WorldWideScience

Sample records for upstream promoter sequence

  1. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  2. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  3. Sequence motif upstream of the Hendra virus fusion protein cleavage site is not sufficient to promote efficient proteolytic processing

    International Nuclear Information System (INIS)

    Craft, Willie Warren; Dutch, Rebecca Ellis

    2005-01-01

    The Hendra virus fusion (HeV F) protein is synthesized as a precursor, F 0 , and proteolytically cleaved into the mature F 1 and F 2 heterodimer, following an HDLVDGVK 109 motif. This cleavage event is required for fusogenic activity. To determine the amino acid requirements for processing of the HeV F protein, we constructed multiple mutants. Individual and simultaneous alanine substitutions of the eight residues immediately upstream of the cleavage site did not eliminate processing. A chimeric SV5 F protein in which the furin site was substituted for the VDGVK 109 motif of the HeV F protein was not processed but was expressed on the cell surface. Another chimeric SV5 F protein containing the HDLVDGVK 109 motif of the HeV F protein underwent partial cleavage. These data indicate that the upstream region can play a role in protease recognition, but is neither absolutely required nor sufficient for efficient processing of the HeV F protein

  4. Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Engelbrecht, Jacob

    1995-01-01

    We present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced...

  5. Clustering in large networks does not promote upstream reciprocity.

    Directory of Open Access Journals (Sweden)

    Naoki Masuda

    Full Text Available Upstream reciprocity (also called generalized reciprocity is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

  6. Clustering in large networks does not promote upstream reciprocity.

    Science.gov (United States)

    Masuda, Naoki

    2011-01-01

    Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

  7. An upstream activation element exerting differential transcriptional activation on an archaeal promoter

    DEFF Research Database (Denmark)

    Peng, Nan; Xia, Qiu; Chen, Zhengjun

    2009-01-01

    S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

  8. Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

    Science.gov (United States)

    Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

    2010-01-01

    Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

  9. Characterization of upstream sequences from the 8S globulin gene ...

    African Journals Online (AJOL)

    Administrator

    2011-09-21

    Sep 21, 2011 ... added recombinant proteins and enzymes for industries. The upstream region ... cost, eukaryotic expression and no endogenous patho- gen pollution, thus it ... developmental process (Santino et al., 1997) which may deplete nutrient ... ideal bioreactors for economic production and storage of value-added ...

  10. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  11. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  12. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  13. Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter

    Energy Technology Data Exchange (ETDEWEB)

    Kleinert, H.; Benecke, B.J.

    1988-02-25

    The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.

  14. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    International Nuclear Information System (INIS)

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.

    2005-01-01

    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ

  15. PROMoter uPstream Transcripts share characteristics with mRNAs and are produced upstream of all three major types of mammalian promoters

    DEFF Research Database (Denmark)

    Preker, Pascal; Almvig, Kristina; Christensen, Marianne S

    2011-01-01

    RNAs, PROMPTs are largely nuclear and rapidly turned over by the RNA exosome. PROMPT-transcribing DNA is occupied by RNA polymerase II (RNAPII) complexes with serine 2 phosphorylated C-terminal domains (CTDs), mimicking that of the associated genic region. Thus, the inefficient elongation capacity of PROMPT...... transcription cannot solely be assigned to poor CTD phosphorylation. Conditions that reduce gene transcription increase RNAPII occupancy of the upstream PROMPT region, suggesting that they reside in a common transcription compartment. Surprisingly, gene promoters that are actively transcribed by RNAPI...

  16. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  17. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  18. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  19. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Science.gov (United States)

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  20. The role of upstream sequences in selecting the reading frame on tmRNA

    Directory of Open Access Journals (Sweden)

    Dewey Jonathan D

    2008-06-01

    Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

  1. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri

    2010-04-01

    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  2. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    Science.gov (United States)

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  3. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    Science.gov (United States)

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  4. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    OpenAIRE

    W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

    2017-01-01

    The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

  5. Upstream-Downstream Joint Carbon Reduction Strategies Based on Low-Carbon Promotion

    Directory of Open Access Journals (Sweden)

    Xiqiang Xia

    2018-06-01

    Full Text Available A differential game model is established to analyze the impact of emissions reduction efforts and low-carbon product promotion on the reduction strategies of low-carbon product manufacturers (subsequently referred to as manufacturers and the retailers of such products in a dynamic environment. Based on this model, changes in emissions reduction efforts and promotional efforts are comparatively analyzed under three scenarios (retailers bearing the promotional cost, manufacturers bearing the promotional cost, and centralized decision-making. The results are as follows: (1 the trajectory of carbon emissions reduction per product unit is the highest when the supply chain is under centralized decision-making, followed by when manufacturers bear the promotional cost, and lastly when retailers bear the cost; (2 when manufacturers bear the promotional cost, the market demand, emissions reduction effort, and promotional effort are higher, although the unit retail price is higher than when retailers bear the promotional cost; and (3 under centralized decision-making, the unit retail price is the lowest; however, sales volume, the emissions reduction effort, and the promotional effort are all higher than those in the other scenarios.

  6. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    Science.gov (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  7. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    Directory of Open Access Journals (Sweden)

    W.S.I. de Silva

    2017-07-01

    Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

  8. Compilation and analysis of Escherichia coli promoter DNA sequences.

    OpenAIRE

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  9. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny.

    Directory of Open Access Journals (Sweden)

    Dorcas J Orengo

    Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.

  10. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    Science.gov (United States)

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  11. Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

    OpenAIRE

    Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.

    2005-01-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identifie...

  12. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  13. The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

  14. Effect of promoter strength and signal sequence on the periplasmic ...

    African Journals Online (AJOL)

    Two plasmids, pFLAG-ATS and pET 26b(+), were studied for the periplasmic expression of recombinant human interferon-2b (IFN-2b) in Escherichia coli. The pFLAG-ATS contains ompA signal sequence and tac promoter while pET 26b(+) contains pelB signal sequence and T7lac promoter. It was observed that periplasmic ...

  15. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  16. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  17. Functional analysis of bipartite begomovirus coat protein promoter sequences

    International Nuclear Information System (INIS)

    Lacatus, Gabriela; Sunter, Garry

    2008-01-01

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

  18. A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

    Directory of Open Access Journals (Sweden)

    Lior Levy

    2017-10-01

    Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

  19. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    Science.gov (United States)

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  20. A de novo 1.58 Mb deletion, including MAP2K6 and mapping 1.28 Mb upstream to SOX9, identified in a patient with Pierre Robin sequence and osteopenia with multiple fractures.

    Science.gov (United States)

    Smyk, Marta; Roeder, Elizabeth; Cheung, Sau Wai; Szafranski, Przemyslaw; Stankiewicz, Paweł

    2015-08-01

    Defects of long-range regulatory elements of dosage-sensitive genes represent an under-recognized mechanism underlying genetic diseases. Haploinsufficiency of SOX9, the gene essential for development of testes and differentiation of chondrocytes, results in campomelic dysplasia, a skeletal malformation syndrome often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.6 Mb up- and downstream to SOX9, and disrupting its distant cis-regulatory elements, have been described in patients with milder forms of campomelic dysplasia, Pierre Robin sequence, and sex reversal. We present an ∼1.58 Mb deletion mapping ∼1.28 Mb upstream to SOX9 that encompasses its putative long-range cis-regulatory element(s) and MAP2K6 in a patient with Pierre Robin sequence and osteopenia with multiple fractures. Low bone mass panel testing using massively parallel sequencing of 23 nuclear genes, including COL1A1 and COL1A2 was negative. Based on the previous mouse model of Map2k6, suggesting that Sox9 is likely a downstream target of the p38 MAPK pathway, and our previous chromosome conformation capture-on-chip (4C) data showing potential interactions between SOX9 promoter and MAP2K6, we hypothesize that deletion of MAP2K6 might have affected SOX9 expression and contributed to our patient's phenotype. © 2015 Wiley Periodicals, Inc.

  1. Effective Feature Selection for Classification of Promoter Sequences.

    Directory of Open Access Journals (Sweden)

    Kouser K

    Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  2. Moving upstream in health promoting policies for older people with early frailty in England? A policy analysis.

    OpenAIRE

    Drennan, V; Walters, K; Avgerinou, C; Gardner, B; Goodman, C; Frost, R; Kharicha, K; Iliffe, S; Manthorpe, J

    2018-01-01

    Objectives Globally, populations are rapidly ageing and countries have developed health promotion and wellbeing strategies to address increasing demand for health care and old-age support. The older population is not homogeneous however, and includes a large group in transition between being active and healthy to being frail, i.e. with early frailty. This review explores the extent to which policy in England has addressed this group with a view to supporting independence and preventing furthe...

  3. Spectrometric study of the folding process of i-motif-forming DNA sequences upstream of the c-kit transcription initiation site

    International Nuclear Information System (INIS)

    Bucek, Pavel; Gargallo, Raimundo; Kudrev, Andrei

    2010-01-01

    The c-kit oncogene shows a cytosine-rich DNA region upstream of the transcription initiation site which forms an i-motif structure at slightly acidic pH values (Bucek et al. ). In the present study, the pH-induced formation of i-motif - forming sequences 5'-CCC CTC CCT CGC GCC CGC CCG-3' (ckitC1, native), 5'-CCC TTC CCT TGT GCC CGC CCG-3' (ckitC2) and 5'-CCCTT CCC TTTTT CCC T CCC T-3' (ckitC3) was studied by spectroscopic techniques, such as UV molecular absorption and circular dichroism (CD), in tandem with two multivariate data analysis methods, the hard modelling-based matrix method and the soft modelling-based MCR-ALS approach. Use of the hard chemical modelling enabled us to propose the equilibrium model, which describes spectral changes as functions of solution acidity. Additionally, the intrinsic protonation constant, K in , and the cooperativity parameters, ω c , and ω a , were calculated from the fitting procedure of the coupled CD and molecular absorption spectra. In the case of ckitC2 and ckitC3, the hard model correctly reproduced the spectral variations observed experimentally. The results indicated that folding was accompanied by a cooperative process, i.e. the enhancement of protonated structure stability upon protonation. In contrast, unfolding was accompanied by an anticooperative process. Finally, folding of the native sequence, ckitC1, seemed to follow a more complex mechanism.

  4. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  5. Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

    Science.gov (United States)

    Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

    1995-01-01

    The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

  6. The retinoid X receptor response element in the human aldehyde dehydrogenase 2 promoter is antagonized by the chicken ovalbumin upstream promoter family of orphan receptors

    NARCIS (Netherlands)

    Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D

    2000-01-01

    Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift

  7. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  8. The role of chicken ovalbumin upstream promoter transcription factor II in the regulation of hepatic fatty acid oxidation and gluconeogenesis in newborn mice.

    Science.gov (United States)

    Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul

    2015-05-15

    Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.

  9. Knockdown of a HIF-2α promoter upstream long noncoding RNA impairs colorectal cancer stem cell properties in vitro through HIF-2α downregulation

    Directory of Open Access Journals (Sweden)

    Yao J

    2015-11-01

    Full Text Available Jie Yao,1,* Jianxiong Li,2,* Peiliang Geng,2,* Yi Li,3,* Hong Chen,3 Yunfeng Zhu2 1Department of Oncology, People’s Liberation Army No 161 Hospital, Wuhan, 2Cancer Center, Division of Internal Medicine, Chinese PLA General Hospital, Beijing, 3Department of Oncology, Kunming General Hospital of Chendu Military Command, Kunming, People’s Republic of China *These authors contributed equally to this work Abstract: Currently, various long noncoding RNAs (lncRNAs have been identified as key regulators of multiple cancers. However, cancer stem cell (CSC-related lncRNAs have rarely been reported. In this study, we found an lncRNA that is a promoter upstream transcript of hypoxia-inducible factor-2α (HIF-2α, and we named it “lncRNA-HIF2PUT”. The function of HIF-2α is closely connected with “stem cell-like” properties, and the function of PROMPTs is often associated with the adjacent protein-coding transcripts. Herein, we showed that the expression of lncRNA-HIF2PUT was significantly correlated with HIF-2α in colorectal cancer (CRC tissues. Knockdown of lncRNA-HIF2PUT blocked the HIF-2α expression and inhibited the CSC properties in CRC cell lines DLD-1 and HT29. LncRNA-HIF2PUTsmall interfering RNA transfection resulted in decreased stemness genes expression, impaired colony formation, and spheroid formation ability, retarded migration, and invasion of the cells. These data suggest that lncRNA-HIF2PUT may be a regulator of HIF-2α and a mediator of CSCs in CRC. Keywords: HIF-2α, long noncoding RNA, colorectal cancer, stem cell properties

  10. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  11. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  12. Expression of wheat high molecular weight glutenin subunit 1Bx is affected by large insertions and deletions located in the upstream flanking sequences.

    Directory of Open Access Journals (Sweden)

    Yuke Geng

    Full Text Available To better understand the transcriptional regulation of high molecular weight glutenin subunit (HMW-GS expression, we isolated four Glu-1Bx promoters from six wheat cultivars exhibiting diverse protein expression levels. The activities of the diverse Glu-1Bx promoters were tested and compared with β-glucuronidase (GUS reporter fusions. Although all the full-length Glu-1Bx promoters showed endosperm-specific activities, the strongest GUS activity was observed with the 1Bx7OE promoter in both transient expression assays and stable transgenic rice lines. A 43 bp insertion in the 1Bx7OE promoter, which is absent in the 1Bx7 promoter, led to enhanced expression. Analysis of promoter deletion constructs confirmed that a 185 bp MITE (miniature inverted-repeat transposable element in the 1Bx14 promoter had a weak positive effect on Glu-1Bx expression, and a 54 bp deletion in the 1Bx13 promoter reduced endosperm-specific activity. To investigate the effect of the 43 bp insertion in the 1Bx7OE promoter, a functional marker was developed to screen 505 Chinese varieties and 160 European varieties, and only 1Bx7-type varieties harboring the 43 bp insertion in their promoters showed similar overexpression patterns. Hence, the 1Bx7OE promoter should be important tool in crop genetic engineering as well as in molecular assisted breeding.

  13. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  14. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

    1994-01-01

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  15. Meta-analysis of Arabidopsis KANADI1 direct target genes identifies basic growth-promoting module acting upstream of hormonal signaling pathways

    DEFF Research Database (Denmark)

    Xie, Yakun; Straub, Daniel; Eguen, Teinai Ebimienere

    2015-01-01

    An intricate network of antagonistically acting transcription factors mediates formation of a flat leaf lamina of Arabidopsis thaliana plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side......) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here we used an mRNA-seq approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis approach combining our datasets with published genome......-wide datasets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we find three YUCCA genes, YUC2, YUC5 and YUC8 to be transcriptionally upregulated, which correlates with an increase in the levels of free auxin. When ectopically expressed...

  16. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  17. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    Science.gov (United States)

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  18. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

  19. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    Science.gov (United States)

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

    2015-01-01

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  1. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Complete re-sequencing of a 2Mb topological domain encompassing the FTO/IRXB genes identifies a novel obesity-associated region upstream of IRX5

    DEFF Research Database (Denmark)

    Hunt, Lilian E; Noyvert, Boris; Bhaw-Rosun, Leena

    2015-01-01

    BACKGROUND: Association studies have identified a number of loci that contribute to an increased body mass index (BMI), the strongest of which is in the first intron of the FTO gene on human chromosome 16q12.2. However, this region is both non-coding and under strong linkage disequilibrium, making...... it recalcitrant to functional interpretation. Furthermore, the FTO gene is located within a complex cis-regulatory landscape defined by a topologically associated domain that includes the IRXB gene cluster, a trio of developmental regulators. Consequently, at least three genes in this interval have been...... implicated in the aetiology of obesity. METHODS: Here, we sequence a 2 Mb region encompassing the FTO, RPGRIP1L and IRXB cluster genes in 284 individuals from a well-characterised study group of Danish men containing extremely overweight young adults and controls. We further replicate our findings both...

  3. Upstream cash cloud

    International Nuclear Information System (INIS)

    Shepherd, R.

    1998-01-01

    This paper focuses on the effects of the slowdown in budgetary growth on the upstream business and offshore services. The dangers facing investors, the strong growth in energy demand, oil company priorities, the dip in profits of the oil companies, new field economics, the budgets for exploration and production, and the rig market outlook are discussed. (UK)

  4. The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancer-like element involved in chloroplast-dependent expression.

    Science.gov (United States)

    Vorst, O; Kock, P; Lever, A; Weterings, B; Weisbeek, P; Smeekens, S

    1993-12-01

    Plastocyanin is part of the photosynthetic electron transport chain in the chloroplast and is encoded in the nucleus. Expression of the Arabidopsis thaliana plastocyanin gene is organ specific: high mRNA levels are observed in young green parts of the plant. Furthermore, expression is dependent on the presence of light and functional chloroplasts. When grown in the presence of norflurazon under white light conditions, resulting in the photo-oxidative destruction of the chloroplast, plastocyanin mRNA levels are strongly reduced. A -1579 to -9 promoter fragment confers light-regulated and chloroplast-dependent expression to the beta-glucuronidase reporter gene in transgenic tobacco plants. This suggests that regulation takes place at the level of transcription. A plastocyanin promoter deletion series ranging from -1579 to -121 which was also tested in tobacco, revealed the presence of a strong positive regulating element (PRE) in the -1579 to -705 region. Deletion of this part of the promoter resulted in a approximately 100-fold reduction of GUS expression as measured in mature leaves. Surprisingly, this enhancer-like element was capable of stimulating transcription from a position downstream of its reporter. Moreover, it could also activate a truncated CaMV 35S promoter. Deletion of this element coincides with the loss of chloroplast-dependency of reporter gene expression, as judged by norflurazon treatment of transgenic seedlings. So, the activity of the PRE itself might depend on the presence of functional chloroplasts.

  5. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  6. Upstream health law.

    Science.gov (United States)

    Sage, William M; McIlhattan, Kelley

    2014-01-01

    For the first time, entrepreneurs are aggressively developing new technologies and business models designed to improve individual and population health, not just to deliver specialized medical care. Consumers of these goods and services are not yet "patients"; they are simply people. As this sector of the health care industry expands, it is likely to require new forms of legal governance, which we term "upstream health law." © 2014 American Society of Law, Medicine & Ethics, Inc.

  7. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

  8. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  9. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

  10. Variability in a three-generation family with Pierre Robin sequence, acampomelic campomelic dysplasia, and intellectual disability due to a novel ∼1 Mb deletion upstream of SOX9, and including KCNJ2 and KCNJ16.

    Science.gov (United States)

    Castori, Marco; Bottillo, Irene; Morlino, Silvia; Barone, Chiara; Cascone, Piero; Grammatico, Paola; Laino, Luigi

    2016-01-01

    Campomelic dysplasia and acampomelic campomelic dysplasia (ACD) are allelic disorders due to heterozygous mutations in or around SOX9. Translocations and deletions involving the SOX9 5' regulatory region are rare causes of these disorders, as well as Pierre Robin sequence (PRS) and 46,XY gonadal dysgenesis. Genotype-phenotype correlations are not straightforward due to the complex epigenetic regulation of SOX9 expression during development. We report a three-generation pedigree with a novel ∼1 Mb deletion upstream of SOX9 and including KCNJ2 and KCNJ16, and ascertained for dominant transmission of PRS. Further characterization of the family identified subtle appendicular anomalies and a variable constellation of axial skeletal features evocative of ACD in several members. Affected males showed learning disability. The identified deletion was smaller than all other chromosome rearrangements associated with ACD. Comparison with other reported translocations and deletions involving this region allowed further refining of genotype-phenotype correlations and an update of the smallest regions of overlap associated with the different phenotypes. Intrafamilial variability in this pedigree suggests a phenotypic continuity between ACD and PRS in patients carrying mutations in the SOX9 5' regulatory region. © 2015 Wiley Periodicals, Inc.

  11. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  12. CaMV-35S promoter sequence-specific DNA methylation in lettuce.

    Science.gov (United States)

    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

    2016-01-01

    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  13. Genes involved in complex adaptive processes tend to have highly conserved upstream regions in mammalian genomes

    Directory of Open Access Journals (Sweden)

    Kohane Isaac

    2005-11-01

    Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged

  14. LHCb upstream tracker

    CERN Multimedia

    Artuso, Marina

    2016-01-01

    The detector for the LHCb upgrade is designed for 40MHz readout, allowing the experiment to run at an instantaneous luminosity of 2x10^33 cm$^2$s$^-1$. The upgrade of the tracker subsystem in front of the dipole magnet, the Upstream Tracker, is crucial for charged track reconstruction and fast trigger decisions based on a tracking algorithm involving also vertex detector information. The detector consists of 4 planes with a total area of about 8.5m$^2$, made of single sided silicon strip sensors read-out by a novel custom-made ASIC (SALT). Details on the performance of prototype sensors, front-end electronics, near-detector electronics and mechanical components are presented.

  15. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Directory of Open Access Journals (Sweden)

    Jin Duan

    Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  16. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    Science.gov (United States)

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  17. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

    Directory of Open Access Journals (Sweden)

    Christine R Langlois

    2016-11-01

    Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

  18. Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

    Directory of Open Access Journals (Sweden)

    Liu Wen-Sheng

    2010-11-01

    Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

  19. Cued memory reactivation during slow-wave sleep promotes explicit knowledge of a motor sequence.

    Science.gov (United States)

    Cousins, James N; El-Deredy, Wael; Parkes, Laura M; Hennies, Nora; Lewis, Penelope A

    2014-11-26

    Memories are gradually consolidated after initial encoding, and this can sometimes lead to a transition from implicit to explicit knowledge. The exact physiological processes underlying this reorganization remain unclear. Here, we used a serial reaction time task to determine whether targeted memory reactivation (TMR) of specific memory traces during slow-wave sleep promotes the emergence of explicit knowledge. Human participants learned two 12-item sequences of button presses (A and B). These differed in both cue order and in the auditory tones associated with each of the four fingers (one sequence had four higher-pitched tones). Subsequent overnight sleep was monitored, and the tones associated with one learned sequence were replayed during slow-wave sleep. After waking, participants demonstrated greater explicit knowledge (p = 0.005) and more improved procedural skill (p = 0.04) for the cued sequence relative to the uncued sequence. Furthermore, fast spindles (13.5-15 Hz) at task-related motor regions predicted overnight enhancement in procedural skill (r = 0.71, p = 0.01). Auditory cues had no effect on post-sleep memory performance in a control group who received TMR before sleep. These findings suggest that TMR during sleep can alter memory representations and promote the emergence of explicit knowledge, supporting the notion that reactivation during sleep is a key mechanism in this process. Copyright © 2014 Cousins et al.

  20. Isolation and sequencing analysis on the seed-specific promoter from soybean

    Institute of Scientific and Technical Information of China (English)

    CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

    2007-01-01

    The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

  1. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  2. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

    Science.gov (United States)

    Raynard, Steven J; Baker, Mark D

    2004-01-01

    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  3. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

    Science.gov (United States)

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

    2012-01-01

    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  4. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  5. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  6. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    Science.gov (United States)

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  7. Upstream technology - onshore

    International Nuclear Information System (INIS)

    Wind, H.

    1998-01-01

    Ways in which the onshore petroleum industry can meet the challenges of technological development in the new century to allow the industry to operate in a sustainable fashion were discussed. Advances in the areas of emissions control, environment protection, production, process automation and in situ heavy oil production have been mentioned as the most important guarantors of sustainable development. Ongoing work to combat emissions includes: (1) electricity from flare gas, (2) flare performance, (3) waste gas injection, (4) zero gas emissions equipment for wells, and (5) enhanced coalbed methane recovery. From the vantage point of improving environmental performance, efforts to minimize surface disturbance, to treat drilling wastes, and to remediate sites with native plants have shown good results. Technology developments in production include: (1) downhole gas/water separation and downhole oil/water separation, (2) water coning control, and (3) pipelines. The most significant advances in automation are the increased use of SCADA monitoring systems and pump off controllers. The two most notable developments in the in situ heavy oil exploitation area are the Steam Assisted Gravity Drainage (SAGD) process and its variant, the Vapex process. The most successful pilot to date has been the AOSTRA Underground Test Facility project in Athabasca. Cooperative research in numerical simulations, tomographic imaging, carbon dioxide, solvent and steam experiments and methane injection work have been cited as the most promising among the collaborative projects promoted by the Canadian Oilsands Network for Research and Development (CONRAD)

  8. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Jing Qin Wu

    Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  9. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    Science.gov (United States)

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  10. The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

    DEFF Research Database (Denmark)

    Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

    2011-01-01

    Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

  11. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  12. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    Directory of Open Access Journals (Sweden)

    Devaraj Illakkiam

    2014-01-01

    Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

  13. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  14. Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

    DEFF Research Database (Denmark)

    Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

    1988-01-01

    Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

  15. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  16. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    Science.gov (United States)

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.

  17. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  18. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  19. Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

    African Journals Online (AJOL)

    The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

  20. Draft Genome Sequence of Bacillus velezensis Lzh-a42, a Plant Growth-Promoting Rhizobacterium Isolated from Tomato Rhizosphere.

    Science.gov (United States)

    Li, Zhenghua; Chen, Mei; Ran, Kun; Wang, Jihua; Zeng, Qiangcheng; Song, Feng

    2018-03-22

    The plant growth-promoting rhizobacterium Bacillus velezensis strain Lzh-a42, which has antimicrobial activity, was isolated from tomato rhizosphere. Here, we report its genome sequence, which includes several predicted functional genes related to secondary metabolite biosynthesis, antimicrobial activity, and biofilm synthesis. Copyright © 2018 Li et al.

  1. Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

    Science.gov (United States)

    Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

    2017-08-31

    Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

  2. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi

    2016-11-04

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  3. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  4. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    Energy Technology Data Exchange (ETDEWEB)

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  5. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...

  6. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....

  7. Upstream waves in Saturn's foreshock

    Science.gov (United States)

    Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.

    1991-01-01

    An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.

  8. The LHCb Upstream Tracker Project

    CERN Document Server

    Steinkamp, Olaf

    2015-01-01

    The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...

