African clade A HIV-1. All vaccines were safe, giving local reactions consistent with the expected response at the injection site. No systemic adverse events or gross abnormality was seen at necropsy. Both AERAS-401 and BCG.HIVA(401) induced high frequencies of BCG-specific IFN-gamma-secreting lymphocytes that declined over 23 weeks, but the latter failed to induce detectable HIV-1-specific IFN-gamma responses. MVA.HIVA elicited HIV-1-specific IFN-gamma responses in all eight animals, but, except for one animal, these responses were weak. The HIV-1-specific responses induced in infants were lower compared to historic data generated by the two HIVA vaccines in adult animals but similar to other recombinant poxviruses tested in this model. This is the first time these vaccines were tested in newborn monkeys. These results inform further infant vaccine development and provide comparative data for two human infant vaccine trials of MVA.HIVA.

  9. Intrarectal vaccination with recombinant vaccinia virus expressing carcinoembronic antigen induces mucosal and systemic immunity and prevents progression of colorectal cancer.

    Science.gov (United States)

    Kim-Schulze, Seunghee; Kim, Hong Sung; Wainstein, Alberto; Kim, Dae Won; Yang, Wein Cui; Moroziewicz, Dorota; Mong, Phyllus Y; Bereta, Michal; Taback, Bret; Wang, Qin; Kaufman, Howard L

    2008-12-01

    The gastrointestinal mucosa contains an intact immune system that protects the host from pathogens and communicates with the systemic immune system. Absorptive epithelial cells in the mucosa give rise to malignant tumors although the interaction between tumor cells and the mucosal immune system is not well defined. The pathophysiology of colorectal cancer has been elucidated through studies of hereditary syndromes, such as familial adenomatous polyposis, a cancer predisposition syndrome caused by germline mutations in the adenomatous polyposis coli tumor suppressor gene. Patients with FAP develop adenomas and inevitably progress to invasive carcinomas by the age of 40. To better delineate the role of mucosal immunity in colorectal cancer, we evaluated the efficacy of intrarectal recombinant vaccinia virus expressing the human carcinoembryonic Ag (CEA) in a murine FAP model in which mice are predisposed to colorectal cancer and also express human CEA in the gut. Mucosal vaccination reduced the incidence of spontaneous adenomas and completely prevented progression to invasive carcinoma. The therapeutic effects were associated with induction of mucosal CEA-specific IgA Ab titers and CD8(+) CTLs. Mucosal vaccination was also associated with an increase in systemic CEA-specific IgG Ab titers, CD4(+) and CD8(+) T cell responses and resulted in growth inhibition of s.c. implanted CEA-expressing tumors suggesting communication between mucosal and systemic immune compartments. Thus, intrarectal vaccination induces mucosal and systemic antitumor immunity and prevents progression of spontaneous colorectal cancer. These results have implications for the prevention of colorectal cancer in high-risk individuals.

  10. Peptide nucleic acid probe for protein affinity purification based on biotin-streptavidin interaction and peptide nucleic acid strand hybridization.

    Science.gov (United States)

    Tse, Jenny; Wang, Yuanyuan; Zengeya, Thomas; Rozners, Eriks; Tan-Wilson, Anna

    2015-02-01

    We describe a new method for protein affinity purification that capitalizes on the high affinity of streptavidin for biotin but does not require dissociation of the biotin-streptavidin complex for protein retrieval. Conventional reagents place both the selectively reacting group (the "warhead") and the biotin on the same molecule. We place the warhead and the biotin on separate molecules, each linked to a short strand of peptide nucleic acid (PNA), synthetic polymers that use the same bases as DNA but attached to a backbone that is resistant to attack by proteases and nucleases. As in DNA, PNA strands with complementary base sequences hybridize. In conditions that favor PNA duplex formation, the warhead strand (carrying the tagged protein) and the biotin strand form a complex that is held onto immobilized streptavidin. As in DNA, the PNA duplex dissociates at moderately elevated temperature; therefore, retrieval of the tagged protein is accomplished by a brief exposure to heat. Using iodoacetate as the warhead, 8-base PNA strands, biotin, and streptavidin-coated magnetic beads, we demonstrate retrieval of the cysteine protease papain. We were also able to use our iodoacetyl-PNA:PNA-biotin probe for retrieval and identification of a thiol reductase and a glutathione transferase from soybean seedling cotyledons. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Features of "All LNA" Duplexes Showing a New Type of Nucleic Acid Geometry.

