
Sample records for vaccinia virus morphogenesis

  1. Membrane remodelling during vaccinia virus morphogenesis. (United States)

    Chichón, Francisco Javier; Rodríguez, María Josefa; Risco, Cristina; Fraile-Ramos, Alberto; Fernández, José Jesús; Esteban, Mariano; Carrascosa, José L


    VACV (vaccinia virus) is one of the most complex viruses, with a size exceeding 300 nm and more than 100 structural proteins. Its assembly involves sequential interactions and important rearrangements of its structural components. We have used electron tomography of sections of VACV-infected cells to follow, in three dimensions, the remodelling of the membrane components of the virus during envelope maturation. The tomograms obtained suggest that a number of independent 'crescents' interact with each other to enclose the volume of an incomplete ellipsoid in the viral factory area, attaining the overall shape and size characteristic of the first immature form of the virus [IV (immature virus)]. The incorporation of the DNA into these forms leads to particles with a nucleoid [IVN (IV with nucleoid)] that results in local disorganization of the envelope in regions near the condensed DNA. These particles suffer the progressive disappearance of the membrane outer spikes with a change in the shape of the membrane, becoming locally curled. The transformation of the IVN into the mature virus involves an extreme rearrangement of the particle envelope, which becomes fragmented and undulated. During this process, we also observed connections between the outer membranes with internal ones, suggesting that the latter originate from internalization of the IV envelope. The main features observed for VACV membrane maturation during morphogenesis resemble the breakdown and reassembly of cellular endomembranes.

  2. Multiple phosphatidylinositol 3-kinases regulate vaccinia virus morphogenesis. (United States)

    McNulty, Shannon; Bornmann, William; Schriewer, Jill; Werner, Chas; Smith, Scott K; Olson, Victoria A; Damon, Inger K; Buller, R Mark; Heuser, John; Kalman, Daniel


    Poxvirus morphogenesis is a complex process that involves the successive wrapping of the virus in host cell membranes. We screened by plaque assay a focused library of kinase inhibitors for those that caused a reduction in viral growth and identified several compounds that selectively inhibit phosphatidylinositol 3-kinase (PI3K). Previous studies demonstrated that PI3Ks mediate poxviral entry. Using growth curves and electron microscopy in conjunction with inhibitors, we show that that PI3Ks additionally regulate morphogenesis at two distinct steps: immature to mature virion (IMV) transition, and IMV envelopment to form intracellular enveloped virions (IEV). Cells derived from animals lacking the p85 regulatory subunit of Type I PI3Ks (p85alpha(-/-)beta(-/-)) presented phenotypes similar to those observed with PI3K inhibitors. In addition, VV appear to redundantly use PI3Ks, as PI3K inhibitors further reduce plaque size and number in p85alpha(-/-)beta(-/-) cells. Together, these data provide evidence for a novel regulatory mechanism for virion morphogenesis involving phosphatidylinositol dynamics and may represent a new therapeutic target to contain poxviruses.

  3. Multiple phosphatidylinositol 3-kinases regulate vaccinia virus morphogenesis.

    Directory of Open Access Journals (Sweden)

    Shannon McNulty


    Full Text Available Poxvirus morphogenesis is a complex process that involves the successive wrapping of the virus in host cell membranes. We screened by plaque assay a focused library of kinase inhibitors for those that caused a reduction in viral growth and identified several compounds that selectively inhibit phosphatidylinositol 3-kinase (PI3K. Previous studies demonstrated that PI3Ks mediate poxviral entry. Using growth curves and electron microscopy in conjunction with inhibitors, we show that that PI3Ks additionally regulate morphogenesis at two distinct steps: immature to mature virion (IMV transition, and IMV envelopment to form intracellular enveloped virions (IEV. Cells derived from animals lacking the p85 regulatory subunit of Type I PI3Ks (p85alpha(-/-beta(-/- presented phenotypes similar to those observed with PI3K inhibitors. In addition, VV appear to redundantly use PI3Ks, as PI3K inhibitors further reduce plaque size and number in p85alpha(-/-beta(-/- cells. Together, these data provide evidence for a novel regulatory mechanism for virion morphogenesis involving phosphatidylinositol dynamics and may represent a new therapeutic target to contain poxviruses.

  4. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection. (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael


    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s(-1) , consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  5. An E2?F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection


    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael


    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 ?m s?1, consistent with...

  6. Tagging of the vaccinia virus protein F13 with mCherry causes aberrant virion morphogenesis. (United States)

    Carpentier, David C J; Hollinshead, Michael S; Ewles, Helen A; Lee, Stacey-Ann; Smith, Geoffrey L


    Vaccinia virus produces two distinct infectious virions; the single-enveloped intracellular mature virus (IMV), which remains in the cell until cell lysis, and the double-enveloped extracellular enveloped virus (EEV), which mediates virus spread. The latter is derived from a triple-enveloped intracellular enveloped virus (IEV) precursor, which is transported to the cell periphery by the kinesin-1 motor complex. This transport involves the viral protein A36 as well as F12 and E2. A36 is an integral membrane protein associated with the outer virus envelope and is the only known direct link between virion and kinesin-1 complex. Yet in the absence of A36 virion egress still occurs on microtubules, albeit at reduced efficiency. In this paper double-fluorescent labelling of the capsid protein A5 and outer-envelope protein F13 was exploited to visualize IEV transport by live-cell imaging in the absence of either A36 or F12. During the generation of recombinant viruses expressing both A5-GFP and F13-mCherry a plaque size defect was identified that was particularly severe in viruses lacking A36. Electron microscopy showed that this phenotype was caused by abnormal wrapping of IMV to form IEV, and this resulted in reduced virus egress to the cell surface. The aberrant wrapping phenotype suggests that the fluorescent fusion protein interferes with an interaction of F13 with the IMV surface that is required for tight association between IMVs and wrapping membranes. The severity of this defect suggests that these viruses are imperfect tools for characterizing virus egress.

  7. An E2–F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael


    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s−1, consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. PMID:19207726

  8. Vaccinia Virus Uses Retromer-Independent Cellular Retrograde Transport Pathways To Facilitate the Wrapping of Intracellular Mature Virions during Virus Morphogenesis (United States)

    Harrison, Kate; Haga, Ismar R.; Pechenick Jowers, Tali; Jasim, Seema; Cintrat, Jean-Christophe; Gillet, Daniel; Schmitt-John, Thomas; Digard, Paul


    ABSTRACT Poxviruses, such as vaccinia virus (VACV), undertake a complex cytoplasmic replication cycle which involves morphogenesis through four distinct virion forms and includes a crucial wrapping step whereby intracellular mature virions (IMVs) are wrapped in two additional membranes to form intracellular enveloped virions (IEVs). To determine if cellular retrograde transport pathways are required for this wrapping step, we examined VACV morphogenesis in cells with reduced expression of the tetrameric tethering factor known as the GARP (Golgi-associated retrograde pathway), a central component of retrograde transport. VACV multistep replication was significantly impaired in cells transfected with small interfering RNA targeting the GARP complex and in cells with a mutated GARP complex. Detailed analysis revealed that depletion of the GARP complex resulted in a reduction in the number of IEVs, thereby linking retrograde transport with the wrapping of IMVs. In addition, foci of viral wrapping membrane proteins without an associated internal core accumulated in cells with a mutated GARP complex, suggesting that impaired retrograde transport uncouples nascent IMVs from the IEV membranes at the site of wrapping. Finally, small-molecule inhibitors of retrograde transport strongly suppressed VACV multistep growth in vitro and reduced weight loss and clinical signs in an in vivo murine model of systemic poxviral disease. This work links cellular retrograde transport pathways with the morphogenesis of poxviruses and identifies a panel of novel inhibitors of poxvirus replication. IMPORTANCE Cellular retrograde transport pathways traffic cargo from endosomes to the trans-Golgi network and are a key part of the intracellular membrane network. This work reveals that the prototypic poxvirus vaccinia virus (VACV) exploits cellular retrograde transport pathways to facilitate the wrapping of intracellular mature virions and therefore promote the production of extracellular virus

  9. Vaccinia virus uses retromer-independent cellular retrograde transport pathways to facilitate the wrapping of intracellular mature virions during viral morphogenesis. (United States)

    Harrison, Kate; Haga, Ismar R; Pechenick Jowers, Tali; Jasim, Seema; Cintrat, Jean-Christophe; Gillet, Daniel; Schmitt-John, Thomas; Digard, Paul; Beard, Philippa M


    Poxviruses such as Vaccinia virus (VACV) undertake a complex cytoplasmic replication cycle which involves morphogenesis through four distinct virion forms, and includes a crucial "wrapping" step whereby intracellular mature virions (IMVs) are wrapped in two additional membranes to form intracellular enveloped virions (IEVs). To determine if cellular retrograde transport pathways were required for this wrapping step we examined VACV morphogenesis in cells with reduced expression of the tetrameric tethering factor complex GARP (Golgi-associated retrograde pathway complex), a central component of retrograde transport. VACV multi-step replication was significantly impaired in cells transfected with siRNA targeting the GARP complex or in cells with a mutated GARP complex. Detailed analysis revealed that depletion of the GARP complex resulted in a reduction in the number of IEVs, thereby linking retrograde transport with the wrapping of IMVs. In addition foci of viral wrapping membrane proteins without an associated internal core accumulated in cells with a mutated GARP complex, suggesting that impaired retrograde transport uncouples nascent IMVs from the IEV membranes at the site of wrapping. Finally, small molecule inhibitors of retrograde transport strongly suppressed VACV multi-step growth in vitro and reduced weight loss and clinical signs in an in vivo murine model of systemic poxviral disease. This work links cellular retrograde transport pathways with morphogenesis of poxviruses and identifies a panel of novel inhibitors of poxvirus replication. Cellular retrograde transport pathways traffic cargo from endosomes to the trans-Golgi network and are a key part of the intracellular membrane network. This work reveals the prototypic poxvirus Vaccinia virus (VACV) exploits cellular retrograde transport pathways to facilitate the wrapping of intracellular mature virions and therefore promote the production of extracellular virus. Inhibition of retrograde transport by

  10. Deletion of the Vaccinia Virus I2 Protein Interrupts Virion Morphogenesis, Leading to Retention of the Scaffold Protein and Mislocalization of Membrane-Associated Entry Proteins. (United States)

    Hyun, Seong-In; Weisberg, Andrea; Moss, Bernard


    The I2L open reading frame of vaccinia virus (VACV) encodes a conserved 72-amino-acid protein with a putative C-terminal transmembrane domain. Previous studies with a tetracycline-inducible mutant demonstrated that I2-deficient virions are defective in cell entry. The purpose of the present study was to determine the step of replication or entry that is affected by loss of the I2 protein. Fluorescence microscopy experiments showed that I2 colocalized with a major membrane protein of immature and mature virions. We generated a cell line that constitutively expressed I2 and allowed construction of the VACV I2L deletion mutant vΔI2. As anticipated, vΔI2 was unable to replicate in cells that did not express I2. Unexpectedly, morphogenesis was interrupted at a stage after immature virion formation, resulting in the accumulation of dense spherical particles instead of brick-shaped mature virions with well-defined core structures. The abnormal particles retained the D13 scaffold protein of immature virions, were severely deficient in the transmembrane proteins that comprise the entry fusion complex (EFC), and had increased amounts of unprocessed membrane and core proteins. Total lysates of cells infected with vΔI2 also had diminished EFC proteins due to instability attributed to their hydrophobicity and failure to be inserted into viral membranes. A similar instability of EFC proteins had previously been found with unrelated mutants blocked earlier in morphogenesis that also accumulated viral membranes retaining the D13 scaffold. We concluded that I2 is required for virion morphogenesis, release of the D13 scaffold, and the association of EFC proteins with viral membranes.IMPORTANCE Poxviruses comprise a large family that infect vertebrates and invertebrates, cause disease in both in humans and in wild and domesticated animals, and are being engineered as vectors for vaccines and cancer therapy. In addition, investigations of poxviruses have provided insights into many

  11. Vaccinia virus as an expression vector. (United States)

    Talavera, A; Rodriguez, J M


    Vaccinia virus (Vv) is a member of the genus Orthopoxvirus, one of seven genera included in the family Poxviridae. Most of these viruses infect vertebrates (Orthopoxvirus, Avipoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Parapoxvirus), but one genus, Entomopoxvirus, infects insects. It is interesting to note that the Fibroma and Mixoma viruses of the leporipoxvirus genus cause tumors in their hosts (rabbits), these being the only tumorigenic viruses in the family (1,2).

  12. Brazilian Vaccinia Viruses and Their Origins

    Centers for Disease Control (CDC) Podcasts


    Smallpox was eradicated more than 25 years ago, but live viruses used in vaccines may have survived to cause animal and human illness today. Dr. Inger Damon, Acting Branch Chief of the Poxvirus and Rabies Branch at CDC, discusses efforts to determine origins and spread of vaccinia viruses in Brazil.  Created: 7/30/2007 by Emerging Infectious Diseases.   Date Released: 7/30/2007.

  13. Susceptibility of Vaccinia Virus to Chemical Disinfectants (United States)

    de Oliveira, Tércia Moreira Ludolfo; Rehfeld, Izabelle Silva; Coelho Guedes, Maria Isabel Maldonado; Ferreira, Jaqueline Maria Siqueira; Kroon, Erna Geessien; Lobato, Zélia Inês Portela


    Vaccinia virus (VACV) is the cause of bovine vaccinia (BV), an emerging zoonotic disease that affects dairy cows and milkers. Some chemical disinfectants have been used on farms affected by BV to disinfect cow teats and milkers' hands. To date, there is no information about the efficacy of disinfectants against VACV. Therefore, this study aimed to assess the virucidal activity of some active disinfectants commonly used in the field. Sodium hypochlorite, quaternary ammonium combined with chlorhexidine, and quaternary ammonium combined with glutaraldehyde were effective in inactivating the virus at all concentrations tested. Iodine and quaternary ammonium as the only active component were partially effective. The presence of bovine feces as organic matter and light decreased the effectiveness of sodium hypochlorite. These results show that an appropriated disinfection and asepsis of teats and hands may be helpful in the control and prevention of BV and other infections with VACV. PMID:21734141

  14. Vaccinia virus, a promising new therapeutic agent for pancreatic cancer. (United States)

    Al Yaghchi, Chadwan; Zhang, Zhongxian; Alusi, Ghassan; Lemoine, Nicholas R; Wang, Yaohe


    The poor prognosis of pancreatic cancer patients signifies a need for radically new therapeutic strategies. Tumor-targeted oncolytic viruses have emerged as attractive therapeutic candidates for cancer treatment due to their inherent ability to specifically target and lyse tumor cells as well as induce antitumor effects by multiple action mechanisms. Vaccinia virus has several inherent features that make it particularly suitable for use as an oncolytic agent. In this review, we will discuss the potential of vaccinia virus in the management of pancreatic cancer in light of our increased understanding of cellular and immunological mechanisms involved in the disease process as well as our extending knowledge in the biology of vaccinia virus.

  15. The vaccinia virus E6 protein influences virion protein localization during virus assembly

    Energy Technology Data Exchange (ETDEWEB)

    Condit, Richard C., E-mail:; Moussatche, Nissin


    Vaccinia virus mutants in which expression of the virion core protein gene E6R is repressed are defective in virion morphogenesis. E6 deficient infections fail to properly package viroplasm into viral membranes, resulting in an accumulation of empty immature virions and large aggregates of viroplasm. We have used immunogold electron microscopy and immunofluorescence confocal microscopy to assess the intracellular localization of several virion structural proteins and enzymes during E6R mutant infections. We find that during E6R mutant infections virion membrane proteins and virion transcription enzymes maintain a normal localization within viral factories while several major core and lateral body proteins accumulate in aggregated virosomes. The results support a model in which vaccinia virions are assembled from at least three substructures, the membrane, the viroplasm and a “pre-nucleocapsid”, and that the E6 protein is essential for maintaining proper localization of the seven-protein complex and the viroplasm during assembly. - Highlights: • Mutation of E6 disrupts association of viral membranes with viral core proteins • Mutation of E6 does not perturb viral membrane biosynthesis • Mutation of E6 does not perturb localization of viral transcription enzymes • Mutation of E6 causes mis-localization and aggregation of viral core proteins • Vaccinia assembly uses three subassemblies: membranes, viroplasm, prenucleocapsid.

  16. Vaccinia Virus Infections in a Martial Arts Gym

    Centers for Disease Control (CDC) Podcasts


    This podcast discusses an outbreak of vaccinia virus in Maryland in 2008. Christine Hughes, a health scientist with the Poxvirus and Rabies Branch at CDC, and co-author of a paper in the April 2011 issue of CDC's journal, discusses vaccinia virus infections in a martial arts gym.  Created: 4/4/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/5/2011.

  17. Incongruencies in Vaccinia Virus Phylogenetic Trees

    Directory of Open Access Journals (Sweden)

    Chad Smithson


    Full Text Available Over the years, as more complete poxvirus genomes have been sequenced, phylogenetic studies of these viruses have become more prevalent. In general, the results show similar relationships between the poxvirus species; however, some inconsistencies are notable. Previous analyses of the viral genomes contained within the vaccinia virus (VACV-Dryvax vaccine revealed that their phylogenetic relationships were sometimes clouded by low bootstrapping confidence. To analyze the VACV-Dryvax genomes in detail, a new tool-set was developed and integrated into the Base-By-Base bioinformatics software package. Analyses showed that fewer unique positions were present in each VACV-Dryvax genome than expected. A series of patterns, each containing several single nucleotide polymorphisms (SNPs were identified that were counter to the results of the phylogenetic analysis. The VACV genomes were found to contain short DNA sequence blocks that matched more distantly related clades. Additionally, similar non-conforming SNP patterns were observed in (1 the variola virus clade; (2 some cowpox clades; and (3 VACV-CVA, the direct ancestor of VACV-MVA. Thus, traces of past recombination events are common in the various orthopoxvirus clades, including those associated with smallpox and cowpox viruses.

  18. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  19. Cryo-electron tomography of vaccinia virus (United States)

    Cyrklaff, Marek; Risco, Cristina; Fernández, Jose Jesús; Jiménez, Maria Victoria; Estéban, Mariano; Baumeister, Wolfgang; Carrascosa, José L.


    The combination of cryo-microscopy and electron tomographic reconstruction has allowed us to determine the structure of one of the more complex viruses, intracellular mature vaccinia virus, at a resolution of 4–6 nm. The tomographic reconstruction allows us to dissect the different structural components of the viral particle, avoiding projection artifacts derived from previous microscopic observations. A surface-rendering representation revealed brick-shaped viral particles with slightly rounded edges and dimensions of ≈360 × 270 × 250 nm. The outer layer was consistent with a lipid membrane (5–6 nm thick), below which usually two lateral bodies were found, built up by a heterogeneous material without apparent ordering or repetitive features. The internal core presented an inner cavity with electron dense coils of presumptive DNA–protein complexes, together with areas of very low density. The core was surrounded by two layers comprising an overall thickness of ≈18–19 nm; the inner layer was consistent with a lipid membrane. The outer layer was discontinuous, formed by a periodic palisade built by the side interaction of T-shaped protein spikes that were anchored in the lower membrane and were arranged into small hexagonal crystallites. It was possible to detect a few pore-like structures that communicated the inner side of the core with the region outside the layer built by the T-shaped spike palisade. PMID:15699328

  20. In vitro recognition of an orf virus early promoter in a vaccinia virus extract

    NARCIS (Netherlands)

    Vos, J C; Mercer, R. A.; Fleming, S B; Robinson, A J


    DNA fragments containing varying lengths of the 5' end of an orf virus early gene (ORF3) and its associated promoter were introduced into sodium deoxycholate-solubilized vaccinia virus extracts capable of initiating transcription in vitro from vaccinia virus early promoters. After separation of the

  1. Vaccinia virus as a subhelper for AAV replication and packaging

    Directory of Open Access Journals (Sweden)

    Andrea R Moore

    Full Text Available Adeno-associated virus (AAV has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  2. Vaccinia virus as a subhelper for AAV replication and packaging. (United States)

    Moore, Andrea R; Dong, Biao; Chen, Lingxia; Xiao, Weidong


    Adeno-associated virus (AAV) has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV) has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  3. Modified vaccinia virus Ankara protects macaques against respiratory challenge with monkeypox virus.

    NARCIS (Netherlands)

    K.J. Stittelaar (Koert); G. van Amerongen (Geert); I. Kondova (Ivanela); R.F. van Lavieren (Rob); F.H. Pistoor (Frank); H.G.M. Niesters (Bert); G.J.J. van Doornum (Gerard); B.A.M. van der Zeijst (Ben); L. Mateo (Luis); P.J. Chaplin (Paul); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)


    textabstractThe use of classical smallpox vaccines based on vaccinia virus (VV) is associated with severe complications in both naive and immune individuals. Modified vaccinia virus Ankara (MVA), a highly attenuated replication-deficient strain of VV, has been proven to be safe in humans and

  4. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice. (United States)

    Andrew, M E


    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34.

  5. Vaccinia virus encodes a polypeptide with DNA ligase activity. (United States)

    Kerr, S M; Smith, G L


    Vaccinia virus gene SalF 15R potentially encodes a polypeptide of 63 kD which shares 30% amino acid identity with S. pombe and S. cerevisiae DNA ligases. DNA ligase proteins can be identified by incubation with alpha-(32P)ATP, resulting in the formation of a covalent DNA ligase-AMP adduct, an intermediate in the enzyme reaction. A novel radio-labelled polypeptide of approximately 61 kD appears in extracts from vaccinia virus infected cells after incubation with alpha-(32P)ATP. This protein is present throughout infection and is a DNA ligase as the radioactivity is discharged in the presence of either DNA substrate or pyrophosphate. DNA ligase assays show an increase in enzyme activity in cell extracts after vaccinia virus infection. A rabbit antiserum, raised against a bacterial fusion protein of beta-galactosidase and a portion of SalF 15R, immune-precipitates polypeptides of 61 and 54 kD from extracts of vaccinia virus-infected cells. This antiserum also immune-precipitates the novel DNA ligase-AMP adduct, thus proving that the observed DNA ligase is encoded by SalF 15R.

  6. Morphogenesis and release of fowlpox virus. (United States)

    Boulanger, D; Smith, T; Skinner, M A


    Release of fowlpox virus (FWPV) as extracellular enveloped virus (EEV) appears to proceed both by the budding of intracellular mature virus (IMV) through the plasma membrane and by the fusion of intracellular enveloped virus (IEV) with the plasma membrane. Based on the frequency of budding events compared to wrapping events observed by electron microscopy, FWPV FP9 strain seems to exit chick embryo fibroblast cells predominantly by budding. In contrast to vaccinia virus (VV), the production of FWPV extracellular virus particles is not affected by N(1)-isonicotinoyl-N(2)-3-methyl-4-chlorobenzoylhydrazine (IMCBH). Comparison of the sequence of the VV F13L gene product with its FWPV orthologue showed a mutation, in the fowlpox protein, at the residue involved in IMCBH resistance in a mutant VV. Glucosamine, monensin or brefeldin A did not have any specific effect on FWPV extracellular virus production. Cytochalasin D, which inhibits the formation of actin filaments, reduces the production of extracellular virus particles by inhibiting the release of cell-associated enveloped virus (CEV) particles from the plasma membrane. Involvement of actin filaments in this mechanism is further supported by the co-localization of actin with viral particles close to the plasma membrane in the absence of cytochalasin D. Actin is also co-localized with virus factories.

  7. Cytoplasmic ATR Activation Promotes Vaccinia Virus Genome Replication

    Directory of Open Access Journals (Sweden)

    Antonio Postigo


    Full Text Available In contrast to most DNA viruses, poxviruses replicate their genomes in the cytoplasm without host involvement. We find that vaccinia virus induces cytoplasmic activation of ATR early during infection, before genome uncoating, which is unexpected because ATR plays a fundamental nuclear role in maintaining host genome integrity. ATR, RPA, INTS7, and Chk1 are recruited to cytoplasmic DNA viral factories, suggesting canonical ATR pathway activation. Consistent with this, pharmacological and RNAi-mediated inhibition of canonical ATR signaling suppresses genome replication. RPA and the sliding clamp PCNA interact with the viral polymerase E9 and are required for DNA replication. Moreover, the ATR activator TOPBP1 promotes genome replication and associates with the viral replisome component H5. Our study suggests that, in contrast to long-held beliefs, vaccinia recruits conserved components of the eukaryote DNA replication and repair machinery to amplify its genome in the host cytoplasm.

  8. Isolation and characterization of cidofovir resistant vaccinia viruses

    Directory of Open Access Journals (Sweden)

    Prichard Mark N


    Full Text Available Abstract Background The emergence of drug resistant viruses, together with the possibility of increased virulence, is an important concern in the development of new antiviral compounds. Cidofovir (CDV is a phosphonate nucleotide that is approved for use against cytomegalovirus retinitis and for the emergency treatment of smallpox or complications following vaccination. One mode of action for CDV has been demonstrated to be the inhibition of the viral DNA polymerase. Results We have isolated several CDV resistant (CDVR vaccinia viruses through a one step process, two of which have unique single mutations within the DNA polymerase. An additional resistant virus isolate provides evidence of a second site mutation within the genome involved in CDV resistance. The CDVR viruses were 3–7 fold more resistant to the drug than the parental viruses. The virulence of the CDVR viruses was tested in mice inoculated intranasally and all were found to be attenuated. Conclusion Resistance to CDV in vaccinia virus can be conferred individually by at least two different mutations within the DNA polymerase gene. Additional genes may be involved. This one step approach for isolating resistant viruses without serial passage and in the presence of low doses of drug minimizes unintended secondary mutations and is applicable to other potential antiviral agents.

  9. Protection from rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene.


    Wiktor, T. J.; Macfarlan, R I; Reagan, K J; Dietzschold, B; Curtis, P. J.; Wunner, W. H.; Kieny, M P; Lathe, R; Lecocq, J P; Mackett, M.


    Inoculation of rabbits and mice with a vaccinia-rabies glycoprotein recombinant (V-RG) virus resulted in rapid induction of high concentrations of rabies virus-neutralizing antibodies and protection from severe intracerebral challenge with several strains of rabies virus. Protection from virus challenge also was achieved against the rabies-related Duvenhage virus but not against the Mokola virus. Effective immunization by V-RG depended on the expression of a rabies glycoprotein that registere...

  10. Retrograde Transport from Early Endosomes to the trans-Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions. (United States)

    Sivan, Gilad; Weisberg, Andrea S; Americo, Jeffrey L; Moss, Bernard


    . Interference with wrapping or subsequent steps results in severe attenuation of the virus. Some previous studies had suggested that the wrapping membrane arises from the trans-Golgi network, whereas others suggested an origin from early endosomes. Some nonenveloped viruses use retrograde trafficking for entry into the cell. In contrast, we provided evidence that retrograde transport from early endosomes to the trans-Golgi network is required for the membrane-wrapping step in morphogenesis of vaccinia virus and egress from the cell. The potent in vitro inhibition of this step by the drug Retro-2 suggests that derivatives with enhanced pharmacological properties might serve as useful antipoxviral agents. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. The mechanisms of genetically modified vaccinia viruses for the treatment of cancer. (United States)

    Jefferson, Artrish; Cadet, Valerie E; Hielscher, Abigail


    The use of oncolytic viruses for the treatment of cancer is an emerging field of cancer research and therapy. Oncolytic viruses are designed to induce tumor specific immunity while replicating selectively within cancer cells to cause lysis of the tumor cells. While there are several forms of oncolytic viruses, the use of vaccinia viruses for oncolysis may be more beneficial than other forms of oncolytic viruses. For example, vaccinia viruses have been shown to exert their anti-tumor effects through genetic engineering strategies which enhance their therapeutic efficacy. This paper will address some of the most common forms of genetically modified vaccinia viruses and will explore the mechanisms whereby they selectively target, enter and destroy cancer cells. Furthermore, this review will highlight how vaccinia viruses activate host immune responses against cancer cells and will address clinical trials evaluating the tumor-directed and killing efficacy of these viruses against solid tumors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Low-resolution structure of vaccinia virus DNA replication machinery. (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas


    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  13. Analysis of variola and vaccinia virus neutralization assays for smallpox vaccines. (United States)

    Hughes, Christine M; Newman, Frances K; Davidson, Whitni B; Olson, Victoria A; Smith, Scott K; Holman, Robert C; Yan, Lihan; Frey, Sharon E; Belshe, Robert B; Karem, Kevin L; Damon, Inger K


    Possible smallpox reemergence drives research for third-generation vaccines that effectively neutralize variola virus. A comparison of neutralization assays using different substrates, variola and vaccinia (Dryvax and modified vaccinia Ankara [MVA]), showed significantly different 90% neutralization titers; Dryvax underestimated while MVA overestimated variola neutralization. Third-generation vaccines may rely upon neutralization as a correlate of protection.

  14. Immune Modulation in Primary Vaccinia virus Zoonotic Human Infections

    Directory of Open Access Journals (Sweden)

    Juliana Assis Silva Gomes


    Full Text Available In 2010, the WHO celebrated the 30th anniversary of the smallpox eradication. Ironically, infections caused by viruses related to smallpox are being increasingly reported worldwide, including Monkeypox, Cowpox, and Vaccinia virus (VACV. Little is known about the human immunological responses elicited during acute infections caused by orthopoxviruses. We have followed VACV zoonotic outbreaks taking place in Brazil and analyzed cellular immune responses in patients acutely infected by VACV. Results indicated that these patients show a biased immune modulation when compared to noninfected controls. Amounts of B cells are low and less activated in infected patients. Although present, T CD4+ cells are also less activated when compared to noninfected individuals, and so are monocytes/macrophages. Similar results were obtained when Balb/C mice were experimentally infected with a VACV sample isolated during the zoonotic outbreaks. Taking together, the data suggest that zoonotic VACVs modulate specific immune cell compartments during an acute infection in humans.

  15. Protection of Mice from Lethal Vaccinia Virus Infection by Vaccinia Virus Protein Subunits with a CpG Adjuvant

    Directory of Open Access Journals (Sweden)

    Sarah Reeman


    Full Text Available Smallpox vaccination carries a high risk of adverse events in recipients with a variety of contra-indications for live vaccines. Although alternative non-replicating vaccines have been described in the form of replication-deficient vaccine viruses, DNA vaccines, and subunit vaccines, these are less efficacious than replicating vaccines in animal models. DNA and subunit vaccines in particular have not been shown to give equivalent protection to the traditional replicating smallpox vaccine. We show here that combinations of the orthopoxvirus A27, A33, B5 and L1 proteins give differing levels of protection when administered in different combinations with different adjuvants. In particular, the combination of B5 and A27 proteins adjuvanted with CpG oligodeoxynucleotides (ODN gives a level of protection in mice that is equivalent to the Lister traditional vaccine in a lethal vaccinia virus challenge model.

  16. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin

    National Research Council Canada - National Science Library

    Jones-Trower, Agnes; Garcia, Alonzo; Meseda, Clement A; He, Yong; Weiss, Carol; Kumar, Arunima; Weir, Jerry P; Merchlinsky, Michael


    Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain...

  17. Modulation of the Myxoma Virus Plaque Phenotype by Vaccinia Virus Protein F11


    Irwin, Chad R; Evans, David H.


    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments...

  18. Assembly of vaccinia virus: Role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks

    NARCIS (Netherlands)

    Sodeik, B.; Doms, R.W.; Ericsson, M.; Hiller, G.; Machamer, C.E.; van 't Hof, W.J.; van Meer, G.|info:eu-repo/dai/nl/068570368; Moss, B.; Griffiths, G.


    Vaccinia virus, the prototype of the Poxviridae, is a large DNA virus which replicates in the cytoplasm of the host cell. The assembly pathway of vaccinia virus displays several unique features, such as the production of two structurally distinct, infectious forms. One of these, termed intracellular

  19. Live-Cell Imaging of Vaccinia Virus Recombination.

    Directory of Open Access Journals (Sweden)

    Patrick Paszkowski


    Full Text Available Recombination between co-infecting poxviruses provides an important mechanism for generating the genetic diversity that underpins evolution. However, poxviruses replicate in membrane-bound cytoplasmic structures known as factories or virosomes. These are enclosed structures that could impede DNA mixing between co-infecting viruses, and mixing would seem to be essential for this process. We hypothesize that virosome fusion events would be a prerequisite for recombination between co-infecting poxviruses, and this requirement could delay or limit viral recombination. We have engineered vaccinia virus (VACV to express overlapping portions of mCherry fluorescent protein fused to a cro DNA-binding element. In cells also expressing an EGFP-cro fusion protein, this permits live tracking of virus DNA and genetic recombination using confocal microscopy. Our studies show that different types of recombination events exhibit different timing patterns, depending upon the relative locations of the recombining elements. Recombination between partly duplicated sequences is detected soon after post-replicative genes are expressed, as long as the reporter gene sequences are located in cis within an infecting genome. The same kinetics are also observed when the recombining elements are divided between VACV and transfected DNA. In contrast, recombination is delayed when the recombining sequences are located on different co-infecting viruses, and mature recombinants aren't detected until well after late gene expression is well established. The delay supports the hypothesis that factories impede inter-viral recombination, but even after factories merge there remain further constraints limiting virus DNA mixing and recombinant gene assembly. This delay could be related to the continued presence of ER-derived membranes within the fused virosomes, membranes that may once have wrapped individual factories.

  20. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)


    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  1. Human CD4+ T cell epitopes from vaccinia virus induced by vaccination or infection.

    Directory of Open Access Journals (Sweden)

    J Mauricio Calvo-Calle


    Full Text Available Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4(+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4(+ T cell responses have been poorly characterized, and CD4(+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens.

  2. Human CD4+ T Cell Epitopes from Vaccinia Virus Induced by Vaccination or Infection (United States)

    Calvo-Calle, J. Mauricio; Strug, Iwona; Nastke, Maria-Dorothea; Baker, Stephen P; Stern, Lawrence J


    Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4+ T cell responses have been poorly characterized, and CD4+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens. PMID:17937498

  3. Doxycycline Inducible Melanogenic Vaccinia Virus as Theranostic Anti-Cancer Agent. (United States)

    Kirscher, Lorenz; Deán-Ben, Xosé Luis; Scadeng, Miriam; Zaremba, Angelika; Zhang, Qian; Kober, Christina; Fehm, Thomas Felix; Razansky, Daniel; Ntziachristos, Vasilis; Stritzker, Jochen; Szalay, Aladar A


    We reported earlier the diagnostic potential of a melanogenic vaccinia virus based system in magnetic resonance (MRI) and optoacoustic deep tissue imaging (MSOT). Since melanin overproduction lead to attenuated virus replication, we constructed a novel recombinant vaccinia virus strain (rVACV), GLV-1h462, which expressed the key enzyme of melanogenesis (tyrosinase) under the control of an inducible promoter-system. In this study melanin production was detected after exogenous addition of doxycycline in two different tumor xenograft mouse models. Furthermore, it was confirmed that this novel vaccinia virus strain still facilitated signal enhancement as detected by MRI and optoacoustic tomography. At the same time we demonstrated an enhanced oncolytic potential compared to the constitutively melanin synthesizing rVACV system.

  4. Vaccinia Virus Recombinants: Expression of VSV Genes and Protective Immunization of Mice and Cattle (United States)

    Mackett, M.; Yilma, T.; Rose, J. K.; Moss, B.


    Vesicular stomatitis virus (VSV) causes a contagious disease of horses, cattle, and pigs. When DNA copies of messenger RNA's for the G or N proteins of VSV were linked to a vaccinia virus promoter and inserted into the vaccinia genome, the recombinants retained infectivity and synthesized VSV polypeptides. After intradermal vaccination with live recombinant virus expressing the G protein, mice produced VSV-neutralizing antibodies and were protected against lethal encephalitis upon intravenous challenge with VSV. In cattle, the degree of protection against intradermalingually injected VSV was correlated with the level of neutralizing antibody produced following vaccination.

  5. Derepression of a novel class of vaccinia virus genes upon DNA replication

    NARCIS (Netherlands)

    Vos, J C; Stunnenberg, H.G.


    A novel class of vaccinia virus genes, called intermediate, is expressed immediately post-replication and prior to the onset of late gene transcription. Intermediate transcription is dependent on trans-acting factors which are present in an active state in virus-infected cells prior to the onset of

  6. Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector

    NARCIS (Netherlands)

    Bernards, R.A.; Destree, A.; McKenzie, S.; Gordon, E.; Weinberg, R.A.; Panicali, D.


    We have constructed a vaccinia virus recombinant that expresses the extracellular domain of the rat neu oncogene-encoded protein, a 185-kDa transmembrane glycoprotein termed p185. Strain NFS mice immunized with this recombinant virus developed a strong antibody response against the neu oncogene

  7. Myxoma and vaccinia viruses bind differentially to human leukocytes. (United States)

    Chan, Winnie M; Bartee, Eric C; Moreb, Jan S; Dower, Ken; Connor, John H; McFadden, Grant


    Myxoma virus (MYXV) and vaccinia virus (VACV), two distinct members of the family Poxviridae, are both currently being developed as oncolytic virotherapeutic agents. Recent studies have demonstrated that ex vivo treatment with MYXV can selectively recognize and kill contaminating cancerous cells from autologous bone marrow transplants without perturbing the engraftment of normal CD34(+) hematopoietic stem and progenitor cells. However, the mechanism(s) by which MYXV specifically recognizes and eliminates the cancer cells in the autografts is not understood. While little is known about the cellular attachment factor(s) exploited by MYXV for entry into any target cells, VACV has been shown to utilize cell surface glycosaminoglycans such as heparan sulfate (HS), the extracellular matrix protein laminin, and/or integrin β1. We have constructed MYXV and VACV virions tagged with the Venus fluorescent protein and compared their characteristics of binding to various human cancer cell lines as well as to primary human leukocytes. We report that the binding of MYXV or VACV to some adherent cell lines could be partially inhibited by heparin, but laminin blocked only VACV binding. In contrast to cultured fibroblasts, the binding of MYXV and VACV to a wide spectrum of primary human leukocytes could not be competed by either HS or laminin. Additionally, MYXV and VACV exhibited very different binding characteristics against certain select human leukocytes, suggesting that the two poxviruses utilize different cell surface determinants for the attachment to these cells. These results indicate that VACV and MYXV can exhibit very different oncolytic tropisms against some cancerous human leukocytes.

  8. Can vaccinia virus be replaced by MVA virus for testing virucidal activity of chemical disinfectants?

    Directory of Open Access Journals (Sweden)

    Rapp Ingrid


    Full Text Available Abstract Background Vaccinia virus strain Lister Elstree (VACV is a test virus in the DVV/RKI guidelines as representative of the stable enveloped viruses. Since the potential risk of laboratory-acquired infections with VACV persists and since the adverse effects of vaccination with VACV are described, the replacement of VACV by the modified vaccinia Ankara strain (MVA was studied by testing the activity of different chemical biocides in three German laboratories. Methods The inactivating properties of different chemical biocides (peracetic acid, aldehydes and alcohols were tested in a quantitative suspension test according to the DVV/RKI guideline. All tests were performed with a protein load of 10% fetal calf serum with both viruses in parallel using different concentrations and contact times. Residual virus was determined by endpoint dilution method. Results The chemical biocides exhibited similar virucidal activity against VACV and MVA. In three cases intra-laboratory differences were determined between VACV and MVA - 40% (v/v ethanol and 30% (v/v isopropanol are more active against MVA, whereas MVA seems more stable than VACV when testing with 0.05% glutardialdehyde. Test accuracy across the three participating laboratories was high. Remarkably inter-laboratory differences in the reduction factor were only observed in two cases. Conclusions Our data provide valuable information for the replacement of VACV by MVA for testing chemical biocides and disinfectants. Because MVA does not replicate in humans this would eliminate the potential risk of inadvertent inoculation with vaccinia virus and disease in non-vaccinated laboratory workers.

  9. Effects of poliovirus 2A(pro) on vaccinia virus gene expression. (United States)

    Feduchi, E; Aldabe, R; Novoa, I; Carrasco, L


    The effects of transient expression of poliovirus 2A(pro) on p220 cleavage in COS cells have been analyzed. When 2A(pro) was cloned in plasmid pTM1 and transiently expressed in COS cells, efficient cleavage of p220 occurred after infection of these cells with a recombinant vaccinia virus bearing phage T7 RNA polymerase. High numbers of COS cells were transfected with pTM1-2A, as judged by p220 cleavage, thereby allowing an analysis of the effects of poliovirus 2A(pro) on vaccinia virus gene expression. A 40-50% cleavage of p220 by transfected poliovirus 2A(pro) was observed ten hours post infection and cleavage was almost complete (80-90%) 20-25 hours post infection with vaccinia virus. Profound inhibition of vaccinia virus protein synthesis was detectable ten hours post infection and was maximal 20-25 hours post infection. This inhibition resulted from neither a blockade of transcription of vaccinia virus nor a lack of translatability of the mRNAs present in cells that synthesize poliovirus 2A(pro). Addition of ara-C inhibited the replication of vaccinia virus and allowed the continued synthesis of cellular proteins. Under these conditions, 2A(pro) is expressed and blocks cellular translation. Finally, p220 cleavage by 2A(pro) did not inhibit the translation of a mRNA encoding poliovirus protein 2C, as directed by the 5' leader sequences of encephalomiocarditis virus. Therefore, these findings show a correlation between p220 cleavage and inhibition of translation from newly made mRNAs. Our results are discussed in the light of present knowledge of p220 function, and new approaches are considered that might provide further insights into the function(s) of initiation factor eIF-4F.

  10. Horizontal study of vaccinia virus infections in an endemic area: epidemiologic, phylogenetic and economic aspects. (United States)

    Assis, Felipe L; Franco-Luiz, Ana Paula M; Paim, Luis M; Oliveira, Graziele P; Pereira, Alexandre F; de Almeida, Gabriel M F; Figueiredo, Leandra B; Tanus, Adriano; Trindade, Giliane S; Ferreira, Paulo P; Kroon, Erna G; Abrahão, Jônatas S


    Vaccinia virus (VACV), the etiological agent of bovine vaccinia (BV), is widespread in Brazil and present in most of the milk-producing regions. We conducted a horizontal study of BV in Bahia, a state of Brazil in which the production of milk is increasing. During 2011, human and bovine clinical samples were collected during outbreaks for BV diagnosis, virus isolation and molecular analysis. We collected data for epidemiological inferences. Vaccinia virus was detected in 87.7% of the analyzed outbreaks, highlighting the effective circulation of VACV in Bahia. The molecular data showed the spreading of group 1 Brazilian VACV to Bahia. We observed a seasonal profile of BV, with its peak in the drier and cooler season. Manual milking was observed in 96 % of the visited properties, showing its importance to viral spread in herds. Under-notification of BV, ineffective animal trade surveillance, and bad milking practices have contributed to the spread of VACV in Brazil.

  11. Use of a recombinant vaccinia virus expressing interferon gamma for post-exposure protection against vaccinia and ectromelia viruses.

    Directory of Open Access Journals (Sweden)

    Susan A Holechek

    Full Text Available Post-exposure vaccination with vaccinia virus (VACV has been suggested to be effective in minimizing death if administered within four days of smallpox exposure. While there is anecdotal evidence for efficacy of post-exposure vaccination this has not been definitively studied in humans. In this study, we analyzed post-exposure prophylaxis using several attenuated recombinant VACV in a mouse model. A recombinant VACV expressing murine interferon gamma (IFN-γ was most effective for post-exposure protection of mice infected with VACV and ectromelia virus (ECTV. Untreated animals infected with VACV exhibited severe weight loss and morbidity leading to 100% mortality by 8 to 10 days post-infection. Animals treated one day post-infection had milder symptoms, decreased weight loss and morbidity, and 100% survival. Treatment on days 2 or 3 post-infection resulted in 40% and 20% survival, respectively. Similar results were seen in ECTV-infected mice. Despite the differences in survival rates in the VACV model, the viral load was similar in both treated and untreated mice while treated mice displayed a high level of IFN-γ in the serum. These results suggest that protection provided by IFN-γ expressed by VACV may be mediated by its immunoregulatory activities rather than its antiviral effects. These results highlight the importance of IFN-γ as a modulator of the immune response for post-exposure prophylaxis and could be used potentially as another post-exposure prophylaxis tool to prevent morbidity following infection with smallpox and other orthopoxviruses.

  12. The development of a monolith-based purification process for Orthopoxvirus vaccinia virus Lister strain. (United States)

    Vincent, David; Kramberger, Petra; Hudej, Rosana; Štrancar, Aleš; Wang, Yaohe; Zhou, Yuhong; Velayudhan, Ajoy


    The purification of large viruses remains an important field of research and development. The development of efficient purification trains is restricted by limited analytical methods, as well as by the complexity of large viruses, as well as the high variability in starting material from cell culture. Vaccinia virus holds great potential as an oncolytic and immunotherapeutic vaccine against a broad spectrum of cancers. In this work, monolith-based capture and polishing chromatographic steps for vaccinia virus Lister strain has been developed. Virus produced in CV-1 cells was harvested and passed through a 0.8μm pre-filter before loading onto CIEX, AIEX and HIC CIM monoliths. Without the need for nuclease treatment, up to 99% of the total DNA loaded can be removed from the vaccinia feed stream by the CIM OH monolith, which also reduces the total protein concentration in the product pool to LLOQ levels, and achieves infectious virus recoveries of 90%. Binding capacities of greater than 1×109pfu of vaccinia per mL of matrix were obtained on both CIM SO3 and CIM OH monoliths. Multiple orthogonal analytical methods have been used to develop process knowledge and understanding. Copyright © 2017. Published by Elsevier B.V.

  13. Mutations Conferring Resistance to Viral DNA Polymerase Inhibitors in Camelpox Virus Give Different Drug-Susceptibility Profiles in Vaccinia Virus

    Czech Academy of Sciences Publication Activity Database

    Duraffour, S.; Andrei, G.; Topalis, D.; Krečmerová, Marcela; Crance, J. M.; Garin, D.; Snoeck, R.


    Roč. 86, č. 13 (2012), s. 7310-7325 ISSN 0022-538X Institutional support: RVO:61388963 Keywords : camelpox virus * CMLV * vaccinia virus VACV * acyclic nucleoside phosphonates * HPMPDAP * cidofovir * drug resistance Subject RIV: CC - Organic Chemistry Impact factor: 5.076, year: 2012

  14. Chemical inactivation of recombinant vaccinia viruses and the effects on antigenicity and immunogenicity of recombinant simian immunodeficiency virus envelope glycoproteins.

    NARCIS (Netherlands)

    E.G.J. Hulskotte (Ellen); M.E.M. Dings (Marlinda); S.G. Norley (Stephen); A.D.M.E. Osterhaus (Albert)


    textabstractThe efficiency of paraformaldehyde (PFA) and binary ethylenimine (BEI) in inactivating recombinant vaccinia virus (rVV), present in baby hamster kidney cells expressing simian immunodeficiency virus envelope glycoproteins (SIV-Env), was measured in a series of inactivation studies. Both

  15. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens

    NARCIS (Netherlands)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Pijlman, Gorben P.


    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious

  16. Efficacy and Safety of Doubly-Regulated Vaccinia Virus in a Mouse Xenograft Model of Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Muneyoshi Futami


    Full Text Available Multiple myeloma is a malignancy of plasma cells of the bone marrow. Although the prognosis is variable, no curative therapy has been defined. Vaccinia virus infects cancer cells and kills such cells in a variety of ways. These include direct infection, triggering of immunomediated cell death, and vascular collapse. The potential of the vaccinia virus as an anti-tumor therapy has attracted the attention of oncologists. Interestingly, our preliminary experiments revealed that myeloma cells were particularly susceptible to vaccinia virus. To exploit this susceptibility and to render vaccinia more myeloma specific, we generated thymidine-kinase-deleted microRNA (miRNA-regulated vaccinia viruses in which the essential viral gene B5R was regulated by miRNAs of normal human cells. Of the miRNAs examined, let-7a was found to be the most reliable in terms of regulating viral transmission. Exposure to unregulated vaccinia virus killed myeloma-transplanted severe combined immunodeficiency (SCID mice; the animals succumbed to viral toxicity. In contrast, the thymidine-kinase-deleted let-7a-regulated virus remained localized within myeloma cells, triggering tumor regression and improving overall survival. In conclusion, a thymidine-kinase-deleted let-7a-regulated vaccinia virus was safe and effective for mice, warranting clinical trials in humans.

  17. Lack of efficacy of aurintricarboxylic acid and ethacrynic acid against vaccinia virus respiratory infections in mice. (United States)

    Smee, Donald F; Hurst, Brett L; Wong, Min-Hui


    Aurintricarboxylic acid (ATA) and ethacrynic acid (ECA) have been reported to exhibit antiviral activity against vaccinia virus infections in cell culture by inhibiting early and late gene transcription, respectively. The purpose of this work was to determine if these inhibitors would effectively treat vaccinia virus infections in mice, which has not previously been studied. ECA was investigated by cell culture plaque reduction assay for the inhibition of cowpox and vaccinia virus infections to clarify issues regarding its potency and selectivity. Mice infected intranasally with vaccinia virus were treated by intraperitoneal route twice daily for 5 days with ATA (10 and 30 mg/kg/day) and ECA (15 and 30 mg/kg/day) or once daily for 2 days with cidofovir (100 mg/kg/day). ECA caused 50% inhibition of virus plaque formation at 20-79 muM in four cultured cell lines, with 50% cytotoxicity at 84-173 muM, giving low (1.3-4.2) selectivity index values. Preliminary toxicity tests in uninfected mice indicated that ATA and ECA were both overtly toxic at 100 mg/kg/day. No protection from mortality was afforded by treatment of vaccinia virus infections with ATA or ECA, but 100% survival was achieved in the cidofovir group. ATA- and ECA-treated mice died significantly sooner than placebo-treated animals, indicating that these compounds exacerbated the infection. Both ATA and ECA lack antiviral potency and selectivity in cell culture. The compounds were ineffective in treating mice at intraperitoneal doses of

  18. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Czech Academy of Sciences Publication Activity Database

    Žurková, K.; Hainz, P.; Kryštofová, J.; Kutinová, L.; Šanda, Miloslav; Němečková, Š.


    Roč. 7, č. 1 (2010), 109/1-109/15 ISSN 1743-422X Institutional research plan: CEZ:AV0Z40550506 Keywords : vaccinia virus * antibodies * virulence Subject RIV: CE - Biochemistry Impact factor: 2.546, year: 2010

  19. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation


    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael


    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in...

  20. Modulation of the myxoma virus plaque phenotype by vaccinia virus protein F11. (United States)

    Irwin, Chad R; Evans, David H


    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments that promote VACV exit and spread. This suggested that although MYXV carries homologs of the required genes (A33R, A34R, A36R, and B5R), they are dysfunctional. To test this, we produced MYXV recombinants expressing these genes, but we could not enhance actin projectile formation even in cells expressing all four VACV proteins. Another notable difference between these viruses is that MYXV lacks a homolog of the F11L gene. F11 inhibits the RhoA-mDia signaling that maintains the integrity of the cortical actin layer. We constructed an MYXV strain encoding F11L and observed that, unlike wild-type MYXV, the recombinant virus disrupted actin stress fibers and produced plaques up to 4-fold larger than those of controls, and these plaques expanded ∼6-fold faster. These viruses also grew to higher titers in multistep growth conditions, produced higher levels of actin projectiles, and promoted infected cell movement, although neither process was to the extent of that observed in VACV-infected cells. Thus, one reason for why MYXV produces small plaques is that it cannot spread via actin filaments, although the reason for this deficiency remains obscure. A second reason is that leporipoxviruses lack vaccinia's capacity to disrupt cortical actin.

  1. Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes▿


    Husain, Matloob; Weisberg, Andrea S.; Moss, Bernard


    The primary membrane of vaccinia virus, as well as those of other poxviruses, forms within a discrete cytoplasmic factory region. We recently determined the existence of an operative pathway from the endoplasmic reticulum within the virus factory to nascent viral membranes and demonstrated that a viral protein could be diverted from this pathway to Golgi membranes by the addition of COPII-binding sites (M. Husain, A. S. Weisberg, and B. Moss, Proc. Natl. Acad. Sci. USA, 103:19506-19511, 2006)...

  2. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Bedognetti Davide


    Full Text Available Abstract Background Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. Methods In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. Results We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Conclusions Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection.

  3. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains

    Directory of Open Access Journals (Sweden)

    Byrd Chelsea M


    Full Text Available Abstract As an approach to initiating a structure-function analysis of the vaccinia virus I7L core protein proteinase, a collection of conditional-lethal mutants in which the mutation had been mapped to the I7L locus were subjected to genomic sequencing and phenotypic analyses. Mutations in six vaccinia virus I7L temperature sensitive mutants fall into two groups: changes at three positions at the N-terminal end between amino acids 29 and 37 and two different substitutions at amino acid 344, near the catalytic domain. Regardless of the position of the mutation, mutants at the non-permissive temperature failed to cleave core protein precursors and had their development arrested prior to core condensation. Thus it appears that the two clusters of mutations may affect two different functional domains required for proteinase activity.

  4. Vectores recombinantes basados en el virus Vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis


    Pérez Jiménez, Eva; Larraga, Vicente; Esteban, Mariano


    Vectores recombinantes basados en el virus vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis. Los vectores de la invención contienen secuencias codificantes de la proteína LACK, preferentemente insertadas en el locus de hemaglutinina del virus y bajo el control de un promotor que permite su expresión a lo largo del ciclo de infección del virus. Son vectores seguros, estables, que dan lugar a una potente respuesta inmune que confiere protección frente a la leishmaniasis,...

  5. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  6. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Felipe L Assis

    Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

  7. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Directory of Open Access Journals (Sweden)

    Sanda Miloslav


    Full Text Available Abstract Background Vaccinia virus, one of the best known members of poxvirus family, has a wide host range both in vivo and in vitro. The expression of Flt3 ligand (FL by recombinant vaccinia virus (rVACV highly influenced properties of the virus in dependence on the level of expression. Results High production of FL driven by the strong synthetic promoter decreased the growth of rVACV in macrophage cell line J774.G8 in vitro as well as its multiplication in vivo when inoculated in mice. The inhibition of replication in vivo was mirrored in low levels of antibodies against vaccinia virus (anti-VACV which nearly approached to the negative serum level in non-infected mice. Strong FL expression changed not only the host range of the recombinant but also the basic protein contents of virions. The major proteins - H3L and D8L - which are responsible for the virus binding to the cells, and 28 K protein that serves as a virulence factor, were changed in the membrane portion of P13-E/L-FL viral particles. The core virion fraction contained multiple larger, uncleaved proteins and a higher amount of cellular proteins compared to the control virus. The overexpression of FL also resulted in its incorporation into the viral core of P13-E/L-FL IMV particles. In contrary to the equimolar ratio of glycosylated and nonglycosylated FL forms found in cells transfected with the expression plasmid, the recombinant virus incorporated mainly the smaller, nonglycosylated FL. Conclusions It has been shown that the overexpression of the Flt3L gene in VACV results in the attenuation of the virus in vivo.

  8. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development. (United States)

    Volz, A; Sutter, G


    Safety tested Modified Vaccinia virus Ankara (MVA) is licensed as third-generation vaccine against smallpox and serves as a potent vector system for development of new candidate vaccines against infectious diseases and cancer. Historically, MVA was developed by serial tissue culture passage in primary chicken cells of vaccinia virus strain Ankara, and clinically used to avoid the undesirable side effects of conventional smallpox vaccination. Adapted to growth in avian cells MVA lost the ability to replicate in mammalian hosts and lacks many of the genes orthopoxviruses use to conquer their host (cell) environment. As a biologically well-characterized mutant virus, MVA facilitates fundamental research to elucidate the functions of poxvirus host-interaction factors. As extremely safe viral vectors MVA vaccines have been found immunogenic and protective in various preclinical infection models. Multiple recombinant MVA currently undergo clinical testing for vaccination against human immunodeficiency viruses, Mycobacterium tuberculosis or Plasmodium falciparum. The versatility of the MVA vector vaccine platform is readily demonstrated by the swift development of experimental vaccines for immunization against emerging infections such as the Middle East Respiratory Syndrome. Recent advances include promising results from the clinical testing of recombinant MVA-producing antigens of highly pathogenic avian influenza virus H5N1 or Ebola virus. This review summarizes our current knowledge about MVA as a unique strain of vaccinia virus, and discusses the prospects of exploiting this virus as research tool in poxvirus biology or as safe viral vector vaccine to challenge existing and future bottlenecks in vaccinology. © 2017 Elsevier Inc. All rights reserved.

  9. Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9. (United States)

    Deng, Lili; Fan, Jun; Guo, Mingming; Huang, Biao


    Targeted oncolytic vaccinia viruses are being developed as a novel strategy in cancer therapy. Arming vaccinia viruses with immunostimulatory cytokines can enhance antitumor efficacy. Such engineered oncolytic viruses, like JX-594, a Wyeth strain vaccinia virus modified with human granulocyte-macrophage colony-stimulating factor (GM-CSF), have shown promising results and have proceeded rapidly in clinical trials. However, the oncolytic potential of the Chinese vaccine strain Tian Tan (VTT) has not been explored. In this study, we constructed a targeted oncolytic vaccinia virus of Tian Tan strain Guang9 (VG9) expressing murine GM-CSF (VG9-GMCSF) and evaluated the antitumor effect of this recombinant vaccinia virus in a murine melanoma model. In vitro, viral replication and cytotoxicity of VG9-GMCSF was as potent as VG9; in vivo, VG9-GMCSF significantly inhibited the growth of subcutaneously implanted melanoma tumors, prolonged the survival of tumor-bearing mice, and produced an antitumor cytotoxic response. Such antitumor effect may be due to the lytic nature of virus as well as the stimulation of immune activity by GM-CSF production. Our results indicate that VG9-GMCSF induces strong tumoricidal activity, providing a potential therapeutic strategy for combating cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. The role of signalling and the cytoskeleton during Vaccinia Virus egress. (United States)

    Leite, Flavia; Way, Michael


    Viruses are obligate intracellular parasites that are critically dependent on their hosts to replicate and generate new progeny. To achieve this goal, viruses have evolved numerous elegant strategies to subvert and utilise the different cellular machineries and processes of their unwilling hosts. Moreover, they often accomplish this feat with a surprisingly limited number of proteins. Among the different systems of the cell, the cytoskeleton is often one of the first to be hijacked as it provides a convenient transport system for viruses to reach their site of replication with relative ease. At the latter stages of their replication cycle, the cytoskeleton also provides an efficient means for newly assembled viral progeny to reach the plasma membrane and leave the infected cell. In this review we discuss how Vaccinia virus takes advantage of the microtubule and actin cytoskeletons of its host to promote the spread of infection into neighboring cells. In particular, we highlight how analysis of actin-based motility of Vaccinia has provided unprecedented insights into how a phosphotyrosine-based signalling network is assembled and functions to stimulate Arp2/3 complex-dependent actin polymerization. We also suggest that the formin FHOD1 promotes actin-based motility of the virus by capping the fast growing ends of actin filaments rather than directly promoting filament assembly. We have come a long way since 1976, when electron micrographs of vaccinia-infected cells implicated the actin cytoskeleton in promoting viral spread. Nevertheless, there are still many unanswered questions concerning the role of signalling and the host cytoskeleton in promoting viral spread and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.


    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.

  12. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  13. Review of Vaccinia Virus and Baculovirus Viability Versus Virucides (United States)


    40- or 6-min exposures to a germicidal lamp (254 nm), virus suspended in water containing an additive, either India ink , charcoal , brewer’s yeast...yeast extract, peptonized milk, I.M.C. protectant, soy hydrolyzate, brilliant yellow stain, red ink , or autoclaved crude suspension of virus-killed...insects retained at least 75% of original virus activity. Yeast extract, India ink , I.M.C. protectant and India ink + Plyac provided the greatest UV

  14. Cambios en virus vaccinia durante la síntesis de RNA in vitro

    Directory of Open Access Journals (Sweden)

    Julio Enrique Ospina


    Full Text Available Observaciones al microscopio electrónico de virus vaccinia previamente incubados en una mezcla para la reacción de RNA polimerasa in vitro, demuestran características alteraciones morfológicas en los virus. Estructuras similares a vesículas y ocasionalmente túbulos se formaron a partir de la membrana externa del virus. Uno de los sustituyentes de la reacción de RNA polimerasa in vitro, mercaptoetanol 0.007M, es el causante de esta alteración. El cambio morfológico se acompaña de pérdida de la infectividad viral. La presencia de grupos sulfhidrilo en la mezcla de la reacción enzimática es esencial para la ocurrencia de la síntesis de RNA de vaccinia in vitro. Esta condición no se pudo sustituir por choque térmico a 70C. ni por digestión parcial del virus por tripsina. Una gran variedad de compuestos con grupos sulfhidrilo pueden reemplazar el mercaptoetanol con efectividad variable. El más activo de ellos fué el ditiotreitol. Un período de latencia de 8 minutos ocurre entre la adición de vaccinia a la mezcla completa para la reacción de RNA polimerasa y la detección de síntesis de RNA. Los datos recolectados sugieren que cambios dependientes del mercaptoetanol ocurren durante este período.

  15. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Directory of Open Access Journals (Sweden)

    Dana Haddad


    Full Text Available Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy.

  16. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36. (United States)

    Johnston, Sara C; Ward, Brian M


    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress.

  17. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery (United States)

    Haddad, Dana


    Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV) strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy. PMID:28589082

  18. Oral immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein recombinant virus vaccine.


    Rupprecht, C. E.; Wiktor, T. J.; Johnston, D H; Hamir, A. N.; Dietzschold, B; Wunner, W. H.; Glickman, L T; Koprowski, H


    Animal rabies control has been frustrated by the existence of multiple wildlife reservoirs and the lack of efficacious oral vaccines. In this investigation, raccoons fed a vaccinia-rabies glycoprotein recombinant virus in a sponge bait developed rabies virus-neutralizing antibody (0.6-54.0 units) and resisted street rabies virus infection 28 and 205 days after feeding. Additional raccoons immunized by oral infusion with attenuated antigenic variants of rabies virus strains CVS-11 and ERA fail...

  19. Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus. (United States)

    Aldabe, R; Feduchi, E; Novoa, I; Carrasco, L


    Poliovirus protease 2A cleaves p220, a component of initiation factor eIF-4F. Polyclonal antibodies that recognize p220 and the cleaved products from different species have been raised. Transfection of several cell lines with poliovirus 2Apro cloned in different plasmids leads to efficient cleavage of p220 upon infection with VT7, a recombinant vaccinia virus that expresses the T7 RNA polymerase. Under these conditions vaccinia virus protein synthesis is severely inhibited, while expression of poliovirus protein 2C from a similar plasmid has no effect. These results show by the first time the effects of p220 cleavage on vaccinia virus translation in the infected cells.