  9. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  10. Genome Sequence of Bacillus velezensis S141, a New Strain of Plant Growth-Promoting Rhizobacterium Isolated from Soybean Rhizosphere.

    Science.gov (United States)

    Sibponkrung, Surachat; Kondo, Takahiko; Tanaka, Kosei; Tittabutr, Panlada; Boonkerd, Nantakorn; Teaumroong, Neung; Yoshida, Ken-Ichi

    2017-11-30

    Bacillus velezensis strain S141 is a plant growth-promoting rhizobacterium isolated from soybean ( Glycine max ) rhizosphere that enhances soybean growth, nodulation, and N 2 fixation efficiency by coinoculation with Bradyrhizobium diazoefficiens USDA110. The S141 genome was identified to comprise a 3,974,582-bp-long circular DNA sequence encoding at least 3,817 proteins. Copyright © 2017 Sibponkrung et al.

  11. Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

    Science.gov (United States)

    Hampel, Stefanie; McKellar, Claire E

    2017-01-01

    A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

  12. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  13. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    Science.gov (United States)

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  14. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  15. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    Science.gov (United States)

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  17. Buzz words in the upstream

    International Nuclear Information System (INIS)

    Knoll, B.

    1998-01-01

    Examples of misleading or misunderstood 'buzz' words that are prevalent in modern upstream technology are illustrated. The terms underbalanced drilling, horizontal wells, and geo-steering, which were unheard of in the early 1980s, have become key 'buzz' words in modern exploitation terminology. The terms are not only misused, but the technologies themselves are frequently mis-applied as shown by the frequency of economic failures, or less than optimal technical successes which have occurred when these technologies have been employed. Two examples, 'horizontal drilling' and 'geosteering', are used to illustrate the point. With regard to horizontal drilling, many oil field professionals consider it as merely a more advanced method of directional drilling. This represents a serious, yet common, misconception. In truth, horizontal wells are not just an altered drilling process, but a fundamental change in exploitation technology. A more appropriate definition would be that a horizontal well is an enhanced oil recovery process, clearly implying a relationship to the exploitation benefit potential of horizontal wells. The other term, 'geo-steering' refers to defining, generating and monitoring a wellpath on geology rather than geometry. It, too, is frequently misused in the technical media. The term is also misrepresented by implying that it is applicable only to the horizontal section of a well, which in fact is far from the truth. To counter these misconceptions, the paper provides appropriate definitions for each of these terms, and defines the conditions under which the techniques themselves are most appropriately used. 7 figs

  18. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina

    2017-10-20

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  19. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina; Lafi, Feras Fawzi; Alam, Intikhab; Zé licourt, Axel de; Eida, Abdul Aziz; Bokhari, Ameerah; Alzubaidy, Hanin S.; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  20. Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

    Science.gov (United States)

    Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

    2014-07-17

    Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

  1. Designing and evaluating a context-based lesson sequence promoting conceptual coherence in biology

    NARCIS (Netherlands)

    Ummels, M. H J; Kamp, M. J A; De Kroon, H.; Boersma, K. Th|info:eu-repo/dai/nl/073043141

    2015-01-01

    Context-based education, in which students deal with biological concepts in a meaningful way, is showing promise in promoting the development of students conceptual coherence. However, literature gives little guidance about how this kind of education should be designed. Therefore, our study aims at

  2. Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Hua

    2006-08-01

    Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

  3. Research on dragons: a teaching sequence to promote the understanding of Nature of Science at Secondary School

    Directory of Open Access Journals (Sweden)

    Romero Ariza, Marta

    2013-01-01

    Full Text Available This paper presents a teaching sequence explicitly designed to improve the understanding of Nature of Science and support Secondary School students to acquire adequate understanding about scientific hypothesis, theories and laws. The instructional intervention engages students in an inquiry process where they have to formulate hypothesis, analyse data and draw conclusions based on evidence. It is a student-centred methodology where teachers act as facilitators and guides, promoting the development of scientific competences and the meaningful understanding of the terms hypothesis, law and theory.

  4. Developmental Origins, Epigenetics, and Equity: Moving Upstream.

    Science.gov (United States)

    Wallack, Lawrence; Thornburg, Kent

    2016-05-01

    The Developmental Origins of Health and Disease and the related science of epigenetics redefines the meaning of what constitutes upstream approaches to significant social and public health problems. An increasingly frequent concept being expressed is "When it comes to your health, your zip code may be more important than your genetic code". Epigenetics explains how the environment-our zip code-literally gets under our skin, creates biological changes that increase our vulnerability for disease, and even children's prospects for social success, over their life course and into future generations. This science requires us to rethink where disease comes from and the best way to promote health. It identifies the most fundamental social equity issue in our society: that initial social and biological disadvantage, established even prior to birth, and linked to the social experience of prior generations, is made worse by adverse environments throughout the life course. But at the same time, it provides hope because it tells us that a concerted focus on using public policy to improve our social, physical, and economic environments can ultimately change our biology and the trajectory of health and social success into future generations.

  5. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    Science.gov (United States)

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  6. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  7. Efficiency of Transcription from Promoter Sequence Variants in Lactobacillus Is Both Strain and Context Dependent

    OpenAIRE

    McCracken, Andrea; Timms, Peter

    1999-01-01

    The introduction of consensus −35 (TTGACA) and −10 (TATAAT) hexamers and a TG motif into the Lactobacillus acidophilus ATCC 4356 wild-type slpA promoter resulted in significant improvements (4.3-, 4.1-, and 10.7-fold, respectively) in transcriptional activity in Lactobacillus fermentum BR11. In contrast, the same changes resulted in decreased transcription in Lactobacillus rhamnosus GG. The TG motif was shown to be important in the context of weak −35 and −10 hexamers (L. fermentum BR11) or a...

  8. Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

    NARCIS (Netherlands)

    Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

    1998-01-01

    Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A

  9. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  10. Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

    Science.gov (United States)

    Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

    2012-01-01

    IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

  11. Artificial promoter libraries for selected organisms and promoters derived from such libraries

    DEFF Research Database (Denmark)

    1998-01-01

    or organisms may be selected from prokaryotes and from eukaryotes; and in prokaryotes the consensus sequences to be retained most often will comprise the -35 signal (-35 to -30): TTGACA and the -10 signal (-12 to -7): TATAAT or parts of both comprising at least 3 conserved nucleotides of each, while...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....

  12. Rationally designed turn promoting mutation in the amyloid-β peptide sequence stabilizes oligomers in solution.

    Directory of Open Access Journals (Sweden)

    Jayakumar Rajadas

    Full Text Available Enhanced production of a 42-residue beta amyloid peptide (Aβ(42 in affected parts of the brain has been suggested to be the main causative factor for the development of Alzheimer's Disease (AD. The severity of the disease depends not only on the amount of the peptide but also its conformational transition leading to the formation of oligomeric amyloid-derived diffusible ligands (ADDLs in the brain of AD patients. Despite being significant to the understanding of AD mechanism, no atomic-resolution structures are available for these species due to the evanescent nature of ADDLs that hinders most structural biophysical investigations. Based on our molecular modeling and computational studies, we have designed Met35Nle and G37p mutations in the Aβ(42 peptide (Aβ(42Nle35p37 that appear to organize Aβ(42 into stable oligomers. 2D NMR on the Aβ(42Nle35p37 peptide revealed the occurrence of two β-turns in the V24-N27 and V36-V39 stretches that could be the possible cause for the oligomer stability. We did not observe corresponding NOEs for the V24-N27 turn in the Aβ(21-43Nle35p37 fragment suggesting the need for the longer length amyloid peptide to form the stable oligomer promoting conformation. Because of the presence of two turns in the mutant peptide which were absent in solid state NMR structures for the fibrils, we propose, fibril formation might be hindered. The biophysical information obtained in this work could aid in the development of structural models for toxic oligomer formation that could facilitate the development of therapeutic approaches to AD.

  13. Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

    Science.gov (United States)

    Bertke, Andrea S; Patel, Amita; Krause, Philip R

    2007-06-01

    Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

  14. Prenylcoumarins in One or Two Steps by a Microwave-Promoted Tandem Claisen Rearrangement/Wittig Olefination/Cyclization Sequence.

    Science.gov (United States)

    Schultze, Christiane; Schmidt, Bernd

    2018-05-04

    The one-pot synthesis of 8-prenylcoumarins from 1,1-dimethylallylated salicylaldehydes and the stabilized ylide [(ethoxycarbonyl)methylene]triphenylphosphorane under microwave conditions was found to have a limited scope. The sequence suffers from a difficult and sometimes low-yielding synthesis of the precursors and from a competing deprenylation upon microwave irradiation. This side reaction occurs in particular with electron rich arenes with two or more alkoxy groups at adjacent positions, a prominent substitution pattern in naturally occurring 8-prenylcoumarins. Both limitations of this one-step sequence were overcome by a two-step synthesis consisting of a microwave-promoted tandem allyl ether Claisen rearrangement/Wittig olefination and a subsequent olefin cross metathesis with 2-methyl-2-butene. The cross metathesis step proceeds with a high selectivity and yields exclusively the desired prenyl, rather than the alternative crotyl substituent. Several naturally occurring 8-prenylcoumarins that were previously inaccessible have been synthesized in good overall yields along this route.

  15. TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

    Science.gov (United States)

    Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

    2013-11-18

    Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

  16. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  17. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    Directory of Open Access Journals (Sweden)

    Adam G Marsh

    Full Text Available Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera and an anemone (Nematostella vectensis. Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to

  18. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    Science.gov (United States)

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

  19. Inventories and upstream gasoline price dynamics

    NARCIS (Netherlands)

    Kuper, Gerard H.

    This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

  20. Russian upstream joint ventures logging progress

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that Occidental Petroleum Corp. has begun exporting oil from Russia as part of an enhanced recovery joint venture in western Siberia. Oxy holds a 50% interest in the joint venture company, Vanyoganneft, and will market the oil. In other activity, two Canadian companies are marking progress with Russian upstream joint ventures

  1. Characterizing leader sequences of CRISPR loci

    DEFF Research Database (Denmark)

    Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

    2016-01-01

    The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

  2. Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

    OpenAIRE

    Leoni, L; Ciervo, A; Orsi, N; Visca, P

    1996-01-01

    The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...

  3. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi

    2016-07-28

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  4. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  5. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  6. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  7. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  8. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  9. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  10. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  11. Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

    OpenAIRE

    Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

    2017-01-01

    This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...

  12. Anatomy of top 100 upstream players

    International Nuclear Information System (INIS)

    Burk, V.A.

    1992-01-01

    A brief review is given of a recent survey of the top one hundred upstream oil and gas companies which file financial data with the US Securities and Exchange Commission. The analysis indicates the increasing globalisation of the industry with exploration and development spending increasing dramatically outside the US. To survive, companies must operate as efficient low cost finders and producers of oil and gas and anticipate and meet changing market demands quickly. (UK)

  13. Upstream Atlantic salmon (Salmo salar) passage

    International Nuclear Information System (INIS)

    Clay, C.H.

    1993-01-01

    Upstream salmon passage though a dam is discussed with respect to three main components: the fishway entrance, the fishway, and the exit. Design considerations and alternative types of components are presented. For fishway entrances, an important consideration is the positioning of the entrance as far upstream as the fish can swim with respect to obstacles. For powerhouses using water diverted from a river, the problem of leading fish past the powerhouse may be overcome by either installing a tailrace barrier or increasing the flow until the home stream odor is sufficient to attract fish. Swimming ability should be the first consideration in fishway design. Fishways with 50 cm drops per pool would be satisfactory in most cases. The problem of headwater fluctuation is overcome through careful fishway selection. Fish locks, hoists, and elevators are other alternatives to pool/weir fishways. The location for a fish exit must be decided on the basis of whether the fishway will be used only for upstream migrations. 5 refs., 1 fig., 1 tab

  14. Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

    Science.gov (United States)

    Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

    1999-01-01

    The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

  15. Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

    Science.gov (United States)

    Guo, Lei; Rhen, Turk

    2017-10-01

    Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Meeting the challenge : capturing the upstream

    International Nuclear Information System (INIS)

    Bogle, E.W.

    1998-01-01

    The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs

  17. Interaction of Energetic Particles with Discontinuities Upstream of Strong Shocks

    Science.gov (United States)

    Malkov, Mikhail; Diamond, Patrick

    2008-11-01

    Acceleration of particles in strong astrophysical shocks is known to be accompanied and promoted by a number of instabilities which are driven by the particles themselves. One of them is an acoustic (also known as Drury's) instability driven by the pressure gradient of accelerated particles upstream. The generated sound waves naturally steepen into shocks thus forming a shocktrain. Similar magnetoacoustic or Alfven type structures may be driven by pick-up ions, for example. We consider the solutions of kinetic equation for accelerated particles within the shocktrain. The accelerated particles are assumed to be coupled to the flow by an intensive pitch-angle scattering on the self-generated Alfven waves. The implications for acceleration and confinement of cosmic rays in this shock environment will be discussed.

  18. DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY

    OpenAIRE

    Miah Muhammad Adel

    2012-01-01

    Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...

  19. Canada's upstream petroleum industry : 1997 perspective

    International Nuclear Information System (INIS)

    1997-06-01

    A review of the trends and activities in the upstream petroleum industry during 1996 were presented, emphasizing the significance of the industry' contribution to Canada's economy. Among the areas included were highlights of Canada's hydrocarbon reserves, conventional production, frontier production, and non-conventional (oil sands) production. New market opportunities and activities in the pipeline transportation sector were also discussed. Environmental issues including health and safety received due attention. In this regard, the industry's efforts to work with government and other stakeholders to ensure that requirements for land use are balanced with the need to protect wilderness and wildlife habitat, received special mention. 16 figs

  20. Upstream Disaster Management to Support People Experiencing Homelessness.

    Science.gov (United States)

    Sundareswaran, Madura; Ghazzawi, Andrea; O'Sullivan, Tracey L

    2015-08-18

    The unique context of day-to-day living for people who are chronically homeless or living with housing insecurity puts them at high risk during community disasters. The impacts of extreme events, such as flooding, storms, riots, and other sources of community disruption, underscore the importance of preparedness efforts and fostering community resilience. This study is part of larger initiative focused on enhancing resilience and preparedness among high risk populations. The purpose of this study was to explore critical issues and strategies to promote resilience and disaster preparedness among people who are homeless in Canada. A sample of interviews (n=21) from key informants across Canada was analyzed to explore existing programs and supports for homeless populations. The data was selected from a larger sample of (n=43) interviews focused on programs and supports for people who are at heightened risk for negative impacts during disasters. Qualitative content analysis was used to extract emergent themes and develop a model of multi-level collaboration to support disaster resilience among people who are homeless. The results indicate there is a need for more upstream continuity planning, collaboration and communication between the emergency management sector and community service organizations that support people who are homeless. Prioritization and investment in the social determinants of health and community supports is necessary to promote resilience among this high-risk population. The findings from this study highlight the importance of acknowledging community support organizations as assets in disaster preparedness. Day-to-day resilience is an ongoing theme for people who are chronically homeless or living with housing insecurity. Upstream investment to build adaptive capacity and collaborate with community organizations is an important strategy to enhance community resilience.

  1. Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.

    Science.gov (United States)

    Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

    2017-06-01

    This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.

  2. Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

    Directory of Open Access Journals (Sweden)

    Ana Maria Salazar-Bryam

    2017-06-01

    Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology

  3. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    Science.gov (United States)

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  4. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

    Science.gov (United States)

    Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

    2017-06-20

    Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

    Science.gov (United States)

    Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

    1985-01-01

    We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

  6. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  7. A cooperative interaction between nontranslated RNA sequences and NS5A protein promotes in vivo fitness of a chimeric hepatitis C/GB virus B.

    Directory of Open Access Journals (Sweden)

    Lucile Warter

    Full Text Available GB virus B (GBV-B is closely related to hepatitis C virus (HCV, infects small non-human primates, and is thus a valuable surrogate for studying HCV. Despite significant differences, the 5' nontranslated RNAs (NTRs of these viruses fold into four similar structured domains (I-IV, with domains II-III-IV comprising the viral internal ribosomal entry site (IRES. We previously reported the in vivo rescue of a chimeric GBV-B (vGB/III(HC containing HCV sequence in domain III, an essential segment of the IRES. We show here that three mutations identified within the vGB/III(HC genome (within the 3'NTR, upstream of the poly(U tract, and NS5A coding sequence are necessary and sufficient for production of this chimeric virus following intrahepatic inoculation of synthetic RNA in tamarins, and thus apparently compensate for the presence of HCV sequence in domain III. To assess the mechanism(s underlying these compensatory mutations, and to determine whether 5'NTR subdomains participating in genome replication do so in a virus-specific fashion, we constructed and evaluated a series of chimeric subgenomic GBV-B replicons in which various 5'NTR subdomains were substituted with their HCV homologs. Domains I and II of the GBV-B 5'NTR could not be replaced with HCV sequence, indicating that they contain essential, virus-specific RNA replication elements. In contrast, domain III could be swapped with minimal loss of genome replication capacity in cell culture. The 3'NTR and NS5A mutations required for rescue of the related chimeric virus in vivo had no effect on replication of the subgenomic GBneoD/III(HC RNA in vitro. The data suggest that in vivo fitness of the domain III chimeric virus is dependent on a cooperative interaction between the 5'NTR, 3'NTR and NS5A at a step in the viral life cycle subsequent to genome replication, most likely during particle assembly. Such a mechanism may be common to all hepaciviruses.

  8. Kin28 regulates the transient association of Mediator with core promoters.

    Science.gov (United States)

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  9. Upstream from OPERA: extreme attention to detail

    CERN Multimedia

    CERN Bulletin

    2011-01-01

    Two weeks ago, at a seminar held at CERN, the OPERA collaboration revealed their astonishing observation: neutrinos might move faster than light. The finding is currently under scrutiny in the scientific community. While the result downstream at Gran Sasso speaks for itself, upstream at CERN things are no less intriguing, with high-tech GPS systems, novel techniques for accurately measuring the time, and unique ways keeping the initial particle beam stable. Take away one ingredient and the accuracy needed for the final measurement is spoiled.   Underground installations of the CERN Neutrinos to Gran Sasso (CNGS) project. First ingredient: a stable beam CERN produces neutrinos by sending a beam of protons to hit a target. The collisions produce a secondary beam, which mostly consists of pions and kaons that decay in flight within an evacuated tunnel. Their decay products are muons and muon-neutrinos. An absorber stops the pions and kaons that do not decay, while the resulting muons are absorb...

  10. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  11. Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

    Science.gov (United States)

    Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

    2013-12-01

    Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

  12. Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone

    International Nuclear Information System (INIS)

    Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.

    1987-01-01

    Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor

  13. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  14. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-27

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  15. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  16. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  17. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter.

    NARCIS (Netherlands)

    Christiansen, H.; Hansen, A.C.; Vijn, I.; Pallisgaard, N.; Larsen, K.; Yang, W.C.; Bisseling, T.; Marcker, K.A.; Jensen, E.O.

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod

  18. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    Science.gov (United States)

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  19. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  20. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  1. Upstream petroleum industry flaring guide : review draft

    International Nuclear Information System (INIS)

    1999-03-01

    The Alberta requirements and expectations for upstream petroleum flaring are presented. Flaring is associated with a wide range of energy activities including oil and gas well drilling and well completion operations. The guide incorporates the recommendations made to the Alberta Energy and Utilities Board (EUB) in June 1998 by the multi-stakeholder Clean Air Strategic Alliance (CASA) on associated or solution gas flaring. Additional requirements which address flaring issues not covered in the CASA report are also included in this guide. The Guide requires a 15 per cent reduction in solution gas flare volume by the end of year 2000 from the 1996 baseline, and a 25 per cent reduction by the end of 2001. The Guide prescribes new flare performance requirements for all flares, within three years for existing solution gas flares, five years for flares at other existing permanent facilities. It sets personal consultation and public notification requirements for new and existing solution gas batteries, and new sulphur recovery requirements for facilities not covered by existing EUB regulations. The Guide also addresses the question of conflict resolution to deal with flaring concerns, the release of flaring and venting data, the proposed reduction of flare limits, progress towards minimizing requirements for electricity generators using otherwise flared gas, annual reporting to the EUB, and management framework review in 2001

  2. Analysis of the pelE promoter in Erwinia chrysanthemi EC16.

    Science.gov (United States)

    Gold, S; Nishio, S; Tsuyumu, S; Keen, N T

    1992-01-01

    The pelE gene of Erwinia chrysanthemi strain EC16 encodes an extracellular pectate lyase protein that is important in virulence on plants. Control of pelE expression is complex, because the gene is regulated by catabolite repression, substrate induction, and growth-phase inhibition. A Tn7-lux reporter gene system was employed to define DNA sequences comprising the pelE promoter. When EC16 cells were grown on medium containing sodium polypectate, pelE transcriptional start sites were observed only at 95 and 96 bases upstream of the translational start site. However, DNA sequences required for pelE expression were also shown by deletion analysis to reside between 196 and 215 base pairs upstream of the translational start site. In addition to these upstream elements, two putative operator sequences that interact with negative regulatory factors occurred downstream of the transcriptional start. Finally, deletion of three bases from a putative catabolite gene activator protein binding site in the pelE promoter eliminated activity. The data demonstrate that the pelE promoter is complex and suggest that it interacts with several regulatory proteins.

  3. Conserved upstream open reading frames in higher plants

    Directory of Open Access Journals (Sweden)

    Schultz Carolyn J

    2008-07-01

    Full Text Available Abstract Background Upstream open reading frames (uORFs can down-regulate the translation of the main open reading frame (mORF through two broad mechanisms: ribosomal stalling and reducing reinitiation efficiency. In distantly related plants, such as rice and Arabidopsis, it has been found that conserved uORFs are rare in these transcriptomes with approximately 100 loci. It is unclear how prevalent conserved uORFs are in closely related plants. Results We used a homology-based approach to identify conserved uORFs in five cereals (monocots that could potentially regulate translation. Our approach used a modified reciprocal best hit method to identify putative orthologous sequences that were then analysed by a comparative R-nomics program called uORFSCAN to find conserved uORFs. Conclusion This research identified new genes that may be controlled at the level of translation by conserved uORFs. We report that conserved uORFs are rare (

  4. Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

    International Nuclear Information System (INIS)

    Gangwar, Shanti P.; Meena, Sita R.; Saxena, Ajay K.

    2012-01-01

    The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C222 1 , with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

  5. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

    DEFF Research Database (Denmark)

    Christiansen, H; Hansen, A C; Vijn, I

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...

  6. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    Science.gov (United States)

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  7. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  8. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    Energy Technology Data Exchange (ETDEWEB)

    Damiani, R.D. Jr.; Wessler, S.R. (Univ. of Georgia, Athens, GA (United States))

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

  9. Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

    Directory of Open Access Journals (Sweden)

    Shuichi Shimmura

    2017-07-01

    Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

  10. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  11. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  13. Prospecting plant growth promoting bacteria and cyanobacteria as options for enrichment of macro- and micronutrients in grains in rice–wheat cropping sequence

    Directory of Open Access Journals (Sweden)

    Anuj Rana

    2015-12-01

    Full Text Available The influence of plant growth promoting bacteria (PGPB and cyanobacteria, alone and in combination, was investigated on micronutrient enrichment and yield in rice–wheat sequence, over a period of two years. Analysis of variance (ANOVA in both crops indicated significant differences in soil dehydrogenase activity and micronutrient enrichment in grains (Fe, Zn in rice, and Cu, Mn in wheat. The combined inoculation of Anabaena oscillarioides CR3, Brevundimonas diminuta PR7, and Ochrobactrum anthropi PR10 (T6 significantly increased nitrogen, phosphorus, and potassium (NPK content and improved rice yield by 21.2%, as compared to the application of recommended dose of NPK fertilizers (T2. The treatment T5 (Providencia sp. PR3 + B. diminuta PR7 + O. anthropi PR10 recorded an enhancement of 13–16% in Fe, Zn, Cu, and Mn concentrations, respectively, in rice grains. In wheat, Providencia sp. PW5 (T6 recorded the highest yield (5.23 Mg ha−1 and significantly higher enrichment of Fe and Cu (44–45% in the grains. This study highlighted the promise of combinations of cyanobacteria/bacteria and their synergistic action in biofortification and providing savings of 40–60 kg N ha−1. Future focus needs to be towards integrating such promising environment-friendly and environmentally sustainable options in nutrient management strategies for this cropping sequence.

  14. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mette Burmølle

    Full Text Available Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids into a laboratory strain (Escherichia coli Genehogs® for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54 and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33 were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  15. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Science.gov (United States)

    Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

    2012-01-01

    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  16. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  17. Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter.

    Science.gov (United States)

    Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana

    2007-01-01

    The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.

  18. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    Science.gov (United States)

    2009-01-01

    Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

  19. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    Directory of Open Access Journals (Sweden)

    Lindberg Pia

    2009-03-01

    Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.

  20. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    Science.gov (United States)

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  1. Impact of upstream industrial effluents on irrigation water quality ...

    African Journals Online (AJOL)

    Impact of upstream industrial effluents on irrigation water quality, soils and ... Knowledge of irrigation water quality is critical to predicting, managing and reducing salt ... Presence of heavy metals in concentration higher than the recommended ...

  2. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    Science.gov (United States)

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  3. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  4. Synthetic promoter libraries for Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

    2014-01-01

    The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

  5. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Hou Jinna

    2012-12-01

    Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

  6. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

    Science.gov (United States)

    Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

    2012-12-15

    Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

  7. Whole genome sequencing and analysis of plant growth promoting bacteria isolated from the rhizosphere of plantation crops coconut, cocoa and arecanut.