    Science.gov (United States)

    Förster, Charlotte; Eichert, André; Oberthür, Dominik; Betzel, Christian; Geßner, Reinhard; Nitsche, Andreas; Fürste, Jens P

    2012-01-01

    "Locked nucleic acids" (LNAs) belong to the backbone-modified nucleic acid family. The 2'-O,4'-C-methylene-β-D-ribofuranose nucleotides are used for single or multiple substitutions in RNA molecules and thereby introduce enhanced bio- and thermostability. This renders LNAs powerful tools for diagnostic and therapeutic applications. RNA molecules maintain the overall canonical A-type conformation upon substitution of single or multiple residues/nucleotides by LNA monomers. The structures of "all" LNA homoduplexes, however, exhibit significant differences in their overall geometry, in particular a decreased twist, roll and propeller twist. This results in a widening of the major groove, a decrease in helical winding, and an enlarged helical pitch. Therefore, the LNA duplex structure can no longer be described as a canonical A-type RNA geometry but can rather be brought into proximity to other backbone-modified nucleic acids, like glycol nucleic acids or peptide nucleic acids. LNA-modified nucleic acids provide thus structural and functional features that may be successfully exploited for future application in biotechnology and drug discovery.

  12. Features of “All LNA” Duplexes Showing a New Type of Nucleic Acid Geometry

    Directory of Open Access Journals (Sweden)

    Charlotte Förster

    2012-01-01

    Full Text Available “Locked nucleic acids” (LNAs belong to the backbone-modified nucleic acid family. The 2′-O,4′-C-methylene-β-D-ribofuranose nucleotides are used for single or multiple substitutions in RNA molecules and thereby introduce enhanced bio- and thermostability. This renders LNAs powerful tools for diagnostic and therapeutic applications. RNA molecules maintain the overall canonical A-type conformation upon substitution of single or multiple residues/nucleotides by LNA monomers. The structures of “all” LNA homoduplexes, however, exhibit significant differences in their overall geometry, in particular a decreased twist, roll and propeller twist. This results in a widening of the major groove, a decrease in helical winding, and an enlarged helical pitch. Therefore, the LNA duplex structure can no longer be described as a canonical A-type RNA geometry but can rather be brought into proximity to other backbone-modified nucleic acids, like glycol nucleic acids or peptide nucleic acids. LNA-modified nucleic acids provide thus structural and functional features that may be successfully exploited for future application in biotechnology and drug discovery.

  13. Nucleic acid purification from plants, animals and microbes in under 30 seconds.

    Directory of Open Access Journals (Sweden)

    Yiping Zou

    2017-11-01

    Full Text Available Nucleic acid amplification is a powerful molecular biology tool, although its use outside the modern laboratory environment is limited due to the relatively cumbersome methods required to extract nucleic acids from biological samples. To address this issue, we investigated a variety of materials for their suitability for nucleic acid capture and purification. We report here that untreated cellulose-based paper can rapidly capture nucleic acids within seconds and retain them during a single washing step, while contaminants present in complex biological samples are quickly removed. Building on this knowledge, we have successfully created an equipment-free nucleic acid extraction dipstick methodology that can obtain amplification-ready DNA and RNA from plants, animals, and microbes from difficult biological samples such as blood and leaves from adult trees in less than 30 seconds. The simplicity and speed of this method as well as the low cost and availability of suitable materials (e.g., common paper towelling, means that nucleic acid extraction is now more accessible and affordable for researchers and the broader community. Furthermore, when combined with recent advancements in isothermal amplification and naked eye DNA visualization techniques, the dipstick extraction technology makes performing molecular diagnostic assays achievable in limited resource settings including university and high school classrooms, field-based environments, and developing countries.

  14. Logic gates and antisense DNA devices operating on a translator nucleic Acid scaffold.

    Science.gov (United States)

    Shlyahovsky, Bella; Li, Yang; Lioubashevski, Oleg; Elbaz, Johann; Willner, Itamar

    2009-07-28

    A series of logic gates, "AND", "OR", and "XOR", are designed using a DNA scaffold that includes four "footholds" on which the logic operations are activated. Two of the footholds represent input-recognition strands, and these are blocked by complementary nucleic acids, whereas the other two footholds are blocked by nucleic acids that include the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The logic gates are activated by either nucleic acid inputs that hybridize to the respective "footholds", or by low-molecular-weight inputs (adenosine monophosphate or cocaine) that yield the respective aptamer-substrate complexes. This results in the respective translocation of the blocking nucleic acids to the footholds carrying the HRP-mimicking DNAzyme sequence, and the concomitant release of the respective DNAzyme. The released product-strands then self-assemble into the hemin/G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. The principle of the logic operation is, then, implemented as a possible paradigm for future nanomedicine. The nucleic acid inputs that bind to the blocked footholds result in the translocation of the blocking nucleic acids to the respective footholds carrying the antithrombin aptamer. The released aptamer inhibits, then, the hydrolytic activity of thrombin. The system demonstrates the regulation of a biocatalytic reaction by a translator system activated on a DNA scaffold.