  20. RNAi Screening Reveals Proteasome- and Cullin3-Dependent Stages in Vaccinia Virus Infection

    Directory of Open Access Journals (Sweden)

    Jason Mercer


    Full Text Available A two-step, automated, high-throughput RNAi silencing screen was used to identify host cell factors required during vaccinia virus infection. Validation and analysis of clustered hits revealed previously unknown processes during virus entry, including a mechanism for genome uncoating. Viral core proteins were found to be already ubiquitinated during virus assembly. After entering the cytosol of an uninfected cell, the viral DNA was released from the core through the activity of the cell’s proteasomes. Next, a Cullin3-based ubiquitin ligase mediated a further round of ubiquitination and proteasome action. This was needed in order to initiate viral DNA replication. The results accentuate the value of large-scale RNAi screens in providing directions for detailed cell biological investigation of complex pathways. The list of cell functions required during poxvirus infection will, moreover, provide a resource for future virus-host cell interaction studies and for the discovery of antivirals.

  1. Thy1+ Nk Cells from Vaccinia Virus-Primed Mice Confer Protection against Vaccinia Virus Challenge in the Absence of Adaptive Lymphocytes (United States)

    Gillard, Geoffrey O.; Bivas-Benita, Maytal; Hovav, Avi-Hai; Grandpre, Lauren E.; Panas, Michael W.; Seaman, Michael S.; Haynes, Barton F.; Letvin, Norman L.


    While immunological memory has long been considered the province of T- and B- lymphocytes, it has recently been reported that innate cell populations are capable of mediating memory responses. We now show that an innate memory immune response is generated in mice following infection with vaccinia virus, a poxvirus for which no cognate germline-encoded receptor has been identified. This immune response results in viral clearance in the absence of classical adaptive T and B lymphocyte populations, and is mediated by a Thy1+ subset of natural killer (NK) cells. We demonstrate that immune protection against infection from a lethal dose of virus can be adoptively transferred with memory hepatic Thy1+ NK cells that were primed with live virus. Our results also indicate that, like classical immunological memory, stronger innate memory responses form in response to priming with live virus than a highly attenuated vector. These results demonstrate that a defined innate memory cell population alone can provide host protection against a lethal systemic infection through viral clearance. PMID:21829360

  2. CD69 Deficiency Enhances the Host Response to Vaccinia Virus Infection through Altered NK Cell Homeostasis. (United States)

    Notario, Laura; Alari-Pahissa, Elisenda; de Molina, Antonio; Lauzurica, Pilar


    During the host response to viral infection, the transmembrane CD69 protein is highly upregulated in all immune cells. We have studied the role of CD69 in the murine immune response to vaccinia virus (VACV) infection, and we report that the absence of CD69 enhances protection against VACV at both short and long times postinfection in immunocompetent and immunodeficient mice. Natural killer (NK) cells were implicated in the increased infection control, since the differences were greatly diminished when NK cells were depleted. This role of NK cells was not based on an altered NK cell reactivity, since CD69 did not affect the NK cell activation threshold in response to major histocompatibility complex class I NK cell targets or protein kinase C activation. Instead, NK cell numbers were increased in the spleen and peritoneum of CD69-deficient infected mice. That was not just secondary to better infection control in CD69-deficient mice, since NK cell numbers in the spleens and the blood of uninfected CD69(-/-) mice were already augmented. CD69-deficient NK cells from infected mice did not have an altered proliferation capacity. However, a lower spontaneous cell death rate was observed for CD69(-/-) lymphocytes. Thus, our results suggest that CD69 limits the innate immune response to VACV infection at least in part through cell homeostatic survival. We show that increased natural killer (NK) cell numbers augment the host response and survival after infection with vaccinia virus. This phenotype is found in the absence of CD69 in immunocompetent and immunodeficient hosts. As part of the innate immune system, NK lymphocytes are activated and participate in the defense against infection. Several studies have focused on the contribution of NK cells to protection against infection with vaccinia virus. In this study, it was demonstrated that the augmented early NK cell response in the absence of CD69 is responsible for the increased protection seen during infection with

  3. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246

    Directory of Open Access Journals (Sweden)

    Earl R. Kern


    Full Text Available Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  4. Vaccinia Virus Natural Infections in Brazil: The Good, the Bad, and the Ugly

    Directory of Open Access Journals (Sweden)

    Jaqueline Silva de Oliveira


    Full Text Available The orthopoxviruses (OPV comprise several emerging viruses with great importance to human and veterinary medicine, including vaccinia virus (VACV, which causes outbreaks of bovine vaccinia (BV in South America. Historically, VACV is the most comprehensively studied virus, however, its origin and natural hosts remain unknown. VACV was the primary component of the smallpox vaccine, largely used during the smallpox eradication campaign. After smallpox was declared eradicated, the vaccination that conferred immunity to OPV was discontinued, favoring a new contingent of susceptible individuals to OPV. VACV infections occur naturally after direct contact with infected dairy cattle, in recently vaccinated individuals, or through alternative routes of exposure. In Brazil, VACV outbreaks are frequently reported in rural areas, affecting mainly farm animals and humans. Recent studies have shown the role of wildlife in the VACV transmission chain, exploring the role of wild rodents as reservoirs that facilitate VACV spread throughout rural areas. Furthermore, VACV circulation in urban environments and the significance of this with respect to public health, have also been explored. In this review, we discuss the history, epidemiological, ecological and clinical aspects of natural VACV infections in Brazil, also highlighting alternative routes of VACV transmission, the factors involved in susceptibility to infection, and the natural history of the disease in humans and animals, and the potential for dissemination to urban environments.

  5. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246. (United States)

    Quenelle, Debra C; Kern, Earl R


    Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  6. Whole cell cryo-electron tomography reveals distinct disassembly intermediates of vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Marek Cyrklaff

    Full Text Available At each round of infection, viruses fall apart to release their genome for replication, and then reassemble into stable particles within the same host cell. For most viruses, the structural details that underlie these disassembly and assembly reactions are poorly understood. Cryo-electron tomography (cryo-ET, a unique method to investigate large and asymmetric structures at the near molecular resolution, was previously used to study the complex structure of vaccinia virus (VV. Here we study the disassembly of VV by cryo-ET on intact, rapidly frozen, mammalian cells, infected for up to 60 minutes. Binding to the cell surface induced distinct structural rearrangements of the core, such as a shape change, the rearrangement of its surface spikes and de-condensation of the viral DNA. We propose that the cell surface induced changes, in particular the decondensation of the viral genome, are a prerequisite for the subsequent release of the vaccinia DNA into the cytoplasm, which is followed by its cytoplasmic replication. Generally, this is the first study that employs whole cell cryo-ET to address structural details of pathogen-host cell interaction.

  7. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques. (United States)

    Burgers, Wendy A; Ginbot, Zekarias; Shen, Yen-Ju; Chege, Gerald K; Soares, Andreia P; Müller, Tracey L; Bunjun, Rubina; Kiravu, Agano; Munyanduki, Henry; Douglass, Nicola; Williamson, Anna-Lise


    Poxvirus vectors represent promising human immunodeficiency virus (HIV) vaccine candidates and were a component of the only successful HIV vaccine efficacy trial to date. We tested the immunogenicity of a novel recombinant capripoxvirus vector, lumpy skin disease virus (LSDV), in combination with modified vaccinia Ankara (MVA), both expressing genes from HIV-1. Here, we demonstrated that the combination regimen was immunogenic in rhesus macaques, inducing high-magnitude, broad and balanced CD4(+) and CD8(+) T-cell responses, and transient activation of the immune response. These studies support further development of LSDV as a vaccine vector. © 2014 The Authors.

  8. Rapid detection of anti-Vaccinia virus neutralizing antibodies

    Directory of Open Access Journals (Sweden)

    Lichtfuss Gregor F


    Full Text Available Abstract Increasing infections with Monkeypox and Cowpox viruses pose a continuous and growing threat to human health. The standard method for detecting poxvirus neutralizing antibodies is the plaque-reduction neutralization test that is specific but also time-consuming and laborious. Therefore, a rapid and reliable method was developed to determine neutralizing antibody titers within twelve hours. The new assay measures viral mRNA transcription as a marker for actively replicating virus after incomplete neutralization using real-time PCR.

  9. A novel high-throughput vaccinia virus neutralization assay and preexisting immunity in populations from different geographic regions in China.

    Directory of Open Access Journals (Sweden)

    Qiang Liu

    Full Text Available BACKGROUND: Pre-existing immunity to Vaccinia Tian Tan virus (VTT resulting from a large vaccination campaign against smallpox prior to the early 1980s in China, has been a major issue for application of VTT-vector based vaccines. It is essential to establish a sensitive and high-throughput neutralization assay to understand the epidemiology of Vaccinia-specific immunity in current populations in China. METHODOLOGY/PRINCIPAL FINDINGS: A new anti-Vaccinia virus (VACV neutralization assay that used the attenuated replication-competent VTT carrying the firefly luciferase gene of Photinus pyralis (rTV-Fluc was established and standardized for critical parameters that included the choice of cell line, viral infection dose, and the infection time. The current study evaluated the maintenance of virus-specific immunity after smallpox vaccination by conducting a non-randomized, cross-sectional analysis of antiviral antibody-mediated immune responses in volunteers examined 30-55 years after vaccination. The rTV-Fluc neutralization assay was able to detect neutralizing antibodies (NAbs against Vaccinia virus without the ability to differentiate strains of Vaccinia virus. We showed that the neutralizing titers measured by our assay were similar to those obtained by the traditional plaque reduction neutralization test (PRNT. Using this assay, we found a low prevalence of NAb to VTT (7.6% in individuals born before 1980 from Beijing and Anhui provinces in China, and when present, anti-VTT NAb titers were low. No NAbs were detected in all 222 samples from individuals born after 1980. There was no significant difference observed for titer or prevalence by gender, age range and geographic origin. CONCLUSION: A simplified, sensitive, standardized, reproducible, and high-throughput assay was developed for the quantitation of NAbs against different Vaccinia strains. The current study provides useful insights for the future development of VTT-based vaccination in

  10. Development of Modified Vaccinia Virus Ankara-based Influenza Vaccines

    NARCIS (Netherlands)

    A.F. Altenburg (Arwen)


    textabstractInfluenza viruses continuously circulate in the human population and are estimated to cause 3-5 million cases of severe respiratory illness annually worldwide of which 250.000-500.000 have a fatal outcome. Vaccination is the most efficient measure to control infectious diseases,

  11. Prevalence of antibodies to Vaccinia virus after smallpox vaccination in Italy. (United States)

    Pütz, Mike M; Alberini, Isabella; Midgley, Claire M; Manini, Ilaria; Montomoli, Emanuele; Smith, Geoffrey L


    Decades after smallpox was eradicated and vaccination discontinued, the level of residual immunity in today's population is largely unknown. This study describes an epidemiological assessment in Italians of antibodies against the intracellular mature virus (IMV) and extracellular envelope virus (EEV) forms of Vaccinia virus. Serum samples (n = 642) were taken in 1993 and 2003 from people between 11 and 102 years old. Most citizens >27 years old were positive for antibodies to IMV and EEV. These antibodies were long-lasting and similar titres were present in citizens between 30 and 100 years old. Serum samples from 1993 and 2003 displayed very similar EEV- and IMV-specific antibody titres. By using these data and demographic considerations, it was predicted that, in 2003, 46 % of the Italian population were positive for both IMV and EEV, 42 % were negative for both and 12 % were positive for one antigen.

  12. Involvement of ESCRT-II in hepatitis B virus morphogenesis.

    Directory of Open Access Journals (Sweden)

    Jens T Stieler

    Full Text Available The hepatitis B virus (HBV is an enveloped DNA virus that replicates via reverse transcription of its pregenomic RNA (pgRNA. Budding of HBV is supposed to occur at intracellular membranes and requires scission functions of the endosomal sorting complex required for transport (ESCRT provided by ESCRT-III and VPS4. Here, we have investigated the impact of the upstream-acting ESCRT-I and ESCRT-II complexes in HBV morphogenesis. RNA interference knockdown of the ESCRT-I subunits TSG101 and VPS28 did not block, but rather stimulate virus release. In contrast, RNAi-mediated depletion of the ESCRT-II components EAP20, EAP30 and EAP45 greatly reduced virus egress. By analyzing different steps of the HBV maturation pathway, we find that the knockdown of ESCRT-II not only inhibited the production and/or release of enveloped virions, but also impaired intracellular nucleocapsid formation. Transcription/translation studies revealed that the depletion of ESCRT-II neither affected the synthesis and nuclear export of HBV-specific RNAs nor the expression of the viral core and envelope proteins. Moreover, the absence of ESCRT-II had no effects on the assembly capability and integrity of HBV core/capsids. However, the level of encapsidated pgRNA was significantly reduced in ESCRT-II-depleted cells, implicating that ESCRT-II directs steps accompanying the formation of replication-competent nucleocapsids, like e.g. assisting in RNA trafficking and encapsidation. In support of this, the capsid protein was found to interact and colocalize with ESCRT-II subunits in virus-producing cells. Together, these results indicate an essential role for ESCRT-II in the HBV life cycle and suggest that ESCRT-II functions prior to the final HBV budding reaction.

  13. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar


    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  14. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune response and tumor imaging. (United States)

    Parviainen, S; Ahonen, M; Diaconu, I; Hirvinen, M; Karttunen, Å; Vähä-Koskela, M; Hemminki, A; Cerullo, V


    Oncolytic vaccinia virus is an attractive platform for immunotherapy. Oncolysis releases tumor antigens and provides co-stimulatory danger signals. However, arming the virus can improve efficacy further. CD40 ligand (CD40L, CD154) can induce apoptosis of tumor cells and it also triggers several immune mechanisms. One of these is a T-helper type 1 (Th1) response that leads to activation of cytotoxic T-cells and reduction of immune suppression. Therefore, we constructed an oncolytic vaccinia virus expressing hCD40L (vvdd-hCD40L-tdTomato), which in addition features a cDNA expressing the tdTomato fluorochrome for detection of virus, potentially important for biosafety evaluation. We show effective expression of functional CD40L both in vitro and in vivo. In a xenograft model of bladder carcinoma sensitive to CD40L treatment, we show that growth of tumors was significantly inhibited by the oncolysis and apoptosis following both intravenous and intratumoral administration. In a CD40-negative model, CD40L expression did not add potency to vaccinia oncolysis. Tumors treated with vvdd-mCD40L-tdtomato showed enhanced efficacy in a syngenic mouse model and induced recruitment of antigen-presenting cells and lymphocytes at the tumor site. In summary, oncolytic vaccinia virus coding for CD40L mediates multiple antitumor effects including oncolysis, apoptosis and induction of Th1 type T-cell responses.

  15. Expression of DAI by an oncolytic vaccinia virus boosts the immunogenicity of the virus and enhances antitumor immunity

    Directory of Open Access Journals (Sweden)

    Mari Hirvinen


    Full Text Available In oncolytic virotherapy, the ability of the virus to activate the immune system is a key attribute with regard to long-term antitumor effects. Vaccinia viruses bear one of the strongest oncolytic activities among all oncolytic viruses. However, its capacity for stimulation of antitumor immunity is not optimal, mainly due to its immunosuppressive nature. To overcome this problem, we developed an oncolytic VV that expresses intracellular pattern recognition receptor DNA-dependent activator of IFN-regulatory factors (DAI to boost the innate immune system and to activate adaptive immune cells in the tumor. We showed that infection with DAI-expressing VV increases expression of several genes related to important immunological pathways. Treatment with DAI-armed VV resulted in significant reduction in the size of syngeneic melanoma tumors in mice. When the mice were rechallenged with the same tumor, DAI-VV-treated mice completely rejected growth of the new tumor, which indicates immunity established against the tumor. We also showed enhanced control of growth of human melanoma tumors and elevated levels of human T-cells in DAI-VV-treated mice humanized with human peripheral blood mononuclear cells. We conclude that expression of DAI by an oncolytic VV is a promising way to amplify the vaccine potency of an oncolytic vaccinia virus to trigger the innate—and eventually the long-lasting adaptive immunity against cancer.

  16. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization. (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A


    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  17. Separate worlds set to collide: smallpox, vaccinia virus vaccination, and human immunodeficiency virus and acquired immunodeficiency syndrome. (United States)

    Amorosa, Valerianna K; Isaacs, Stuart N


    Concerns about the possible release of smallpox by bioterrorists has led to policies that recommend smallpox vaccination of some health care providers, and, in the near future, the vaccine may become available to the general population on a voluntary basis. Both smallpox virus (variola virus) and the smallpox vaccine (vaccinia virus) will have a significant impact on people infected with human immunodeficiency virus (HIV). Given that populations with acquired immunodeficiency syndrome and populations with immunosuppressed conditions due to solid organ and bone marrow transplantation were not present in the days when smallpox was prevalent, we will speculate on how smallpox might present in immunodeficient patients, and we will review the adverse events expected from the smallpox vaccine in hosts with HIV infection.

  18. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader

    NARCIS (Netherlands)

    Schwer, B; Visca, P.; Vos, J C; Stunnenberg, H.G.


    We have demonstrated by primer elongation and cap analysis that mature vaccinia virus late transcripts are discontinuously synthesized. We have shown that RNA transcripts from a translocated 11K and from the authentic 11K and 4b late promoters are extended by approximately 35 nucleotides beyond the

  19. Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R

    Directory of Open Access Journals (Sweden)

    Hardie Grahame


    Full Text Available Abstract Background Vaccinia virus gene B1R encodes a serine/threonine protein kinase. In vitro this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions. Results Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase in vitro, digested with V8 protease, and phosphopeptides separated by HPLC. The N-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala. Conclusions We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated in vivo.

  20. Functional characterization of the vaccinia virus I5 protein

    Directory of Open Access Journals (Sweden)

    Stanitsa Eleni S


    Full Text Available The I5L gene is one of ~90 genes that are conserved throughout the chordopoxvirus family, and hence are presumed to play vital roles in the poxvirus life cycle. Previous work had indicated that the VP13 protein, a component of the virion membrane, was encoded by the I5L gene, but no additional studies had been reported. Using a recombinant virus that encodes an I5 protein fused to a V5 epitope tag at the endogenous locus (vI5V5, we show here that the I5 protein is expressed as a post-replicative gene and that the ~9 kDa protein does not appear to be phosphorylated in vivo. I5 does not appear to traffic to any cellular organelle, but ultrastructural and biochemical analyses indicate that I5 is associated with the membranous components of assembling and mature virions. Intact virions can be labeled with anti-V5 antibody as assessed by immunoelectron microscopy, indicating that the C' terminus of the protein is exposed on the virion surface. Using a recombinant virus which encodes only a TET-regulated copy of the I5V5 gene (vΔindI5V5, or one in which the I5 locus has been deleted (vΔI5, we also show that I5 is dispensable for replication in tissue culture. Neither plaque size nor the viral yield produced in BSC40 cells or primary human fibroblasts are affected by the absence of I5 expression.

  1. Potential effect of prior raccoonpox virus infection in raccoons on vaccinia-based rabies immunization

    Directory of Open Access Journals (Sweden)

    MacCarthy Kathleen A


    Full Text Available Abstract Background The USDA, Wildlife Services cooperative oral rabies vaccination (ORV program uses a live vaccinia virus-vectored (genus Orthopoxvirus vaccine, Raboral V-RG® (V-RG, to vaccinate specific wildlife species against rabies virus in several regions of the U.S. Several naturally occurring orthopoxviruses have been found in North America, including one isolated from asymptomatic raccoons (Procyon lotor. The effect of naturally occurring antibodies to orthopoxviruses on successful V-RG vaccination in raccoons is the focus of this study. Results Overall, raccoons pre-immunized (n = 10 with a recombinant raccoonpox virus vaccine (RCN-F1 responded to vaccination with V-RG with lower rabies virus neutralizing antibody (VNA titers than those which were not pre-immunized (n = 10 and some failed to seroconvert for rabies VNA to detectable levels. Conclusion These results suggest that the success of some ORV campaigns may be hindered where raccoonpox virus or possibly other orthopoxvirus antibodies are common in wildlife species targeted for ORV. If these areas are identified, different vaccination strategies may be warranted.

  2. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  3. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes. (United States)

    Bourquain, Daniel; Dabrowski, Piotr Wojtek; Nitsche, Andreas


    Animal-borne orthopoxviruses, like monkeypox, vaccinia and the closely related cowpox virus, are all capable of causing zoonotic infections in humans, representing a potential threat to human health. The disease caused by each virus differs in terms of symptoms and severity, but little is yet know about the reasons for these varying phenotypes. They may be explained by the unique repertoire of immune and host cell modulating factors encoded by each virus. In this study, we analysed the specific modulation of the host cell's gene expression profile by cowpox, monkeypox and vaccinia virus infection. We aimed to identify mechanisms that are either common to orthopoxvirus infection or specific to certain orthopoxvirus species, allowing a more detailed description of differences in virus-host cell interactions between individual orthopoxviruses. To this end, we analysed changes in host cell gene expression of HeLa cells in response to infection with cowpox, monkeypox and vaccinia virus, using whole-genome gene expression microarrays, and compared these to each other and to non-infected cells. Despite a dominating non-responsiveness of cellular transcription towards orthopoxvirus infection, we could identify several clusters of infection-modulated genes. These clusters are either commonly regulated by orthopoxvirus infection or are uniquely regulated by infection with a specific orthopoxvirus, with major differences being observed in immune response genes. Most noticeable was an induction of genes involved in leukocyte migration and activation in cowpox and monkeypox virus-infected cells, which was not observed following vaccinia virus infection. Despite their close genetic relationship, the expression profiles induced by infection with different orthopoxviruses vary significantly. It may be speculated that these differences at the cellular level contribute to the individual characteristics of cowpox, monkeypox and vaccinia virus infections in certain host species.

  4. Successful pseudorabies vaccination in maternally immune piglets using recombinant vaccinia virus vaccines. (United States)

    Brockmeier, S I; Lager, K M; Mengeling, W L


    Three gilts were vaccinated with a NYVAC vaccinia recombinant expressing glycoprotein gD of pseudorabies virus (PRV) (NYVAC/gD). After farrowing, the piglets were allowed to nurse normally to obtain colostral immunity and then were divided into four groups, receiving NYVAC/gD, a NYVAC recombinant expressing glycoprotein gB of PRV (NYVAC/gB), an inactivated PRV vaccine (iPRV), or no vaccine. The piglets were vaccinated twice, three weeks apart beginning at approximately two weeks of age and later challenged with virulent PRV oronasally. Piglets that received NYVAC/gB or iPRV were the best protected based on lack of mortality, lower temperature responses, decreased weight loss and decreased viral shedding after challenge. These results indicate effective strategies for stimulating active immune response while still under the protection of maternal immunity.

  5. Myxoma and vaccinia virus exploit different mechanisms to enter and infect human cancer cells (United States)

    Villa, Nancy Y.; Bartee, Eric; Mohamed, Mohamed R.; Rahman, Masmudur M.; Barrett, John W.; McFadden, Grant


    Myxoma (MYXV) and vaccinia virus (VACV) have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1- Low pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2- The tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3- Knockdown of PAK1 revealed that it is required for a late stage downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. PMID:20334889

  6. Vaccinia virus-mediated melanin production allows MR and optoacoustic deep tissue imaging and laser-induced thermotherapy of cancer. (United States)

    Stritzker, Jochen; Kirscher, Lorenz; Scadeng, Miriam; Deliolanis, Nikolaos C; Morscher, Stefan; Symvoulidis, Panagiotis; Schaefer, Karin; Zhang, Qian; Buckel, Lisa; Hess, Michael; Donat, Ulrike; Bradley, William G; Ntziachristos, Vasilis; Szalay, Aladar A


    We reported earlier the delivery of antiangiogenic single chain antibodies by using oncolytic vaccinia virus strains to enhance their therapeutic efficacy. Here, we provide evidence that gene-evoked production of melanin can be used as a therapeutic and diagnostic mediator, as exemplified by insertion of only one or two genes into the genome of an oncolytic vaccinia virus strain. We found that produced melanin is an excellent reporter for optical imaging without addition of substrate. Melanin production also facilitated deep tissue optoacoustic imaging as well as MRI. In addition, melanin was shown to be a suitable target for laser-induced thermotherapy and enhanced oncolytic viral therapy. In conclusion, melanin as a mediator for thermotherapy and reporter for different imaging modalities may soon become a versatile alternative to replace fluorescent proteins also in other biological systems. After ongoing extensive preclinical studies, melanin overproducing oncolytic virus strains might be used in clinical trials in patients with cancer.

  7. Significant Growth Inhibition of Canine Mammary Carcinoma Xenografts following Treatment with Oncolytic Vaccinia Virus GLV-1h68 (United States)

    Gentschev, Ivaylo; Ehrig, Klaas; Donat, Ulrike; Hess, Michael; Rudolph, Stephan; Chen, Nanhai; Yu, Yong A.; Zhang, Qian; Bullerdiek, Jörn; Nolte, Ingo; Stritzker, Jochen; Szalay, Aladar A.


    Canine mammary carcinoma is a highly metastatic tumor that is poorly responsive to available treatment. Therefore, there is an urgent need to identify novel agents for therapy of this disease. Recently, we reported that the oncolytic vaccinia virus GLV-1h68 could be a useful tool for therapy of canine mammary adenoma in vivo. In this study we analyzed the therapeutic effect of GLV-1h68 against canine mammary carcinoma. Cell culture data demonstrated that GLV-1h68 efficiently infected and destroyed cells of the mammary carcinoma cell line MTH52c. Furthermore, after systemic administration, this attenuated vaccinia virus strain primarily replicated in canine tumor xenografts in nude mice. Finally, infection with GLV-1h68 led to strong inflammatory and oncolytic effects resulting in significant growth inhibition of the tumors. In summary, the data showed that the GLV-1h68 virus strain has promising potential for effective treatment of canine mammary carcinoma. PMID:20631910

  8. Reverse Genetics of SARS-Related Coronavirus Using Vaccinia Virus-Based Recombination (United States)

    Zevenhoven, Jessika C.; Weber, Friedemann; Züst, Roland; Kuri, Thomas; Dijkman, Ronald; Chang, Guohui; Siddell, Stuart G.; Snijder, Eric J.; Thiel, Volker; Davidson, Andrew D.


    Severe acute respiratory syndrome (SARS) is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV) that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime) as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV). Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs). In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E). Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs. PMID:22412934

  9. Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination.

    Directory of Open Access Journals (Sweden)

    Sjoerd H E van den Worm

    Full Text Available Severe acute respiratory syndrome (SARS is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV. Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs. In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E. Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs.

  10. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism. (United States)

    Trefry, John C; Wooley, Dawn P


    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  11. Oncolytic vaccinia virus as an adjuvant treatment to cytoreductive surgery for malignant peritoneal mesothelioma. (United States)

    Acuna, Sergio A; Ottolino-Perry, Kathryn; Çako, Besmira; Tang, Nan; Angarita, Fernando A; McCart, J Andrea


    Malignant peritoneal mesothelioma (MPM) is an aggressive cancer with a dismal prognosis. Oncolytic viruses are a promising new therapy for cancer because of their ability to kill tumor cells with minimal toxicity to normal tissues. This experimental study aimed to examine the potential of modified vaccinia virus (VV) to treat MPM when administered alone or as an adjuvant treatment to surgery. Two aggressive murine mesothelioma cell lines (AC29, AB12), were used. Cell viability and viral cytopathic effects were assessed using MTS and crystal violet assays. Immunocompetent mice were injected intraperitoneally with MPM cells and treated with intraperitoneal VV. Tumor-bearing mice also underwent cytoreductive surgery (CRS) followed by VV (or control) therapy. The cytotoxic effects of VV on MPM cell lines was significantly increased compared with the control non-cancer cell line. In both orthotopic models, VV induced tumor regression, prolonging median and long-term survival. VV treatment after incomplete CRS was not superior to VV alone; however, when mice with microscopic disease were treated with VV, further prolongation of median and long-term survivals was observed. VV selectively kills MPM cells in vitro and leads to improved survival and cures in immunocompetent murine models. Higher efficacy of the virus in the microscopic disease context suggests the use of the virus as an adjuvant treatment to complete surgical resection. These promising results justify further studies of VV in humans as a novel treatment for MPM.

  12. Vaccinia virus G8R protein: a structural ortholog of proliferating cell nuclear antigen (PCNA.

    Directory of Open Access Journals (Sweden)

    Melissa Da Silva

    Full Text Available BACKGROUND: Eukaryotic DNA replication involves the synthesis of both a DNA leading and lagging strand, the latter requiring several additional proteins including flap endonuclease (FEN-1 and proliferating cell nuclear antigen (PCNA in order to remove RNA primers used in the synthesis of Okazaki fragments. Poxviruses are complex viruses (dsDNA genomes that infect eukaryotes, but surprisingly little is known about the process of DNA replication. Given our previous results that the vaccinia virus (VACV G5R protein may be structurally similar to a FEN-1-like protein and a recent finding that poxviruses encode a primase function, we undertook a series of in silico analyses to identify whether VACV also encodes a PCNA-like protein. RESULTS: An InterProScan of all VACV proteins using the JIPS software package was used to identify any PCNA-like proteins. The VACV G8R protein was identified as the only vaccinia protein that contained a PCNA-like sliding clamp motif. The VACV G8R protein plays a role in poxvirus late transcription and is known to interact with several other poxvirus proteins including itself. The secondary and tertiary structure of the VACV G8R protein was predicted and compared to the secondary and tertiary structure of both human and yeast PCNA proteins, and a high degree of similarity between all three proteins was noted. CONCLUSIONS: The structure of the VACV G8R protein is predicted to closely resemble the eukaryotic PCNA protein; it possesses several other features including a conserved ubiquitylation and SUMOylation site that suggest that, like its counterpart in T4 bacteriophage (gp45, it may function as a sliding clamp ushering transcription factors to RNA polymerase during late transcription.

  13. Vaccinia virus Transmission through Experimentally Contaminated Milk Using a Murine Model.

    Directory of Open Access Journals (Sweden)

    Izabelle Silva Rehfeld

    Full Text Available Bovine vaccinia (BV is a zoonosis caused by Vaccinia virus (VACV, which affects dairy cattle and humans. Previous studies have detected the presence of viable virus particles in bovine milk samples naturally and experimentally contaminated with VACV. However, it is not known whether milk contaminated with VACV could be a route of viral transmission. However, anti-Orthopoxvirus antibodies were detected in humans from BV endemic areas, whom had no contact with affected cows, which suggest that other VACV transmission routes are possible, such as consumption of contaminated milk and dairy products. Therefore, it is important to study the possibility of VACV transmission by contaminated milk. This study aimed to examine VACV transmission, pathogenesis and shedding in mice orally inoculated with experimentally contaminated milk. Thirty mice were orally inoculated with milk containing 107 PFU/ml of VACV, and ten mice were orally inoculated with uncontaminated milk. Clinical examinations were performed for 30 consecutive days, and fecal samples and oral swabs (OSs were collected every other day. Mice were euthanized on predetermined days, and tissue and blood samples were collected. Nested-PCR, plaque reduction neutralization test (PRNT, viral isolation, histopathology, and immunohistochemistry (IHC methods were performed on the collected samples. No clinical changes were observed in the animals. Viral DNA was detected in feces, blood, OSs and tissues, at least in one of the times tested. The lungs displayed moderate to severe interstitial lymphohistiocytic infiltrates, and only the heart, tonsils, tongue, and stomach did not show immunostaining at the IHC analysis. Neutralizing antibodies were detected at the 20th and 30th days post infection in 50% of infected mice. The results revealed that VACV contaminated milk could be a route of viral transmission in mice experimentally infected, showing systemic distribution and shedding through feces and oral

  14. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA* (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric


    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  15. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA. (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric


    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus. (United States)

    Marín-López, Alejandro; Ortego, Javier


    Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

  17. Hepatitis C virus nonstructural protein 5B is involved in virus morphogenesis. (United States)

    Gouklani, Hamed; Bull, Rowena A; Beyer, Claudia; Coulibaly, Fasséli; Gowans, Eric J; Drummer, Heidi E; Netter, Hans J; White, Peter A; Haqshenas, Gholamreza


    The p7 protein of hepatitis C virus (HCV) is a viroporin that is dispensable for viral genome replication but plays a critical role in virus morphogenesis. In this study, we generated a JFH1-based intergenotypic chimeric genome that encoded a heterologous genotype 1b (GT1b) p7. The parental intergenotypic chimeric genome was nonviable in human hepatoma cells, and infectious chimeric virions were produced only when cells transfected with the chimeric genomes were passaged several times. Sequence analysis of the entire polyprotein-coding region of the recovered chimeric virus revealed one predominant amino acid substitution in nonstructural protein 2 (NS2), T23N, and one in NS5B, K151R. Forward genetic analysis demonstrated that each of these mutations per se restored the infectivity of the parental chimeric genome, suggesting that interactions between p7, NS2, and NS5B were required for virion assembly/maturation. p7 and NS5B colocalized in cellular compartments, and the NS5B mutation did not affect the colocalization pattern. The NS5B K151R mutation neither increased viral RNA replication in human hepatoma cells nor altered the polymerase activity of NS5B in an in vitro assay. In conclusion, this study suggests that HCV NS5B is involved in virus morphogenesis.

  18. Hepatitis C Virus Nonstructural Protein 5B Is Involved in Virus Morphogenesis (United States)

    Gouklani, Hamed; Bull, Rowena A.; Beyer, Claudia; Coulibaly, Fasséli; Gowans, Eric J.; Drummer, Heidi E.; Netter, Hans J.; White, Peter A.


    The p7 protein of hepatitis C virus (HCV) is a viroporin that is dispensable for viral genome replication but plays a critical role in virus morphogenesis. In this study, we generated a JFH1-based intergenotypic chimeric genome that encoded a heterologous genotype 1b (GT1b) p7. The parental intergenotypic chimeric genome was nonviable in human hepatoma cells, and infectious chimeric virions were produced only when cells transfected with the chimeric genomes were passaged several times. Sequence analysis of the entire polyprotein-coding region of the recovered chimeric virus revealed one predominant amino acid substitution in nonstructural protein 2 (NS2), T23N, and one in NS5B, K151R. Forward genetic analysis demonstrated that each of these mutations per se restored the infectivity of the parental chimeric genome, suggesting that interactions between p7, NS2, and NS5B were required for virion assembly/maturation. p7 and NS5B colocalized in cellular compartments, and the NS5B mutation did not affect the colocalization pattern. The NS5B K151R mutation neither increased viral RNA replication in human hepatoma cells nor altered the polymerase activity of NS5B in an in vitro assay. In conclusion, this study suggests that HCV NS5B is involved in virus morphogenesis. PMID:22345449

  19. Vaccinia virus intracellular enveloped virions move to the cell periphery on microtubules in the absence of the A36R protein. (United States)

    Herrero-Martínez, Esteban; Roberts, Kim L; Hollinshead, Michael; Smith, Geoffrey L


    Vaccinia virus (VACV) intracellular enveloped virus (IEV) particles are transported to the cell periphery on microtubules where they fuse with the plasma membrane to form cell-associated enveloped virus (CEV). Two IEV-specific proteins, F12L and A36R, are implicated in mediating transport of IEV. Without F12L, virus morphogenesis halts after formation of IEV, and CEV is not formed, whereas without A36R, IEV was reported not to be transported, yet CEV was formed, To address the roles of A36R and F12L in IEV transport, viruses with deletions of either F12L (vdeltaF12L) or A36R (vdeltaA36R) were labelled with enhanced green fluorescent protein (EGFP) fused to the core protein A5L, and used to follow CEV production with time. Without F12L, CEV production was inhibited by >99 %, whereas without A36R, CEV were produced at approximately 60 % of wild-type levels at 24 h post-infection. Depolymerization of microtubules, but not actin, inhibited CEV formation in vdeltaA36R-infected cells. Moreover, vdeltaA36R IEV labelled with EGFP fused to the B5R protein co-localized with microtubules, showing that the A36R protein is not required for the interaction of IEV with microtubules. Time-lapse confocal microscopy confirmed that both wild-type and vdeltaA36R IEV moved in a stop-start manner at speeds consistent with microtubular movement, although the mean length of vdeltaA36R IEV movement was shorter. These data demonstrate that VACV IEV is transported to the cell surface using microtubules in the absence of A36R, and therefore IEV must attach to microtubule motors using at least one protein other than A36R.

  20. Safety and biodistribution of a double-deleted oncolytic vaccinia virus encoding CD40 ligand in laboratory Beagles

    Directory of Open Access Journals (Sweden)

    Karoliina Autio


    Full Text Available We evaluated adverse events, biodistribution and shedding of oncolytic vaccinia virus encoding CD40 ligand in two Beagles, in preparation for a phase 1 trial in canine cancer patients. Dog 1 received one dose of vaccinia virus and was euthanized 24 hours afterwards, while dog 2 received virus four times once weekly and was euthanized 7 days after that. Dogs were monitored for adverse events and underwent a detailed postmortem examination. Blood, saliva, urine, feces, and organs were collected for virus detection. Dog 1 had mild fever and lethargy while dog 2 experienced a possible seizure 5.5 hours after first virus administration. Viral DNA declined quickly in the blood after virus administration in both dogs but was still detectable 1 week later by quantitative polymerase chain reaction. Only samples taken directly after virus infusion contained infectious virus. Small amounts of viral DNA, but no infectious virus, were detected in a few saliva and urine samples. Necropsies did not reveal any relevant pathological changes and virus DNA was detected mainly in the spleen. The dogs in the study did not have cancer, and thus adverse events could be more common and viral load higher in dogs with tumors which allow viral amplification.

  1. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice. (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F


    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  2. Comparison of the Cowpox Virus and Vaccinia Virus Mature Virion Proteome: Analysis of the Species- and Strain-Specific Proteome.

    Directory of Open Access Journals (Sweden)

    Joerg Doellinger

    Full Text Available Cowpox virus (CPXV causes most zoonotic orthopoxvirus (OPV infections in Europe and Northern as well as Central Asia. The virus has the broadest host range of OPV and is transmitted to humans from rodents and other wild or domestic animals. Increasing numbers of human CPXV infections in a population with declining immunity have raised concerns about the virus' zoonotic potential. While there have been reports on the proteome of other human-pathogenic OPV, namely vaccinia virus (VACV and monkeypox virus (MPXV, the protein composition of the CPXV mature virion (MV is unknown. This study focused on the comparative analysis of the VACV and CPXV MV proteome by label-free single-run proteomics using nano liquid chromatography and high-resolution tandem mass spectrometry (nLC-MS/MS. The presented data reveal that the common VACV and CPXV MV proteome contains most of the known conserved and essential OPV proteins and is associated with cellular proteins known to be essential for viral replication. While the species-specific proteome could be linked mainly to less genetically-conserved gene products, the strain-specific protein abundance was found to be of high variance in proteins associated with entry, host-virus interaction and protein processing.

  3. Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors

    Directory of Open Access Journals (Sweden)

    Moss Bernard


    Full Text Available Abstract Background Replication of the vaccinia virus genome occurs in cytoplasmic factory areas and is dependent on the virus-encoded DNA polymerase and at least four additional viral proteins. DNA synthesis appears to start near the ends of the genome, but specific origin sequences have not been defined. Surprisingly, transfected circular DNA lacking specific viral sequences is also replicated in poxvirus-infected cells. Origin-independent plasmid replication depends on the viral DNA polymerase, but neither the number of additional viral proteins nor the site of replication has been determined. Results Using a novel real-time polymerase chain reaction assay, we detected a >400-fold increase in newly replicated plasmid in cells infected with vaccinia virus. Studies with conditional lethal mutants of vaccinia virus indicated that each of the five proteins known to be required for viral genome replication was also required for plasmid replication. The intracellular site of replication was determined using a plasmid containing 256 repeats of the Escherichia coli lac operator and staining with an E. coli lac repressor-maltose binding fusion protein followed by an antibody to the maltose binding protein. The lac operator plasmid was localized in cytoplasmic viral factories delineated by DNA staining and binding of antibody to the viral uracil DNA glycosylase, an essential replication protein. In addition, replication of the lac operator plasmid was visualized continuously in living cells infected with a recombinant vaccinia virus that expresses the lac repressor fused to enhanced green fluorescent protein. Discrete cytoplasmic fluorescence was detected in cytoplasmic juxtanuclear sites at 6 h after infection and the area and intensity of fluorescence increased over the next several hours. Conclusion Replication of a circular plasmid lacking specific poxvirus DNA sequences mimics viral genome replication by occurring in cytoplasmic viral factories

  4. Increased ATP generation in the host cell is required for efficient vaccinia virus production

    Directory of Open Access Journals (Sweden)

    Hsu Che-Fang


    Full Text Available Abstract To search for cellular genes up-regulated by vaccinia virus (VV infection, differential display-reverse transcription-polymerase chain reaction (ddRT-PCR assays were used to examine the expression of mRNAs from mock-infected and VV-infected HeLa cells. Two mitochondrial genes for proteins that are part of the electron transport chain that generates ATP, ND4 and CO II, were up-regulated after VV infection. Up-regulation of ND4 level by VV infection was confirmed by Western blotting analysis. Up-regulation of ND4 was reduced by the MAPK inhibitor, apigenin, which has been demonstrated elsewhere to inhibit VV replication. The induction of ND4 expression occurred after viral DNA replication since ara C, an inhibitor of poxviral DNA replication, could block this induction. ATP production was increased in the host cells after VV infection. Moreover, 4.5 μM oligomycin, an inhibitor of ATP production, reduced the ATP level 13 hr after virus infection to that of mock-infected cells and inhibited viral protein expression and virus production, suggesting that increased ATP production is required for efficient VV production. Our results further suggest that induction of ND4 expression is through a Bcl-2 independent pathway.

  5. Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics. (United States)

    Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H


    Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

  6. RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

    Energy Technology Data Exchange (ETDEWEB)

    Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)


    Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

  7. Vaccinia virus protein complex F12/E2 interacts with kinesin light chain isoform 2 to engage the kinesin-1 motor complex. (United States)

    Carpentier, David C J; Gao, William N D; Ewles, Helen; Morgan, Gareth W; Smith, Geoffrey L


    During vaccinia virus morphogenesis, intracellular mature virus (IMV) particles are wrapped by a double lipid bilayer to form triple enveloped virions called intracellular enveloped virus (IEV). IEV are then transported to the cell surface where the outer IEV membrane fuses with the cell membrane to expose a double enveloped virion outside the cell. The F12, E2 and A36 proteins are involved in transport of IEVs to the cell surface. Deletion of the F12L or E2L genes causes a severe inhibition of IEV transport and a tiny plaque size. Deletion of the A36R gene leads to a smaller reduction in plaque size and less severe inhibition of IEV egress. The A36 protein is present in the outer membrane of IEVs, and over-expressed fragments of this protein interact with kinesin light chain (KLC). However, no interaction of F12 or E2 with the kinesin complex has been reported hitherto. Here the F12/E2 complex is shown to associate with kinesin-1 through an interaction of E2 with the C-terminal tail of KLC isoform 2, which varies considerably between different KLC isoforms. siRNA-mediated knockdown of KLC isoform 1 increased IEV transport to the cell surface and virus plaque size, suggesting interaction with KLC isoform 1 is somehow inhibitory of IEV transport. In contrast, knockdown of KLC isoform 2 did not affect IEV egress or plaque formation, indicating redundancy in virion egress pathways. Lastly, the enhancement of plaque size resulting from loss of KLC isoform 1 was abrogated by removal of KLC isoforms 1 and 2 simultaneously. These observations suggest redundancy in the mechanisms used for IEV egress, with involvement of KLC isoforms 1 and 2, and provide evidence of interaction of F12/E2 complex with the kinesin-1 complex.

  8. Vaccinia virus protein complex F12/E2 interacts with kinesin light chain isoform 2 to engage the kinesin-1 motor complex.

    Directory of Open Access Journals (Sweden)

    David C J Carpentier


    Full Text Available During vaccinia virus morphogenesis, intracellular mature virus (IMV particles are wrapped by a double lipid bilayer to form triple enveloped virions called intracellular enveloped virus (IEV. IEV are then transported to the cell surface where the outer IEV membrane fuses with the cell membrane to expose a double enveloped virion outside the cell. The F12, E2 and A36 proteins are involved in transport of IEVs to the cell surface. Deletion of the F12L or E2L genes causes a severe inhibition of IEV transport and a tiny plaque size. Deletion of the A36R gene leads to a smaller reduction in plaque size and less severe inhibition of IEV egress. The A36 protein is present in the outer membrane of IEVs, and over-expressed fragments of this protein interact with kinesin light chain (KLC. However, no interaction of F12 or E2 with the kinesin complex has been reported hitherto. Here the F12/E2 complex is shown to associate with kinesin-1 through an interaction of E2 with the C-terminal tail of KLC isoform 2, which varies considerably between different KLC isoforms. siRNA-mediated knockdown of KLC isoform 1 increased IEV transport to the cell surface and virus plaque size, suggesting interaction with KLC isoform 1 is somehow inhibitory of IEV transport. In contrast, knockdown of KLC isoform 2 did not affect IEV egress or plaque formation, indicating redundancy in virion egress pathways. Lastly, the enhancement of plaque size resulting from loss of KLC isoform 1 was abrogated by removal of KLC isoforms 1 and 2 simultaneously. These observations suggest redundancy in the mechanisms used for IEV egress, with involvement of KLC isoforms 1 and 2, and provide evidence of interaction of F12/E2 complex with the kinesin-1 complex.

  9. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication. (United States)

    Verardi, Paulo H; Titong, Allison; Hagen, Caitlin J


    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies.

  10. [Modified vaccinia virus ankara (MVA)--development as recombinant vaccine and prospects for use in veterinary medicine]. (United States)

    Volz, Asisa; Fux, Robert; Langenmayer, Martin C; Sutter, Gerd


    Poxviruses as expression vectors are widely used in medical research for the development of recombinant vaccines and molecular therapies. Here we review recent accomplishments in vaccine research using recombinant modified vaccinia virus ankara (MVA). MVA is a highly attenuated vaccinia virus strain that originated from serial tissue culture passage in chicken embryo fibroblasts more than 40 years ago. Growth adaptation to avian host cells caused deletions and mutations in the viral genome affecting about 15% of the original genetic information. In consequence, MVA is replication-deficient in cells of mammalian origin and fails to produce many of the virulence factors encoded by conventional vaccinia virus. Because of its safety for the general environment MVA can be handled under conditions of biosafety level one. Non-replicating MVA can enter any target cell and activate its molecular life cycle to express all classes of viral and recombinant genes. Therefore, recombinant MVA have been established as an extremely safe and efficient vector system for vaccine development in medical research. By now, various recombinant MVA vaccines have been found safe and immunogenic when used for phase I/II clinical testing in humans, and suitable for industrial scale production following good practice of manufacturing. Thus, there is an obvious usefulness of recombinant MVA vaccines for novel prophylactic and therapeutic approaches also in veterinary medicine. Results from first studies in companion and farm animals are highly promising.

  11. Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination. (United States)

    Verheust, Céline; Goossens, Martine; Pauwels, Katia; Breyer, Didier


    The modified vaccinia virus Ankara (MVA) strain is a highly attenuated strain of vaccinia virus that has been demonstrated to be safe for humans. MVA is widely considered as the vaccinia virus strain of choice for clinical investigation because of its high safety profile. It also represents an excellent candidate for use as vector system in recombinant vaccine development for gene delivery or vaccination against infectious diseases or tumours, even in immunocompromised individuals. The use of MVA and recombinant MVA vectors must comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The purpose of the present paper is to highlight some biological characteristics of MVA and MVA-based recombinant vectors and to discuss these from a biosafety point of view in the context of the European regulatory framework for genetically modified organisms with emphasis on the assessment of potential risks associated with environmental release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Genomic identification of human vaccinia virus keratoconjunctivitis and its importance as a laboratory-acquired infection

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi Motlagh


    Full Text Available Context: Vaccinia virus (VACV is a member of orthopoxvirus genus of the family Poxviridae. VACVs are enveloped, double-stranded DNA viruses. Several species of this family, for example, molluscum contagiosum, smallpox, deerpox, horsepox, rabbitpox, and VACVs may cause conjunctivitis. Aims: Given the high incidence of keratoconjunctivitis in Iran (approximately 3.6%-53.9% and insufficient clinical diagnostic measures, laboratory tests for detection of its causes and determination of accurate keratoconjunctivitis/conjunctivitis prevalence due to different pathogens are essential. Settings and Design: In this research, conjunctival samples collected from 100 patients with keratoconjunctivitis signs were referred to an eye hospital of Iran. Subjects and Methods: After DNA extraction, polymerase chain reaction (PCR was carried out for detection of VACV. PCR-positive products were further subjected to DNA sequencing. Statistical Analysis Used: The results were analyzed using Chi-square test. Results: In this study, 28% of the samples were positive and a statistically significant relationship obtained between working in medical or research laboratories and VACV prevalence (P < 0.05. Conclusions: This study showed a high rate of VACV keratoconjunctivitis, and therefore, further studies for its prevention and control are necessary.

  13. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  14. Brazilian vaccinia virus strains show a classical orthopoxvirus in-fection course and cross-protection

    Institute of Scientific and Technical Information of China (English)

    Betania Paiva Drumond; Jonatas Santos Abraho; Zlia Ins Portela Lobato; Cludio Antonio Bonjardim; Paulo Csar Peregrino Ferreira; Erna Geessien Kroon


    Objectives:The purpose of this work was to study the infection course and cross-protection in mice after intra-dermal injection of Vaccinia virus (VACV ) strain Western Reserve and three Brazilian VACV strains:Araatuba,Muriaéand BeAn58058 isolated from cow,human and rodent,respectively.Methods:Balb /c mice were inoculated by footpad and back scarification and daily monitored regarding lesion development and weight loss.To check cross protection after intradermal VACV inoculation,mice were subsequently infected with different VACV strains and monitored to check lesion development.Serum neutralization assays were per-formed to check for the presence of antibodies against Orthopoxvirus.Results:After VACV intradermal inocu-lation the lesion development pattern was similar in mice infected with the different virus strains.By using the footpad scarification model,cross-protection among VACV strains was observed.Moreover,neutralizing anti-bodies against Orthopoxvirus were detected in sera from mice infected with all VACV strains.Conclusion:Al-though it was not possible to observe virulence differences among VACV strains isolated from cow,rodent and human using the murine model,this inoculation route showed to be an appropriated model to study lesions de-velopment since it mimics natural infections by VACV in nature.

  15. Cellular expression of a functional nodavirus RNA replicon from vaccinia virus vectors. (United States)

    Ball, L A


    RNA replication provides a powerful means for the amplification of RNA, but to date it has been found to occur naturally only among RNA viruses. In an attempt to harness this process for the amplification of heterologous mRNAs, both an RNA replicase and its corresponding RNA templates have been expressed in functional form, using vaccinia virus-bacteriophage T7 RNA polymerase vectors. Plasmids were constructed which contained in 5'-to-3' order (i) a bacteriophage T7 promoter; (ii) a full-length cDNA encoding either the RNA replicase (RNA 1) or the coat protein (RNA 2) of flock house virus (FHV), (iii) a cDNA sequence that encoded the self-cleaving ribozyme of satellite tobacco ringspot virus, and (iv) a T7 transcriptional terminator. Both in vitro and in vivo, circular plasmids of this structure were transcribed by T7 RNA polymerase to produce RNAs with sizes that closely resembled those of the two authentic FHV genomic RNAs, RNA 1 and RNA 2. In baby hamster kidney cells that expressed authentic FHV RNA replicase, the RNA 2 (coat protein) transcripts were accurately replicated. Moreover, the RNA 1 (replicase) transcripts directed the synthesis of an enzyme that could replicate not only authentic virion-derived FHV RNA but also the plasmid-derived transcripts themselves. Under the latter conditions, replicative amplification of the RNA transcripts ensued and resulted in a high rate of synthesis of the encoded proteins. This successful expression from a DNA vector of the complex biological process of RNA replication will greatly facilitate studies of its mechanism and is a major step towards the goal of harnessing RNA replication for mRNA amplification.

  16. Vaccinia viruses isolated from cutaneous disease in horses are highly virulent for rabbits. (United States)

    Felipetto Cargnelutti, Juliana; Schmidt, Candice; Masuda, Eduardo Kenji; Braum, Lisiane Danusa; Weiblen, Rudi; Furtado Flores, Eduardo


    Two genotypically distinct Vaccinia viruses (VACV), named P1V and P2V, were isolated from an outbreak of cutaneous disease in horses in Southern Brazil. We herein investigated the susceptibility of rabbits, a proposed animal model, to P1V and P2V infection. Groups of weanling rabbits were inoculated intranasally (IN) with P1V or P2V at low (10(2.5) TCID50), medium (10(4.5)TCID50), or high titer (10(6.5)TCID50). Rabbits inoculated with medium and high titers shed virus in nasal secretions and developed serous to hemorrhagic nasal discharge and severe respiratory distress, followed by progressive apathy and high lethality. Clinical signs appeared around days 3-6 post-inoculation (pi) and lasted up to the day of death or euthanasia (around days 5-10). Virus shedding and clinical signs were less frequent in rabbits inoculated with low virus titers. Viremia was detected in all groups, with different frequencies. Viral DNA was detected in the feces of a few animals inoculated with P1V and P2V, low titer, and with P2V at high titer. Gross necropsy findings and histological examination showed diffuse interstitial fibrousing pneumonia with necrosuppurative bronchopneumonia and intestinal liquid content. Neutralizing antibodies were detected in all inoculated animals surviving beyond day 9 pi. These results show that rabbits are highly susceptible to VACV isolated from horses, and develop severe respiratory and systemic disease upon IN inoculation. Thus, rabbits may be used to study selected aspects of VACV infection and disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus. (United States)

    Mota, Bruno E F; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A; Vieira, Leda Q; da Fonseca, Flávio G; Ferreira, Paulo C P; Bonjardim, Cláudio A; Damon, Inger K; Kroon, Erna G


    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/-)) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/-) with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-), and passive transfer of WT T cells to Rag1(-/-) animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals with

  18. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Bruno E F Mota

    Full Text Available Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/- produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/- with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-, and passive transfer of WT T cells to Rag1(-/- animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify

  19. Adverse Events Post Smallpox-Vaccination: Insights from Tail Scarification Infection in Mice with Vaccinia virus (United States)

    Mota, Bruno E. F.; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M. Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A.; Vieira, Leda Q.; da Fonseca, Flávio G.; Ferreira, Paulo C. P.; Bonjardim, Cláudio A.; Damon, Inger K.; Kroon, Erna G.


    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1−/−) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1−/− with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1−/−, and passive transfer of WT T cells to Rag1−/− animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals

  20. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  1. A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference.

    Directory of Open Access Journals (Sweden)

    Philippa M Beard

    Full Text Available Vaccinia virus (VACV is a large, cytoplasmic, double-stranded DNA virus that requires complex interactions with host proteins in order to replicate. To explore these interactions a functional high throughput small interfering RNA (siRNA screen targeting 6719 druggable cellular genes was undertaken to identify host factors (HF influencing the replication and spread of an eGFP-tagged VACV. The experimental design incorporated a low multiplicity of infection, thereby enhancing detection of cellular proteins involved in cell-to-cell spread of VACV. The screen revealed 153 pro- and 149 anti-viral HFs that strongly influenced VACV replication. These HFs were investigated further by comparisons with transcriptional profiling data sets and HFs identified in RNAi screens of other viruses. In addition, functional and pathway analysis of the entire screen was carried out to highlight cellular mechanisms involved in VACV replication. This revealed, as anticipated, that many pro-viral HFs are involved in translation of mRNA and, unexpectedly, suggested that a range of proteins involved in cellular transcriptional processes and several DNA repair pathways possess anti-viral activity. Multiple components of the AMPK complex were found to act as pro-viral HFs, while several septins, a group of highly conserved GTP binding proteins with a role in sequestering intracellular bacteria, were identified as strong anti-viral VACV HFs. This screen has identified novel and previously unexplored roles for cellular factors in poxvirus replication. This advancement in our understanding of the VACV life cycle provides a reliable knowledge base for the improvement of poxvirus-based vaccine vectors and development of anti-viral theraputics.

  2. Antibody against extracellular vaccinia virus (EV protects mice through complement and Fc receptors.

    Directory of Open Access Journals (Sweden)

    Matthew E Cohen

    Full Text Available Protein-based subunit smallpox vaccines have shown their potential as effective alternatives to live virus vaccines in animal model challenge studies. We vaccinated mice with combinations of three different vaccinia virus (VACV proteins (A33, B5, L1 and examined how the combined antibody responses to these proteins cooperate to effectively neutralize the extracellular virus (EV infectious form of VACV. Antibodies against these targets were generated in the presence or absence of CpG adjuvant so that Th1-biased antibody responses could be compared to Th2-biased responses to the proteins with aluminum hydroxide alone, specifically with interest in looking at the ability of anti-B5 and anti-A33 polyclonal antibodies (pAb to utilize complement-mediated neutralization in vitro. We found that neutralization of EV by anti-A33 or anti-B5 pAb can be enhanced in the presence of complement if Th1-biased antibody (IgG2a is generated. Mechanistic differences found for complement-mediated neutralization showed that anti-A33 antibodies likely result in virolysis, while anti-B5 antibodies with complement can neutralize by opsonization (coating. In vivo studies found that mice lacking the C3 protein of complement were less protected than wild-type mice after passive transfer of anti-B5 pAb or vaccination with B5. Passive transfer of anti-B5 pAb or monoclonal antibody into mice lacking Fc receptors (FcRs found that FcRs were also important in mediating protection. These results demonstrate that both complement and FcRs are important effector mechanisms for antibody-mediated protection from VACV challenge in mice.

  3. Structure of vaccinia virus thymidine kinase in complex with dTTP: insights for drug design

    Directory of Open Access Journals (Sweden)

    Balzarini Jan


    Full Text Available Abstract Background Development of countermeasures to bioterrorist threats such as those posed by the smallpox virus (variola, include vaccination and drug development. Selective activation of nucleoside analogues by virus-encoded thymidine (dThd kinases (TK represents one of the most successful strategies for antiviral chemotherapy as demonstrated for anti-herpes drugs. Vaccinia virus TK is a close orthologue of variola TK but also shares a relatively high sequence identity to human type 2 TK (hTK, thus achieving drug selectivity relative to the host enzyme is challenging. Results In order to identify any differences compared to hTK that may be exploitable in drug design, we have determined the crystal structure of VVTK, in complex with thymidine 5'-triphosphate (dTTP. Although most of the active site residues are conserved between hTK and VVTK, we observe a difference in conformation of residues Asp-43 and Arg-45. The equivalent residues in hTK hydrogen bond to dTTP, whereas in subunit D of VVTK, Asp-43 and Arg-45 adopt a different conformation preventing interaction with this nucleotide. Asp-43 and Arg-45 are present in a flexible loop, which is disordered in subunits A, B and C. The observed difference in conformation and flexibility may also explain the ability of VVTK to phosphorylate (South-methanocarbathymine whereas, in contrast, no substrate activity with hTK is reported for this compound. Conclusion The difference in conformation for Asp-43 and Arg-45 could thus be used in drug design to generate VVTK/Variola TK-selective nucleoside analogue substrates and/or inhibitors that have lower affinity for hTK.

  4. [Construction and identification of non-replication recombinant vaccinia virus co-expressing human papillomavirus type 16 L1/L2/E6/E7 proteins]. (United States)

    Huang, Wei; Tian, Hou-wen; Ren, Jiao; Fan, Jiang-tao; Zhao, Li; Bian, Tao; Lu, Zhen-hua; Ruan, Li


    To generate a human papillomavirus (HPV16) prophylactic and therapeutic vaccine candidate for cervical cancer. HPV16 major capsid protein L1 gene/minor capsid protein L2 gene and HPV16 early E6/E7 genes were inserted into a vaccinia virus expression vector. A strain of non-recombinant vaccinia virus containing the sequences was obtained through a homologous recombination and identified. DNA hybridization confirmed that the HPV16L1/L2/E6/E7 genes were integrated into vaccinia virus DNA. Western Blot result showed that full-length L1/L2/E6/E7 proteins were co-expressed in CEF cells infected with the recombinant virus. NTVJE6E7CKL1L2 could be taken as a candidate of prophylactic and therapeutic vaccine for HPV-associated tumors and their precancerous transformations.

  5. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing. (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard


    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  6. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells (United States)

    Salgado, Ana Paula Carneiro; Soares-Martins, Jamária Adriana Pinheiro; Andrade, Luciana Garcia; Albarnaz, Jonas Dutra; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien; Bonjardim, Cláudio Antônio


    Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV) and Cowpox (CPXV) and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN) Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication. PMID:23903969

  7. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Carneiro Salgado


    Full Text Available Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV and Cowpox (CPXV and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication.

  8. Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps?

    Directory of Open Access Journals (Sweden)

    Malachy I. Okeke


    Full Text Available Modified vaccinia virus Ankara (MVA is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health. However, key aspects of MVA biology require further research in order to provide data needed to evaluate the potential risks that may occur due to the use of MVA and MVA-vectored vaccines. The purpose of this paper is to identify knowledge gaps in the biology of MVA and recombinant MVA that are of relevance to its hazard characterization and discuss ongoing and future experiments aimed at providing data necessary to fill in the knowledge gaps. In addition, we presented arguments for the inclusion of uncertainty analysis and experimental investigation of verifiable worst-case scenarios in the environmental risk assessment of MVA and recombinant MVA. These will contribute to improved risk assessment of MVA and recombinant MVA vaccines.

  9. Myxoma and vaccinia viruses exploit different mechanisms to enter and infect human cancer cells. (United States)

    Villa, Nancy Y; Bartee, Eric; Mohamed, Mohamed R; Rahman, Masmudur M; Barrett, John W; McFadden, Grant


    Myxoma (MYXV) and vaccinia (VACV) viruses have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1--low-pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2--the tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3--knockdown of PAK1 revealed that it is required for a late stage event downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. 2010 Elsevier Inc. All rights reserved.

  10. Antigen Gene Transfer to Human Plasmacytoid Dendritic Cells Using Recombinant Adenovirus and Vaccinia Virus Vectors

    Directory of Open Access Journals (Sweden)

    Hetty J. Bontkes


    Full Text Available Recombinant adenoviruses (RAd and recombinant vaccinia viruses (RVV expressing tumour-associated antigens (TAA are used as anti-tumour vaccines. It is important that these vaccines deliver the TAA to dendritic cells (DC for the induction of a strong immune response. Infection of myeloid DC (MDC with RAd alone is relatively inefficient but CD40 retargeting significantly increases transduction efficiency and DC maturation. Infection with RVV is efficient without DC maturation. Plasmacytoid dendritic cells (PDC play a role in the innate immune response to viral infections through the secretion of IFNα but may also play a role in specific T-cell induction. The aim of our study was to investigate whether PDC are better targets for RAd and RVV based vaccines. RAd alone hardly infected PDC (2% while CD40 retargeting did not improve transduction efficiency, but it did increase PDC maturation (25% CD83 positive cells. Accordingly, specific CTL activation by RAd infected PDC was limited (the number of IFNγ producing CTL was reduced by 75% compared to stimulation with peptide loaded PDC. RVV infected PDC specifically stimulated CTL but PDC were not activated. These Results indicate that PDC are not ideal targets for RAd and RVV based vaccines. However, PDC induced specific CTL activation after pulsing with recombinant protein, indicating that PDC can also cross-present antigens released from surrounding infected cells.