    Directory of Open Access Journals (Sweden)

    Alka Gupta

    Full Text Available Coconut, cocoa and arecanut are commercial plantation crops that play a vital role in the Indian economy while sustaining the livelihood of more than 10 million Indians. According to 2012 Food and Agricultural organization's report, India is the third largest producer of coconut and it dominates the production of arecanut worldwide. In this study, three Plant Growth Promoting Rhizobacteria (PGPR from coconut (CPCRI-1, cocoa (CPCRI-2 and arecanut (CPCRI-3 characterized for the PGP activities have been sequenced. The draft genome sizes were 4.7 Mb (56% GC, 5.9 Mb (63.6% GC and 5.1 Mb (54.8% GB for CPCRI-1, CPCRI-2, CPCRI-3, respectively. These genomes encoded 4056 (CPCRI-1, 4637 (CPCRI-2 and 4286 (CPCRI-3 protein-coding genes. Phylogenetic analysis revealed that both CPCRI-1 and CPCRI-3 belonged to Enterobacteriaceae family, while, CPCRI-2 was a Pseudomonadaceae family member. Functional annotation of the genes predicted that all three bacteria encoded genes needed for mineral phosphate solubilization, siderophores, acetoin, butanediol, 1-aminocyclopropane-1-carboxylate (ACC deaminase, chitinase, phenazine, 4-hydroxybenzoate, trehalose and quorum sensing molecules supportive of the plant growth promoting traits observed in the course of their isolation and characterization. Additionally, in all the three CPCRI PGPRs, we identified genes involved in synthesis of hydrogen sulfide (H2S, which recently has been proposed to aid plant growth. The PGPRs also carried genes for central carbohydrate metabolism indicating that the bacteria can efficiently utilize the root exudates and other organic materials as energy source. Genes for production of peroxidases, catalases and superoxide dismutases that confer resistance to oxidative stresses in plants were identified. Besides these, genes for heat shock tolerance, cold shock tolerance and glycine-betaine production that enable bacteria to survive abiotic stress were also identified.

  8. The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

    Science.gov (United States)

    Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

    2011-03-01

    Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Valuating Indonesian upstream oil management scenario through system dynamics modelling

    Science.gov (United States)

    Ketut Gunarta, I.; Putri, F. A.

    2018-04-01

    Under the existing regulation in Constitution Number 22 Year 2001 (UU No 22 Tahun 2001), Production Sharing Contract (PSC) continues to be the scenario in conducting oil and gas upstream mining activities as the previous regulation (UU No. 8 Tahun 1971). Because of the high costs and risks in upstream mining activities, the contractors are dominated by foreign companies, meanwhile National Oil Company (NOC) doesn’t act much. The domination of foreign contractor companies also warned Indonesia in several issues addressing to energy independence and energy security. Therefore, to achieve the goals of energy which is independence and security, there need to be a revision in upstream oil activities regulating scenario. The scenarios will be comparing the current scenario, which is PSC, with the “full concession” scenario for National Oil Company (NOC) in managing oil upstream mining activities. Both scenario will be modelled using System Dynamics methodology and assessed furthermore using financial valuation method of income approach. Under the 2 scenarios, the author will compare which scenario is better for upstream oil management in reaching the goals mentioned before and more profitable in financial aspect. From the simulation, it is gathered that concession scenario offers better option than PSC in reaching energy independence and energy security.

  10. Participation costs can suppress the evolution of upstream reciprocity.

    Science.gov (United States)

    Peña, Jorge; Pestelacci, Enea; Berchtold, André; Tomassini, Marco

    2011-03-21

    Indirect reciprocity, one of the many mechanisms proposed to explain the evolution of cooperation, is the idea that altruistic actions can be rewarded by third parties. Upstream or generalized reciprocity is one type of indirect reciprocity in which individuals help someone if they have been helped by somebody else in the past. Although empirically found to be at work in humans, the evolution of upstream reciprocity is difficult to explain from a theoretical point of view. A recent model of upstream reciprocity, first proposed by Nowak and Roch (2007) and further analyzed by Iwagami and Masuda (2010), shows that while upstream reciprocity alone does not lead to the evolution of cooperation, it can act in tandem with mechanisms such as network reciprocity and increase the total level of cooperativity in the population. We argue, however, that Nowak and Roch's model systematically leads to non-uniform interaction rates, where more cooperative individuals take part in more games than less cooperative ones. As a result, the critical benefit-to-cost ratios derived under this model in previous studies are not invariant with respect to the addition of participation costs. We show that accounting for these costs can hinder and even suppress the evolution of upstream reciprocity, both for populations with non-random encounters and graph-structured populations. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    Science.gov (United States)

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  12. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    Directory of Open Access Journals (Sweden)

    Feng-Yu Wang

    Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  13. Upstream Tracking and the Decay $B^{0} \\to K^{+}\\pi^{-}\\mu^{+}\\mu^{-}$ at the LHCb Experiment

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00388407; Serra, Nicola; Steinkamp, Olaf; Storaci, Barbara

    The LHCb detector is a single-arm forward spectrometer covering the pseudorapidity range $2 < \\eta < 5$, designed to search for indirect evidence of New Physics in $C\\!P$ violation and rare decays of beauty and charm hadrons. The unique geometry takes advantage of the large $b$ and $c$ quark production in the forward region at the LHC. The detector includes a high granularity silicon-strip vertex detector, a silicon-strip detector upstream of the magnet and three stations of silicon-strip detectors and straw drift tubes downstream of the magnet. This thesis is divided into two main parts. The first part details the development of improved algorithms to perform track reconstruction using the sub-detectors upstream of the LHCb magnet. A novel idea to perform upstream tracking as an intermediate step of the track reconstruction sequence was investigated. The vast gains in tracking performance obtained when using upstream tracks led to the algorithm being adopted into the default reconstruction sequence for...

  14. Human Resource Local Content in Ghana's Upstream Petroleum Industry

    Science.gov (United States)

    Benin, Papa

    Enactment of Ghana's Petroleum (Local Content and Local Participation) Regulations, 2013 (L.I. 2204) was intended to regulate the percentage of local products, personnel, financing, and goods and services rendered within Ghana's upstream petroleum industry value chain. Five years after the inception of Ghana's upstream oil and gas industry, a gap is evident between the requirements of L.I. 2204 and professional practice. Drawing on Lewin's change theory, a cross-sectional study was conducted to examine the extent of differences between the prevailing human resource local content and the requirements of L.I. 2204 in Ghana's upstream petroleum industry. The extent to which training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its upstream petroleum industry was also examined. Survey data were collected from 97 management, technical, and other staff in 2 multinational petroleum companies whose oil and gas development plans have been approved by the Petroleum Commission of Ghana. To answer the research questions and test their hypotheses, one-way ANOVA was performed with staff category (management, technical, and other) as the independent variable and prevalent local content as the dependent variable. Results indicated that prevailing local content in Ghana's upstream petroleum industry meets the requirements of L.I. 2204. Further, training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its offshore petroleum industry. Findings may encourage leaders within multinational oil companies and the Petroleum Commission of Ghana to organize educational seminars that equip indigenous Ghanaians with specialized skills for working in Ghana's upstream petroleum industry.

  15. Exploring Social Learning through Upstream Engagement in Science and Technology

    DEFF Research Database (Denmark)

    Mortensen, Jonas Egmose

    This discussion paper deliberates on how the concept of social learning can be used for evaluating upstream engagement initiatives in science and technology.  The paper briefly introduces to the concept of upstream engagement and a concrete case, the UK Citizen Science for Sustainability project...... (SuScit), as an outset for discussing how the concept of social learning can be used for analysing and understanding relations between citizen participation, Science and research, and sustainability. A number of relevant research questions and methodological considerations are distilled...

  16. Upstream oil and gas industry options paper : report of the upstream oil and gas working group of the Industry Issues Table to the National Climate Change Secretariat

    International Nuclear Information System (INIS)

    1999-09-01

    The Canadian Association of Petroleum Producers (CAPP) has coordinated the efforts of the upstream oil and natural gas industry to draft a foundation paper to provide data on industry greenhouse gas (GHG) emissions and actions. This paper is a technical piece targeted at government officials and stakeholders involved in the National Climate Change Secretariat process. The paper also outlines the context for considering policies aimed at reducing oil and gas industry emissions on climate change. The 6 key messages that CAPP wanted to emphasize in this paper were: (1) Canada's situation is very different from that of the U.S. and most other industrial countries, (2) GHG emissions are primarily an end-use consumption issue, (3) the climate change issue and the Kyoto Protocol present a major uncertainty that could undermine Canadian oil and natural gas development opportunities, (4) Canada should not be penalised by its growth of oil and natural gas resources, (5) the ability to reduce emissions by changing production technology is limited because large reductions in Canadian upstream emissions would only mean a shift of production to other countries which would not help to reduce global emissions, and (6) Canada should focus on promoting cost-effective action, research and development and international flexibility, and ensure that recognition is given to those companies that reduce emissions. tabs., figs

  17. Genome-wide mapping of autonomous promoter activity in human cells.

    Science.gov (United States)

    van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

    2017-02-01

    Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

  18. Sector report: Malaysia. Upstream oil and gas industry

    International Nuclear Information System (INIS)

    1997-01-01

    This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market in oil and natural gas. The report includes Malaysia's oil and gas reserves, production, exploration, major profits upstream, production sharing contracts, pipeline construction, operators in production, service sector, and Petronas. (UK)

  19. Collisionless shocks and upstream waves and particles: Introductory remarks

    International Nuclear Information System (INIS)

    Kennel, C.F.

    1981-01-01

    We discuss more aspects of collisionless shock theory that might be pertinent to the problem of upstream waves and particles. It is hoped that our qualititive remarks may be a useful guide for the general reader as he goes through the detailed papers to come

  20. Employee assistance programs in the upstream petroleum industry

    International Nuclear Information System (INIS)

    Crutcher, R.A.; Yip, R.Y.; Young, M.R.

    1991-01-01

    This paper is a descriptive overview of Employee Assistance Programs (EAPs) in the upstream Canadian petroleum industry. The authors review current EAP models within the occupational health setting and the Canadian health care context. This article also explores the challenging issues of EAP's emergent functions in workplace substance abuse programs, its changing role in organizational effectiveness and its professional identity

  1. Inlet effect induced ''upstream'' critical heat flux in smooth tubes

    International Nuclear Information System (INIS)

    Kitto, J.B. Jr.

    1986-01-01

    An unusual form of ''upstream'' critical heat flux (CHF) has been observed and directly linked to the inlet flow pattern during an experimental study of high pressure (17 - 20 MPa) water flowing through a vertical 38.1 mm ID smooth bore tube with uniform axial and nonuniform circumferential heating. These upstream CHF data were characterized by temperature excursions which initially occurred at a relatively fixed axial location in the middle of the test section while the outlet and inlet heated lengths experienced no change. A rifled tube inlet flow conditioner could be substituted for a smooth tube section to generate the desired swirling inlet flow pattern. The upstream CHF data were found to match data from a uniformly heated smooth bore tube when the comparison was made using the peak local heat flux. The mechanism proposed to account for the upstream CHF observations involves the destructive interference between the decaying swirl flow and the secondary circumferential liquid flow field resulting from the one-sided heating

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  3. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Directory of Open Access Journals (Sweden)

    Stephanie E Hesselson

    2009-09-01

    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  4. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  5. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  6. Fiscal 2000 project for promoting international cooperation. Survey report on preparation of technological information in APEC region (Upstream area: preparation of video for training); 2000 nendo kokusai kyoryoku suishin jigyo chosa hokokusho. APEC iki nai ni okeru gijutsu joho seibi ni kakawaru chosa (Joryu bunya - kenshu you video sakusei)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    With the purpose of spreading and promoting clean coal technology (CCT) in coal producing countries in the APEC region, videos for training use were prepared so as to contribute to the reduction in environmental problems through the introduction of the coal cleaning and wastewater treatment technologies used in Japanese mines. In the video, comparison is made between the untreated wastewater and cleaned water flowing in and out of a present coal-cleaning plant, with the purification ratio determined, recognisably showing the effect by the cleaning facilities, and introducing the type of equipment required to satisfy the standard under the regulation. Also introduced is a technology for utilizing sludge collected in a sedimentation pond and fly ash scavenged in a private power plant. The videotape was prepared for 40 reels in English, 40 in Chinese, and 20 in Indonesian. The video title is 'Environmental safeguard of coal cleaning plant', and the contents are the importance of wastewater treatment and measures against water pollution, wastewater treatment technology in Taiheiyo coal mines, and wastewater treatment technology in Ikeshima coal mines. (NEDO)

  7. Tectonic uplift-influenced monsoonal changes promoted hominin occupation of the Luonan Basin: Insights from a loess-paleosol sequence, eastern Qinling Mountains, central China

    Science.gov (United States)

    Fang, Qian; Hong, Hanlie; Zhao, Lulu; Furnes, Harald; Lu, Huayu; Han, Wen; Liu, Yao; Jia, Zhuoyue; Wang, Chaowen; Yin, Ke; Algeo, Thomas J.

    2017-08-01

    Quaternary soil deposits from northern and southern China are distinctly different, reflecting variability of the East Asian monsoon north and south of the Qinling Mountains. Coeval sediments from the transitional climatic zone of central China, which are little studied to date, have the potential to improve our understanding of Quaternary monsoon changes and associated influences on hominin occupation of this region. Here, we investigate in detail a well-preserved and continuous Quaternary loess-paleosol sequence (Shangbaichuan) from the Luonan Basin, using a variety of weathering indices including major and trace element ratios, clay mineralogy, and Fe-oxide mineralogy. The whole-rock samples display similar rare earth element patterns characterized by upper continental crustal ratios: (La/Yb)N ≈ 9.5 and Eu/Eu* ≈ 0.65. Elemental data such as (La/Yb)N, La/Th and Eu/Eu* ratios show a high degree of homogeneity, suggesting that dust in the source region may have been thoroughly mixed and recycled, resulting in all samples having a uniform initial composition. Indices for pedogenic weathering such as Na/K, Ba/Sr, Rb/Sr, CIA, CIW, CPA, PIA, kaolinite/illite, (kaolinite + smectite)/illite, and hematite/(hematite + goethite) exhibit similar secular trends and reveal a four-stage accumulation history. The indices also indicate that the climate was warmer and wetter during the most recent interglacial stage, compared with coeval environments of the Chinese Loess Plateau. Secular changes in weathering intensity can be related to stepwise uplift of the Qinling Mountains and variation in East Asian monsoon intensity, both of which played significant roles in controlling climate evolution in the Luonan Basin. Furthermore, intensified aridity and winter monsoon strength in dust source areas, as evidenced by mineralogic and geochemical changes, may have been due to the mid-Pleistocene climate transition. Based on temporal correlation of warmer and wetter climatic conditions

  8. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  9. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  10. On-line soft sensing in upstream bioprocessing.

    Science.gov (United States)

    Randek, Judit; Mandenius, Carl-Fredrik

    2018-02-01

    This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

  11. Upstream-downstream cooperation approach in Guanting Reservoir watershed.

    Science.gov (United States)

    Yang, Zhi-Feng; Zhang, Wen-Guo

    2005-01-01

    A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.

  12. Torque fluctuations caused by upstream mean flow and turbulence

    Science.gov (United States)

    Farr, T. D.; Hancock, P. E.

    2014-12-01

    A series of studies are in progress investigating the effects of turbine-array-wake interactions for a range of atmospheric boundary layer states by means of the EnFlo meteorological wind tunnel. The small, three-blade model wind turbines drive 4-quadrant motor-generators. Only a single turbine in neutral flow is considered here. The motor-generator current can be measured with adequate sensitivity by means of a current sensor allowing the mean and fluctuating torque to be inferred. Spectra of torque fluctuations and streamwise velocity fluctuations ahead of the rotor, between 0.1 and 2 diameters, show that only the large-scale turbulent motions contribute significantly to the torque fluctuations. Time-lagged cross-correlation between upstream velocity and torque fluctuations are largest over the inner part of the blade. They also show the turbulence to be frozen in behaviour over the 2 diameters upstream of the turbine.

  13. Environmental regulatory framework for the upstream petroleum industry

    International Nuclear Information System (INIS)

    1996-01-01

    In order to provide its member companies with a useful reference document in environmental analysis and compliance, CAPP compiled a list of Canadian legislation, regulations and guidelines which relate to the upstream petroleum industry. Text of all federal, Alberta, British Columbia and Saskatchewan legislation, regulations, guidelines and related documents were provided. Pending legislation, regulations and government policy have been identified. Annual updates will be provided to all subscribers

  14. Entrepreneurial Leadership in Upstream Oil and Gas Industry

    OpenAIRE

    Kalu, Mona Ukpai

    2015-01-01

    The study examined Entrepreneurial leadership in Upstream Oil and Gas industry and its ability to accelerate innovative energy technology development. The declining deliverability from existing reservoirs and ever increasing demand for energy to fuel growth in many parts of the world is driving oil and gas exploration into more difficult to access reservoirs like bituminous sands and shale gas. Accelerating new innovative technology development to access these new streams of profitable oil an...

  15. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    Science.gov (United States)

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  16. DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

    Energy Technology Data Exchange (ETDEWEB)

    Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)

    2016-03-01

    Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.

  17. Upstream waves simultaneously observed by ISEE and UKS

    International Nuclear Information System (INIS)

    Russell, C.T.; Luhmann, J.G.; Elphic, R.C.; Southwood, D.J.; Smith, M.F.; Johnstone, A.D.

    1987-01-01

    Measurements obtained in the solar wind by ISEE-2 and the United Kingdom Subsatellite (UKS) have been examined for observations of upstream waves. These data reveal that the waves in the foreshock region are enhanced at all frequencies from at least 0.003 Hz to 0.5 Hz. The wave spectra generally have a spectral peak, but this peak is usually broad and the peak frequency depends on the position of the spacecraft. Generally, the spectra seen at the two spacecraft are most similar at high frequencies and least similar at low frequencies. The geometry of the interaction is displayed in the plane containing the magnetic field, the solar wind velocity, and the spacecraft location. However, this coordinate system does not order all the observed wave properties. It does not clearly explain or order the handedness of the waves, or their direction of propagation. It is clear that the upstream region is inherently three-dimensional. The position-dependent nature of the upstream waves indicates that comparisons between ground-based measurements and in-situ observations must be undertaken with some caution

  18. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  19. Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

    Science.gov (United States)

    Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

    2011-04-29

    Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  1. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  2. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  3. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  4. Monitoring upstream sinkhole development by detailed sonar profiling

    Energy Technology Data Exchange (ETDEWEB)

    Rigbey, S. [Acres International Ltd., Niagara Falls, ON (Canada)

    2004-09-01

    This paper describes the development and use of a simple sonar system that has been used by engineers for routine monitoring of small sinkholes on the upstream face of a distressed earth dam. Improper construction of the dam led to the development of several sinkholes measuring 10 to 20 m in diameter upstream from the dam which is founded on deep alluvial sands and gravels. The dam has a central core of silt and leakage varies between 200 and 500 l/s, depending on the water level of the reservoir. The main issues with the upstream blanket are: improper fill placement due to the inability to dewater the area properly; omission of a filter material between the blanket and the alluvium foundation; thin placement of fill and runnelling of the blanket prior to impoundment; and, short upstream extent of the blanket. A downstream weighting toe of material was placed to address the seepage and piping that developed immediately following impounding. Other incidents continued over the years, such as downstream sinkholes, slumping of the crest and repairs about 12 years after construction. An inverter filter was also constructed to better control the seepage. Simple bathymetric surveys conducted by sounding the bottom of the reservoir from the ice surface each winter revealed the presence of several large sinkholes. Although infilling programs were conducted, sinkholes redeveloped after each program. The bathymetric surveys were found to be limited in accuracy and repeatability. Therefore, it was not possible to monitor small developments on a yearly basis. A 3-dimensional seepage model was developed to reconcile some of the unexplained piezometric patterns and to better understand the seepage patterns. However, this was also unsuccessful on its own. A trial sonar survey was then undertaken in 2002 by a Vancouver-based sonar company using an Imagenix profiling sonar head. It was successful in locating a small, previously unknown sinkhole measuring a few metres in diameter at

  5. Molecular Evolution of Two Distinct dmrt1 Promoters for Germ and Somatic Cells in Vertebrate Gonads.

    Science.gov (United States)

    Mawaribuchi, Shuuji; Musashijima, Masato; Wada, Mikako; Izutsu, Yumi; Kurakata, Erina; Park, Min Kyun; Takamatsu, Nobuhiko; Ito, Michihiko

    2017-03-01

    The transcription factor DMRT1 has important functions in two distinct processes, somatic-cell masculinization and germ-cell development in mammals. However, it is unknown whether the functions are conserved during evolution, and what mechanism underlies its expression in the two cell lineages. Our analysis of the Xenopus laevis and Silurana tropicalis dmrt1 genes indicated the presence of two distinct promoters: one upstream of the noncoding first exon (ncEx1), and one within the first intron. In contrast, only the ncEx1-upstream promoter was detected in the dmrt1 gene of the agnathan sand lamprey, which expressed dmrt1 exclusively in the germ cells. In X. laevis, the ncEx1- and exon 2-upstream promoters were predominantly used for germ-cell and somatic-cell transcription, respectively. Importantly, knockdown of the ncEx1-containing transcript led to reduced germ-cell numbers in X. laevis gonads. Intriguingly, two genetically female individuals carrying the knockdown construct developed testicles. Analysis of the reptilian leopard gecko dmrt1 revealed the absence of ncEx1. We propose that dmrt1 regulated germ-cell development in the vertebrate ancestor, then acquired another promoter in its first intron to regulate somatic-cell masculinization during gnathostome evolution. In the common ancestor of reptiles and mammals, only one promoter got function for both the two cell lineages, accompanied with the loss of ncEx1. In addition, we found a conserved noncoding sequence (CNS) in the dmrt1 5'-flanking regions only among amniote species, and two CNSs in the introns among most vertebrates except for agnathans. Finally, we discuss relationships between these CNSs and the promoters of dmrt1 during vertebrate evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  7. Draft genome sequence of Burkholderia sordidicola S170, a potential plant growth promoter isolated from coniferous forest soil in the Czech Republic

    DEFF Research Database (Denmark)

    Lladó, Salvador; Xu, Zhuofei; Sørensen, Søren Johannes

    2014-01-01

    Burkholderia species are key players in the accumulation of carbon from cellulose decomposition in coniferous forest ecosystems. We report here the draft genome of Burkholderia sordidicola strain S170, containing features associated with known genes involved in plant growth promotion...

  8. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    Science.gov (United States)

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  9. Increased risk of oesophageal adenocarcinoma among upstream petroleum workers

    Science.gov (United States)

    Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C

    2013-01-01

    Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535

  10. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  11. Electromagnetic ion beam instability upstream of the earth's bow shock

    International Nuclear Information System (INIS)

    Gary, S.P.; Gosling, J.T.; Forslund, D.W.

    1981-01-01

    The linear theory of the electromagnetic ion beam instability for arbitrary angles of propagation has been studied. The parameters considered in the theory are typical of the solar wind upstream of the earth's bow shock when a 'reflected' proton beam is present. Maximum growth occurs for propagation parallel to the ambient field B, but this instability also displays significant growth at wave-vectors oblique to B, Oblique, unstable modes seem to be the likely source of the compressive magnetic fluctuations recently observed in conjunction with 'diffuse' ion population. An energetic ion beam does not directly give rise to linear growth of either ion acoustic or whistler mode instabilities

  12. Multiple upstream modules regulate zebrafish myf5 expression

    Directory of Open Access Journals (Sweden)

    Weng Chih-Wei

    2007-01-01

    Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

  13. ISEE/IMP Observations of simultaneous upstream ion events

    International Nuclear Information System (INIS)

    Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.

    1983-01-01

    Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft

  14. EMMPRIN, an upstream regulator of MMPs, in CNS biology.

    Science.gov (United States)

    Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

    2015-01-01

    Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

  15. A String Number-Line Lesson Sequence to Promote Students' Relative Thinking and Understanding of Scale, Key Elements of Proportional Reasoning

    Science.gov (United States)

    Hilton, Annette; Hilton, Geoff

    2018-01-01

    This article describes part of a study in which researchers designed lesson sequences based around using a string number line to help teachers support children's development of relative thinking and understanding of linear scale. In the first year of the study, eight teachers of Years 3-5 participated in four one-day professional development…

  16. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    Science.gov (United States)

    Shanak, Siba; Helms, Volkhard

    2014-12-01

    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  17. Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

    Science.gov (United States)

    Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

    2016-01-01

    Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

  18. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  19. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-13

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  20. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi; AL Bladi, Maha Lafi Saleh; Salem, Nida M.; Al-Banna, Luma; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  1. Draft Genome Sequence of Bacillus amyloliquefaciens EBL11, a New Strain of Plant Growth-Promoting Bacterium Isolated from Rice Rhizosphere

    Science.gov (United States)

    Wang, Yinghuan; Greenfield, Paul; Jin, Decai

    2014-01-01

    Bacillus amyloliquefaciens strain EBL11 is a bacterium that can promote plant growth by inhibiting the growth of fungi on plant surfaces and providing nutrients as a nonchemical biofertilizer. The estimated genome of this strain is 4.05 Mb in size and harbors 3,683 coding genes (CDSs). PMID:25059875

  2. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  3. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Lin, Dong; Shi, Y.; Miller, W.L.

    1990-01-01

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  4. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  5. RNA sequence determinants of a coupled termination-reinitiation strategy for downstream open reading frame translation in Helminthosporium victoriae virus 190S and other victoriviruses (Family Totiviridae).

    Science.gov (United States)

    Li, Hua; Havens, Wendy M; Nibert, Max L; Ghabrial, Said A

    2011-07-01

    The genome-length, dicistronic mRNA of the double-stranded RNA fungal virus Helminthosporium victoriae virus 190S (genus Victorivirus, family Totiviridae) contains two long open reading frames (ORFs) that overlap in the tetranucleotide AUGA. Translation of the downstream ORF, which encodes the RNA-dependent RNA polymerase (RdRp), has been proposed to depend on ribosomal reinitiation following termination of the upstream ORF, which encodes the capsid protein. In the current study, we examined the RNA sequence determinants for RdRp translation in this virus and demonstrated that a coupled termination-reinitiation (stop-restart) strategy is indeed used. Signals for termination-reinitiation are found within a 32-nucleotide stretch of RNA immediately upstream of the AUGA motif, including a predicted pseudoknot structure. The close proximity in which this predicted structure is followed by the upstream ORF's stop codon appears to be especially important for promoting translation of the downstream ORF. The normal strong preferences for an AUG start codon and the canonical sequence context to favor translation initiation appear somewhat relaxed for the downstream ORF. Similar sequence motifs and predicted RNA structures in other victoriviruses suggest that they all share a related stop-restart strategy for RdRp translation. Members of the genus Victorivirus thus provide new and unique opportunities for exploring the molecular mechanisms of translational coupling, which remain only partly understood in this and other systems.