  15. Nucleic Acid Extraction from Synthetic Mars Analog Soils for in situ Life Detection

    Science.gov (United States)

    Mojarro, Angel; Ruvkun, Gary; Zuber, Maria T.; Carr, Christopher E.

    2017-08-01

    Biological informational polymers such as nucleic acids have the potential to provide unambiguous evidence of life beyond Earth. To this end, we are developing an automated in situ life-detection instrument that integrates nucleic acid extraction and nanopore sequencing: the Search for Extra-Terrestrial Genomes (SETG) instrument. Our goal is to isolate and determine the sequence of nucleic acids from extant or preserved life on Mars, if, for example, there is common ancestry to life on Mars and Earth. As is true of metagenomic analysis of terrestrial environmental samples, the SETG instrument must isolate nucleic acids from crude samples and then determine the DNA sequence of the unknown nucleic acids. Our initial DNA extraction experiments resulted in low to undetectable amounts of DNA due to soil chemistry-dependent soil-DNA interactions, namely adsorption to mineral surfaces, binding to divalent/trivalent cations, destruction by iron redox cycling, and acidic conditions. Subsequently, we developed soil-specific extraction protocols that increase DNA yields through a combination of desalting, utilization of competitive binders, and promotion of anaerobic conditions. Our results suggest that a combination of desalting and utilizing competitive binders may establish a "universal" nucleic acid extraction protocol suitable for analyzing samples from diverse soils on Mars.

  16. DSSR-enhanced visualization of nucleic acid structures in Jmol.

    Science.gov (United States)

    Hanson, Robert M; Lu, Xiang-Jun

    2017-05-03

    Sophisticated and interactive visualizations are essential for making sense of the intricate 3D structures of macromolecules. For proteins, secondary structural components are routinely featured in molecular graphics visualizations. However, the field of RNA structural bioinformatics is still lagging behind; for example, current molecular graphics tools lack built-in support even for base pairs, double helices, or hairpin loops. DSSR (Dissecting the Spatial Structure of RNA) is an integrated and automated command-line tool for the analysis and annotation of RNA tertiary structures. It calculates a comprehensive and unique set of features for characterizing RNA, as well as DNA structures. Jmol is a widely used, open-source Java viewer for 3D structures, with a powerful scripting language. JSmol, its reincarnation based on native JavaScript, has a predominant position in the post Java-applet era for web-based visualization of molecular structures. The DSSR-Jmol integration presented here makes salient features of DSSR readily accessible, either via the Java-based Jmol application itself, or its HTML5-based equivalent, JSmol. The DSSR web service accepts 3D coordinate files (in mmCIF or PDB format) initiated from a Jmol or JSmol session and returns DSSR-derived structural features in JSON format. This seamless combination of DSSR and Jmol/JSmol brings the molecular graphics of 3D RNA structures to a similar level as that for proteins, and enables a much deeper analysis of structural characteristics. It fills a gap in RNA structural bioinformatics, and is freely accessible (via the Jmol application or the JSmol-based website http://jmol.x3dna.org). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A modern mode of activation for nucleic acid enzymes.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    2007-07-01

    Full Text Available Through evolution, enzymes have developed subtle modes of activation in order to ensure the sufficiently high substrate specificity required by modern cellular metabolism. One of these modes is the use of a target-dependent module (i.e. a docking domain such as those found in signalling kinases. Upon the binding of the target to a docking domain, the substrate is positioned within the catalytic site. The prodomain acts as a target-dependent module switching the kinase from an off state to an on state. As compared to the allosteric mode of activation, there is no need for the presence of a third partner. None of the ribozymes discovered to date have such a mode of activation, nor does any other known RNA. Starting from a specific on/off adaptor for the hepatitis delta virus ribozyme, that differs but has a mechanism reminiscent of this signalling kinase, we have adapted this mode of activation, using the techniques of molecular engineering, to both catalytic RNAs and DNAs exhibiting various activities. Specifically, we adapted three cleaving ribozymes (hepatitis delta virus, hammerhead and hairpin ribozymes, a cleaving 10-23 deoxyribozyme, a ligating hairpin ribozyme and an artificially selected capping ribozyme. In each case, there was a significant gain in terms of substrate specificity. Even if this mode of control is unreported for natural catalytic nucleic acids, its use needs not be limited to proteinous enzymes. We suggest that the complexity of the modern cellular metabolism might have been an important selective pressure in this evolutionary process.