  11. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole


    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human...

  12. Protective Effect of Surfactant Protein D in Pulmonary Vaccinia Virus Infection: Implication of A27 Viral Protein

    Directory of Open Access Journals (Sweden)

    Julien Perino


    Full Text Available Vaccinia virus (VACV was used as a surrogate of variola virus (VARV (genus Orthopoxvirus, the causative agent of smallpox, to study Orthopoxvirus infection. VARV is principally transmitted between humans by aerosol droplets. Once inhaled, VARV first infects the respiratory tract where it could encounter surfactant components, such as soluble pattern recognition receptors. Surfactant protein D (SP-D, constitutively present in the lining fluids of the respiratory tract, plays important roles in innate host defense against virus infection. We investigated the role of SP-D in VACV infection and studied the A27 viral protein involvement in the interaction with SP-D. Interaction between SP-D and VACV caused viral inhibition in a lung cell model. Interaction of SP-D with VACV was mediated by the A27 viral protein. Binding required Ca2+ and interactions were blocked in the presence of excess of SP-D saccharide ligands. A27, which lacks glycosylation, directly interacted with SP-D. The interaction between SP-D and the viral particle was also observed using electron microscopy. Infection of mice lacking SP-D (SP-D-/- resulted in increased mortality compared to SP-D+/+ mice. Altogether, our data show that SP-D participates in host defense against the vaccinia virus infection and that the interaction occurs with the viral surface protein A27.

  13. Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36▿ (United States)

    Johnston, Sara C.; Ward, Brian M.


    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress. PMID:19052096

  14. Protective properties of vaccinia virus-based vaccines: skin scarification promotes a nonspecific immune response that protects against orthopoxvirus disease. (United States)

    Rice, Amanda D; Adams, Mathew M; Lindsey, Scott F; Swetnam, Daniele M; Manning, Brandi R; Smith, Andrew J; Burrage, Andrew M; Wallace, Greg; MacNeill, Amy L; Moyer, Richard W


    The process of vaccination introduced by Jenner generated immunity against smallpox and ultimately led to the eradication of the disease. Procedurally, in modern times, the virus is introduced into patients via a process called scarification, performed with a bifurcated needle containing a small amount of virus. What was unappreciated was the role that scarification itself plays in generating protective immunity. In rabbits, protection from lethal disease is induced by intradermal injection of vaccinia virus, whereas a protective response occurs within the first 2 min after scarification with or without virus, suggesting that the scarification process itself is a major contributor to immunoprotection. importance: These results show the importance of local nonspecific immunity in controlling poxvirus infections and indicate that the process of scarification should be critically considered during the development of vaccination protocols for other infectious agents. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Broad protection against avian influenza virus by using a modified vaccinia Ankara virus expressing a mosaic hemagglutinin gene. (United States)

    Kamlangdee, Attapon; Kingstad-Bakke, Brock; Anderson, Tavis K; Goldberg, Tony L; Osorio, Jorge E


    A critical failure in our preparedness for an influenza pandemic is the lack of a universal vaccine. Influenza virus strains diverge by 1 to 2% per year, and commercially available vaccines often do not elicit protection from one year to the next, necessitating frequent formulation changes. This represents a major challenge to the development of a cross-protective vaccine that can protect against circulating viral antigenic diversity. We have constructed a recombinant modified vaccinia virus Ankara (MVA) that expresses an H5N1 mosaic hemagglutinin (H5M) (MVA-H5M). This mosaic was generated in silico using 2,145 field-sourced H5N1 isolates. A single dose of MVA-H5M provided 100% protection in mice against clade 0, 1, and 2 avian influenza viruses and also protected against seasonal H1N1 virus (A/Puerto Rico/8/34). It also provided short-term (10 days) and long-term (6 months) protection postvaccination. Both neutralizing antibodies and antigen-specific CD4(+) and CD8(+) T cells were still detected at 5 months postvaccination, suggesting that MVA-H5M provides long-lasting immunity. Influenza viruses infect a billion people and cause up to 500,000 deaths every year. A major problem in combating influenza is the lack of broadly effective vaccines. One solution from the field of human immunodeficiency virus vaccinology involves a novel in silico mosaic approach that has been shown to provide broad and robust protection against highly variable viruses. Unlike a consensus algorithm which picks the most frequent residue at each position, the mosaic method chooses the most frequent T-cell epitopes and combines them to form a synthetic antigen. These studies demonstrated that a mosaic influenza virus H5 hemagglutinin expressed by a viral vector can elicit full protection against diverse H5N1 challenges as well as induce broader immunity than a wild-type hemagglutinin. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence


    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  17. Cleavage of Dicer protein by I7 protease during vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Jhih-Si Chen

    Full Text Available Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

  18. Apoptosis and necrosis in vaccinia virus-infected HeLa G and BSC-40 cells. (United States)

    Liskova, Jana; Knitlova, Jarmila; Honner, Richard; Melkova, Zora


    In most cells, vaccinia virus (VACV) infection is considered to cause a lytic cell death, an equivalent of necrosis. However, upon infection of the epithelial cell lines HeLa G and BSC-40 with VACV strain Western Reserve (WR), we have previously observed an increased activation of and activity attributable to caspases, a typical sign of apoptosis. In this paper, we have further analyzed the type of cell death in VACV-infected cells HeLa G and BSC-40. In a cell-based flow cytometric assay, we showed a specific activation of caspase-2 and 4 in HeLa G and BSC-40 cells infected with VACV, strain WR, while we did not find any effects of inhibitors of calpain and cathepsin D and E. The actual activity of the two caspases, but also of caspase-3, was then confirmed in lysates of infected HeLa G, but not in BSC-40 cells. Accordingly, poly(ADP)-ribose polymerase (PARP) cleavage was found increased only in infected HeLa G cells. Consequently, we have determined morphological features of apoptosis and/or activity of the executioner caspase-3 in infected HeLa G cells in situ, while only a background apoptosis was observed in infected BSC-40 cells. Finally, vaccination strains Dryvax and Praha were found to induce apoptosis in both HeLa G and BSC-40 cells, as characterized morphologically and by PARP cleavage. These findings may be important for understanding the differences in VACV-host interactions and post-vaccination complications in different individuals. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer. (United States)

    Yoo, So Young; Bang, Seo Young; Jeong, Su-Nam; Kang, Dae Hwan; Heo, Jeong


    Stem cell-like colon cancer cells (SCCs) pose a major challenge in colon cancer treatment because of their resistance to chemotherapy and radiotherapy. Oncolytic virus-based therapy has shown promising results in uncured cancer patients; however, its effects on SCCs are not well studied yet. Here, we engineered a cancer-favoring oncolytic vaccinia virus (CVV) as a potent biotherapeutic and investigated its therapeutic efficacy in terms of killing SCCs. CVV is an evolved Wyeth strain vaccinia virus (EVV) lacking the viral thymidine kinase. SCC models were established using human or mouse colon cancer spheres, which continuously expressed stemness markers. The cancer-favoring characteristics and different cytotoxic pathways for killing cancer cells successfully overrode general drug resistance, thereby killing colon cancer cells regardless of the presence of SCCs. Subcutaneously injected HT29 spheres showed lower growth in CVV-treated models than in 5-Fu-treated models. Intraperitoneally injected CT26 spheres induced tumor masses in the abdominal region. CVV-treated groups showed higher survival rates and smaller tumor mass formation, compared to 5-Fu-treated groups. Interestingly, the combined treatment of CVV with 5-Fu showed improved survival rates and complete suppression of tumor mass. The CVV developed in this study, thus, effectively suppresses SCCs, which can be synergistically enhanced by simultaneous treatment with the anticancer drug 5-Fu. Our novel CVV is highly advantageous as a next-generation therapeutic for treating colon cancer.

  20. Viral exploitation of the MEK/ERK pathway - A tale of vaccinia virus and other viruses. (United States)

    Bonjardim, Cláudio A


    The VACV replication cycle is remarkable in the sense that it is performed entirely in the cytoplasmic compartment of vertebrate cells, due to its capability to encode enzymes required either for regulating the macromolecular precursor pool or the biosynthetic processes. Although remarkable, this gene repertoire is not sufficient to confer the status of a free-living microorganism to the virus, and, consequently, the virus relies heavily on the host to successfully generate its progeny. During the complex virus-host interaction, viruses must deal not only with the host pathways to accomplish their temporal demands but also with pathways that counteract viral infection, including the inflammatory, innate and acquired immune responses. This review focuses on VACV and other DNA or RNA viruses that stimulate the MEK (MAPK - Mitogen Activated Protein Kinase)/ERK- Extracellular signal-Regulated Kinase) pathway as part of their replication cycle. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA)

    DEFF Research Database (Denmark)

    Cottingham, Matthew G; Andersen, Rikke F; Spencer, Alexandra J


    -length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering) of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A...... to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA), now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full......-2006). In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+) T cells against an epitope from Plasmodium berghei was created using Gal...

  2. Unintentional transfer of vaccinia virus associated with smallpox vaccines: ACAM2000(®) compared with Dryvax(®). (United States)

    Tack, Danielle M; Karem, Kevin L; Montgomery, Jay R; Collins, Limone; Bryant-Genevier, Marthe G; Tiernan, Rosemary; Cano, Maria; Lewis, Paige; Engler, Renata J M; Damon, Inger K; Reynolds, Mary G


    Routine vaccination against smallpox (variola) ceased in the US in 1976. However, in 2002 limited coverage for military personnel and some healthcare workers was reinstituted. In March 2008, ACAM2000® replaced Dryvax® as the vaccine used in the United States against smallpox. Unintentional transfer of vaccinia virus from a vaccination site by autoinoculation or contact transmission, can have significant public health implications. We summarize unintentional virus transfer AEs associated with ACAM2000® since March 2008 and compare with Dryvax®. We identified 309 reports for ACAM2000® with skin or ocular involvement, of which 93 were autoinoculation cases and 20 were contact transmission cases. The rate for reported cases of autoinoculation was 20.6 per 100,000 vaccinations and for contact transmission was 4.4 per 100,000 vaccinations. Eighteen contact transmission cases could be attributed to contact during a sporting activity (45%) or intimate contact (45%). Of the 113 unintentional transfer cases, 6 met the case definition for ocular vaccinia. The most common locations for all autoinoculation and contact cases were arm/elbow/shoulder (35/113; 31%) and face (24/113; 21%). Methods We reviewed 753 reports associated with smallpox in the Vaccine Adverse Event Reporting System and CDC Poxvirus consultation log, reported from March 2008 to August 2010. Reports were classified into categories based upon standard case definitions. Overall, unintentional transfer events for ACAM2000® and Dryvax® are similar. We recommend continued efforts to prevent transfer events and continuing education for healthcare providers focused on recognition of vaccinia lesions, proper sample collection, and laboratory testing to confirm diagnosis.

  3. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses. (United States)

    Merchlinsky, M


    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  4. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis.

    Directory of Open Access Journals (Sweden)

    Don B Gammon


    Full Text Available Ribonucleotide reductases (RRs are evolutionarily-conserved enzymes that catalyze the rate-limiting step during dNTP synthesis in mammals. RR consists of both large (R1 and small (R2 subunits, which are both required for catalysis by the R1(2R2(2 heterotetrameric complex. Poxviruses also encode RR proteins, but while the Orthopoxviruses infecting humans [e.g. vaccinia (VACV, variola, cowpox, and monkeypox viruses] encode both R1 and R2 subunits, the vast majority of Chordopoxviruses encode only R2 subunits. Using plaque morphology, growth curve, and mouse model studies, we investigated the requirement of VACV R1 (I4 and R2 (F4 subunits for replication and pathogenesis using a panel of mutant viruses in which one or more viral RR genes had been inactivated. Surprisingly, VACV F4, but not I4, was required for efficient replication in culture and virulence in mice. The growth defects of VACV strains lacking F4 could be complemented by genes encoding other Chordopoxvirus R2 subunits, suggesting conservation of function between poxvirus R2 proteins. Expression of F4 proteins encoding a point mutation predicted to inactivate RR activity but still allow for interaction with R1 subunits, caused a dominant negative phenotype in growth experiments in the presence or absence of I4. Co-immunoprecipitation studies showed that F4 (as well as other Chordopoxvirus R2 subunits form hybrid complexes with cellular R1 subunits. Mutant F4 proteins that are unable to interact with host R1 subunits failed to rescue the replication defect of strains lacking F4, suggesting that F4-host R1 complex formation is critical for VACV replication. Our results suggest that poxvirus R2 subunits form functional complexes with host R1 subunits to provide sufficient dNTPs for viral replication. Our results also suggest that R2-deficient poxviruses may be selective oncolytic agents and our bioinformatic analyses provide insights into how poxvirus nucleotide metabolism proteins may

  5. Mutations conferring resistance to viral DNA polymerase inhibitors in camelpox virus give different drug-susceptibility profiles in vaccinia virus. (United States)

    Duraffour, Sophie; Andrei, Graciela; Topalis, Dimitri; Krečmerová, Marcela; Crance, Jean-Marc; Garin, Daniel; Snoeck, Robert


    Cidofovir or (S)-HPMPC is one of the three antiviral drugs that might be used for the treatment of orthopoxvirus infections. (S)-HPMPC and its 2,6-diaminopurine counterpart, (S)-HPMPDAP, have been described to select, in vitro, for drug resistance mutations in the viral DNA polymerase (E9L) gene of vaccinia virus (VACV). Here, to extend our knowledge of drug resistance development among orthopoxviruses, we selected, in vitro, camelpox viruses (CMLV) resistant to (S)-HPMPDAP and identified a single amino acid change, T831I, and a double mutation, A314V+A684V, within E9L. The production of recombinant CMLV and VACV carrying these amino acid substitutions (T831I, A314V, or A314V+A684V) demonstrated clearly their involvement in conferring reduced sensitivity to viral DNA polymerase inhibitors, including (S)-HPMPDAP. Both CMLV and VACV harboring the A314V change showed comparable drug-susceptibility profiles to various antivirals and similar impairments in viral growth. In contrast, the single change T831I and the double change A314V+A684V in VACV were responsible for increased levels of drug resistance and for cross-resistance to viral DNA polymerase antivirals that were not observed with their CMLV counterparts. Each amino acid change accounted for an attenuated phenotype of VACV in vivo. Modeling of E9L suggested that the T→I change at position 831 might abolish hydrogen bonds between E9L and the DNA backbone and have a direct impact on the incorporation of the acyclic nucleoside phosphonates. Our findings demonstrate that drug-resistance development in two related orthopoxvirus species may impact drug-susceptibility profiles and viral fitness differently.

  6. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  7. Recombinant vaccinia DIs expressing simian immunodeficiency virus gag and pol in mammalian cells induces efficient cellular immunity as a safe immunodeficiency virus vaccine candidate. (United States)

    Okamura, Tomotaka; Someya, Kenji; Matsuo, Kazuhiro; Hasegawa, Atsuhiko; Yamamoto, Naoki; Honda, Mitsuo


    A highly attenuated vaccinia virus substrain of Dairen-I (DIs) shows promise as a candidate vector for eliciting positive immunity against immune deficiency virus. DIs was randomly obtained by serial 1-day egg passages of a chorioarantoic membrane-adapted Dairen strain (DIE), resulting in substantial genomic deletion, including various genes regulating the virus-host-range. To investigate the impact of that deletion and of the subsequent insertion of a foreign gene into that region of DIs on the ability of the DIs recombinant to induce antigen-specific immunity, we generated a recombinant vaccinia DIs expressing fulllength gag and pol genes of simian immunodeficiency virus (SIV) (rDIsSIV gag/pol) and studied the biological and immunological characteristics of the recombinant natural mutant. The rDIsSIV gag/pol developed a tiny plaque on the chick embryo fibroblast (CEF). Viral particles of rDIsSIV gag/pol as well as SIV Gag-like particles were electromicroscopically detected in the cytoplasm. Interestingly, the recombinant DIs strain grows well in CEF cells but not in mammalian cells. While rDIsSIV gag/pol produces SIV proteins in mammalian HeLa and CV-1 cells, recombinant modified vaccinia Ankara strain (MVA) expressing SIV gag and pol genes (MVA/SIV239 gag/pol) clearly replicates in HeLa and CV-1 cell lines under synchronized growth conditions and produces the SIV protein in all cell lines. Moreover, intradermal administration of rDIsSIV gag/pol or of MVA/SIV239 gag/pol elicited similar levels of IFN-gamma spot-forming cells specific for SIV Gag. If the non-productive infection characteristically induced by recombinant DIs is sufficient to trigger immune induction, as we believe it is, then a human immunodeficiency virus vaccine employing the DIs recombinant would have the twin advantages of being both effective and safe.

  8. The NYCBH vaccinia virus deleted for the innate immune evasion gene, E3L, protects rabbits against lethal challenge by rabbitpox virus (United States)

    Denzler, Karen L; Rice, Amanda D; MacNeill, Amy L; Fukushima, Nobuko; Lindsey, Scott F; Wallace, Greg; Burrage, Andrew M; Smith, Andrew J; Manning, Brandi R; Swetnam, Daniele M; Gray, Stacey A; Moyer, RW; Jacobs, Bertram L


    Vaccinia virus deleted for the innate immune evasion gene, E3L, has been shown to be highly attenuated and yet induces a protective immune response against challenge by homologous virus in a mouse model. In this manuscript the NYCBH vaccinia virus vaccine strain was compared to NYCBH vaccinia virus deleted for E3L (NYCBHΔE3L) in a rabbitpox virus (RPV) challenge model. Upon scarification, both vaccines produced a desired skin lesion, although the lesion produced by NYCBHΔE3L was smaller. Both vaccines fully protected rabbits against lethal challenge by escalating doses of RPV, from 10 LD50 to 1,000 LD50. A single dose of NYCBHΔE3L protected rabbits from weight loss, fever, and clinical symptoms following the lowest dose challenge of 10 LD50, however it allowed a moderate level of RPV replication at the challenge site, some spread to external skin and mucosal surfaces, and increased numbers of secondary lesions as compared to vaccination with NYCBH. Alternately, two doses of NYCBHΔE3L fully protected rabbits from weight loss, fever, and clinical symptoms, following challenge with 100 to 1,000 LD50 RPV, and it prevented development of secondary lesions similar to protection seen with NYCBH. Finally, vaccination with either one or two doses of NYCBHΔE3L resulted in similar neutralizing antibody titers following RPV challenge as compared to titers obtained by vaccination with NYCBH. These results support the efficacy of the attenuated NYCBHΔE3L in protection against an orthologous poxvirus challenge. PMID:21840358

  9. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)


    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  10. Vaccinia viruses isolated from skin infection in horses produced cutaneous and systemic disease in experimentally infected rabbits. (United States)

    Cargnelutti, Juliana Felipetto; Schmidt, Candice; Masuda, Eduardo Kenji; Nogueira, Paula Rochelle Kurrle; Weiblen, Rudi; Flores, Eduardo Furtado


    The susceptibility of rabbits to two isolates of Vaccinia virus (VACV) recovered from cutaneous disease in horses in Southern Brazil was investigated. Rabbits were inoculated in the ear skin with both VACV isolates, either in single or mixed infection. All inoculated animals presented local skin lesions characterized by hyperaemia, papules, vesicles, pustules and ulcers. Infectious virus was detected in the lungs and intestine of rabbits that died during acute disease. Histological examination of the skin revealed changes characteristic of those associated with members of the genus Orthopoxvirus. These results demonstrate that rabbits develop skin disease accompanied by systemic signs upon intradermal inoculation of these two equine VACV isolates, either alone or in combination, opening the way for using rabbits to study selected aspects of the biology and pathogenesis of VACV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Myristoylation increases the CD8+T-cell response to a GFP prototype antigen delivered by modified vaccinia virus Ankara. (United States)

    Marr, Lisa; Lülf, Anna-Theresa; Freudenstein, Astrid; Sutter, Gerd; Volz, Asisa


    Activation of CD8(+)T-cells is an essential part of immune responses elicited by recombinant modified vaccinia virus Ankara (MVA). Strategies to enhance T-cell responses to antigens may be particularly necessary for broadly protective immunization against influenza A virus infections or for candidate vaccines targeting chronic infections and cancer. Here, we tested recombinant MVAs that targeted a model antigen, GFP, to different localizations in infected cells. In vitro characterization demonstrated that GFP accumulated in the nucleus (MVA-nls-GFP), associated with cellular membranes (MVA-myr-GFP) or was equally distributed throughout the cell (MVA-GFP). On vaccination, we found significantly higher levels of GFP-specific CD8(+)T-cells in MVA-myr-GFP-vaccinated BALB/c mice than in those immunized with MVA-GFP or MVA-nls-GFP. Thus, myristoyl modification may be a useful strategy to enhance CD8(+)T-cell responses to MVA-delivered target antigens.

  12. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy (United States)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)


    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  13. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015. (United States)

    Petersen, Brett W; Harms, Tiara J; Reynolds, Mary G; Harrison, Lee H


    On June 25, 2015, the Advisory Committee on Immunization Practices (ACIP) recommended routine vaccination with live smallpox (vaccinia) vaccine (ACAM2000) for laboratory personnel who directly handle 1) cultures or 2) animals contaminated or infected with replication-competent vaccinia virus, recombinant vaccinia viruses derived from replication-competent vaccinia strains (i.e., those that are capable of causing clinical infection and producing infectious virus in humans), or other orthopoxviruses that infect humans (e.g., monkeypox, cowpox, and variola) (recommendation category: A, evidence type 2 [Box]). Health care personnel (e.g., physicians and nurses) who currently treat or anticipate treating patients with vaccinia virus infections and whose contact with replication-competent vaccinia viruses is limited to contaminated materials (e.g., dressings) and persons administering ACAM2000 smallpox vaccine who adhere to appropriate infection prevention measures can be offered vaccination with ACAM2000 (recommendation category: B, evidence type 2 [Box]). These revised recommendations update the previous ACIP recommendations for nonemergency use of vaccinia virus smallpox vaccine for laboratory and health care personnel at risk for occupational exposure to orthopoxviruses (1). Since 2001, when the previous ACIP recommendations were developed, ACAM2000 has replaced Dryvax as the only smallpox vaccine licensed by the U.S. Food and Drug Administration (FDA) and available for use in the United States (2). These recommendations contain information on ACAM2000 and its use in laboratory and health care personnel at risk for occupational exposure to orthopoxviruses.

  14. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene. (United States)

    Heine, H G; Stevens, M P; Foord, A J; Boyle, D B


    Sheeppoxvirus (SPV), goatpoxvirus (GPV) and lumpy skin disease virus (LSDV) of cattle belong to the Capripoxvirus genus of the Poxviridae family and can cause significant economic losses in countries where they are endemic. Capripox diagnosis by classical virological methods dependent on live capripox virus is not suitable in countries such as Australia where the virus is exotic and live virus is not available. To develop diagnostic tests based on recombinant material, we cloned and sequenced a 3.7 kb viral DNA fragment of SPV that contained open reading frames homologous to the vaccinia virus J6R, H1L, H2R, H3L and H4L genes. A capripoxvirus specific PCR assay was developed that differentiated between SPV and LSDV on the basis of unique restriction sites in the corresponding PCR fragments. The vaccinia virus H3L homolog was identified as the capripoxvirus P32 antigen. The P32 proteins of SPV and LSDV were expressed in Escherichia coli as a fusion protein with a poly-histidine tag and affinity purified on metal binding resin. The full-length P32 protein contained a transmembrane region close to the carboxy terminus and was membrane associated but could be solubilised in detergent and used as trapping antigen in an antibody detection ELISA. The ELISA was specific for capripoxvirus as only sera from sheep infected with capripoxvirus but not orf or vaccinia virus reacted with the capripoxvirus P32 antigen.

  15. Immunogenicity and virulence of attenuated vaccinia virus Tian Tan encoding HIV-1 muti-epitope genes, p24 and cholera toxin B subunit in mice. (United States)

    Du, Shouwen; Wang, Yuhang; Liu, Cunxia; Wang, Maopeng; Zhu, Yilong; Tan, Peng; Ren, Dayong; Li, Xiao; Tian, Mingyao; Yin, Ronglan; Li, Chang; Jin, Ningyi


    No effective prophylactic or therapeutic vaccine against HIV-1 in humans is currently available. This study analyzes the immunogenicity and safety of a recombinant attenuated vaccinia virus. A chimeric gene of HIV-1 multi-epitope genes containing CpG ODN and cholera toxin B subunit (CTB) was inserted into Chinese vaccinia virus Tian Tan strain (VTT) mutant strain. The recombinant virus rddVTT(-CCMp24) was assessed for immunogenicity and safety in mice. Results showed that the protein CCMp24 was expressed stably in BHK-21 infected with rddVTT(-CCMp24). And the recombinant virus induced the production of HIV-1 p24 specific immunoglobulin G (IgG), IL-2 and IL-4. The recombinant vaccine induced γ-interferon secretion against HIV peptides, and elicited a certain levels of immunological memory. Results indicated that the recombinant virus had certain immunogenicity to HIV-1. Additionally, the virulence of the recombinant virus was been attenuated in vivo of mice compared with wild type VTT (wtVTT), and the introduction of CTB and HIV Mp24 did not alter the infectivity and virulence of defective vaccinia virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation (United States)

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael


    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in actin tail formation. In this study we have sought to understand how these proteins, all of which are predicted to have small cytoplasmic domains, are involved in IEV assembly and actin tail formation. Our data reveal that while deletion of A34R, B5R, or F13L resulted in a severe reduction in IEV particle assembly, IEVs formed by the ΔB5R and ΔF13L deletion strains, but not ΔA34R, were still able to induce actin tails. The ΔA36R deletion strain produced normal amounts of IEV particles, although these were unable to induce actin tails. Using several different approaches, we demonstrated that A36R is a type Ib membrane protein with a large, 195-amino-acid cytoplasmic domain exposed on the surface of IEV particles. Finally, coimmunoprecipitation experiments demonstrated that A36R interacts with A33R and A34R but not with B5R and that B5R forms a complex with A34R but not with A33R or A36R. Using extracts from ΔA34R- and ΔA36R-infected cells, we found that the interaction of A36R with A33R and that of A34R with B5R are independent of A34R and A36R, respectively. We conclude from our observations that multiple interactions between IEV membrane proteins exist which have important implications for IEV assembly and actin tail formation. Furthermore, these data suggest that while A34R is involved in IEV assembly and organization, A36R is critical for actin tail formation. PMID:10074134

  17. Live vaccinia-rabies virus recombinants, but not an inactivated rabies virus cell culture vaccine, protect B-lymphocyte-deficient A/WySnJ mice against rabies: considerations of recombinant defective poxviruses for rabies immunization of immunocompromised individuals. (United States)

    Lodmell, Donald L; Esposito, Joseph J; Ewalt, Larry C


    Presently, commercially available cell culture rabies vaccines for humans and animals consist of the five inactivated rabies virus proteins. The vaccines elicit a CD4+ helper T-cell response and a humoral B-cell response against the viral glycoprotein (G) resulting in the production of virus neutralizing antibody. Antibody against the viral nucleoprotein (N) is also present, but the mechanism(s) of its protection is unclear. HIV-infected individuals with low CD4+ T-lymphocyte counts and individuals undergoing treatment with immunosuppressive drugs have an impaired neutralizing antibody response after pre- and post-exposure immunization with rabies cell culture vaccines. Here we show the efficacy of live vaccinia-rabies virus recombinants, but not a cell culture vaccine consisting of inactivated rabies virus, to elicit elevated levels of neutralizing antibody in B-lymphocyte deficient A/WySnJ mice. The cell culture vaccine also failed to protect the mice, whereas a single immunization of a vaccinia recombinant expressing the rabies virus G or co-expressing G and N equally protected the mice up to 18 months after vaccination. The data suggest that recombinant poxviruses expressing the rabies virus G, in particular replication defective poxviruses such as canarypox or MVA vaccinia virus that undergo abortive replication in non-avian cells, or the attenuated vaccinia virus NYVAC, should be evaluated as rabies vaccines in immunocompromised individuals.

  18. Both NK cell-intrinsic and -extrinsic STAT1 signaling are required for NK cell response against vaccinia virus. (United States)

    Fortin, Carl; Huang, Xiaopei; Yang, Yiping


    NK cells play an important role in innate immune control of the infection with vaccinia virus (VV). However, it remains incompletely defined how the activation of NK cells in response to VV is regulated. In this study, we showed that STAT1 was critical for NK cell activation upon VV infection and the subsequent clearance of VV infection in vivo. We further demonstrated that STAT1 signaling in both NK and accessory cells such as dendritic cells was required for efficient NK cell activation upon VV infection. Mechanistically, STAT1 signaling in dendritic cells promoted the expression of NKG2D ligands, which is required for NK cell activation via the NKG2D pathway. Taken together, our data suggest that STAT1 mediates anti-VV effect by promoting NK cell activation through both NK-intrinsic and extrinsic mechanisms and may provide insights into the design of effective NK cell-based therapies for viral infections.

  19. Regression of Human Prostate Tumors and Metastases in Nude Mice following Treatment with the Recombinant Oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev


    Full Text Available Virotherapy using oncolytic vaccinia virus strains is one of the most promising new strategies for cancer therapy. In the current study, we analyzed the therapeutic efficacy of the oncolytic vaccinia virus GLV-1h68 against two human prostate cancer cell lines DU-145 and PC-3 in cell culture and in tumor xenograft models. By viral proliferation assays and cell survival tests, we demonstrated that GLV-1h68 was able to infect, replicate in, and lyse these prostate cancer cells in culture. In DU-145 and PC-3 tumor xenograft models, a single intravenous injection with GLV-1h68 resulted in a significant reduction of primary tumor size. In addition, the GLV-1h68-infection led to strong inflammatory and oncolytic effects resulting in drastic reduction of regional lymph nodes with PC-3 metastases. Our data documented that the GLV-1h68 virus has a great potential for treatment of human prostate carcinoma.

  20. Vaccinia virus outperforms a panel of other poxviruses as a potent oncolytic agent for the control of head and neck squamous cell carcinoma cell lines. (United States)

    Nichols, Anthony C; Yoo, John; Um, Sung; Mundi, Neil; Palma, David A; Fung, Kevin; Macneil, S Danielle; Koropatnick, James; Mymryk, Joe S; Barrett, John W


    Head and neck squamous cell carcinoma (HNSCC) is the fifth most common cancer worldwide. Existing therapies for advanced tumors have high failure rates and can have severe consequences in terms of pain, disfigurement, and poor speech and swallowing function. New treatment strategies are needed to improve outcomes for patients suffering with this disease and oncolytic viruses represent a promising approach. We infected six well-characterized HNSCC cell lines (Cal27, Detroit562, FaDu, SCC4, SCC15, SCC25), with increasing doses of a panel of poxviruses (including myxoma, vaccinia, raccoonpox and tanapox viruses) modified to express green fluorescence protein to determine which virus was the most effective oncolytic agent in cell-based assays. While myxoma, raccoonpox and tanapox displayed differing efficacy in the panel of cell lines, vaccinia virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all cell lines. Oncolytic poxviruses, particularly vaccinia virus, were effective in killing HNSCC in vitro and hold promise as potential treatments for patients with HNSCC. Copyright © 2013 S. Karger AG, Basel.

  1. Genetic Confirmation that the H5 Protein Is Required for Vaccinia Virus DNA Replication. (United States)

    Boyle, Kathleen A; Greseth, Matthew D; Traktman, Paula


    The duplication of the poxvirus double-stranded DNA genome occurs in cytoplasmic membrane-delimited factories. This physical autonomy from the host nucleus suggests that poxvirus genomes encode the full repertoire of proteins committed for genome replication. Biochemical and genetic analyses have confirmed that six viral proteins are required for efficient DNA synthesis; indirect evidence has suggested that the multifunctional H5 protein may also have a role. Here we show that H5 localizes to replication factories, as visualized by immunofluorescence and immunoelectron microscopy, and can be retrieved upon purification of the viral polymerase holoenzyme complex. The temperature-sensitive (ts) mutant Dts57, which was generated by chemical mutagenesis and has a lesion in H5, exhibits defects in DNA replication and morphogenesis under nonpermissive conditions, depending upon the experimental protocol. The H5 variant encoded by the genome of this mutant is ts for function but not stability. For a more precise investigation of how H5 contributes to DNA synthesis, we placed the ts57 H5 allele in an otherwise wild-type viral background and also performed small interfering RNA-mediated depletion of H5. Finally, we generated a complementing cell line, CV-1-H5, which allowed us to generate a viral recombinant in which the H5 open reading frame was deleted and replaced with mCherry (vΔH5). Analysis of vΔH5 allowed us to demonstrate conclusively that viral DNA replication is abrogated in the absence of H5. The loss of H5 does not compromise the accumulation of other early viral replication proteins or the uncoating of the virion core, suggesting that H5 plays a direct and essential role in facilitating DNA synthesis. Variola virus, the causative agent of smallpox, is the most notorious member of the Poxviridae family. Poxviruses are unique among DNA viruses that infect mammalian cells, in that their replication is restricted to the cytoplasm of the cell. This physical

  2. Human and animal infections by vaccinia-like viruses in the state of Rio de Janeiro: a novel expanding zoonosis. (United States)

    Schatzmayr, H G; Costa, R V C; Gonçalves, M C R; D'Andréa, P S; Barth, O M


    Since 1999, vesicular infections caused by Orthopoxvirus in humans and animals, mainly in dairy cattle, have been identified in 20 municipalities in the Rio de Janeiro state of Brazil. This paper describes studies conducted in counties of the northwestern, middle-Paraíba Valley and southern regions of the Rio de Janeiro state where 77 human, 346 bovine and 78 rodent samples were collected over the past ten years. Laboratory investigations using virus isolation, electron microscopy, molecular biology (PCR) and serological analysis confirmed Orthopoxvirus infections in 77.9% of human, 49.2% of dairy cattle and 17.9% of rodent samples. The characterisation of the Cantagalo/IOC strain reconfirmed that this virus was a vaccinia-like virus. In other regions of the Rio de Janeiro state, vesicular/pustular infections in animals and humans are suspected but these have not yet been confirmed. A continuous surveillance system has been established to monitor these regions in addition to several other states of the Brazilian Federation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. A marker-free system for highly efficient construction of vaccinia virus vectors using CRISPR Cas9

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    Full Text Available The current method for creation of vaccinia virus (VACV vectors involves using a selection and purification marker, however inclusion of a gene without therapeutic value in the resulting vector is not desirable for clinical use. The Cre-LoxP system has been used to make marker-free Poxviruses, but the efficiency was very low. To obtain a marker-free VACV vector, we developed marker gene excision systems to modify the thymidine kinase (TK region and N1L regions using Cre-Loxp and Flp-FRET systems respectively. CRISPR-Cas9 system significantly resulted in a high efficiency (∼90% in generation of marker gene-positive TK-mutant VACV vector. The marker gene (RFP could be excised from the recombinant virus using Cre recombinase. To make a marker-free VV vector with double gene deletions targeting the TK and N1L gene, we constructed a donor repair vector targeting the N1L gene, which can carry a therapeutic gene and the marker (RFP that could be excised from the recombinant virus using Flp recombinase. The marker-free system developed here can be used to efficiently construct VACV vectors armed with any therapeutic genes in the TK region or N1L region without marker genes. Our marker-free system platform has significant potential for development of new marker-free VACV vectors for clinical application.

  4. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

    Directory of Open Access Journals (Sweden)

    Matthew G Cottingham


    Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

  5. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses


    Dowall, Stuart D.; Graham, Victoria A.; Emma Rayner; Laura Hunter; Robert Watson; Irene Taylor; Antony Rule; Carroll, Miles W.; Roger Hewson


    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. I...

  6. Human vaccinia-like virus outbreaks in São Paulo and Goiás States, Brazil: virus detection, isolation and identification Surtos de vírus Vaccinia-like nos Estados de São Paulo e Goiás, Brasil: detecção, isolamento e identificação viral

    Directory of Open Access Journals (Sweden)

    Teresa Keico Nagasse-Sugahara


    Full Text Available Since October 2001, the Adolfo Lutz Institute has been receiving vesicular fluids and scab specimens of patients from Paraíba Valley region in the São Paulo and Minas Gerais States and from São Patricio Valley, in the Goiás State. Epidemiological data suggested that the outbreaks were caused by Cowpox virus or Vaccinia virus. Most of the patients are dairy milkers that had vesiculo-pustular lesions on the hands, arms, forearms, and some of them, on the face. Virus particles with orthopoxvirus morphology were detected by direct electron microscopy (DEM in samples of 49 (66.21% patients of a total of 74 analyzed. Viruses were isolated in Vero cell culture and on chorioallantoic membrane (CAM of embryonated chicken eggs. Among 21 samples submitted to PCR using primers for hemagglutinin (HA gene, 19 were positive. Restriction digestion with TaqI resulted in four characteristic Vaccinia virus fragments. HA nucleotide sequences showed 99.9% similarity with Cantagalo virus, described as a strain of Vaccinia virus. The only difference observed was the substitution of one nucleotide in the position 616 leading to change in one amino acid of the protein in the position 206. The phylogenetic analysis showed that the isolates clustered together with Cantagalo virus, other Vaccinia strains and Rabbitpox virus.A partir de outubro de 2001, o Instituto Adolfo Lutz tem recebido amostras de líquido vesicular e crostas de lesões de pele de pacientes das regiões do Vale do Paraíba, Estado de São Paulo e do Vale do São Patricio, Estado de Goiás. Os dados clínicos e epidemiológicos sugeriam que os surtos poderiam ser causados por Cowpox virus ou Vaccinia virus. A maioria dos pacientes era ordenhadores que tinham lesões vesicopustulares nas mãos, braços, antebraços e alguns na face. A análise por microscopia eletrônica direta (MED detectou partículas com morfologia de vírus do gênero Orthopoxvirus em amostras de 49 (66,21% pacientes dos 74

  7. Inhibition of Translation Initiation by Protein 169: A Vaccinia Virus Strategy to Suppress Innate and Adaptive Immunity and Alter Virus Virulence.

    Directory of Open Access Journals (Sweden)

    Pavla Strnadova


    Full Text Available Vaccinia virus (VACV is the prototypic orthopoxvirus and the vaccine used to eradicate smallpox. Here we show that VACV strain Western Reserve protein 169 is a cytoplasmic polypeptide expressed early during infection that is excluded from virus factories and inhibits the initiation of cap-dependent and cap-independent translation. Ectopic expression of protein 169 causes the accumulation of 80S ribosomes, a reduction of polysomes, and inhibition of protein expression deriving from activation of multiple innate immune signaling pathways. A virus lacking 169 (vΔ169 replicates and spreads normally in cell culture but is more virulent than parental and revertant control viruses in intranasal and intradermal murine models of infection. Intranasal infection by vΔ169 caused increased pro-inflammatory cytokines and chemokines, infiltration of pulmonary leukocytes, and lung weight. These alterations in innate immunity resulted in a stronger CD8+ T-cell memory response and better protection against virus challenge. This work illustrates how inhibition of host protein synthesis can be a strategy for virus suppression of innate and adaptive immunity.

  8. Inhibition of Translation Initiation by Protein 169: A Vaccinia Virus Strategy to Suppress Innate and Adaptive Immunity and Alter Virus Virulence. (United States)

    Strnadova, Pavla; Ren, Hongwei; Valentine, Robert; Mazzon, Michela; Sweeney, Trevor R; Brierley, Ian; Smith, Geoffrey L


    Vaccinia virus (VACV) is the prototypic orthopoxvirus and the vaccine used to eradicate smallpox. Here we show that VACV strain Western Reserve protein 169 is a cytoplasmic polypeptide expressed early during infection that is excluded from virus factories and inhibits the initiation of cap-dependent and cap-independent translation. Ectopic expression of protein 169 causes the accumulation of 80S ribosomes, a reduction of polysomes, and inhibition of protein expression deriving from activation of multiple innate immune signaling pathways. A virus lacking 169 (vΔ169) replicates and spreads normally in cell culture but is more virulent than parental and revertant control viruses in intranasal and intradermal murine models of infection. Intranasal infection by vΔ169 caused increased pro-inflammatory cytokines and chemokines, infiltration of pulmonary leukocytes, and lung weight. These alterations in innate immunity resulted in a stronger CD8+ T-cell memory response and better protection against virus challenge. This work illustrates how inhibition of host protein synthesis can be a strategy for virus suppression of innate and adaptive immunity.

  9. RNA-Seq Based Transcriptome Analysis of the Type I Interferon Host Response upon Vaccinia Virus Infection of Mouse Cells

    Directory of Open Access Journals (Sweden)

    Bruno Hernáez


    Full Text Available Vaccinia virus (VACV encodes the soluble type I interferon (IFN binding protein B18 that is secreted from infected cells and also attaches to the cell surface, as an immunomodulatory strategy to inhibit the host IFN response. By using next generation sequencing technologies, we performed a detailed RNA-seq study to dissect at the transcriptional level the modulation of the IFN based host response by VACV and B18. Transcriptome profiling of L929 cells after incubation with purified recombinant B18 protein showed that attachment of B18 to the cell surface does not trigger cell signalling leading to transcriptional activation. Consistent with its ability to bind type I IFN, B18 completely inhibited the IFN-mediated modulation of host gene expression. Addition of UV-inactivated virus particles to cell cultures altered the expression of a set of 53 cellular genes, including genes involved in innate immunity. Differential gene expression analyses of cells infected with replication competent VACV identified the activation of a broad range of host genes involved in multiple cellular pathways. Interestingly, we did not detect an IFN-mediated response among the transcriptional changes induced by VACV, even after the addition of IFN to cells infected with a mutant VACV lacking B18. This is consistent with additional viral mechanisms acting at different levels to block IFN responses during VACV infection.

  10. Linear Epitopes in Vaccinia Virus A27 Are Targets of Protective Antibodies Induced by Vaccination against Smallpox. (United States)

    Kaever, Thomas; Matho, Michael H; Meng, Xiangzhi; Crickard, Lindsay; Schlossman, Andrew; Xiang, Yan; Crotty, Shane; Peters, Bjoern; Zajonc, Dirk M


    Vaccinia virus (VACV) A27 is a target for viral neutralization and part of the Dryvax smallpox vaccine. A27 is one of the three glycosaminoglycan (GAG) adhesion molecules and binds to heparan sulfate. To understand the function of anti-A27 antibodies, especially their protective capacity and their interaction with A27, we generated and subsequently characterized 7 murine monoclonal antibodies (MAbs), which fell into 4 distinct epitope groups (groups I to IV). The MAbs in three groups (groups I, III, and IV) bound to linear peptides, while the MAbs in group II bound only to VACV lysate and recombinant A27, suggesting that they recognized a conformational and discontinuous epitope. Only group I antibodies neutralized the mature virion in a complement-dependent manner and protected against VACV challenge, while a group II MAb partially protected against VACV challenge but did not neutralize the mature virion. The epitope for group I MAbs was mapped to a region adjacent to the GAG binding site, a finding which suggests that group I MAbs could potentially interfere with the cellular adhesion of A27. We further determined the crystal structure of the neutralizing group I MAb 1G6, as well as the nonneutralizing group IV MAb 8E3, bound to the corresponding linear epitope-containing peptides. Both the light and the heavy chains of the antibodies are important in binding to their antigens. For both antibodies, the L1 loop seems to dominate the overall polar interactions with the antigen, while for MAb 8E3, the light chain generally appears to make more contacts with the antigen. Vaccinia virus is a powerful model to study antibody responses upon vaccination, since its use as the smallpox vaccine led to the eradication of one of the world's greatest killers. The immunodominant antigens that elicit the protective antibodies are known, yet for many of these antigens, little information about their precise interaction with antibodies is available. In an attempt to better

  11. Imaging characteristics, tissue distribution, and spread of a novel oncolytic vaccinia virus carrying the human sodium iodide symporter.

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    Full Text Available INTRODUCTION: Oncolytic viruses show promise for treating cancer. However, to assess therapy and potential toxicity, a noninvasive imaging modality is needed. This study aims to determine the in vivo biodistribution, and imaging and timing characteristics of a vaccinia virus, GLV-1h153, encoding the human sodium iodide symporter (hNIS. METHODS: GLV-1h153 was modified from GLV-1h68 to encode the hNIS gene. Timing of cellular uptake of radioiodide (131I in human pancreatic carcinoma cells PANC-1 was assessed using radiouptake assays. Viral biodistribution was determined in nude mice bearing PANC-1 xenografts, and infection in tumors confirmed histologically and optically via Green Fluorescent Protein (GFP and bioluminescence. Timing characteristics of enhanced radiouptake in xenografts were assessed via (124I-positron emission tomography (PET. Detection of systemic administration of virus was investigated with both (124I-PET and 99m-technecium gamma-scintigraphy. RESULTS: GLV-1h153 successfully facilitated time-dependent intracellular uptake of (131I in PANC-1 cells with a maximum uptake at 24 hours postinfection (P<0.05. In vivo, biodistribution profiles revealed persistence of virus in tumors 5 weeks postinjection at 10(9 plaque-forming unit (PFU/gm tissue, with the virus mainly cleared from all other major organs. Tumor infection by GLV-1h153 was confirmed via optical imaging and histology. GLV-1h153 facilitated imaging virus replication in tumors via PET even at 8 hours post radiotracer injection, with a mean %ID/gm of 3.82 ± 0.46 (P<0.05 2 days after intratumoral administration of virus, confirmed via tissue radiouptake assays. One week post systemic administration, GLV-1h153-infected tumors were detected via (124I-PET and 99m-technecium-scintigraphy. CONCLUSION: GLV-1h153 is a promising oncolytic agent against pancreatic cancer with a promising biosafety profile. GLV-1h153 facilitated time-dependent hNIS-specific radiouptake in pancreatic

  12. Safety, immunogenicity, and efficacy of prime-boost immunization with recombinant poxvirus FP9 and modified vaccinia virus Ankara encoding the full-length Plasmodium falciparum circumsporozoite protein. (United States)

    Walther, Michael; Thompson, Fiona M; Dunachie, Susanna; Keating, Sheila; Todryk, Stephen; Berthoud, Tamara; Andrews, Laura; Andersen, Rikke F; Moore, Anne; Gilbert, Sarah C; Poulton, Ian; Dubovsky, Filip; Tierney, Eveline; Correa, Simon; Huntcooke, Angela; Butcher, Geoffrey; Williams, Jack; Sinden, Robert E; Hill, Adrian V S


    Heterologous prime-boost immunization with DNA and various recombinant poxviruses encoding malaria antigens is capable of inducing strong cell-mediated immune responses and partial protection in human sporozoite challenges. Here we report a series of trials assessing recombinant fowlpox virus and modified vaccinia virus Ankara encoding the Plasmodium falciparum circumsporozoite protein in various prime-boost combinations, doses, and application routes. For the first time, these vaccines were administered intramuscularly and at doses of up to 5 x 10(8) PFU. Vaccines containing this antigen proved safe and induced modest immune responses but showed no evidence of efficacy in a sporozoite challenge.

  13. The membrane fusion step of vaccinia virus entry is cooperatively mediated by multiple viral proteins and host cell components.

    Directory of Open Access Journals (Sweden)

    Jason P Laliberte


    Full Text Available For many viruses, one or two proteins allow cell attachment and entry, which occurs through the plasma membrane or following endocytosis at low pH. In contrast, vaccinia virus (VACV enters cells by both neutral and low pH routes; four proteins mediate cell attachment and twelve that are associated in a membrane complex and conserved in all poxviruses are dedicated to entry. The aim of the present study was to determine the roles of cellular and viral proteins in initial stages of entry, specifically fusion of the membranes of the mature virion and cell. For analysis of the role of cellular components, we used well characterized inhibitors and measured binding of a recombinant VACV virion containing Gaussia luciferase fused to a core protein; viral and cellular membrane lipid mixing with a self-quenching fluorescent probe in the virion membrane; and core entry with a recombinant VACV expressing firefly luciferase and electron microscopy. We determined that inhibitors of tyrosine protein kinases, dynamin GTPase and actin dynamics had little effect on binding of virions to cells but impaired membrane fusion, whereas partial cholesterol depletion and inhibitors of endosomal acidification and membrane blebbing had a severe effect at the later stage of core entry. To determine the role of viral proteins, virions lacking individual membrane components were purified from cells infected with members of a panel of ten conditional-lethal inducible mutants. Each of the entry protein-deficient virions had severely reduced infectivity and except for A28, L1 and L5 greatly impaired membrane fusion. In addition, a potent neutralizing L1 monoclonal antibody blocked entry at a post-membrane lipid-mixing step. Taken together, these results suggested a 2-step entry model and implicated an unprecedented number of viral proteins and cellular components involved in signaling and actin rearrangement for initiation of virus-cell membrane fusion during poxvirus entry.

  14. NK cell-extrinsic IL-18 signaling is required for efficient NK-cell activation by vaccinia virus. (United States)

    Brandstadter, Joshua D; Huang, Xiaopei; Yang, Yiping


    NK cells are important for the control of vaccinia virus (VV) in vivo. Recent studies have shown that multiple pathways are required for effective activation of NK cells. These include both TLR-dependent and -independent pathways, as well as the NKG2D activating receptor that recognizes host stress-induced NKG2D ligands. However, it remains largely unknown what controls the upregulation of NKG2D ligands in response to VV infection. In this study using C57BL/6 mice, we first showed that IL-18 is critical for NK-cell activation and viral clearance. We then demonstrated that IL-18 signaling on both NK cells and DCs is required for efficient NK-cell activation upon VV infection in vitro. We further showed in vivo that efficient NK-cell activation in response to VV is dependent on DCs and IL-18 signaling in non-NK cells, suggesting an essential role for NK cell-extrinsic IL-18 signaling in NK-cell activation. Mechanistically, IL-18 signaling in DCs promotes expression of Rae-1, an NKG2D ligand. Collectively, our data reveal a previously unrecognized role for NK cell-extrinsic IL-18 signaling in NK-cell activation through upregulation of NKG2D ligands. These observations may provide insights into the design of effective NK-cell-based therapies for viral infections and cancer. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Systemic treatment of xenografts with vaccinia virus GLV-1h68 reveals the immunologic facet of oncolytic therapy

    Directory of Open Access Journals (Sweden)

    Liu Hui


    Full Text Available Abstract Background GLV-1h68 is an attenuated recombinant vaccinia virus (VACV that selectively colonizes established human xenografts inducing their complete regression. Results Here, we explored xenograft/VACV/host interactions in vivo adopting organism-specific expression arrays and tumor cell/VACV in vitro comparing VACV replication patterns. There were no clear-cut differences in vitro among responding and non-responding tumors, however, tumor rejection was associated in vivo with activation of interferon-stimulated genes (ISGs and innate immune host's effector functions (IEFs correlating with VACV colonization of the xenografts. These signatures precisely reproduce those observed in humans during immune-mediated tissue-specific destruction (TSD that causes tumor or allograft rejection, autoimmunity or clearance of pathogens. We recently defined these common pathways in the "immunologic constant of rejection" hypothesis (ICR. Conclusion This study provides the first prospective validation of a universal mechanism associated with TSD. Thus, xenograft infection by oncolytic VACV, beyond offering a promising therapy of established cancers, may represent a reliable pre-clinical model to test therapeutic strategies aimed at modulating the central pathways leading to TSD; this information may lead to the identification of principles that could refine the treatment of cancer and chronic infection by immune stimulation or autoimmunity and allograft rejection through immune tolerance.

  16. Oral vaccination of wildlife using a vaccinia-rabies-glycoprotein recombinant virus vaccine (RABORAL V-RG®): a global review. (United States)

    Maki, Joanne; Guiot, Anne-Laure; Aubert, Michel; Brochier, Bernard; Cliquet, Florence; Hanlon, Cathleen A; King, Roni; Oertli, Ernest H; Rupprecht, Charles E; Schumacher, Caroline; Slate, Dennis; Yakobson, Boris; Wohlers, Anne; Lankau, Emily W


    RABORAL V-RG® is an oral rabies vaccine bait that contains an attenuated ("modified-live") recombinant vaccinia virus vector vaccine expressing the rabies virus glycoprotein gene (V-RG). Approximately 250 million doses have been distributed globally since 1987 without any reports of adverse reactions in wildlife or domestic animals since the first licensed recombinant oral rabies vaccine (ORV) was released into the environment to immunize wildlife populations against rabies. V-RG is genetically stable, is not detected in the oral cavity beyond 48 h after ingestion, is not shed by vaccinates into the environment, and has been tested for thermostability under a range of laboratory and field conditions. Safety of V-RG has been evaluated in over 50 vertebrate species, including non-human primates, with no adverse effects observed regardless of route or dose. Immunogenicity and efficacy have been demonstrated under laboratory and field conditions in multiple target species (including fox, raccoon, coyote, skunk, raccoon dog, and jackal). The liquid vaccine is packaged inside edible baits (i.e., RABORAL V-RG, the vaccine-bait product) which are distributed into wildlife habitats for consumption by target species. Field application of RABORAL V-RG has contributed to the elimination of wildlife rabies from three European countries (Belgium, France and Luxembourg) and of the dog/coyote rabies virus variant from the United States of America (USA). An oral rabies vaccination program in west-central Texas has essentially eliminated the gray fox rabies virus variant from Texas with the last case reported in a cow during 2009. A long-term ORV barrier program in the USA using RABORAL V-RG is preventing substantial geographic expansion of the raccoon rabies virus variant. RABORAL V-RG has also been used to control wildlife rabies in Israel for more than a decade. This paper: (1) reviews the development and historical use of RABORAL V-RG; (2) highlights wildlife rabies control

  17. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein. (United States)

    Remy-Ziller, Christelle; Germain, Claire; Spindler, Anita; Hoffmann, Chantal; Silvestre, Nathalie; Rooke, Ronald; Bonnefoy, Jean-Yves; Préville, Xavier


    Women showing normal cytology but diagnosed with a persistent high-risk human papillomavirus (HR-HPV) infection have a higher risk of developing high-grade cervical intraepithelial neoplasia and cervical cancer than noninfected women. As no therapeutic management other than surveillance is offered to these women, there is a major challenge to develop novel targeted therapies dedicated to the treatment of these patients. As such, E1 and E2 antigens, expressed early in the HPV life cycle, represent very interesting candidates. Both proteins are necessary for maintaining coordinated viral replication and gene synthesis during the differentiation process of the epithelium and are essential for the virus to complete its normal and propagative replication cycle. In the present study, we evaluated a new active targeted immunotherapeutic, a modified vaccinia virus Ankara (MVA) vector containing the E1 sequence of HPV16, aimed at inducing cellular immune responses with the potential to help and clear persistent HPV16-related infection. We carried out an extensive comparative time course analysis of the cellular immune responses induced by different schedules of immunization in C57BL/6 mice. We showed that multiple injections of MVA-E1 allowed sustained HPV16 E1-specific cellular immune responses in vaccinated mice and had no impact on the exhaustion phenotype of the generated HPV16 E1-specific CD8⁺ T cells, but they led to the differentiation of multifunctional effector T cells with high cytotoxic capacity. This study provides proof of concept that an MVA expressing HPV16 E1 can induce robust and long-lasting E1-specific responses and warrants further development of this candidate.

  18. Safety and immunogenicity of novel recombinant BCG and modified vaccinia virus Ankara vaccines in neonate rhesus macaques. (United States)

    Rosario, Maximillian; Fulkerson, John; Soneji, Shamit; Parker, Joe; Im, Eung-Jun; Borthwick, Nicola; Bridgeman, Anne; Bourne, Charles; Joseph, Joan; Sadoff, Jerald C; Hanke, Tomás


    Although major inroads into making antiretroviral therapy available in resource-poor countries have been made, there is an urgent need for an effective vaccine administered shortly after birth, which would protect infants from acquiring human immunodeficiency virus type 1 (HIV-1) through breast-feeding. Bacillus Calmette-Guérin (BCG) is given to most infants at birth, and its recombinant form could be used to prime HIV-1-specific responses for a later boost by heterologous vectors delivering the same HIV-1-derived immunogen. Here, two groups of neonate Indian rhesus macaques were immunized with either novel candidate vaccine BCG.HIVA(401) or its parental strain AERAS-401, followed by two doses of recombinant modified vaccinia virus Ankara MVA.HIVA. The HIVA immunogen is derived from African clade A HIV-1. All vaccines were safe, giving local reactions consistent with the expected response at the injection site. No systemic adverse events or gross abnormality was seen at necropsy. Both AERAS-401 and BCG.HIVA(401) induced high frequencies of BCG-specific IFN-gamma-secreting lymphocytes that declined over 23 weeks, but the latter failed to induce detectable HIV-1-specific IFN-gamma responses. MVA.HIVA elicited HIV-1-specific IFN-gamma responses in all eight animals, but, except for one animal, these responses were weak. The HIV-1-specific responses induced in infants were lower compared to historic data generated by the two HIVA vaccines in adult animals but similar to other recombinant poxviruses tested in this model. This is the first time these vaccines were tested in newborn monkeys. These results inform further infant vaccine development and provide comparative data for two human infant vaccine trials of MVA.HIVA.

  19. Safety of recombinant fowlpox strain FP9 and modified vaccinia virus Ankara vaccines against liver-stage P. falciparum malaria in non-immune volunteers. (United States)

    Webster, D P; Dunachie, S; McConkey, S; Poulton, I; Moore, A C; Walther, M; Laidlaw, S M; Peto, T; Skinner, M A; Gilbert, S C; Hill, A V S


    The ability to generate potent antigen-specific T cell responses by vaccination has been a major hurdle in vaccinology. Vaccinia virus and avipox viruses have been shown to be capable of expressing antigens in mammalian cells and can induce a protective immune response against several mammalian pathogens. We report on two such vaccine constructs, modified vaccinia virus Ankara and FP9 (an attenuated fowlpox virus) both expressing the pre-erythrocytic malaria antigen thrombospondin-related adhesion protein and a string of CD8+ epitopes (ME-TRAP). In prime-boost combinations in a mouse model MVA and FP9 are highly immunogenic and induce substantial protective efficacy. A series of human clinical trials using the recombinant MVA and FP9 malaria vaccines encoding ME-TRAP, both independently and in prime-boost combinations with or without the DNA vaccine DNA ME-TRAP, has shown them to be both immunogenic for CD8+ T cells and capable of inducing protective efficacy. We report here a detailed analysis of the safety profiles of these viral vectors and show that anti-vector antibody responses induced by the vectors are generally low to moderate. We conclude that these vectors are safe and show acceptable side effect profiles for prophylactic vaccination.

  20. Vaccinia Virus B1 Kinase Is Required for Postreplicative Stages of the Viral Life Cycle in a BAF-Independent Manner in U2OS Cells (United States)

    Jamin, Augusta; Ibrahim, Nouhou; Wicklund, April; Weskamp, Kaitlin


    ABSTRACT The vaccinia virus B1R gene encodes a highly conserved protein kinase that is essential for the poxviral life cycle. As demonstrated in many cell types, B1 plays a critical role during viral DNA replication when it inactivates the cellular host defense effector barrier to autointegration factor (BAF or BANF1). To better understand the role of B1 during infection, we have characterized the growth of a B1-deficient temperature-sensitive mutant virus (Cts2 virus) in U2OS osteosarcoma cells. In contrast to all other cell lines tested to date, we found that in U2OS cells, Cts2 viral DNA replication is unimpaired at the nonpermissive temperature. However, the Cts2 viral yield in these cells was reduced more than 10-fold, thus indicating that B1 is required at another stage of the vaccinia virus life cycle. Our results further suggest that the host defense function of endogenous BAF may be absent in U2OS cells but can be recovered through either overexpression of BAF or fusion of U2OS cells with mouse cells in which the antiviral function of BAF is active. Interestingly, examination of late viral proteins during Cts2 virus infection demonstrated that B1 is required for optimal processing of the L4 protein. Finally, execution point analyses as well as electron microscopy studies uncovered a role for B1 during maturation of poxviral virions. Overall, this work demonstrates that U2OS cells are a novel model system for studying the cell type-specific regulation of BAF and reveals a role for B1 beyond DNA replication during the late stages of the viral life cycle. IMPORTANCE The most well characterized role for the vaccinia virus B1 kinase is to facilitate viral DNA replication by phosphorylating and inactivating BAF, a cellular host defense responsive to foreign DNA. Additional roles for B1 later in the viral life cycle have been postulated for decades but are difficult to examine directly due to the importance of B1 during DNA replication. Here, we demonstrate that

  1. A heterologous prime-boosting strategy with replicating Vaccinia virus vectors and plant-produced HIV-1 Gag/dgp41 virus-like particles. (United States)

    Meador, Lydia R; Kessans, Sarah A; Kilbourne, Jacquelyn; Kibler, Karen V; Pantaleo, Giuseppe; Roderiguez, Mariano Esteban; Blattman, Joseph N; Jacobs, Bertram L; Mor, Tsafrir S


    Showing modest efficacy, the RV144 HIV-1 vaccine clinical trial utilized a non-replicating canarypox viral vector and a soluble gp120 protein boost. Here we built upon the RV144 strategy by developing a novel combination of a replicating, but highly-attenuated Vaccinia virus vector, NYVAC-KC, and plant-produced HIV-1 virus-like particles (VLPs). Both components contained the full-length Gag and a membrane anchored truncated gp41 presenting the membrane proximal external region with its conserved broadly neutralizing epitopes in the pre-fusion conformation. We tested different prime/boost combinations of these components in mice and showed that the group primed with NYVAC-KC and boosted with both the viral vectors and plant-produced VLPs have the most robust Gag-specific CD8 T cell responses, at 12.7% of CD8 T cells expressing IFN-γ in response to stimulation with five Gag epitopes. The same immunization group elicited the best systemic and mucosal antibody responses to Gag and dgp41 with a bias towards IgG1. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  3. Vaccinia Virus Immunomodulator A46: A Lipid and Protein-Binding Scaffold for Sequestering Host TIR-Domain Proteins.