  6. Identification of a novel temperature sensitive promoter in cho cells

    Directory of Open Access Journals (Sweden)

    Hesse Friedemann

    2011-05-01

    Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

  7. OGJ group weathered tough times upstream and downstream in 1991

    International Nuclear Information System (INIS)

    Biggs, J.B.; Price, R.B.

    1992-01-01

    With an upstream sector hit by low oil and gas prices and downstream operations squeezed by weak petroleum demand, 1991, was a tough year for the group of 22 major integrated U.S. companies Oil and Gas Journal tracks. This paper reports that the brief respite caused by the oil price spike in second half 1990 ended abruptly early in first half 1991, and it turned into a year of buckling down for most companies. They shed non-core assets, implemented strategic restructuring moves, and reduced staff. Although low prices slowed overall drilling activity for the group, oil and gas production increased slightly, and most companies reported reserves gains. Recession in the U.S. and Europe depressed demand for the group's fined products enough to pinch downstream earnings even as buoyant Asia-Pacific demand helped jack up world product sales

  8. SAP and life-cycle management in the upstream

    International Nuclear Information System (INIS)

    Davis, B.

    1997-01-01

    Business relationships today depend more than ever on changing alliances and partnerships to leverage risk in a commodity market. SAP is a fully integrated, enterprise-wide software system that uses business processes tightly integrated around a common data model to facilitate these business relationships across the oil and gas supply chain. The SAP modules contain the business processes that are needed to handle the logistics and operations maintenance for operating an oil or gas field. Each industry has unique business-process requirements that the core SAP application set may not cover. In the oil and gas business, there are unique financial requirements in the upstream for working in joint ventures. In the downstream business segment, handling bulk hydrocarbons requires additional functionality

  9. Shape and shear guide sperm cells spiraling upstream

    Science.gov (United States)

    Kantsler, Vasily; Dunkel, Jorn; Goldstein, Raymond E.

    2014-11-01

    A major puzzle in biology is how mammalian sperm determine and maintain the correct swimming direction during the various phases of the sexual reproduction process. Currently debated mechanisms for sperm long range travel vary from peristaltic pumping to temperature sensing (thermotaxis) and direct response to fluid flow (rheotaxis), but little is known quantitatively about their relative importance. Here, we report the first quantitative experimental study of mammalian sperm rheotaxis. Using microfluidic devices, we investigate systematically the swimming behavior of human and bull sperm over a wide range of physiologically relevant shear rates and viscosities. Our measurements show that the interplay of fluid shear, steric surface-interactions and chirality of the flagellar beat leads to a stable upstream spiraling motion of sperm cells, thus providing a generic and robust rectification mechanism to support mammalian fertilization. To rationalize these findings, we identify a minimal mathematical model that is capable of describing quantitatively the experimental observations.

  10. Statistical handbook for Canada's upstream petroleum industry: '96 updates

    International Nuclear Information System (INIS)

    1997-01-01

    The Statistical Handbook of CAPP is an annual compilation of useful information about the Canadian petroleum and natural gas industry. It has been published since 1955, and is a key source of upstream petroleum statistics. It presents a historical summary of the petroleum industry''s progress and provides detailed statistical information on the production and consumption of petroleum, petroleum products, natural gas and natural gas liquids, imports and exports, land sales, pipelines, reserves, drilling and refinery activities, and prices in Canada. The information, mostly in tabular form, is based on the latest available data (generally up to and including 1996). For the first time in 1997, the Handbook is also made available in CD-ROM format (EXCEL 5.0). Plans are also underway to publish the Handbook on a secure site on the Internet

  11. From Worker Health To Citizen Health: Moving Upstream

    Science.gov (United States)

    Sepulveda, Martin-Jose

    2014-01-01

    New rapid growth economies, urbanization, health systems crises and “big data” are causing fundamental changes in social structures and systems including health. These forces for change have significant consequences for occupational and environmental medicine and will challenge the specialty to think beyond workers and workplaces as the principal locus of innovation for health and performance. These trends are placing great emphasis on upstream strategies for addressing the complex systems dynamics of the social determinants of health. The need to engage systems in communities for healthier workforces is a shift in orientation from worker and workplace centric to citizen and community centric. This change for occupational and environmental medicine requires extending systems approaches in the workplace to communities which are systems of systems and which require different skills, data, tools and partnerships. PMID:24284749

  12. Optimized PCR with sequence specific primers (PCR-SSP for fast and efficient determination of Interleukin-6 Promoter -597/-572/-174Haplotypes

    Directory of Open Access Journals (Sweden)

    Bugert Peter

    2009-12-01

    Full Text Available Abstract Background Interleukin-6 (IL-6 promoter polymorphisms at positions -597(G→A, -572(G→C and -174(G→C were shown to have a clinical impact on different major diseases. At present PCR-SSP protocols for IL-6 -597/-572/-174haplotyping are elaborate and require large amounts of genomic DNA. Findings We describe an improved typing technique requiring a decreased number of PCR-reactions and a reduced PCR-runtime due to optimized PCR-conditions. Conclusion This enables a fast and efficient determination of IL-6 -597/-572/-174haplotypes in clinical diagnosis and further evaluation of IL-6 promoter polymorphisms in larger patient cohorts.

  13. Explosion Clad for Upstream Oil and Gas Equipment

    Science.gov (United States)

    Banker, John G.; Massarello, Jack; Pauly, Stephane

    2011-01-01

    Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO2 and/or H2S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

  14. Explosion Clad for Upstream Oil and Gas Equipment

    International Nuclear Information System (INIS)

    Banker, John G.; Massarello, Jack; Pauly, Stephane

    2011-01-01

    Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO 2 and/or H 2 S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

  15. Upstream particles observed in the earth's foreshock region

    International Nuclear Information System (INIS)

    Eastman, T.E.; Anderson, R.R.; Frank, L.A.; Parks, G.K.

    1981-01-01

    On the basis of primarily an extensive study of fully three-dimensional plasma data, we describe the interrelationships of the upstream particles and plasma waves observed in the earth's foreshock region. The University of Iowa LEPEDEAs detect ions and electrons from 1 eV to 45 keV over all except approx.2% of the unit sphere. Comparisons are made with high time resolution particle data obtained by the University of California (Berkeley) instruments and plasma wave data collected by the University of Iowa plasma wave instruments on the two ISEE spacecraft. The presence of ion beams or dispersed ion distributions is found to be a sufficient condition for the presence of electrostatic and electromagnetic wave emissions. Detailed correlations of ions with plasma waves down to a tenth of an ion gyroperiod indicate that ion acoustic emission is enhanced when increased anisotropies and gyrophase organization are observed. Time aliasing effects limit the interpretation of velocity distributions taken within the foreshock region. High time resolution correlations between the different instruments, however, demonstrate that time variations of a single isotropic or anisotropic distribution cannot produce the dispersed ion distributions. Detailed analysis of high time resolution data reveals that the upstream particles undergo significant spatial and temporal variations including gyrophase organization. Gyrophase organization comprises groups of ion clusters each one of which includes ions with similar pitch angles that gyrate together about a common guiding center. On the basis of our high time resolution analysis of three-dimensional plasma data combined with magnetic field and plasma wave data, we conclude that (1) ions observed in the foreshock region display gyrophase organization produced by ion clusters with a spatial scale <1 R/sub g/, and (2) dispersed ion distributions are produced primarily by direct sources at or near the bow shock

  16. Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

    Science.gov (United States)

    Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

    2017-01-01

    A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

  17. LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-04-01

    Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

  18. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  19. New genome sequence data and molecular tools promote the use of photosynthetic and edible cyanobacteria in bioregenerative systems to support human space exploration.

    Science.gov (United States)

    Leys, Natalie; Morin, Nicolas; Janssen, Paul; Mergeay, Max

    Cyanobacteria are daily used as nutritional supplements (e.g. Spirulina) and are considered for promising applications beyond Earth, in space, where they can play a crucial role in closed miniaturised biological waste recycling systems that are currently developed to support future long-term space missions. Cyanobacteria can be cultured with artificial light in controllable photobioreactors, and used for the efficient removal of CO2 from and production of O2 in the at-mosphere of the confined spacecraft, for removal of nitrate from waste water that is recycled to potable water, and as complementary food source. In this context, the filamentous cyanobac-terium Arthrospira sp. PCC 8005 was selected as part of the bio-regenerative life-support system MELiSSA from the European Space Agency. For bioprocess control and optimisation, the access to its genetic information and the development of molecular tools is crucial. Here we report on our efforts to determine the full genome of the cyanobacterium Arthrospira sp. PCC 8005. The obtained sequence data were analysed in detail to gain a better insight in the photosynthetic, nutritive, or potential toxic potential of this strain. In addition, the sensitivity of PCC 8005 to ionizing radiation was investigated because prolonged exposure of PCC 8005 to cosmic radiation in space might have a deleterious effect on its metabolism and oxygenic properties. To our knowledge, of the 6 different research groups across the globe trying to sequence Arthrospira strains, none of them, including us, were yet able to obtain a complete genome sequence. For Arthrospira sp. strain PCC 8005, we obtained 119 contigs (assembled in 16 scaffolds), representing 6,3 Mb, with 5,856 predicted protein-coding sequences (CDSs) and 176 genes encoding RNA. The PCC 8005 genome displays an unusual high number of large repeated sequences, covering around 8% of the genome, which likely hampered the sequenc-ing. The PCC 8005 genome is also ridden by mobile

  20. Sectoral approaches establishment for climate change mitigation in Thailand upstream oil and gas industry

    International Nuclear Information System (INIS)

    Chaiyapa, Warathida; Esteban, Miguel; Kameyama, Yasuko

    2016-01-01

    Understanding the upstream oil and gas (O&G) industry's responses to climate change and what factors can be influential to trigger their mitigation strategies is crucial for policy-makers to harness the huge resources that this industry can mobilize towards environmental protection. Considering that individual climate change efforts are unlikely to affect global mitigation paths, the study investigates the possibility that sectoral approaches can help in the reduction of greenhouse gas emissions, using Thailand as a case study. It conducted online questionnaire surveys and semi-structured interviews to acquire primary data from companies and key informants from the government, NGOs, NPOs and academics. The results suggested that, among three possible groups of factors that could affect company decisions on whether to promote sectoral approaches, domestic politics (particularly the Thai government) is the most important, though other factors also play important and interrelated roles. The most welcomed type of scheme that could be envisaged would appear to be a sectoral agreement between government and industry. Finally, the authors provide two main policy recommendations, namely the establishment of an industrial association of O&G companies and for it to target how to start looking at measures to reduce greenhouse gas emissions amongst large companies in the sector. - Highlights: •Examining the possibility of establishing a sectoral approach Thailand's upstream O&G industry. •Analytical framework was constructed to ascertain most influential factors. •Questionnaires and interviews were employed with companies, government, NGOs and academic. •Domestic politics is the most determining factor, but other factors have strong interrelation. •Sectoral agreement between government and industry is the most likely scheme to be established.

  1. Differences in sedge fen vegetation upstream and downstream from a managed impoundment

    Science.gov (United States)

    Kowalski, Kurt P.; Wilcox, Douglas A.

    2003-01-01

    The U.S. Fish and Wildlife Service proposed the restoration of wetlands impacted by a series of drainage ditches and pools located in an extensive undeveloped peatland in the Seney National Wildlife Refuge, Michigan. This study examined the nature and extent of degradation to the Marsh Creek wetlands caused by alteration of natural hydrology by a water-storage pool (C-3 Pool) that intersects the Marsh Creek channel. We tested the hypothesis that a reduction in moderate-intensity disturbance associated with natural water-level fluctuations below the C-3 dike contributed to lower species richness, reduced floristic quality and a larger tree and shrub component than vegetation upstream from the pool. Wetland plant communities were sampled quantitatively and analyzed for species richness, floristic quality and physiognomy. Aerial photographs, GIS databases and GPS data contributed to the characterization and analysis of the Marsh Creek wetlands. Results showed that there was lower species richness in vegetated areas downstream from the pool, but not the anticipated growth in shrubs. Wetland vegetation upstream and downstream from the pool had similar floristic quality, except for a greater number of weedy taxa above the pool. Seepage through the pool dike and localized ground-water discharge created conditions very similar to those observed around beaver dams in Marsh Creek. In essence, the dike containing the C-3 Pool affected hydrology and wetland plant communities in a manner similar to an enormous beaver dam, except that it did not allow seasonal flooding episodes to occur. Management actions to release water from the pool into the original Marsh Creek channel at certain times and in certain amounts that mimic the natural flow regime would be expected to promote greater plant species richness and minimize the negative impacts of the dike.

  2. Computational methods in sequence and structure prediction

    Science.gov (United States)

    Lang, Caiyi

    This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed

  3. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  4. NFATC3-PLA2G15 Fusion Transcript Identified by RNA Sequencing Promotes Tumor Invasion and Proliferation in Colorectal Cancer Cell Lines.

    Science.gov (United States)

    Jang, Jee-Eun; Kim, Hwang-Phill; Han, Sae-Won; Jang, Hoon; Lee, Si-Hyun; Song, Sang-Hyun; Bang, Duhee; Kim, Tae-You

    2018-06-14

    This study was designed to identify novel fusion transcripts (FTs) and their functional significance in colorectal cancer lines. We performed paired-end RNA sequencing of 28 colorectal cancer (CRC) cell lines. FT candidates were identified using TopHat-fusion, ChimeraScan, and FusionMap tools and further experimental validation was conducted through reverse transcription-polymerase chain reaction and Sanger sequencing. FT was depleted in human CRC line and the effects on cell proliferation, cell migration, and cell invasion were analyzed. 1,380 FT candidates were detected through bioinformatics filtering. We selected 6 candidate FTs, including 4 inter-chromosomal and 2 intra-chromosomal FTs and each FT was found in at least 1 of the 28 cell lines. Moreover, when we tested 19 pairs of CRC tumor and adjacent normal tissue samples, NFATC3-PLA2G15 FT was found in 2. Knockdown of NFATC3-PLA2G15 using siRNA reduced mRNA expression of epithelial-mesenchymal transition (EMT) markers such as vimentin, twist, and fibronectin and increased mesenchymal-epithelial transition markers of E-cadherin, claudin-1, and FOXC2 in colo-320 cell line harboring NFATC3-PLA2G15 FT. The NFATC3-PLA2G15 knockdown also inhibited invasion, colony formation capacity, and cell proliferation. These results suggest that that NFATC3-PLA2G15 FTs may contribute to tumor progression by enhancing invasion by EMT and proliferation.

  5. Decrease in Survival Rate of Colorectal Cancer Patients Due to Insertion of a Single Guanine Base in Promoter Sequences of Matrix Metalloproteinase-1 Gene (in Tehran Population

    Directory of Open Access Journals (Sweden)

    Z Hojati

    2009-01-01

    Full Text Available Introduction: Insertion or deletion of a guanine in -1607 at promoter region of matrix metalloproteinase-1 enzyme creates two allelic types for this gene in the population: 2G and 1G, respectively. 2G allele contains an extra binding site for ETS transcription factors that this may increase the level of gene expression. Therefore, aim of this study was investigation of the single Guanine insertion in the promoter gene and its association with colorectal cancer patient survival rate and tumor progression. Methods: Blood samples from 150 colorectal patients and 100 cases were extracted. The mean follow-up was 25 months (12-36 months. Cases and patients were genotyped using genomic DNA extraction and PCR-RFLP. Results: Colorectal cancer patients were divided in two groups; with activity of metastasis (M+ and without activity of metastasis (M-. 2G allele in metastasis group (55% showed more frequency rather than controls (23%. Survival analyses showed that 3 years survival patients rate in the patients without metastasis activity carrying 1G allele (homo and heterozygote was 81% and for 2G homozygote is 66% (p=0.04. The survival rate dependent to cancer was 90% and 71%, respectively (P=0.01. Conclusion: According to the results, it seems that patients carrying 1G allele show a better survival rate dependent on cancer as compared to patients who do not carry this allele.

  6. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  7. An upstream open reading frame modulates ebola virus polymerase translation and virus replication.

    Directory of Open Access Journals (Sweden)

    Reed S Shabman

    2013-01-01

    Full Text Available Ebolaviruses, highly lethal zoonotic pathogens, possess longer genomes than most other non-segmented negative-strand RNA viruses due in part to long 5' and 3' untranslated regions (UTRs present in the seven viral transcriptional units. To date, specific functions have not been assigned to these UTRs. With reporter assays, we demonstrated that the Zaire ebolavirus (EBOV 5'-UTRs lack internal ribosomal entry site function. However, the 5'-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5'-UTR derived from the viral polymerase (L mRNA strongly suppressed translation of GFP compared to a β-actin 5'-UTR. The L 5'-UTR is one of four viral genes to possess upstream AUGs (uAUGs, and ablation of each uAUG enhanced translation of the primary ORF (pORF, most dramatically in the case of the L 5'-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a "weak" Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress. To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10-100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.

  8. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    Science.gov (United States)

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  9. Cost-efficient remediation of an upstream oilfield battery site

    Energy Technology Data Exchange (ETDEWEB)

    Siebert, L.D. [Imperial Oil Resources Canada, Calgary, AB (Canada); Bedard, G.; Pouliot, M.; Soucy, F.; Faucher, C.; Corbin, R. [Biogenie Inc., Quebec City, PQ (Canada)

    2003-07-01

    The soil at an oilfield battery site, located 18 kilometres (km) northwest of Devon, Alberta has been contaminated with crude oil and salt, following years of operation. Surrounding the site is flat farmland intended for future agricultural production. A remedial program aimed at complying with Tier I criteria of the Alberta Soil and Water Quality Guidelines for Hydrocarbons at Upstream Oil and Gas Facilities (ASWQG) of Alberta Environment, was developed and implemented. Characterization of the site was carried out in 1997 to delineate a salt plume, followed by a second sampling campaign in 1999, which all together revealed three impacted areas. A supplementary characterization was performed in 2001 by Biogenie in an effort to better determine the nature and level of petroleum contamination and more accurately evaluate the volume of contaminated soil. A three-dimensional Visualization software integrating a Kriging geostatistical model was used for this purpose. The results indicated that an estimated 8,800 cubic metres of contaminated soil would need to be excavated and treated. The next phase involved an evaluation of the various remedial options, which was accomplished using a biotreatability study. The remediation program selected involved the excavation of the contaminated soil and segregation of source material, the ex-situ Biopile treatment of the source material to meet Class II landfill criteria, and the ex-situ Biopile treatment of the contaminated soil followed by its use as backfill on site. The biotreatability study proved to be a strategic tool in the remediation effort. 1 tab., 2 figs.

  10. How will climate change policy affect upstream oil and gas

    International Nuclear Information System (INIS)

    Hyndman, R.

    2003-01-01

    This presentation outlined the status of climate change policies in Canada and Alberta for large industry with particular reference to the effect that the policies may have on upstream oil and gas. Global climate change and energy use was outlined along with what actions that should be taken to secure energy supplies and stabilize greenhouse gas (GHG) emissions. An economic model projection of global carbon dioxide emissions without the Kyoto agreement was presented. Global action on climate change will likely include greater efforts in energy efficiency to slow the growth in demand for energy. However, demand for oil and gas is still likely to increase in the next few decades due to a growing population worldwide. The author emphasized that developing countries should not forgo economic growth to avoid higher energy use. It was argued that Canadian climate change policies are out of line with the global climate change effort because they focus on short-term reductions rather than developing technologies. The policies also divert investment to competing suppliers that do not impose GHG costs, with no global GHG benefit. The author described why Alberta climate change policy rejects the Kyoto target. Natural Resource Canada's approach to large industrial emitters was also discussed along with a proposed policy framework by the Canadian Association of Petroleum Producers (CAPP) for long term certainty. 2 tabs., 12 figs

  11. Atmospheric emissions from the upstream oil and gas industry

    International Nuclear Information System (INIS)

    Taylor, B.G.S.

    1994-01-01

    The results are presented of a study set up to determine the nature and levels of atmospheric emissions resulting from United Kingdom oil and gas exploration and production activities. The study was commissioned by the UK Offshore Operators Association. Emissions by the upstream oil and gas industry of common pollutants, such as carbon monoxide, sulphur dioxide and nitrous oxide, and ozone depletion chemicals were shown in each case to be less than 1% of total UK emissions. Greenhouse gas emissions in the industry arise mainly from production operations with a small but significant contribution from onshore activities. Carbon dioxide is the major component followed in descending order by nitrogen oxides, methane and volatile organic compounds. In 1991, these emissions formed 3.2%, 4.6%, 2.9% and 2.8% of the UK totals respectively; overall this represented only about 3% of UK global warming emissions. The evidence of this study illustrates that the industry, which produces 67% of the UK's primary energy, is successfully managing its operations in an environmentally responsible way. (3 figures, 3 tables) (UK)

  12. Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

    Science.gov (United States)

    Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

    2012-10-01

    Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

  13. Cellular specificity of HIV-1 replication can be controlled by LTR sequences

    International Nuclear Information System (INIS)

    Reed-Inderbitzin, Edward; Maury, Wendy

    2003-01-01

    Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

  14. Integrating ribosomal promoter vectors that offer a choice of constitutive expression profiles in Leishmania donovani.

    Science.gov (United States)

    Soysa, Radika; Tran, Khoa D; Ullman, Buddy; Yates, Phillip A

    2015-12-01

    We have designed a novel series of integrating ribosomal RNA promoter vectors with five incrementally different constitutive expression profiles, covering a 250-fold range. Differential expression was achieved by placing different combinations of synthetic or leishmanial DNA sequences upstream and downstream of the transgene coding sequence in order to modulate pre-mRNA processing efficiency and mRNA stability, respectively. All of the vectors have extensive multiple cloning sites, and versions are available for producing N- or C- terminal GFP fusions at each of the possible relative expression levels. In addition, the modular configuration of the vectors allows drug resistance cassettes and other components to be readily exchanged. In toto, these vectors should be useful additions to the toolkit available for molecular and genetic studies of Leishmania donovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. "Upstream Thinking": the catchment management approach of a water provider

    Science.gov (United States)

    Grand-Clement, E.; Ross, M.; Smith, D.; Anderson, K.; Luscombe, D.; Le Feuvre, N.; Brazier, R. E.

    2012-04-01

    Human activities have large impacts on water quality and provision. Water companies throughout the UK are faced with the consequences of poor land management and need to find appropriate solutions to decreasing water quality. This is particularly true in the South West of England, where 93% of the drinking water is sourced from rivers and reservoirs: large areas of drained peatlands (i.e. Exmoor and Dartmoor National Parks) are responsible for a significant input of dissolved organic carbon (DOC) discolouring the water, whilst poorly managed farming activities can lead to diffuse pollution. Alongside the direct environmental implications, poor water quality is partly increasing water treatment costs and will drive significant future investment in additional water treatment, with further repercussions on customers. This highlights the need for water companies throughout the UK, and further afield, to be more involved in catchment management. "Upstream Thinking" is South West Water's (SWW) approach to catchment management, where working with stakeholders to improve water quality upstream aims to avoid increasingly costly solutions downstream. This approach has led the company to invest in two major areas of work: (1) The Farmland programme where problematic farm management practices and potential solutions are identified, typically 40% of the required investment is then offered in exchange for a legal undertaking to maintain the new farm assets in good condition for 25 years; (2) The Mires programme which involves heavy investment in peatland restoration through the blocking of open ditches in order to improve water storage and quality in the long term. From these two projects, it has been clear that stakeholder involvement of groups such as local farmers, the Westcountry Rivers Trust, the Exmoor National Park Authority, the Environment Agency, Natural England and the Exmoor Society is essential, first because it draws in catchment improvement expertise which is not

  16. Geological nominations at UNESCO World Heritage, an upstream struggle

    Science.gov (United States)

    Olive-Garcia, Cécile; van Wyk de Vries, Benjamin

    2017-04-01

    Using my 10 years experience in setting up and defending a UNESCO world Heritage Geological nomination, this presentation aims to give a personal insight into this international process and the differential use of science, subjective perception (aesthetic and 'naturality'), and politics. At this point in the process, new protocols have been tested in order to improve the dialogue, accountability and transparency between the different stake-holders. These are, the State parties, the IUCN, the scientific community, and UNESCO itself. Our proposal is the Chaîne des Puys-Limagne fault ensemble, which combines tectonic, geomorphological evolution and volcanology. The project's essence is a conjunction of inseparable geological features and processes, set in the context of plate tectonics. This very unicit yof diverse forms and processes creates the value of the site. However, it is just this that has caused a problem, as the advisory body has a categorical approach of nominations that separates items to assess them in an unconnected manner.From the start we proposed a combined approach, where a property is seen in its entirety, and the constituent elements seen as interlinked elements reflecting the joint underlying phenomena. At this point, our project has received the first ever open review by an independent technical mission (jointly set up by IUCN, UNESCO and the State party). The subsequent report was broadly supportive of the project's approach and of the value of the ensemble of features. The UNESCO committee in 2016, re-referred the nomination, acknowledging the potential Outstanding Universal Value of the site and requesting the parties to continue the upstream process (e.g. collaborative work), notably on the recommendations and conclusions of the Independent Technical mission report. Meetings are continuing, and I shall provide you with the hot-off-the-press news as this ground breaking nomination progresses.

  17. Oman: Current status, upstream and export developments, investment opportunities

    International Nuclear Information System (INIS)

    Skeet, I.