  18. Toward Complete Sequence Flexibility of Nucleic Acid Base Analogue FRET.

    Science.gov (United States)

    Wranne, Moa S; Füchtbauer, Anders Foller; Dumat, Blaise; Bood, Mattias; El-Sagheer, Afaf H; Brown, Tom; Gradén, Henrik; Grøtli, Morten; Wilhelmsson, L Marcus

    2017-07-12

    Förster resonance energy transfer (FRET) using fluorescent base analogues is a powerful means of obtaining high-resolution nucleic acid structure and dynamics information that favorably complements techniques such as NMR and X-ray crystallography. Here, we expand the base-base FRET repertoire with an adenine analogue FRET-pair. Phosphoramidite-protected quadracyclic 2'-deoxyadenosine analogues qAN1 (donor) and qAnitro (acceptor) were synthesized and incorporated into DNA by a generic, reliable, and high-yielding route, and both constitute excellent adenine analogues. The donor, qAN1, has quantum yields reaching 21% and 11% in single- and double-strands, respectively. To the best of our knowledge, this results in the highest average brightness of an adenine analogue inside DNA. Its potent emissive features overlap well with the absorption of qAnitro and thus enable accurate FRET-measurements over more than one turn of B-DNA. As we have shown previously for our cytosine analogue FRET-pair, FRET between qAN1 and qAnitro positioned at different base separations inside DNA results in efficiencies that are highly dependent on both distance and orientation. This facilitates significantly enhanced resolution in FRET structure determinations, demonstrated here in a study of conformational changes of DNA upon binding of the minor groove binder netropsin. Finally, we note that the donor and acceptor of our cytosine FRET-pair, tC(O) and tCnitro, can be conveniently combined with the acceptor and donor of our current adenine pair, respectively. Consequently, our base analogues can now measure base-base FRET between 3 of the 10 possible base combinations and, through base-complementarity, between all sequence positions in a duplex.

  19. Polarizable model potential function for nucleic acid bases.

    Science.gov (United States)

    Nakagawa, Setsuko

    2007-07-15

    A polarizable model potential (PMP) function for adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) is developed on the basis of ab initio molecular orbital calculations at the MP2/6-31+G* level. The PMP function consists of Coulomb, van der Waals, and polarization terms. The permanent atomic charges of the Coulomb term are determined by using electrostatic potential (ESP) optimization. The multicenter polarizabilities of the polarization term are determined by using polarized one-electron potential (POP) optimization in which the electron density changes induced by a test charge are target. Isotropic and anisotropic polarizabilities are adopted as the multicenter polarizabilities. In the PMP calculations using the optimized parameters, the interaction energies of Watson-Crick type A-T and C-G base pairs were -15.6 and -29.4 kcal/mol, respectively. The interaction energy of Hoogsteen type A-T base pair was -17.8 kcal/mol. These results reproduce well the quantum chemistry calculations at the MP2/6-311++G(3df,2pd) level within the differences of 0.6 kcal/mol. The stacking energies of A-T and C-G were -9.7 and -10.9 kcal/mol. These reproduce well the calculation results at the MP2/6-311++G (2d,2p) level within the differences of 1.3 kcal/mol. The potential energy surfaces of the system in which a sodium ion or a chloride ion is adjacent to the nucleic acid base are calculated. The interaction energies of the PMP function reproduced well the calculation results at the MP2/6-31+G* or MP2/6-311++G(2d,2p) level. The reason why the PMP function reproduces well the high-level quantum mechanical interaction energies is addressed from the viewpoint of each energy terms. Copyright (c) 2007 Wiley Periodicals, Inc.

  20. Highly Efficient Synthesis of Allopurinol Locked Nucleic Acid Monomer by C6 Deamination of 8-Aza-7-bromo-7-deazaadenine Locked Nucleic Acid Monomer

    DEFF Research Database (Denmark)

    Kosbar, Tamer Reda El-Saeed; Sofan, M.; Abou-Zeid, L.

    2013-01-01

    An allopurinol locked nucleic acid (LNA) monomer was prepared by a novel strategy through C6 deamination of the corresponding 8-aza-7-bromo-7-deazaadenine LNA monomer with aqueous sodium hydroxide. An 8-aza-7-deazaadenine LNA monomer was also synthesized by a modification of the new synthetic...... the required LNA monomers....