    Directory of Open Access Journals (Sweden)

    Sofiya Fedosyuk


    Full Text Available Vaccinia virus interferes with early events of the activation pathway of the transcriptional factor NF-kB by binding to numerous host TIR-domain containing adaptor proteins. We have previously determined the X-ray structure of the A46 C-terminal domain; however, the structure and function of the A46 N-terminal domain and its relationship to the C-terminal domain have remained unclear. Here, we biophysically characterize residues 1-83 of the N-terminal domain of A46 and present the X-ray structure at 1.55 Å. Crystallographic phases were obtained by a recently developed ab initio method entitled ARCIMBOLDO_BORGES that employs tertiary structure libraries extracted from the Protein Data Bank; data analysis revealed an all β-sheet structure. This is the first such structure solved by this method which should be applicable to any protein composed entirely of β-sheets. The A46(1-83 structure itself is a β-sandwich containing a co-purified molecule of myristic acid inside a hydrophobic pocket and represents a previously unknown lipid-binding fold. Mass spectrometry analysis confirmed the presence of long-chain fatty acids in both N-terminal and full-length A46; mutation of the hydrophobic pocket reduced the lipid content. Using a combination of high resolution X-ray structures of the N- and C-terminal domains and SAXS analysis of full-length protein A46(1-240, we present here a structural model of A46 in a tetrameric assembly. Integrating affinity measurements and structural data, we propose how A46 simultaneously interferes with several TIR-domain containing proteins to inhibit NF-κB activation and postulate that A46 employs a bipartite binding arrangement to sequester the host immune adaptors TRAM and MyD88.

  4. Intrarectal vaccination with recombinant vaccinia virus expressing carcinoembronic antigen induces mucosal and systemic immunity and prevents progression of colorectal cancer. (United States)

    Kim-Schulze, Seunghee; Kim, Hong Sung; Wainstein, Alberto; Kim, Dae Won; Yang, Wein Cui; Moroziewicz, Dorota; Mong, Phyllus Y; Bereta, Michal; Taback, Bret; Wang, Qin; Kaufman, Howard L


    The gastrointestinal mucosa contains an intact immune system that protects the host from pathogens and communicates with the systemic immune system. Absorptive epithelial cells in the mucosa give rise to malignant tumors although the interaction between tumor cells and the mucosal immune system is not well defined. The pathophysiology of colorectal cancer has been elucidated through studies of hereditary syndromes, such as familial adenomatous polyposis, a cancer predisposition syndrome caused by germline mutations in the adenomatous polyposis coli tumor suppressor gene. Patients with FAP develop adenomas and inevitably progress to invasive carcinomas by the age of 40. To better delineate the role of mucosal immunity in colorectal cancer, we evaluated the efficacy of intrarectal recombinant vaccinia virus expressing the human carcinoembryonic Ag (CEA) in a murine FAP model in which mice are predisposed to colorectal cancer and also express human CEA in the gut. Mucosal vaccination reduced the incidence of spontaneous adenomas and completely prevented progression to invasive carcinoma. The therapeutic effects were associated with induction of mucosal CEA-specific IgA Ab titers and CD8(+) CTLs. Mucosal vaccination was also associated with an increase in systemic CEA-specific IgG Ab titers, CD4(+) and CD8(+) T cell responses and resulted in growth inhibition of s.c. implanted CEA-expressing tumors suggesting communication between mucosal and systemic immune compartments. Thus, intrarectal vaccination induces mucosal and systemic antitumor immunity and prevents progression of spontaneous colorectal cancer. These results have implications for the prevention of colorectal cancer in high-risk individuals.

  5. Phylogenetic analysis of three genes of Penguinpox virus corresponding to Vaccinia virus G8R (VLTF-1, A3L (P4b and H3L reveals that it is most closely related to Turkeypox virus, Ostrichpox virus and Pigeonpox virus

    Directory of Open Access Journals (Sweden)

    Williamson Anna-Lise


    Full Text Available Abstract Phylogenetic analysis of three genes of Penguinpox virus, a novel Avipoxvirus isolated from African penguins, reveals its relationship to other poxviruses. The genes corresponding to Vaccinia virus G8R (VLTF-1, A3L (P4b and H3L were sequenced and phylogenetic trees (Neighbour-Joining and UPGMA constructed from MUSCLE nucleotide and amino acid alignments of the equivalent sequences from several different poxviruses. Based on this analysis, PEPV was confirmed to belong to the genus Avipoxvirus, specifically, clade A, subclade A2 and to be most closely related to Turkeypox virus (TKPV, Ostrichpox virus (OSPVand Pigeonpox virus (PGPV.

  6. Deletion of the K1L Gene Results in a Vaccinia Virus That Is Less Pathogenic Due to Muted Innate Immune Responses, yet Still Elicits Protective Immunity. (United States)

    Bravo Cruz, Ariana G; Han, Aiguo; Roy, Edward J; Guzmán, Arielle B; Miller, Rita J; Driskell, Elizabeth A; O'Brien, William D; Shisler, Joanna L


    All viruses strategically alter the antiviral immune response to their benefit. The vaccinia virus (VACV) K1 protein has multiple immunomodulatory effects in tissue culture models of infection, including NF-κB antagonism. However, the effect of K1 during animal infection is poorly understood. We determined that a K1L-less vaccinia virus (vΔK1L) was less pathogenic than wild-type VACV in intranasal and intradermal models of infection. Decreased pathogenicity was correlated with diminished virus replication in intranasally infected mice. However, in intradermally inoculated ears, vΔK1L replicated to levels nearly identical to those of VACV, implying that the decreased immune response to vΔK1L infection, not virus replication, dictated lesion size. Several lines of evidence support this theory. First, vΔK1L induced slightly less edema than vK1L, as revealed by histopathology and noninvasive quantitative ultrasound technology (QUS). Second, infiltrating immune cell populations were decreased in vΔK1L-infected ears. Third, cytokine and chemokine gene expression was decreased in vΔK1L-infected ears. While these results identified the biological basis for smaller lesions, they remained puzzling; because K1 antagonizes NF-κB in vitro, antiviral gene expression was expected to be higher during vΔK1L infection. Despite these diminished innate immune responses, vΔK1L vaccination induced a protective VACV-specific CD8+ T cell response and protected against a lethal VACV challenge. Thus, vΔK1L is the first vaccinia virus construct reported that caused a muted innate immune gene expression profile and decreased immune cell infiltration in an intradermal model of infection yet still elicited protective immunity.IMPORTANCE The vaccinia virus (VACV) K1 protein inhibits NF-κB activation among its other antagonistic functions. A virus lacking K1 (vΔK1L) was predicted to be less pathogenic because it would trigger a more robust antiviral immune response than VACV. Indeed

  7. Screening for vaccinia virus egress inhibitors: separation of IMV, IEV, and EEV. (United States)

    Byrd, Chelsea M; Hruby, Dennis E


    Concerns about the possible use of variola virus as a biological weapon as well as the need for therapeutics for the treatment or prevention of naturally acquired poxvirus infections or vaccination complications have led to the search for small molecule inhibitors of poxvirus replication. One unique and attractive target for antiviral development is viral egress. Part of understanding the mechanism of action of viral egress inhibitors involves determining which virion form is being made. This can be accomplished through buoyant density centrifugation.

  8. The 131-amino-acid repeat region of the essential 39-kilodalton core protein of fowlpox virus FP9, equivalent to vaccinia virus A4L protein, is nonessential and highly immunogenic. (United States)

    Boulanger, D; Green, P; Smith, T; Czerny, C P; Skinner, M A


    The immunodominant, 39,000-molecular weight core protein (39K protein) of fowlpox virus (FP9 strain), equivalent to the vaccinia virus A4L gene product, contains highly charged domains at each end of the protein and multiple copies of a 12-amino-acid serine-rich repeat sequence in the middle of the protein. Similar repeats were also detected in other fowlpox virus strains, suggesting that they might confer a selective advantage to the virus. The molloscum contagiosum virus homolog (MC107L) also contains repeats, unlike the vaccinia virus protein. The number of repeats in the fowlpox virus protein does not seem to be crucial, since some strains have a different number of repeats, as shown by the difference in the size of the protein in these strains. The repeat region could be deleted, indicating that it is not essential for replication in vitro. It was not possible to delete the entire 39K protein, indicating that it was essential (transcriptional control signals for the flanking genes were left intact). The repeat region is partly responsible for the immunodominance of the protein, but the C-terminal part of the protein also contains highly antigenic linear epitopes. A role for the 39K protein in immune system modulation is discussed.

  9. Use of vaccinia virus vectors to study protein processing in human disease. Normal nerve growth factor processing and secretion in cultured fibroblasts from patients with familial dysautonomia. (United States)

    Edwards, R H; Rutter, W J


    Familial dysautonomia is a hereditary disorder that affects autonomic and sensory neurons. Nerve growth factor (NGF) is required for the normal development of sympathetic and sensory neurons and it has been postulated that an abnormality involving NGF may be responsible for familial dysautonomia. Previous studies have shown that the beta-NGF gene is not linked to the disease. However, NGF appears to be abnormal by immunochemical assays; the putative altered form of NGF could result from a disturbance in the processing pathway. To study the processing of the 35-kD glycosylated NGF precursor and the secretion of NGF in familial dysautonomia, we have employed a recombinant vaccinia virus vector to express high levels of NGF mRNA in primary fibroblast cultures from patients with the disorder; the processing pathway was then studied directly. Cells from several unrelated patients all produce the same 35-kD NGF precursor, process this normally to NGF within the cell, and release NGF into the medium. There are no differences in the ability of cells from patients and from unaffected relatives to process and secrete NGF. The use of similar recombinant vaccinia virus vectors to express proteins at high level in primary cell lines should facilitate the detection of posttranslational processing defects in a variety of human disorders.

  10. Modified vaccinia virus Ankara expressing the hemagglutinin of pandemic (H1N1) 2009 virus induces cross-protective immunity against Eurasian 'avian-like' H1N1 swine viruses in mice. (United States)

    Castrucci, Maria R; Facchini, Marzia; Di Mario, Giuseppina; Garulli, Bruno; Sciaraffia, Ester; Meola, Monica; Fabiani, Concetta; De Marco, Maria A; Cordioli, Paolo; Siccardi, Antonio; Kawaoka, Yoshihiro; Donatelli, Isabella


    To examine cross-reactivity between hemagglutinin (HA) derived from A/California/7/09 (CA/09) virus and that derived from representative Eurasian "avian-like" (EA) H1N1 swine viruses isolated in Italy between 1999 and 2008 during virological surveillance in pigs. Modified vaccinia virus Ankara (MVA) expressing the HA gene of CA/09 virus (MVA-HA-CA/09) was used as a vaccine to investigate cross-protective immunity against H1N1 swine viruses in mice. Two classical swine H1N1 (CS) viruses and four representative EA-like H1N1 swine viruses previously isolated during outbreaks of respiratory disease in pigs on farms in Northern Italy were used in this study. Female C57BL/6 mice were vaccinated with MVA/HA/CA/09 and then challenged intranasally with H1N1 swine viruses. Cross-reactive antibody responses were determined by hemagglutination- inhibition (HI) and virus microneutralizing (MN) assays of sera from MVA-vaccinated mice. The extent of protective immunity against infection with H1N1 swine viruses was determined by measuring lung viral load on days 2 and 4 post-challenge. Systemic immunization of mice with CA/09-derived HA, vectored by MVA, elicited cross-protective immunity against recent EA-like swine viruses. This immune protection was related to the levels of cross-reactive HI antibodies in the sera of the immunized mice and was dependent on the similarity of the antigenic site Sa of H1 HAs. Our findings suggest that the herd immunity elicited in humans by the pandemic (H1N1) 2009 virus could limit the transmission of recent EA-like swine HA genes into the influenza A virus gene pool in humans. © 2013 The Authors Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  11. In a nutshell: structure and assembly of the vaccinia virion. (United States)

    Condit, Richard C; Moussatche, Nissin; Traktman, Paula


    Poxviruses comprise a large family of viruses characterized by a large, linear dsDNA genome, a cytoplasmic site of replication and a complex virion morphology. The most notorious member of the poxvirus family is variola, the causative agent of smallpox. The laboratory prototype virus used for the study of poxviruses is vaccinia, the virus that was used as a live, naturally attenuated vaccine for the eradication of smallpox. Both the morphogenesis and structure of poxvirus virions are unique among viruses. Poxvirus virions apparently lack any of the symmetry features common to other viruses such as helical or icosahedral capsids or nucleocapsids. Instead poxvirus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a walled, biconcave core flanked by "lateral bodies." The virion assembly pathway involves a remarkable fabrication of membrane-containing crescents and immature virions, which evolve into mature virions in a process that is unparalleled in virology. As a result of significant advances in poxvirus genetics and molecular biology during the past 15 years, we can now positively identify over 70 specific gene products contained in poxvirus virions, and we can describe the effects of mutations in over 50 specific genes on poxvirus assembly. This review summarizes these advances and attempts to assemble them into a comprehensible and thoughtful picture of poxvirus structure and assembly.

  12. L1R, A27L, A33R and B5R vaccinia virus genes expressed by fowlpox recombinants as putative novel orthopoxvirus vaccines. (United States)

    Pacchioni, Sole Maria; Bissa, Massimiliano; Zanotto, Carlo; Morghen, Carlo De Giuli; Illiano, Elena; Radaelli, Antonia


    The traditional smallpox vaccine, administered by scarification, was discontinued in the general population from 1980, because of the absence of new smallpox cases. However, the development of an effective prophylactic vaccine against smallpox is still necessary, to protect from the threat of deliberate release of the variola virus for bioterrorism and from new zoonotic infections, and to improve the safety of the traditional vaccine. Preventive vaccination still remains the most effective control and new vectors have been developed to generate recombinant vaccines against smallpox that induce the same immunogenicity as the traditional one. As protective antibodies are mainly directed against the surface proteins of the two infectious forms of vaccinia, the intracellular mature virions and the extracellular virions, combined proteins from these viral forms can be used to better elicit a complete and protective immunity. Four novel viral recombinants were constructed based on the fowlpox genetic background, which independently express the vaccinia virus L1 and A27 proteins present on the mature virions, and the A33 and B5 proteins present on the extracellular virions. The correct expression of the transgenes was determined by RT-PCR, Western blotting, and immunofluorescence. Using immunoprecipitation and Western blotting, the ability of the proteins expressed by the four novel FPL1R, FPA27L, FPA33R and FPB5R recombinants to be recognized by VV-specific hyperimmune mouse sera was demonstrated. By neutralisation assays, recombinant virus particles released by infected chick embryo fibroblasts were shown not be recognised by hyperimmune sera. This thus demonstrates that the L1R, A27L, A33R and B5R gene products are not inserted into the new viral progeny. Fowlpox virus replicates only in avian species, but it is permissive for entry and transgene expression in mammalian cells, while being immunologically non-cross-reactive with vaccinia virus. These recombinants might

  13. Effects of nasal or pulmonary delivered treatments with an adenovirus vectored interferon (mDEF201 on respiratory and systemic infections in mice caused by cowpox and vaccinia viruses.

    Directory of Open Access Journals (Sweden)

    Donald F Smee

    Full Text Available An adenovirus 5 vector encoding for mouse interferon alpha, subtype 5 (mDEF201 was evaluated for efficacy against lethal cowpox (Brighton strain and vaccinia (WR strain virus respiratory and systemic infections in mice. Two routes of mDEF201 administration were used, nasal sinus (5-µl and pulmonary (50-µl, to compare differences in efficacy, since the preferred treatment of humans would be in a relatively small volume delivered intranasally. Lower respiratory infections (LRI, upper respiratory infections (URI, and systemic infections were induced by 50-µl intranasal, 10-µl intranasal, and 100-µl intraperitoneal virus challenges, respectively. mDEF201 treatments were given prophylactically either 24 h (short term or 56d (long-term prior to virus challenge. Single nasal sinus treatments of 10(6 and 10(7 PFU/mouse of mDEF201 protected all mice from vaccinia-induced LRI mortality (comparable to published studies with pulmonary delivered mDEF201. Systemic vaccinia infections responded significantly better to nasal sinus delivered mDEF201 than to pulmonary treatments. Cowpox LRI infections responded to 10(7 mDEF201 treatments, but a 10(6 dose was only weakly protective. Cowpox URI infections were equally treatable by nasal sinus and pulmonary delivered mDEF201 at 10(7 PFU/mouse. Dose-responsive prophylaxis with mDEF201, given one time only 56 d prior to initiating a vaccinia virus LRI infection, was 100% protective from 10(5 to 10(7 PFU/mouse. Improvements in lung hemorrhage score and lung weight were evident, as were decreases in liver, lung, and spleen virus titers. Thus, mDEF201 was able to treat different vaccinia and cowpox virus infections using both nasal sinus and pulmonary treatment regimens, supporting its development for humans.

  14. Modified vaccinia virus Ankara expressing the hemagglutinin of pandemic (H1N1) 2009 virus induces cross-protective immunity against Eurasian ‘avian-like’ H1N1 swine viruses in mice (United States)

    Castrucci, Maria R; Facchini, Marzia; Di Mario, Giuseppina; Garulli, Bruno; Sciaraffia, Ester; Meola, Monica; Fabiani, Concetta; De Marco, Maria A; Cordioli, Paolo; Siccardi, Antonio; Kawaoka, Yoshihiro; Donatelli, Isabella


    Objectives To examine cross-reactivity between hemagglutinin (HA) derived from A/California/7/09 (CA/09) virus and that derived from representative Eurasian “avian-like” (EA) H1N1 swine viruses isolated in Italy between 1999 and 2008 during virological surveillance in pigs. Design Modified vaccinia virus Ankara (MVA) expressing the HA gene of CA/09 virus (MVA-HA-CA/09) was used as a vaccine to investigate cross-protective immunity against H1N1 swine viruses in mice. Sample Two classical swine H1N1 (CS) viruses and four representative EA-like H1N1 swine viruses previously isolated during outbreaks of respiratory disease in pigs on farms in Northern Italy were used in this study. Setting Female C57BL/6 mice were vaccinated with MVA/HA/CA/09 and then challenged intranasally with H1N1 swine viruses. Main outcome measures Cross-reactive antibody responses were determined by hemagglutination- inhibition (HI) and virus microneutralizing (MN) assays of sera from MVA-vaccinated mice. The extent of protective immunity against infection with H1N1 swine viruses was determined by measuring lung viral load on days 2 and 4 post-challenge. Results and Conclusions Systemic immunization of mice with CA/09-derived HA, vectored by MVA, elicited cross-protective immunity against recent EA-like swine viruses. This immune protection was related to the levels of cross-reactive HI antibodies in the sera of the immunized mice and was dependent on the similarity of the antigenic site Sa of H1 HAs. Our findings suggest that the herd immunity elicited in humans by the pandemic (H1N1) 2009 virus could limit the transmission of recent EA-like swine HA genes into the influenza A virus gene pool in humans. PMID:24373385

  15. Picornavirus Morphogenesis (United States)

    Jiang, Ping; Liu, Ying; Ma, Hsin-Chieh; Paul, Aniko V.


    SUMMARY The Picornaviridae represent a large family of small plus-strand RNA viruses that cause a bewildering array of important human and animal diseases. Morphogenesis is the least-understood step in the life cycle of these viruses, and this process is difficult to study because encapsidation is tightly coupled to genome translation and RNA replication. Although the basic steps of assembly have been known for some time, very few details are available about the mechanism and factors that regulate this process. Most of the information available has been derived from studies of enteroviruses, in particular poliovirus, where recent evidence has shown that, surprisingly, the specificity of encapsidation is governed by a viral protein-protein interaction that does not involve an RNA packaging signal. In this review, we make an attempt to summarize what is currently known about the following topics: (i) encapsidation intermediates, (ii) the specificity of encapsidation (iii), viral and cellular factors that are required for encapsidation, (iv) inhibitors of encapsidation, and (v) a model of enterovirus encapsidation. Finally, we compare some features of picornavirus morphogenesis with those of other plus-strand RNA viruses. PMID:25184560

  16. Enhanced T cell-mediated protection against malaria in human challenges by using the recombinant poxviruses FP9 and modified vaccinia virus Ankara. (United States)

    Webster, Daniel P; Dunachie, Susanna; Vuola, Jenni M; Berthoud, Tamara; Keating, Sheila; Laidlaw, Stephen M; McConkey, Samuel J; Poulton, Ian; Andrews, Laura; Andersen, Rikke F; Bejon, Philip; Butcher, Geoff; Sinden, Robert; Skinner, Michael A; Gilbert, Sarah C; Hill, Adrian V S


    Malaria is a major global health problem for which an effective vaccine is required urgently. Prime-boost vaccination regimes involving plasmid DNA and recombinant modified vaccinia virus Ankara-encoding liver-stage malaria antigens have been shown to be powerfully immunogenic for T cells and capable of inducing partial protection against experimental malaria challenge in humans, manifested as a delay in time to patent parasitemia. Here, we report that substitution of plasmid DNA as the priming vector with a specific attenuated recombinant fowlpox virus, FP9, vaccine in such prime-boost regimes can elicit complete sterile protection that can last for 20 months. Protection at 20 months was associated with persisting memory but not effector T cell responses. The protective efficacy of various immunization regimes correlated with the magnitude of induced immune responses, supporting the strategy of maximizing durable T cell immunogenicity to develop more effective liver-stage vaccines against Plasmodium falciparum malaria.

  17. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses.

    Directory of Open Access Journals (Sweden)

    Stuart D Dowall

    Full Text Available Crimean-Congo Haemorrhagic Fever (CCHF is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP. It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge.

  18. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses. (United States)

    Dowall, Stuart D; Graham, Victoria A; Rayner, Emma; Hunter, Laura; Watson, Robert; Taylor, Irene; Rule, Antony; Carroll, Miles W; Hewson, Roger


    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge.

  19. A vaccinia virus recombinant transcribing an alphavirus replicon and expressing alphavirus structural proteins leads to packaging of alphavirus infectious single cycle particles.

    Directory of Open Access Journals (Sweden)

    Juana M Sánchez-Puig

    Full Text Available Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses.

  20. Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus

    Directory of Open Access Journals (Sweden)

    Mittra Arjun


    Full Text Available Abstract Introduction Oncolytic viruses show promise for treating cancer. However, to assess therapeutic efficacy and potential toxicity, a noninvasive imaging modality is needed. This study aimed to determine if insertion of the human sodium iodide symporter (hNIS cDNA as a marker for non-invasive imaging of virotherapy alters the replication and oncolytic capability of a novel vaccinia virus, GLV-1h153. Methods GLV-1h153 was modified from parental vaccinia virus GLV-1h68 to carry hNIS via homologous recombination. GLV-1h153 was tested against human pancreatic cancer cell line PANC-1 for replication via viral plaque assays and flow cytometry. Expression and transportation of hNIS in infected cells was evaluated using Westernblot and immunofluorescence. Intracellular uptake of radioiodide was assessed using radiouptake assays. Viral cytotoxicity and tumor regression of treated PANC-1tumor xenografts in nude mice was also determined. Finally, tumor radiouptake in xenografts was assessed via positron emission tomography (PET utilizing carrier-free 124I radiotracer. Results GLV-1h153 infected, replicated within, and killed PANC-1 cells as efficiently as GLV-1h68. GLV-1h153 provided dose-dependent levels of hNIS expression in infected cells. Immunofluorescence detected transport of the protein to the cell membrane prior to cell lysis, enhancing hNIS-specific radiouptake (P In vivo, GLV-1h153 was as safe and effective as GLV-1h68 in regressing pancreatic cancer xenografts (P 124I-PET. Conclusion Insertion of the hNIS gene does not hinder replication or oncolytic capability of GLV-1h153, rendering this novel virus a promising new candidate for the noninvasive imaging and tracking of oncolytic viral therapy.

  1. Immunization with a recombinant vaccinia virus that encodes nonstructural proteins of the hepatitis C virus suppresses viral protein levels in mouse liver.

    Directory of Open Access Journals (Sweden)

    Satoshi Sekiguchi

    Full Text Available Chronic hepatitis C, which is caused by infection with the hepatitis C virus (HCV, is a global health problem. Using a mouse model of hepatitis C, we examined the therapeutic effects of a recombinant vaccinia virus (rVV that encodes an HCV protein. We generated immunocompetent mice that each expressed multiple HCV proteins via a Cre/loxP switching system and established several distinct attenuated rVV strains. The HCV core protein was expressed consistently in the liver after polyinosinic acid-polycytidylic acid injection, and these mice showed chronic hepatitis C-related pathological findings (hepatocyte abnormalities, accumulation of glycogen, steatosis, liver fibrosis, and hepatocellular carcinoma. Immunization with one rVV strain (rVV-N25, which encoded nonstructural HCV proteins, suppressed serum inflammatory cytokine levels and alleviated the symptoms of pathological chronic hepatitis C within 7 days after injection. Furthermore, HCV protein levels in liver tissue also decreased in a CD4 and CD8 T-cell-dependent manner. Consistent with these results, we showed that rVV-N25 immunization induced a robust CD8 T-cell immune response that was specific to the HCV nonstructural protein 2. We also demonstrated that the onset of chronic hepatitis in CN2-29((+/-/MxCre((+/- mice was mainly attributable to inflammatory cytokines, (tumor necrosis factor TNF-α and (interleukin IL-6. Thus, our generated mice model should be useful for further investigation of the immunological processes associated with persistent expression of HCV proteins because these mice had not developed immune tolerance to the HCV antigen. In addition, we propose that rVV-N25 could be developed as an effective therapeutic vaccine.

  2. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene (United States)

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise; Mach, Henryk; Troutman, Robert; Isopi, Lynne; Williams, Donna; Hurni, William; Xu, Zheng; Smith, Jeffrey G.; Wang, Su; Liu, Xu; Guan, Liming; Long, Romnie; Trigona, Wendy; Heidecker, Gwendolyn J.; Perry, Helen C.; Persaud, Natasha; Toner, Timothy J.; Su, Qin; Liang, Xiaoping; Youil, Rima; Chastain, Michael; Bett, Andrew J.; Volkin, David B.; Emini, Emilio A.; Shiver, John W.


    Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defective adenovirus serotype 5 (Ad5) vector, each expressing the same codon-optimized HIV-1 gag gene for immunogenicity in rhesus monkeys. The DNA vaccines were formulated with and without one of two chemical adjuvants (aluminum phosphate and CRL1005). The Ad5-gag vector was the most effective in eliciting anti-Gag CTL. The vaccine produced both CD4+ and CD8+ T-cell responses, with the latter consistently being the dominant component. To determine the effect of existing antiadenovirus immunity on Ad5-gag-induced immune responses, monkeys were exposed to adenovirus subtype 5 that did not encode antigen prior to immunization with Ad5-gag. The resulting anti-Gag T-cell responses were attenuated but not abolished. Regimens that involved priming with different DNA vaccine formulations followed by boosting with the adenovirus vector were also compared. Of the formulations tested, the DNA-CRL1005 vaccine primed T-cell responses most effectively and provided the best overall immune responses after boosting with Ad5-gag. These results are suggestive of an immunization strategy for humans that are centered on use of the adenovirus vector and in which existing adenovirus immunity may be overcome by combined immunization with adjuvanted DNA and adenovirus vector boosting. PMID:12743287

  3. Rapid Generation of Multiple Loci-Engineered Marker-free Poxvirus and Characterization of a Clinical-Grade Oncolytic Vaccinia Virus

    Directory of Open Access Journals (Sweden)

    Zong Sheng Guo


    Full Text Available Recombinant poxviruses, utilized as vaccine vectors and oncolytic viruses, often require manipulation at multiple genetic loci in the viral genome. It is essential for viral vectors to possess no adventitious mutations and no (antibiotic selection marker in the final product for human patients in order to comply with the guidance from the regulatory agencies. Rintoul et al. have previously developed a selectable and excisable marker (SEM system for the rapid generation of recombinant vaccinia virus. In the current study, we describe an improved methodology for rapid creation and selection of recombinant poxviruses with multiple genetic manipulations solely based on expression of a fluorescent protein and with no requirement for drug selection that can lead to cellular stress and the risk of adventitious mutations throughout the viral genome. Using this improved procedure combined with the SEM system, we have constructed multiple marker-free oncolytic poxviruses expressing different cytokines and other therapeutic genes. The high fidelity of inserted DNA sequences validates the utility of this improved procedure for generation of therapeutic viruses for human patients. We have created an oncolytic poxvirus expressing human chemokine CCL5, designated as vvDD-A34R-hCCL5, with manipulations at two genetic loci in a single virus. Finally, we have produced and purified this virus in clinical grade for its use in a phase I clinical trial and presented data on initial in vitro characterization of the virus.

  4. Role of metalloproteases in vaccinia virus epitope processing for transporter associated with antigen processing (TAP)-independent human leukocyte antigen (HLA)-B7 class I antigen presentation. (United States)

    Lorente, Elena; García, Ruth; Mir, Carmen; Barriga, Alejandro; Lemonnier, François A; Ramos, Manuel; López, Daniel


    The transporter associated with antigen processing (TAP) translocates the viral proteolytic peptides generated by the proteasome and other proteases in the cytosol to the endoplasmic reticulum lumen. There, they complex with nascent human leukocyte antigen (HLA) class I molecules, which are subsequently recognized by the CD8(+) lymphocyte cellular response. However, individuals with nonfunctional TAP complexes or tumor or infected cells with blocked TAP molecules are able to present HLA class I ligands generated by TAP-independent processing pathways. Herein, using a TAP-independent polyclonal vaccinia virus-polyspecific CD8(+) T cell line, two conserved vaccinia-derived TAP-independent HLA-B*0702 epitopes were identified. The presentation of these epitopes in normal cells occurs via complex antigen-processing pathways involving the proteasome and/or different subsets of metalloproteinases (amino-, carboxy-, and endoproteases), which were blocked in infected cells with specific chemical inhibitors. These data support the hypothesis that the abundant cellular proteolytic systems contribute to the supply of peptides recognized by the antiviral cellular immune response, thereby facilitating immunosurveillance. These data may explain why TAP-deficient individuals live normal life spans without any increased susceptibility to viral infections.

  5. The detection of Vaccinia virus confirms the high circulation of Orthopoxvirus in buffaloes living in geographical isolation, Marajó Island, Brazilian Amazon. (United States)

    Franco-Luiz, Ana Paula Moreira; Fagundes Pereira, Alexandre; de Oliveira, Cairo Henrique Sousa; Barbosa, José Diomedes; Oliveira, Danilo Bretas; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; de Souza Trindade, Giliane; Abrahão, Jônatas Santos; Kroon, Erna Geessien


    In Brazil, serologic evidence of Orthopoxvirus (OPV) circulation showed positivity around 20% in cattle, humans, monkeys and rodents. Although OPV seropositivity has been described in buffalo herds in southeastern Brazil, no Vaccinia virus (VACV) (member of genus OPV) outbreaks in buffalo herds have been described in this country. This study aimed to investigate the detection of anti-OPV antibodies and to study the OPV genome in Brazilian buffalo herds. Our results demonstrated a high OPV seropositivity in buffalo herds on Marajó Island and molecular data confirmed the circulation of VACV. The geographical isolation conditionmight be a sine qua non condition to explain our results. Copyright © 2016. Published by Elsevier Ltd.

  6. Mutational analysis of vaccinia virus E3 protein: the biological functions do not correlate with its biochemical capacity to bind double-stranded RNA. (United States)

    Dueck, Kevin J; Hu, YuanShen Sandy; Chen, Peter; Deschambault, Yvon; Lee, Jocelyn; Varga, Jessie; Cao, Jingxin


    Vaccinia E3 protein has the biochemical capacity of binding to double-stranded RNA (dsRNA). The best characterized biological functions of the E3 protein include its host range function, suppression of cytokine expression, and inhibition of interferon (IFN)-induced antiviral activity. Currently, the role of the dsRNA binding capacity in the biological functions of the E3 protein is not clear. To further understand the mechanism of the E3 protein biological functions, we performed alanine scanning of the entire dsRNA binding domain of the E3 protein to examine the link between its biochemical capacity of dsRNA binding and biological functions. Of the 115 mutants examined, 20 were defective in dsRNA binding. Although the majority of the mutants defective in dsRNA binding also showed defective replication in HeLa cells, nine mutants (I105A, Y125A, E138A, F148A, F159A, K171A, L182A, L183A, and I187/188A) retained the host range function to various degrees. Further examination of a set of representative E3L mutants showed that residues essential for dsRNA binding are not essential for the biological functions of E3 protein, such as inhibition of protein kinase R (PKR) activation, suppression of cytokine expression, and apoptosis. Thus, data described in this communication strongly indicate the E3 protein performs its biological functions via a novel mechanism which does not correlate with its dsRNA binding activity. dsRNAs produced during virus replication are important pathogen-associated molecular patterns (PAMPs) for inducing antiviral immune responses. One of the strategies used by many viruses to counteract such antiviral immune responses is achieved by producing dsRNA binding proteins, such as poxvirus E3 family proteins, influenza virus NS1, and Ebola virus V35 proteins. The most widely accepted model for the biological functions of this class of viral dsRNA binding proteins is that they bind to and sequester viral dsRNA PAMPs; thus, they suppress the related

  7. Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans. (United States)


    selected antigens is through fractionation of Brucella strain RB51 or E.coli recombinants expressing the appropriateBrucella antigen. Briefly, the method...animal species infected with Brucella spp. It is also able to induce the in vitro production of INF-y with lymphocytes of RB51 vaccinated mice (Table...SOD RB51 1IkDa 20 15 x0 0- 10 E 0- Uve Acetone Buffer Void 0-0.1 0.1-0-25 0.25->0.5 0.5-0.75 0.75->1.0 Klled 14 Preparation of new vaccinia/ Brucella

  8. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis (United States)


    virus (MeV), Sendai virus (SeV), human parainfluenza viruses (hPIV) types 1-4, Simian virus 5 (SV5), Newcastle disease virus (NDV), Mumps virus, and...Malur, and A. K. Banerjee. 2001. Polarity of human parainfluenza virus type 3 infection in polarized human lung epithelial A549 cells: role of...Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV

  9. Vaccinia virus proteins A52 and B14 Share a Bcl-2-like fold but have evolved to inhibit NF-kappaB rather than apoptosis.

    Directory of Open Access Journals (Sweden)

    Stephen C Graham


    Full Text Available Vaccinia virus (VACV, the prototype poxvirus, encodes numerous proteins that modulate the host response to infection. Two such proteins, B14 and A52, act inside infected cells to inhibit activation of NF-kappaB, thereby blocking the production of pro-inflammatory cytokines. We have solved the crystal structures of A52 and B14 at 1.9 A and 2.7 A resolution, respectively. Strikingly, both these proteins adopt a Bcl-2-like fold despite sharing no significant sequence similarity with other viral or cellular Bcl-2-like proteins. Unlike cellular and viral Bcl-2-like proteins described previously, A52 and B14 lack a surface groove for binding BH3 peptides from pro-apoptotic Bcl-2-like proteins and they do not modulate apoptosis. Structure-based phylogenetic analysis of 32 cellular and viral Bcl-2-like protein structures reveals that A52 and B14 are more closely related to each other and to VACV N1 and myxoma virus M11 than they are to other viral or cellular Bcl-2-like proteins. This suggests that a progenitor poxvirus acquired a gene encoding a Bcl-2-like protein and, over the course of evolution, gene duplication events have allowed the virus to exploit this Bcl-2 scaffold for interfering with distinct host signalling pathways.

  10. Impaired cellular responses to cytosolic DNA or infection with Listeria monocytogenes and vaccinia virus in the absence of the murine LGP2 protein.

    Directory of Open Access Journals (Sweden)

    Darja Pollpeter


    Full Text Available Innate immune signaling is crucial for detection of and the initial response to microbial pathogens. Evidence is provided indicating that LGP2, a DEXH box domain protein related to the RNA recognition receptors RIG-I and MDA5, participates in the cellular response to cytosolic double-stranded DNA (dsDNA. Analysis of embryonic fibroblasts and macrophages from mice harboring targeted disruption in the LGP2 gene reveals that LGP2 can act as a positive regulator of type I IFN and anti-microbial gene expression in response to transfected dsDNA. Results indicate that infection of LGP2-deficient mice with an intracellular bacterial pathogen, Listeria monocytogenes, leads to reduced levels of type I IFN and IL12, and allows increased bacterial growth in infected animals, resulting in greater colonization of both spleen and liver. Responses to infection with vaccinia virus, a dsDNA virus, are also suppressed in cells lacking LGP2, reinforcing the ability of LGP2 to act as a positive regulator of antiviral signaling. In vitro mechanistic studies indicate that purified LGP2 protein does not bind DNA but instead mediates these responses indirectly. Data suggest that LGP2 may be acting downstream of the intracellular RNA polymerase III pathway to activate anti-microbial signaling. Together, these findings demonstrate a regulatory role for LGP2 in the response to cytosolic DNA, an intracellular bacterial pathogen, and a DNA virus, and provide a plausible mechanistic hypothesis as the basis for this activity.

  11. Modified vaccinia virus Ankara triggers type I IFN production in murine conventional dendritic cells via a cGAS/STING-mediated cytosolic DNA-sensing pathway.

    Directory of Open Access Journals (Sweden)

    Peihong Dai


    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated poxvirus that has been engineered as a vaccine against infectious agents and cancers. Our goal is to understand how MVA modulates innate immunity in dendritic cells (DCs, which can provide insights to vaccine design. In this study, using murine bone marrow-derived dendritic cells, we assessed type I interferon (IFN gene induction and protein secretion in response to MVA infection. We report that MVA infection elicits the production of type I IFN in murine conventional dendritic cells (cDCs, but not in plasmacytoid dendritic cells (pDCs. Transcription factors IRF3 (IFN regulatory factor 3 and IRF7, and the positive feedback loop mediated by IFNAR1 (IFN alpha/beta receptor 1, are required for the induction. MVA induction of type I IFN is fully dependent on STING (stimulator of IFN genes and the newly discovered cytosolic DNA sensor cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase. MVA infection of cDCs triggers phosphorylation of TBK1 (Tank-binding kinase 1 and IRF3, which is abolished in the absence of cGAS and STING. Furthermore, intravenous delivery of MVA induces type I IFN in wild-type mice, but not in mice lacking STING or IRF3. Treatment of cDCs with inhibitors of endosomal and lysosomal acidification or the lysosomal enzyme Cathepsin B attenuated MVA-induced type I IFN production, indicating that lysosomal enzymatic processing of virions is important for MVA sensing. Taken together, our results demonstrate a critical role of the cGAS/STING-mediated cytosolic DNA-sensing pathway for type I IFN induction in cDCs by MVA. We present evidence that vaccinia virulence factors E3 and N1 inhibit the activation of IRF3 and the induction of IFNB gene in MVA-infected cDCs.

  12. Immunization with a recombinant fowlpox virus expressing a hepatitis C virus core-E1 polyprotein variant, protects mice and African green monkeys (Chlorocebus aethiops sabaeus) against challenge with a surrogate vaccinia virus. (United States)

    Alvarez-Lajonchere, Liz; Amador-Cañizares, Yalena; Frías, Roberto; Milian, Yoamel; Musacchio, Alexis; Guerra, Ivis; Acosta-Rivero, Nelson; Martínez, Gillian; Castro, Jorge; Puentes, Pedro; Cosme, Karelia; Dueñas-Carrera, Santiago


    HCV (hepatitis C virus) is a worldwide health problem nowadays. No preventive vaccine is available against this pathogen, and therapeutic treatments currently in use have important drawbacks, including limited efficacy. In the present work a recombinant fowlpox virus, FPCoE1, expressing a truncated HCV core-E1 polyprotein, was generated. FPCoE1 virus generally failed to elicit a humoral immune response against HCV antigens in BALB/c mice. By contrast, mice inoculated with FPCoE1 elicited a positive interferon-gamma secretion response against HCV core in ex-vivo ELISPOT (enzyme-linked immunospot) assays. Remarkably, mice inoculated with FPCoE1 significantly controlled viraemia in a surrogate challenge model with vvRE, a recombinant vaccinia virus expressing HCV structural antigens. In fact, 40% of the mice had no detectable levels of vvRE in their ovaries. Administration of FPCoE1 in vervet monkeys [Chlorocebus (formerly Cercophitecus) aethiops sabaeus] induced lymphoproliferative response against HCV core and E1 proteins in 50% of immunized animals. Monkeys immunized with FPCoE1 had no detectable levels of vvRE in their blood, whereas monkeys inoculated with FP9, the negative control virus, had detectable levels of vvRE in blood up to 7 days after challenge. In conclusion, recombinant fowlpox virus FPCoE1 is able to induce an anti-HCV immune response in mice and monkeys. This ability could be rationally employed to develop effective strategies against HCV infection by using FPCoE1 in combination with other vaccine candidates or antiviral treatments.

  13. Preferential Targeting of Conserved Gag Regions after Vaccination with a Heterologous DNA Prime-Modified Vaccinia Virus Ankara Boost HIV-1 Vaccine Regimen. (United States)

    Bauer, Asli; Podola, Lilli; Mann, Philipp; Missanga, Marco; Haule, Antelmo; Sudi, Lwitiho; Nilsson, Charlotta; Kaluwa, Bahati; Lueer, Cornelia; Mwakatima, Maria; Munseri, Patricia J; Maboko, Leonard; Robb, Merlin L; Tovanabutra, Sodsai; Kijak, Gustavo; Marovich, Mary; McCormack, Sheena; Joseph, Sarah; Lyamuya, Eligius; Wahren, Britta; Sandström, Eric; Biberfeld, Gunnel; Hoelscher, Michael; Bakari, Muhammad; Kroidl, Arne; Geldmacher, Christof


    Prime-boost vaccination strategies against HIV-1 often include multiple variants for a given immunogen for better coverage of the extensive viral diversity. To study the immunologic effects of this approach, we characterized breadth, phenotype, function, and specificity of Gag-specific T cells induced by a DNA-prime modified vaccinia virus Ankara (MVA)-boost vaccination strategy, which uses mismatched Gag immunogens in the TamoVac 01 phase IIa trial. Healthy Tanzanian volunteers received three injections of the DNA-SMI vaccine encoding a subtype B and AB-recombinant Gagp37 and two vaccinations with MVA-CMDR encoding subtype A Gagp55 Gag-specific T-cell responses were studied in 42 vaccinees using fresh peripheral blood mononuclear cells. After the first MVA-CMDR boost, vaccine-induced gamma interferon-positive (IFN-γ+) Gag-specific T-cell responses were dominated by CD4+ T cells (P viruses. While including multiple variants for a given immunogen in prime-boost vaccination strategies is one approach that aims to improve coverage for global virus variants, the immunologic consequences of this strategy have been poorly defined so far. It is unclear whether inclusion of multiple variants in prime-boost vaccination strategies improves recognition of variant viruses by T cells and by which mechanisms this would be achieved, either by improved cross-recognition of multiple variants for a given antigenic region or through preferential targeting of antigenic regions more conserved between prime and boost. Engineering vaccines to induce adaptive immune responses that preferentially target conserved antigenic regions of viral vulnerability might facilitate better immune control after preventive and therapeutic vaccination for HIV and for other variable viruses. Copyright © 2017 American Society for Microbiology.

  14. miR-142-5p Disrupts Neuronal Morphogenesis Underlying Porcine Hemagglutinating Encephalomyelitis Virus Infection by Targeting Ulk1. (United States)

    Li, Zi; Lan, Yungang; Zhao, Kui; Lv, Xiaoling; Ding, Ning; Lu, Huijun; Zhang, Jing; Yue, Huiqing; Shi, Junchao; Song, Deguang; Gao, Feng; He, Wenqi


    Porcine hemagglutinating encephalomyelitis virus (PHEV) invades the central nervous system (CNS) and causes neurodegenerative disease in suckling piglets, but the understanding of its neuropathogenicity for neurological dysfunction remains limited. Here, we report that miR-142-5p is localized to neurons and negatively regulates neuronal morphogenesis in porcine hemagglutinating encephalomyelitis (PHE). This phenotype was mediated by miR-142-5p inhibition of an mRNA encoding unc-51-like-kinase1 (Ulk1), which controls axon outgrowth and dendrite formation. Modulating miR-142-5p activity by microRNA mimics or inhibitors induced neurodegeneration, including stunted axon elongation, unstable dendritic spine formation, and irregular swelling and disconnection in neurites. Relieving Ulk1 mRNA repression in primary cortical neurons by miR-142-5p antagomirs or replication-deficient adenoviruses encoding Ulk1 (Ad5-Ulk1), which improved rescue of nerve injury, restricted viral replication, and increased survival rate in mice underlying PHEV infection. In contrast, disrupting Ulk1 in RNAi-expressing neurons mostly led to significantly shortened axon elongation and/or an abnormally large number of branched dendrites. Taken together, we demonstrated that the abnormal neuronal morphogenesis underlying PHEV infection was mainly caused by functional mRNA repression of the miR-142-5p target Ulk1. Our data revealed that PHEV adapted to use spatiotemporal control of host microRNAs to invade CNS, and provided new insights into the virus-associated neurological dysfunction microenvironment.

  15. Transient dominant host-range selection using Chinese hamster ovary cells to generate marker-free recombinant viral vectors from vaccinia virus. (United States)

    Liu, Liang; Cooper, Tamara; Eldi, Preethi; Garcia-Valtanen, Pablo; Diener, Kerrilyn R; Howley, Paul M; Hayball, John D


    Recombinant vaccinia viruses (rVACVs) are promising antigen-delivery systems for vaccine development that are also useful as research tools. Two common methods for selection during construction of rVACV clones are (i) co-insertion of drug resistance or reporter protein genes, which requires the use of additional selection drugs or detection methods, and (ii) dominant host-range selection. The latter uses VACV variants rendered replication-incompetent in host cell lines by the deletion of host-range genes. Replicative ability is restored by co-insertion of the host-range genes, providing for dominant selection of the recombinant viruses. Here, we describe a new method for the construction of rVACVs using the cowpox CP77 protein and unmodified VACV as the starting material. Our selection system will expand the range of tools available for positive selection of rVACV during vector construction, and it is substantially more high-fidelity than approaches based on selection for drug resistance.

  16. Preclinical Testing Oncolytic Vaccinia Virus Strain GLV-5b451 Expressing an Anti-VEGF Single-Chain Antibody for Canine Cancer Therapy. (United States)

    Adelfinger, Marion; Bessler, Simon; Frentzen, Alexa; Cecil, Alexander; Langbein-Laugwitz, Johanna; Gentschev, Ivaylo; Szalay, Aladar A


    Virotherapy on the basis of oncolytic vaccinia virus (VACV) strains is a novel approach for canine cancer therapy. Here we describe, for the first time, the characterization and the use of VACV strain GLV-5b451 expressing the anti-vascular endothelial growth factor (VEGF) single-chain antibody (scAb) GLAF-2 as therapeutic agent against different canine cancers. Cell culture data demonstrated that GLV-5b451 efficiently infected and destroyed all four tested canine cancer cell lines including: mammary carcinoma (MTH52c), mammary adenoma (ZMTH3), prostate carcinoma (CT1258), and soft tissue sarcoma (STSA-1). The GLV-5b451 virus-mediated production of GLAF-2 antibody was observed in all four cancer cell lines. In addition, this antibody specifically recognized canine VEGF. Finally, in canine soft tissue sarcoma (CSTS) xenografted mice, a single systemic administration of GLV-5b451 was found to be safe and led to anti-tumor effects resulting in the significant reduction and substantial long-term inhibition of tumor growth. A CD31-based immuno-staining showed significantly decreased neo-angiogenesis in GLV-5b451-treated tumors compared to the controls. In summary, these findings indicate that GLV-5b451 has potential for use as a therapeutic agent in the treatment of CSTS.

  17. Ultrastructural morphogenesis of a virus associated with lymphocystis-like lesions in parore Girella tricuspidata (Kyphosidae: Perciformes). (United States)

    Hine, P M; Wakefield, St J; Mackereth, G; Morrison, R


    The morphogenesis of large icosahedral viruses associated with lymphocystis-like lesions in the skin of parore Girella tricuspidata is described. The electron-lucent perinuclear viromatrix comprised putative DNA with open capsids at the periphery, very large arrays of smooth endoplasmic reticulum (sER), much of it with a reticulated appearance (rsER) or occurring as rows of vesicles. Lysosomes, degenerating mitochondria and virions in various stages of assembly, and paracrystalline arrays were also present. Long electron-dense inclusions (EDIs) with 15 nm repeating units split terminally and curled to form tubular structures internalising the 15 nm repeating structures. These tubular structures appeared to form the virion capsids. Large parallel arrays of sER sometimes alternated with aligned arrays of crinkled cisternae along which passed a uniformly wide (20 nm) thread-like structure. Strings of small vesicles near open capsids may also have been involved in formation of an inner lipid layer. Granules with a fine fibrillar appearance also occurred in the viromatrix, and from the presence of a halo around mature virions it appeared that the fibrils may form a layer around the capsid. The general features of virogenesis of large icosahedral dsDNA viruses, the large amount of ER, particularly rsER and the EDIs, are features of nucleo-cytoplasmic large DNA viruses, rather than features of 1 genus or family.

  18. Expansion of the mammalian 3 beta-hydroxysteroid dehydrogenase/plant dihydroflavonol reductase superfamily to include a bacterial cholesterol dehydrogenase, a bacterial UDP-galactose-4-epimerase, and open reading frames in vaccinia virus and fish lymphocystis disease virus. (United States)

    Baker, M E; Blasco, R


    Mammalian 3 beta-hydroxysteroid dehydrogenase and plant dihydroflavonol reductases are descended from a common ancestor. Here we present evidence that Nocardia cholesterol dehydrogenase, E. coli UDP-galactose-4 epimerase, and open reading frames in vaccinia virus and fish lymphocystis disease virus are homologous to 3 beta-hydroxysteroid dehydrogenase and dihydroflavonol reductase. Analysis of a multiple alignment of these sequences indicates that viral ORFs are most closely related to the mammalian 3 beta-hydroxysteroid dehydrogenases. The ancestral protein of this superfamily is likely to be one that metabolized sugar nucleotides. The sequence similarity between 3 beta-hydroxysteroid dehydrogenase and the viral ORFs is sufficient to suggest that these ORFs have an activity that is similar to 3 beta-hydroxysteroid dehydrogenase or cholesterol dehydrogenase, although the putative substrates are not yet known.

  19. Vaccinia virus protein C6 is a virulence factor that binds TBK-1 adaptor proteins and inhibits activation of IRF3 and IRF7.

    Directory of Open Access Journals (Sweden)

    Leonie Unterholzner


    Full Text Available Recognition of viruses by pattern recognition receptors (PRRs causes interferon-β (IFN-β induction, a key event in the anti-viral innate immune response, and also a target of viral immune evasion. Here the vaccinia virus (VACV protein C6 is identified as an inhibitor of PRR-induced IFN-β expression by a functional screen of select VACV open reading frames expressed individually in mammalian cells. C6 is a member of a family of Bcl-2-like poxvirus proteins, many of which have been shown to inhibit innate immune signalling pathways. PRRs activate both NF-κB and IFN regulatory factors (IRFs to activate the IFN-β promoter induction. Data presented here show that C6 inhibits IRF3 activation and translocation into the nucleus, but does not inhibit NF-κB activation. C6 inhibits IRF3 and IRF7 activation downstream of the kinases TANK binding kinase 1 (TBK1 and IκB kinase-ε (IKKε, which phosphorylate and activate these IRFs. However, C6 does not inhibit TBK1- and IKKε-independent IRF7 activation or the induction of promoters by constitutively active forms of IRF3 or IRF7, indicating that C6 acts at the level of the TBK1/IKKε complex. Consistent with this notion, C6 immunoprecipitated with the TBK1 complex scaffold proteins TANK, SINTBAD and NAP1. C6 is expressed early during infection and is present in both nucleus and cytoplasm. Mutant viruses in which the C6L gene is deleted, or mutated so that the C6 protein is not expressed, replicated normally in cell culture but were attenuated in two in vivo models of infection compared to wild type and revertant controls. Thus C6 contributes to VACV virulence and might do so via the inhibition of PRR-induced activation of IRF3 and IRF7.

  20. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity (United States)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.


    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  1. Modified Vaccinia Virus Ankara Vector Induces Specific Cellular and Humoral Responses in the Female Reproductive Tract, the Main HIV Portal of Entry. (United States)

    Marlin, Romain; Nugeyre, Marie-Thérèse; Tchitchek, Nicolas; Parenti, Matteo; Hocini, Hakim; Benjelloun, Fahd; Cannou, Claude; Dereuddre-Bosquet, Nathalie; Levy, Yves; Barré-Sinoussi, Françoise; Scarlatti, Gabriella; Le Grand, Roger; Menu, Elisabeth


    The female reproductive tract (FRT) is one of the major mucosal invasion sites for HIV-1. This site has been neglected in previous HIV-1 vaccine studies. Immune responses in the FRT after systemic vaccination remain to be characterized. Using a modified vaccinia virus Ankara (MVA) as a vaccine model, we characterized specific immune responses in all compartments of the FRT of nonhuman primates after systemic vaccination. Memory T cells were preferentially found in the lower tract (vagina and cervix), whereas APCs and innate lymphoid cells were mainly located in the upper tract (uterus and fallopian tubes). This compartmentalization of immune cells in the FRT was supported by transcriptomic analyses and a correlation network. Polyfunctional MVA-specific CD8+ T cells were detected in the blood, lymph nodes, vagina, cervix, uterus, and fallopian tubes. Anti-MVA IgG and IgA were detected in cervicovaginal fluid after a second vaccine dose. Thus, systemic vaccination with an MVA vector elicits cellular and Ab responses in the FRT. Copyright © 2017 by The American Association of Immunologists, Inc.

  2. Elicitation of both anti HIV-1 Env humoral and cellular immunities by replicating vaccinia prime Sendai virus boost regimen and boosting by CD40Lm.

    Directory of Open Access Journals (Sweden)

    Xianfeng Zhang

    Full Text Available For protection from HIV-1 infection, a vaccine should elicit both humoral and cell-mediated immune responses. A novel vaccine regimen and adjuvant that induce high levels of HIV-1 Env-specific T cell and antibody (Ab responses was developed in this study. The prime-boost regimen that used combinations of replication-competent vaccinia LC16m8Δ (m8Δ and Sendai virus (SeV vectors expressing HIV-1 Env efficiently produced both Env-specific CD8(+ T cells and anti-Env antibodies, including neutralizing antibodies (nAbs. These results sharply contrast with vaccine regimens that prime with an Env expressing plasmid and boost with the m8Δ or SeV vector that mainly elicited cellular immunities. Moreover, co-priming with combinations of m8Δs expressing Env or a membrane-bound human CD40 ligand mutant (CD40Lm enhanced Env-specific CD8(+ T cell production, but not anti-Env antibody production. In contrast, priming with an m8Δ that coexpresses CD40Lm and Env elicited more anti-Env Abs with higher avidity, but did not promote T cell responses. These results suggest that the m8Δ prime/SeV boost regimen in conjunction with CD40Lm expression could be used as an immunization platform for driving both potent cellular and humoral immunities against pathogens such as HIV-1.

  3. Evaluating the orthopoxvirus type I interferon-binding molecule as a vaccine target in the vaccinia virus intranasal murine challenge model. (United States)

    Golden, Joseph W; Hooper, Jay W


    The biological threat imposed by orthopoxviruses warrants the development of safe and effective vaccines. We developed a candidate orthopoxvirus DNA-based vaccine, termed 4pox, which targets four viral structural components, A33, B5, A27, and L1. While this vaccine protects mice and nonhuman primates from lethal infections, we are interested in further enhancing its potency. One approach to enhance potency is to include additional orthopoxvirus immunogens. Here, we investigated whether vaccination with the vaccinia virus (VACV) interferon (IFN)-binding molecule (IBM) could protect BALB/c mice against lethal VACV challenge. We found that vaccination with this molecule failed to significantly protect mice from VACV when delivered alone. IBM modestly augmented protection when delivered together with the 4pox vaccine. All animals receiving the 4pox vaccine plus IBM lived, whereas only 70% of those receiving a single dose of 4pox vaccine survived. Mapping studies using truncated mutants revealed that vaccine-generated antibodies spanned the immunoglobulin superfamily domains 1 and 2 and, to a lesser extent, 3 of the IBM. These antibodies inhibited IBM cell binding and IFN neutralization activity, indicating that they were functionally active. This study shows that DNA vaccination with the VACV IBM results in a robust immune response but that this response does not significantly enhance protection in a high-dose challenge model.

  4. Antibodies produced by mice immunized with recombinant vaccinia viruses expressing two different types of a major Theileria sergenti surface antigen (p32) react with the native surface antigen. (United States)

    Takasima, Y; Xuan, X; Matsumoto, Y; Onuma, M; Otsuka, H


    A 32 kDa major surface antigen, p32, of Theileria sergenti at the piroplasm stage is the main target of the host immune response. The immunogenic property of the p32 varies in some strains among the population of Theileria sergenti in Japan where the Chitose type and the Ikeda type are the most common varieties. We have constructed vaccinia virus recombinants vv/p32C and vv/p32I which harbor the Chitose and Ikeda types of p32 gene, respectively. It was found that vv/p32C and vv/p32I produced type-specific p32 which did not cross react with the monoclonal antibodies (mAbs) against the other type of p32. When mice were immunized with vv/p32C and vv/p32I, antibodies against p32 were detectable 2 weeks after the immunization, and these antibodies reacted with the native surface antigen in purified T. sergenti merozoite.

  5. Exploring the potential benefits of vaccinia virus complement control protein in controlling complement activation in pathogenesis of the central nervous system diseases. (United States)

    Kotwal, Girish J; Fernando, Nilisha; Zhou, Jianhua; Valter, Krisztina


    Aging is a major risk factor for the development of diseases related to the central nervous system (CNS), such as Alzheimer's disease (AD) and age-related macular degeneration (AMD). In both cases, linkage studies and genome-wide association studies found strong links with complement regulatory genes and disease risk. In AD, both CLU and CR1 genes were implicated in the late-onset form of the disease. In AMD, polymorphisms in CFH, CFB and C2 were similarly implicated. The cost of caring for patients with AD or AMD is approaching billions of dollars, and with the baby boomers reaching their 60's, this amount is likely to increase further. Intervention using complement inhibitors for individuals in their early 50s who are at a higher risk of disease development, (testing positive for genetic risk factors), could slow the progression of AD or AMD and possibly prevent the severity of late stage symptoms. Although we have used the vaccinia virus complement control protein (VCP) to elucidate the role of complement in CNS diseases, it has merely been an investigational tool but not the only possible potential therapeutic agent. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Structure, morphogenesis and function of tubular structures induced by cowpea mosaic virus

    NARCIS (Netherlands)

    Kasteel, D.T.J.


    During systemic plant infection, viruses move from the initially infected cells through plasmodesmata to neighbouring cells. Different mechanisms have been proposed for this cell-to-cell movement. Cowpea mosaic virus (CPMV) employs one of the major movement mechanisms, i.e. tubule-guided

  7. A candidate HIV/AIDS vaccine (MVA-B lacking vaccinia virus gene C6L enhances memory HIV-1-specific T-cell responses.

    Directory of Open Access Journals (Sweden)

    Juan García-Arriaza

    Full Text Available The vaccinia virus (VACV C6 protein has sequence similarities with the poxvirus family Pox_A46, involved in regulation of host immune responses, but its role is unknown. Here, we have characterized the C6 protein and its effects in virus replication, innate immune sensing and immunogenicity in vivo. C6 is a 18.2 kDa protein, which is expressed early during virus infection and localizes to the cytoplasm of infected cells. Deletion of the C6L gene from the poxvirus vector MVA-B expressing HIV-1 Env, Gag, Pol and Nef antigens from clade B (MVA-B ΔC6L had no effect on virus growth kinetics; therefore C6 protein is not essential for virus replication. The innate immune signals elicited by MVA-B ΔC6L in human macrophages and monocyte-derived dendritic cells (moDCs are characterized by the up-regulation of the expression of IFN-β and IFN-α/β-inducible genes. In a DNA prime/MVA boost immunization protocol in mice, flow cytometry analysis revealed that MVA-B ΔC6L enhanced the magnitude and polyfunctionality of the HIV-1-specific CD4+ and CD8+ T-cell memory immune responses, with most of the HIV-1 responses mediated by the CD8+ T-cell compartment with an effector phenotype. Significantly, while MVA-B induced preferentially Env- and Gag-specific CD8+ T-cell responses, MVA-B ΔC6L induced more Gag-Pol-Nef-specific CD8+ T-cell responses. Furthermore, MVA-B ΔC6L enhanced the levels of antibodies against Env in comparison with MVA-B. These findings revealed that C6 can be considered as an immunomodulator and that deleting C6L gene in MVA-B confers an immunological benefit by enhancing IFN-β-dependent responses and increasing the magnitude and quality of the T-cell memory immune responses to HIV-1 antigens. Our observations are relevant for the improvement of MVA vectors as HIV-1 vaccines.

  8. Vaccine efficacy against malaria by the combination of porcine parvovirus-like particles and vaccinia virus vectors expressing CS of Plasmodium.

    Directory of Open Access Journals (Sweden)

    Dolores Rodríguez

    Full Text Available With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs carrying the CD8(+ T cell epitope (SYVPSAEQI of the circumsporozoite (CS protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS, and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8(+ T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV vectors from the Western Reserve (WR and modified virus Ankara (MVA strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria.

  9. Adsorption of recombinant poxvirus L1-protein to aluminum hydroxide/CpG vaccine adjuvants enhances immune responses and protection of mice from vaccinia virus challenge. (United States)

    Xiao, Yuhong; Zeng, Yuhong; Alexander, Edward; Mehta, Shyam; Joshi, Sangeeta B; Buchman, George W; Volkin, David B; Middaugh, C Russell; Isaacs, Stuart N


    The stockpiling of live vaccinia virus vaccines has enhanced biopreparedness against the intentional or accidental release of smallpox. Ongoing research on future generation smallpox vaccines is providing key insights into protective immune responses as well as important information about subunit-vaccine design strategies. For protein-based recombinant subunit vaccines, the formulation and stability of candidate antigens with different adjuvants are important factors to consider for vaccine design. In this work, a non-tagged secreted L1-protein, a target antigen on mature virus, was expressed using recombinant baculovirus technology and purified. To identify optimal formulation conditions for L1, a series of biophysical studies was performed over a range of pH and temperature conditions. The overall physical stability profile was summarized in an empirical phase diagram. Another critical question to address for development of an adjuvanted vaccine was if immunogenicity and protection could be affected by the interactions and binding of L1 to aluminum salts (Alhydrogel) with and without a second adjuvant, CpG. We thus designed a series of vaccine formulations with different binding interactions between the L1 and the two adjuvants, and then performed a series of vaccination-challenge experiments in mice including measurement of antibody responses and post-challenge weight loss and survival. We found that better humoral responses and protection were conferred with vaccine formulations when the L1-protein was adsorbed to Alhydrogel. These data demonstrate that designing vaccine formulation conditions to maximize antigen-adjuvant interactions is a key factor in smallpox subunit-vaccine immunogenicity and protection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Combined prime-boost vaccination against tick-borne encephalitis (TBE using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

    Directory of Open Access Journals (Sweden)

    Zakharova LG


    Full Text Available Abstract Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines.