    1994-01-01

    Oil production in Oman has consistently increased since 1980 to reach its current level of ca 800,000 bbl/d. Reserves total ca 5 billion bbl and gas reserves are over 20 trillion ft 3 , of which a third is being dedicated for export. The main operator is Petroleum Development Oman (PDO), which is 60% owned by the Omani government. Some production areas are taken up by other companies under production sharing contracts. Gas is used for local industrial purposes and a third of gas reserves are being dedicated to a liquefied natural gas export scheme planned to be on-stream by 2000. The government has been seeking foreign investment and increasing private-sector participation, an example being a Belgian-Omani consortium to construct a 100-MW gas-fired power station. However, opportunities for investing in the upstream oil/gas sector are limited since most prospective areas have already been taken up. The economic, political, and social problems which may affect future investment are discussed. Oman is essentially a one-resource economy and declines in oil prices have led to widening government deficits. Social expectations created by the oil-financed welfare state make it difficult for government expenditures to be cut back. There is lack of public debate in the state-controlled media and no public participation in policy and decision making. There is a perception of widening corruption in government and a nascent movement toward a more rigid Islamic view of society. Controls are needed to maintain a reasonable balance between oil revenues and public expenditures, while pressures from an increasingly literate and numerous population will demand changes to the traditional autocratic system of government. 5 figs., 2 tabs

  18. Predicting functional upstream open reading frames in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Kristiansson Erik

    2009-12-01

    Full Text Available Abstract Background Some upstream open reading frames (uORFs regulate gene expression (i.e., they are functional and can play key roles in keeping organisms healthy. However, how uORFs are involved in gene regulation is not yet fully understood. In order to get a complete view of how uORFs are involved in gene regulation, it is expected that a large number of experimentally verified functional uORFs are needed. Unfortunately, wet-experiments to verify that uORFs are functional are expensive. Results In this paper, a new computational approach to predicting functional uORFs in the yeast Saccharomyces cerevisiae is presented. Our approach is based on inductive logic programming and makes use of a novel combination of knowledge about biological conservation, Gene Ontology annotations and genes' responses to different conditions. Our method results in a set of simple and informative hypotheses with an estimated sensitivity of 76%. The hypotheses predict 301 further genes to have 398 novel functional uORFs. Three (RPC11, TPK1, and FOL1 of these 301 genes have been hypothesised, following wet-experiments, by a related study to have functional uORFs. A comparison with another related study suggests that eleven of the predicted functional uORFs from genes LDB17, HEM3, CIN8, BCK2, PMC1, FAS1, APP1, ACC1, CKA2, SUR1, and ATH1 are strong candidates for wet-lab experimental studies. Conclusions Learning based prediction of functional uORFs can be done with a high sensitivity. The predictions made in this study can serve as a list of candidates for subsequent wet-lab verification and might help to elucidate the regulatory roles of uORFs.

  19. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  20. Innovation and performance: The case of the upstream petroleum sector

    Science.gov (United States)

    Persaud, A. C. Jai

    This thesis investigates innovation in the upstream crude oil and natural gas sector, a strategic part of the Canadian economy and a vital industry for North American energy trade and security. Significant interest exists in understanding innovation in this sector from a private and public policy perspective. Interest in the sector has intensified recently due to concerns about world oil supply, Canada's oil sands development, and the potential that Canada may become an "energy superpower." The study examines the factors that drive companies involved in exploration, development, and production in the upstream petroleum sector to innovate and the impact of their innovation activities through major technologies on their performance. The thesis focuses on process innovation, which involves the adoption of new or significantly improved production processes, and is distinct from product innovation, which is based on the development and commercialization of a product with improved product characteristics to deliver new services to the consumer. The thesis provides a comprehensive review of the literature and develops an investigative model framework to examine the drivers of innovation and the impact of innovation on performance in the upstream petroleum sector. The research employs a survey questionnaire that was developed to obtain data and information, which was missing in the literature or not publicly available to test key relationships of innovation and performance indicators. In addition to the survey questionnaire, a number of knowledgeable experts in the industry were also interviewed. A total of 68 respondents completed the survey questionnaire, accounting for 40 percent of the firms in the industry. This percentage goes up to over 50 percent when account is taken of extremely small firms who could not fill out the survey. Further, the 68 respondents account for most of the industry revenues, production, and employment. The respondents include most of the key

  1. Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

    Science.gov (United States)

    Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

    2017-04-01

    Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of

  2. Genome-Wide Search for Translated Upstream Open Reading Frames in Arabidopsis Thaliana.

    Science.gov (United States)

    Hu, Qiwen; Merchante, Catharina; Stepanova, Anna N; Alonso, Jose M; Heber, Steffen

    2016-03-01

    Upstream open reading frames (uORFs) are open reading frames that occur within the 5' UTR of an mRNA. uORFs have been found in many organisms. They play an important role in gene regulation, cell development, and in various metabolic processes. It is believed that translated uORFs reduce the translational efficiency of the main coding region. However, only few uORFs are experimentally characterized. In this paper, we use ribosome footprinting together with a semi-supervised approach based on stacking classification models to identify translated uORFs in Arabidopsis thaliana. Our approach identified 5360 potentially translated uORFs in 2051 genes. GO terms enriched in genes with translated uORFs include catalytic activity, binding, transferase activity, phosphotransferase activity, kinase activity, and transcription regulator activity. The reported uORFs occur with a higher frequency in multi-isoform genes, and some uORFs are affected by alternative transcript start sites or alternative splicing events. Association rule mining revealed sequence features associated with the translation status of the uORFs. We hypothesize that uORF translation is a complex process that might be regulated by multiple factors. The identified uORFs are available online at:https://www.dropbox.com/sh/zdutupedxafhly8/AABFsdNR5zDfiozB7B4igFcja?dl=0. This paper is the extended version of our research presented at ISBRA 2015.

  3. Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

    Science.gov (United States)

    Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

    2017-11-15

    Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

  4. Promoter reuse in prokaryotes

    NARCIS (Netherlands)

    Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

    2012-01-01

    Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

  5. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    Science.gov (United States)

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  6. The up-stream regulation of polymerase-1 and transcript release factor(PTRF/Cavin-1 in prostate cancer: an epigenetic analysis

    Directory of Open Access Journals (Sweden)

    Helen D. Nicholson

    2016-09-01

    Full Text Available The expression of PTRF is down-regulated in prostate cell lines and tissues. Restorationof PTRF expression leads to a reduction in aggressive phenotypes of prostate cancer cells both in vitro and in vivo. Epigenetics examines the changes in gene expression that occur without changing DNA sequences. Two main epigenetic mechanisms include hypermethylation of the gene’s promoter region and changes to the chromatin structure through histone modification. We investigated the involvement of possible epigenetic up-stream regulatory mechanisms that may down-regulate PTRF in prostate cancer cells. Normal (RWPE-1 and prostate cancer (LNCaP and PC3 cell lines were treated with DNA methylation inhibitor, 5-aza-2Ꞌ-deoxycytidine (5AZA and histone deacetylase inhibitor, Trichostatin-A (TSA either independently or in combination. A bioinformatics approach was also used to investigate the changes of epigenetic driver genes in silico. In normal prostate cells(RWPE-1, and androgen independent prostate cancer cells (PC3, treatment with 5AZA and/or TSA did not affect PTRF expression. However, TSA and TSA + 5AZA treatments, but not 5AZA alone,up-regulated the expression of PTRF in LNCaP cells. Bioinformatic analysis of the potential histone deacetylase (HDAC genes involved showed that HDAC2, HDAC6 and HDAC10 may be potential candidate genes for the regulation of PTRF. This corroborative study describes the possible role of an epigenetic mechanism onPTRF, further studies are required to allow a better understanding of theup-stream mechanisms that regulate PTRF expression.

  7. Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

    DEFF Research Database (Denmark)

    Chen, Yun; Pai, Athma A; Herudek, Jan

    2016-01-01

    Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...

  8. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  9. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    Science.gov (United States)

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  10. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  11. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  12. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  13. Identification of putative regulatory upstream ORFs in the yeast genome using heuristics and evolutionary conservation

    Directory of Open Access Journals (Sweden)

    Bilsland Elizabeth

    2007-08-01

    Full Text Available Abstract Background The translational efficiency of an mRNA can be modulated by upstream open reading frames (uORFs present in certain genes. A uORF can attenuate translation of the main ORF by interfering with translational reinitiation at the main start codon. uORFs also occur by chance in the genome, in which case they do not have a regulatory role. Since the sequence determinants for functional uORFs are not understood, it is difficult to discriminate functional from spurious uORFs by sequence analysis. Results We have used comparative genomics to identify novel uORFs in yeast with a high likelihood of having a translational regulatory role. We examined uORFs, previously shown to play a role in regulation of translation in Saccharomyces cerevisiae, for evolutionary conservation within seven Saccharomyces species. Inspection of the set of conserved uORFs yielded the following three characteristics useful for discrimination of functional from spurious uORFs: a length between 4 and 6 codons, a distance from the start of the main ORF between 50 and 150 nucleotides, and finally a lack of overlap with, and clear separation from, neighbouring uORFs. These derived rules are inherently associated with uORFs with properties similar to the GCN4 locus, and may not detect most uORFs of other types. uORFs with high scores based on these rules showed a much higher evolutionary conservation than randomly selected uORFs. In a genome-wide scan in S. cerevisiae, we found 34 conserved uORFs from 32 genes that we predict to be functional; subsequent analysis showed the majority of these to be located within transcripts. A total of 252 genes were found containing conserved uORFs with properties indicative of a functional role; all but 7 are novel. Functional content analysis of this set identified an overrepresentation of genes involved in transcriptional control and development. Conclusion Evolutionary conservation of uORFs in yeasts can be traced up to 100

  14. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    Science.gov (United States)

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

  15. MECP2 promoter methylation and X chromosome inactivation in autism.

    Science.gov (United States)

    Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

    2008-06-01

    Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

  16. Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

    Directory of Open Access Journals (Sweden)

    Dilley Robert

    2009-01-01

    Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

  17. Technology strategy in the upstream petroleum supply chain

    International Nuclear Information System (INIS)

    Bret-Rouzaut, N.; Thom, M.

    2005-03-01

    This study focuses on technology activities in the upstream oil and gas industry. Data from the period 1984 to 2002 is studied for evidence. The objectives are to describe technology strategies within this sector and to develop an understanding of how technology-related tasks and the control of technology are distributed throughout the supply chain. Frameworks for decision-making around technology strategy are presented. Firms that operate internationally and with the widest range of technological capabilities (so technology strategy is not modified strongly by any specialisation) are studied. These firms are large, private international oil companies and large integrated service and supply companies. Technology has different and distinct capabilities; it is a response to growth opportunities, it is a way to lower costs and it can lower the risks of certain business activities. Firms engage in Research and Development (R and D) to provide new technology. However, R and D is risky due to its typically long payback period and during this time many changes to forecasts and unforeseen paths may arise. These unforeseen circumstances provide unexpected benefits or expenses. In the context of this report, technology is defined as something that gives the user competitive advantage. Evidence points to having access to technology as a source of competitive advantage but oil companies and their suppliers have very different competitive objectives and strategies around technology. The former compete over the acquisition, exploration and production of crude oil and natural gas; competition is based on having some lead-time and/or cost advantage in terms of integrating the best technologies into any project. The later compete for the supply of products and services; competition is based on their technology content, quality and price. The international oil companies (IOCs), who are the traditional big spenders on technology, have reduced their technological activities

  18. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  19. Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation.

    Science.gov (United States)

    Qin, Yu-Xiang; Qin, Fangyuan

    2016-02-01

    Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

    Science.gov (United States)

    Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

    2010-09-01

    As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

  1. Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

    Science.gov (United States)

    Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

    2016-11-25

    Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts. The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4-11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50-160 and 20-90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6-3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5-3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation. Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are

  2. Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

    Science.gov (United States)

    Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

    1989-01-01

    The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

  3. Low power consumption O-band VCSEL sources for upstream channels in PON systems

    DEFF Research Database (Denmark)

    Vegas Olmos, Juan José; Rodes Lopez, Roberto; Tafur Monroy, Idelfonso

    2012-01-01

    This paper presents an experimental validation of a low power optical network unit employing vertical-cavity surface-emitting lasers as upstream sources for passive optical networks with an increased power budget, enabling even larger splitting ratios....

  4. Loss of proteostatic control as a substrate for Atrial Fibrillation; a novel target for upstream therapy by Heat Shock Proteins

    Directory of Open Access Journals (Sweden)

    Roelien Amanda Marjolein Meijering

    2012-02-01

    Full Text Available Atrial Fibrillation (AF is the most common, sustained clinical tachyarrhythmia associated with significant morbidity and mortality. AF is a persistent condition with progressive structural remodeling of the atrial cardiomyocytes due to the AF itself, resulting in cellular changes commonly observed in ageing and in other heart diseases. While rhythm control by electrocardioversion or drug treatment is the treatment of choice in symptomatic AF patients, its effectiveness is still limited. Current research is directed at preventing new-onset AF by limiting the development of substrates underlying AF promotion and resembles mechanism-based therapy. Upstream therapy refers to the use of non-ion channel anti-arrhythmic drugs that modify the atrial substrate- or target-specific mechanisms of AF, with the ultimate aim to prevent the occurrence (primary prevention or recurrence of the arrhythmia following (spontaneous conversion (secondary prevention.Heat shock proteins (HSPs are molecular chaperones and comprise a large family of proteins involved in the protection against various forms of cellular stress. Their classical function is the conservation of proteostasis via prevention of toxic protein aggregation by binding to (partially unfolded proteins. Our recent data reveal that HSPs prevent electrical, contractile and structural remodeling of cardiomyocytes, thus attenuating the AF substrate in cellular, Drosophila melanogaster and animal experimental models. Furthermore, studies in humans suggest a protective role for HSPs against the progression from paroxysmal AF to persistent AF and in recurrence of AF. In this review, we discuss upregulation of the heat shock response system as a novel target for upstream therapy to prevent derailment of proteostasis and consequently promotion and recurrence of AF.

  5. Moving electronic medical records upstream: incorporating social determinants of health.

    Science.gov (United States)

    Gottlieb, Laura M; Tirozzi, Karen J; Manchanda, Rishi; Burns, Abby R; Sandel, Megan T

    2015-02-01

    Knowledge of the biological pathways and mechanisms connecting social factors with health has increased exponentially over the past 25 years, yet in most clinical settings, screening and intervention around social determinants of health are not part of standard clinical care. Electronic medical records provide new opportunities for assessing and managing social needs in clinical settings, particularly those serving vulnerable populations. To illustrate the feasibility of capturing information and promoting interventions related to social determinants of health in electronic medical records. Three case studies were examined in which electronic medical records have been used to collect data and address social determinants of health in clinical settings. From these case studies, we identified multiple functions that electronic medical records can perform to facilitate the integration of social determinants of health into clinical systems, including screening, triaging, referring, tracking, and data sharing. If barriers related to incentives, training, and privacy can be overcome, electronic medical record systems can improve the integration of social determinants of health into healthcare delivery systems. More evidence is needed to evaluate the impact of such integration on health care outcomes before widespread adoption can be recommended. Copyright © 2015 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Optimal Sparse Upstream Sensor Placement for Hydrokinetic Turbines

    Science.gov (United States)

    Cavagnaro, Robert; Strom, Benjamin; Ross, Hannah; Hill, Craig; Polagye, Brian

    2016-11-01

    Accurate measurement of the flow field incident upon a hydrokinetic turbine is critical for performance evaluation during testing and setting boundary conditions in simulation. Additionally, turbine controllers may leverage real-time flow measurements. Particle image velocimetry (PIV) is capable of rendering a flow field over a wide spatial domain in a controlled, laboratory environment. However, PIV's lack of suitability for natural marine environments, high cost, and intensive post-processing diminish its potential for control applications. Conversely, sensors such as acoustic Doppler velocimeters (ADVs), are designed for field deployment and real-time measurement, but over a small spatial domain. Sparsity-promoting regression analysis such as LASSO is utilized to improve the efficacy of point measurements for real-time applications by determining optimal spatial placement for a small number of ADVs using a training set of PIV velocity fields and turbine data. The study is conducted in a flume (0.8 m2 cross-sectional area, 1 m/s flow) with laboratory-scale axial and cross-flow turbines. Predicted turbine performance utilizing the optimal sparse sensor network and associated regression model is compared to actual performance with corresponding PIV measurements.

  7. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    Science.gov (United States)

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  8. par genes in Mycobacterium bovis and Mycobacterium smegmatis are arranged in an operon transcribed from "SigGC" promoters

    Directory of Open Access Journals (Sweden)

    Casart Yveth

    2008-03-01

    Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.

  9. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  10. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  11. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  12. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  13. Global transcriptional landscape and promoter mapping of the gut commensal Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe

    2017-12-28

    Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.

  14. Water Stress in Global Transboundary River Basins: Significance of Upstream Water Use on Downstream Stress

    Science.gov (United States)

    Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.

    2016-01-01

    Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.

  15. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    Science.gov (United States)

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  17. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  18. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    International Nuclear Information System (INIS)

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A.

    2006-01-01

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection

  19. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    Science.gov (United States)

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

  20. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    Science.gov (United States)

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  1. Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

    Science.gov (United States)

    Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

    2018-05-03

    Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

  2. Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

    Science.gov (United States)

    Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

    2016-11-15

    Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

  3. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Upstream pressure variations associated with the bow shock and their effects on the magnetosphere

    International Nuclear Information System (INIS)

    Fairfield, D.H.; Baumjohann, W.; Paschmann, G.; Luehr, H.; Sibeck, D.G.

    1990-01-01

    Magnetic field enhancements and depressions on the time scales of minutes were frequently observed simultaneously by the AMPTE CCE, GOES 5, and GOES 6 spacecraft in the subsolar magnetosphere. The source of these perturbations has been detected in the high time resolution AMPTE IRM measurements of the kinetic pressure of the solar wind upstream of the bow shock. It is argued that these upstream pressure variations are not inherent in the solar wind but rather are associated with the bow shock. This conclusion follows from the facts that (1) the upstream field strength and the density associated with the perturbations are highly correlated with each other whereas these quantities tend to be anticorrelated in the undisturbed solar wind, and (2) the upstream perturbations occur within the foreshock or at its boundary. The results imply a mode of interaction between the solar wind and the magnetosphere whereby density changes produced in the foreshock subsequently convect through the bow shock and impinge on the magnetosphere. Also velocity decreases deep within the foreshock sometimes reach many tens of kilometers per second and may be associated with further pressure variations as a changing interplanetary field direction changes the foreshock geometry. Upstream pressure perturbations should create significant effects on the magnetopause and at the foot of nearby field lines that lead to the polar cusp ionosphere

  5. Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

    Science.gov (United States)

    Begun, James W; Potthoff, Sandra

    The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

  6. Spatial distribution of upstream magnetospheric ≥50 keV ions

    Directory of Open Access Journals (Sweden)

    G. C. Anagnostopoulos

    2000-01-01

    Full Text Available We present for the first time a statistical study of \\geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

  7. Spatial distribution of upstream magnetospheric ≥50 keV ions

    Directory of Open Access Journals (Sweden)

    G. Kaliabetsos

    Full Text Available We present for the first time a statistical study of geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

  8. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    Science.gov (United States)

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  9. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  10. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    Science.gov (United States)

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Development of useful recombinant promoter and its expression analysis in different plant cells using confocal laser scanning microscopy.

    Directory of Open Access Journals (Sweden)

    Deepak Kumar

    Full Text Available BACKGROUND: Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s. Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27 and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, -271 to +31. Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. CONCLUSION AND SIGNIFICANCE: We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in

  12. CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation.

    Science.gov (United States)

    Tang, Tiantian; Lang, Xueting; Xu, Congfei; Wang, Xiaqiong; Gong, Tao; Yang, Yanqing; Cui, Jun; Bai, Li; Wang, Jun; Jiang, Wei; Zhou, Rongbin

    2017-08-04

    The NLRP3 inflammasome can sense different pathogens or danger signals, and has been reported to be involved in the development of many human diseases. Potassium efflux and mitochondrial damage are both reported to mediate NLRP3 inflammasome activation, but the underlying, orchestrating signaling events are still unclear. Here we show that chloride intracellular channels (CLIC) act downstream of the potassium efflux-mitochondrial reactive oxygen species (ROS) axis to promote NLRP3 inflammasome activation. NLRP3 agonists induce potassium efflux, which causes mitochondrial damage and ROS production. Mitochondrial ROS then induces the translocation of CLICs to the plasma membrane for the induction of chloride efflux to promote NEK7-NLRP3 interaction, inflammasome assembly, caspase-1 activation, and IL-1β secretion. Thus, our results identify CLICs-dependent chloride efflux as an essential and proximal upstream event for NLRP3 activation.The NLRP3 inflammasome is key to the regulation of innate immunity against pathogens or stress, but the underlying signaling regulation is still unclear. Here the authors show that chloride intracellular channels (CLIC) interface between mitochondria stress and inflammasome activation to modulate inflammatory responses.

  13. Strategic human resources study of the upstream petroleum industry : the decade ahead

    International Nuclear Information System (INIS)

    2003-10-01

    This report presents the results of a 10 month study of the human resources issues in Canada's upstream petroleum industry. The study identifies workforce demographics, skills, and supply and demand. It also discusses the impact of technology and other key challenges facing human resources issues. The upstream petroleum industry includes exploration and production, service industries, pipeline transmission, natural gas processing, and heavy oil and bitumen extracting and upgrading. The study defined four regions in Canada: Western Canada Sedimentary Basin, the oil sands, the north, and the east coast. The main influences on the management practices within the upstream petroleum industry are: globalization; cyclical economic conditions; operational excellence business models; government regulatory requirements; stakeholder expectations for involvement; technological advances; changing demographics, and workplace skills. The study also presented suggestions for changes in best practices to improve the efficiency and effectiveness of product and service delivery. refs., tabs., figs

  14. Ion acceleration at the earth's bow shock: A review of observations in the upstream region

    International Nuclear Information System (INIS)

    Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

    1979-01-01

    Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

  15. Wake flow behaviour behind a smaller cylinder oscillating in the wake of an upstream stationary cylinder

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yangyang; Sun, Zhilin [Ocean College, Zhejiang University, Hangzhou 310058 (China); Tan, Danielle S [Maritime Research Centre, Nanyang Technological University, Singapore 639798 (Singapore); Yu, Dingyong [College of Engineering, Ocean University of China, 266100 (China); Tan, Soon Keat, E-mail: yygao@zju.edu.cn [Nanyang Environment and Water Research Institute, Nanyang Technological University, Singapore 639798 (Singapore)

    2014-04-01

    The flow patterns around a cylinder oscillating freely in the wake of a larger cylinder upstream were investigated using the particle image velocimetry technique. The upstream cylinder was fixed at both ends while the downstream smaller cylinder was held by springs such that it was free to oscillate in the transverse direction. The flow patterns, amplitudes of oscillation and vortex shedding frequencies were compared with those of a single cylinder. In the presence of the upstream cylinder, the three parameters characterizing the oscillation response of the smaller cylinder—amplitude of oscillation, vortex shedding frequency and Reynolds stresses—were greatly reduced. While their magnitude increased with gap ratio, these three parameters were still smaller than the corresponding magnitudes for a single oscillating cylinder. The peak values of turbulence statistics such as Reynolds shear stress and normal stress behind the oscillating downstream cylinder were similarly reduced, and increased with gap ratios. (paper)

  16. Observations of two distinct populations of bow shock ions in the upstream solar wind

    International Nuclear Information System (INIS)

    Gosling, J.T.; Asbridge, J.; Bame, S.J.; Paschmann, G.; Sckopke, N.

    1978-01-01

    Observations upstream of the earth's bow shock with the LASL/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above approx. 10 keV/ion and 2) relatively collimated flow coming from the direction of the shock. On the other hand, the ''diffuse'' ions are distinguished by relatively flat energy spectra above approx. 10 keV and broad angular distributions. They are by far the most commonly observed upstream ion event. A close causal association is suggested between the diffuse ion population in the upstream solar wind and energetic plasma ions observed within the magnetosheath

  17. Ion acceleration at the earth's bow shock: a review of observations in the upstream region

    International Nuclear Information System (INIS)

    Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

    1979-01-01

    Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

  18. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  19. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  20. Willingness of upstream and downstream resource managers to engage in compensation schemes for environmental services

    Directory of Open Access Journals (Sweden)

    Chapika Sangkapitux

    2009-04-01

    Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy

  1. Sequencing and functional analysis of the nifENXorf1orf2 gene cluster of Herbaspirillum seropedicae.

    Science.gov (United States)

    Klassen, G; Pedrosa, F O; Souza, E M; Yates, M G; Rigo, L U

    1999-12-01

    A 5.1-kb DNA fragment from the nifHDK region of H. seropedicae was isolated and sequenced. Sequence analysis showed the presence of nifENXorf1orf2 but nifTY were not present. No nif or consensus promoter was identified. Furthermore, orf1 expression occurred only under nitrogen-fixing conditions and no promoter activity was detected between nifK and nifE, suggesting that these genes are expressed from the upstream nifH promoter and are parts of a unique nif operon. Mutagenesis studies indicate that nifN was essential for nitrogenase activity whereas nifXorf1orf2 were not. High homology between the C-terminal region of the NifX and NifB proteins from H. seropedicae was observed. Since the NifX and NifY proteins are important for FeMo cofactor (FeMoco) synthesis, we propose that alternative proteins with similar activities exist in H. seropedicae.

  2. A functional SNP upstream of the ADRB2 gene is associated with COPD

    Directory of Open Access Journals (Sweden)

    Li JX

    2018-03-01

    Full Text Available Jin-Xiu Li,1,2,* Wei-Ping Fu,3,* Jing Zhang,4 Xiao-Hua Zhang,1,2 Chang Sun,1,5 Lu-Ming Dai,3 Li Zhong,1,5,6 Li Yu,1,2 Ya-Ping Zhang1,7 1State Key Laboratory for Conservation and Utilization of Bio-Resource in Yunnan, 2Key Laboratory for Animal Genetic Diversity and Evolution of High Education in Yunnan Province, School of Life Sciences, Yunnan University, 3Department of Respiratory Critical Care Medicine, 4Department of Thoracic Surgery, The First Affiliated Hospital of Kunming Medical University, Kunming, 5College of Life Sciences, 6Provincial Demonstration Center for Experimental Biology Education, Shaanxi Normal University, Xi’an, 7State Key Laboratory of Genetic Resources and Evolution, and Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China *These authors contributed equally to this work Background: Previous studies have suggested that β2-adrenergic receptor (ADRB2 is associated with COPD. However, the role of genetic polymorphisms in ADRB2 on COPD has not been evaluated yet. Methods: In this study, SNaPshot genotyping, luciferase assay, chromatin immunoprecipitation and real-time polymerase chain reaction were adopted to investigate the association between ADRB2 genetic polymorphisms and COPD, comprehensively. Results: One single nucleotide polymorphism (rs12654778, located upstream of ADRB2, showed a significant association with COPD by the logistic regression analysis after adjusting for age, sex and smoking history (p=0.04 in 200 COPD patients and 222 controls from southwest Chinese population. Furthermore, the luciferase assay indicated that rs12654778-A allele reduced the relative promoter activity by ~26% compared with rs12654778-G allele (p=0.0034. The chromatin immunoprecipitation analysis demonstrated that rs12654778 modulated the binding affinity of transcription factor neurofibromin 1. In addition, a significantly reduced expression of ADRB

  3. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    Science.gov (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  4. The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

    Science.gov (United States)

    Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

    2010-01-01

    Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

  5. The role of heterologous chloroplast sequence elements in transgene integration and expression.

    Science.gov (United States)

    Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

    2010-04-01

    Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

  6. Analysis of an upstream weighted collocation approximation to the transport equation

    International Nuclear Information System (INIS)

    Shapiro, A.; Pinder, G.F.

    1981-01-01

    The numerical behavior of a modified orthogonal collocation method, as applied to the transport equations, can be examined through the use of a Fourier series analysis. The necessity of such a study becomes apparent in the analysis of several techniques which emulate classical upstream weighting schemes. These techniques are employed in orthogonal collocation and other numerical methods as a means of handling parabolic partial differential equations with significant first-order terms. Divergent behavior can be shown to exist in one upstream weighting method applied to orthogonal collocation

  7. A scheme for regulating toxic substances to water quality of Chamsil upstream water system

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kang Suk; Kim, Jee Hoon [Korea Environment Institute, Seoul (Korea)

    1998-12-01

    This study asserts to reflect a concept of toxicity thoroughly in the present water quality concept. It presents an appropriate solution to control toxic substances flowing into the Chamsil upstream water system. Although a regulation of toxic substances into major rivers in Korea other than Han river is also required urgently, it will be studied in future. It is expected that this study on Chamsil upstream would be a cornerstone for establishing a national regulation policy of toxic substances into water system. 28 refs., 1 fig., 36 tabs.

  8. Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

    Science.gov (United States)

    Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

    2012-01-01

    The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

  9. The WW domain protein Kibra acts upstream of Hippo in Drosophila

    DEFF Research Database (Denmark)

    Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie

    2010-01-01

    inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...

  10. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    Science.gov (United States)

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  11. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  12. Differential expression of upstream stimulatory factor (USF 2 variants in eutopic endometria from women with endometriosis: estradiol regulation

    Directory of Open Access Journals (Sweden)

    Jazmin Castro

    2015-01-01

    Full Text Available BACKGROUND: Endometriosis, pro-inflammatory and invasive benign disease estrogen dependent, abnormally express in endometria the enzyme P450Arom, positively regulated by steroid factor-1 (SF-1. Our objective was to study the nuclear protein contents of upstream stimulating factor 2 (USF2a and USF2b, a positive regulator of SF-1, throughout the menstrual cycle in eutopic endometria from women with and without (control endometriosis and the involvement of nuclear estrogen receptors (ER and G-coupled protein estrogen receptor (GPER-1 RESULTS: Upstream stimulating factor 2 protein contents were higher in mid (USF2b and late (USF2a and USF2b secretory phase in eutopic endometria from endometriosis than control (p < 0.05. In isolated control epithelial cells incubated with E2 and PGE2, to resemble the endometriosis condition, the data showed: (a significant increase of USF2a and USF2b nuclear protein contents when treated with E2, PPT (specific agonist for ERa or G1 (specific agonist for GPER1; (b no increase in USF2 binding to SF-1 E-Box/DNA consensus sequence in E2-treated cells; (c USF2 variants protein contents were not modified by PGE2; (d SF-1 nuclear protein content was significantly higher than basal when treated with PGE2, E2 or G1, stimulation unaffected by ICI (nuclear ER antagonist; and (e increased (p < 0.05 cytosolic protein contents of P450Arom when treated with PGE2, E2, PPT or G1 compared to basal, effect that was additive with E2 + PGE2 together. Nevertheless, in endometriosis cells, the high USF2, SF-1 and P450Arom protein contents in basal condition were unmodified CONCLUSION: These data strongly suggest that USF2 variants and P450Arom are regulated by E2 through ERa and GPER1, whereas SF-1 through GPER1, visualized by the response of the cells obtained from control endometria, being unaffected the endogenously stimulated cells from endometriosis origin. The lack of E2 stimulation on USF2/SF-1 E-Box/DNA-sequence binding and the

  13. Inactivation of human α-globin gene expression by a de novo deletion located upstream of the α-globin gene cluster

    International Nuclear Information System (INIS)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.

    1990-01-01

    Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes

  14. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  15. Does eIF3 promote reinitiation after translation of short upstream ORFs also in mammalian cells?

    Czech Academy of Sciences Publication Activity Database

    Hronová, Vladislava; Mohammad, Mahabub Pasha; Wagner, Susan; Pánek, Josef; Gunišová, Stanislava; Zeman, Jakub; Poncová, Kristýna; Valášek, Leoš Shivaya

    2017-01-01

    Roč. 14, č. 12 (2017), s. 1660-1667 ISSN 1547-6286 R&D Projects: GA ČR GA15-10116S Institutional support: RVO:61388971 Keywords : ATF4 * eIF3 * GCN4 Subject RIV: EE - Microbiology, Virology OBOR OECD: Developmental biology Impact factor: 3.900, year: 2016

  16. Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field

    Directory of Open Access Journals (Sweden)

    Nicole L. Key

    2014-01-01

    Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.

  17. Enhancer elements upstream of the SHOX gene are active in the developing limb.

    Science.gov (United States)

    Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

    2010-05-01

    Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

  18. Canadian upstream oil and gas industry profitability: Historical review and future perspectives [with executive summary

    International Nuclear Information System (INIS)

    1991-09-01

    The profitability of the Canadian upstream oil and gas industry is examined by analyzing return on equity and return on capital invested. By all measures and interpretations, the upstream industry has been unprofitable since the mid-1980s; returns generated are far below the industry's own historical cost of capital, and are inadequate relative to other sectors of the Canadian economy and to international oil and gas companies. This poor profitability is attributed to such factors as: overly optimistic price forecasts and healthy cash flows generated in the early 1980s, which led to excess capital spending; poor returns on capital reflective of the physical limitations of the Western Canadian Sedimentary Basin; high capital and operating costs; and a high royalty burden imposed by provincial governments. The consequences of low profitability include inadequate returns to equity investors, a drop in spending on upstream services such as drilling and exploration, a reduced ability of the industry to generate employment, and an adverse effect on the economy of Alberta. Forecasts indicate that the upstream sector is extremely vulnerable to a scenario of relatively flat prices due to high and increasing operating costs and depletion charges, and the significant royalty payments that still are in effect. Little scope is foreseen for industry profitability to return to acceptable levels over the first half of the 1990s. Reduced royalties have the potential to make a significant contribution to improved profitability. 52 figs., 40 tabs

  19. Multispacecraft observations of energetic ions upstream and downstream of the bow shock

    International Nuclear Information System (INIS)

    Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)

    1989-01-01

    We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989

  20. Water stress in global transboundary river basins : Significance of upstream water use on downstream stress

    NARCIS (Netherlands)

    Munia, H.; Guillaume, J. H A; Mirumachi, N.; Porkka, M.; Wada, Y.|info:eu-repo/dai/nl/341387819; Kummu, M.

    2016-01-01

    Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analysed in many of these international river basins, this has

  1. Restructuring: new relationships between the oil companies and the upstream oil firms

    International Nuclear Information System (INIS)

    Barreau, S.

    2001-11-01

    Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

  2. INDIRECT UPSTREAM EFFECTS OF DAMS: CONSEQUENCES OF MIGRATORY CONSUMER EXTIRPATION IN PUERTO RICO

    Science.gov (United States)

    EFFIE A. GREATHOUSE; CATHERINE M. PRINGLE; WILLIAM H. MCDOWELL; JEFF G. HOLMQUIST

    2006-01-01

    Large dams degrade the integrity of a wide variety of ecosystems, yet direct downstream effects of dams have received the most attention from ecosystem managers and researchers. We investigated indirect upstream effects of dams resulting from decimation of migratory freshwater shrimp and fish populations in Puerto Rico, USA, in both high- and low-gradient streams. In...

  3. The upstream escape of energized solar wind protons from the bow shock

    International Nuclear Information System (INIS)

    Greenstadt, E.W.

    1975-01-01

    Recently, there have been some systematic observations of backstreaming protons at the Earth's bow shock with parallel velocity components and total energies much too high to be associated with the usual long-period upstream waves or to be produced by Sonnerup's simple reflection process (Lin et al., 1974), and these protons (30-100keV) were attributed to some unknown acceleration mechanism in the upstream region. The observations of Lof et al. involved protons in high pitch angle, and, although their reasons for favoring an upstream acceleration were quite different, it may seem intuitive that high pitch angle particles would have difficulty escaping the shock, especially at large field-normal angles. Such an inference would superficially support the notion of energization outside the bow shock. It seems worthwhile therefore to examine the extent to which the geometry of individual particle motion alone might select among reflected particles those that can escape upstream and those that cannot. In this paper the geometry of escape is described and some simple numerical examples are worked out for a few special cases. It is found that protons with rather high energies and pitch angles can escape the shock at only marginally quasi-parallel field orientations (i.e., thetasub(nB) approximately 50 0 ), even if they have quite moderate speeds parallel to B. (Auth.)

  4. Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam

    Directory of Open Access Journals (Sweden)

    Sutham Visutimeteegorn

    2007-11-01

    Full Text Available During the flooding events, the operation of Chao Phraya Dam to control downstream water discharge is one of the causes of the inundation occuring over the upstream area. The purposes of this research are to study the effects of the operation of Chao Phraya Dam upon the upstream flood inundation and to find out the new measures of the flood mitigation in the upstream areas of Chao Phraya Dam by using a hydrodynamic model. The results show that Manning's n in the Chao Phraya River and its tributaries is 0.030-0.035 in the main channels and 0.050-0.070 in the flood plain areas. The backwater due to the operation of the Chao Praya dam affects as far as 110 kilometers upstream. New methods of water diversion can mitigate the flood inundation without the effect on the floating rice fields. The construction of reservoirs in the Upper Sakaekang River Basin and the Upper Yom River Basin will mitigate the flood not only in their own basins but also in the Lower Chao Phraya River Basin. The coordinated operation of the Chao Phraya Dam, the regulators and the upper basin reservoirs will efficiently mitigate the flood inundation.

  5. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a ...

    Indian Academy of Sciences (India)

    RESEARCH ARTICLE. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a child ... whereby genes are expressed in a parent-of-origin dependent manner. One of the ... lity, neurodevelopmental delay, features of attention deficit hyperactivity .... Received 16 December 2015; accepted 8 January 2016. Unedited ...

  6. ENHANCING THE ROLE OF STAKEHOLDERS IN THE MANAGEMENT OF UPSTREAM CILIWUNG WATERSHED

    Directory of Open Access Journals (Sweden)

    Iis Alviya

    2016-08-01

    Full Text Available Stakeholders have a ver y important role interm of the management of upstream watershed. Thus, the common understanding on the existence and role of stakeholders is an important factor in order to achieve good governance of watershed management, leading to the attainment of environmental, social and economic benefits. This paper aims to analyse the role, interests, and cooperation among stakeholders and its relationship with the condition of upper Ciliwung watershed. Stakeholder analysis was used in this study to identify stakeholders, to categorize them, and to investigate the relationship between stakeholders. The analysis showed the lack of cooperation among stakeholders both between key stakeholders with primar y stakeholders. This resulted in lack of communities' understanding on the benefits and the importance of conservation activities in the upstream Ciliwung watershed. Meanwhile, the cooperation between key stakeholders and supporting stakeholders, especially the providers of funds, was relatively better/stronger. This can be seen from a better management of inter-agency cooperation in the upstream Ciliwung watershed, although the effort was tend to be project-oriented. Therefore, communication forum need to be established, to taking role for synchronizing , collaborating and coordinating stakeholders' efforts, so that the management programs of upstream Ciliwung watershed can be integrated.

  7. Implications of Upstream Flow Availability for Watershed Surface Water Supply Across the Conterminous United States

    Science.gov (United States)

    Kai Duan; Ge Sun; Peter V. Caldwell; Steven G. McNulty; Yang Zhang

    2018-01-01

    Although it is well established that the availability of upstream flow (AUF) affects downstream water supply, its significance has not been rigorously categorized and quantified at fine resolutions. This study aims to fill this gap by providing a nationwide inventory of AUF and local water resource, and assessing their roles in securing water supply across the 2,099 8-...

  8. Sodium Pick-Up Ion Observations in the Solar Wind Upstream of Mercury

    Science.gov (United States)

    Jasinski, J. M.; Raines, J. M.; Slavin, J. A.; Regoli, L. R.; Murphy, N.

    2018-05-01

    We present the first observations of sodium pick-up ions upstream of Mercury’s magnetosphere. From these observations we infer properties of Mercury’s sodium exosphere and implications for the solar wind interaction with Mercury’s magnetosphere.

  9. Coordination in the upstream supply chain of the Dutch railway sector : a research agenda

    NARCIS (Netherlands)

    Schlicher, L.P.J.; Slikker, M.; van Houtum, G.J.J.A.N.; Pombo, J.

    2016-01-01

    In this paper, we present a research agenda which identifies three research directions for the upstream supply chain of the Dutch railway sector. The first research direction focusses on coordination of spare parts with criticality differences and related allocations of potential cost savings

  10. Research on performance of upstream pumping mechanical seal with different deep spiral groove

    International Nuclear Information System (INIS)

    Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H

    2012-01-01

    As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

  11. Research on performance of upstream pumping mechanical seal with different deep spiral groove

    Science.gov (United States)

    Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.

    2012-11-01

    As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

  12. Upstream pumping of radial lip seals by tangentially deforming, rough seal surfaces

    NARCIS (Netherlands)

    Bavel, van P.G.M.; Ruijl, T.A.M.; Leeuwen, van H.J.; Muijderman, E.A.

    1996-01-01

    This paper aims at a theoretical explanation of the following two experimental observations of radial lip seals: fluid film formation and upstream pumping action. The origins of these observations are still poorly understood. A hydrodynamic analysis is presented for the fully flooded contact zone of

  13. Exploring Patterns of Upstream Internationalization: The Role of Home-region ‘Stickiness’

    NARCIS (Netherlands)

    A.R. Muller (Allan); R.J.M. van Tulder (Rob)

    2005-01-01

    textabstractRecent work has emphasized the importance of regional strategies downstream, adding new depth to the debate on ‘globalization’. This paper adds to the debate by exploring the regional dimension upstream for a sample of Triad-based Fortune 500 firms. We find support for our hypothesis

  14. The clinical impact of chromosomal rearrangements with breakpoints upstream of the SOX9 gene: two novel de novo balanced translocations associated with acampomelic campomelic dysplasia.

    Science.gov (United States)

    Fonseca, Ana Carolina S; Bonaldi, Adriano; Bertola, Débora R; Kim, Chong A; Otto, Paulo A; Vianna-Morgante, Angela M

    2013-05-07

    The association of balanced rearrangements with breakpoints near SOX9 [SRY (sex determining region Y)-box 9] with skeletal abnormalities has been ascribed to the presumptive altering of SOX9 expression by the direct disruption of regulatory elements, their separation from SOX9 or the effect of juxtaposed sequences. We report on two sporadic apparently balanced translocations, t(7;17)(p13;q24) and t(17;20)(q24.3;q11.2), whose carriers have skeletal abnormalities that led to the diagnosis of acampomelic campomelic dysplasia (ACD; MIM 114290). No pathogenic chromosomal imbalances were detected by a-CGH. The chromosome 17 breakpoints were mapped, respectively, 917-855 kb and 601-585 kb upstream of the SOX9 gene. A distal cluster of balanced rearrangements breakpoints on chromosome 17 associated with SOX9-related skeletal disorders has been mapped to a segment 932-789 kb upstream of SOX9. In this cluster, the breakpoint of the herein described t(17;20) is the most telomeric to SOX9, thus allowing the redefining of the telomeric boundary of the distal breakpoint cluster region related to skeletal disorders to 601-585 kb upstream of SOX9. Although both patients have skeletal abnormalities, the t(7;17) carrier presents with relatively mild clinical features, whereas the t(17;20) was detected in a boy with severe broncheomalacia, depending on mechanical ventilation. Balanced and unbalanced rearrangements associated with disorders of sex determination led to the mapping of a regulatory region of SOX9 function on testicular differentiation to a 517-595 kb interval upstream of SOX9, in addition to TESCO (Testis-specific enhancer of SOX9 core). As the carrier of t(17;20) has an XY sex-chromosome constitution and normal male development for his age, the segment of chromosome 17 distal to the translocation breakpoint should contain the regulatory elements for normal testis development. These two novel translocations illustrate the clinical variability in carriers of balanced

  15. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  16. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    Science.gov (United States)

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    Science.gov (United States)

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

    2015-01-01

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  18. Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

    International Nuclear Information System (INIS)

    Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth

    2009-01-01

    The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

  19. Upstream structural management measures for an urban area flooding in Turkey

    Science.gov (United States)

    Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.

    2015-06-01

    In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.

  20. Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

    2017-08-01

    X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Cloning and analysis of the ascorbate peroxidase gene promoter ...

    African Journals Online (AJOL)

    enoh

    2012-03-22

    Mar 22, 2012 ... physiological function of BnAPX in plant response to photooxidative stress, 1562 bp upstream sequence of ... Many light-responsive cis-elements were revealed in this .... element, CGTCA-motif is a MeJA responsive element.

  2. Effect of food-related stress conditions and loss of agr and sigB on seb promoter activity in S. aureus.

    Science.gov (United States)

    Sihto, Henna-Maria; Stephan, Roger; Engl, Christoph; Chen, John; Johler, Sophia

    2017-08-01

    Staphylococcal enterotoxin B (SEB) causes staphylococcal food poisoning and is produced in up to ten times higher quantities than other major enterotoxins. While Staphylococcus aureus growth is often repressed by competing flora, the organism exhibits a decisive growth advantage under some stress conditions. So far, data on the influence of food-related stressors and regulatory mutations on seb expression is limited and largely based on laboratory strains, which were later reported to harbor mutations. Therefore, the aim of this study was to investigate the influence of stress and regulatory mutations on seb promoter activity. To this end, transcriptional fusions were created in two strains, USA300 and HG003, carrying different seb upstream sequences fused to a blaZ reporter. NaCl, nitrite, and glucose stress led to significantly decreased seb promoter activity, while lactic acid stress resulted in significantly increased seb promoter activity. Loss of agr decreased seb promoter activity and loss of sigB increased promoter activity, with the magnitude of change depending on the strain. These results demonstrate that mild stress conditions encountered during food production and preservation can induce significant changes in seb promoter activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Function of the EGR-1/TIS8 radiation inducible promoter in a minimal HSV-1 amplicon system

    International Nuclear Information System (INIS)

    Spear, M.A.; Sakamoto, K.M.; Herrlinger, U.; Pechan, P.; Breakefield, X.O.

    1997-01-01

    Purpose: To evaluate function of the EGR-1/TIS8 promoter region in minimal HSV-1 amplicon system in order to determine the feasibility of using the system to regulate vector replication with radiation. Materials and Methods: A 600-base pair 5' upstream region of the EGR-1 promoter linked to chloramphenicol acetyltransferase (CAT) was recombined into a minimal HSV-1 amplicon vector system (pONEC). pONEC or a control plasmid was transfected into U87 glioma cells using the Lipofectamine method. Thirty-six hours later one aliquot of cells from each transfection was irradiated to a dose of 20 Gy and another identical aliquot served as a control. CAT activity was assayed 8 hours after irradiation. Results: pONEC transfected cells irradiated with 20 Gy demonstrated 2.0 fold increase in CAT activity compared to non-irradiated cells. Cells transfected with control plasmid showed no change in CAT activity. Unirradiated pONEC cells had CAT activity 1.3 times those transfected with control plasmid. Conclusion: We have previously created HSV-1 gene therapy amplicon vector systems which allow virus-amplicon interdependent replication, with the intent of regulating replication. The above data demonstrates that a minimal amplicon system will allow radiation dependent regulation by the EGR-1 promoter, thus indicating the possibility of using this system to regulate onsite, spatially and temporally regulated vector production. Baseline CAT activity was higher and relative induction lower than other reported expression constructs, which raises concern for the ability of the system to produce a differential in transcription levels sufficient for this purpose. This is possibly the result of residual promoter/enhancer elements remaining in the HSV-1 sequences. We are attempting to create constructs lacking these elements. Addition of secondary promoter sequences may also be of use. We are also currently evaluating the efficacy of the putative IEX-1 radiation inducible promoter region in

  4. BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes along Different Microtubule Tracks.

    Science.gov (United States)

    Guardia, Carlos M; Farías, Ginny G; Jia, Rui; Pu, Jing; Bonifacino, Juan S

    2016-11-15

    The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multi-subunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here, we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. Published by Elsevier Inc.

  5. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    Science.gov (United States)

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  6. Evolution of the leukotoxin promoter in genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Davies, Robert L

    2009-01-01

    of the leukotoxin promoter among representatives of the five species within genus Mannheimia. We also consider how the evolution of the leukotoxin operon fits with the evolution and maintenance of virulence. Results: The alignment of the intergenic regions upstream of the leukotoxin genes showed significant...

  7. Wind Predictions Upstream Wind Turbines from a LiDAR Database

    Directory of Open Access Journals (Sweden)

    Soledad Le Clainche

    2018-03-01

    Full Text Available This article presents a new method to predict the wind velocity upstream a horizontal axis wind turbine from a set of light detection and ranging (LiDAR measurements. The method uses higher order dynamic mode decomposition (HODMD to construct a reduced order model (ROM that can be extrapolated in space. LiDAR measurements have been carried out upstream a wind turbine at six different planes perpendicular to the wind turbine axis. This new HODMD-based ROM predicts with high accuracy the wind velocity during a timespan of 24 h in a plane of measurements that is more than 225 m far away from the wind turbine. Moreover, the technique introduced is general and obtained with an almost negligible computational cost. This fact makes it possible to extend its application to both vertical axis wind turbines and real-time operation.

  8. Independents in European Gas Markets after liberalisation - downstream integration of upstream oil and gas companies

    International Nuclear Information System (INIS)

    Eikeland, Per Ove

    2005-01-01

    A central objective of gas market liberalisation in Europe in the 1990s was to increase competition by opening end-use markets for independent suppliers. Upstream oil and gas companies in Europe reacted to this opportunity by announcing strategies to integrate forward in European gas markets. By late 2004, however, upstream companies still recorded generally weak downstream strategy implementation in Europe. The article concludes that this general implementation gap should be explained by political failure in EU member states to abolish gas market barriers to entry for independents. Variation between companies in degree of implementation should be explained by variation in conditions in the companies' home markets / wider business spheres and internal company factors. (Author)

  9. Technological acceleration and organizational transformations in the upstream oil and gas industry

    International Nuclear Information System (INIS)

    Isabelle, M.

    2000-12-01

    The upstream oil and gas industry experienced a dramatic technological acceleration in the early 1970's. The relationships between the agents in this industry have themselves undergone deep changes since that date. This thesis shows that a tight link exists between the technological acceleration and the organizational transformations in the upstream oil and gas industry. In a first part, it focuses on the economic theory's developments concerning industrial organization. In a second part, it applies these developments to three types of relations: those between the owner-states of hydrocarbon resources and the international petroleum companies; those between the international petroleum companies and their subcontractors; and finally those between the international petroleum companies themselves. (author)

  10. Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

    International Nuclear Information System (INIS)

    Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.

    2008-01-01

    In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity

  11. Measurements of energy spectra of fast electrons from PF-1000 in the upstream and downstream directions

    Energy Technology Data Exchange (ETDEWEB)

    Kwiatkowski, R.; Czaus, K.; Skladnik-Sadowska, E.; Malinowski, K.; Zebrowski, J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Sadowski, M.J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Karpinski, L.; Paduch, M.; Scholz, M. [Institute of Plasma Physics and Laser Microfusion (IPPLM), 01-497 Warsaw (Poland); Kubes, P. [Czech Technical University (CVUT), 166-27 Prague, (Czech Republic)

    2011-07-01

    The paper describes measurements of energy spectra of electrons emitted in the upstream direction along the symmetry-axis of the PF-1000 facility, operated with the deuterium filling at 21 kV, 290 kJ. The measurements were performed with a magnetic analyzer. The same analyzer was used to measure also electron beams emitted in along the symmetry-axis in the downstream direction. The recorded spectra showed that the electron-beams emitted in the upstream direction have energies in the range from about 40 keV to about 800 keV, while those in the downstream direction have energies in the range from about 60 keV to about 200 keV. These spectra confirm that in the PF (Plasma Focus) plasma column there appear strong local fields accelerating charged particles in different directions. This document is composed of a paper and a poster. (authors)

  12. Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

    Directory of Open Access Journals (Sweden)

    van Straalen Nico M

    2007-06-01

    Full Text Available Abstract Background Metallothionein (mt transcription is elevated in heavy metal tolerant field populations of Orchesella cincta (Collembola. This suggests that natural selection acts on transcriptional regulation of mt in springtails at sites where cadmium (Cd levels in soil reach toxic values This study investigates the nature and the evolutionary origin of polymorphisms in the metallothionein promoter (pmt and their functional significance for mt expression. Results We sequenced approximately 1600 bp upstream the mt coding region by genome walking. Nine pmt alleles were discovered in NW-European populations. They differ in the number of some indels, consensus transcription factor binding sites and core promoter elements. Extensive recombination events between some of the alleles can be inferred from the alignment. A deviation from neutral expectations was detected in a cadmium tolerant population, pointing towards balancing selection on some promoter stretches. Luciferase constructs were made from the most abundant alleles, and responses to Cd, paraquat (oxidative stress inducer and moulting hormone were studied in cell lines. By using paraquat we were able to dissect the effect of oxidative stress from the Cd specific effect, and extensive differences in mt induction levels between these two stressors were observed. Conclusion The pmt alleles evolved by a number of recombination events, and exhibited differential inducibilities by Cd, paraquat and molting hormone. In a tolerant population from a metal contaminated site, promoter allele frequencies differed significantly from a reference site and nucleotide polymorphisms in some promoter stretches deviated from neutral expectations, revealing a signature of balancing selection. Our results suggest that the structural differences in the Orchesella cincta metallothionein promoter alleles contribute to the metallothionein -over-expresser phenotype in cadmium tolerant populations.