  11. HLA-DM constrains epitope selection in the human CD4 T cell response to vaccinia virus by favoring the presentation of peptides with longer HLA-DM-mediated half-lives1 (United States)

    Yin, Liusong; Calvo-Calle, J. Mauricio; Dominguez-Amorocho, Omar; Stern, Lawrence J.


    HLA-DM (DM) is a non-classical major histocompatibility complex II (MHC II) protein that acts as a peptide editor to mediate the exchange of peptides loaded onto MHC II during antigen presentation. Although the ability of DM to promote peptide exchange in vitro and in vivo is well established, the role of DM in epitope selection is still unclear, especially in human response to infectious disease. In this study, we addressed this question in the context of the human CD4 T cell response to vaccinia virus. We measured the IC50, intrinsic dissociation half-life, and DM-mediated dissociation half-life for a large set of peptides derived from the major core protein A10L and other known vaccinia epitopes bound to HLA-DR1, and compared these properties to the presence and magnitude of peptide-specific CD4+ T cell responses. We found that MHC II-peptide complex kinetic stability in the presence of DM distinguishes T cell epitopes from non-recognized peptides in A10L peptides and also in a set of predicted tight binders from the entire vaccinia genome. Taken together, these analyses demonstrate that DM-mediated dissociation half-life is a strong and independent factor governing peptide immunogenicity by favoring the presentation of peptides with greater kinetic stability in the presence of DM. PMID:22966084

  12. HLA-DM constrains epitope selection in the human CD4 T cell response to vaccinia virus by favoring the presentation of peptides with longer HLA-DM-mediated half-lives. (United States)

    Yin, Liusong; Calvo-Calle, J Mauricio; Dominguez-Amorocho, Omar; Stern, Lawrence J


    HLA-DM (DM) is a nonclassical MHC class II (MHC II) protein that acts as a peptide editor to mediate the exchange of peptides loaded onto MHC II during Ag presentation. Although the ability of DM to promote peptide exchange in vitro and in vivo is well established, the role of DM in epitope selection is still unclear, especially in human response to infectious disease. In this study, we addressed this question in the context of the human CD4 T cell response to vaccinia virus. We measured the IC(50), intrinsic dissociation t(1/2), and DM-mediated dissociation t(1/2) for a large set of peptides derived from the major core protein A10L and other known vaccinia epitopes bound to HLA-DR1 and compared these properties to the presence and magnitude of peptide-specific CD4(+) T cell responses. We found that MHC II-peptide complex kinetic stability in the presence of DM distinguishes T cell epitopes from nonrecognized peptides in A10L peptides and also in a set of predicted tight binders from the entire vaccinia genome. Taken together, these analyses demonstrate that DM-mediated dissociation t(1/2) is a strong and independent factor governing peptide immunogenicity by favoring the presentation of peptides with greater kinetic stability in the presence of DM.

  13. Vulvar vaccinia infection after sexual contact with a smallpox vaccinee. (United States)

    Muzny, Christina A; King, Heather; Byers, Paul; Currier, Mary; Nolan, Rathel; Mena, Leandro


    Vaccinia (smallpox) vaccine is an effective immunizing agent that brought about global eradication of naturally occurring smallpox, as declared by the World Health Organization in 1980. The United States ceased generalized smallpox vaccination in 1972 but reinstated it in 2002 for military personnel and selected healthcare workers (first responders who may be investigating possible cases of smallpox or caring for patients in selected hospitals) after the 2001 bioterrorism attacks. Since reinstitution of the vaccine, reports of transmission of vaccinia virus through contact with military smallpox vaccinees have been published, including four cases of female genital infection. We report a subsequent case of vulvar vaccinia infection acquired during sexual contact with a military vaccinee.

  14. Fungal Morphogenesis (United States)

    Lin, Xiaorong; Alspaugh, J. Andrew; Liu, Haoping; Harris, Steven


    Morphogenesis in fungi is often induced by extracellular factors and executed by fungal genetic factors. Cell surface changes and alterations of the microenvironment often accompany morphogenetic changes in fungi. In this review, we will first discuss the general traits of yeast and hyphal morphotypes and how morphogenesis affects development and adaptation by fungi to their native niches, including host niches. Then we will focus on the molecular machinery responsible for the two most fundamental growth forms, yeast and hyphae. Last, we will describe how fungi incorporate exogenous environmental and host signals together with genetic factors to determine their morphotype and how morphogenesis, in turn, shapes the fungal microenvironment. PMID:25367976

  15. Host-range restriction of vaccinia virus E3L deletion mutant can be overcome in vitro, but not in vivo, by expression of the influenza virus NS1 protein.

    Directory of Open Access Journals (Sweden)

    Susana Guerra

    Full Text Available During the last decades, research focused on vaccinia virus (VACV pathogenesis has been intensified prompted by its potential beneficial application as a vector for vaccine development and anti-cancer therapies, but also due to the fear of its potential use as a bio-terrorism threat. Recombinant viruses lacking a type I interferon (IFN antagonist are attenuated and hence good vaccine candidates. However, vaccine virus growth requires production in IFN-deficient systems, and thus viral IFN antagonists that are active in vitro, yet not in vivo, are of great value. The VACV E3 and influenza virus NS1 proteins are distinct double-stranded RNA-binding proteins that play an important role in pathogenesis by inhibiting the mammalian IFN-regulated innate antiviral response. Based on the functional similarities between E3 and NS1, we investigated the ability of NS1 to replace the biological functions of E3 of VACV in both in vitro and in vivo systems. For this, we generated a VACV recombinant virus lacking the E3L gene, yet expressing NS1 (VVΔE3L/NS1. Our study revealed that NS1 can functionally replace E3 in cultured cells, rescuing the protein synthesis blockade, and preventing apoptosis and RNA breakdown. In contrast, in vivo the VVΔE3L/NS1 virus was highly attenuated after intranasal inoculation, as it was unable to spread to the lungs and other organs. These results indicate that there are commonalities but also functional differences in the roles of NS1 and E3 as inhibitors of the innate antiviral response, which could potentially be utilized for vaccine production purposes in the future.

  16. Translation of mRNAs from vesicular stomatitis virus and vaccinia virus is differentially blocked in cells with depletion of eIF4GI and/or eIF4GII. (United States)

    Welnowska, Ewelina; Castelló, Alfredo; Moral, Pablo; Carrasco, Luis


    Cytolytic viruses abrogate host protein synthesis to maximize the translation of their own mRNAs. In this study, we analyzed the eukaryotic initiation factor (eIF) 4G requirement for translation of vesicular stomatitis virus (VSV) and vaccinia virus (VV) mRNAs in HeLa cells using two different strategies: eIF4G depletion by small interfering RNAs or cleavage of eIF4G by expression of poliovirus 2A protease. Depletion of eIF4GI or eIF4GII moderately inhibits cellular protein synthesis, whereas silencing of both factors has only a slightly higher effect. Under these conditions, the extent of VSV protein synthesis is similar to that of nondepleted control cells, whereas VV expression is substantially reduced. Similar results were obtained when eIF4E was depleted. On the other hand, eIF4G cleavage by poliovirus 2A protease strongly inhibits translation of VV protein expression, whereas translation directed by VSV mRNAs is not abrogated, even though VSV mRNAs are capped. Therefore, the requirement for eIF4F activity is different for VV and VSV, suggesting that the molecular mechanism by which their mRNAs initiate their translation is also different. Consistent with these findings, eIF4GI does not colocalize with ribosomes in VSV-infected cells, while eIF2alpha locates at perinuclear sites coincident with ribosomes.

  17. Outbreaks of vesicular disease caused by Vaccinia virus in dairy cattle from Goiás State, Brazil (2010-2012

    Directory of Open Access Journals (Sweden)

    Fabiano J.F. de Sant'Ana


    Full Text Available Cases of vesicular and exanthematic disease by Vaccinia virus (VACV have been reported in dairy herds of several Brazilian regions, occasionally also affecting humans. The present article describes eight outbreaks of vesicular disease caused by VACV in dairy herds of six counties of Goiás state, Midwestern Brazil (2010-2012, involving a total of 122 cows, 12 calves and 11 people. Dairy cows (3 to 9 years old were affected in all cases and calves (2 to 9 months old were affected in five outbreaks, presenting oral lesions. The morbidity ranged between 8 and 100% in cows, and 1.5 to 31% in calves. In the cows, the clinical signs started with vesicles (2-7mm, painful and coalescent papules (3-8 mm, which resulted in ulcers (5-25mm and scabs in teats, and, occasionally, in the muzzle. The clinical course lasted from 16 to 26 days. The histopathology of bovine skin samples revealed superficial perivascular inflammatory infiltrate of lymphocytes, plasma cells, neutrophils, macrophages and multifocal areas of acanthosis, spongiosis, hipergranulosis and parakeratotic or orthokeratotic hyperkeratosis with adjacent focally extensive ulcers. Eosinophilic inclusion bodies were noted in the cytoplasm of the keratinocytes. PCR to vgf gene of Orthopoxvirus was positive in samples collected from all outbreaks, and in some cases, genomic VACV sequences were identified by nucleotide sequencing of the PCR amplicons. Infectious virus was isolated in cell culture from scabs from one outbreak. Antibodies to Orthopoxvirus were detected in at least 3 or 4 animals in most outbreaks, by ELISA (outbreaks 1, 2, 3, 4, 5 and 7 or virus-neutralization (outbreak 6. Neutralizing titers ranging from 8 to 64 in outbreak 6. In all outbreaks, VACV infection was suspected based on the clinical and pathological findings and it was confirmed by laboratory tests. Upon the etiological confirmation, other agents associated with vesicular disease were discarded. In all outbreaks, at least

  18. Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant

    Directory of Open Access Journals (Sweden)

    Domingo-Gil Elena


    Full Text Available Abstract Background Hepatitis C virus (HCV infection is of growing concern in public health with around 350 million chronically infected individuals worldwide. Although the IFN-α/rivabirin is the only approved therapy with 10–30% clinical efficacy, the protective molecular mechanism involved during the treatment is still unknown. To analyze the effect of HCV polyprotein expression on the antiviral response of the host, we developed a novel vaccinia virus (VV-based delivery system (VT7-HCV7.9 where structural and nonstructural (except part of NS5B proteins of HCV ORF from genotype 1b are efficiently expressed and produced, and timely regulated in mammalian cell lines. Results Regulated transcript production and viral polypeptide processing was demonstrated in various cell lines infected with the recombinant VT7-HCV7.9, indicating that the cellular and viral proteolytic machineries are functional within these cells. The inducible expression of the HCV polyprotein by VV inhibits the synthesis of both host and viral proteins over the time and also induces apoptosis in HeLa and HepG2-infected cells. These effects occur accompanying with the phosphorylation of the translation initiation factor eIF-2α. In cells co-infected with VT7-HCV7.9 and a recombinant VV expressing the dominant negative eIF-2α-S51A mutant in the presence of the inductor isopropyl-thiogalactoside (IPTG, protein synthesis is rescued. The IFN-inducible protein kinase PKR is responsible for the translational block, as demonstrated with PKR-/- and PKR+/+ cell lines. However, apoptosis induced by VT7-HCV7.9 is mediated by the RNase L pathway, in a PKR-independent manner. Conclusion These findings demonstrate the antiviral relevance of the proteins induced by interferon, PKR and RNase L during expression from a VV recombinant of the HCV polyprotein in human cell lines. HCV polyprotein expression caused a severe cytopathological effect in human cells as a result of inhibition of

  19. Anti-tumoral effect of recombinant vaccinia virus through US guided injection in a rabbit model of hepatic VX2 carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Jong Young; Park, Byeong Ho; Kang, Myong Jin; Cho, Jin Han; Choi, Jong Cheol; Choi, Sun Seob; Nam, Kyung Jin; Hwang, Tae Ho; Jeong, Jin Sook [College of Medicine, Dong-A University, Busan (Korea, Republic of)


    The purpose of this study was to evaluate the anti-tumoral effect of recombinant vaccinia virus (rVV) (Thymidine kinase (-)/GM-CSF (+)) that was administered as a US guided intratumoral injection in a rabbit model of hepatic VX2 carcinoma. VX2 carcinoma was implanted in the livers of 12 rabbits. US was performed at every week interval to detect hepatic mass after the implantation of VX2 carcinoma. The accurate tumor size and volume was evaluated with CT when the tumor was detected on US. US guided injection of rVV (10{sup 9} pfu/ml) was preformed in three rabbits, intravenous injection of the same dose of rVV was done in two rabbits and another seven rabbits that were without any treatment were selected as a control group. We evaluated the change of the hepatic tumor size and extrahepatic metastasis on serial CT. Tumor specimens were harvested from rabbits that were killed at 8 weeks after VX2 implantation. These tissues were histoimmuopathologically compared to each other (the virus injection group and the control group). The differences between these groups were statistically assessed with student t-tests. Tumor growth was significantly suppressed in the US guided injection group compared with the intravenous injection group or the control group ({rho} < 0.01). The intravenous injection group showed statistically significant tumor suppression compared to the control group ({rho} < 0.01) until 2 weeks after virus injection. Quantification of the pulmonary metastatic nodules was performed in view of both the number and volume. The average number or volume of the pulmonary metastatic nodules in the US injection group was much smaller than these in the control group. Histopathologically, the tumors of the US guided injection group showed less extensive necrosis than those of the control group. Immunohistochemically, the tumor of the US guided injection group showed more prominent infiltration of CD4 (+) and CD8 (+) lymphocytes than did the tumors of the other group

  20. Drosophila S2 cells are non-permissive for vaccinia virus DNA replication following entry via low pH-dependent endocytosis and early transcription.

    Directory of Open Access Journals (Sweden)

    Zain Bengali

    Full Text Available Vaccinia virus (VACV, a member of the chordopox subfamily of the Poxviridae, abortively infects insect cells. We have investigated VACV infection of Drosophila S2 cells, which are useful for protein expression and genome-wide RNAi screening. Biochemical and electron microscopic analyses indicated that VACV entry into Drosophila S2 cells depended on the VACV multiprotein entry-fusion complex but appeared to occur exclusively by a low pH-dependent endocytic mechanism, in contrast to both neutral and low pH entry pathways used in mammalian cells. Deep RNA sequencing revealed that the entire VACV early transcriptome, comprising 118 open reading frames, was robustly expressed but neither intermediate nor late mRNAs were made. Nor was viral late protein synthesis or inhibition of host protein synthesis detected by pulse-labeling with radioactive amino acids. Some reduction in viral early proteins was noted by Western blotting. Nevertheless, synthesis of the multitude of early proteins needed for intermediate gene expression was demonstrated by transfection of a plasmid containing a reporter gene regulated by an intermediate promoter. In addition, expression of a reporter gene with a late promoter was achieved by cotransfection of intermediate genes encoding the late transcription factors. The requirement for transfection of DNA templates for intermediate and late gene expression indicated a defect in viral genome replication in VACV-infected S2 cells, which was confirmed by direct analysis. Furthermore, VACV-infected S2 cells did not support the replication of a transfected plasmid, which occurs in mammalian cells and is dependent on all known viral replication proteins, indicating a primary restriction of DNA synthesis.

  1. Viral warfare! Front-line defence and arming the immune system against cancer using oncolytic vaccinia and other viruses. (United States)

    Dave, R V; Jebar, A H S; Jennings, V A; Adair, R A; West, E J; Errington-Mais, F; Toogood, G J; Melcher, A A


    Despite mankind's many achievements, we are yet to find a cure for cancer. We are now approaching a new era which recognises the promise of harnessing the immune system for anti-cancer therapy. Pathogens have been implicated for decades as potential anti-cancer agents, but implementation into clinical therapy has been plagued with significant drawbacks. Newer 'designer' agents have addressed some of these concerns, in particular, a new breed of oncolytic virus: JX-594, a genetically engineered pox virus, is showing promise. To review the current literature on the use of oncolytic viruses in the treatment of cancer; both by direct oncolysis and stimulation of the immune system. The review will provide a background and historical progression for the surgeon on tumour immunology, and the interplay between oncolytic viruses, immune cells, inflammation on tumourigenesis. A literature review was performed using the Medline database. Viral therapeutics hold promise as a novel treatment modality for the treatment of disseminated malignancy. It provides a multi-pronged attack against tumour burden; direct tumour cell lysis, exposure of tumour-associated antigens (TAA), induction of immune danger signals, and recognition by immune effector cells. Copyright © 2014 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  2. Morphogenesis of respiratory syncytial virus in human primary nasal ciliated epithelial cells occurs at surface membrane microdomains that are distinct from cilia

    Energy Technology Data Exchange (ETDEWEB)

    Jumat, Muhammad Raihan [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Yan, Yan [Department of Otolaryngology, Yong Loo Lin School of Medicine, National University Health System, National University of Singapore, Singapore 119228 (Singapore); Ravi, Laxmi Iyer [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Wong, Puisan [Detection and Diagnostics Laboratory, DSO National Laboratories, 27 Medical Drive, Singapore 117510 (Singapore); Huong, Tra Nguyen [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Li, Chunwei [Department of Otolaryngology, Yong Loo Lin School of Medicine, National University Health System, National University of Singapore, Singapore 119228 (Singapore); Tan, Boon Huan [Detection and Diagnostics Laboratory, DSO National Laboratories, 27 Medical Drive, Singapore 117510 (Singapore); Wang, De Yun [Department of Otolaryngology, Yong Loo Lin School of Medicine, National University Health System, National University of Singapore, Singapore 119228 (Singapore); Sugrue, Richard J., E-mail: [School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore)


    The distribution of cilia and the respiratory syncytial virus (RSV) nucleocapsid (N) protein, fusion (F) protein, attachment (G) protein, and M2-1 protein in human ciliated nasal epithelial cells was examined at between 1 and 5 days post-infection (dpi). All virus structural proteins were localized at cell surface projections that were distinct from cilia. The F protein was also trafficked into the cilia, and while its presence increased as the infection proceeded, the N protein was not detected in the cilia at any time of infection. The presence of the F protein in the cilia correlated with cellular changes in the cilia and reduced cilia function. At 5 dpi extensive cilia loss and further reduced cilia function was noted. These data suggested that although RSV morphogenesis occurs at non-cilia locations on ciliated nasal epithelial cells, RSV infection induces changes in the cilia body that leads to extensive cilia loss. - Highlights: • Respiratory syncytial virus (RSV) infects nasal ciliated epithelial cells. • Virus morphogenesis occurs within filamentous projections distinct from cilia. • The RSV N protein was not detected in the cilia at any time during infection. • Trafficking of the F protein into the cilia occurred early in infection. • Presence of the F protein in cilia correlated with impaired cilia function.

  3. Enteric Immunization of Mice Against Influenza with Recombinant Vaccinia (United States)

    Meitin, Catherine A.; Bender, Bradley S.; Small, Parker A., Jr.


    Intrajejunal administration to mice of a recombinant vaccinia virus containing the influenza virus hemagglutinin gene induced IgA antibody in nasal, gut, and vaginal secretions. It also induced IgG antibody in serum and cell-mediated immunity. The immunization provided significant protection against an influenza virus challenge. This work suggests that enteric-coated recombinant vaccinia could be an orally administered, inexpensive, multivalent, temperature-stable, safe, and effective vaccine for children that could be particularly useful in developing nations, where multiple injections are not easily administered. Oral administration of vaccines should also reduce children's fear of shots at the doctor's office.

  4. Viral-mediated oncolysis is the most critical factor in the late-phase of the tumor regression process upon vaccinia virus infection

    Directory of Open Access Journals (Sweden)

    Yu Yong A


    Full Text Available Abstract Background In principle, the elimination of malignancies by oncolytic virotherapy could proceed by different mechanisms - e.g. tumor cell specific oncolysis, destruction of the tumor vasculature or an anti-tumoral immunological response. In this study, we analyzed the contribution of these factors to elucidate the responsible mechanism for regression of human breast tumor xenografts upon colonization with an attenuated vaccinia virus (VACV. Methods Breast tumor xenografts were analyzed 6 weeks post VACV infection (p.i.; regression phase by immunohistochemistry and mouse-specific expression arrays. Viral-mediated oncolysis was determined by tumor growth analysis combined with microscopic studies of intratumoral virus distribution. The tumor vasculature was morphologically characterized by diameter and density measurements and vessel functionality was analyzed by lectin perfusion and extravasation studies. Immunological aspects of viral-mediated tumor regression were studied in either immune-deficient mouse strains (T-, B-, NK-cell-deficient or upon cyclophosphamide-induced immunosuppression (MHCII+-cell depletion in nude mice. Results Late stage VACV-infected breast tumors showed extensive necrosis, which was highly specific to cancer cells. The tumor vasculature in infected tumor areas remained functional and the endothelial cells were not infected. However, viral colonization triggers hyperpermeability and dilatation of the tumor vessels, which resembled the activated endothelium in wounded tissue. Moreover, we demonstrated an increased expression of genes involved in leukocyte-endothelial cell interaction in VACV-infected tumors, which orchestrate perivascular inflammatory cell infiltration. The immunohistochemical analysis of infected tumors displayed intense infiltration of MHCII-positive cells and colocalization of tumor vessels with MHCII+/CD31+ vascular leukocytes. However, GI-101A tumor growth analysis upon VACV-infection in

  5. Profilin is required for viral morphogenesis, syncytium formation, and cell-specific stress fiber induction by respiratory syncytial virus

    Directory of Open Access Journals (Sweden)

    Barik Sailen


    Full Text Available Abstract Background Actin is required for the gene expression and morphogenesis of respiratory syncytial virus (RSV, a clinically important Pneumovirus of the Paramyxoviridae family. In HEp-2 cells, RSV infection also induces actin stress fibers, which may be important in the immunopathology of the RSV disease. Profilin, a major regulator of actin polymerization, stimulates viral transcription in vitro. Thus, we tested the role of profilin in RSV growth and RSV-actin interactions in cultured cells (ex vivo. Results We tested three cell lines: HEp-2 (human, A549 (human, and L2 (rat. In all three, RSV grew well and produced fused cells (syncytium, and two RSV proteins, namely, the phosphoprotein P and the nucleocapsid protein N, associated with profilin. In contrast, induction of actin stress fibers by RSV occurred in HEp-2 and L2 cells, but not in A549. Knockdown of profilin by RNA interference had a small effect on viral macromolecule synthesis but strongly inhibited maturation of progeny virions, cell fusion, and induction of stress fibers. Conclusions Profilin plays a cardinal role in RSV-mediated cell fusion and viral maturation. In contrast, interaction of profilin with the viral transcriptional proteins P and N may only nominally activate viral RNA-dependent RNA polymerase. Stress fiber formation is a cell-specific response to infection, requiring profilin and perhaps other signaling molecules that are absent in certain cell lines. Stress fibers per se play no role in RSV replication in cell culture. Clearly, the cellular architecture controls multiple steps of host-RSV interaction, some of which are regulated by profilin.

  6. Immunogenicity of oncolytic vaccinia viruses JX-GFP and TG6002 in a human melanoma in vitro model: studying immunogenic cell death, dendritic cell maturation and interaction with cytotoxic T lymphocytes

    Directory of Open Access Journals (Sweden)

    Heinrich B


    Full Text Available B Heinrich,1 J Klein,1 M Delic,1 K Goepfert,1 V Engel,1 L Geberzahn,1 M Lusky,2 P Erbs,2 X Preville,3 M Moehler1 1First Department of Internal Medicine, University Medical Center Mainz, Mainz, Germany; 2Transgene SA, Illkirch-Graffenstaden, 3Amoneta Diagnostics, Huningue, France Abstract: Oncolytic virotherapy is an emerging immunotherapeutic modality for cancer treatment. Oncolytic viruses with genetic modifications can further enhance the oncolytic effects on tumor cells and stimulate antitumor immunity. The oncolytic vaccinia viruses JX-594-GFP+/hGM-CSF (JX-GFP and TG6002 are genetically modified by secreting granulocyte-macrophage colony-stimulating factor (GM-CSF or transforming 5-fluorocytosine (5-FC into 5-fluorouracil (5-FU. We compared their properties to kill tumor cells and induce an immunogenic type of cell death in a human melanoma cell model using SK29-MEL melanoma cells. Their influence on human immune cells, specifically regarding the activation of dendritic cells (DCs and the interaction with the autologous cytotoxic T lymphocyte (CTL clone, was investigated. Melanoma cells were infected with either JX-GFP or TG6002 alone or in combination with 5-FC and 5-FU. The influence of viral infection on cell viability followed a time- and multiplicity of infection dependent manner. Combination of virus treatment with 5-FU resulted in stronger reduction of cell viability. TG6002 in combination with 5-FC did not significantly strengthen the reduction of cell viability in this setting. Expression of calreticulin and high mobility group 1 protein (HMGB1, markers of immunogenic cell death (ICD, could be detected after viral infection. Accordingly, DC maturation was noted after viral oncolysis. DCs presented stronger expression of activation and maturation markers. The autologous CTL clone IVSB expressed the activation marker CD69, but viral treatment failed to enhance cytotoxicity marker. In summary, vaccinia viruses JX-GFP and TG6002 lyse

  7. Deletion ofF4L(ribonucleotide reductase) in vaccinia virus produces a selective oncolytic virus and promotes anti-tumor immunity with superior safety in bladder cancer models. (United States)

    Potts, Kyle G; Irwin, Chad R; Favis, Nicole A; Pink, Desmond B; Vincent, Krista M; Lewis, John D; Moore, Ronald B; Hitt, Mary M; Evans, David H


    Bladder cancer has a recurrence rate of up to 80% and many patients require multiple treatments that often fail, eventually leading to disease progression. In particular, standard of care for high-grade disease, Bacillus Calmette-Guérin (BCG), fails in 30% of patients. We have generated a novel oncolytic vaccinia virus (VACV) by mutating the F4L gene that encodes the virus homolog of the cell-cycle-regulated small subunit of ribonucleotide reductase (RRM2). The F4L -deleted VACVs are highly attenuated in normal tissues, and since cancer cells commonly express elevated RRM2 levels, have tumor-selective replication and cell killing. These F4L -deleted VACVs replicated selectively in immune-competent rat AY-27 and xenografted human RT112-luc orthotopic bladder cancer models, causing significant tumor regression or complete ablation with no toxicity. It was also observed that rats cured of AY-27 tumors by VACV treatment developed anti-tumor immunity as evidenced by tumor rejection upon challenge and by ex vivo cytotoxic T-lymphocyte assays. Finally, F4L -deleted VACVs replicated in primary human bladder cancer explants. Our findings demonstrate the enhanced safety and selectivity of F4L -deleted VACVs, with application as a promising therapy for patients with BCG-refractory cancers and immune dysregulation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  8. In silico-accelerated identification of conserved and immunogenic variola/vaccinia T-cell epitopes

    DEFF Research Database (Denmark)

    Moise, Leonard; McMurry, Julie A; Buus, Søren


    Epitopes shared by the vaccinia and variola viruses underlie the protective effect of vaccinia immunization against variola infection. We set out to identify a subset of cross-reactive epitopes using bioinformatics and immunological methods. Putative T-cell epitopes were computationally predicted...

  9. Surto de varíola bovina causada pelo vírus Vaccinia na região da Zona da Mata Mineira Outbreak of exantemal disease caused by Vaccinia virus in human and cattle in Zona da Mata region, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Z.I.P. Lobato


    Full Text Available Relata-se um surto de doença exantemática, caracterizada como varíola bovina, acometendo bovinos e seres humanos na Zona da Mata Mineira. Setenta e duas propriedades, distribuídas em 20 municípios localizados na região, foram visitadas para se levantar os aspectos clínicos e epidemiológicos da doença. Detectaram-se 1020 vacas doentes durante a investigação, quando houve queda na produção do leite associada a infecções bacterianas secundárias. Casos humanos foram registrados em 83% das propriedades visitadas. Espécimes clínicos e amostras de soro foram coletados dos animais doentes ou convalescentes. O diagnóstico de laboratório mostrou o envolvimento de um ortopoxvírus, precisamente o Vaccinia virus como agente etiológico do surto.It was investigated an outbreak of exantemal disease in human and cattle in Zona da Mata region, Minas Gerais's State, Brazil. Seventy two farms located in 20 counties locating in this region were visited and disease pattern was studied. 1020 cows got sick in the visited herds and in 83% of them human cases occurred together with disease in animals. Drop in milk production and secondary infection were frequently observed. The disease occurred mainly from may to September. Serum and scars from sick and convalescent animals were collected and laboratory diagnostic showed that an orthopoxvirus, more precisely vaccinia virus was involved in the outbreak.

  10. The primary immune response to Vaccinia virus vaccination includes cells with a distinct cytotoxic effector CD4 T-cell phenotype. (United States)

    Munier, C Mee Ling; van Bockel, David; Bailey, Michelle; Ip, Susanna; Xu, Yin; Alcantara, Sheilajen; Liu, Sue Min; Denyer, Gareth; Kaplan, Warren; Suzuki, Kazuo; Croft, Nathan; Purcell, Anthony; Tscharke, David; Cooper, David A; Kent, Stephen J; Zaunders, John J; Kelleher, Anthony D


    Smallpox was eradicated by a global program of inoculation with Vaccinia virus (VV). Robust VV-specific CD4 T-cell responses during primary infection are likely essential to controlling VV replication. Although there is increasing interest in cytolytic CD4 T-cells across many viral infections, the importance of these cells during acute VV infection is unclear. We undertook a detailed functional and genetic characterization of CD4 T-cells during acute VV-infection of humans. VV-specific T-cells were identified by up-regulation of activation markers directly ex vivo and through cytokine and co-stimulatory molecule expression. At day-13-post primary inoculation with VV, CD38highCD45RO+ CD4 T-cells were purified by cell sorting, RNA isolated and analysed by microarray. Differential expression of up-regulated genes in activated CD4 T-cells was confirmed at the mRNA and protein levels. We compared analyses of VV-specific CD4 T-cells to studies on 12 subjects with primary HIV infection (PHI). VV-specific T-cells lines were established from PBMCs collected post vaccination and checked for cytotoxicity potential. A median 11.9% CD4 T-cells were CD38highCD45RO+ at day-13 post-VV inoculation, compared to 3.0% prior and 10.4% during PHI. Activated CD4 T-cells had an up-regulation of genes related to cytolytic function, including granzymes K and A, perforin, granulysin, TIA-1, and Rab27a. No difference was seen between CD4 T-cell expression of perforin or TIA-1 to VV and PHI, however granzyme k was more dominant in the VV response. At 25:1 effector to target ratio, two VV-specific T-cell lines exhibited 62% and 30% cytotoxicity respectively and CD107a degranulation. We show for the first time that CD4 CTL are prominent in the early response to VV. Understanding the role of CD4 CTL in the generation of an effective anti-viral memory may help develop more effective vaccines for diseases such as HIV. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  11. Crystal structure of the vaccinia virus DNA polymerase holoenzyme subunit D4 in complex with the A20 N-terminal domain.

    Directory of Open Access Journals (Sweden)

    Céline Contesto-Richefeu


    Full Text Available Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase E9, the uracil-DNA glycosylase D4 and A20, a protein with no known enzymatic activity. The D4/A20 heterodimer is the DNA polymerase co-factor whose function is essential for processive DNA synthesis. Genetic and biochemical data have established that residues located in the N-terminus of A20 are critical for binding to D4. However, no information regarding the residues of D4 involved in A20 binding is yet available. We expressed and purified the complex formed by D4 and the first 50 amino acids of A20 (D4/A20₁₋₅₀. We showed that whereas D4 forms homodimers in solution when expressed alone, D4/A20₁₋₅₀ clearly behaves as a heterodimer. The crystal structure of D4/A20₁₋₅₀ solved at 1.85 Å resolution reveals that the D4/A20 interface (including residues 167 to 180 and 191 to 206 of D4 partially overlaps the previously described D4/D4 dimer interface. A20₁₋₅₀ binding to D4 is mediated by an α-helical domain with important leucine residues located at the very N-terminal end of A20 and a second stretch of residues containing Trp43 involved in stacking interactions with Arg167 and Pro173 of D4. Point mutations of the latter residues disturb D4/A20₁₋₅₀ formation and reduce significantly thermal stability of the complex. Interestingly, small molecule docking with anti-poxvirus inhibitors selected to interfere with D4/A20 binding could reproduce several key features of the D4/A20₁₋₅₀ interaction. Finally, we propose a model of D4/A20₁₋₅₀ in complex with DNA and discuss a number of mutants described in the literature, which affect DNA synthesis. Overall, our data give new insights into the assembly of the poxvirus DNA polymerase cofactor and may be useful for the design and rational improvement of antivirals targeting the D4/A20 interface.

  12. Innate immune sensing of modified vaccinia virus Ankara (MVA is mediated by TLR2-TLR6, MDA-5 and the NALP3 inflammasome.

    Directory of Open Access Journals (Sweden)

    Julie Delaloye


    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated double-stranded DNA poxvirus currently developed as a vaccine vector against HIV/AIDS. Profiling of the innate immune responses induced by MVA is essential for the design of vaccine vectors and for anticipating potential adverse interactions between naturally acquired and vaccine-induced immune responses. Here we report on innate immune sensing of MVA and cytokine responses in human THP-1 cells, primary human macrophages and mouse bone marrow-derived macrophages (BMDMs. The innate immune responses elicited by MVA in human macrophages were characterized by a robust chemokine production and a fairly weak pro-inflammatory cytokine response. Analyses of the cytokine production profile of macrophages isolated from knockout mice deficient in Toll-like receptors (TLRs or in the adapter molecules MyD88 and TRIF revealed a critical role for TLR2, TLR6 and MyD88 in the production of IFNbeta-independent chemokines. MVA induced a marked up-regulation of the expression of RIG-I like receptors (RLR and the IPS-1 adapter (also known as Cardif, MAVS or VISA. Reduced expression of RIG-I, MDA-5 and IPS-1 by shRNAs indicated that sensing of MVA by RLR and production of IFNbeta and IFNbeta-dependent chemokines was controlled by the MDA-5 and IPS-1 pathway in the macrophage. Crosstalk between TLR2-MyD88 and the NALP3 inflammasome was essential for expression and processing of IL-1beta. Transcription of the Il1b gene was markedly impaired in TLR2(-/- and MyD88(-/- BMDM, whereas mature and secreted IL-1beta was massively reduced in NALP3(-/- BMDMs or in human THP-1 macrophages with reduced expression of NALP3, ASC or caspase-1 by shRNAs. Innate immune sensing of MVA and production of chemokines, IFNbeta and IL-1beta by macrophages is mediated by the TLR2-TLR6-MyD88, MDA-5-IPS-1 and NALP3 inflammasome pathways. Delineation of the host response induced by MVA is critical for improving our understanding of poxvirus

  13. Comparing adjuvanted H28 and modified vaccinia virus ankara expressingH28 in a mouse and a non-human primate tuberculosis model.

    Directory of Open Access Journals (Sweden)

    Rolf Billeskov

    Full Text Available Here we report for the first time on the immunogenicity and protective efficacy of a vaccine strategy involving the adjuvanted fusion protein "H28" (consisting of Ag85B-TB10.4-Rv2660c and Modified Vaccinia Virus Ankara expressing H28. We show that a heterologous prime-boost regimen involving priming with H28 in a Th1 adjuvant followed by boosting with H28 expressed by MVA (H28/MVA28 induced the highest percentage of IFN-γ expressing T cells, the highest production of IFN-γ per single cell and the highest induction of CD8 T cells compared to either of the vaccines given alone. In contrast, in mice vaccinated with adjuvanted recombinant H28 alone (H28/H28 we observed the highest production of IL-2 per single cell and the highest frequency of antigen specific TNF-α/IL-2 expressing CD4 T cells pre and post infection. Interestingly, TNF-α/IL-2 expressing central memory-like CD4 T cells showed a significant positive correlation with protection at week 6 post infection, whereas the opposite was observed for post infection CD4 T cells producing only IFN-γ. Moreover, as a BCG booster vaccine in a clinically relevant non-human primate TB model, the H28/H28 vaccine strategy induced a slightly more prominent reduction of clinical disease and pathology for up to one year post infection compared to H28/MVA28. Taken together, our data showed that the adjuvanted subunit and MVA strategies led to different T cell subset combinations pre and post infection and that TNF-α/IL-2 double producing but not IFN-γ single producing CD4 T cell subsets correlated with protection in the mouse TB model. Moreover, our data demonstrated that the H28 vaccine antigen was able to induce strong protection in both a mouse and a non-human primate TB model.

  14. Diseño y construcción de vectores de transferencia para la obtención de virus vaccinia Ankara modificado (MVA recombinantes Design and construction of transfer vectors in order to obtain recombinant modified vaccinia virus Ankara (MVA

    Directory of Open Access Journals (Sweden)

    M. F. Ferrer


    Full Text Available El virus vaccinia Ankara modificado (MVA constituye un buen candidato para el desarrollo de vectores virales de expresión no replicativos porque no replica en la mayoría de las células de mamíferos. Para la producción de MVA recombinantes es fundamental disponer de vectores de transferencia que, por recombinación homóloga con el genoma viral, permitan introducir los genes de interés en regiones no esenciales para la replicación in vitro. En este trabajo se diseñaron y obtuvieron los vectores de transferencia denominados VT-MHA y VT-MTK que portan las regiones correspondientes a las posiciones 1-303 y 608-948 del gen MVA165R y 1-244 y 325-534 del gen MVA086R, respectivamente, las que flanquean un sitio de clonado múltiple para la inserción de los genes foráneos. En dichos vectores se clonaron los casetes para la expresión de los genes lac Z o uid A, y la actividad de las enzimas marcadoras b-galactosidasa y b-glucuronidasa se confirmó in situ. Además, utilizando el vector denominado VT-MTK-GUS, se obtuvieron y aislaron MVA recombinantes puros que portan y expresan el gen uid A. Los resultados obtenidos constituyen las herramientas básicas para establecer la metodología de obtención de MVA recombinantes, con el propósito de desarrollar localmente vectores virales no replicativos candidatos a vacunas.Modified Vaccinia virus Ankara (MVA constitutes a good candidate for the development of non-replicative expression viral vectors because it does not replicate in most of mammalian cells. It is essential, for the production of recombinant MVA, the availability of transfer vectors which allow the introduction of desired genes into non-essential regions for in vitro viral replication, by homologous recombination with the viral genome. In the present work, the transfer vectors named VT-MHA and VT-MTK were designed and obtained. They carried genomic regions corresponding to 1- 303 and 608-948 positions of the MVA165R gene and 1-244 and

  15. Immunogenicity of the candidate malaria vaccines FP9 and modified vaccinia virus Ankara encoding the pre-erythrocytic antigen ME-TRAP in 1-6 year old children in a malaria endemic area. (United States)

    Bejon, Philip; Mwacharo, Jedidah; Kai, Oscar K; Todryk, Stephen; Keating, Sheila; Lang, Trudie; Gilbert, Sarah C; Peshu, Norbert; Marsh, Kevin; Hill, Adrian V S


    In a phase 1 trial, 22 children in a malaria endemic area were immunised with candidate malaria vaccination regimes. The regimes used two recombinant viral vectors, attenuated fowlpox strain FP9 and modified vaccinia virus Ankara (MVA). Both encoded the pre-erythrocytic malaria antigen construct ME-TRAP. Strong T cell responses were detected by both ex vivo and cultured ELISpot assays. Data from phase 1 trials in adults on anti-vector responses raised by FP9 is presented. These responses partially cross-reacted with MVA, and detectably reduced the immunogenicity of vaccination with MVA. This prompted the comparison of half dose and full dose FP9 priming vaccinations in children. Regimes using half dose FP9 priming tended to be more immunogenic than full dose. The potential for enhanced immunogenicity with half doses of priming vectors warrants further investigation, and larger studies to determine protection against malaria in children are required.

  16. Vaccination with recombinant modified vaccinia virus Ankara expressing bovine respiratory syncytial virus (bRSV) proteins protects calves against RSV challenge

    NARCIS (Netherlands)

    Antonis, A.F.G.; Most, van der R.G.; Suezer, Y.; Stockhofe-Zurwieden, N.; Daus, F.J.; Sutter, G.; Schrijver, R.S.


    Respiratory syncytial virus (RSV) is a major cause of severe respiratory disease in infants and calves. Bovine RSV (bRSV) is a natural pathogen for cattle, and bRSV infection in calves shares many features with the human infection. Thus, bRSV infection in cattle provides the ideal setting to

  17. Immune properties of recombinant vaccinia virus encoding CD154 (CD40L) are determined by expression of virally encoded CD40L and the presence of CD40L protein in viral particles. (United States)

    Bereta, Michal; Bereta, Joanna; Park, Jonas; Medina, Freddy; Kwak, Heesun; Kaufman, Howard L


    Expression of costimulatory molecules by recombinant poxviruses is a promising strategy for enhancing therapeutic vaccines. CD40-CD40L interactions are critical for conditioning dendritic cells (DC) and priming T- and B-cell immunity. We constructed a vaccinia virus expressing murine CD40L (rV-CD40L) and studied its immunomodulatory properties in vitro. Direct DC infection with control vaccinia or psoralen/UV-inactivated rV-CD40L stimulated high levels of interleukin 12 (IL-12) release. However, replication-competent rV-CD40L did not stimulate IL-12 under similar conditions. We observed a high level of CD40L protein on purified viral particles and demonstrated that induction of IL-12 by nonreplicating rV-CD40L was blocked by anti-CD40 antibodies suggesting that functional CD40L on viral particles contributed to alterations in IL-12 synthesis. Since cross-presentation of tumor-associated antigens by DC is augmented by viral infection of tumor cells, we infected MC38 murine colon carcinoma cells with rV-CD40L. Infected cells stimulated IL-12 secretion by DC and proliferation of B cells and DX5(+) (NK/NKT) cells through direct CD40-CD40L interaction. A subpopulation of NKT cells expressing CD40 (NK1.1(+), CD3(lo)) appeared to be a major effector population responding to MC38/rV-CD40L. These results highlight the complex immune regulatory effects of rV-CD40L defined by the cumulative effects of CD40L expression, presence of CD40L protein in viral particles, and the replication potential of the virus.

  18. Identification of Restriction Factors by Human Genome-Wide RNA Interference Screening of Viral Host Range Mutants Exemplified by Discovery of SAMD9 and WDR6 as Inhibitors of the Vaccinia Virus K1L-C7L- Mutant. (United States)

    Sivan, Gilad; Ormanoglu, Pinar; Buehler, Eugen C; Martin, Scott E; Moss, Bernard


    RNA interference (RNAi) screens intended to identify host factors that restrict virus replication may fail if the virus already counteracts host defense mechanisms. To overcome this limitation, we are investigating the use of viral host range mutants that exhibit impaired replication in nonpermissive cells. A vaccinia virus (VACV) mutant with a deletion of both the C7L and K1L genes, K1L(-)C7L(-), which abrogates replication in human cells at a step prior to late gene expression, was chosen for this strategy. We carried out a human genome-wide small interfering RNA (siRNA) screen in HeLa cells infected with a VACV K1L(-)C7L(-) mutant that expresses the green fluorescent protein regulated by a late promoter. This positive-selection screen had remarkably low background levels and resulted in the identification of a few cellular genes, notably SAMD9 and WDR6, from approximately 20,000 tested that dramatically enhanced green fluorescent protein expression. Replication of the mutant virus was enabled by multiple siRNAs to SAMD9 or WDR6. Moreover, SAMD9 and WDR6 clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 knockout HeLa cell lines were permissive for replication of the K1L(-)C7L(-) mutant, in agreement with the siRNA data. Expression of exogenous SAMD9 or interferon regulatory factor 1 restricted replication of the K1L(-)C7L(-) mutant in the SAMD9(-/-) cells. Independent interactions of SAMD9 with the K1 and C7 proteins were suggested by immunoprecipitation. Knockout of WDR6 did not reduce the levels of SAMD9 and interactions of WDR6 with SAMD9, C7, and K1 proteins were not detected, suggesting that these restriction factors act independently but possibly in the same innate defense pathway. The coevolution of microbial pathogens with cells has led to an arms race in which the invader and host continuously struggle to gain the advantage. For this reason, traditional siRNA screens may fail to uncover important immune mechanisms if the pathogens

  19. Oncolytic vaccinia therapy of squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Yong A


    Full Text Available Abstract Background Novel therapies are necessary to improve outcomes for patients with squamous cell carcinomas (SCC of the head and neck. Historically, vaccinia virus was administered widely to humans as a vaccine and led to the eradication of smallpox. We examined the therapeutic effects of an attenuated, replication-competent vaccinia virus (GLV-1h68 as an oncolytic agent against a panel of six human head and neck SCC cell lines. Results All six cell lines supported viral transgene expression (β-galactosidase, green fluorescent protein, and luciferase as early as 6 hours after viral exposure. Efficient transgene expression and viral replication (>150-fold titer increase over 72 hrs were observed in four of the cell lines. At a multiplicity of infection (MOI of 1, GLV-1h68 was highly cytotoxic to the four cell lines, resulting in ≥ 90% cytotoxicity over 6 days, and the remaining two cell lines exhibited >45% cytotoxicity. Even at a very low MOI of 0.01, three cell lines still demonstrated >60% cell death over 6 days. A single injection of GLV-1h68 (5 × 106 pfu intratumorally into MSKQLL2 xenografts in mice exhibited localized intratumoral luciferase activity peaking at days 2–4, with gradual resolution over 10 days and no evidence of spread to normal organs. Treated animals exhibited near-complete tumor regression over a 24-day period without any observed toxicity, while control animals demonstrated rapid tumor progression. Conclusion These results demonstrate significant oncolytic efficacy by an attenuated vaccinia virus for infecting and lysing head and neck SCC both in vitro and in vivo, and support its continued investigation in future clinical trials.

  20. Vaccinia virus A43R gene encodes an orthopoxvirus-specific late non-virion type-1 membrane protein that is dispensable for replication but enhances intradermal lesion formation. (United States)

    Sood, Cindy L; Moss, Bernard


    The vaccinia virus A43R open reading frame encodes a 168-amino acid protein with a predicted N-terminal signal sequence and a C-terminal transmembrane domain. Although A43R is conserved in all sequenced members of the orthopoxvirus genus, no non-orthopoxvirus homolog or functional motif was recognized. Biochemical and confocal microscopic studies indicated that A43 is expressed at late times following viral DNA synthesis and is a type-1 membrane protein with two N-linked oligosaccharide chains. A43 was present in Golgi and plasma membranes but only a trace amount was detected in sucrose gradient purified mature virions and none in CsCl gradient purified enveloped virions. Prevention of A43R expression had no effect on plaque size or virus replication in cell culture and little effect on virulence after mouse intranasal infection. Although the A43 mutant produced significantly smaller lesions in skin of mice than the control, the amounts of virus recovered from the lesions were similar.

  1. Use of the Capripoxvirus homologue of Vaccinia virus 30 kDa RNA polymerase subunit (RPO30) gene as a novel diagnostic and genotyping target: development of a classical PCR method to differentiate Goat poxvirus from Sheep poxvirus. (United States)

    Lamien, Charles Euloge; Le Goff, Christian; Silber, Roland; Wallace, David B; Gulyaz, Velý; Tuppurainen, Eeva; Madani, Hafsa; Caufour, Philippe; Adam, Tajelser; El Harrak, Mehdi; Luckins, Antony George; Albina, Emmanuel; Diallo, Adama


    Sheep poxvirus (SPPV), Goat poxvirus (GTPV) and Lumpy skin disease virus (LSDV) are Capripoxviruses (CaPVs) responsible for causing severe poxvirus disease in sheep, goats and cattle, respectively. Serological differentiation of CaPVs is not possible and strain identification has relied on the implicitly accepted hypothesis that the viruses show well defined host specificity. However, it is now known that cross infections can occur and authentication of identity based on the host animal species from which the strain was first isolated, is not valid and should be replaced with molecular techniques to allow unequivocal strain differentiation. To identify a diagnostic target for strain genotyping, the CaPV homologue of the Vaccinia virus E4L gene which encodes the 30 kDa DNA-dependent RNA polymerase subunit, RPO30 was analyzed. Forty-six isolates from different hosts and geographical origins were included. Most CaPVs fit into one of the three different groups according to their host origins: the SPPV, the GTPV and the LSDV group. A unique 21-nucleotide deletion was found in all SPPV isolates which was exploited to develop a RPO30-based classical PCR test to differentiate SPPV from GTPV that will allow rapid differential diagnosis of disease during CaPV outbreaks in small ruminants. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Establishing elements of a synthetic biology platform for Vaccinia virus production: BioBrick™ design, serum-free virus production and microcarrier-based cultivation of CV-1 cells

    Directory of Open Access Journals (Sweden)

    Shuchang Liu


    Full Text Available Vaccinia virus (VACV is an established vector for vaccination and is beginning to prove effective as an oncolytic agent. Industrial production of VACV stands to benefit in future from advances made by synthetic biology in genome engineering and standardisation. The CV-1 cell line can be used for VACV propagation and has been used extensively with the CRISPR/Cas9 system for making precise edits of the VACV genome. Here we take first steps toward establishing a scalable synthetic biology platform for VACV production with CV-1 cells featuring standardised biological tools and serum free cell cultivation. We propose a new BioBrick™ plasmid backbone format for inserting transgenes into VACV. We then test the performance of CV-1 cells in propagation of a conventional recombinant Lister strain VACV, VACVL-15 RFP, in a serum-free process. CV-1 cells grown in 5% foetal bovine serum (FBS Dulbecco’s Modified Eagle Medium (DMEM were adapted to growth in OptiPRO and VP-SFM brands of serum-free media. Specific growth rates of 0.047 h−1 and 0.044 h−1 were observed for cells adapted to OptiPRO and VP-SFM respectively, compared to 0.035 h−1 in 5% FBS DMEM. Cells adapted to OptiPRO and to 5% FBS DMEM achieved recovery ratios of over 96%, an indication of their robustness to cryopreservation. Cells adapted to VP-SFM showed a recovery ratio of 82%. Virus productivity in static culture, measured as plaque forming units (PFU per propagator cell, was 75 PFU/cell for cells in 5% FBS DMEM. VP-SFM and OptiPRO adaptation increased VACV production to 150 PFU/cell and 350 PFU/cell respectively. Boosted PFU/cell from OptiPRO-adapted cells persisted when 5% FBS DMEM or OptiPRO medium was observed during the infection step and when titre was measured using cells adapted to 5% FBS DMEM or OptiPRO medium. Finally, OptiPRO-adapted CV-1 cells were successfully cultivated using Cytodex-1 microcarriers to inform future scale up studies.

  3. Establishing elements of a synthetic biology platform for Vaccinia virus production: BioBrick™ design, serum-free virus production and microcarrier-based cultivation of CV-1 cells. (United States)

    Liu, Shuchang; Ruban, Ludmila; Wang, Yaohe; Zhou, Yuhong; Nesbeth, Darren N


    Vaccinia virus (VACV) is an established vector for vaccination and is beginning to prove effective as an oncolytic agent. Industrial production of VACV stands to benefit in future from advances made by synthetic biology in genome engineering and standardisation. The CV-1 cell line can be used for VACV propagation and has been used extensively with the CRISPR/Cas9 system for making precise edits of the VACV genome. Here we take first steps toward establishing a scalable synthetic biology platform for VACV production with CV-1 cells featuring standardised biological tools and serum free cell cultivation. We propose a new BioBrick™ plasmid backbone format for inserting transgenes into VACV. We then test the performance of CV-1 cells in propagation of a conventional recombinant Lister strain VACV, VACVL-15 RFP, in a serum-free process. CV-1 cells grown in 5% foetal bovine serum (FBS) Dulbecco's Modified Eagle Medium (DMEM) were adapted to growth in OptiPRO and VP-SFM brands of serum-free media. Specific growth rates of 0.047 h-1 and 0.044 h-1 were observed for cells adapted to OptiPRO and VP-SFM respectively, compared to 0.035 h-1 in 5% FBS DMEM. Cells adapted to OptiPRO and to 5% FBS DMEM achieved recovery ratios of over 96%, an indication of their robustness to cryopreservation. Cells adapted to VP-SFM showed a recovery ratio of 82%. Virus productivity in static culture, measured as plaque forming units (PFU) per propagator cell, was 75 PFU/cell for cells in 5% FBS DMEM. VP-SFM and OptiPRO adaptation increased VACV production to 150 PFU/cell and 350 PFU/cell respectively. Boosted PFU/cell from OptiPRO-adapted cells persisted when 5% FBS DMEM or OptiPRO medium was observed during the infection step and when titre was measured using cells adapted to 5% FBS DMEM or OptiPRO medium. Finally, OptiPRO-adapted CV-1 cells were successfully cultivated using Cytodex-1 microcarriers to inform future scale up studies.

  4. Deletion of the vaccinia virus gene A46R, encoding for an inhibitor of TLR signalling, is an effective approach to enhance the immunogenicity in mice of the HIV/AIDS vaccine candidate NYVAC-C.

    Directory of Open Access Journals (Sweden)

    Beatriz Perdiguero

    Full Text Available Viruses have developed strategies to counteract signalling through Toll-like receptors (TLRs that are involved in the detection of viruses and induction of proinflammatory cytokines and IFNs. Vaccinia virus (VACV encodes A46 protein which disrupts TLR signalling by interfering with TLR: adaptor interactions. Since the innate immune response to viruses is critical to induce protective immunity, we studied whether deletion of A46R gene in a NYVAC vector expressing HIV-1 Env, Gag, Pol and Nef antigens (NYVAC-C improves immune responses against HIV-1 antigens. This question was examined in human macrophages and in mice infected with a single A46R deletion mutant of the vaccine candidate NYVAC-C (NYVAC-C-ΔA46R. The viral gene A46R is not required for virus replication in primary chicken embryo fibroblast (CEF cells and its deletion in NYVAC-C markedly increases TNF, IL-6 and IL-8 secretion by human macrophages. Analysis of the immune responses elicited in BALB/c mice after DNA prime/NYVAC boost immunization shows that deletion of A46R improves the magnitude of the HIV-1-specific CD4 and CD8 T cell immune responses during adaptive and memory phases, maintains the functional profile observed with the parental NYVAC-C and enhances anti-gp120 humoral response during the memory phase. These findings establish the immunological role of VACV A46R on innate immune responses of macrophages in vitro and antigen-specific T and B cell immune responses in vivo and suggest that deletion of viral inhibitors of TLR signalling is a useful approach for the improvement of poxvirus-based vaccine candidates.

  5. The morphogenesis of herpes simplex virus type 1 in infected parental mouse L fibroblasts and mutant gro29 cells

    DEFF Research Database (Denmark)

    Jensen, Helle Lone; Norrild, Bodil


    Mutants of cell lines and viruses are important biological tools. The pathway of herpesvirus particle maturation and egress are contentious issues. The mutant gro29 line of mouse L cells is defective for egress of herpes simplex virus type 1 (HSV-1) virions, and a candidate for studies of virus...

  6. Identification of Restriction Factors by Human Genome-Wide RNA Interference Screening of Viral Host Range Mutants Exemplified by Discovery of SAMD9 and WDR6 as Inhibitors of the Vaccinia Virus K1L−C7L− Mutant (United States)

    Sivan, Gilad; Ormanoglu, Pinar; Buehler, Eugen C.; Martin, Scott E.


    ABSTRACT RNA interference (RNAi) screens intended to identify host factors that restrict virus replication may fail if the virus already counteracts host defense mechanisms. To overcome this limitation, we are investigating the use of viral host range mutants that exhibit impaired replication in nonpermissive cells. A vaccinia virus (VACV) mutant with a deletion of both the C7L and K1L genes, K1L−C7L−, which abrogates replication in human cells at a step prior to late gene expression, was chosen for this strategy. We carried out a human genome-wide small interfering RNA (siRNA) screen in HeLa cells infected with a VACV K1L−C7L− mutant that expresses the green fluorescent protein regulated by a late promoter. This positive-selection screen had remarkably low background levels and resulted in the identification of a few cellular genes, notably SAMD9 and WDR6, from approximately 20,000 tested that dramatically enhanced green fluorescent protein expression. Replication of the mutant virus was enabled by multiple siRNAs to SAMD9 or WDR6. Moreover, SAMD9 and WDR6 clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 knockout HeLa cell lines were permissive for replication of the K1L−C7L− mutant, in agreement with the siRNA data. Expression of exogenous SAMD9 or interferon regulatory factor 1 restricted replication of the K1L−C7L− mutant in the SAMD9−/− cells. Independent interactions of SAMD9 with the K1 and C7 proteins were suggested by immunoprecipitation. Knockout of WDR6 did not reduce the levels of SAMD9 and interactions of WDR6 with SAMD9, C7, and K1 proteins were not detected, suggesting that these restriction factors act independently but possibly in the same innate defense pathway. PMID:26242627

  7. Safety and tolerability of conserved region vaccines vectored by plasmid DNA, simian adenovirus and modified vaccinia virus ankara administered to human immunodeficiency virus type 1-uninfected adults in a randomized, single-blind phase I trial.

    Directory of Open Access Journals (Sweden)

    Emma-Jo Hayton

    Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2

  8. Proteome analysis of vaccinia virus IHD-W-infected HEK 293 cells with 2-dimensional gel electrophoresis and MALDI-PSD-TOF MS of on solid phase support N-terminally sulfonated peptides

    Directory of Open Access Journals (Sweden)

    Bartel Sebastian


    Full Text Available Abstract Background Despite the successful eradication of smallpox by the WHO-led vaccination programme, pox virus infections remain a considerable health threat. The possible use of smallpox as a bioterrorism agent as well as the continuous occurrence of zoonotic pox virus infections document the relevance to deepen the understanding for virus host interactions. Since the permissiveness of pox infections is independent of hosts surface receptors, but correlates with the ability of the virus to infiltrate the antiviral host response, it directly depends on the hosts proteome set. In this report the proteome of HEK293 cells infected with Vaccinia Virus strain IHD-W was analyzed by 2-dimensional gel electrophoresis and MALDI-PSD-TOF MS in a bottom-up approach. Results The cellular and viral proteomes of VACV IHD-W infected HEK293 cells, UV-inactivated VACV IHD-W-treated as well as non-infected cells were compared. Derivatization of peptides with 4-sulfophenyl isothiocyanate (SPITC carried out on ZipTipμ-C18 columns enabled protein identification via the peptides' primary sequence, providing improved s/n ratios as well as signal intensities of the PSD spectra. The expression of more than 24 human proteins was modulated by the viral infection. Effects of UV-inactivated and infectious viruses on the hosts' proteome concerning energy metabolism and proteins associated with gene expression and protein-biosynthesis were quite similar. These effects might therefore be attributed to virus entry and virion proteins. However, the modulation of proteins involved in apoptosis was clearly correlated to infectious viruses. Conclusions The proteome analysis of infected cells provides insight into apoptosis modulation, regulation of cellular gene expression and the regulation of energy metabolism. The confidence of protein identifications was clearly improved by the peptides' derivatization with SPITC on a solid phase support. Some of the identified proteins

  9. Development of a novel, guinea pig-specific IFN-γ ELISPOT assay and characterization of guinea pig cytomegalovirus GP83-specific cellular immune responses following immunization with a modified vaccinia virus Ankara (MVA)-vectored GP83 vaccine. (United States)

    Gillis, Peter A; Hernandez-Alvarado, Nelmary; Gnanandarajah, Josephine S; Wussow, Felix; Diamond, Don J; Schleiss, Mark R


    The guinea pig (Cavia porcellus) provides a useful animal model for studying the pathogenesis of many infectious diseases, and for preclinical evaluation of vaccines. However, guinea pig models are limited by the lack of immunological reagents required for characterization and quantification of antigen-specific T cell responses. To address this deficiency, an enzyme-linked immunospot (ELISPOT) assay for guinea pig interferon (IFN)-γ was developed to measure antigen/epitope-specific T cell responses to guinea pig cytomegalovirus (GPCMV) vaccines. Using splenocytes harvested from animals vaccinated with a modified vaccinia virus Ankara (MVA) vector encoding the GPCMV GP83 (homolog of human CMV pp65 [gpUL83]) protein, we were able to enumerate and map antigen-specific responses, both in vaccinated as well as GPCMV-infected animals, using a panel of GP83-specific peptides. Several potential immunodominant GP83-specific peptides were identified, including one epitope, LGIVHFFDN, that was noted in all guinea pigs that had a detectable CD8+ response to GP83. Development of a guinea pig IFN-γ ELISPOT should be useful in characterization of additional T cell-specific responses to GPCMV, as well as other pathogens. This information in turn can help focus future experimental evaluation of immunization strategies, both for GPCMV as well as for other vaccine-preventable illnesses studied in the guinea pig model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins

    Directory of Open Access Journals (Sweden)

    Vemulapalli Srilakshmi


    Full Text Available Abstract Background Although many vaccinia virus proteins have been identified and studied in detail, only a few studies have attempted a comprehensive survey of the protein composition of the vaccinia virion. These projects have identified the major proteins of the vaccinia virion, but little has been accomplished to identify the unknown or less abundant proteins. Obtaining a detailed knowledge of the viral proteome of vaccinia virus will be important for advancing our understanding of orthopoxvirus biology, and should facilitate the development of effective antiviral drugs and formulation of vaccines. Results In order to accomplish this task, purified vaccinia virions were fractionated into a soluble protein enriched fraction (membrane proteins and lateral bodies and an insoluble protein enriched fraction (virion cores. Each of these fractions was subjected to further fractionation by either sodium dodecyl sulfate-polyacrylamide gel electophoresis, or by reverse phase high performance liquid chromatography. The soluble and insoluble fractions were also analyzed directly with no further separation. The samples were prepared for mass spectrometry analysis by digestion with trypsin. Tryptic digests were analyzed by using either a matrix assisted laser desorption ionization time of flight tandem mass spectrometer, a quadrupole ion trap mass spectrometer, or a quadrupole-time of flight mass spectrometer (the latter two instruments were equipped with electrospray ionization sources. Proteins were identified by searching uninterpreted tandem mass spectra against a vaccinia virus protein database created by our lab and a non-redundant protein database. Conclusion Sixty three vaccinia proteins were identified in the virion particle. The total number of peptides found for each protein ranged from 1 to 62, and the sequence coverage of the proteins ranged from 8.2% to 94.9%. Interestingly, two vaccinia open reading frames were confirmed as being expressed

  11. Safety profile of the viral vectors of attenuated fowlpox strain FP9 and modified vaccinia virus Ankara recombinant for either of 2 preerythrocytic malaria antigens, ME-TRAP or the circumsporozoite protein, in children and adults in Kenya. (United States)

    Bejon, Philip; Peshu, Norbert; Gilbert, Sarah C; Lowe, Brett S; Molyneux, Catherine S; Forsdyke, John; Lang, Trudie; Hill, Adrian V S; Marsh, Kevin


    We are developing a heterologous prime-boost vaccine strategy against malaria. This approach uses sequential immunization with different vectors to deliver a common preerythrocytic malaria antigen. Preliminary evidence of efficacy and safety has been previously documented in studies from an area where malaria is nonendemic. Additional safety data from an area where malaria is endemic are now required before larger-scale studies are undertaken to determine the efficacy of this vaccine strategy in the field. Other modified vaccinia virus Ankara (MVA) recombinants and prime-boost immunizations are being developed as vaccines against human immunodeficiency virus (HIV) infection, tuberculosis, and cancer, and MVA is a candidate attenuated smallpox vaccine. Candidate vaccines against malaria were intradermally administered to 73 adults (7 of whom were HIV positive) and 22 children in Kenya. These vaccines used the attenuated fowlpox strain FP9 and the MVA recombinant for either of 2 preerythrocytic malaria antigens, multiple preerythrocytic-stage epitopes joined with the preerythrocytic-stage antigen TRAP (ME-TRAP) and the circumsporozoite protein (CS). Adverse events were recorded. Reactogenicity was mild. MVA caused less frequent and less severe cutaneous reaction if given after FP9 priming. Half doses reduced the frequency and the severity of systemic reactogenicity, and particular vaccine lots were associated with different reactogenicities. Unexpectedly, prior immunity to the ME-TRAP antigen appeared to be protective against local reactions after immunization. Where the final intention is to use MVA after FP9 priming, previous testing of MVA alone overestimates reactogenicity. These recombinant vectors appear to be safe and suitable for use in larger-scale studies of children in Africa and of HIV-positive individuals.