  13. Isolation and characterization of the Jatropha curcas APETALA1 (JcAP1) promoter conferring preferential expression in inflorescence buds.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Longjian; Xu, Zeng-Fu

    2016-08-01

    The 1.5 kb JcAP1 promoter from the biofuel plant Jatropha curcas is predominantly active in the inflorescence buds of transgenic plants, in which the -1313/-1057 region is essential for maintaining the activity. Arabidopsis thaliana APETALA1 (AP1) is a MADS-domain transcription factor gene that functions primarily in flower development. We isolated a homolog of AP1 from Jatropha curcas (designated JcAP1), which was shown to exhibit flower-specific expression in Jatropha. JcAP1 is first expressed in inflorescence buds and continues to be primarily expressed in the sepals. We isolated a 1.5 kb JcAP1 promoter and evaluated its activity in transgenic Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. In transgenic Arabidopsis and Jatropha, the inflorescence buds exhibited notable GUS activity, whereas the sepals did not. Against expectations, the JcAP1 promoter was active in the anthers of Arabidopsis and Jatropha and was highly expressed in Jatropha seeds. An analysis of promoter deletions in transgenic Arabidopsis revealed that deletion of the -1313/-1057 region resulted in loss of JcAP1 promoter activity in the inflorescence buds and increased activity in the anthers. These results suggested that some regulatory sequences in the -1313/-1057 region are essential for maintaining promoter activity in inflorescence buds and can partly suppress activity in the anthers. Based on these findings, we hypothesized that other elements located upstream of the 1.5 kb JcAP1 promoter may be required for flower-specific activation. The JcAP1 promoter characterized in this study can be used to drive transgene expression in both the inflorescence buds and seeds of Jatropha.

  14. The Giant Mottled Eel, Anguilla marmorata, Uses Blue-Shifted Rod Photoreceptors during Upstream Migration

    OpenAIRE

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity ...

  15. MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

    Science.gov (United States)

    Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

    2012-01-01

    The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

  16. Frequency effects of upstream wake and blade interaction on the unsteady boundary layer flow

    International Nuclear Information System (INIS)

    Kang, Dong Jin; Bae, Sang Su

    2002-01-01

    Effects of the reduced frequency of upstream wake on downstream unsteady boundary layer flow were simulated by using a Navier-Stokes code. The Navier-Stokes code is based on an unstructured finite volume method and uses a low Reynolds number turbulence model to close the momentum equations. The geometry used in this paper is the MIT flapping foil experimental set-up and the reduced frequency of the upstream wake is varied in the range of 0.91 to 10.86 to study its effect on the unsteady boundary layer flow. Numerical solutions show that they can be divided into two categories. One is so called the low frequency solution, and behaves quite similar to a Stokes layer. Its characteristics is found to be quite similar to those due to either a temporal or spatial wave. The low frequency solutions are observed clearly when reduced frequency is smaller than 3.26. The other one is the high frequency solution. It is observed for the reduced frequency larger than 7.24. It shows a sudden shift of the phase angle of the unsteady velocity around the edge of the boundary layer. The shift of phase angle is about 180 degree, and leads to separation of the boundary layer flow from corresponding outer flow. The high frequency solution shows the characteristics of a temporal wave whose wave length is half of the upstream frequency. This characteristics of the high frequency solution is found to be caused by the strong interaction between unsteady vortices. This strong interaction also leads to destroy of the upstream wake stripe inside the viscous sublayer as well as the buffer layer

  17. Hydrodynamic response of fuel rod with longitudinal fins to upstream generated vortices

    International Nuclear Information System (INIS)

    Naot, D.; Oron, A.; Technion-Israel Inst. of Tech., Haifa. Dept. of Mechanical Engineering)

    1984-01-01

    The hydrodynamic response of turbulent channel flow to upstream generated vortices was numerically simulated for fuel element with longitudinal cooling fins. Turbulence is modelled by an algebraic stress model and an energy-dissipation model. The developing flow is solved using a parabolic pressure correction algorithm. The decay of the initial vortices in non-circular sub-channel in the presence of geometry driven secondary currents is described and the uncertainty in the local turbulent shear stresses is discussed. (orig.)

  18. When is vertical integration profitable? Focus on a large upstream company in the gas market

    International Nuclear Information System (INIS)

    Hatlebakk, Magnus

    2001-12-01

    This note discusses basic economic mechanisms that may affect the profitability of vertical integration in the European gas industry. It concentrates on reasonable strategies for a large upstream company which considers a stronger engagement downstream. The note warns against the effect of simplified conclusions with regard to the impact of vertical integration. It applies a simple model of successive oligopolies to discuss double mark-ups, exclusions, barriers to entry, etc

  19. Key concerns of U.K. oil and gas company directors for upstream oil developments

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    Energy 2006 is a survey published by Ernst and Young presenting the main concerns over the past decade of the UK company directors. The upstream conclusions are presented here. In the medium term (3 years) and long term (10 years), the main concerns were with replacing reserves and with oil price changes. Company re-organisation etc., de-regulation of the gas market, maximising production, return of Iraq to the oil market, and environmental issues were also of concern. (author)

  20. A numerical study on the flow upstream of a wind turbine on complex terran

    DEFF Research Database (Denmark)

    Meyer Forsting, Alexander Raul; Bechmann, Andreas; Troldborg, Niels

    2016-01-01

    The interaction of a wind turbine with the upstream flow-field in complex and flat terrain is studied using Reynolds-averaged Navier-Stokes (RANS) simulations with a two equation turbulence closure. The complex site modelled is Perdigao (Portugal), where a turbine is located on one of two parallel...... the wind turbine wake trajectory which in turn governs the orientation of the induction zone...

  1. Upstream migration of Pacific lampreys in the John Day River, Oregon: Behavior, timing, and habitat use

    Science.gov (United States)

    Robinson, T. Craig; Bayer, J.M.

    2005-01-01

    Adult Pacific lamprey migration and habitat preferences for over-winter holding and spawning, and larval rearing in tributaries to the Columbia River are not well understood. The John Day River is one such tributary where larval and adult stages of this species have been documented, and its free-flowing character provided the opportunity to study migration of Pacific lampreys unimpeded by passage constraints. Forty-two adult Pacific lampreys were captured in the John Day River near its mouth during their upstream migration. Pacific lampreys were surgically implanted with radio transmitters and released onsite, and tracked by fixed-site, aerial, and terrestrial telemetry methods for nearly one year. Adults moved upstream exclusively at night, with a mean rate of 11.1 ?? 6.3 km/day. They halted upstream migration by September, and held a single position for approximately six months in the lateral margins of riffles and glides, using boulders for cover. More than half of Pacific lampreys resumed migration in March before ending movement in early May. Pacific lampreys that resumed migration in spring completed a median of 87% of their upstream migration before over-winter holding. Upon completing migration. Pacific lampreys briefly held position before beginning downstream movement at the end of May. Though not directly observed, halting migration and movement downstream were likely the result of spawning and death. Gains in adult Pacific lamprey passage through the Columbia River hydrosystem and tributaries may be made by improvements that would expedite migration during spring and summer and increase the quantity and variety of cover and refuge opportunities. ?? 2005 by the Northwest Scientific Association. All rights reserved.

  2. The role of the ionosphere in coupling upstream ULF wave power into the dayside magnetosphere

    International Nuclear Information System (INIS)

    Engebretson, M.J.; Cahill, L.J. Jr.; Arnoldy, R.L.; Anderson, B.J.; Rosenberg, T.J.; Carpenter, D.L.; Inan, U.S.; Eather, R.H.

    1991-01-01

    A series of recent studies of Pc 3 magnetic pulsations in the dayside outer magnetosphere has given new insights into the possible mechanisms of entry of ULF wave power into the magnetosphere from a bow shock related upstream source. In this paper, the authors first review many of these new observational results by presenting a comparison of data from two 10-hour intervals on successive days in April 1986 and then present a possible model for transmission of pulsation signals from the magnetosheath into the dayside magnetosphere. Simultaneous multi-instrument observations at South Pole Station, located below the cusp/cleft ionosphere near local noon, magnetic field observations by the AMPTE CCE satellite in the dayside outer magnetosphere, and upstream magnetic field observations by the IMP 8 satellite show clear interplanetary magnetic field field magnitude control of dayside resonant harmonic pulsations and band-limited very high latitude pulsations, as well as pulsation-modulated precipitation of what appear to be magnetosheath/boundary layer electrons. They believe that this modulated precipitation may be responsible for the propagation of upstream wave power in the Pc 3 frequency band into the high-latitude ionosphere, from whence it may be transported throughout the dayside outer magnetosphere by means of an ionospheric transistor. In this model, modulations in ionospheric conductivity caused by cusp/cleft precipitation cause varying ionospheric currents with frequency spectra determined by the upstream waves; these modulations will be superimposed on the Birkeland currents, which close via these ionospheric currents. Modulated region 2 Birkeland currents will in turn provide a narrow-band source of wave energy to a wide range of dayside local times in the outer magnetosphere

  3. Role of nitric oxide in vasodilation in upstream muscle during intermittent pneumatic compression.

    Science.gov (United States)

    Chen, Long-En; Liu, Kang; Qi, Wen-Ning; Joneschild, Elizabeth; Tan, Xiangling; Seaber, Anthony V; Stamler, Jonathan S; Urbaniak, James R

    2002-02-01

    This study investigated the dosage effects of nitric oxide synthase (NOS) inhibitor N(G)-monomethyl-L-arginine (L-NMMA) on intermittent pneumatic compression (IPC)-induced vasodilation in uncompressed upstream muscle and the effects of IPC on endothelial NOS (eNOS) expression in upstream muscle. After L-NMMA infusion, mean arterial pressure increased by 5% from baseline (99.5 +/- 18.7 mmHg; P < 0.05). Heart rate and respiratory rate were not significantly affected. One-hour IPC application on legs induced a 10% dilation from baseline in 10- to 20-microm arterioles and a 10-20% dilation in 21- to 40 microm arterioles and 41- to 70-microm arteries in uncompressed cremaster muscle. IPC-induced vasodilation was dose dependently reduced, abolished, or even reversed by concurrently infused L-NMMA. Moreover, expression of eNOS mRNA in uncompressed cremaster muscle was upregulated to 2 and 2.5 times normal at the end of 1- and 5-h IPC on legs, respectively, and the expression of eNOS protein was upregulated to 1.8 times normal. These increases returned to baseline level after cessation of IPC. The results suggest that eNOS plays an important role in regulating the microcirculation in upstream muscle during IPC.

  4. Influence of upstream stator on rotor flutter stability in a low pressure steam turbine stage

    Energy Technology Data Exchange (ETDEWEB)

    Huang, X.; He, L. [University of Durham (United Kingdom). School of Engineering; Bell, D. [ALSTOM Power Ltd., Rugby (United Kingdom)

    2006-07-01

    Conventional blade flutter prediction is normally based on an isolated blade row model, however, little is known about the influence of adjacent blade rows. In this article, an investigation is presented into the influence of the upstream stator row on the aero-elastic stability of rotor blades in the last stage of a low pressure (LP) steam turbine. The influence of the upstream blade row is computed directly by a time-marching, unsteady, Navier-Stokes flow solver in a stator-rotor coupled computational domain. The three-dimensional flutter solution is obtained, with adequate mesh resolution, in a single passage domain through application of the Fourier-Transform based Shape-Correction method. The capability of this single-passage method is examined through comparison with predictions obtained from a complete annulus model, and the results demonstrate a good level of accuracy, while achieving a speed up factor of 25. The present work shows that the upstream stator blade row can significantly change the aero-elastic behaviour of an LP steam turbine rotor. Caution is, therefore, advised when using an isolated blade row model for blade flutter prediction. The results presented also indicated that the intra-row interaction is of a strong three-dimensional nature. (author)

  5. Multiple spacecraft observations of interplanetary shocks: characteristics of the upstream ulf turbulence

    International Nuclear Information System (INIS)

    Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.

    1982-01-01

    All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum

  6. Experimental Branch Retinal Vein Occlusion Induces Upstream Pericyte Loss and Vascular Destabilization.

    Directory of Open Access Journals (Sweden)

    Elisa Dominguez

    Full Text Available Branch retinal vein occlusion (BRVO leads to extensive vascular remodeling and is important cause of visual impairment. Although the vascular morphological changes following experimental vein occlusion have been described in a variety of models using angiography, the underlying cellular events are ill defined.We here show that laser-induced experimental BRVO in mice leads to a wave of TUNEL-positive endothelial cell (EC apoptosis in the upstream vascular network associated with a transient edema and hemorrhages. Subsequently, we observe an induction of EC proliferation within the dilated vein and capillaries, detected by EdU incorporation, and the edema resolves. However, the pericytes of the upstream capillaries are severely reduced, which was associated with continuing EC apoptosis and proliferation. The vascular remodeling was associated with increased expression of TGFβ, TSP-1, but also FGF2 expression. Exposure of the experimental animals to hypoxia, when pericyte (PC dropout had occurred, led to a dramatic increase in endothelial cell proliferation, confirming the vascular instability induced by the experimental BRVO.Experimental BRVO leads to acute endothelial cells apoptosis and increased permeability. Subsequently the upstream vascular network remains destabilized, characterized by pericyte dropout, un-physiologically high endothelial cells turnover and sensitivity to hypoxia. These early changes might pave the way for capillary loss and subsequent chronic ischemia and edema that characterize the late stage disease.

  7. The economic benefits of vegetation in the upstream area of Ciliwung watershed

    Science.gov (United States)

    Saridewi, T. R.; Nazaruddin

    2018-04-01

    Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

  8. Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle.

    Science.gov (United States)

    Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu

    2017-12-06

    Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.

  9. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  10. The Pseudomonas aeruginosa transcriptome in planktonic cultures and static biofilms using RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Andreas Dötsch

    Full Text Available In this study, we evaluated how gene expression differs in mature Pseudomonas aeruginosa biofilms as opposed to planktonic cells by the use of RNA sequencing technology that gives rise to both quantitative and qualitative information on the transcriptome. Although a large proportion of genes were consistently regulated in both the stationary phase and biofilm cultures as opposed to the late exponential growth phase cultures, the global biofilm gene expression pattern was clearly distinct indicating that biofilms are not just surface attached cells in stationary phase. A large amount of the genes found to be biofilm specific were involved in adaptation to microaerophilic growth conditions, repression of type three secretion and production of extracellular matrix components. Additionally, we found many small RNAs to be differentially regulated most of them similarly in stationary phase cultures and biofilms. A qualitative analysis of the RNA-seq data revealed more than 3000 putative transcriptional start sites (TSS. By the use of rapid amplification of cDNA ends (5'-RACE we confirmed the presence of three different TSS associated with the pqsABCDE operon, two in the promoter of pqsA and one upstream of the second gene, pqsB. Taken together, this study reports the first transcriptome study on P. aeruginosa that employs RNA sequencing technology and provides insights into the quantitative and qualitative transcriptome including the expression of small RNAs in P. aeruginosa biofilms.

  11. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  12. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  13. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  14. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  15. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    Science.gov (United States)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  16. How downstream sub-basins depend on upstream inflows to avoid scarcity: typology and global analysis of transboundary rivers

    Science.gov (United States)

    Munia, Hafsa Ahmed; Guillaume, Joseph H. A.; Mirumachi, Naho; Wada, Yoshihide; Kummu, Matti

    2018-05-01

    Countries sharing river basins are often dependent upon water originating outside their boundaries; meaning that without that upstream water, water scarcity may occur with flow-on implications for water use and management. We develop a formalisation of this concept drawing on ideas about the transition between regimes from resilience literature, using water stress and water shortage as indicators of water scarcity. In our analytical framework, dependency occurs if water from upstream is needed to avoid scarcity. This can be diagnosed by comparing different types of water availability on which a sub-basin relies, in particular local runoff and upstream inflows. At the same time, possible upstream water withdrawals reduce available water downstream, influencing the latter water availability. By developing a framework of scarcity and dependency, we contribute to the understanding of transitions between system regimes. We apply our analytical framework to global transboundary river basins at the scale of sub-basin areas (SBAs). Our results show that 1175 million people live under water stress (42 % of the total transboundary population). Surprisingly, the majority (1150 million) of these currently suffer from stress only due to their own excessive water use and possible water from upstream does not have impact on the stress status - i.e. they are not yet dependent on upstream water to avoid stress - but could still impact on the intensity of the stress. At the same time, 386 million people (14 %) live in SBAs that can avoid stress owing to available water from upstream and have thus upstream dependency. In the case of water shortage, 306 million people (11 %) live in SBAs dependent on upstream water to avoid possible shortage. The identification of transitions between system regimes sheds light on how SBAs may be affected in the future, potentially contributing to further refined analysis of inter- and intrabasin hydro-political power relations and strategic planning

  17. Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

    Science.gov (United States)

    Gerasymenko, I M; Sheludko, Y V

    2017-07-01

    To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

  18. Regulatory sequence of cupin family gene

    Science.gov (United States)

    Hood, Elizabeth; Teoh, Thomas

    2017-07-25

    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  19. An in situ Comparison of Electron Acceleration at Collisionless Shocks under Differing Upstream Magnetic Field Orientations

    Energy Technology Data Exchange (ETDEWEB)

    Masters, A.; Dougherty, M. K. [The Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2AZ (United Kingdom); Sulaiman, A. H. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); Stawarz, Ł. [Astronomical Observatory, Jagiellonian University, ul. Orla 171, 30-244 Krakow (Poland); Reville, B. [School of Mathematics and Physics, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Sergis, N. [Office of Space Research and Technology, Academy of Athens, Soranou Efesiou 4, 11527 Athens (Greece); Fujimoto, M. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Burgess, D. [School of Physics and Astronomy, Queen Mary University of London, London E1 4NS (United Kingdom); Coates, A. J., E-mail: a.masters@imperial.ac.uk [Mullard Space Science Laboratory, Department of Space and Climate Physics, University College London, Holmbury St. Mary, Dorking RH5 6NT (United Kingdom)

    2017-07-10

    A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at a quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.

  20. Ions upstream of the earth's bow shock: a theoretical comparison of alternative source populations

    International Nuclear Information System (INIS)

    Schwartz, S.J.; Thomsen, M.F.; Gosling, J.T.

    1983-01-01

    A theoretical framework is developed for studying trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field. We include the effects of a sharp shock potential rise. Expressions are derived for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field: the appropriate equations are also provided to transform these motions back to the observer's frame. The utility of these expressions is illustrated by comparing the predicted upstream motions for four different source models for upstream ions: magnetic moment-conserving reflection of the solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal. This comparison reveals that, for identical geometries, the reflection models produce higher energies and/or gyromotion than do the leakage models. We further argue that in a single simple encounter with the shock, an ion should behave in an unmagnetized manner and hence should not conserve its magnetic moment. Conservation of magnetic moment, if it is to occur, would seem to require multiple encounters with the shock. We investigate the conditions under which such multiple encounters can occur and find that under most quasi-parallel geometries neither leaked nor reflected ions should probably conserve their magnetic moments

  1. Upstream effects of dams on alluvial channels: state-of-the-art and future challenges

    Science.gov (United States)

    Liro, Maciej

    2017-04-01

    More than 50,000 large dams (with the height above 15 m) operate all over the world and, thus, they significantly disturb water and sediment transport in river systems. These disturbances are recognized as one of the most important factors shaping river morphology in the Anthropocene. Downstream effects of dams have been well documented in numerous case studies and supported by predictions from existing models. In contrast, little is known on the upstream effects of dams on alluvial channels. This review highlights the lack of studies on sedimentological, hydromorphological and biogeomorphological adjustments of alluvial rivers in the base-level raised zones of backwater upstream of dam reservoirs where water level fluctuations occur. Up to date, it has been documented that backwater effects may facilitate fine and coarse sediment deposition, increase groundwater level, provide higher and more frequent channel and floodplain inundation and lead to significant morphological changes. But there have been no studies quantifying short- and long-term consequences of these disturbances for the hydromorphological and biogeomorphological feedbacks that control development of alluvial channels. Some recent studies carried out on gravel-bed and fine-grained bed rivers show that the above mentioned disturbances facilitate vegetation expansion on exposed channel sediments and floodplain influencing river morphology, which suggests that backwater area of alluvial rivers may be treated as the hotspot of bio-geomorphological changes in a fluvial system. To set the stage for future research on upstream effects of dams, this work presents the existing state-of-art and proposes some hypotheses which may be tested in future studies. This study was carried out within the scope of the Research Project 2015/19/N/ST10/01526 financed by the National Science Centre of Poland

  2. Beyond police crisis intervention: moving "upstream" to manage cases and places of behavioral health vulnerability.

    Science.gov (United States)

    Wood, Jennifer D; Beierschmitt, Laura

    2014-01-01

    Law enforcement officers continue to serve on the front lines as mental health interventionists, and as such have been subject to a wave of "first generation" reform designed to enhance their crisis response capabilities. Yet, this focus on crisis intervention has not answered recent calls to move "upstream" and bolster early intervention in the name of long-term recovery. This paper reports on findings from an action research project in Philadelphia aimed at exploring opportunities for enhanced upstream engagement. Study methods include spatial analyses of police mental health transportations from an eight year period (2004-2011) and qualitative data from twenty-three "framing conversations" with partners and other stakeholders, seven focus groups with police and outreach workers, five key informant interviews as well as document reviews of the service delivery system in Philadelphia. Recommendations include the need to move beyond a focus on what police can do to a wider conception of city agencies and business stakeholders who can influence vulnerable people and vulnerable spaces of the city. We argue for the need to develop shared principles and rules of engagement that clarify roles and stipulate how best to enlist city resources in a range of circumstances. Since issues of mental health, substance use and disorder are so tightly coupled, we stress the importance of establishing a data-driven approach to crime and disorder reduction in areas of the city we term "hotspots of vulnerability". In line with a recovery philosophy, such an approach should reduce opportunities for anti-social behavior among the "dually labeled" in ways consistent with "procedural justice". Furthermore, crime and disorder data flowing from police and security to behavioral health analysts could contribute to a more focused case management of "repeat utilizers" across the two systems. Our central argument is that a twin emphasis on "case management" and "place management" may provide

  3. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

    2003-01-01

    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  4. Recombinant Promoter (MUASCsV8CP) Driven Totiviral Killer Protein 4 (KP4) Imparts Resistance Against Fungal Pathogens in Transgenic Tobacco

    Science.gov (United States)

    Deb, Debasish; Shrestha, Ankita; Maiti, Indu B.; Dey, Nrisingha

    2018-01-01

    Development of disease-resistant plant varieties achieved by engineering anti-microbial transgenes under the control of strong promoters can suffice the inhibition of pathogen growth and simultaneously ensure enhanced crop production. For evaluating the prospect of such strong promoters, we comprehensively characterized the full-length transcript promoter of Cassava Vein Mosaic Virus (CsVMV; -565 to +166) and identified CsVMV8 (-215 to +166) as the highest expressing fragment in both transient and transgenic assays. Further, we designed a new chimeric promoter ‘MUASCsV8CP’ through inter-molecular hybridization among the upstream activation sequence (UAS) of Mirabilis Mosaic Virus (MMV; -297 to -38) and CsVMV8, as the core promoter (CP). The MUASCsV8CP was found to be ∼2.2 and ∼2.4 times stronger than the CsVMV8 and CaMV35S promoters, respectively, while its activity was found to be equivalent to that of the CaMV35S2 promoter. Furthermore, we generated transgenic tobacco plants expressing the totiviral ‘Killer protein KP4’ (KP4) under the control of the MUASCsV8CP promoter. Recombinant KP4 was found to accumulate both in the cytoplasm and apoplast of plant cells. The agar-based killing zone assays revealed enhanced resistance of plant-derived KP4 against two deuteromycetous foliar pathogenic fungi viz. Alternaria alternata and Phoma exigua var. exigua. Also, transgenic plants expressing KP4 inhibited the growth progression of these fungi and conferred significant fungal resistance in detached-leaf and whole plant assays. Taken together, we establish the potential of engineering “in-built” fungal stress-tolerance in plants by expressing KP4 under a novel chimeric caulimoviral promoter in a transgenic approach. PMID:29556246

  5. Inclusion of Moloney murine leukemia virus elements upstream of the transgene cassette in an E1-deleted adenovirus leads to an unusual genomic integration in epithelial cells

    International Nuclear Information System (INIS)

    Zheng Changyu; O'Connell, Brian C.; Baum, Bruce J.