  12. Induction of Noxa-mediated apoptosis by modified vaccinia virus Ankara depends on viral recognition by cytosolic helicases, leading to IRF-3/IFN-β-dependent induction of pro-apoptotic Noxa.

    Directory of Open Access Journals (Sweden)

    Pedro Eitz Ferrer


    Full Text Available Viral infection is a stimulus for apoptosis, and in order to sustain viral replication many viruses are known to carry genes encoding apoptosis inhibitors. F1L, encoded by the orthopoxvirus modified vaccinia virus Ankara (MVA has a Bcl-2-like structure. An MVA mutant lacking F1L (MVAΔF1L induces apoptosis, indicating that MVA infection activates and F1L functions to inhibit the apoptotic pathway. In this study we investigated the events leading to apoptosis upon infection by MVAΔF1L. Apoptosis largely proceeded through the pro-apoptotic Bcl-2 family protein Bak with some contribution from Bax. Of the family of pro-apoptotic BH3-only proteins, only the loss of Noxa provided substantial protection, while the loss of Bim had a minor effect. In mice, MVA preferentially infected macrophages and DCs in vivo. In both cell types wt MVA induced apoptosis albeit more weakly than MVAΔF1L. The loss of Noxa had a significant protective effect in macrophages, DC and primary lymphocytes, and the combined loss of Bim and Noxa provided strong protection. Noxa protein was induced during infection, and the induction of Noxa protein and apoptosis induction required transcription factor IRF3 and type I interferon signalling. We further observed that helicases RIG-I and MDA5 and their signalling adapter MAVS contribute to Noxa induction and apoptosis in response to MVA infection. RNA isolated from MVA-infected cells induced Noxa expression and apoptosis when transfected in the absence of viral infection. We thus here describe a pathway leading from the detection of viral RNA during MVA infection by the cytosolic helicase-pathway, to the up-regulation of Noxa and apoptosis via IRF3 and type I IFN signalling.

  13. Vaccinia virus Vaccinia complement control protein: Multi-functional ...

    Indian Academy of Sciences (India)


    tissue of diabetic and fat fed animals: Effects of insulin and manganese. 215 .... Bioluminometric assay of ATP in mouse brain: Determinant factors for ... in wheat. 199. Kumar R see Kumar M. 199. Kumar R Sampath see Balasubramanyam M. 715. Kumar Vikrant. Status of Austro-Asiatic groups in the peopling of India: An.

  14. Protective effect of Toll-like receptor 4 in pulmonary vaccinia infection.

    Directory of Open Access Journals (Sweden)

    Martha A Hutchens


    Full Text Available Innate immune responses are essential for controlling poxvirus infection. The threat of a bioterrorist attack using Variola major, the smallpox virus, or zoonotic transmission of other poxviruses has renewed interest in understanding interactions between these viruses and their hosts. We recently determined that TLR3 regulates a detrimental innate immune response that enhances replication, morbidity, and mortality in mice in response to vaccinia virus, a model pathogen for studies of poxviruses. To further investigate Toll-like receptor signaling in vaccinia infection, we first focused on TRIF, the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more susceptible to vaccinia infection than wild-type mice. We then focused on TLR4, the other Toll-like receptor that signals through TRIF. Following respiratory infection with vaccinia, mice lacking TLR4 signaling had greater viral replication, hypothermia, and mortality than control animals. The mechanism of TLR4-mediated protection was not due to increased release of proinflammatory cytokines or changes in total numbers of immune cells recruited to the lung. Challenge of primary bone marrow macrophages isolated from TLR4 mutant and control mice suggested that TLR4 recognizes a viral ligand rather than an endogenous ligand. These data establish that TLR4 mediates a protective innate immune response against vaccinia virus, which informs development of new vaccines and therapeutic agents targeted against poxviruses.

  15. Enhanced T Cell-Mediated Protection against Malaria in Human Challenges by Using the Recombinant Poxviruses FP9 and Modified Vaccinia virus Ankara

    National Research Council Canada - National Science Library

    Daniel P. Webster; Susanna Dunachie; Jenni M. Vuola; Tamara Berthoud; Sheila Keating; Stephen M. Laidlaw; Samuel J. McConkey; Ian Poulton; Laura Andrews; Rikke F. Andersen; Philip Bejon; Geoff Butcher; Robert Sinden; Michael A. Skinner; Sarah C. Gilbert; Adrian V. S. Hill; Louis H. Miller


    .... Here, we report that substitution of plasmid DNA as the priming vector with a specific attenuated recombinant fowlpox virus, FP9, vaccine in such prime-boost regimes can elicit complete sterile...

  16. Insertion of vaccinia virus C7L host range gene into NYVAC-B genome potentiates immune responses against HIV-1 antigens

    National Research Council Canada - National Science Library

    Nájera, José Luis; Gómez, Carmen Elena; García-Arriaza, Juan; Sorzano, Carlos Oscar; Esteban, Mariano


    ... while maintaining an attenuated phenotype in mice. In an effort to improve the immunogenicity of NYVAC, we have developed a novel poxvirus vector by inserting the VACV host-range C7L gene into the genome of NYVAC-B, a recombinant virus that expresses...

  17. Role of cleavage at the core-E1 junction of hepatitis C virus polyprotein in viral morphogenesis (United States)

    Pène, Véronique; Lemasson, Matthieu; Harper, Francis; Pierron, Gérard; Rosenberg, Arielle R.


    In hepatitis C virus (HCV) polyprotein sequence, core protein terminates with E1 envelope signal peptide. Cleavage by signal peptidase (SP) separates E1 from the complete form of core protein, anchored in the endoplasmic reticulum (ER) membrane by the signal peptide. Subsequent cleavage of the signal peptide by signal-peptide peptidase (SPP) releases the mature form of core protein, which preferentially relocates to lipid droplets. Both of these cleavages are required for the HCV infectious cycle, supporting the idea that HCV assembly begins at the surface of lipid droplets, yet SPP-catalyzed cleavage is dispensable for initiation of budding in the ER. Here we have addressed at what step(s) of the HCV infectious cycle SP-catalyzed cleavage at the core-E1 junction is required. Taking advantage of the sole system that has allowed visualization of HCV budding events in the ER lumen of mammalian cells, we showed that, unexpectedly, mutations abolishing this cleavage did not prevent but instead tended to promote the initiation of viral budding. Moreover, even though no viral particles were released from Huh-7 cells transfected with a full-length HCV genome bearing these mutations, intracellular viral particles containing core protein protected by a membrane envelope were formed. These were visualized by electron microscopy as capsid-containing particles with a diameter of about 70 nm and 40 nm before and after delipidation, respectively, comparable to intracellular wild-type particle precursors except that they were non-infectious. Thus, our results show that SP-catalyzed cleavage is dispensable for HCV budding per se, but is required for the viral particles to acquire their infectivity and secretion. These data support the idea that HCV assembly occurs in concert with budding at the ER membrane. Furthermore, capsid-containing particles did not accumulate in the absence of SP-catalyzed cleavage, suggesting the quality of newly formed viral particles is controlled before




    Khoobyarian, Newton (University of Illinois, Chicago). Interference induced against vaccinia in an adenovirus-RHF-1 system. J. Bacteriol. 87:24-32. 1964.-It was observed that a continuous line of rabbit heart cell culture (strain RHF-1), when overlaid with growth medium after infection of cultures with adenovirus types 2, 3, 4, and 7, would develop resistance to vaccinia plaque formation. Data are presented to provide some information on the nature of such resistance observed specifically in an adenovirus 2-RHF-1 system. An analysis of this phenomenon indicated the following. (i) At least 6 hr were required before the start of vaccinia inhibition, and 15 to 18 hr were necessary for the maximal occurrence of inhibition; the degree of interference established varied with the concentration of adenovirus. (ii) The site of interference action was inside rather than outside the cells, since hardly any difference could be shown in the rate of vaccinia adsorption on resistant and susceptible cells. (iii) The interaction of adenovirus with RHF-1 cells not only would inhibit cell infection with vaccinia but would also suppress the 24- to 48-hr yield of virus. (iv) When RHF-1 cells were overlaid with maintenance medium after their infection with a low multiplicity of RHF-1 passaged adenovirus 2 (to establish sublethal infection), an inhibitory substance of varied activity could be detected daily over a period of at least 10 days which, when transferred to normal RHF-1 cultures, would render them resistant to vaccinia infection. (v) Although limited growth of virus appeared to be responsible for the production of the inhibitor, increase in inhibitory activity did not seem to coincide with increase in virus titer. (vi) The inhibitor seemed to resemble interferons in inhibiting virus plaque production, but its exact identity and the mode of action remain to be determined.

  19. Protein Primary Structure of the Vaccinia Virion at Increased Resolution (United States)

    Ngo, Tuan; Mirzakhanyan, Yeva; Moussatche, Nissin; Gershon, Paul David


    Here we examine the protein covalent structure of the vaccinia virus virion. Within two virion preparations, >88% of the theoretical vaccinia virus-encoded proteome was detected with high confidence, including the first detection of products from 27 open reading frames (ORFs) previously designated "predicted," "uncharacterized," "inferred," or "hypothetical" polypeptides containing as few as 39 amino acids (aa) and six proteins whose detection required nontryptic proteolysis. We also detected the expression of four short ORFs, each of which was located within an ORF ("ORF-within-ORF"), including one not previously recognized or known to be expressed. Using quantitative mass spectrometry (MS), between 58 and 74 proteins were determined to be packaged. A total of 63 host proteins were also identified as candidates for packaging. Evidence is provided that some portion of virion proteins are "nicked" via a combination of endoproteolysis and concerted exoproteolysis in a manner, and at sites, independent of virus origin or laboratory procedures. The size of the characterized virion phosphoproteome was doubled from 189 (J. Matson, W. Chou, T. Ngo, and P. D. Gershon, Virology 452-453:310-323, 2014, doi: to 396 confident, unique phosphorylation sites, 268 of which were within the packaged proteome. This included the unambiguous identification of phosphorylation "hot spots" within virion proteins. Using isotopically enriched ATP, 23 sites of intravirion kinase phosphorylation were detected within nine virion proteins, all at sites already partially occupied within the virion preparations. The clear phosphorylation of proteins RAP94 and RP19 was consistent with the roles of these proteins in intravirion early gene transcription. In a blind search for protein modifications, cysteine glutathionylation and O-linked glycosylation featured prominently. We provide evidence for the phosphoglycosylation of vaccinia virus proteins

  20. Interaction of the interferon-induced PKR protein kinase with inhibitory proteins P58IPK and vaccinia virus K3L is mediated by unique domains: implications for kinase regulation. (United States)

    Gale, M; Tan, S L; Wambach, M; Katze, M G


    Expression of the double-stranded RNA-activated protein kinase (PKR) is induced by interferons, with PKR activity playing a pivotal role in establishing the interferon-induced antiviral and antiproliferative states. PKR is directly regulated by physical association with the specific inhibitor, P58IPK, a cellular protein of the tetratricopeptide repeat (TPR) family, and K3L, the product of the corresponding vaccinia virus gene. P58IPK and K3L repress PKR activation and activity. To investigate the mechanism of P58IPK- and K3L-mediated PKR inhibition, we have used a combination of in vitro and in vivo binding assays to identify the interactive regions of these proteins. The P58IPK-interacting site of PKR was mapped to a 52-amino-acid aa segment (aa 244 to 296) spanning the ATP-binding region of the protein kinase catalytic domain. The interaction with PKR did not require the C-terminal DNA-J homology region of P58IPK but was dependent on the presence of the eukaryotic initiation factor 2-alpha homology region, mapping to the 34 aa within the sixth P58IPK TPR motif. Consistent with other TPR proteins, P58IPK formed multimers in vivo: the N-terminal 166 aa were both necessary and sufficient for complex formation. A parallel in vivo analysis to map the K3L-binding region of PKR revealed that like P58IPK , K3L interacted exclusively with the PKR protein kinase catalytic domain. In contrast, however, the K3L-binding region of PKR was localized to within aa 367 to 551, demonstrating that each inhibitor bound PKR in unique, nonoverlapping domains. These data, taken together, suggest that P58IPK and K3L may mediate PKR inhibition by distinct mechanisms. Finally, we will propose a model of PKR inhibition in which P58IPK or a P58IPK complex binds PKR and interferes with nucleotide binding and autoregulation, while formation of a PKR-K3L complex interferes with active-site function and/or substrate association.

  1. A prime/boost DNA/Modified vaccinia virus Ankara vaccine expressing recombinant Leishmania DNA encoding TRYP is safe and immunogenic in outbred dogs, the reservoir of zoonotic visceral leishmaniasis. (United States)

    Carson, Connor; Antoniou, Maria; Ruiz-Argüello, Maria Begoña; Alcami, Antonio; Christodoulou, Vasiliki; Messaritakis, Ippokratis; Blackwell, Jenefer M; Courtenay, Orin


    Previous studies demonstrated safety, immunogenicity and efficacy of DNA/modified vaccinia virus Ankara (MVA) prime/boost vaccines expressing tryparedoxin peroxidase (TRYP) and Leishmania homologue of the mammalian receptor for activated C kinase (LACK) against Leishmania major challenge in mice, which was consistent with results from TRYP protein/adjuvant combinations in non-human primates. This study aimed to conduct safety and immunogenicity trials of these DNA/MVA vaccines in dogs, the natural reservoir host of Leishmania infantum, followed-up for 4 months post-vaccination. In a cohort of 22 uninfected outbred dogs, blinded randomised administration of 1000 microg (high dose) or 100 microg (low dose) DNA prime (day 0) and 1x10(8)pfu MVA boost (day 28) was shown to be safe and showed no clinical side effects. High dose DNA/MVA vaccinated TRYP dogs produced statistically higher mean levels of the type-1 pro-inflammatory cytokine IFN-gamma than controls in whole blood assays (WBA) stimulated with the recombinant vaccine antigen TRYP, up to the final sampling at day 126, and in the absence of challenge with Leishmania. TRYP vaccinated dogs also demonstrated significantly higher TRYP-specific total IgG and IgG2 subtype titres than in controls, and positive in vivo intradermal reactions at day 156 in the absence of natural infection, observed in 6/8 TRYP vaccinated dogs. No significant increases in IFN-gamma in LACK-stimulated WBA, or in LACK-specific IgG levels, were detected in LACK vaccinated dogs compared to controls, and only 2/9 LACK vaccinated dogs demonstrated DTH responses at day 156. In all groups, IgG1 subclass responses and antigen-specific stimulation of IL-10 were similar to controls demonstrating an absence of Th2/T(reg) response, as expected in the absence of in vivo restimulation or natural/experimental challenge with Leishmania. These collective results indicate significant antigen-specific type-1 responses and in vivo memory phase cellular immune

  2. Frequency of adverse events after vaccination with different vaccinia strains.

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar


    Full Text Available BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of vaccination-related adverse events, compared to the risk of contracting an infection. Although considerable effort has been made to understand the dynamics of smallpox transmission in modern societies, little attention has been paid to estimating the frequency of adverse events due to smallpox vaccination. Studies exploring the consequences of smallpox vaccination strategies have commonly used a frequency of approximately one death per million vaccinations, which is based on a study of vaccination with the New York City Board of Health (NYCBH strain of vaccinia virus. However, a multitude of historical studies of smallpox vaccination with other vaccinia strains suggest that there are strain-related differences in the frequency of adverse events after vaccination. Because many countries have stockpiled vaccine based on the Lister strain of vaccinia virus, a quantitative evaluation of the adverse effects of such vaccines is essential for emergency response planning. We conducted a systematic review and statistical analysis of historical data concerning vaccination against smallpox with different strains of vaccinia virus. METHODS AND FINDINGS: We analyzed historical vaccination data extracted from the literature. We extracted data on the frequency of postvaccinal encephalitis and death with respect to vaccinia strain and age of vaccinees. Using a hierarchical Bayesian approach for meta-analysis, we estimated the expected frequencies of postvaccinal encephalitis and death with respect to age at vaccination for smallpox vaccines based on the NYCBH and Lister vaccinia strains. We found large heterogeneity between findings from different studies and a time-period effect

  3. Concanavalin A-mediated cell agglutinability induced by Vaccinia virions. [Uv radiation, /sup 125/I tracer technique

    Energy Technology Data Exchange (ETDEWEB)

    Mbuy, G.; Bubel, H.C.


    The induction of enhanced concanavalin A (Con A)-mediated cellular agglutinability by purified vaccinia virus was examined quantitatively. Increased HEp-2 cell agglutinability by the lectin occurred within the first hour of infection and persisted without further change throughout the virus infectious cycle. Ultraviolet, but not heat-inactivated, virus was as effective as infectious virus in causing increased Con A agglutinability. Inhibition of viral and host cell protein synthesis by Streptovitacin A failed to alter the lectin response to vaccinia virus infection. Fluorescein-labeled Con A was observed to form clusters and large fluorescent patches on the infected cell surface during the earliest stage of infection. Studies with /sup 125/I-labeled Con A revealed an early but minimal increase in lectin binding to infected cells. After the first hour of infection, no further increase in Con A binding was observed. When cells were exposed to purified vaccinia virus surface tubules increased Con A agglutinability comparable to that obtained with native virus was demonstrated. Con A-mediated agglutinability of cells was temperature-dependent and displayed a higher temperature transition in infected cells. These data suggest that upon contact with the host cell, vaccinia virions or surface tubules induce alterations in the plasma membrane which are reflected in an enhanced agglutinability by Con A.

  4. Animal infections by vaccinia-like viruses in the state of Rio de Janeiro: an expanding disease Infecções animais por vírus semelhantes ao vaccínia no estado do Rio de Janeiro: uma doença em expansão

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr


    Full Text Available In the present study we investigated the presence of infections by vaccinia-like viruses in dairy cattle from 12 counties in the state of Rio de Janeiro in the last 9 years. Clinical specimens were collected from adult animals with vesicular/pustular lesions mainly in the udder and teats, and from calves with lesions around the nose and mouth. A plaque reduction neutralization test (PRNT was applied to search for antibodies to Orthopoxvirus; the vesicular/pustular fluids and scabs were examined by PCR, electron microscopy (EM and by inoculation in VERO cells for virus isolation. Antibodies to Orthopoxvirus were detected in most cases. The PCR test indicated a high nucleotide homology among the isolates and the vaccinia viruses (VACV used as controls. By EM, typical orthopoxvirus particles were observed in some specimens. The agents isolated in tissue culture were confirmed as vaccinia-like viruses by EM and PCR. The HA gene of the vaccinia-like Cantagalo/IOC virus isolated in our laboratory was sequenced and compared with other vaccinia-like isolates, showing high homology with the original Cantagalo strain, both strains isolated in 1999 from dairy cattle. Antibodies to Orthopoxvirus were detected in one wild rodent (genus Akodon sp. collected in the northwestern region of the state, indicating the circulation of poxvirus in this area. Nonetheless, PCR applied to tissue samples collected from the wild rodents were negative. Vesicular/pustular lesions in people in close contact with animals have been also recorded. Thus, the vaccinia-like virus infections in cattle and humans in the state seem to be an expanding condition, resulting in economic losses to dairy herds and leading to transient incapacitating human disease. Therefore, a possible immunization of the dairy cattle in the state should be carefully evaluated.Neste estudo avaliou-se a presença de infecções por vírus semelhantes ao vírus vaccínia (VACV em gado leiteiro em 12 munic

  5. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  6. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang


    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  7. Multicellular Models of Morphogenesis (United States)

    EPA’s Virtual Embryo project (v-Embryo™), in collaboration with developers of CompuCell3D, aims to create computer models of morphogenesis that can be used to address the effects of chemical perturbation on embryo development at the cellular level. Such computational (in silico) ...

  8. Dairy production practices and associated risks for bovine vaccinia exposure in cattle, Brazil

    Directory of Open Access Journals (Sweden)

    I.A. Borges


    Full Text Available A cross-sectional serosurvey was performed to identify environmental features or practices of dairy farms associated with risk for exposure to vaccinia-like viruses in dairy cattle in Brazil. Sera from 103 cows from 18 farms in Minas Gerais state were examined for Orthopoxvirus-neutralizing antibodies. A database of 243 binary or multiple-selection categorical variables regarding the physical features and surrounding ecology of each property was obtained. Thirteen of 46 presumptive predictor variables were found to be significantly associated with Orthopoxvirus serostatus by univariate logistic regression methods. Use of teat sanitizer and having felids on the property were independently associated with virus exposure by multivariable analysis. Rodents have long been suspected of serving as maintenance reservoirs for vaccinia-like viruses in Brazil. Therefore, domestic felids are not only effective predators of small rodent pests, but also their urine can serve as a deterrent to rodent habitation in buildings such as stables and barns. These results corroborate previous evidence of the high significance of rodents in the Vaccinia virus transmission cycle, and they also raise questions regarding the common use of teat sanitizers in dairy production areas.

  9. Guinea pigs experimentally infected with vaccinia virus replicate and shed, but do not transmit the virus Cobaias infectadas experimentalmente com vírus vaccínia replicam e excretam, porém não transmitem o vírus

    Directory of Open Access Journals (Sweden)

    Juliana Felipetto Cargnelutti


    Full Text Available The origin of vaccinia viruses (VACV associated with vesicular disease in cattle and humans in Southeast Brazil remains uncertain, yet the role of wild species in virus transmission has been suggested. This study investigated the susceptibility and transmission potential by guinea pigs (Cavia porcellus - phylogenetically close to an abundant Brazilian rodent (Cavia aperea - to two VACV strains (P1V and P2V isolated from an outbreak of cutaneous disease in horses in Southern Brazil. Eight guinea pigs inoculated intranasally with P1V and P2V (10(6 did not develop clinical signs, but six animals shed virus in nasal secretions (day 1 to 9 post-inoculation - pi, developed viremia (between days 1 and 10 pi and seroconverted to VACV. In spite of virus replication and shedding, the virus was not transmitted to sentinel animals by direct or indirect contact (aerosols or through food and water contaminated with virus. These results demonstrate that, in spite of replicating and shedding the virus, guinea pigs do not transmit the virus upon experimental inoculation. This finding makes unlikely a possible participation of related species in VACV maintenance and transmission in nature.A origem dos vírus vaccínia (VACV, envolvidos em surtos de doença vesicular em bovinos e humanos no Sudeste do Brasil, permanece desconhecida, e a participação de espécies silvestres na manutenção e transmissão do vírus tem sido sugerida. O objetivo deste trabalho foi investigar a susceptibilidade e o potencial de transmissão por cobaias (Cavia porcellus - filogeneticamente relacionada a uma espécie de roedor, conhecido por preá (Cavia aperea, bastante abundante no país - a duas cepas de VACV (P1V e P2V isoladas de um surto de doença cutânea em equinos no Rio Grande do Sul. Oito cobaias inoculadas pela via intranasal com uma mistura das amostras P1V e P2V (10(6 não apresentaram sinais clínicos, porém seis animais excretaram o vírus nas

  10. Mathematical models of morphogenesis

    Directory of Open Access Journals (Sweden)

    Dilão Rui


    Full Text Available Morphogenesis is the ensemble of phenomena that generates the form and shape of organisms. Organisms are classified according to some of its structural characteristics, to its metabolism and to its form. In particular, the empirical classification associated with the phylum concept is related with the form and shape of organisms. In the first part of this talk, we introduce the class of mathematical models associated the Turing approach to pattern formation. In the Turing approach, morphogenesis models are described by reaction-diffusion parabolic partial differential equations. Based on this formalism, we present a mathematical model describing the first two hours of development of the fruit fly Drosophila. In the second part of this talk, we present results on Pareto optimality to calibrate and validate mathematical models.

  11. Mathematical models of morphogenesis


    Dilão Rui


    Morphogenesis is the ensemble of phenomena that generates the form and shape of organisms. Organisms are classified according to some of its structural characteristics, to its metabolism and to its form. In particular, the empirical classification associated with the phylum concept is related with the form and shape of organisms. In the first part of this talk, we introduce the class of mathematical models associated the Turing approach to pattern formation. In the Turing approach, morphogene...

  12. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations. (United States)

    Slike, Bonnie M; Creegan, Matthew; Marovich, Mary; Ngauy, Viseth


    Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years) and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity) may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb) responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT) of 250 to baseline (vaccination. This contrasted with a comparator group of adults, ages 35-49, who were vaccinated with Dryvax® as children. In the childhood vaccinees, titers persisted for >30 years with a GMT of 210 (range 112-3234). This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  13. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Directory of Open Access Journals (Sweden)

    Bonnie M Slike

    Full Text Available Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT of 250 to baseline (30 years with a GMT of 210 (range 112-3234. This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  14. Clathrin facilitates the morphogenesis of retrovirus particles.

    Directory of Open Access Journals (Sweden)

    Fengwen Zhang


    Full Text Available The morphogenesis of retroviral particles is driven by Gag and GagPol proteins that provide the major structural component and enzymatic activities required for particle assembly and maturation. In addition, a number of cellular proteins are found in retrovirus particles; some of these are important for viral replication, but many lack a known functional role. One such protein is clathrin, which is assumed to be passively incorporated into virions due to its abundance at the plasma membrane. We found that clathrin is not only exceptionally abundant in highly purified HIV-1 particles but is recruited with high specificity. In particular, the HIV-1 Pol protein was absolutely required for clathrin incorporation and point mutations in reverse transcriptase or integrase domains of Pol could abolish incorporation. Clathrin was also specifically incorporated into other retrovirus particles, including members of the lentivirus (simian immunodeficiency virus, SIVmac, gammaretrovirus (murine leukemia virus, MLV and betaretrovirus (Mason-Pfizer monkey virus, M-PMV genera. However, unlike HIV-1, these other retroviruses recruited clathrin primarily using peptide motifs in their respective Gag proteins that mimicked motifs found in cellular clathrin adaptors. Perturbation of clathrin incorporation into these retroviruses, via mutagenesis of viral proteins, siRNA based clathrin depletion or adaptor protein (AP180 induced clathrin sequestration, had a range of effects on the accuracy of particle morphogenesis. These effects varied according to which retrovirus was examined, and included Gag and/or Pol protein destabilization, inhibition of particle assembly and reduction in virion infectivity. For each retrovirus examined, clathrin incorporation appeared to be important for optimal replication. These data indicate that a number of retroviruses employ clathrin to facilitate the accurate morphogenesis of infectious particles. We propose a model in which clathrin

  15. The Morphogenesis and Biology of a Morbillivirus from MCF Cattle. (United States)


    strain 70-P-1096 was used as the reference strain of bovine parainfluenza type 3 (P13). Nil--------------------------------------- 29 It was recovered...Doane. 1971. The Morphogenesis and Cytopathology of Bovine Parainfluenza Type 3 Virus. J. Gen. Virol. 12:271-279. Mettam, R. W. M. 1923. Snotsiekte in...pathology in low passage fetal bovine cells. Antigenic studies with this virus and other 72-P-535 isolates using direct and indirect immunofluorescence

  16. Sea Urchin Morphogenesis. (United States)

    McClay, David R


    In the sea urchin morphogenesis follows extensive molecular specification. The specification controls the many morphogenetic events and these, in turn, precede patterning steps that establish the larval body plan. To understand how the embryo is built it was necessary to understand those series of molecular steps. Here an example of the historical sequence of those discoveries is presented as it unfolded over the last 50 years, the years during which major progress in understanding development of many animals and plants was documented by CTDB. In sea urchin development a rich series of experimental studies first established many of the phenomenological components of skeletal morphogenesis and patterning without knowledge of the molecular components. The many discoveries of transcription factors, signals, and structural proteins that contribute to the shape of the endoskeleton of the sea urchin larva then followed as molecular tools became available. A number of transcription factors and signals were discovered that were necessary for specification, morphogenesis, and patterning. Perturbation of the transcription factors and signals provided the means for assembling models of the gene regulatory networks used for specification and controlled the subsequent morphogenetic events. The earlier experimental information informed perturbation experiments that asked how patterning worked. As a consequence it was learned that ectoderm provides a series of patterning signals to the skeletogenic cells and as a consequence the skeletogenic cells secrete a highly patterned skeleton based on their ability to genotypically decode the localized reception of several signals. We still do not understand the complexity of the signals received by the skeletogenic cells, nor do we understand in detail how the genotypic information shapes the secreted skeletal biomineral, but the current knowledge at least outlines the sequence of events and provides a useful template for future

  17. Morphogenesis by symbiogenesis (United States)

    Chapman, M. J.; Margulis, L.


    Here we review cases where initiation of morphogenesis, including the differentiation of specialized cells and tissues, has clearly evolved due to cyclical symbiont integration. For reasons of space, our examples are drawn chiefly from the plant, fungal and bacterial kingdoms. Partners live in symbioses and show unique morphological specializations that result when they directly and cyclically interact. We include here brief citations to relevant literature where plant, bacterial or fungal partners alternate independent with entirely integrated living. The independent, or at least physically unassociated stages, are correlated with the appearance of distinctive morphologies that can be traced to the simultaneous presence and strong interaction of the plant with individuals that represent different taxa.

  18. Dynamics of Salivary Gland Morphogenesis


    Harunaga, J.; Hsu, J. C.; Yamada, K M


    Salivary glands form during embryonic development by a complex process that creates compact, highly organized secretory organs with functions essential for oral health. The architecture of these glands is generated by branching morphogenesis, revealed by recent research to involve unexpectedly dynamic cell motility and novel regulatory pathways. Numerous growth factors, extracellular matrix molecules, gene regulatory pathways, and mechanical forces contribute to salivary gland morphogenesis, ...

  19. Expression of CCL19 from Oncolytic Vaccinia Enhances Immunotherapeutic Potential while Maintaining Oncolytic Activity

    Directory of Open Access Journals (Sweden)

    Jun Li


    Full Text Available Promising phase II clinical results have been reported recently for several oncolytic viral therapeutics, including strains based on vaccinia virus. One reason for this has been an increased appreciation of the critical therapeutic importance of the immune response raised by these viruses. However, the most commonly used approaches to enhance these immunotherapeutic effects in oncolytic viruses, typically though expression of cytokine transgenes, often also result in a reduction in oncolytic activity and premature clearance of the virotherapy from the tumor. Approaches that enhance the immunotherapeutic effects while maintaining oncolytic activity would therefore be beneficial. Here, it is demonstrated that the expression of the chemokine CCL19 (ELC from an oncolytic vaccinia virus (vvCCL19 results in increased antitumor effects in syngeneic mouse tumor models. This corresponded with increased t cell and dendritic cell infiltration into the tumor. However, vvCCL19 persisted in the tumor at equivalent levels to a control virus without CCL19, demonstrating that oncolytic activity was not curtailed. Instead, vvCCL19 was cleared rapidly and selectively from normal tissues and organs, indicating a potentially increased safety profile. The therapeutic activity of vvCCL19 could be further significantly increased through combination with adoptive transfer of therapeutic immune cells expressing CCR7, the receptor for CCL19. This approach therefore represents a means to increase the safety and therapeutic benefit of oncolytic viruses, used alone or in combination with immune cell therapies.

  20. Oncolytic vaccinia virotherapy of anaplastic thyroid cancer in vivo. (United States)

    Lin, Shu-Fu; Price, Daniel L; Chen, Chun-Hao; Brader, Peter; Li, Sen; Gonzalez, Lorena; Zhang, Qian; Yu, Yong A; Chen, Nanhai; Szalay, Aladar A; Fong, Yuman; Wong, Richard J


    Anaplastic thyroid carcinoma (ATC) is a fatal disease with a median survival of only 6 months. Novel therapies are needed to improve dismal outcomes. A mutated, replication-competent, vaccinia virus (GLV-1h68) has oncolytic effects on human ATC cell lines in vitro. We assessed the utility of GLV-1h68 in treating anaplastic thyroid cancer in vivo. Athymic nude mice with xenograft flank tumors of human ATCs (8505C and DRO90-1) were treated with a single intratumoral injection of GLV-1h68 at low dose (5x10(5) plaque-forming unit), high dose (5x10(6) plaque-forming unit), or PBS. Virus-mediated marker gene expression (luciferase, green fluorescent protein, and beta-galactosidase), viral biodistribution, and flank tumor volumes were measured. Luciferase expression was detected 2 d after injection. Continuous viral replication within tumors was reflected by increasing luciferase activity to d 9. At d 10, tumor viral recovery was increased more than 50-fold as compared with the injected dose, and minimal virus was recovered from the lung, liver, brain, heart, spleen, and kidneys. High-dose virus directly injected into normal tissues was undetectable at d 10. The mean volume of control 8505C tumors increased 50.8-fold by d 45, in contrast to 10.5-fold (low dose) and 2.1-fold (high dose; P=0.028) increases for treated tumors. DRO90-1 tumors also showed significant growth inhibition by high-dose virus. No virus-related toxicity was observed throughout the study. GLV-1h68 efficiently infects, expresses transgenes within, and inhibits the growth of ATC in vivo. These promising findings support future clinical trials for patients with ATC.

  1. Comparative Proteomics of Human Monkeypox and Vaccinia Intracellular Mature and Extracellular Enveloped Virions

    Energy Technology Data Exchange (ETDEWEB)

    Manes, Nathan P.; Estep, Ryan D.; Mottaz, Heather M.; Moore, Ronald J.; Clauss, Therese RW; Monroe, Matthew E.; Du, Xiuxia; Adkins, Joshua N.; Wong, Scott; Smith, Richard D.


    Orthopoxviruses are the largest and most complex of the animal viruses. In response to the recent emergence of monkeypox in Africa and the threat of smallpox bioterrorism, virulent (monkeypox virus) and benign (vaccinia virus) orthopoxviruses were proteomically compared with the goal of identifying proteins required for pathogenesis. Orthopoxviruses were grown in HeLa cells to two different viral forms (intracellular mature virus and extracellular enveloped virus), purified by sucrose gradient ultracentrifugation, denatured using RapiGest™ surfactant, and digested with trypsin. Unfractionated samples and strong cation exchange HPLC fractions were analyzed by reversed-phase LC-MS/MS, and analyses of the MS/MS spectra using SEQUEST® and X! Tandem resulted in the identification of hundreds of monkeypox, vaccinia, and copurified host proteins. The unfractionated samples were additionally analyzed by LC-MS on an LTQ-Orbitrap™, and the accurate mass and elution time tag approach was used to perform quantitative comparisons. Possible pathophysiological roles of differentially expressed orthopoxvirus genes are discussed.

  2. Crosstalk between immune cell and oncolytic vaccinia therapy enhances tumor trafficking and antitumor effects. (United States)

    Sampath, Padma; Li, Jun; Hou, Weizhou; Chen, Hannah; Bartlett, David L; Thorne, Steve H


    The combination of an oncolytic virus, that directly destroys tumor cells and mediates an acute immune response, with an immune cell therapy, capable of further enlisting and enhancing the host immune response, has the potential to create a potent therapeutic effect. We have previously developed several strategies for optimizing the delivery of oncolytic vaccinia virus vectors to their tumor targets, including the use of immune cell-based carrier vehicles and the incorporation of mutations that increase production of the enveloped form of vaccinia (extracellular enveloped viral (EEV)) that is better adapted to spread within a host. Here, we initially combine these approaches to create a novel therapeutic, consisting of an immune cell (cytokine-induced killer, CIK) preloaded with an oncolytic virus that is EEV enhanced. This resulted in direct interaction between the viral and immune cell components with each assisting the other in directing the therapy to the tumor and so enhancing the antitumor effects. This effect could be further improved through CCL5 expression from the virus. The resulting multicomponent therapy displays the ability for synergistic crosstalk between components, so significantly enhancing tumor trafficking and antitumor effects.

  3. Molecular network, pathway, and functional analysis of time-dependent gene changes associated with pancreatic cancer susceptibility to oncolytic vaccinia virotherapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad


    Conclusions: Our study reveals the ability to assess time-dependent changes in gene expression patterns in pancreatic cancer cells associated with infection and susceptibility to vaccinia viruses. This suggests that molecular assays may be useful to develop safer and more efficacious oncolyticvirotherapies and support the idea that these treatments may target pathways implicated in pancreatic cancer resistance to conventional therapies.

  4. Models of lung branching morphogenesis. (United States)

    Miura, Takashi


    Vertebrate airway has a tree-like-branched structure. This structure is generated by repeated tip splitting, which is called branching morphogenesis. Although this phenomenon is extensively studied in developmental biology, the mechanism of the pattern formation is not well understood. Conversely, there are many tree-like structures in purely physical or chemical systems, and their pattern formation mechanisms are well-understood using mathematical models. Recent studies correlate these biological observations and mathematical models to understand lung branching morphogenesis. These models use slightly different mechanisms. In this article, we will review recent progress in modelling lung branching morphogenesis, and future directions to experimentally verify the models. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  5. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T


    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  6. The control of branching morphogenesis (United States)

    Iber, Dagmar; Menshykau, Denis


    Many organs of higher organisms are heavily branched structures and arise by an apparently similar process of branching morphogenesis. Yet the regulatory components and local interactions that have been identified differ greatly in these organs. It is an open question whether the regulatory processes work according to a common principle and how far physical and geometrical constraints determine the branching process. Here, we review the known regulatory factors and physical constraints in lung, kidney, pancreas, prostate, mammary gland and salivary gland branching morphogenesis, and describe the models that have been formulated to analyse their impacts. PMID:24004663

  7. Heart fields and cardiac morphogenesis

    NARCIS (Netherlands)

    Kelly, Robert G.; Buckingham, Margaret E.; Moorman, Antoon F.


    In this review, we focus on two important steps in the formation of the embryonic heart: (i) the progressive addition of late differentiating progenitor cells from the second heart field that drives heart tube extension during looping morphogenesis, and (ii) the emergence of patterned proliferation

  8. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era. (United States)

    Figueiredo, Poliana de Oliveira; Silva-Fernandes, André Tavares da; Mota, Bruno Eduardo Fernandes; Costa, Galileu Barbosa; Borges, Iara Apolinário; Ferreira, Paulo César Peregrino; Abrahão, Jônatas Santos; Braga, Erika Martins; Kroon, Erna Geessien; Trindade, Giliane de Souza


    Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV). We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132) with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  9. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era

    Directory of Open Access Journals (Sweden)

    Poliana de Oliveira Figueiredo


    Full Text Available Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV. We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132 with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  10. Immunogenicity of viral vector, prime-boost SIV vaccine regimens in infant rhesus macaques: attenuated vesicular stomatitis virus (VSV) and modified vaccinia Ankara (MVA) recombinant SIV vaccines compared to live-attenuated SIV. (United States)

    Van Rompay, Koen K A; Abel, Kristina; Earl, Patricia; Kozlowski, Pamela A; Easlick, Juliet; Moore, Joseph; Buonocore-Buzzelli, Linda; Schmidt, Kimberli A; Wilson, Robert L; Simon, Ian; Moss, Bernard; Rose, Nina; Rose, John; Marthas, Marta L


    In a previously developed infant macaque model mimicking HIV infection by breast-feeding, we demonstrated that intramuscular immunization with recombinant poxvirus vaccines expressing simian immunodeficiency virus (SIV) structural proteins provided partial protection against infection following oral inoculation with virulent SIV. In an attempt to further increase systemic but also local antiviral immune responses at the site of viral entry, we tested the immunogenicity of different orally administered, replicating vaccines. One group of newborn macaques received an oral prime immunization with a recombinant vesicular stomatitis virus expressing SIVmac239 gag, pol and env (VSV-SIVgpe), followed 2 weeks later by an intramuscular boost immunization with MVA-SIV. Another group received two immunizations with live-attenuated SIVmac1A11, administered each time both orally and intravenously. Control animals received mock immunizations or non-SIV VSV and MVA control vectors. Analysis of SIV-specific immune responses in blood and lymphoid tissues at 4 weeks of age demonstrated that both vaccine regimens induced systemic antibody responses and both systemic and local cell-mediated immune responses. The safety and immunogenicity of the VSV-SIVgpe+MVA-SIV immunization regimen described in this report provide the scientific incentive to explore the efficacy of this vaccine regimen against virulent SIV exposure in the infant macaque model. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  11. Heart fields and cardiac morphogenesis. (United States)

    Kelly, Robert G; Buckingham, Margaret E; Moorman, Antoon F


    In this review, we focus on two important steps in the formation of the embryonic heart: (i) the progressive addition of late differentiating progenitor cells from the second heart field that drives heart tube extension during looping morphogenesis, and (ii) the emergence of patterned proliferation within the embryonic myocardium that generates distinct cardiac chambers. During the transition between these steps, the major site of proliferation switches from progenitor cells outside the early heart to proliferation within the embryonic myocardium. The second heart field and ballooning morphogenesis concepts have major repercussions on our understanding of human heart development and disease. In particular, they provide a framework to dissect the origin of congenital heart defects and the regulation of myocardial proliferation and differentiation of relevance for cardiac repair. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  12. Heart Fields and Cardiac Morphogenesis


    Kelly, Robert G.; Buckingham, Margaret E.; Moorman, Antoon F.


    In this review, we focus on two important steps in the formation of the embryonic heart: (i) the progressive addition of late differentiating progenitor cells from the second heart field that drives heart tube extension during looping morphogenesis, and (ii) the emergence of patterned proliferation within the embryonic myocardium that generates distinct cardiac chambers. During the transition between these steps, the major site of proliferation switches from progenitor cells outside the early...

  13. Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?

    DEFF Research Database (Denmark)

    Jespersen, Sanne; Hønge, Bo Langhoff; Medina, Candida

    Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?......Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?...

  14. Molecular Analysis of Salivary Gland Branching Morphogenesis

    National Research Council Canada - National Science Library

    Sakai, Takayoshi; Larsen, Melinda; Kogo, Mikihiko; Yamada, Kenneth M


    .... This mini-review describes a recently developed and tested set of approaches for identifying and characterizing molecules essential for branching morphogenesis and other developmental processes...

  15. Transforming growth factor alpha, Shope fibroma growth factor, and vaccinia growth factor can replace myxoma growth factor in the induction of myxomatosis in rabbits. (United States)

    Opgenorth, A; Nation, N; Graham, K; McFadden, G


    The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.

  16. Viruses in cancer treatment. (United States)

    Alemany, R


    Soon after the discovery that viruses cause human disease, started the idea of using viruses to treat cancer. After the initial indiscriminate use, crude preparations of each novel virus in the early twentieth century, a second wave of virotherapy blossomed in the 60s with purified and selected viruses. Responses were rare and short-lived. Immune rejection of the oncolytic viruses was identified as the major problem and virotherapy was abandoned. During the past two decades virotherapy has re-emerged with engineered viruses, with a trend towards using them as tumor-debulking immunostimulatory agents combined with radio or chemotherapy. Currently, oncolytic Reovirus, Herpes, and Vaccinia virus are in late phase clinical trials. Despite the renewed hope, efficacy will require improving systemic tumor targeting, overcoming stroma barriers for virus spread, and selectively stimulating immune responses against tumor antigens but not against the virus. Virotherapy history, viruses, considerations for clinical trials, and hurdles are briefly overviewed.

  17. Antibody library display on a mammalian virus vector: combining the advantages of both phage and yeast display into one technology. (United States)

    Smith, Ernest S; Zauderer, Maurice


    Utilizing a vaccinia virus based library technology, we previously developed an antibody discovery platform that enabled efficient selection of fully functional IgG antibodies from highly diverse immunoglobulin gene libraries expressed on the surface of mammalian cells. Recently, we have further modified this platform to enable efficient expression of a library of fully human antibodies on the surface of vaccinia virus; an enveloped mammalian virus. Similar in concept to phage display, conditions are utilized under which each vaccinia virion expresses a single antibody specificity on its surface. Various panning and magnetic bead based methods have been developed to allow screening of a library of vaccinia- MAb virions and selection of recombinant vaccinia virus encoding specific antibodies. Upon infection of mammalian cells the antibody is not only incorporated into newly produced virus, it is also displayed on the surface of the host cell. Similar to methods utilized in yeast display, the cells displaying vaccinia encoded antibody can also be selected using a combination of magnetic beads and cell sorting, and the virus encoding the specific antibody heavy and light chains readily recovered and analyzed. This technology allows for rapid high throughput selection of vaccinia-MAb virions in a cell free panning system, followed by cell based screening for high specificity and fine selection of optimal antibodies.

  18. Virus detection using Viro-Adembeads, a rapid capture system for viruses, and plaque assay in intentionally virus-contaminated beverages. (United States)

    Hatano, Ben; Kojima, Asato; Sata, Tetsutaro; Katano, Harutaka


    Intentional contamination of beverages with microbes is one type of bioterrorist threat. While bacteria and fungus can be easily collected by a centrifuge, viruses are difficult to collect from virus-contaminated beverages. In this study, we demonstrated that Viro-Adembeads, a rapid-capture system for viruses using anionic polymer-coated magnetic beads, collected viruses from beverages contaminated intentionally with vaccinia virus and human herpesvirus 8. Real-time PCR showed that the recovery rates of the contaminated viruses in green tea and orange juice were lower than those in milk and water. Plaque assay showed that green tea and orange juice cut the efficiency of vaccinia virus infection in CV-1 cells. These results suggest that the efficiency of virus detection depends on the kind of beverage being tested. Viro-Adembeads would be a useful tool for detecting viruses rapidly in virus-contaminated beverages used in a bioterrorist attack.

  19. Smallpox virus plaque phenotypes: genetic, geographical and case fatality relationships. (United States)

    Olson, Victoria A; Karem, Kevin L; Smith, Scott K; Hughes, Christine M; Damon, Inger K


    Smallpox (infection with Orthopoxvirus variola) remains a feared illness more than 25 years after its eradication. Historically, case-fatality rates (CFRs) varied between outbreaks (<1 to approximately 40 %), the reasons for which are incompletely understood. The extracellular enveloped virus (EEV) form of orthopoxvirus progeny is hypothesized to disseminate infection. Investigations with the closely related Orthopoxvirus vaccinia have associated increased comet formation (EEV production) with increased mouse mortality (pathogenicity). Other vaccinia virus genetic manipulations which affect EEV production inconsistently support this association. However, antisera against vaccinia virus envelope protect mice from lethal challenge, further supporting a critical role for EEV in pathogenicity. Here, we show that the increased comet formation phenotypes of a diverse collection of variola viruses associate with strain phylogeny and geographical origin, but not with increased outbreak-related CFRs; within clades, there may be an association of plaque size with CFR. The mechanisms for variola virus pathogenicity probably involves multiple host and pathogen factors.

  20. Mechanocellular models of epithelial morphogenesis. (United States)

    Fletcher, Alexander G; Cooper, Fergus; Baker, Ruth E


    Embryonic epithelia achieve complex morphogenetic movements, including in-plane reshaping, bending and folding, through the coordinated action and rearrangement of individual cells. Technical advances in molecular and live-imaging studies of epithelial dynamics provide a very real opportunity to understand how cell-level processes facilitate these large-scale tissue rearrangements. However, the large datasets that we are now able to generate require careful interpretation. In combination with experimental approaches, computational modelling allows us to challenge and refine our current understanding of epithelial morphogenesis and to explore experimentally intractable questions. To this end, a variety of cell-based modelling approaches have been developed to describe cell-cell mechanical interactions, ranging from vertex and 'finite-element' models that approximate each cell geometrically by a polygon representing the cell's membrane, to immersed boundary and subcellular element models that allow for more arbitrary cell shapes. Here, we review how these models have been used to provide insights into epithelial morphogenesis and describe how such models could help future efforts to decipher the forces and mechanical and biochemical feedbacks that guide cell and tissue-level behaviour. In addition, we discuss current challenges associated with using computational models of morphogenetic processes in a quantitative and predictive way.This article is part of the themed issue 'Systems morphodynamics: understanding the development of tissue hardware'. © 2017 The Author(s).

  1. Characterization of the Determinants of NS2-3-Independent Virion Morphogenesis of Pestiviruses. (United States)

    Klemens, O; Dubrau, D; Tautz, N


    A peculiarity of the Flaviviridae is the critical function of nonstructural (NS) proteins for virus particle formation. For pestiviruses, like bovine viral diarrhea virus (BVDV), uncleaved NS2-3 represents an essential factor for virion morphogenesis, while NS3 is an essential component of the viral replicase. Accordingly, in natural pestivirus isolates, processing at the NS2-3 cleavage site is not complete, to allow for virion morphogenesis. Virion morphogenesis of the related hepatitis C virus (HCV) shows a major deviation from that of pestiviruses: while RNA replication also requires free NS3, virion formation does not depend on uncleaved NS2-NS3. Recently, we described a BVDV-1 chimera based on strain NCP7 encompassing the NS2-4B*-coding region of strain Osloss (E. Lattwein, O. Klemens, S. Schwindt, P. Becher, and N. Tautz, J Virol 86:427-437, 2012, doi:10.1128/JVI.06133-11). This chimera allowed for the production of infectious virus particles in the absence of uncleaved NS2-3. The Osloss sequence deviates in the NS2-4B* part from NCP7 in 48 amino acids and also has a ubiquitin insertion between NS2 and NS3. The present study demonstrates that in the NCP7 backbone, only two amino acid exchanges in NS2 (E1576V) and NS3 (V1721A) are sufficient and necessary to allow for efficient NS2-3-independent virion morphogenesis. The adaptation of a bicistronic virus encompassing an internal ribosomal entry site element between the NS2 and NS3 coding sequences to efficient virion morphogenesis led to the identification of additional amino acids in E2, NS2, and NS5B that are critically involved in this process. The surprisingly small requirements for approximating the packaging schemes of pestiviruses and HCV with respect to the NS2-3 region is in favor of a common mechanism in an ancestral virus. For positive-strand RNA viruses, the processing products of the viral polyprotein serve in RNA replication as well as virion morphogenesis. For bovine viral diarrhea virus

  2. Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001 (United States)

    Lederman, Edith R.; Davidson, Whitni; Groff, Harold L.; Smith, Scott K.; Warkentien, Tyler; Li, Yu; Wilkins, Kimberly A.; Karem, Kevin L.; Akondy, Rama S.; Ahmed, Rafi; Frace, Michael; Shieh, Wun-Ju; Zaki, Sherif; Hruby, Dennis E.; Painter, Wendy P.; Bergman, Kimberly L.; Cohen, Jeffrey I.; Damon, Inger K.


    Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV. PMID:22904336

  3. Cellular and physical mechanisms of branching morphogenesis (United States)

    Varner, Victor D.; Nelson, Celeste M.


    Branching morphogenesis is the developmental program that builds the ramified epithelial trees of various organs, including the airways of the lung, the collecting ducts of the kidney, and the ducts of the mammary and salivary glands. Even though the final geometries of epithelial trees are distinct, the molecular signaling pathways that control branching morphogenesis appear to be conserved across organs and species. However, despite this molecular homology, recent advances in cell lineage analysis and real-time imaging have uncovered surprising differences in the mechanisms that build these diverse tissues. Here, we review these studies and discuss the cellular and physical mechanisms that can contribute to branching morphogenesis. PMID:25005470

  4. Tension, contraction and tissue morphogenesis. (United States)

    Heer, Natalie C; Martin, Adam C


    D'Arcy Thompson was a proponent of applying mathematical and physical principles to biological systems, an approach that is becoming increasingly common in developmental biology. Indeed, the recent integration of quantitative experimental data, force measurements and mathematical modeling has changed our understanding of morphogenesis - the shaping of an organism during development. Emerging evidence suggests that the subcellular organization of contractile cytoskeletal networks plays a key role in force generation, while on the tissue level the spatial organization of forces determines the morphogenetic output. Inspired by D'Arcy Thompson's On Growth and Form, we review our current understanding of how biological forms are created and maintained by the generation and organization of contractile forces at the cell and tissue levels. We focus on recent advances in our understanding of how cells actively sculpt tissues and how forces are involved in specific morphogenetic processes. © 2017. Published by The Company of Biologists Ltd.

  5. Polarity in Mammalian Epithelial Morphogenesis (United States)

    Roignot, Julie; Peng, Xiao; Mostov, Keith


    Cell polarity is fundamental for the architecture and function of epithelial tissues. Epithelial polarization requires the intervention of several fundamental cell processes, whose integration in space and time is only starting to be elucidated. To understand what governs the building of epithelial tissues during development, it is essential to consider the polarization process in the context of the whole tissue. To this end, the development of three-dimensional organotypic cell culture models has brought new insights into the mechanisms underlying the establishment and maintenance of higher-order epithelial tissue architecture, and in the dynamic remodeling of cell polarity that often occurs during development of epithelial organs. Here we discuss some important aspects of mammalian epithelial morphogenesis, from the establishment of cell polarity to epithelial tissue generation. PMID:23378592

  6. Equination (inoculation of horsepox): An early alternative to vaccination (inoculation of cowpox) and the potential role of horsepox virus in the origin of the smallpox vaccine. (United States)

    Esparza, José; Schrick, Livia; Damaso, Clarissa R; Nitsche, Andreas


    For almost 150 years after Edward Jenner had published the "Inquiry" in 1798, it was generally assumed that the cowpox virus was the vaccine against smallpox. It was not until 1939 when it was shown that vaccinia, the smallpox vaccine virus, was serologically related but different from the cowpox virus. In the absence of a known natural host, vaccinia has been considered to be a laboratory virus that may have originated from mutational or recombinational events involving cowpox virus, variola viruses or some unknown ancestral Orthopoxvirus. A favorite candidate for a vaccinia ancestor has been the horsepox virus. Edward Jenner himself suspected that cowpox derived from horsepox and he also believed that "matter" obtained from either disease could be used as preventative of smallpox. During the 19th century, inoculation with cowpox (vaccination) was used in Europe alongside with inoculation with horsepox (equination) to prevent smallpox. Vaccine-manufacturing practices during the 19th century may have resulted in the use of virus mixtures, leading to different genetic modifications that resulted in present-day vaccinia strains. Horsepox, a disease previously reported only in Europe, has been disappearing on that continent since the beginning of the 20th century and now seems to have become extinct, although the virus perhaps remains circulating in an unknown reservoir. Genomic sequencing of a horsepox virus isolated in Mongolia in 1976 indicated that, while closely related to vaccinia, this horsepox virus contained additional, potentially ancestral sequences absent in vaccinia. Recent genetic analyses of extant vaccinia viruses have revealed that some strains contain ancestral horsepox virus genes or are phylogenetically related to horsepox virus. We have recently reported that a commercially produced smallpox vaccine, manufactured in the United States in 1902, is genetically highly similar to horsepox virus, providing a missing link in this 200-year-old mystery

  7. Beyond cell proliferation in avian facial morphogenesis. (United States)

    Linde-Medina, Marta; Hallgrímsson, Benedikt; Marcucio, Ralph


    The upper jaw in vertebrates forms from several prominences that arise around the stomodeum or primitive mouth. These prominences undergo coordinated growth and morphogenesis to fuse and form the face. Undirected, regionalized cell proliferation is thought to be the driving force behind the morphogenesis of the facial prominences. However, recent findings suggest that directed cell behaviors in the mesenchyme (e.g., directed cell division, directed cell movement, convergent extension) might be required for successful face formation. Here we discuss the evidence for this view and how directed behaviors may interact with the basement membrane to regulate morphogenesis of the facial region. We believe that future research in these largely unexplored areas could significantly impact our understanding of facial morphogenesis. © 2016 Wiley Periodicals, Inc.

  8. Cell-intrinsic drivers of dendrite morphogenesis. (United States)

    Puram, Sidharth V; Bonni, Azad


    The proper formation and morphogenesis of dendrites is fundamental to the establishment of neural circuits in the brain. Following cell cycle exit and migration, neurons undergo organized stages of dendrite morphogenesis, which include dendritic arbor growth and elaboration followed by retraction and pruning. Although these developmental stages were characterized over a century ago, molecular regulators of dendrite morphogenesis have only recently been defined. In particular, studies in Drosophila and mammalian neurons have identified numerous cell-intrinsic drivers of dendrite morphogenesis that include transcriptional regulators, cytoskeletal and motor proteins, secretory and endocytic pathways, cell cycle-regulated ubiquitin ligases, and components of other signaling cascades. Here, we review cell-intrinsic drivers of dendrite patterning and discuss how the characterization of such crucial regulators advances our understanding of normal brain development and pathogenesis of diverse cognitive disorders.

  9. Signaling circuitry in vascular morphogenesis. (United States)

    Warren, Carmen M; Iruela-Arispe, M Luisa


    In this mini-review, we have highlighted the recent breakthroughs in growth factor signaling that have made conceptual changes in our understanding of how blood vessels are formed. Studies conducted over the past few years have focused on understanding the cell biology of vascular morphogenesis. The major themes include characterization of the different cell types that comprise a vascular sprout, as well as the regulatory influence of cell-cell and cell-matrix interactions on signaling outcomes. In addition, novel trends have emerged, including nonconventional ways in which vascular endothelial growth factor contributes to cell survival and metabolic balance. The growth of new capillary sprouts from a preexisting vascular network requires a highly coordinated cellular response to both growth factors and morphogens. This response is sensed and triggered by cell surface receptors responsible for the activation of an intracellular cascade that efficiently initiates migration and proliferation programs. While the molecular players that coordinate these effects have been identified, recent findings have expanded our understanding of how context, in particular cell-cell and cell-matrix interactions, affects endothelial cell responses to growth factors.

  10. Cellular dynamics and embryonic morphogenesis (United States)

    Zallen, Jennifer


    The elongated body axis is a characteristic feature of many multicellular animals. Axis elongation occurs largely through cell rearrangements that are coordinated across a large cell population and driven by an asymmetric distribution of cytoskeletal and junctional proteins [1]. To visualize cellular dynamics during this process, we performed time-lapse confocal imaging of cell behavior in the Drosophila embryo. These studies revealed that rearranging cells display a steady increase in topological disorder that is accompanied by the formation of transient structures where 5-11 cells meet [2,3]. These multicellular rosettes form and resolve in a directional fashion to produce a local change in the aspect ratio of the cellular assembly, contributing to an overall change in tissue structure. We propose that higher-order rosette structures link local cell interactions to global tissue reorganization during morphogenesis. [1] J. Zallen and E. Wieschaus, Developmental Cell 6, 343 (2004). [2] J. Zallen and R. Zallen, J. Phys.: Condens. Matter 16, S5073 (2004). [3] J. Blankenship et al., Developmental Cell 11, 459 (2006).

  11. Hemodynamics driven cardiac valve morphogenesis. (United States)

    Steed, Emily; Boselli, Francesco; Vermot, Julien


    Mechanical forces are instrumental to cardiovascular development and physiology. The heart beats approximately 2.6 billion times in a human lifetime and heart valves ensure that these contractions result in an efficient, unidirectional flow of the blood. Composed of endocardial cells (EdCs) and extracellular matrix (ECM), cardiac valves are among the most mechanically challenged structures of the body both during and after their development. Understanding how hemodynamic forces modulate cardiovascular function and morphogenesis is key to unraveling the relationship between normal and pathological cardiovascular development and physiology. Most valve diseases have their origins in embryogenesis, either as signs of abnormal developmental processes or the aberrant re-expression of fetal gene programs normally quiescent in adulthood. Here we review recent discoveries in the mechanobiology of cardiac valve development and introduce the latest technologies being developed in the zebrafish, including live cell imaging and optical technologies, as well as modeling approaches that are currently transforming this field. This article is part of a Special Issue entitled: Cardiomyocyte Biology: Integration of Developmental and Environmental Cues in the Heart edited by Marcus Schaub and Hughes Abriel. Copyright © 2015. Published by Elsevier B.V.

  12. Viruses as nanomedicine for cancer. (United States)

    Badrinath, Narayanasamy; Heo, Jeong; Yoo, So Young

    Oncolytic virotherapy, a type of nanomedicine in which oncolytic viruses (OVs) are used to selectively infect and lyse cancer cells, is an emerging field in cancer therapy. Some OVs exhibit a specific tropism for cancer cells, whereas others require genetic modification to enhance their binding with and entry into cancer cells. OVs both kill tumor cells and induce the host's immune response against tumor cells. Armed with antitumor cellular molecules, antibodies, and/or in combination with anticancer drugs, OVs can accelerate the lysis of cancer cells. Among the OVs, vaccinia virus has been the focus of preclinical and clinical research because of its many favorable properties. In this review, the basic mechanisms of action of OVs are presented, including their entry, survival, tumor lysis, and immune activation, and the latest research in vaccinia virus-based virotherapy and its status as an anticancer nanomedicine in prospective clinical trials are discussed.

  13. HIV-1 vaccines based on replication-competent Tiantan vaccinia protected Chinese rhesus macaques from simian HIV infection. (United States)

    Liu, Qiang; Li, Yue; Luo, Zhenwu; Yang, Guibo; Liu, Yong; Liu, Ying; Sun, Maosheng; Dai, Jiejie; Li, Qihan; Qin, Chuan; Shao, Yiming


    To assess the efficacy of HIV vaccines constructed from replication-competent Tiantan vaccinia virus (rTV) alone or combined with DNA in protecting Chinese rhesus macaques from homologous Simian/Human Immunodeficiency Virus (SHIV)-CN97001 challenge. The nef, gag, pol, and gp140 genes from strain CRF07_BC HIV-1 CN54 were selected to construct an HIV vaccine using the rTV or rTV/DNA vaccine. After vaccination, the vaccine and control groups were intravenously challenged with SHIV-CN97001 (32 MID50). HIV-specific antibodies and neutralizing antibodies, gp70 V1V2 binding antibodies, and cytotoxic T-lymphocyte responses were measured prospectively after vaccination with an ELISA, a virus infectivity assay in TZM-bl cells, and ELISPOT assays, respectively. Viral RNA was quantified after challenge with real-time reverse transcriptase-PCR (RT-PCR), and protection efficacy was determined with an analysis of CD8 lymphocyte depletion in vivo. Both rTV and DNA/rTV vaccine groups developed strong cellular and humoral responses against HIV-1 CN54 antigens, including Gag and Env, and also developed significant and persistent anti-Env antibodies and neutralizing antibodies after immunization. Both the rTV and DNA/rTV groups were significantly protected against SHIV-CN97001 or displayed lower viremia than the controls. After CD8 lymphocyte depletion, no viremia was detectable in the vaccinated monkeys, but rebounded rapidly in the control animals. Protection against infection correlated with vaccine-elicited neutralizing antibodies specific for homologous HIV-1 viruses. An rTV-based HIV-1 vaccine, with or without a DNA primer, provided protection from SHIV challenge in a macaque model. Replication-competent Tiantan vaccinia is a promising vector and should enable advances in HIV-1 vaccine development.

  14. Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

    Directory of Open Access Journals (Sweden)

    He Yong


    Full Text Available Abstract Background A33 is a type II integral membrane protein expressed on the extracellular enveloped form of vaccinia virus (VACV. Passive transfer of A33-directed monoclonal antibodies or vaccination with an A33 subunit vaccine confers protection against lethal poxvirus challenge in animal models. Homologs of A33 are highly conserved among members of the Orthopoxvirus genus and are potential candidates for inclusion in vaccines or assays targeting extracellular enveloped virus activity. One monoclonal antibody directed against VACV A33, MAb-1G10, has been shown to target a conformation-dependent epitope. Interestingly, while it recognizes VACV A33 as well as the corresponding variola homolog, it does not bind to the monkeypox homolog. In this study, we utilized a random phage display library to investigate the epitope recognized by MAb-1G10 that is critical for facilitating cell-to-cell spread of the vaccinia virus. Results By screening with linear or conformational random phage libraries, we found that phages binding to MAb-1G10 display the consensus motif CEPLC, with a disulfide bond formed between two cysteine residues required for MAb-1G10 binding. Although the phage motif contained no linear sequences homologous to VACV A33, structure modeling and analysis suggested that residue D115 is important to form the minimal epitope core. A panel of point mutants expressing the ectodomain of A33 protein was generated and analyzed by either binding assays such as ELISA and immunoprecipitation or a functional assessment by blocking MAb-1G10 mediated comet inhibition in cell culture. Conclusions These results confirm L118 as a component of the MAb-1G10 binding epitope, and further identify D115 as an essential residue. By defining the minimum conformational structure, as well as the conformational arrangement of a short peptide sequence recognized by MAb-1G10, these results introduce the possibility of designing small molecule mimetics that may

  15. Comparison of the Transcription and Replication Strategies of Marburg Virus and Ebola Virus by Using Artificial Replication Systems


    Mühlberger, Elke; Weik, Michael; Viktor E Volchkov; Klenk, Hans-Dieter; Becker, Stephan


    The members of the family Filoviridae, Marburg virus (MBGV) and Ebola virus (EBOV), are very similar in terms of morphology, genome organization, and protein composition. To compare the replication and transcription strategies of both viruses, an artificial replication system based on the vaccinia virus T7 expression system was established for EBOV. Specific transcription and replication of an artificial monocistronic minireplicon was demonstrated by reporter gene expression and detection of ...

  16. Oncolytic gene therapy with recombinant vaccinia strain GLV-2b372 efficiently kills hepatocellular carcinoma. (United States)

    Ady, Justin W; Johnsen, Clark; Mojica, Kelly; Heffner, Jacqueline; Love, Damon; Pugalenthi, Amudhan; Belin, Laurence J; Chen, Nanhai G; Yu, Yong A; Szalay, Aladar A; Fong, Yuman


    Hepatocellular carcinoma (HCC) commonly presents at a late stage when surgery is no longer a curative option. As such, novel therapies for advanced HCC are needed. Oncolytic viruses are a viable option for cancer therapy owing to their ability to specifically infect, replicate within, and kill cancer cells. In this study, we have investigated the ability of GLV-2b372, a novel light-emitting recombinant vaccinia virus derived from a wild-type Lister strain, to kill HCC. Four human HCC cell lines were assayed in vitro for infectivity and cytotoxicity. Viral replication was quantified via standard viral plaque assays. Flank HCC xenografts generated in athymic nude mice were treated with intratumoral GLV-2b372 to assess for tumor growth inhibition and viral biodistribution. Infectivity occurred in a time- and concentration-dependent manner with 70% cell death in all cell lines by day 5. All cell lines supported efficient viral replication. At 25 days after infection, flank tumor volumes decreased by 50% whereas controls increased by 400%. Tumor tissue demonstrated substantial GLV-2b372 infection at 24 hours, 48 hours, and 2 weeks. We demonstrate that GLV-2b372 efficiently kills human HCC in vitro and in vivo and is a viable treatment option for patients with HCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Infecções humanas causadas por poxvirus relacionados ao vírus vaccinia no Brasil Human infections caused by vaccinia-like poxviruses in Brazil

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr


    Full Text Available A partir de 1999, infecções humanas por Orthopoxvirus vem sendo observadas em pelo menos oito estados no país, com a formação de vesículas as quais evoluem para pústulas e crostas, principalmente nos membros superiores e face, após contacto com bovinos apresentando lesões semelhantes no úbere. Alem das lesões na pele, foram descritas nos pacientes reações ganglionares axilares por vezes dolorosas, febre, cefaléia, fadiga, desidratação, anorexia, sudorese, artralgia e mialgia, evoluindo o quadro por três a quatro semanas. Lesão vulvar bem como transmissão intrafamiliar foram igualmente descritas. Estudos moleculares demonstraram que os poxvirus identificados são geneticamente relacionados a amostras do vírus vaccinia utilizadas no passado, nas campanhas de vacinação. Especimens clínicos de 80 infecções humanas foram estudados no laboratório e a infecção por orthopoxvirus confirmada em 68 casos. São apresentadas lesões observadas em pacientes bem como discutidas as implicações desta zoonose no Brasil.Since 1999, human infection caused by Orthopoxvirus has been observed in at least eight Brazilian states, with the presence of vesicles that evolve to pustules and crusts, especially on the hands, arms and face, after contact with cows showing comparable lesions on the udder. In addition to the skin lesions, there have been descriptions of patients with axillary ganglionic reactions that are sometimes painful, along with fever, headache, fatigue, dehydration, anorexia, sudoresis, arthralgia and muscle pain. The condition evolves over a three to four-week period. Vulvar lesions and transmission within families have also been described. Molecular studies have shown that the poxviruses identified are genetically related to vaccinia virus samples that were used in vaccination campaigns in the past. Clinical specimens from 80 human infections were studied in the laboratory, and orthopoxvirus infections were confirmed in 68

  18. Extracellular matrix motion and early morphogenesis. (United States)

    Loganathan, Rajprasad; Rongish, Brenda J; Smith, Christopher M; Filla, Michael B; Czirok, Andras; Bénazéraf, Bertrand; Little, Charles D


    For over a century, embryologists who studied cellular motion in early amniotes generally assumed that morphogenetic movement reflected migration relative to a static extracellular matrix (ECM) scaffold. However, as we discuss in this Review, recent investigations reveal that the ECM is also moving during morphogenesis. Time-lapse studies show how convective tissue displacement patterns, as visualized by ECM markers, contribute to morphogenesis and organogenesis. Computational image analysis distinguishes between cell-autonomous (active) displacements and convection caused by large-scale (composite) tissue movements. Modern quantification of large-scale 'total' cellular motion and the accompanying ECM motion in the embryo demonstrates that a dynamic ECM is required for generation of the emergent motion patterns that drive amniote morphogenesis. © 2016. Published by The Company of Biologists Ltd.

  19. Shapes in the Shadow: Evolutionary Dynamics of Morphogenesis

    NARCIS (Netherlands)

    Hogeweg, P.


    This article investigates the evolutionary dynamics of morphogenesis. In this study, morphogenesis arises as a side-effect of maximization of number of cell types. Thus, it investigates the evolutionary dynamics of side-effects. Morphogenesis is governed by the interplay between differential

  20. A Unifying Theory of Branching Morphogenesis

    NARCIS (Netherlands)

    Hannezo, Edouard; Scheele, Colinda L G J; Moad, Mohammad; Drogo, Nicholas; Heer, Rakesh; Sampogna, Rosemary V; van Rheenen, Jacco; Simons, Benjamin D


    The morphogenesis of branched organs remains a subject of abiding interest. Although much is known about the underlying signaling pathways, it remains unclear how macroscopic features of branched organs, including their size, network topology, and spatial patterning, are encoded. Here, we show that,

  1. Extreme morphogenesis in the central caucasus mountains (United States)

    Bulanov, S. A.; Karavaev, V. A.; Seminozhenko, S. S.


    The results of field observations on exogenic morphogenesis in the upper reaches of the Cherek Balkarskii River (Kabardino-Balkaria) are presented. It is established that different components of the extreme morphogenetic process confined to the distribution area of unconsolidated Quaternary sediments are closely interrelated to form a peculiar geomorphological mechanism.

  2. Comparative analysis of viral gene expression programs during poxvirus infection: a transcriptional map of the vaccinia and monkeypox genomes.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins


    Full Text Available Poxviruses engage in a complex and intricate dialogue with host cells as part of their strategy for replication. However, relatively little molecular detail is available with which to understand the mechanisms behind this dialogue.We designed a specialized microarray that contains probes specific to all predicted ORFs in the Monkeypox Zaire (MPXV and Vaccinia Western Reserve (VACV genomes, as well as >18,000 human genes, and used this tool to characterize MPXV and VACV gene expression responses in vitro during the course of primary infection of human monocytes, primary human fibroblasts and HeLa cells. The two viral transcriptomes show distinct features of temporal regulation and species-specific gene expression, and provide an early foundation for understanding global gene expression responses during poxvirus infection.The results provide a temporal map of the transcriptome of each virus during infection, enabling us to compare viral gene expression across species, and classify expression patterns of previously uncharacterized ORFs.

  3. Enhancement of feline immunodeficiency virus infection after immunization with envelope glycoprotein subunit vaccines.

    NARCIS (Netherlands)

    C.H.J. Siebelink (Kees); E.J. Tijhaar (Edwin); R.C. Huisman (Robin); W. Huisman (Willem); A. de Ronde; I.H. Darby; M.J. Francis; G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert)


    textabstractCats were immunized three times with different recombinant feline immunodeficiency virus (FIV) candidate vaccines. Recombinant vaccinia virus (rVV)-expressed envelope glycoprotein with (vGR657) or without (vGR657 x 15) the cleavage site and an FIV envelope bacterial fusion protein


    Indian Academy of Sciences (India)

    and-mouth disease in livestock was an infectious particle smaller than any bacteria. This was the first clue to the nature of viruses, genetic entities that lie somewhere in the gray area between living and non-living states.

  5. Feedback, Lineages and Self-Organizing Morphogenesis.

    Directory of Open Access Journals (Sweden)

    Sameeran Kunche


    Full Text Available Feedback regulation of cell lineage progression plays an important role in tissue size homeostasis, but whether such feedback also plays an important role in tissue morphogenesis has yet to be explored. Here we use mathematical modeling to show that a particular feedback architecture in which both positive and negative diffusible signals act on stem and/or progenitor cells leads to the appearance of bistable or bi-modal growth behaviors, ultrasensitivity to external growth cues, local growth-driven budding, self-sustaining elongation, and the triggering of self-organization in the form of lamellar fingers. Such behaviors arise not through regulation of cell cycle speeds, but through the control of stem or progenitor self-renewal. Even though the spatial patterns that arise in this setting are the result of interactions between diffusible factors with antagonistic effects, morphogenesis is not the consequence of Turing-type instabilities.

  6. Claudins in morphogenesis: Forming an epithelial tube. (United States)

    Baumholtz, Amanda I; Gupta, Indra R; Ryan, Aimee K


    The claudin family of tetraspan transmembrane proteins is essential for tight junction formation and regulation of paracellular transport between epithelial cells. Claudins also play a role in apical-basal cell polarity, cell adhesion and link the tight junction to the actin cytoskeleton to exert effects on cell shape. The function of claudins in paracellular transport has been extensively studied through loss-of-function and gain-of-function studies in cell lines and in animal models, however, their role in morphogenesis has been less appreciated. In this review, we will highlight the importance of claudins during morphogenesis by specifically focusing on their critical functions in generating epithelial tubes, lumens, and tubular networks during organ formation.

  7. Feedback, Lineages and Self-Organizing Morphogenesis (United States)

    Calof, Anne L.; Lowengrub, John S.; Lander, Arthur D.


    Feedback regulation of cell lineage progression plays an important role in tissue size homeostasis, but whether such feedback also plays an important role in tissue morphogenesis has yet to be explored. Here we use mathematical modeling to show that a particular feedback architecture in which both positive and negative diffusible signals act on stem and/or progenitor cells leads to the appearance of bistable or bi-modal growth behaviors, ultrasensitivity to external growth cues, local growth-driven budding, self-sustaining elongation, and the triggering of self-organization in the form of lamellar fingers. Such behaviors arise not through regulation of cell cycle speeds, but through the control of stem or progenitor self-renewal. Even though the spatial patterns that arise in this setting are the result of interactions between diffusible factors with antagonistic effects, morphogenesis is not the consequence of Turing-type instabilities. PMID:26989903

  8. Airway branching morphogenesis in three dimensional culture

    Directory of Open Access Journals (Sweden)

    Gudjonsson Thorarinn


    Full Text Available Abstract Background Lungs develop from the fetal digestive tract where epithelium invades the vascular rich stroma in a process called branching morphogenesis. In organogenesis, endothelial cells have been shown to be important for morphogenesis and the maintenance of organ structure. The aim of this study was to recapitulate human lung morphogenesis in vitro by establishing a three dimensional (3D co-culture model where lung epithelial cells were cultured in endothelial-rich stroma. Methods We used a human bronchial epithelial cell line (VA10 recently developed in our laboratory. This cell line cell line maintains a predominant basal cell phenotype, expressing p63 and other basal markers such as cytokeratin-5 and -14. Here, we cultured VA10 with human umbilical vein endothelial cells (HUVECs, to mimic the close interaction between these cell types during lung development. Morphogenesis and differentiation was monitored by phase contrast microscopy, immunostainings and confocal imaging. Results We found that in co-culture with endothelial cells, the VA10 cells generated bronchioalveolar like structures, suggesting that lung epithelial branching is facilitated by the presence of endothelial cells. The VA10 derived epithelial structures display various complex patterns of branching and show partial alveolar type-II differentiation with pro-Surfactant-C expression. The epithelial origin of the branching VA10 colonies was confirmed by immunostaining. These bronchioalveolar-like structures were polarized with respect to integrin expression at the cell-matrix interface. The endothelial-induced branching was mediated by soluble factors. Furthermore, fibroblast growth factor receptor-2 (FGFR-2 and sprouty-2 were expressed at the growing tips of the branching structures and the branching was inhibited by the FGFR-small molecule inhibitor SU5402. Discussion In this study we show that a human lung epithelial cell line can be induced by endothelial cells to

  9. One more piece in the VACV ecological puzzle: could peridomestic rodents be the link between wildlife and bovine vaccinia outbreaks in Brazil?

    Directory of Open Access Journals (Sweden)

    Jônatas S Abrahão

    Full Text Available BACKGROUND: Despite the fact that smallpox eradication was declared by the World Health Organization (WHO in 1980, other poxviruses have emerged and re-emerged, with significant public health and economic impacts. Vaccinia virus (VACV, a poxvirus used during the WHO smallpox vaccination campaign, has been involved in zoonotic infections in Brazilian rural areas (Bovine Vaccinia outbreaks - BV, affecting dairy cattle and milkers. Little is known about VACV's natural hosts and its epidemiological and ecological characteristics. Although VACV was isolated and/or serologically detected in Brazilian wild animals, the link between wildlife and farms has not yet been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we describe for the first time, to our knowledge, the isolation of a VACV (Mariana virus - MARV from a mouse during a BV outbreak. Genetic data, in association with biological assays, showed that this isolate was the same etiological agent causing exanthematic lesions observed in the cattle and human inhabitants of a particular BV-affected area. Phylogenetic analysis grouped MARV with other VACV isolated during BV outbreaks. CONCLUSION/SIGNIFICANCE: These data provide new biological and epidemiological information on VACV and lead to an interesting question: could peridomestic rodents be the link between wildlife and BV outbreaks?

  10. Normal morphogenesis of epithelial tissues and progression of epithelial tumors (United States)

    Wang, Chun-Chao; Jamal, Leen; Janes, Kevin A.


    Epithelial cells organize into various tissue architectures that largely maintain their structure throughout the life of an organism. For decades, the morphogenesis of epithelial tissues has fascinated scientists at the interface of cell, developmental, and molecular biology. Systems biology offers ways to combine knowledge from these disciplines by building integrative models that are quantitative and predictive. Can such models be useful for gaining a deeper understanding of epithelial morphogenesis? Here, we take inventory of some recurring themes in epithelial morphogenesis that systems approaches could strive to capture. Predictive understanding of morphogenesis at the systems level would prove especially valuable for diseases such as cancer, where epithelial tissue architecture is profoundly disrupted. PMID:21898857

  11. Vaccinia scars associated with better survival for adults. An observational study from Guinea-Bissau

    DEFF Research Database (Denmark)

    Aaby, Peter; Gustafson, Per; Roth, Adam Anders Edvin


    Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality.......Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality....

  12. Crystal structure of vaccinia viral A27 protein reveals a novel structure critical for its function and complex formation with A26 protein.

    Directory of Open Access Journals (Sweden)

    Tao-Hsin Chang

    Full Text Available Vaccinia virus envelope protein A27 has multiple functions and is conserved in the Orthopoxvirus genus of the poxvirus family. A27 protein binds to cell surface heparan sulfate, provides an anchor for A26 protein packaging into mature virions, and is essential for egress of mature virus (MV from infected cells. Here, we crystallized and determined the structure of a truncated form of A27 containing amino acids 21-84, C71/72A (tA27 at 2.2 Å resolution. tA27 protein uses the N-terminal region interface (NTR to form an unexpected trimeric assembly as the basic unit, which contains two parallel α-helices and one unusual antiparallel α-helix; in a serpentine way, two trimers stack with each other to form a hexamer using the C-terminal region interface (CTR. Recombinant tA27 protein forms oligomers in a concentration-dependent manner in vitro in gel filtration. Analytical ultracentrifugation and multi-angle light scattering revealed that tA27 dimerized in solution and that Leu47, Leu51, and Leu54 at the NTR and Ile68, Asn75, and Leu82 at the CTR are responsible for tA27 self-assembly in vitro. Finally, we constructed recombinant vaccinia viruses expressing full length mutant A27 protein defective in either NTR, CTR, or both interactions; the results demonstrated that wild type A27 dimer/trimer formation was impaired in NTR and CTR mutant viruses, resulting in small plaques that are defective in MV egress. Furthermore, the ability of A27 protein to form disulfide-linked protein complexes with A26 protein was partially or completely interrupted by NTR and CTR mutations, resulting in mature virion progeny with increased plasma membrane fusion activity upon cell entry. Together, these results demonstrate that A27 protein trimer structure is critical for MV egress and membrane fusion modulation. Because A27 is a neutralizing target, structural information will aid the development of inhibitors to block A27 self-assembly or complex formation against

  13. Architects of assembly: roles of Flaviviridae non-structural proteins in virion morphogenesis. (United States)

    Murray, Catherine L; Jones, Christopher T; Rice, Charles M


    Viruses of the Flaviviridae family, including hepatitis C, dengue and bovine viral diarrhoea, are responsible for considerable morbidity and mortality worldwide. Recent advances in our understanding of virion assembly have uncovered commonalities among distantly related members of this family. We discuss the emerging hypothesis that physical virion components are not alone in forming the infectious particle, but that non-structural proteins are intimately involved in orchestrating morphogenesis. Pinpointing the roles of Flaviviridae proteins in virion production could reveal new avenues for antiviral therapeutics.

  14. Smallpox virus resequencing GeneChips can also rapidly ascertain species status for some zoonotic non-variola orthopoxviruses. (United States)

    Sulaiman, Irshad M; Sammons, Scott A; Wohlhueter, Robert M


    We recently developed a set of seven resequencing GeneChips for the rapid sequencing of Variola virus strains in the WHO Repository of the Centers for Disease Control and Prevention. In this study, we attempted to hybridize these GeneChips with some known non-Variola orthopoxvirus isolates, including monkeypox, cowpox, and vaccinia viruses, for rapid detection.

  15. Review: cornification, morphogenesis and evolution of feathers. (United States)

    Alibardi, Lorenzo


    Feathers are corneous microramifications of variable complexity derived from the morphogenesis of barb ridges. Histological and ultrastructural analyses on developing and regenerating feathers clarify the three-dimensional organization of cells in barb ridges. Feather cells derive from folds of the embryonic epithelium of feather germs from which barb/barbule cells and supportive cells organize in a branching structure. The following degeneration of supportive cells allows the separation of barbule cells which are made of corneous beta-proteins and of lower amounts of intermediate filament (IF)(alpha) keratins, histidine-rich proteins, and corneous proteins of the epidermal differentiation complex. The specific protein association gives rise to a corneous material with specific biomechanic properties in barbules, rami, rachis, or calamus. During the evolution of different feather types, a large expansion of the genome coding for corneous feather beta-proteins occurred and formed 3-4-nm-thick filaments through a different mechanism from that of 8-10 nm IF keratins. In the chick, over 130 genes mainly localized in chromosomes 27 and 25 encode feather corneous beta-proteins of 10-12 kDa containing 97-105 amino acids. About 35 genes localized in chromosome 25 code for scale proteins (14-16 kDa made of 122-146 amino acids), claws and beak proteins (14-17 kDa proteins of 134-164 amino acids). Feather morphogenesis is periodically re-activated to produce replacement feathers, and multiple feather types can result from the interactions of epidermal and dermal tissues. The review shows schematic models explaining the translation of the morphogenesis of barb ridges present in the follicle into the three-dimensional shape of the main types of branched or un-branched feathers such as plumulaceous, pennaceous, filoplumes, and bristles. The temporal pattern of formation of barb ridges in different feather types and the molecular control from the dermal papilla through

  16. Assisted morphogenesis: glial control of dendrite shapes. (United States)

    Procko, Carl; Shaham, Shai


    Neurons display a myriad of dendritic architectures, reflecting their diverse roles in information processing and transduction in the nervous system. Recent findings suggest that neuronal signals may not account for all aspects of dendrite morphogenesis. Observations from C. elegans and other organisms suggest that glial cells can affect dendrite length and guidance, as well as localization and shapes of dendritic receptive structures, such as dendritic spines and sensory cilia. Thus, besides direct roles in controlling neuronal activity, glia contribute to neuron function by ensuring that neurons attain their proper shapes. Copyright © 2010 Elsevier Ltd. All rights reserved.

  17. A Unifying Theory of Branching Morphogenesis. (United States)

    Hannezo, Edouard; Scheele, Colinda L G J; Moad, Mohammad; Drogo, Nicholas; Heer, Rakesh; Sampogna, Rosemary V; van Rheenen, Jacco; Simons, Benjamin D


    The morphogenesis of branched organs remains a subject of abiding interest. Although much is known about the underlying signaling pathways, it remains unclear how macroscopic features of branched organs, including their size, network topology, and spatial patterning, are encoded. Here, we show that, in mouse mammary gland, kidney, and human prostate, these features can be explained quantitatively within a single unifying framework of branching and annihilating random walks. Based on quantitative analyses of large-scale organ reconstructions and proliferation kinetics measurements, we propose that morphogenesis follows from the proliferative activity of equipotent tips that stochastically branch and randomly explore their environment but compete neutrally for space, becoming proliferatively inactive when in proximity with neighboring ducts. These results show that complex branched epithelial structures develop as a self-organized process, reliant upon a strikingly simple but generic rule, without recourse to a rigid and deterministic sequence of genetically programmed events. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Vectors based on modified vaccinia Ankara expressing influenza H5N1 hemagglutinin induce substantial cross-clade protective immunity.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: New highly pathogenic H5N1 influenza viruses are continuing to evolve with a potential threat for an influenza pandemic. So far, the H5N1 influenza viruses have not widely circulated in humans and therefore constitute a high risk for the non immune population. The aim of this study was to evaluate the cross-protective potential of the hemagglutinins of five H5N1 strains of divergent clades using a live attenuated modified vaccinia Ankara (MVA vector vaccine. METHODOLOGY/PRINCIPAL FINDINGS: The replication-deficient MVA virus was used to express influenza hemagglutinin (HA proteins. Specifically, recombinant MVA viruses expressing the HA genes of the clade 1 virus A/Vietnam/1203/2004 (VN/1203, the clade 2.1.3 virus A/Indonesia/5/2005 (IN5/05, the clade 2.2 viruses A/turkey/Turkey/1/2005 (TT01/05 and A/chicken/Egypt/3/2006 (CE/06, and the clade 2.3.4 virus A/Anhui/1/2005 (AH1/05 were constructed. These experimental live vaccines were assessed in a lethal mouse model. Mice vaccinated with the VN/1203 hemagglutinin-expressing MVA induced excellent protection against all the above mentioned clades. Also mice vaccinated with the IN5/05 HA expressing MVA induced substantial protection against homologous and heterologous AH1/05 challenge. After vaccination with the CE/06 HA expressing MVA, mice were fully protected against clade 2.2 challenge and partially protected against challenge of other clades. Mice vaccinated with AH1/05 HA expressing MVA vectors were only partially protected against homologous and heterologous challenge. The live vaccines induced substantial amounts of neutralizing antibodies, mainly directed against the homologous challenge virus, and high levels of HA-specific IFN-γ secreting CD4 and CD8 T-cells against epitopes conserved among the H5 clades and subclades. CONCLUSIONS/SIGNIFICANCE: The highest level of cross-protection was induced by the HA derived from the VN/1203 strain, suggesting that pandemic H5 vaccines

  19. Extracellular matrix and cytoskeletal dynamics during branching morphogenesis (United States)

    Kim, Hye Young; Nelson, Celeste M.


    Branching morphogenesis is a fundamental developmental process which results in amplification of epithelial surface area for exchanging molecules in organs including the lung, kidney, mammary gland and salivary gland. These complex tree-like structures are built by iterative rounds of simple routines of epithelial morphogenesis, including bud formation, extension, and bifurcation, that require constant remodeling of the extracellular matrix (ECM) and the cytoskeleton. In this review, we highlight the current understanding of the role of the ECM and cytoskeletal dynamics in branching morphogenesis across these different organs. The cellular and molecular mechanisms shared during this morphogenetic process provide insight into the development of other branching organs. PMID:22609561

  20. Delivering the message: epimorphin and mammary epithelial morphogenesis. (United States)

    Radisky, Derek C; Hirai, Yohei; Bissell, Mina J


    The mammary gland consists of a highly branched tubular epithelium surrounded by a complex mesenchymal stroma. Epimorphin is an extracellular protein that is expressed by mammary mesenchymal cells that directs epithelial morphogenesis. Depending upon the context of presentation--polar versus apolar--epimorphin can selectively direct two key processes of tubulogenesis: branching morphogenesis (processes involved in tubule initiation and extension) and luminal morphogenesis (required for enlargement of tubule caliber). Here, we outline the fundamentals of mammary gland development and describe the function of epimorphin in these processes. We conclude with a review of recent studies that suggest similar morphogenic roles for epimorphin in other glandular organs.

  1. Morphogenesis in Belousov-Zhabotinsky microdroplets (United States)

    Li, Ning; Tompkins, Nathan; Girabawe, Camille; Epstein, Irving; Fraden, Seth; Brandeis/Mrsec Team


    We present experimental evidence for the six cases Alan Turing predicted using linear stability analysis in his 1952 paper ``The chemical basis of morphogenesis'' in our reaction diffusion system. Our experimental system consists of a microfluidically generated microemulsion consisting of Ru(bipy)3 catalyzed light sensitive BZ aqueous droplets which are diffusively coupled through oil gaps. We observed that some droplets grow and others shrink due to the unequal consumption of chemicals in the droplets which leads to an osmotic pressure change, as Turing predicted in his paper. The initial and boundary conditions of our system were controlled by programmable illumination via the light sensitive catalyst Ru(bipy)3. Simulation and linear stability analysis were performed and compared with the experiments. Funded by MRSEC.

  2. Morphogenesis of filaments growing in flexible confinements (United States)

    Vetter, R.; Wittel, F. K.; Herrmann, H. J.


    Space-saving design is a requirement that is encountered in biological systems and the development of modern technological devices alike. Many living organisms dynamically pack their polymer chains, filaments or membranes inside deformable vesicles or soft tissue-like cell walls, chorions and buds. Surprisingly little is known about morphogenesis due to growth in flexible confinements—perhaps owing to the daunting complexity lying in the nonlinear feedback between packed material and expandable cavity. Here we show by experiments and simulations how geometric and material properties lead to a plethora of morphologies when elastic filaments are growing far beyond the equilibrium size of a flexible thin sheet they are confined in. Depending on friction, sheet flexibility and thickness, we identify four distinct morphological phases emerging from bifurcation and present the corresponding phase diagram. Four order parameters quantifying the transitions between these phases are proposed.

  3. Laser capture microdissection to study flower morphogenesis (United States)

    Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Kowalczuk, Cezary; PlÄ der, Wojciech; Przybecki, Zbigniew


    Laser Capture Microdissection (LCM) is a sample preparation microscopic method that enables isolation of an interesting cell or cells population from human, animal or plant tissue. This technique allows for obtaining pure sample from heterogeneous mixture. From isolated cells, it is possible to obtain the appropriate quality material used for genomic research in transcriptomics, proteomics and metabolomics. We used LCM method to study flower morphogenesis and specific bud's organ organization and development. The genes expression level in developing flower buds of male (B10) and female (2gg) lines were analyzed with qPCR. The expression was checked for stamen and carpel primordia obtained with LCM and for whole flower buds at successive stages of growth.

  4. Patterned cell and matrix dynamics in branching morphogenesis. (United States)

    Wang, Shaohe; Sekiguchi, Rei; Daley, William P; Yamada, Kenneth M


    Many embryonic organs undergo branching morphogenesis to maximize their functional epithelial surface area. Branching morphogenesis requires the coordinated interplay of multiple types of cells with the extracellular matrix (ECM). During branching morphogenesis, new branches form by "budding" or "clefting." Cell migration, proliferation, rearrangement, deformation, and ECM dynamics have varied roles in driving budding versus clefting in different organs. Elongation of the newly formed branch and final maturation of the tip involve cellular mechanisms that include cell elongation, intercalation, convergent extension, proliferation, and differentiation. New methodologies such as high-resolution live imaging, tension sensors, and force-mapping techniques are providing exciting new opportunities for future research into branching morphogenesis. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

  5. Normal morphogenesis of epithelial tissues and progression of epithelial tumors. (United States)

    Wang, Chun-Chao; Jamal, Leen; Janes, Kevin A


    Epithelial cells organize into various tissue architectures that largely maintain their structure throughout the life of an organism. For decades, the morphogenesis of epithelial tissues has fascinated scientists at the interface of cell, developmental, and molecular biology. Systems biology offers ways to combine knowledge from these disciplines by building integrative models that are quantitative and predictive. Can such models be useful for gaining a deeper understanding of epithelial morphogenesis? Here, we take inventory of some recurring themes in epithelial morphogenesis that systems approaches could strive to capture. Predictive understanding of morphogenesis at the systems level would prove especially valuable for diseases such as cancer, where epithelial tissue architecture is profoundly disrupted. Copyright © 2011 John Wiley & Sons, Inc.

  6. Growth and Morphogenesis during Early Heart Development in Amniotes


    Kenzo Ivanovitch; Isaac Esteban; Miguel Torres


    In this review, we will focus on the growth and morphogenesis of the developing heart, an aspect of cardiovascular development to which Antoon Moorman and colleagues have extensively contributed. Over the last decades, genetic studies and characterization of regionally regulated gene programs have provided abundant novel insights into heart development essential to understand the basis of congenital heart disease. Heart morphogenesis, however, is inherently a complex and dynamic three-dimensi...

  7. Extracellular matrix and growth factors in branching morphogenesis (United States)

    Hardman, P.; Spooner, B. S.


    The unifying hypothesis of the NSCORT in gravitational biology postulates that the ECM and growth factors are key interrelated components of a macromolecular regulatory system. The ECM is known to be important in growth and branching morphogenesis of embryonic organs. Growth factors have been detected in the developing embryo, and often the pattern of localization is associated with areas undergoing epithelial-mesenchymal interactions. Causal relationships between these components may be of fundamental importance in control of branching morphogenesis.

  8. The Arabidopsis embryo as a miniature morphogenesis model. (United States)

    Wendrich, Jos R; Weijers, Dolf


    Four basic ingredients of morphogenesis, oriented cell division and expansion, cell-cell communication and cell fate specification allow plant cells to develop into a wide variety of organismal architectures. A central question in plant biology is how these cellular processes are regulated and orchestrated. Here, we present the advantages of the early Arabidopsis embryo as a model for studying the control of morphogenesis. All ingredients of morphogenesis converge during embryogenesis, and the highly predictable nature of embryo development offers unprecedented opportunities for understanding their regulation in time and space. In this review we describe the morphogenetic principles underlying embryo patterning and discuss recent advances in their regulation. Morphogenesis is under tight transcriptional control and most genes that were identified as important regulators of embryo patterning encode transcription factors or components of signaling pathways. There exists, therefore, a large gap between the transcriptional control of embryo morphogenesis and the cellular execution. We describe the first such connections, and propose future directions that should help bridge this gap and generate comprehensive understanding of the control of morphogenesis. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  9. Vaccinia complement control protein: Multi-functional protein and a ...

    Indian Academy of Sciences (India)


    Another evasion strategy is piracy of immune-response genes from the host – a characteri- stic feature of DNA viruses (Haig 2001). The virus presu- mably acquires the DNA encoding the protein from the host and, over an evolutionary period, manipulates the. DNA to retain only the most essential domain. Poxviruses are ...

  10. T-cell epitopes identified by BALB/c mice immunized with vaccinia expressing HIV-1 gag lie within immunodominant regions recognized by HIV-infected Indian patients

    Directory of Open Access Journals (Sweden)

    Ashwini V Shete


    Full Text Available Background: Human immunodeficiency virus (HIV antigens from transmitted strains of HIV would prove crucial in vaccine designing for prevention of HIV infection. Immune response generated by Vaccinia construct expressing the HIV-1 gag gene from transmitted Indian HIV-1 subtype C strain (Vgag in BALB/c mice is reported in the present study along with the identification of epitopes responsible for induction of the immune response. Aims: The aim of this study was to determine immune response generated by the constructs in a mouse model and to understand the epitope specificities of the response. Settings and Design: This was an observational study carried out in BALB/c mice. Materials and Methods: The immunogenecity of Vgag construct was evaluated in BALB/c mice after multiple immunizations. T-cell response was monitored by the interferon-γ ELISPOT assay using HIV-1 C Gag overlapping peptides and anti-P24 antibodies were estimated by ELISA. Statistical Analysis Used: Graphpad prism software was used for statistical analysis and for plotting graphs. Results: IFN-γ-secreting T cells and antibodies were detected against HIV Gag in mice after immunization. Although after repeated immunizations, antibody-mediated immune response increased or remained sustained, the magnitude of IFN-γ-secreting T cell was found to be decreased over time. The Gag peptides recognized by mice were mainly confined to the P24 region and had a considerable overlap with earlier reported immunodominant regions recognized by HIV-infected Indian patients. Conclusion: Vaccinia construct with a gag gene from transmitted HIV-1 virus was found to be immunogenic. The Gag regions identified by mice could have important implications in terms of future HIV vaccine designing.

  11. Expanding the repertoire of Modified Vaccinia Ankara-based vaccine vectors via genetic complementation strategies.

    Directory of Open Access Journals (Sweden)

    David A Garber

    Full Text Available Modified Vaccinia virus Ankara (MVA is a safe, highly attenuated orthopoxvirus that is being developed as a recombinant vaccine vector for immunization against a number of infectious diseases and cancers. However, the expression by MVA vectors of large numbers of poxvirus antigens, which display immunodominance over vectored antigens-of-interest for the priming of T cell responses, and the induction of vector-neutralizing antibodies, which curtail the efficacy of subsequent booster immunizations, remain as significant impediments to the overall utility of such vaccines. Thus, genetic approaches that enable the derivation of MVA vectors that are antigenically less complex may allow for rational improvement of MVA-based vaccines.We have developed a genetic complementation system that enables the deletion of essential viral genes from the MVA genome, thereby allowing us to generate MVA vaccine vectors that are antigenically less complex. Using this system, we deleted the essential uracil-DNA-glycosylase (udg gene from MVA and propagated this otherwise replication-defective variant on a complementing cell line that constitutively expresses the poxvirus udg gene and that was derived from a newly identified continuous cell line that is permissive for growth of wild type MVA. The resulting virus, MVADeltaudg, does not replicate its DNA genome or express late viral gene products during infection of non-complementing cells in culture. As proof-of-concept for immunological 'focusing', we demonstrate that immunization of mice with MVADeltaudg elicits CD8+ T cell responses that are directed against a restricted repertoire of vector antigens, as compared to immunization with parental MVA. Immunization of rhesus macaques with MVADeltaudg-gag, a udg(- recombinant virus that expresses an HIV subtype-B consensus gag transgene, elicited significantly higher frequencies of Gag-specific CD8 and CD4 T cells following both primary (2-4-fold and booster (2-fold

  12. Virus inactivation under the photodynamic effect of phthalocyanine zinc(II) complexes. (United States)

    Remichkova, Mimi; Mukova, Luchia; Nikolaeva-Glomb, Lubomira; Nikolova, Nadya; Doumanova, Lubka; Mantareva, Vanya; Angelov, Ivan; Kussovski, Veselin; Galabov, Angel S


    Various metal phthalocyanines have been studied for their capacity for photodynamic effects on viruses. Two newly synthesized water-soluble phthalocyanine Zn(II) complexes with different charges, cationic methylpyridyloxy-substituted Zn(II)- phthalocyanine (ZnPcMe) and anionic sulfophenoxy-substituted Zn(II)-phthalocyanine (ZnPcS), were used for photoinactivation of two DNA-containing enveloped viruses (herpes simplex virus type 1 and vaccinia virus), two RNA-containing enveloped viruses (bovine viral diarrhea virus and Newcastle disease virus) and two nude viruses (the enterovirus Coxsackie B1, a RNA-containing virus, and human adenovirus 5, a DNA virus). These two differently charged phthalocyanine complexes showed an identical marked virucidal effect against herpes simplex virus type 1, which was one and the same at an irradiation lasting 5 or 20 min (Δlog=3.0 and 4.0, respectively). Towards vaccinia virus this effect was lower, Δlog=1.8 under the effect of ZnPcMe and 2.0 for ZnPcS. Bovine viral diarrhea virus manifested a moderate sensitivity to ZnPcMe (Δlog=1.8) and a pronounced one to ZnPcS at 5- and 20-min irradiation (Δlog=5.8 and 5.3, respectively). The complexes were unable to inactivate Newcastle disease virus, Coxsackievirus B1 and human adenovirus type 5.

  13. Quantifying the Intercellular Forces during Drosophila Morphogenesis (United States)

    Ma, Xiaoyan; Hutson, M. Shane


    In many models of morphogenesis, cellular movements are driven by differences in interfacial tension along cell-cell boundaries. We have developed a microsurgical method to determine these tensions in living fruit fly (Drosophila) embryos. Cell edges in these embryos are labeled with green fluorescent protein chimeras; and line scan images that intersect several cell edges are recorded with a laser-scanning confocal microscope at a time resolution of 2 ms. While recording these scans, a Q-switched Nd:YAG laser is used to cut a single cell edge. The recoil of adjacent cell edges is evident in the line scans and the time-dependent cell edge positions are extracted using custom ImageJ plugins based on the Lucas-Kanade algorithm. The post-incision recoil velocities of cell edges are determined by fitting the cell edge positions to a double exponential function. In addition, a power spectrum analysis of cell-edge position fluctuations is used to determine the viscous damping constant. In the regime of low Reynolds number, the tension along a cell-cell boundary is well-approximated by the product of the viscous damping constant and the initial recoil velocity of adjacent cell edges. We will present initial results from two stages of Drosophila development -- germ band retraction and early dorsal closure.

  14. Microtubules, polarity and vertebrate neural tube morphogenesis. (United States)

    Cearns, Michael D; Escuin, Sarah; Alexandre, Paula; Greene, Nicholas D E; Copp, Andrew J


    Microtubules (MTs) are key cellular components, long known to participate in morphogenetic events that shape the developing embryo. However, the links between the cellular functions of MTs, their effects on cell shape and polarity, and their role in large-scale morphogenesis remain poorly understood. Here, these relationships were examined with respect to two strategies for generating the vertebrate neural tube: bending and closure of the mammalian neural plate; and cavitation of the teleost neural rod. The latter process has been compared with 'secondary' neurulation that generates the caudal spinal cord in mammals. MTs align along the apico-basal axis of the mammalian neuroepithelium early in neural tube closure, participating functionally in interkinetic nuclear migration, which indirectly impacts on cell shape. Whether MTs play other functional roles in mammalian neurulation remains unclear. In the zebrafish, MTs are important for defining the neural rod midline prior to its cavitation, both by localizing apical proteins at the tissue midline and by orienting cell division through a mirror-symmetric MT apparatus that helps to further define the medial localization of apical polarity proteins. Par proteins have been implicated in centrosome positioning in neuroepithelia as well as in the control of polarized morphogenetic movements in the neural rod. Understanding of MT functions during early nervous system development has so far been limited, partly by techniques that fail to distinguish 'cause' from 'effect'. Future developments will likely rely on novel ways to selectively impair MT function in order to investigate the roles they play. © 2016 Anatomical Society.

  15. Local mechanisms in sex specific morphogenesis. (United States)

    Drews, U


    Sex determination in mammals occurs on three levels. Segregation of sex chromosomes determines the chromosomal sex. Sry on the Y chromosome induces formation of a testis which in turn regulates via AMH and testosterone the development of the genital tract and the external phenotype. Recently a number of new factors have been described, which affect sexual development but have not yet found a place in the above canonical scheme of sex determination. For the purpose of this review, the factors are aligned according to their quality as transcription factors, steroid hormones, or growth factors. In this web of regulatory factors, the classical sex determining factors have evolved as master mechanisms while others function as slaves, or were totally suppressed. In this context, androgens acquired a dominant role in mammalian development. Androgens determine the morphogenesis of the genital tract. The effects of androgens are mediated by local cellular interactions. In the cranial section of the Wolffian duct the androgen receptor appears in the epithelium and mediates maintenance of the duct via an epithelial factor. In the caudal section of the duct the androgen receptor is expressed in the embryonic mesenchyme. Vesicular glands are induced via a morphogenetically active mesenchymal condensation, while the epithelial buds are primarily AR androgen receptor negative. The dominant role of androgens and formation of a vagina evolved together at the transition to eutherian mammals. Under this aspect, the role of androgens in the development of the vagina is analyzed. Copyright 2001 S. Karger AG, Basel

  16. Mechanical growth and morphogenesis of seashells

    KAUST Repository

    Moulton, D.E.


    Seashells grow through the local deposition of mass along the aperture. Many mathematical descriptions of the shapes of shells have been provided over the years, and the basic logarithmic coiling seen in mollusks can be simulated with few parameters. However, the developmental mechanisms underlying shell coiling are largely not understood and the ubiquitous presence of ornamentation such as ribs, tubercles, or spines presents yet another level of difficulty. Here we develop a general model for shell growth based entirely on the local geometry and mechanics of the aperture and mantle. This local description enables us to efficiently describe both arbitrary growth velocities and the evolution of the shell aperture itself. We demonstrate how most shells can be simulated within this framework. We then turn to the mechanics underlying the shell morphogenesis, and develop models for the evolution of the aperture. We demonstrate that the elastic response of the mantle during shell deposition provides a natural mechanism for the formation of three-dimensional ornamentation in shells. © 2012 Elsevier Ltd.

  17. Cellular Mechanisms of Drosophila Heart Morphogenesis

    Directory of Open Access Journals (Sweden)

    Georg Vogler


    Full Text Available Many of the major discoveries in the fields of genetics and developmental biology have been made using the fruit fly, Drosophila melanogaster. With regard to heart development, the conserved network of core cardiac transcription factors that underlies cardiogenesis has been studied in great detail in the fly, and the importance of several signaling pathways that regulate heart morphogenesis, such as Slit/Robo, was first shown in the fly model. Recent technological advances have led to a large increase in the genomic data available from patients with congenital heart disease (CHD. This has highlighted a number of candidate genes and gene networks that are potentially involved in CHD. To validate genes and genetic interactions among candidate CHD-causing alleles and to better understand heart formation in general are major tasks. The specific limitations of the various cardiac model systems currently employed (mammalian and fish models provide a niche for the fly model, despite its evolutionary distance to vertebrates and humans. Here, we review recent advances made using the Drosophila embryo that identify factors relevant for heart formation. These underline how this model organism still is invaluable for a better understanding of CHD.

  18. Multiscale information modelling for heart morphogenesis (United States)

    Abdulla, T.; Imms, R.; Schleich, J. M.; Summers, R.


    Science is made feasible by the adoption of common systems of units. As research has become more data intensive, especially in the biomedical domain, it requires the adoption of a common system of information models, to make explicit the relationship between one set of data and another, regardless of format. This is being realised through the OBO Foundry to develop a suite of reference ontologies, and NCBO Bioportal to provide services to integrate biomedical resources and functionality to visualise and create mappings between ontology terms. Biomedical experts tend to be focused at one level of spatial scale, be it biochemistry, cell biology, or anatomy. Likewise, the ontologies they use tend to be focused at a particular level of scale. There is increasing interest in a multiscale systems approach, which attempts to integrate between different levels of scale to gain understanding of emergent effects. This is a return to physiological medicine with a computational emphasis, exemplified by the worldwide Physiome initiative, and the European Union funded Network of Excellence in the Virtual Physiological Human. However, little work has been done on how information modelling itself may be tailored to a multiscale systems approach. We demonstrate how this can be done for the complex process of heart morphogenesis, which requires multiscale understanding in both time and spatial domains. Such an effort enables the integration of multiscale metrology.

  19. Psoriasis herpeticum due to Varicella zoster virus: A Kaposi′s varicelliform eruption in erythrodermic psoriasis

    Directory of Open Access Journals (Sweden)

    Geeta Garg


    Full Text Available Kaposi′s varicelliform eruption (KVE or eczema herpeticum is characterized by disseminated papulovesicular eruption caused by a number of viruses like Herpes simplex virus I and II, Coxsackie virus, and Vaccinia and Small pox viruses in patients with pre-existing skin disease. The occurrence of KVE with psoriasis has been reported recently as a new entity psoriasis herpeticum. The rare causation of psoriasis herpeticum due to Varicella zoster virus in a patient with underlying psoriasis is being reported for the first time.

  20. Heterotypic control of basement membrane dynamics during branching morphogenesis. (United States)

    Nelson, Deirdre A; Larsen, Melinda


    Many mammalian organs undergo branching morphogenesis to create highly arborized structures with maximized surface area for specialized organ function. Cooperative cell-cell and cell-matrix adhesions that sculpt the emerging tissue architecture are guided by dynamic basement membranes. Properties of the basement membrane are reciprocally controlled by the interacting epithelial and mesenchymal cell populations. Here we discuss how basement membrane remodeling is required for branching morphogenesis to regulate cell-matrix and cell-cell adhesions that are required for cell patterning during morphogenesis and how basement membrane impacts morphogenesis by stimulation of cell patterning, force generation, and mechanotransduction. We suggest that in addition to creating mature epithelial architecture, remodeling of the epithelial basement membrane during branching morphogenesis is also essential to promote maturation of the stromal mesenchyme to create mature organ structure. Recapitulation of developmental cell-matrix and cell-cell interactions are of critical importance in tissue engineering and regeneration strategies that seek to restore organ function. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Quantitative methods to study epithelial morphogenesis and polarity. (United States)

    Aigouy, B; Collinet, C; Merkel, M; Sagner, A


    Morphogenesis of an epithelial tissue emerges from the behavior of its constituent cells, including changes in shape, rearrangements, and divisions. In many instances the directionality of these cellular events is controlled by the polarized distribution of specific molecular components. In recent years, our understanding of morphogenesis and polarity highly benefited from advances in genetics, microscopy, and image analysis. They now make it possible to measure cellular dynamics and polarity with unprecedented precision for entire tissues throughout their development. Here we review recent approaches to visualize and measure cell polarity and tissue morphogenesis. The chapter is organized like an experiment. We first discuss the choice of cell and polarity reporters and describe the use of mosaics to reveal hidden cell polarities or local morphogenetic events. Then, we outline application-specific advantages and disadvantages of different microscopy techniques and image projection algorithms. Next, we present methods to extract cell outlines to measure cell polarity and detect cellular events underlying morphogenesis. Finally, we bridge scales by presenting approaches to quantify the specific contribution of each cellular event to global tissue deformation. Taken together, we provide an in-depth description of available tools and theoretical concepts to quantitatively study cell polarity and tissue morphogenesis over multiple scales. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Specificity protein 7 is not essential for tooth morphogenesis. (United States)

    Clarke, John C; Bae, Ji-Myung; Adhami, Mitra; Rashid, Harunur; Chen, Haiyan; Napierala, Dobrawa; Gutierrez, Soraya E; Sinha, Krishna; Crombrugghe, Benoit de; Javed, Amjad


    Tooth formation is a multifaceted process involving numerous interactions between oral epithelium and neural crest derived ecto-mesenchyme from morphogenesis to cyto-differentiation. The precise molecular regulator that drives the cyto-differentiation and dynamic cross-talk between the two cell types has yet to be fully understood. Runx2 along with its downstream target Sp7 are essential transcription factors for development of the mineralizing cell types. Global knockout of the Runx2 gene results in an arrest of tooth morphogenesis at the late bud stage. Like Runx2, Sp7-null mutants exhibit peri-natal lethality and are completely devoid of alveolar bone. However, the role of Sp7 in tooth development remains elusive. Here, we report the effects of Sp7 deletion on tooth formation. Surprisingly, tooth morphogenesis progresses normally until the mid bell stage in Sp7-homozygous mutants. Incisors and multi-cusped first and second molars were noted in both littermates. Thus, formation of alveolar bone is not a prerequisite for tooth morphogenesis. Tooth organs of Sp7-null however, were significantly smaller in size when compared to WT. Differentiation of both ameloblasts and odontoblasts was disrupted in Sp7-null mice. Only premature and disorganized ameloblasts and odontoblasts were noted in mutant mice. These data indicate that Sp7 is not required for tooth morphogenesis but is obligatory for the functional maturation of both ameloblasts and odontoblasts.

  3. Peculiarities of the morphogenesis of monocarpic shoot of Betonica officinalis L. (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Svitlana P. Zhurakivska


    Full Text Available The article presents the results of research of the morphogenesis of Betonica officinalis in Precarpathian region. Observations on the plant’s growth are described and consecutive stages of its morphogenesis are reported.

  4. Morphogenesis of mimivirus and its viral factories: an atomic force microscopy study of infected cells. (United States)

    Kuznetsov, Yuri G; Klose, Thomas; Rossmann, Michael; McPherson, Alexander


    Amoebas infected with mimivirus were disrupted at sequential stages of virus production and were visualized by atomic force microscopy. The development of virus factories proceeded over 3 to 4 h postinfection and resulted from the coalescence of 0.5- to 2-μm vesicles, possibly bearing nucleic acid, derived from either the nuclear membrane or the closely associated rough endoplasmic reticulum. Virus factories actively producing virus capsids on their surfaces were imaged, and this allowed the morphogenesis of the capsids to be delineated. The first feature to appear on a virus factory surface when a new capsid is born is the center of a stargate, which is a pentameric protein oligomer. As the arms of the stargate grow from the pentamer, a rough disk the diameter of a capsid thickens around it. This marks the initial emergence of a protein-coated membrane vesicle. The capsid self-assembles on the vesicle. Hillocks capped by different pentameric proteins spontaneously appear on the emerging vesicle at positions that are ultimately occupied by 5-fold icosahedral vertices. A lattice of coat protein nucleates at each of the 5-fold vertices, but not at the stargate, and then spreads outward from the vertices over the surface, merging seamlessly to complete the icosahedral capsid. Filling with DNA and associated proteins occurs by the transfer of nucleic acid from the interior of the virus factory into the nearly completed capsids. The portal, through which the DNA enters, is sealed by a plug of protein having a diameter of about 40 nm. A layer of integument protein that anchors the surface fibers is acquired by the passage of capsids through a membrane enriched in the protein. The coating of surface fibers is similarly acquired when the integument protein-coated capsids pass through a second membrane that has a forest of surface fibers embedded on one side.

  5. Morphogenesis and pattern formation in biological systems experiments and models

    CERN Document Server

    Noji, Sumihare; Ueno, Naoto; Maini, Philip


    A central goal of current biology is to decode the mechanisms that underlie the processes of morphogenesis and pattern formation. Concerned with the analysis of those phenomena, this book covers a broad range of research fields, including developmental biology, molecular biology, plant morphogenesis, ecology, epidemiology, medicine, paleontology, evolutionary biology, mathematical biology, and computational biology. In Morphogenesis and Pattern Formation in Biological Systems: Experiments and Models, experimental and theoretical aspects of biology are integrated for the construction and investigation of models of complex processes. This collection of articles on the latest advances by leading researchers not only brings together work from a wide spectrum of disciplines, but also provides a stepping-stone to the creation of new areas of discovery.

  6. Morphogenesis of simple leaves: regulation of leaf size and shape. (United States)

    Rodriguez, Ramiro E; Debernardi, Juan M; Palatnik, Javier F


    Plants produce new organs throughout their life span. Leaves first initiate as rod-like structures protruding from the shoot apical meristem, while they need to pass through different developmental stages to become the flat organ specialized in photosynthesis. Leaf morphogenesis is an active process regulated by many genes and pathways that can generate organs with a wide variety of sizes and shapes. Important differences in leaf architecture can be seen among different species, but also in single individuals. A key aspect of leaf morphogenesis is the precise control of cell proliferation. Modification or manipulation of this process may lead to leaves with different sizes and shapes, and changes in the organ margins and curvature. Many genes required for leaf development have been identified in Arabidopsis thaliana, and the mechanisms underlying leaf morphogenesis are starting to be unraveled at the molecular level. © 2013 Wiley Periodicals, Inc.

  7. In-vivo analysis of morphogenesis in plants. (United States)

    Stanislas, T; Hamant, O; Traas, J


    Although many molecular regulators of morphogenesis have been identified in plants, it remains largely unknown how the molecular networks influence local cell shape and how cell growth, form, and position are coordinated during tissue and organ formations. So far, analyses of gene function in morphogenesis have mainly focused on the qualitative analysis of phenotypes, often providing limited mechanistic insight into how particular factors act. For this reason, there has been a growing interest in mathematical and computational models to formalize and test hypotheses. These require much more rigorous, quantitative approaches; in parallel, new quantitative and correlative imaging pipelines have been developed to study morphogenesis. Here, we describe a number of such methods, focusing on live imaging. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. A global sensitivity analysis approach for morphogenesis models. (United States)

    Boas, Sonja E M; Navarro Jimenez, Maria I; Merks, Roeland M H; Blom, Joke G


    Morphogenesis is a developmental process in which cells organize into shapes and patterns. Complex, non-linear and multi-factorial models with images as output are commonly used to study morphogenesis. It is difficult to understand the relation between the uncertainty in the input and the output of such 'black-box' models, giving rise to the need for sensitivity analysis tools. In this paper, we introduce a workflow for a global sensitivity analysis approach to study the impact of single parameters and the interactions between them on the output of morphogenesis models. To demonstrate the workflow, we used a published, well-studied model of vascular morphogenesis. The parameters of this cellular Potts model (CPM) represent cell properties and behaviors that drive the mechanisms of angiogenic sprouting. The global sensitivity analysis correctly identified the dominant parameters in the model, consistent with previous studies. Additionally, the analysis provided information on the relative impact of single parameters and of interactions between them. This is very relevant because interactions of parameters impede the experimental verification of the predicted effect of single parameters. The parameter interactions, although of low impact, provided also new insights in the mechanisms of in silico sprouting. Finally, the analysis indicated that the model could be reduced by one parameter. We propose global sensitivity analysis as an alternative approach to study the mechanisms of morphogenesis. Comparison of the ranking of the impact of the model parameters to knowledge derived from experimental data and from manipulation experiments can help to falsify models and to find the operand mechanisms in morphogenesis. The workflow is applicable to all 'black-box' models, including high-throughput in vitro models in which output measures are affected by a set of experimental perturbations.

  9. A global sensitivity analysis approach for morphogenesis models

    KAUST Repository

    Boas, Sonja E. M.


    Background Morphogenesis is a developmental process in which cells organize into shapes and patterns. Complex, non-linear and multi-factorial models with images as output are commonly used to study morphogenesis. It is difficult to understand the relation between the uncertainty in the input and the output of such ‘black-box’ models, giving rise to the need for sensitivity analysis tools. In this paper, we introduce a workflow for a global sensitivity analysis approach to study the impact of single parameters and the interactions between them on the output of morphogenesis models. Results To demonstrate the workflow, we used a published, well-studied model of vascular morphogenesis. The parameters of this cellular Potts model (CPM) represent cell properties and behaviors that drive the mechanisms of angiogenic sprouting. The global sensitivity analysis correctly identified the dominant parameters in the model, consistent with previous studies. Additionally, the analysis provided information on the relative impact of single parameters and of interactions between them. This is very relevant because interactions of parameters impede the experimental verification of the predicted effect of single parameters. The parameter interactions, although of low impact, provided also new insights in the mechanisms of in silico sprouting. Finally, the analysis indicated that the model could be reduced by one parameter. Conclusions We propose global sensitivity analysis as an alternative approach to study the mechanisms of morphogenesis. Comparison of the ranking of the impact of the model parameters to knowledge derived from experimental data and from manipulation experiments can help to falsify models and to find the operand mechanisms in morphogenesis. The workflow is applicable to all ‘black-box’ models, including high-throughput in vitro models in which output measures are affected by a set of experimental perturbations.

  10. Genetics of aplasia cutis reveal novel regulators of skin morphogenesis. (United States)

    Marneros, Alexander G


    The molecular mechanisms that control skin morphogenesis are complex and only incompletely understood. Aplasia cutis manifests with localized skin defects at birth and is a feature in various syndromes. Identifying the genes that cause these genetic skin conditions provides the opportunity to define novel regulators of skin morphogenesis. Recently, human genetic approaches have led to the identification of aplasia cutis-causing mutations in genes that have previously not been implicated to have an important role in skin biology. These findings reveal novel molecular mechanisms that are involved in skin formation during development.

  11. Turing's next steps: the mechanochemical basis of morphogenesis. (United States)

    Howard, Jonathon; Grill, Stephan W; Bois, Justin S


    Nearly 60 years ago, Alan Turing showed theoretically how two chemical species, termed morphogens, diffusing and reacting with each other can generate spatial patterns. Diffusion plays a crucial part in transporting chemical signals through space to establish the length scale of the pattern. When coupled to chemical reactions, mechanical processes - forces and flows generated by motor proteins - can also define length scales and provide a mechanochemical basis for morphogenesis. forces and flows generated by motor proteins - can also define length scales and provide a mechanochemical basis for morphogenesis.

  12. Identity and dynamics of mammary stem cells during branching morphogenesis

    NARCIS (Netherlands)

    Scheele, Colinda L.G.J.; Hannezo, Edouard; Muraro, Mauro J.; Zomer, Anoek; Langedijk, Nathalia S.M.; Van Oudenaarden, Alexander; Simons, Benjamin D; Van Rheenen, Jacco


    During puberty, the mouse mammary gland develops into a highly branched epithelial network. Owing to the absence of exclusive stem cell markers, the location, multiplicity, dynamics and fate of mammary stem cells (MaSCs), which drive branching morphogenesis, are unknown. Here we show that

  13. Epithelial morphogenesis: the mouse eye as a model system. (United States)

    Chauhan, Bharesh; Plageman, Timothy; Lou, Ming; Lang, Richard


    Morphogenesis is the developmental process by which tissues and organs acquire the shape that is critical to their function. Here, we review recent advances in our understanding of the mechanisms that drive morphogenesis in the developing eye. These investigations have shown that regulation of the actin cytoskeleton is central to shaping the presumptive lens and retinal epithelia that are the major components of the eye. Regulation of the actin cytoskeleton is mediated by Rho family GTPases, by signaling pathways and indirectly, by transcription factors that govern the expression of critical genes. Changes in the actin cytoskeleton can shape cells through the generation of filopodia (that, in the eye, connect adjacent epithelia) or through apical constriction, a process that produces a wedge-shaped cell. We have also learned that one tissue can influence the shape of an adjacent one, probably by direct force transmission, in a process we term inductive morphogenesis. Though these mechanisms of morphogenesis have been identified using the eye as a model system, they are likely to apply broadly where epithelia influence the shape of organs during development. © 2015 Elsevier Inc. All rights reserved.

  14. The Arabidopsis embryo as a miniature morphogenesis model

    NARCIS (Netherlands)

    Wendrich, J.R.; Weijers, D.


    Four basic ingredients of morphogenesis, oriented cell division and expansion, cell–cell communication and cell fate specification allow plant cells to develop into a wide variety of organismal architectures. A central question in plant biology is how these cellular processes are regulated and

  15. Acoustic Environments: Applying Evolutionary Algorithms for Sound based Morphogenesis

    DEFF Research Database (Denmark)

    Foged, Isak Worre; Pasold, Anke; Jensen, Mads Brath


    The research investigates the application of evolutionary computation in relation to sound based morphogenesis. It does so by using the Sabine equation for performance benchmark in the development of the spatial volume and refl ectors, effectively creating the architectural expression as a whole...

  16. PTEN regulates lung endodermal morphogenesis through MEK/ERK pathway. (United States)

    Xing, Yiming; Wang, Runming; Li, Changgong; Minoo, Parviz


    Pten is a multifunctional tumor suppressor. Deletions and mutations in the Pten gene have been associated with multiple forms of human cancers. Pten is a central regulator of several signaling pathways that influences multiple cellular functions. One such function is in cell motility and migration, although the precise mechanism remains unknown. In this study, we deleted Pten in the embryonic lung epithelium using Gata5-cre mice. Absence of Pten blocked branching morphogenesis and ERK and AKT phosphorylation at E12.5. In an explant model, Pten(Δ/Δ) mesenchyme-free embryonic lung endoderm failed to branch. Inhibition of budding in Pten(Δ/Δ) explants was associated with major changes in cell migration, while cell proliferation was not affected. We further examined the role of ERK and AKT in branching morphogenesis by conditional, endodermal-specific mutants which blocked ERK or AKT phosphorylation. MEK(DM/+); Gata5-cre (blocking of ERK phosphorylation) lung showed more severe phenotype in branching morphogenesis. The inhibition of budding was also associated with disruption of cell migration. Thus, the mechanisms by which Pten is required for early endodermal morphogenesis may involve ERK, but not AKT, mediated cell migration. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Cuticle morphogenesis in crustacean embryonic and postembryonic stages. (United States)

    Mrak, Polona; Bogataj, Urban; Štrus, Jasna; Žnidaršič, Nada


    The crustacean cuticle is a chitin-based extracellular matrix, produced in general by epidermal cells and ectodermally derived epithelial cells of the digestive tract. Cuticle morphogenesis is an integrative part of embryonic and postembryonic development and it was studied in several groups of crustaceans, but mainly with a focus on one selected aspect of morphogenesis. Early studies were focused mainly on in vivo or histological observations of embryonic or larval molt cycles and more recently, some ultrastructural studies of the cuticle differentiation during development were performed. The aim of this paper is to review data on exoskeletal and gut cuticle formation during embryonic and postembryonic development in crustaceans, obtained in different developmental stages of different species and to bring together and discuss different aspects of cuticle morphogenesis, namely data on the morphology, ultrastructure, composition, connections to muscles and molt cycles in relation to cuticle differentiation. Based on the comparative evaluation of microscopic analyses of cuticle in crustacean embryonic and postembryonic stages, common principles of cuticle morphogenesis during development are discussed. Additional studies are suggested to further clarify this topic and to connect the new knowledge to related fields. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Cellular Potts modeling of complex multicellular behaviors in tissue morphogenesis

    NARCIS (Netherlands)

    T. Hirashima (Tsuyoshi); E.G. Rens (Lisanne); R.M.H. Merks (Roeland)


    textabstractMathematical modeling is an essential approach for the understanding of complex multicellular behaviors in tissue morphogenesis. Here, we review the cellular Potts model (CPM; also known as the Glazier-Graner-Hogeweg model), an effective computational modeling framework. We discuss its

  19. Growth and Morphogenesis during Early Heart Development in Amniotes. (United States)

    Ivanovitch, Kenzo; Esteban, Isaac; Torres, Miguel


    In this review, we will focus on the growth and morphogenesis of the developing heart, an aspect of cardiovascular development to which Antoon Moorman and colleagues have extensively contributed. Over the last decades, genetic studies and characterization of regionally regulated gene programs have provided abundant novel insights into heart development essential to understand the basis of congenital heart disease. Heart morphogenesis, however, is inherently a complex and dynamic three-dimensional process and we are far from understanding its cellular basis. Here, we discuss recent advances in studying heart morphogenesis and regionalization under the light of the pioneering work of Moorman and colleagues, which allowed the reinterpretation of regional gene expression patterns under a new morphogenetic framework. Two aspects of early heart formation will be discussed in particular: (1) the initial formation of the heart tube and (2) the formation of the cardiac chambers by the ballooning process. Finally, we emphasize that in addition to analyses based on fixed samples, new approaches including clonal analysis, single-cell sequencing, live-imaging and quantitative analysis of the data generated will likely lead to novel insights in understanding early heart tube regionalization and morphogenesis in the near future.

  20. Growth and Morphogenesis during Early Heart Development in Amniotes

    Directory of Open Access Journals (Sweden)

    Kenzo Ivanovitch


    Full Text Available In this review, we will focus on the growth and morphogenesis of the developing heart, an aspect of cardiovascular development to which Antoon Moorman and colleagues have extensively contributed. Over the last decades, genetic studies and characterization of regionally regulated gene programs have provided abundant novel insights into heart development essential to understand the basis of congenital heart disease. Heart morphogenesis, however, is inherently a complex and dynamic three-dimensional process and we are far from understanding its cellular basis. Here, we discuss recent advances in studying heart morphogenesis and regionalization under the light of the pioneering work of Moorman and colleagues, which allowed the reinterpretation of regional gene expression patterns under a new morphogenetic framework. Two aspects of early heart formation will be discussed in particular: (1 the initial formation of the heart tube and (2 the formation of the cardiac chambers by the ballooning process. Finally, we emphasize that in addition to analyses based on fixed samples, new approaches including clonal analysis, single-cell sequencing, live-imaging and quantitative analysis of the data generated will likely lead to novel insights in understanding early heart tube regionalization and morphogenesis in the near future.

  1. Twist1 Is Essential for Tooth Morphogenesis and Odontoblast Differentiation

    National Research Council Canada - National Science Library

    Meng, Tian; Huang, Yanyu; Wang, Suzhen; Zhang, Hua; Dechow, Paul C; Wang, Xiaofang; Qin, Chunlin; Shi, Bing; D'Souza, Rena N; Lu, Yongbo


    ...)) by breeding Twist1 floxed mice (Twist1(fl/fl)) with Twist2-Cre recombinase knockin mice (Twist2(Cre) (/+)). The Twist2(Cre) (/+);Twist1(fl/fl) embryos formed smaller tooth germs and abnormal cusps during early tooth morphogenesis...

  2. Modelling Morphogenesis: From Single Cells to Crawling Slugs

    NARCIS (Netherlands)

    Savill, N.J.; Hogeweg, P.


    We present a three-dimensional hybrid cellular automata (CA)/partial differential equation (PDE) model that allows for the study of morphogenesis in simple cellular systems. We apply the model to the cellular slime mold Dictyostelium discoideum "from single cells to crawling slug". Using simple

  3. Can morphogenesis be understood in terms of physical rules?

    Indian Academy of Sciences (India)


    Mar 17, 2005 ... Home; Journals; Journal of Biosciences; Volume 30; Issue 1. Can morphogenesis be ... The present author has recently made computer simulations with his colleagues to construct branching systems of human organs, such as the lung airway and the liver blood vessels. In the simulations certain rules are ...

  4. Fibronectin Deposition Participates in Extracellular Matrix Assembly and Vascular Morphogenesis (United States)

    Hielscher, Abigail; Ellis, Kim; Qiu, Connie; Porterfield, Josh; Gerecht, Sharon


    The extracellular matrix (ECM) has been demonstrated to facilitate angiogenesis. In particular, fibronectin has been documented to activate endothelial cells, resulting in their transition from a quiescent state to an active state in which the cells exhibit enhanced migration and proliferation. The goal of this study is to examine the role of polymerized fibronectin during vascular tubulogenesis using a 3 dimensional (3D) cell-derived de-cellularized matrix. A fibronectin-rich 3D de-cellularized ECM was used as a scaffold to study vascular morphogenesis of endothelial cells (ECs). Confocal analyses of several matrix proteins reveal high intra- and extra-cellular deposition of fibronectin in formed vascular structures. Using a small peptide inhibitor of fibronectin polymerization, we demonstrate that inhibition of fibronectin fibrillogenesis in ECs cultured atop de-cellularized ECM resulted in decreased vascular morphogenesis. Further, immunofluorescence and ultrastructural analyses reveal decreased expression of stromal matrix proteins in the absence of polymerized fibronectin with high co-localization of matrix proteins found in association with polymerized fibronectin. Evaluating vascular kinetics, live cell imaging showed that migration, migration velocity, and mean square displacement, are disrupted in structures grown in the absence of polymerized fibronectin. Additionally, vascular organization failed to occur in the absence of a polymerized fibronectin matrix. Consistent with these observations, we tested vascular morphogenesis following the disruption of EC adhesion to polymerized fibronectin, demonstrating that block of integrins α5β1 and αvβ3, abrogated vascular morphogenesis. Overall, fibronectin deposition in a 3D cell-derived de-cellularized ECM appears to be imperative for matrix assembly and vascular morphogenesis. PMID:26811931

  5. Nucleotide sequence of the 4.3 kbp BamHI-N fragment of fowlpox virus FP9. (United States)

    Pollitt, E; Skinner, M A; Heaphy, S


    Nucleotide sequence analysis of the 4.3 kbp BamHI-N fragment of the fowlpox virus (FPV) genome revealed that it encodes 7 proteins with homology to vaccinia virus (VV) E11L, E10R, O1L, O3L, I1L, I2L and I3L encoded proteins. No evidence of FPV homolog of VV O2L could be found.

  6. Sequences within the VP6 molecule of bluetongue virus that determine cytoplasmic and nuclear targeting of the protein.


    Yi, C K; Bansal, O B; Hong, M L; Chatterjee, S.; Roy, P


    Genome segment 9 of bluetongue virus serotype 10 encodes the minor protein VP6. The protein is abundant with basic residues particularly in two regions of the carboxy half of the molecule. A series of amino- and carboxy-terminal deletion mutants was expressed in mammalian cells by using a vaccinia virus T7 polymerase-driven transient expression system, and the intracellular fate of the products was monitored by both immunofluorescence staining and cell fractionation techniques. Data obtained ...

  7. The genome of Shope fibroma virus, a tumorigenic poxvirus, contains a growth factor gene with sequence similarity to those encoding epidermal growth factor and transforming growth factor alpha.


    Chang, W; Upton, C.; Hu, S.L.; Purchio, A F; McFadden, G.


    Degenerate oligonucleotide probes corresponding to a highly conserved region common to epidermal growth factor, transforming growth factor alpha, and vaccinia growth factor were used to identify a novel growth factor gene in the Shope fibroma virus genome. Sequence analysis indicates that the Shope fibroma growth factor is a distinct new member of this family of growth factors.

  8. Reverse Genetics Plasmid for Cloning Unstable Influenza A Virus Gene Segments


    Zhou, Bin; Jerzak, Greta; Scholes, Derek T.; Donnelly, Matthew E.; Li, Yan; Wentworth, David E.


    Reverse genetics approaches that enable the generation of recombinant influenza A viruses entirely from plasmids are invaluable for studies on virus replication, morphogenesis, pathogenesis, or transmission. Furthermore, influenza virus reverse genetics is now critical for the development of new vaccines for this human and animal pathogen. Periodically, influenza gene segments are unstable within plasmids in bacteria. The PB2 gene segment of a highly pathogenic avian H5 influenza virus A/Turk...

  9. Vaccinia protein F12 has structural similarity to kinesin light chain and contains a motor binding motif required for virion export. (United States)

    Morgan, Gareth W; Hollinshead, Michael; Ferguson, Brian J; Murphy, Brendan J; Carpentier, David C J; Smith, Geoffrey L


    Vaccinia virus (VACV) uses microtubules for export of virions to the cell surface and this process requires the viral protein F12. Here we show that F12 has structural similarity to kinesin light chain (KLC), a subunit of the kinesin-1 motor that binds cargo. F12 and KLC share similar size, pI, hydropathy and cargo-binding tetratricopeptide repeats (TPRs). Moreover, molecular modeling of F12 TPRs upon the crystal structure of KLC2 TPRs showed a striking conservation of structure. We also identified multiple TPRs in VACV proteins E2 and A36. Data presented demonstrate that F12 is critical for recruitment of kinesin-1 to virions and that a conserved tryptophan and aspartic acid (WD) motif, which is conserved in the kinesin-1-binding sequence (KBS) of the neuronal protein calsyntenin/alcadein and several other cellular kinesin-1 binding proteins, is essential for kinesin-1 recruitment and virion transport. In contrast, mutation of WD motifs in protein A36 revealed they were not required for kinesin-1 recruitment or IEV transport. This report of a viral KLC-like protein containing a KBS that is conserved in several cellular proteins advances our understanding of how VACV recruits the kinesin motor to virions, and exemplifies how viruses use molecular mimicry of cellular components to their advantage.

  10. Vaccinia protein F12 has structural similarity to kinesin light chain and contains a motor binding motif required for virion export.

    Directory of Open Access Journals (Sweden)

    Gareth W Morgan


    Full Text Available Vaccinia virus (VACV uses microtubules for export of virions to the cell surface and this process requires the viral protein F12. Here we show that F12 has structural similarity to kinesin light chain (KLC, a subunit of the kinesin-1 motor that binds cargo. F12 and KLC share similar size, pI, hydropathy and cargo-binding tetratricopeptide repeats (TPRs. Moreover, molecular modeling of F12 TPRs upon the crystal structure of KLC2 TPRs showed a striking conservation of structure. We also identified multiple TPRs in VACV proteins E2 and A36. Data presented demonstrate that F12 is critical for recruitment of kinesin-1 to virions and that a conserved tryptophan and aspartic acid (WD motif, which is conserved in the kinesin-1-binding sequence (KBS of the neuronal protein calsyntenin/alcadein and several other cellular kinesin-1 binding proteins, is essential for kinesin-1 recruitment and virion transport. In contrast, mutation of WD motifs in protein A36 revealed they were not required for kinesin-1 recruitment or IEV transport. This report of a viral KLC-like protein containing a KBS that is conserved in several cellular proteins advances our understanding of how VACV recruits the kinesin motor to virions, and exemplifies how viruses use molecular mimicry of cellular components to their advantage.

  11. Targeting the Vaccinia Virus L1 Protein to the Cell Surface Enhances Production of Neutralizing Antibodies (United States)


    weight on day 2 and by day 7, all mice died. Mice vaccinated with unmodified L1R also began to lose weight on day 2 and all mice succumbed to infection...Connaught) by tail scar- ificationwere also challenged.Weights weremonitored for 14 days postinfection. As shown in Fig. 5, unvaccinated mice began to lose

  12. Smallpox vaccination and bioterrorism with pox viruses. (United States)

    Mayr, Anton


    Bioterrorist attacks occupy a special place amongst the innumerable potential types of terrorist attack, with the intentional release of pox viruses being especially feared in this connection. Apart from the variola virus, the agent responsible for smallpox in humans, the monkeypox virus and numerous other animal pox viruses pose potential risks for humans and animals. This risk scenario also includes recombinations between the various pox viruses, changes in hosts and genetically engineered manipulations of pox viruses. For over 200 years, the method of choice for combatting smallpox was via vaccination with a reproductive, original vaccinia virus. Worldwide eradication of smallpox at the end of the 1970s and the discontinuation of routine smallpox vaccination in 1980 can be credited to such vaccination. Unfortunately, these vaccinations were associated with a large number of postvaccinal impairments, sometimes resulting in death (e.g. postvaccinal encephalitis). The only way to restrict such postvaccinal complications was to carry out initial vaccination within the first 2 postnatal years. Initial vaccination at a later age led to such a sharp increase in the number of vaccines with complications that vaccination had to be discouraged. The dilemma of the smallpox vaccine stocks stems from the fact that a large portion of these stocks are produced with the same vaccinia strains as before. This is irresponsible, especially as the percentage of immune-suppressed persons in the population, for whom vaccination-related complications pose an especial threat, is increasing. One solution to the dilemma of the smallpox vaccine stocks is the MVA strain. It is harmless, protects humans and animals equally well against smallpox and can be applied parenterally.

  13. Cadherin Trafficking for Tissue Morphogenesis: Control and Consequences. (United States)

    West, Junior J; Harris, Tony J C


    Cadherin-based adherens junctions are critical for connecting cells in tissues. Regulated cadherin trafficking also makes these complexes amazingly dynamic, with permissive and instructive consequences on multicellular development. Here, we review how cadherin trafficking affects various forms of tissue morphogenesis from Drosophila and Caenorhabditis elegans to zebrafish, Xenopus and mouse. We describe how core trafficking machinery (such as clathrin, dynamin, Rab small G proteins and the exocyst complex) integrates with other molecular systems (transcriptional factors, signaling pathways, microtubules, actin networks, apico-basal polarity proteins and planar cell polarity proteins) to control cadherin endocytosis, exocytosis and recycling. This control can occur at all cell-cell contacts or specific junctions for distinct effects on tissue morphogenesis during animal development. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. The evolution of fungal morphogenesis, a personal account. (United States)

    Bartnicki-Garcia, Salomon


    This article describes the evolution of the field of fungal morphogenesis, its beginning at the end of the 19th century and its exponential growth during the second half of the 20th century, continuing until the present day. The main theme correlates biological progress with the advent of new technologies. Accordingly the article describes the discovery of apical growth, the fibrillar nature of the fungal wall, the chemistry of the cell wall, the search for biochemical pathways in morphogenesis, the discovery of the Spitzenkörper, the apical gradient of wall synthesis, key highlights in ultrastructural research, the development of mathematical models particularly the vesicle supply center (VSC) model, the revolution brought about by molecular biology and unique discoveries such as the hydrophobins and γ-tubulin and some the latest triumphs of the marriage between molecular genetics and confocal microscopy. Credit is given to the investigators responsible for all the advances. © 2016 by The Mycological Society of America.

  15. EphB/syndecan-2 signaling in dendritic spine morphogenesis

    DEFF Research Database (Denmark)

    Ethell, I M; Irie, F; Kalo, M S


    We previously reported that the cell surface proteoglycan syndecan-2 can induce dendritic spine formation in hippocampal neurons. We demonstrate here that the EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine...... formation. Syndecan-2 is tyrosine phosphorylated and forms a complex with EphB2 in mouse brain. Dominant-negative inhibition of endogenous EphB receptor activities blocks clustering of endogenous syndecan-2 and normal spine formation in cultured hippocampal neurons. This is the first evidence that Eph...... receptors play a physiological role in dendritic spine morphogenesis. Our observations suggest that spine morphogenesis is triggered by the activation of Eph receptors, which causes tyrosine phosphorylation of target molecules, such as syndecan-2, in presumptive spines....

  16. Role of GSK3 signaling in neuronal morphogenesis

    Directory of Open Access Journals (Sweden)

    Yun Tai eKim


    Full Text Available Glycogen synthase kinase 3 (GSK3 is emerging as a key regulator of several aspects of neuronal morphogenesis including neuronal polarization, axon growth and axon branching. Multiple signaling pathways have been identified that control neuronal polarization, including PI3K, Rho-GTPases, Par3/6, TSC-mTOR, and PKA-LKB1. However, how these pathways are coordinated is not clear. As GSK3 signaling exhibits crosstalk with each of these pathways it has the potential to integrate these polarity signals in the control neuronal polarization. After neurons establish polarity, GSK3 acts as an important signaling mediator in the regulation of axon extension and axon branching by transducing upstream signaling to reorganizion of the axonal cytoskeleton, especially microtubules. Here we review the roles of GSK3 signaling in neuronal morphogenesis and discuss the underlying molecular mechanisms.

  17. Polarized protein transport and lumen formation during epithelial tissue morphogenesis. (United States)

    Blasky, Alex J; Mangan, Anthony; Prekeris, Rytis


    One of the major challenges in biology is to explain how complex tissues and organs arise from the collective action of individual polarized cells. The best-studied model of this process is the cross talk between individual epithelial cells during their polarization to form the multicellular epithelial lumen during tissue morphogenesis. Multiple mechanisms of apical lumen formation have been proposed. Some epithelial lumens form from preexisting polarized epithelial structures. However, de novo lumen formation from nonpolarized cells has recently emerged as an important driver of epithelial tissue morphogenesis, especially during the formation of small epithelial tubule networks. In this review, we discuss the latest findings regarding the mechanisms and regulation of de novo lumen formation in vitro and in vivo.

  18. Salivary Gland Branching Morphogenesis — Recent Progress and Future Opportunities


    Hsu, Jeff Chi-feng; Yamada, Kenneth M.


    Salivary glands provide saliva to maintain oral health, and a loss of salivary gland function substantially decreases quality-of-life. Understanding the biological mechanisms that generate salivary glands during embryonic development may identify novel ways to regenerate function or design artificial salivary glands. This review article summarizes current research on the process of branching morphogenesis of salivary glands, which creates gland structure during development. We highlight excit...

  19. A case for biotic morphogenesis of coniform stromatolites


    Batchelor, M. T.; Burne, R.V.; Henry, B. I.; Jackson, M J


    Mathematical models have recently been used to cast doubt on the biotic origin of stromatolites. Here by contrast we propose a biotic model for stromatolite morphogenesis which considers the relationship between upward growth of a phototropic or phototactic biofilm ($v$) and mineral accretion normal to the surface ($\\lambda$). These processes are sufficient to account for the growth and form of many ancient stromatolities. Domical stromatolites form when $v$ is less than or comparable to $\\la...

  20. Prediction of steps in the evolution of variola virus host range.

    Directory of Open Access Journals (Sweden)

    Chad Smithson

    Full Text Available Variola virus, the agent of smallpox, has a severely restricted host range (humans but a devastatingly high mortality rate. Although smallpox has been eradicated by a World Health Organization vaccination program, knowledge of the evolutionary processes by which human super-pathogens such as variola virus arise is important. By analyzing the evolution of variola and other closely related poxviruses at the level of single nucleotide polymorphisms we detected a hotspot of genome variation within the smallpox ortholog of the vaccinia virus O1L gene, which is known to be necessary for efficient replication of vaccinia virus in human cells. These mutations in the variola virus ortholog and the subsequent loss of the functional gene from camelpox virus and taterapox virus, the two closest relatives of variola virus, strongly suggest that changes within this region of the genome may have played a key role in the switch to humans as a host for the ancestral virus and the subsequent host-range restriction that must have occurred to create the phenotype exhibited by smallpox.

  1. Inhibition of enveloped viruses infectivity by curcumin.

    Directory of Open Access Journals (Sweden)

    Tzu-Yen Chen

    Full Text Available Curcumin, a natural compound and ingredient in curry, has antiinflammatory, antioxidant, and anticarcinogenic properties. Previously, we reported that curcumin abrogated influenza virus infectivity by inhibiting hemagglutination (HA activity. This study demonstrates a novel mechanism by which curcumin inhibits the infectivity of enveloped viruses. In all analyzed enveloped viruses, including the influenza virus, curcumin inhibited plaque formation. In contrast, the nonenveloped enterovirus 71 remained unaffected by curcumin treatment. We evaluated the effects of curcumin on the membrane structure using fluorescent dye (sulforhodamine B; SRB-containing liposomes that mimic the viral envelope. Curcumin treatment induced the leakage of SRB from these liposomes and the addition of the influenza virus reduced the leakage, indicating that curcumin disrupts the integrity of the membranes of viral envelopes and of liposomes. When testing liposomes of various diameters, we detected higher levels of SRB leakage from the smaller-sized liposomes than from the larger liposomes. Interestingly, the curcumin concentration required to reduce plaque formation was lower for the influenza virus (approximately 100 nm in diameter than for the pseudorabies virus (approximately 180 nm and the vaccinia virus (roughly 335 × 200 × 200 nm. These data provide insights on the molecular antiviral mechanisms of curcumin and its potential use as an antiviral agent for enveloped viruses.

  2. Testing Turing's Theory of Morphogenesis in Chemical Cells (United States)

    Tompkins, Nathan; Li, Ning; Girabawe, Camille; Heymann, Michael; Ermentrout, G. Bard; Epstein, Irving; Fraden, Seth


    Alan Turing's 1952 paper ``The Chemical Basis of Morphogenesis'' described how reaction-diffusion dynamics could create six spatiotemporal patterns including a stationary pattern that could lead to physical morphogenesis (which now bears his name). This stationary ``Turing pattern'' has been observed in continuous media of various chemical systems but never in diffusively coupled discrete reactors as Turing theorized. We have created a system of microfluidically produced chemical compartments containing the Belousov-Zhabotinsky reaction that are designed to fulfill the assumptions of Turing's theoretical system. This system demonstrates all six spatiotemporal patterns that Turing predicted. In particular, we observe the stationary case that bears Turing's name where the cells create a pattern of oxidized and reduced states. As Turing predicted, this chemical heterogeneity gives rise to physical heterogeneity by driving an osmotic flow, swelling the reduced cells and shrinking the oxidized cells. In addition to the six patterns and physical morphogenesis predicted by Turing we observe a seventh pattern of mixed stationary/oscillatory states that is not predicted by Turing. This seventh pattern requires modifying Turing's theory to include slight heterogeneity to match experiments.

  3. A bidirectional interface growth model for cranial interosseous suture morphogenesis (United States)

    Zollikofer, Christoph P E; Weissmann, John David


    Interosseous sutures exhibit highly variable patterns of interdigitation and corrugation. Recent research has identified fundamental molecular mechanisms of suture formation, and computer models have been used to simulate suture morphogenesis. However, the role of bone strain in the development of complex sutures is largely unknown, and measuring suture morphologies beyond the evaluation of fractal dimensions remains a challenge. Here we propose a morphogenetic model of suture formation, which is based on the paradigm of Laplacian interface growth. Computer simulations of suture morphogenesis under various boundary conditions generate a wide variety of synthetic sutural forms. Their morphologies are quantified with a combination of Fourier analysis and principal components analysis, and compared with natural morphological variation in an ontogenetic sample of human interparietal suture lines. Morphometric analyses indicate that natural sutural shapes exhibit a complex distribution in morphospace. The distribution of synthetic sutures closely matches the natural distribution. In both natural and synthetic systems, sutural complexity increases during morphogenesis. Exploration of the parameter space of the simulation system indicates that variation in strain and/or morphogen sensitivity and viscosity of sutural tissue may be key factors in generating the large variability of natural suture complexity. PMID:21539540

  4. Identity and dynamics of mammary stem cells during branching morphogenesis. (United States)

    Scheele, Colinda L G J; Hannezo, Edouard; Muraro, Mauro J; Zomer, Anoek; Langedijk, Nathalia S M; van Oudenaarden, Alexander; Simons, Benjamin D; van Rheenen, Jacco


    During puberty, the mouse mammary gland develops into a highly branched epithelial network. Owing to the absence of exclusive stem cell markers, the location, multiplicity, dynamics and fate of mammary stem cells (MaSCs), which drive branching morphogenesis, are unknown. Here we show that morphogenesis is driven by proliferative terminal end buds that terminate or bifurcate with near equal probability, in a stochastic and time-invariant manner, leading to a heterogeneous epithelial network. We show that the majority of terminal end bud cells function as highly proliferative, lineage-committed MaSCs that are heterogeneous in their expression profile and short-term contribution to ductal extension. Yet, through cell rearrangements during terminal end bud bifurcation, each MaSC is able to contribute actively to long-term growth. Our study shows that the behaviour of MaSCs is not directly linked to a single expression profile. Instead, morphogenesis relies upon lineage-restricted heterogeneous MaSC populations that function as single equipotent pools in the long term.

  5. Nodal and FGF coordinate ascidian neural tube morphogenesis. (United States)

    Navarrete, Ignacio A; Levine, Michael


    Formation of the vertebrate neural tube represents one of the premier examples of morphogenesis in animal development. Here, we investigate this process in the simple chordate Ciona intestinalis Previous studies have implicated Nodal and FGF signals in the specification of lateral and ventral neural progenitors. We show that these signals also control the detailed cellular behaviors underlying morphogenesis of the neural tube. Live-imaging experiments show that FGF controls the intercalary movements of ventral neural progenitors, whereas Nodal is essential for the characteristic stacking behavior of lateral cells. Ectopic activation of FGF signaling is sufficient to induce intercalary behaviors in cells that have not received Nodal. In the absence of FGF and Nodal, neural progenitors exhibit a default behavior of sequential cell divisions, and fail to undergo the intercalary and stacking behaviors essential for normal morphogenesis. Thus, cell specification events occurring prior to completion of gastrulation coordinate the morphogenetic movements underlying the organization of the neural tube. © 2016. Published by The Company of Biologists Ltd.

  6. Ultrasound patterning technologies for studying vascular morphogenesis in 3D. (United States)

    Comeau, Eric S; Hocking, Denise C; Dalecki, Diane


    Investigations in this report demonstrate the versatility of ultrasound-based patterning and imaging technologies for studying determinants of vascular morphogenesis in 3D environments. Forces associated with ultrasound standing wave fields (USWFs) were employed to non-invasively and volumetrically pattern endothelial cells within 3D collagen hydrogels. Patterned hydrogels were composed of parallel bands of endothelial cells located at nodal regions of the USWF and spaced at intervals equal to one half wavelength of the incident sound field. Acoustic parameters were adjusted to vary the spatial dimensions of the endothelial bands, and effects on microvessel morphogenesis were analyzed. High-frequency ultrasound imaging techniques were used to image and quantify the spacing, width and density of initial planar cell bands. Analysis of resultant microvessel networks showed that vessel width, orientation, density and branching activity were strongly influenced by the initial 3D organization of planar bands and, hence, could be controlled by acoustic parameters used for patterning. In summary, integration of USWF-patterning and high-frequency ultrasound imaging tools enabled fabrication of vascular constructs with defined microvessel size and orientation, providing insight into how spatial cues in 3D influence vascular morphogenesis. © 2017. Published by The Company of Biologists Ltd.

  7. Serotonin is required for pharyngeal arch morphogenesis in zebrafish

    Directory of Open Access Journals (Sweden)

    Saleh Bashammakh


    Full Text Available Serotonin (5-HT is not only a neurotransmitter but also a mediator of developmental processes in vertebrates. In this study, we analyzed the importance of 5-HT during zebrafish development. The expression patterns of three zebrafish tryptophan hydroxylase isoforms (Tph1A, Tph1B, Tph2, the rate-limiting enzymes in 5-HT synthesis, were analyzed and compared to the appearance and distribution of 5-HT. 5-HT was found in the raphe nuclei correlating with tph2 expression and in the pineal gland correlating with tph1a and tph2 expressions. Tph2-deficient fish generated with antisense morpholino oligonucleotides exhibited morphogenesis defects during pharyngeal arch development. The correct specification of neural crest (NC cells was not affected in tph2 morphants as shown by the expression of early markers, but the survival and differentiation of pharyngeal arch progenitor cells were impaired. An organizing role of 5-HT in pharyngeal arch morphogenesis was suggested by a highly regular pattern of 5-HT positive cells in this tissue. Moreover, the 5-HT2B receptor was expressed in the pharyngeal arches and its pharmacological inhibition also induced defects in pharyngeal arch morphogenesis. These results support an important role of Tph2-derived serotonin as a morphogenetic factor in the development of NC-derived tissues.

  8. A pandemic influenza H1N1 live vaccine based on modified vaccinia Ankara is highly immunogenic and protects mice in active and passive immunizations.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: The development of novel influenza vaccines inducing a broad immune response is an important objective. The aim of this study was to evaluate live vaccines which induce both strong humoral and cell-mediated immune responses against the novel human pandemic H1N1 influenza virus, and to show protection in a lethal animal challenge model. METHODOLOGY/PRINCIPAL FINDINGS: For this purpose, the hemagglutinin (HA and neuraminidase (NA genes of the influenza A/California/07/2009 (H1N1 strain (CA/07 were inserted into the replication-deficient modified vaccinia Ankara (MVA virus--a safe poxviral live vector--resulting in MVA-H1-Ca and MVA-N1-Ca vectors. These live vaccines, together with an inactivated whole virus vaccine, were assessed in a lung infection model using immune competent Balb/c mice, and in a lethal challenge model using severe combined immunodeficient (SCID mice after passive serum transfer from immunized mice. Balb/c mice vaccinated with the MVA-H1-Ca virus or the inactivated vaccine were fully protected from lung infection after challenge with the influenza H1N1 wild-type strain, while the neuraminidase virus MVA-N1-Ca induced only partial protection. The live vaccines were already protective after a single dose and induced substantial amounts of neutralizing antibodies and of interferon-gamma-secreting (IFN-gamma CD4- and CD8 T-cells in lungs and spleens. In the lungs, a rapid increase of HA-specific CD4- and CD8 T cells was observed in vaccinated mice shortly after challenge with influenza swine flu virus, which probably contributes to the strong inhibition of pulmonary viral replication observed. In addition, passive transfer of antisera raised in MVA-H1-Ca vaccinated immune-competent mice protected SCID mice from lethal challenge with the CA/07 wild-type virus. CONCLUSIONS/SIGNIFICANCE: The non-replicating MVA-based H1N1 live vaccines induce a broad protective immune response and are promising vaccine candidates for

  9. Btbd7 is essential for region-specific epithelial cell dynamics and branching morphogenesis in vivo

    DEFF Research Database (Denmark)

    Daley, William P; Matsumoto, Kazue; Doyle, Andrew D


    Branching morphogenesis of developing organs requires coordinated but poorly understood changes in epithelial cell-cell adhesion and cell motility. We report that Btbd7 is a crucial regulator of branching morphogenesis in vivo. Btbd7 levels are elevated in peripheral cells of branching epithelial...... end buds, where it enhances cell motility and cell-cell adhesion dynamics. Genetic ablation of Btbd7 in mice disrupts branching morphogenesis of salivary gland, lung, and kidney. Btbd7 knockout results in more tightly packed outer bud cells, which display stronger E-cadherin localization, reduced cell...... dynamics of cell adhesion and motility during epithelial branching morphogenesis....

  10. Enhanced and sustained CD8+ T cell responses with an adenoviral vector-based hepatitis C virus vaccine encoding NS3 linked to the MHC class II chaperone protein invariant chain

    DEFF Research Database (Denmark)

    Mikkelsen, Marianne; Holst, Peter Johannes; Bukh, Jens


    memory. Functionally, the AdIiNS3-vaccinated mice had a significantly increased cytotoxic capacity compared with the AdNS3 group. The AdIiNS3-induced CD8(+) T cells protected mice from infection with recombinant vaccinia virus expressing HCV NS3 of heterologous 1b strains, and studies in knockout mice...

  11. Myxoma Virus Induces Type I Interferon Production in Murine Plasmacytoid Dendritic Cells via a TLR9/MyD88-, IRF5/IRF7-, and IFNAR-Dependent Pathway▿ (United States)

    Dai, Peihong; Cao, Hua; Merghoub, Taha; Avogadri, Francesca; Wang, Weiyi; Parikh, Tanvi; Fang, Chee-Mun; Pitha, Paula M.; Fitzgerald, Katherine A.; Rahman, Masmudur M.; McFadden, Grant; Hu, Xiaoyu; Houghton, Alan N.; Shuman, Stewart; Deng, Liang


    Poxviruses are large DNA viruses that replicate in the cytoplasm of infected cells. Myxoma virus is a rabbit poxvirus that belongs to the Leporipoxvirus genus. It causes a lethal disease called myxomatosis in European rabbits but cannot sustain any detectable infection in nonlagomorphs. Vaccinia virus is a prototypal orthopoxvirus that was used as a vaccine to eradicate smallpox. Myxoma virus is nonpathogenic in mice, whereas systemic infection with vaccinia virus can be lethal even in immunocompetent mice. Plasmacytoid dendritic cells (pDCs) are potent type I interferon (IFN)-producing cells that play important roles in antiviral innate immunity. How poxviruses are sensed by pDCs to induce type I IFN production is not well understood. Here we report that infection of primary murine pDCs with myxoma virus, but not with vaccinia virus, induces IFN-α, IFN-β, tumor necrosis factor (TNF), and interleukin-12p70 (IL-12p70) production. Using pDCs derived from genetic knockout mice, we show that the myxoma virus-induced innate immune response requires the endosomal DNA sensor TLR9 and its adaptor MyD88, transcription factors IRF5 and IRF7, and the type I IFN positive-feedback loop mediated by IFNAR1. It is independent of the cytoplasmic RNA sensing pathway mediated by the mitochondrial adaptor molecule MAVS, the TLR3 adaptor TRIF, or the transcription factor IRF3. Using pharmacological inhibitors, we demonstrate that myxoma virus-induced type I IFN and IL-12p70 production in murine pDCs is also dependent on phosphatidylinositol 3-kinase (PI3K) and Akt. Furthermore, our results reveal that the N-terminal Z-DNA/RNA binding domain of vaccinia virulence factor E3, which is missing in the orthologous M029 protein expressed by myxoma virus, plays an inhibitory role in poxvirus sensing and innate cytokine production by murine pDCs. PMID:21835795

  12. Myxoma virus induces type I interferon production in murine plasmacytoid dendritic cells via a TLR9/MyD88-, IRF5/IRF7-, and IFNAR-dependent pathway. (United States)

    Dai, Peihong; Cao, Hua; Merghoub, Taha; Avogadri, Francesca; Wang, Weiyi; Parikh, Tanvi; Fang, Chee-Mun; Pitha, Paula M; Fitzgerald, Katherine A; Rahman, Masmudur M; McFadden, Grant; Hu, Xiaoyu; Houghton, Alan N; Shuman, Stewart; Deng, Liang


    Poxviruses are large DNA viruses that replicate in the cytoplasm of infected cells. Myxoma virus is a rabbit poxvirus that belongs to the Leporipoxvirus genus. It causes a lethal disease called myxomatosis in European rabbits but cannot sustain any detectable infection in nonlagomorphs. Vaccinia virus is a prototypal orthopoxvirus that was used as a vaccine to eradicate smallpox. Myxoma virus is nonpathogenic in mice, whereas systemic infection with vaccinia virus can be lethal even in immunocompetent mice. Plasmacytoid dendritic cells (pDCs) are potent type I interferon (IFN)-producing cells that play important roles in antiviral innate immunity. How poxviruses are sensed by pDCs to induce type I IFN production is not well understood. Here we report that infection of primary murine pDCs with myxoma virus, but not with vaccinia virus, induces IFN-α, IFN-β, tumor necrosis factor (TNF), and interleukin-12p70 (IL-12p70) production. Using pDCs derived from genetic knockout mice, we show that the myxoma virus-induced innate immune response requires the endosomal DNA sensor TLR9 and its adaptor MyD88, transcription factors IRF5 and IRF7, and the type I IFN positive-feedback loop mediated by IFNAR1. It is independent of the cytoplasmic RNA sensing pathway mediated by the mitochondrial adaptor molecule MAVS, the TLR3 adaptor TRIF, or the transcription factor IRF3. Using pharmacological inhibitors, we demonstrate that myxoma virus-induced type I IFN and IL-12p70 production in murine pDCs is also dependent on phosphatidylinositol 3-kinase (PI3K) and Akt. Furthermore, our results reveal that the N-terminal Z-DNA/RNA binding domain of vaccinia virulence factor E3, which is missing in the orthologous M029 protein expressed by myxoma virus, plays an inhibitory role in poxvirus sensing and innate cytokine production by murine pDCs.

  13. Genome-wide comparison of cowpox viruses reveals a new clade related to Variola virus.

    Directory of Open Access Journals (Sweden)

    Piotr Wojtek Dabrowski

    Full Text Available Zoonotic infections caused by several orthopoxviruses (OPV like monkeypox virus or vaccinia virus have a significant impact on human health. In Europe, the number of diagnosed infections with cowpox viruses (CPXV is increasing in animals as well as in humans. CPXV used to be enzootic in cattle; however, such infections were not being diagnosed over the last decades. Instead, individual cases of cowpox are being found in cats or exotic zoo animals that transmit the infection to humans. Both animals and humans reveal local exanthema on arms and legs or on the face. Although cowpox is generally regarded as a self-limiting disease, immunosuppressed patients can develop a lethal systemic disease resembling smallpox. To date, only limited information on the complex and, compared to other OPV, sparsely conserved CPXV genomes is available. Since CPXV displays the widest host range of all OPV known, it seems important to comprehend the genetic repertoire of CPXV which in turn may help elucidate specific mechanisms of CPXV pathogenesis and origin. Therefore, 22 genomes of independent CPXV strains from clinical cases, involving ten humans, four rats, two cats, two jaguarundis, one beaver, one elephant, one marah and one mongoose, were sequenced by using massive parallel pyrosequencing. The extensive phylogenetic analysis showed that the CPXV strains sequenced clearly cluster into several distinct clades, some of which are closely related to Vaccinia viruses while others represent different clades in a CPXV cluster. Particularly one CPXV clade is more closely related to Camelpox virus, Taterapox virus and Variola virus than to any other known OPV. These results support and extend recent data from other groups who postulate that CPXV does not form a monophyletic clade and should be divided into multiple lineages.

  14. Induction of cell-cell fusion by ectromelia virus is not inhibited by its fusion inhibitory complex

    Directory of Open Access Journals (Sweden)

    Fuchs Pinhas


    Full Text Available Abstract Background Ectromelia virus, a member of the Orthopox genus, is the causative agent of the highly infectious mousepox disease. Previous studies have shown that different poxviruses induce cell-cell fusion which is manifested by the formation of multinucleated-giant cells (polykaryocytes. This phenomenon has been widely studied with vaccinia virus in conditions which require artificial acidification of the medium. Results We show that Ectromelia virus induces cell-cell fusion under neutral pH conditions and requires the presence of a sufficient amount of viral particles on the plasma membrane of infected cells. This could be achieved by infection with a replicating virus and its propagation in infected cells (fusion "from within" or by infection with a high amount of virus particles per cell (fusion "from without". Inhibition of virus maturation or inhibition of virus transport on microtubules towards the plasma membrane resulted in a complete inhibition of syncytia formation. We show that in contrast to vaccinia virus, Ectromelia virus induces cell-cell fusion irrespectively of its hemagglutination properties and cell-surface expression of the orthologs of the fusion inhibitory complex, A56 and K2. Additionally, cell-cell fusion was also detected in mice lungs following lethal respiratory infection. Conclusion Ectromelia virus induces spontaneous cell-cell fusion in-vitro and in-vivo although expressing an A56/K2 fusion inhibitory complex. This syncytia formation property cannot be attributed to the 37 amino acid deletion in ECTV A56.

  15. Evaluation of Virus Inactivation by Formaldehyde to Enhance Biosafety of Diagnostic Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Lars Möller


    Full Text Available Formaldehyde (FA fixation of infectious samples is a well-established protocol in diagnostic electron microscopy of viruses. However, published experimental data that demonstrate virus inactivation by these fixation procedures are lacking. Usually, fixation is performed immediately before the sample preparation for microscopy. The fixation procedure should transform viruses in a non–infectious but nonetheless structurally intact form in order to allow a proper diagnosis based on morphology. FA provides an essential advantage in comparison to other disinfectants, because it preserves the ultrastructure of biological material without interfering significantly with the preparation (i.e., the negative staining and the detection of viruses. To examine the efficiency of FA inactivation, we used Vaccinia virus, Human adenovirus and Murine norovirus as models and treated them with FA under various conditions. Critical parameters for the inactivation efficiency were the temperature, the duration of the FA treatment, and the resistance of the virus in question. Our results show that FA inactivation at low temperature (4 °C bears a high risk of incomplete inactivation. Higher temperatures (25 °C are more efficient, although they still require rather long incubation times to fully inactivate a complex and highly robust virus like Vaccinia. A protocol, which applied 2% buffered FA for 60 min and a temperature–shift from 25 to 37 °C after 30 min was efficient for the complete inactivation of all test viruses, and therefore has the potential to improve both biosafety and speed of diagnostic electron microscopy.

  16. Infection cycles of large DNA viruses: Emerging themes and underlying questions

    Energy Technology Data Exchange (ETDEWEB)

    Mutsafi, Yael, E-mail:; Fridmann-Sirkis, Yael; Milrot, Elad; Hevroni, Liron; Minsky, Abraham, E-mail:


    The discovery of giant DNA viruses and the recent realization that such viruses are diverse and abundant blurred the distinction between viruses and cells. These findings elicited lively debates on the nature and origin of viruses as well as on their potential roles in the evolution of cells. The following essay is, however, concerned with new insights into fundamental structural and physical aspects of viral replication that were derived from studies conducted on large DNA viruses. Specifically, the entirely cytoplasmic replication cycles of Mimivirus and Vaccinia are discussed in light of the highly limited trafficking of large macromolecules in the crowded cytoplasm of cells. The extensive spatiotemporal order revealed by cytoplasmic viral factories is described and contended to play an important role in promoting the efficiency of these ‘nuclear-like’ organelles. Generation of single-layered internal membrane sheets in Mimivirus and Vaccinia, which proceeds through a novel membrane biogenesis mechanism that enables continuous supply of lipids, is highlighted as an intriguing case study of self-assembly. Mimivirus genome encapsidation was shown to occur through a portal different from the ‘stargate’ portal that is used for genome release. Such a ‘division of labor’ is proposed to enhance the efficacy of translocation processes of very large viral genomes. Finally, open questions concerning the infection cycles of giant viruses to which future studies are likely to provide novel and exciting answers are discussed. - Highlights: • The discovery of giant DNA viruses blurs the distinction between viruses and cells. • Mimivirus and Vaccinia replicate exclusively in their host cytoplasm. • Mimivirus genome is delivered through a unique portal coined the Stargate. • Generation of Mimivirus internal membrane proceeds through a novel pathway.

  17. Mucosal immunization induces a higher level of lasting neutralizing antibody response in mice by a replication-competent smallpox vaccine: vaccinia Tiantan strain. (United States)

    Lu, Bin; Yu, Wenbo; Huang, Xiaoxing; Wang, Haibo; Liu, Li; Chen, Zhiwei


    The possible bioterrorism threat using the variola virus, the causative agent of smallpox, has promoted us to further investigate the immunogenicity profiles of existing vaccines. Here, we study for the first time the immunogenicity profile of a replication-competent smallpox vaccine (vaccinia Tiantan, VTT strain) for inducing neutralizing antibodies (Nabs) through mucosal vaccination, which is noninvasive and has a critical implication for massive vaccination programs. Four different routes of vaccination were tested in parallel including intramuscular (i.m.), intranasal (i.n.), oral (i.o.), and subcutaneous (s.c.) inoculations in mice. We found that one time vaccination with an optimal dose of VTT was able to induce anti-VTT Nabs via each of the four routes. Higher levels of antiviral Nabs, however, were induced via the i.n. and i.o. inoculations when compared with the i.m. and s.c. routes. Moreover, the i.n. and i.o. vaccinations also induced higher sustained levels of Nabs overtime, which conferred better protections against homologous or alternating mucosal routes of viral challenges six months post vaccination. The VTT-induced immunity via all four routes, however, was partially effective against the intramuscular viral challenge. Our data have implications for understanding the potential application of mucosal smallpox vaccination and for developing VTT-based vaccines to overcome preexisting antivaccinia immunity.

  18. Mucosal Immunization Induces a Higher Level of Lasting Neutralizing Antibody Response in Mice by a Replication-Competent Smallpox Vaccine: Vaccinia Tiantan Strain

    Directory of Open Access Journals (Sweden)

    Bin Lu


    Full Text Available The possible bioterrorism threat using the variola virus, the causative agent of smallpox, has promoted us to further investigate the immunogenicity profiles of existing vaccines. Here, we study for the first time the immunogenicity profile of a replication-competent smallpox vaccine (vaccinia Tiantan, VTT strain for inducing neutralizing antibodies (Nabs through mucosal vaccination, which is noninvasive and has a critical implication for massive vaccination programs. Four different routes of vaccination were tested in parallel including intramuscular (i.m., intranasal (i.n., oral (i.o., and subcutaneous (s.c. inoculations in mice. We found that one time vaccination with an optimal dose of VTT was able to induce anti-VTT Nabs via each of the four routes. Higher levels of antiviral Nabs, however, were induced via the i.n. and i.o. inoculations when compared with the i.m. and s.c. routes. Moreover, the i.n. and i.o. vaccinations also induced higher sustained levels of Nabs overtime, which conferred better protections against homologous or alternating mucosal routes of viral challenges six months post vaccination. The VTT-induced immunity via all four routes, however, was partially effective against the intramuscular viral challenge. Our data have implications for understanding the potential application of mucosal smallpox vaccination and for developing VTT-based vaccines to overcome preexisting antivaccinia immunity.

  19. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection (United States)

    Gammon, Don B; Duraffour, Sophie; Rozelle, Daniel K; Hehnly, Heidi; Sharma, Rita; Sparks, Michael E; West, Cara C; Chen, Ying; Moresco, James J; Andrei, Graciela; Connor, John H; Conte, Darryl; Gundersen-Rindal, Dawn E; Marshall, William L; Yates, John R; Silverman, Neal; Mello, Craig C


    Virus-host interactions drive a remarkable diversity of immune responses and countermeasures. We found that two RNA viruses with broad host ranges, vesicular stomatitis virus (VSV) and Sindbis virus (SINV), are completely restricted in their replication after entry into Lepidopteran cells. This restriction is overcome when cells are co-infected with vaccinia virus (VACV), a vertebrate DNA virus. Using RNAi screening, we show that Lepidopteran RNAi, Nuclear Factor-κB, and ubiquitin-proteasome pathways restrict RNA virus infection. Surprisingly, a highly conserved, uncharacterized VACV protein, A51R, can partially overcome this virus restriction. We show that A51R is also critical for VACV replication in vertebrate cells and for pathogenesis in mice. Interestingly, A51R colocalizes with, and stabilizes, host microtubules and also associates with ubiquitin. We show that A51R promotes viral protein stability, possibly by preventing ubiquitin-dependent targeting of viral proteins for destruction. Importantly, our studies reveal exciting new opportunities to study virus-host interactions in experimentally-tractable Lepidopteran systems. DOI: PMID:24966209

  20. Safety and immunogenicity of LC16m8, an attenuated smallpox vaccine in vaccinia-naive adults. (United States)

    Kennedy, Jeffrey S; Gurwith, Marc; Dekker, Cornelia L; Frey, Sharon E; Edwards, Kathryn M; Kenner, Julie; Lock, Michael; Empig, Cyril; Morikawa, Shigeru; Saijo, Masayuki; Yokote, Hiroyuki; Karem, Kevin; Damon, Inger; Perlroth, Mark; Greenberg, Richard N


    LC16m8 is an attenuated cell culture-adapted Lister vaccinia smallpox vaccine missing the B5R protein and licensed for use in Japan. We conducted a phase I/II clinical trial that compared the safety and immunogenicity of LC16m8 with Dryvax in vaccinia-naive participants. Adverse events were assessed, as were electrocardiography and laboratory testing for cardiotoxicity and viral culturing of the vaccination sites. Neutralization titers to vaccinia, monkeypox, and variola major were assessed and cell-mediated immune responses were measured by interferon (IFN)-γ enzyme-linked immunosorbent spot and lymphoproliferation assays. Local and systemic reactions after vaccination with LC16m8 were similar to those reported after Dryvax. No clinically significant abnormalities consistent with cardiac toxicity were seen for either vaccine. Both vaccines achieved antivaccinia, antivariola, and antimonkeypox neutralizing antibody titers >1:40, although the mean plaque reduction neutralization titer of LC16m8 at day 30 after vaccination was significantly lower than Dryvax for anti-NYCBH vaccinia (P smallpox. Clinical Trials Registration. NCT00103584.

  1. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    Energy Technology Data Exchange (ETDEWEB)

    Upton, C.; McFadden, G.


    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively.

  2. Phase 1 safety and immunogenicity evaluation of ADMVA, a multigenic, modified vaccinia Ankara-HIV-1 B'/C candidate vaccine.

    Directory of Open Access Journals (Sweden)

    Sandhya Vasan

    Full Text Available BACKGROUND: We conducted a Phase I dose-escalation trial of ADMVA, a Clade-B'/C-based HIV-1 candidate vaccine expressing env, gag, pol, nef, and tat in a modified vaccinia Ankara viral vector. Sequences were derived from a prevalent circulating HIV-1 recombinant form in Yunnan, China, an area of high HIV incidence. The objective was to evaluate the safety and immunogenicity of ADMVA in human volunteers. METHODOLOGY/PRINCIPAL FINDINGS: ADMVA or placebo was administered intramuscularly at months 0, 1 and 6 to 50 healthy adult volunteers not at high risk for HIV-1. In each dosage group [1x10(7 (low, 5x10(7 (mid, or 2.5x10(8 pfu (high] volunteers were randomized in a 3:1 ratio to receive ADMVA or placebo in a double-blinded design. Subjects were followed for local and systemic reactogenicity, adverse events including cardiac adverse events, and clinical laboratory parameters. Study follow up was 18 months. Humoral immunogenicity was evaluated by anti-gp120 binding ELISA, immunoflourescent staining, and HIV-1 neutralization. Cellular immunogenicity was assessed by a validated IFNgamma ELISpot assay and intracellular cytokine staining. Anti-vaccinia binding titers were measured by ELISA. ADMVA was generally well-tolerated, with no vaccine-related serious adverse events or cardiac adverse events. Local or systemic reactogenicity events were reported by 77% and 78% of volunteers, respectively. The majority of events were of mild intensity. The IFNgamma ELISpot response rate to any HIV antigen was 0/12 (0% in the placebo group, 3/12 (25% in the low dosage group, 6/12 (50% in the mid dosage group, and 8/13 (62% in the high dosage group. Responses were often multigenic and occasionally persisted up to one year post vaccination. Antibodies to gp120 were detected in 0/12 (0%, 8/13 (62%, 6/12 (50% and 10/13 (77% in the placebo, low, mid, and high dosage groups, respectively. Antibodies persisted up to 12 months after vaccination, with a trend toward agreement

  3. A Randomized, Double-Blind, Placebo-Controlled Phase II Trial Investigating the Safety and Immunogenicity of Modified Vaccinia Ankara Smallpox Vaccine (MVA-BN® in 56-80-Year-Old Subjects.

    Directory of Open Access Journals (Sweden)

    Richard N Greenberg

    Full Text Available Modified Vaccinia Ankara MVA-BN® is a live, highly attenuated, viral vaccine under advanced development as a non-replicating smallpox vaccine. In this Phase II trial, the safety and immunogenicity of Modified Vaccinia Ankara MVA-BN® (MVA was assessed in a 56-80 years old population.MVA with a virus titer of 1 x 108 TCID50/dose was administered via subcutaneous injection to 56-80 year old vaccinia-experienced subjects (N = 120. Subjects received either two injections of MVA (MM group or one injection of Placebo and one injection of MVA (PM group four weeks apart. Safety was evaluated by assessment of adverse events (AE, focused physical exams, electrocardiogram recordings and safety laboratories. Solicited AEs consisted of a set of pre-defined expected local reactions (erythema, swelling, pain, pruritus, and induration and systemic symptoms (body temperature, headache, myalgia, nausea and fatigue and were recorded on a memory aid for an 8-day period following each injection. The immunogenicity of the vaccine was evaluated in terms of humoral immune responses measured with a vaccinia-specific enzyme-linked immunosorbent assay (ELISA and a plaque reduction neutralization test (PRNT before and at different time points after vaccination.Vaccinations were well tolerated by all subjects. No serious adverse event related to MVA and no case of myopericarditis was reported. The overall incidence of unsolicited AEs was similar in both groups. For both groups immunogenicity responses two weeks after the final vaccination (i.e. Visit 4 were as follows: Seroconversion (SC rates (doubling of titers from baseline in vaccine specific antibody titers measured by ELISA were 83.3% in Group MM and 82.8% in Group PM (difference 0.6% with 95% exact CI [-13.8%, 15.0%], and 90.0% for Group MM and 77.6% for Group PM measured by PRNT (difference 12.4% with 95% CI of [-1.1%, 27.0%]. Geometric mean titers (GMT measured by ELISA two weeks after the final vaccination for

  4. The other gastropod larvae: larval morphogenesis in a marine neritimorph. (United States)

    Page, Louise R; Ferguson, Samuel J


    Two of the three major gastropod clades with feeding larvae are sister groups and larval morphogenesis for members of these clades, the Caenogastropoda and Heterobranchia, has been well studied. The third clade, the Neritimorpha, has an unstable phylogenetic position and little is known about development of their planktotrophic larvae. Information about larval morphology of neritimorphs and resolution of their controversial phylogenetic placement is critically important for understanding evolution of larval feeding within the Gastropoda. We describe larval morphogenesis to metamorphic competence for laboratory-reared larvae of Nerita melanotragus (Smith, 1884) (Neritimorpha: Neritidae). Preliminary observations suggest that prehatch larvae are capable of delayed hatching, possibly by entering a diapause state. Our description of larval morphogenesis, as based on tissue sections for light and transmission electron microscopy, scanning electron microscopy, three-dimensional-reconstructions of sectioned tissue, and labeling of muscles with fluorphore-tagged phalloidin, revealed four features that are unprecedented among both feeding and nonfeeding gastropod larvae. Larvae of N. melanotragus have muscles on the left and right side that both meet current criteria of a larval retractor muscle; shell-anchored muscles with oblique striations that project inside the visceral nerve loop to insert mainly on the velar lobes. They also have left and right digestive glands of similar size and a left and right hypobranchial gland. A larval "heart" is absent, but water circulation through the mantle cavity may be facilitated by large circular orifices, lined by patches of motile cilia, leading in and out of the mantle cavity. Comparison of larval traits among all three groups of gastropods with feeding larvae indicates that larvae of N. melanotragus have many unique characteristics, but they show more similarities to caenogastropod than to heterobranch larvae. These results are a

  5. A Grhl2-dependent gene network controls trophoblast branching morphogenesis. (United States)

    Walentin, Katharina; Hinze, Christian; Werth, Max; Haase, Nadine; Varma, Saaket; Morell, Robert; Aue, Annekatrin; Pötschke, Elisabeth; Warburton, David; Qiu, Andong; Barasch, Jonathan; Purfürst, Bettina; Dieterich, Christoph; Popova, Elena; Bader, Michael; Dechend, Ralf; Staff, Anne Cathrine; Yurtdas, Zeliha Yesim; Kilic, Ergin; Schmidt-Ott, Kai M


    Healthy placental development is essential for reproductive success; failure of the feto-maternal interface results in pre-eclampsia and intrauterine growth retardation. We found that grainyhead-like 2 (GRHL2), a CP2-type transcription factor, is highly expressed in chorionic trophoblast cells, including basal chorionic trophoblast (BCT) cells located at the chorioallantoic interface in murine placentas. Placentas from Grhl2-deficient mouse embryos displayed defects in BCT cell polarity and basement membrane integrity at the chorioallantoic interface, as well as a severe disruption of labyrinth branching morphogenesis. Selective Grhl2 inactivation only in epiblast-derived cells rescued all placental defects but phenocopied intraembryonic defects observed in global Grhl2 deficiency, implying the importance of Grhl2 activity in trophectoderm-derived cells. ChIP-seq identified 5282 GRHL2 binding sites in placental tissue. By integrating these data with placental gene expression profiles, we identified direct and indirect Grhl2 targets and found a marked enrichment of GRHL2 binding adjacent to genes downregulated in Grhl2(-/-) placentas, which encoded known regulators of placental development and epithelial morphogenesis. These genes included that encoding the serine protease inhibitor Kunitz type 1 (Spint1), which regulates BCT cell integrity and labyrinth formation. In human placenta, we found that human orthologs of murine GRHL2 and its targets displayed co-regulation and were expressed in trophoblast cells in a similar domain as in mouse placenta. Our data indicate that a conserved Grhl2-coordinated gene network controls trophoblast branching morphogenesis, thereby facilitating development of the site of feto-maternal exchange. This might have implications for syndromes related to placental dysfunction. © 2015. Published by The Company of Biologists Ltd.

  6. Cortical forces in cell shape changes and tissue morphogenesis. (United States)

    Rauzi, Matteo; Lenne, Pierre-François


    Cortical forces drive a variety of cell shape changes and cell movements during tissue morphogenesis. While the molecular components underlying these forces have been largely identified, how they assemble and spatially and temporally organize at cell surfaces to promote cell shape changes in developing tissues are open questions. We present here different key aspects of cortical forces: their physical nature, some rules governing their emergence, and how their deployment at cell surfaces drives important morphogenetic movements in epithelia. We review a wide range of literature combining genetic/molecular, biophysical and modeling approaches, which explore essential features of cortical force generation and transmission in tissues. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Dark-induced morphogenesis in synchronized cultures of Blastocladiella britannica. (United States)



    Horenstein, E. A. (Michigan State University, East Lansing) and E. C. Cantino. Dark-induced morphogenesis in synchronized cultures of Blastocladiella britannica. J. Bacteriol. 84:37-45. 1962-A method is described for growing synchronized, single generations of a million cells or more of the aquatic fungus, Blastocladiella britannica, uniformly suspended in agitated liquid media. The effects of population density upon the cell volume, dry weight, and generation time are described. The all-or-none effect of light and dark upon differentiation of thin-walled cells and thick-walled, pitted, resistant-sporangial cells, respectively, has been demonstrated, and the point of no return for both morphological pathways defined.

  8. The Pea Seedling as a Model of Normal and Abnormal Morphogenesis (United States)

    Kurkdjian, Armen; And Others


    Describes several simple and inexpensive experiments designed to facilitate the study of normal and abnormal morphogenesis in the biology laboratory. Seedlings of the common garden pea are used in the experiments, and abnormal morphogenesis (tumors) are induced by a virulent strain of the crown-gall organism, Agrobacterium tumefaciens. (JR)

  9. Un(MaSC)ing Stem Cell Dynamics in Mammary Branching Morphogenesis. (United States)

    Greenwood, Erin; Wrenn, Emma D; Cheung, Kevin J


    The properties of stem cells that participate in mammary gland branching morphogenesis remain contested. Reporting in Nature, Scheele et al. (2017) establish a model for post-pubertal mammary branching morphogenesis in which position-dependent, lineage-restricted stem cells undergo cell mixing in order to contribute to long-term growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Physics and the canalization of morphogenesis: a grand challenge in organismal biology (United States)

    von Dassow, Michelangelo; Davidson, Lance A.


    Morphogenesis takes place in a background of organism-to-organism and environmental variation. Therefore, a fundamental question in the study of morphogenesis is how the mechanical processes of tissue movement and deformation are affected by that variability, and in turn, how the mechanics of the system modulates phenotypic variation. We highlight a few key factors, including environmental temperature, embryo size, and environmental chemistry that might perturb the mechanics of morphogenesis in natural populations. Then we discuss several ways in which mechanics – including feedback from mechanical cues – might influence intra-specific variation in morphogenesis. To understand morphogenesis it will be necessary to consider whole-organism, environment, and evolutionary scales because these larger scales present the challenges that developmental mechanisms have evolved to cope with. Studying the variation organisms express and the variation organisms experience will aid in deciphering the causes of birth defects. PMID:21750364

  11. The contribution of specific cell subpopulations to submandibular salivary gland branching morphogenesis. (United States)

    Kwon, Hae Ryong; Larsen, Melinda


    Branching morphogenesis is the developmental program responsible for generating a large surface to volume ratio in many secretory and absorptive organs. To accomplish branching morphogenesis, spatiotemporal regulation of specific cell subpopulations is required. Here, we review recent studies that define the contributions of distinct cell subpopulations to specific cellular processes during branching morphogenesis in the mammalian submandibular salivary gland, including the initiation of the gland, the coordination of cleft formation, and the contribution of stem/progenitor cells to morphogenesis. In conclusion, we provide an overview of technological advances that have opened opportunities to further probe the contributions of specific cell subpopulations and to define the integration of events required for branching morphogenesis. Copyright © 2015 Elsevier Ltd. All rights reserved.