    2003-01-01

    Classically, the 5' and 3' long terminal repeats (LTRs) are considered necessary but not sufficient for retroviral integration. Recently, we reported that inclusion of these and additional elements from Moloney murine leukemia virus (MoMLV) facilitated transgene integration, without retroviral integrase, when placed in an adenoviral context (AdLTR-luc vector) (Nat. Biotech. 18 (2000), 176; Biochem. Biophys. Res. Commun. 300 (2003), 115). To help understand this nonhomologous DNA recombination event, we constructed another vector, AdELP-luc, with 2.7 kb of MoMLV elements identically placed into an E1-deleted adenovirus type 5 backbone upstream of a luciferase cDNA reporter gene. Unlike AdLTR-luc, no MoMLV elements were placed downstream of the expression cassette. AdELP-luc readily infected epithelial cells in vitro. Southern hybridizations with DNA from cloned cells showed that disruption of the MoMLV sequences occurred. One cell clone, grown in vitro without any special selection medium for 9 months, exhibited stable vector integration and luciferase activity. Importantly, both Southern hybridization and FISH analyses showed that in addition to the MoMLV elements and expression cassette, substantial adenoviral sequence downstream of the luciferase cDNA was genomically integrated. These results suggest that the 2.7 kb of MoMLV sequence included in AdELP-luc have cis-acting functions and mediates an unusual integration event

  6. On the upstream boundary of electron foreshocks in the solar wind

    International Nuclear Information System (INIS)

    Zimbardo, G.; Veltri, P.

    1996-01-01

    The backstreaming of electrons from planetary and interplanetary shocks creates foreshocks of fast particles propagating along the magnetic field. The effect of low frequency magnetic fluctuations is to create both a broadening and a fine structure of the foreshock upstream boundary. This is studied by means of a newly developed 3-D numerical simulation of turbulent magnetic fields. Applications to the Earth and to the termination shock electron foreshocks are done, and some implications on the observations of the spreading and of the bursty structure of the foreshocks are discussed

  7. Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

    Science.gov (United States)

    1976-11-01

    periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

  8. Moving Upstream and Going Local: The Responsibility to Protect Ten Years Later

    Directory of Open Access Journals (Sweden)

    Bridget Moix

    2015-10-01

    Full Text Available Ten years ago the international community pledged to protect civilians from genocide, ethnic cleansing, war crimes, and crimes against humanity by endorsing the responsibility to protect (R2P doctrine. Yet today, horrific violence against civilians continues in places like Syria, Iraq, and South Sudan. This article examines some of the progress and gaps in the international community’s efforts to better protect civilians against mass violence over the past decade. It proposes two emerging directions for advancing the R2P agenda in the coming years: 1 greater focus on upstream prevention, and 2 increased support for locally-led peacebuilding and prevention actors and capacities.

  9. The role of upstream distal electrodes in mitigating electrochemical degradation of ionic liquid ion sources

    Science.gov (United States)

    Brikner, Natalya; Lozano, Paulo C.

    2012-11-01

    Ionic liquid ion sources produce molecular ions from micro-tip emitters wetted with room-temperature molten salts. When a single ion polarity is extracted, counterions accumulate and generate electrochemical reactions that limit the source lifetime. The dynamics of double layer formation are reviewed and distal electrode contacts are introduced to resolve detrimental electrochemical decomposition effects at the micro-tip apex. By having the emitter follow the ionic liquid potential, operation can be achieved for an extended period of time with no apparent degradation of the material, indicating that electrochemistry can be curtailed and isolated to the upstream distal electrode.

  10. Deep brine recognition upstream the EBE syndicate. Geochemical and isotopic investigations. Final report

    International Nuclear Information System (INIS)

    2009-01-01

    The authors report and discuss the results obtained after performing a drilling upstream the drinkable water harnessing field of a water supply syndicate in Alsace (Ensisheim, Bollwiller and surroundings), in order to confirm the existence of a deep brine source. This brine is diluted by recent waters. The first isotopic investigations do not allow the origin of this brine to be identified, but fractures due to some seismic events are suspected. The report presents the drilling and the various aspects of the chemical and isotopic studies (sampling, physico-chemical analysis, dating, identification of various isotopes)

  11. Is it a must to add upstream devices for high GVF multiphase

    Energy Technology Data Exchange (ETDEWEB)

    Dou, Jianwen; Guo, Jason; Gokulnath, R.

    2005-07-01

    High accuracies in measurement of the gross liquid and net oil flow rates at high GVF levels in the multiphase flow is identified as one of the most demanding needs of the industry, especially in high water cut environments. The underlying factor that decides the accuracy of the net oil flow rate measurement is the accuracy at which the gross liquid and water cut are measured and the prevailing water cut in the flow. It is an established fact that accuracies falter with increasing GVF in the multiphase flow. The purpose of this paper is to present the performance results of a newly developed Compact High GVF Haimo multiphase meter that addresses the above needs, without having to use an Upstream Separation Device for high GVF application while retaining the accuracies within +2% absolute for water cut and 10% relative for liquid and gas flow rates at 90% confidence level. while also optimising the footprint, the cost, the weight of the solution Further developmental work and trials are in progress to achieve the targeted accuracy levels under very high GVF conditions as well. Contents of the Paper:1) Definitions. 2) MFM 2000 + Upstream Separation Device. 3) Haimo's experience with upstream devices. 4) Motivation to develop the new Compact meter solution. 5) Description of the Compact solution. 6) Performance testing of the Compact solution in a third party test facility. 7) Conclusion and Benefit which are: The objective of working out a new solution for high GVF without having to use a Upstream Separation Device seem to have been achieved with excellent test results; The new configuration of Compact High GVF meter successfully met and exceeded its Acceptance criteria. The main objective was to asses its performance, confirm the quality of the measurements and check its compliance with the Accuracy specifications. The consistency of the absolute error on water cut much lower than 2% for the full range of the GVF and liquid flow rates re-establishes the

  12. Upstream oil and gas. Subsector no. 7: Oil and gas exploration and development 1995 to 1999

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-08-01

    Prepared by the Alberta Human Resources and Employment, this report provides a summary of the lost-time injuries and disease descriptions of workers injured while employed in the upstream oil and gas industries in Alberta during the period 1995 to 1999. The report includes the characteristics of the injured worker and the risk of injury to workers in the industries in Alberta, as well as the cost of injuries and revenue by means of total premiums paid by the employers. The occupational fatalities that were accepted by the Workers Compensation Board and investigated by the Occupational Health and Safety were summarized in the report along with a brief description of the injuries. The aim was to provide information concerning health and safety issues to government, employers, workers, and health and safety officers in the industries in Alberta about health and safety issues. The focus was placed on the oil and gas exploration and development sub-sector. Defined as all upstream oil field activities of employers which generate revenue from the production and sale of crude oil and/or natural gas, the sub-sector comprises major integrated oil and gas companies and small independent producers. In those cases where the owner/producer operates its own upstream production/processing facilities, they form an integral part of this sub-section. In addition, oil and gas marketing firms are included. Oil/gas well, well head equipment; flow lines/gathering systems tied into field processing facilities; battery sites/compressors stations; crude oil separators and natural gas dehydrators/treaters; natural gas/sulfur processing plants; heavy oil projects including steam generation; and other enhanced recovery methods are all included in the sub-sector. The other sub-sectors in the upstream oil and gas industries are: exploration, oilfield maintenance and construction, well servicing with service rigs and power swivels, drilling of oil and gas wells, oilfield downhole and other

  13. Downstream natural gas in Europe - high hopes dashed for upstream oil and gas companies

    International Nuclear Information System (INIS)

    Eikeland, P.O.

    2007-01-01

    Access for independents to retail gas markets was a central concern in European policy reform efforts in the 1990s. Upstream oil and gas companies reacted with strategic intentions of forward integration. By late 2004, forward integration was still weak, however. An important explanation of the gap between announced strategic re-orientation and actual strategy implementation lies in the political failure of EU member states to dismantle market barriers to entry for independents. Variations between companies in downstream strategy implementation are explained by variations in business opportunities and internal company factors. [Author

  14. Downstream natural gas in Europe-High hopes dashed for upstream oil and gas companies

    International Nuclear Information System (INIS)

    Eikeland, Per Ove

    2007-01-01

    Access for independents to retail gas markets was a central concern in European policy reform efforts in the 1990s. Upstream oil and gas companies reacted with strategic intentions of forward integration. By late 2004, forward integration was still weak, however. An important explanation of the gap between announced strategic re-orientation and actual strategy implementation lies in the political failure of EU member states to dismantle market barriers to entry for independents. Variations between companies in downstream strategy implementation are explained by variations in business opportunities and internal company factors

  15. How to use Big Data technologies to optimize operations in Upstream Petroleum Industry

    Directory of Open Access Journals (Sweden)

    Abdelkader Baaziz

    2013-12-01

    Full Text Available “Big Data is the oil of the new economy” is the most famous citation during the three last years. It has even been adopted by the World Economic Forum in 2011. In fact, Big Data is like crude! It’s valuable, but if unrefined it cannot be used. It must be broken down, analyzed for it to have value. But what about Big Data generated by the Petroleum Industry and particularly its upstream segment? Upstream is no stranger to Big Data. Understanding and leveraging data in the upstream segment enables firms to remain competitive throughout planning, exploration, delineation, and field development.Oil & Gas Companies conduct advanced geophysics modeling and simulation to support operations where 2D, 3D & 4D Seismic generate significant data during exploration phases. They closely monitor the performance of their operational assets. To do this, they use tens of thousands of data-collecting sensors in subsurface wells and surface facilities to provide continuous and real-time monitoring of assets and environmental conditions. Unfortunately, this information comes in various and increasingly complex forms, making it a challenge to collect, interpret, and leverage the disparate data. As an example, Chevron’s internal IT traffic alone exceeds 1.5 terabytes a day.Big Data technologies integrate common and disparate data sets to deliver the right information at the appropriate time to the correct decision-maker. These capabilities help firms act on large volumes of data, transforming decision-making from reactive to proactive and optimizing all phases of exploration, development and production. Furthermore, Big Data offers multiple opportunities to ensure safer, more responsible operations. Another invaluable effect of that would be shared learning.The aim of this paper is to explain how to use Big Data technologies to optimize operations. How can Big Data help experts to decision-making leading the desired outcomes?Keywords:Big Data; Analytics

  16. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  17. Characterization of wind velocities in the upstream induction zone of a wind turbine using scanning continuous-wave lidars

    DEFF Research Database (Denmark)

    Simley, Eric; Angelou, Nikolas; Mikkelsen, Torben Krogh

    2016-01-01

    As a wind turbine generates power, induced velocities, lower than the freestream velocity, will be present upstream of the turbine due to perturbation of the flow by the rotor. In this study, the upstream induction zone of a 225kW horizontal axis Vestas V27 wind turbine located at the Danish...... Technical University’s Risø campus is investigated using a scanning Light Detection and Ranging (lidar) system. Three short-range continuous-wave “WindScanner” lidars are positioned in the field around the V27 turbine allowing detection of all three components of the wind velocity vectors within...... the induction zone. The time-averaged mean wind speeds at different locations in the upstream induction zone are measured by scanning a horizontal plane at hub height and a vertical plane centered at the middle of the rotor extending roughly 1.5 rotor diameters (D) upstream of the rotor. Turbulence statistics...

  18. Optical power equalization for upstream traffic with injection-locked Fabry-Perot lasers in TDM-PON

    Science.gov (United States)

    Huang, Ting-Tsan; Sheu, Lih-Gen; Chi, Sien

    2010-10-01

    An optical power equalization of upstream traffic in time-division-multiplexed passive optical network (TDM-PON) based on injection-locked Fabry-Perot lasers has been experimentally investigated. The upstream transmitters with stable spectrum are achieved by using an external injection light source in the optical line terminal (OLT). The different upstream powers can be equalized by injection locking a Fabry-Perot laser diode (FP-LD) biased below threshold current in OLT. The dynamic upstream power range from - 8.5 to - 19.5 db m is reduced to a 1.6 dB maximal power variation, when the uplink signal is directly modulated at 1.25 Gb/s.

  19. Performance of upstream interaction region detectors for the FIRST experiment at GSI

    CERN Document Server

    Abou-Haidar, Z; Alvarez, M A G; Anelli, M; Aumann, T; Battistoni, G; Bocci, A; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cirrone, G A P; Cortes-Giraldo, M A; Cuttone, G; De Napoli, M; Durante, M; Fernandez-Garcia, J P; Finck, C; Gallardo, M I; Golosio, B; Iarocci, E; Iazzi, F; Ickert, G; Introzzi, R; Juliani, D; Krimmer, J; Kurz, N; Labalme, M; Leifels, Y; Le Fevre, A; Leray, S; Marchetto, F; Monaco, V; Morone, M C; Oliva, P; Paoloni, A; Patera, V; Piersanti, L; Pleskac, R; Quesada, J M; Randazzo, N; Romano, F; Rossi, D; Rosso, V; Rousseau, M; Sacchi, R; Sala, P; Sarti, A; Schuy, C; Sciubba, A; Sfienti, C; Simon, H; Sipala, V; Spiriti, E; Stuttge, L; Tropea, S; Younis, H

    2012-01-01

    The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at GSI has been designed to study carbon fragmentation, measuring (12)C double differential cross sections (- (2)I /- - E) for different beam energies between 100 and 1000 MeV/u. The experimental setup integrates newly designed detectors in the, so called, Interaction Region around the graphite target. The Interaction Region upstream detectors are a 250 mum thick scintillator and a drift chamber optimized for a precise measurement of the ions interaction time and position on the target. In this article we review the design of the upstream detectors along with the preliminary results of the data taking performed on August 2011 with 400 MeV/u fully stripped carbon ion beam at GSI. Detectors performances will be reviewed and compared to those obtained during preliminary tests, performed with 500 MeV electrons (at the BTF facility in the INFN Frascati Laboratories) and 80 MeV/u protons and carbon ions (at the INFN LNS Laboratories in Cata...

  20. Detailed study of electron plasma waves upstream of the earth's bow shock

    International Nuclear Information System (INIS)

    Etcheto, J.; Faucheux, M.

    1984-01-01

    A detailed study of electron plasma waves observed upstream of the earth's bow shock and of their relationships to the position of the satellite in the foreshock and to the electron measurements has been carried out. The wave characteristics depend on the position in the electron foreshock: a narrow-bnd (a few percent) and intense (a few millivolts per meter) noise is observed at the plasma frequency at the edge of the foreshock while the spectrum widens (Δf/fapprox. =0.3) at the same time as the power decreases (hundreds of microvolts per meter) deeper (a few earth radii) inside the foreshock. Signals below the plasma frequency are also observed. These waves are polarized along the magnetic field, with long wavelengths below and at the plasma frequency and short wavelengths above it. They appear as short bursts, the duration of which depends on the frequency: longer close to the plasma frequency (50 ms), they shorten with increasing separation from the plasma frequency, the usual duration being 15 ms. While the correlation of the wave characteristics with the reflected electrons is good as the satellite moves inside the foreshock, no evolution is found with the distance to the bow shock, neither for the noise nor for the particles. These results are discussed in the frame of various mechanisms which have been proposed to explain these upstream waves but no satisfactory agreement is found with any of them

  1. Investigating the Applicability of Upstream Detection Strategy at Pedestrian Signalised Crossings

    Directory of Open Access Journals (Sweden)

    Sitti A Hassan

    2017-10-01

    Full Text Available In the UK, the Puffin crossing has provision to extend pedestrian green time for those who take longer to cross. However, even at such a pedestrian friendly facility, the traffic signal control is usually designed to minimise vehicle delay while providing the crossing facility. This situation is rather contrary to the current policies to encourage walking. It is this inequity that has prompted the need to re-examine the traffic control of signalised crossings to provide more benefit to both pedestrians and vehicles. In this context, this paper explores the possibility of implementing an Upstream Detection strategy at a Puffin crossing to provide a user friendly crossing. The study has been carried out by simulating a mid-block Puffin crossing for various detector distances and a number of combinations of pedestrian and traffic flows. This paper presents the simulation results and recommends the situations at which Upstream Detection would be suitable.

  2. Chandra's Observations of Jupiter's X-Ray Aurora During Juno Upstream and Apojove Intervals

    Science.gov (United States)

    Jackman, C.M.; Dunn, W.; Kraft, R.; Gladstone, R.; Branduardi-Raymont, G.; Knigge, C.; Altamirano, D.; Elsner, R.

    2017-01-01

    The Chandra space telescope has recently conducted a number of campaigns to observe Jupiter's X-ray aurora. The first set of campaigns took place in summer 2016 while the Juno spacecraft was upstream of the planet sampling the solar wind. The second set of campaigns took place in February, June and August 2017 at times when the Juno spacecraft was at apojove (expected close to the magnetopause). We report on these upstream and apojove campaigns including intensities and periodicities of auroral X-ray emissions. This new era of jovian X-ray astronomy means we have more data than ever before, long observing windows (up to 72 kiloseconds for this Chandra set), and successive observations relatively closely spaced in time. These features combine to allow us to pursue novel methods for examining periodicities in the X-ray emission. Our work will explore significance testing of emerging periodicities, and the search for coherence in X-ray pulsing over weeks and months, seeking to understand the robustness and regularity of previously reported hot spot X-ray emissions. The periods that emerge from our analysis will be compared against those which emerge from radio and UV wavelengths.

  3. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    Science.gov (United States)

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  4. MAVEN Observation of an Obliquely Propagating Low-Frequency Wave Upstream of Mars

    Science.gov (United States)

    Ruhunusiri, Suranga; Halekas, J. S.; Connerney, J. E. P.; Espley, J. R.; McFadden, J. P.; Mazelle, C.; Brain, D.; Collinson, G.; Harada, Y.; Larson, D. E.; hide

    2016-01-01

    We report Mars Atmosphere and Volatile EvolutioN (MAVEN) mission observations of a large amplitude low-frequency plasma wave that propagated oblique to the ambient magnetic field upstream of Mars along with a non-solar-wind plasma component that had a flow velocity perpendicular to the magnetic field. We consider nine possibilities for this wave that include various combinations of its propagation direction, polarization in the solar wind frame, and ion source responsible for its generation. Using the observed wave parameters and the measured plasma parameters as constraints, we uniquely identify the wave by systematically discarding these possibilities. We determine that the wave is a right-hand polarized wave that propagated upstream in the solar wind frame. We find two possibilities for the ion source that can be responsible for this wave generation. They are either newly born pickup protons or reflected solar wind protons from the bow shock.We determine that the observed non-solar-wind component is not responsible for the wave generation, and it is likely that the non-solar-wind component was merely perturbed by the passage of the wave.

  5. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  6. Duplication of an upstream silencer of FZP increases grain yield in rice.

    Science.gov (United States)

    Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

    2017-11-01

    Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

  7. Experience of molecular monitoring techniques in upstream oil and gas operations

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, Anthony F.; Anfindsen, Hilde; Liengen, Turid; Molid, Solfrid [Statoil ASA (Denmark)

    2011-07-01

    For a numbers of years, molecular monitoring tools have been used in upstream oil and gas operations but the results have given only limited added value. This paper discusses the various techniques available for upstream molecular monitoring which provides scope for identification of microbial influenced problems. The methodology, which consists of analyzing solid samples using traditional as well as molecular techniques, is detailed. Two cases were studied with the objective of determining if microbial contamination was contributing to the problem. The first case was a study of amorphous deposits in production wells and mainly iron sulphide was found. The second study was of amorphous deposits in water injection wells and the analysis showed typical components of drilling and completion fluids with some organic material. Two more cases, corrosion of tubing in a water injection well and flow line corrosion, are discussed and the results are given. From the study, it can be concluded that failure can be due to several factors, chemical and biological.

  8. Research on Cavitation Regions of Upstream Pumping Mechanical Seal Based on Dynamic Mesh Technique

    Directory of Open Access Journals (Sweden)

    Huilong Chen

    2014-08-01

    Full Text Available In order to study the cavitation area of the Upstream Pumping Mechanical Seal, three-dimensional microgap inner flow field of the Upstream Pumping Mechanical Seal was simulated with multiphase flow cavitation model and dynamic mesh technique based on hydrodynamic lubrication theory. Furthermore, the simulated result was compared with the experimental data. The results show that the simulated result with the Zwart-Gerber-Belamri cavitation model was much closer to the experimental data. The area of cavitation inception mainly occurred at the concave side of the spiral groove and surrounding region without spiral grooves, which was nearly covered by the inner diameter to roots of grooves; in addition, the region near the surface of the stationary ring was primary cavitation location. The area of cavitation has little relationship with the medium pressure; however, it became larger following increasing rotating speed in the range of researched operating conditions. Moreover the boundary of cavitated area was transformed from smooth to rough, which occurred in similar film thickness. When cavitation number was decreasing, which was conducive to improving the lubrication performance of sealed auxiliary, it made the sealing stability decline.

  9. Effect of an upstream bulge configuration on film cooling with and without mist injection.

    Science.gov (United States)

    Wang, Jin; Li, Qianqian; Sundén, Bengt; Ma, Ting; Cui, Pei

    2017-12-01

    To meet the economic requirements of power output, the increased inlet temperature of modern gas turbines is above the melting point of the material. Therefore, high-efficient cooling technology is needed to protect the blades from the hot mainstream. In this study, film cooling was investigated in a simplified channel. A bulge located upstream of the film hole was numerically investigated by analysis of the film cooling effectiveness distribution downstream of the wall. The flow distribution in the plate channel is first presented. Comparing with a case without bulge, different cases with bulge heights of 0.1d, 0.3d and 0.5d were examined with blowing ratios of 0.5 and 1.0. Cases with 1% mist injection were also included in order to obtain better cooling performance. Results show that the bulge configuration located upstream the film hole makes the cooling film more uniform, and enhanceslateral cooling effectiveness. Unlike other cases, the configuration with a 0.3d-height bulge shows a good balance in improving the downstream and lateral cooling effectiveness. Compared with the case without mist at M = 0.5, the 0.3d-height bulge with 1% mist injection increases lateral average effectiveness by 559% at x/d = 55. In addition, a reduction of the thermal stress concentration can be obtained by increasing the height of the bulge configuration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD

    Science.gov (United States)

    Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.

    2016-12-01

    The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.

  11. Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

    Directory of Open Access Journals (Sweden)

    Luis V. Rodríguez-Durán

    2011-01-01

    Full Text Available Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

  12. Novel strategies for upstream and downstream processing of tannin acyl hydrolase.

    Science.gov (United States)

    Rodríguez-Durán, Luis V; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N

    2011-01-01

    Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

  13. Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion

    Science.gov (United States)

    Fox, G. A.; Sheshukov, A.; Cruse, R.; Kolar, R. L.; Guertault, L.; Gesch, K. R.; Dutnell, R. C.

    2016-05-01

    The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

  14. HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

    Science.gov (United States)

    Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

    2007-04-04

    To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

  15. Analysis of aberrant methylation on promoter sequences of tumor suppressor genes and total DNA in sputum samples: a promising tool for early detection of COPD and lung cancer in smokers

    Directory of Open Access Journals (Sweden)

    Guzmán Leda

    2012-07-01

    Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is a disorder associated to cigarette smoke and lung cancer (LC. Since epigenetic changes in oncogenes and tumor suppressor genes (TSGs are clearly important in the development of LC. In this study, we hypothesize that tobacco smokers are susceptible for methylation in the promoter region of TSGs in airway epithelial cells when compared with non-smoker subjects. The purpose of this study was to investigate the usefulness of detection of genes promoter methylation in sputum specimens, as a complementary tool to identify LC biomarkers among smokers with early COPD. Methods We determined the amount of DNA in induced sputum from patients with COPD (n = 23, LC (n = 26, as well as in healthy subjects (CTR (n = 33, using a commercial kit for DNA purification, followed by absorbance measurement at 260 nm. The frequency of CDKN2A, CDH1 and MGMT promoter methylation in the same groups was determined by methylation-specific polymerase chain reaction (MSP. The Fisher’s exact test was employed to compare frequency of results between different groups. Results DNA concentration was 7.4 and 5.8 times higher in LC and COPD compared to the (CTR (p  Conclusions We provide evidence that aberrant methylation of TSGs in samples of induced sputum is a useful tool for early diagnostic of lung diseases (LC and COPD in smoker subjects. Virtual slides The abstract MUST finish with the following text: Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1127865005664160

  16. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  17. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    Science.gov (United States)

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  18. Comparison of accelerated ion populations observed upstream of the bow shocks at Venus and Mars

    Directory of Open Access Journals (Sweden)

    M. Yamauchi

    2011-03-01

    Full Text Available Foreshock ions are compared between Venus and Mars at energies of 0.6~20 keV using the same ion instrument, the Ion Mass Analyser, on board both Venus Express and Mars Express. Venus Express often observes accelerated protons (2~6 times the solar wind energy that travel away from the Venus bow shock when the spacecraft location is magnetically connected to the bow shock. The observed ions have a large field-aligned velocity compared to the perpendicular velocity in the solar wind frame, and are similar to the field-aligned beams and intermediate gyrating component of the foreshock ions in the terrestrial upstream region. Mars Express does not observe similar foreshock ions as does Venus Express, indicating that the Martian foreshock does not possess the intermediate gyrating component in the upstream region on the dayside of the planet. Instead, two types of gyrating protons in the solar wind frame are observed very close to the Martian quasi-perpendicular bow shock within a proton gyroradius distance. The first type is observed only within the region which is about 400 km from the bow shock and flows tailward nearly along the bow shock with a similar velocity as the solar wind. The second type is observed up to about 700 km from the bow shock and has a bundled structure in the energy domain. A traversal on 12 July 2005, in which the energy-bunching came from bundling in the magnetic field direction, is further examined. The observed velocities of the latter population are consistent with multiple specular reflections of the solar wind at the bow shock, and the ions after the second reflection have a field-aligned velocity larger than that of the de Hoffman-Teller velocity frame, i.e., their guiding center has moved toward interplanetary space out from the bow shock. To account for the observed peculiarity of the Martian upstream region, finite gyroradius effects of the solar wind protons compared to the radius of the bow shock curvature and

  19. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    Science.gov (United States)

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  20. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  1. Functional Characterization of TaSnRK2.8 Promoter in Response to Abiotic Stresses by Deletion Analysis in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Hongying Zhang

    2017-07-01

    Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.

  2. Ion distributions in the Earth's foreshock upstream from the bow shock

    Science.gov (United States)

    Fuselier, S. A.

    1995-01-01

    A variety of suprathermal and energetic ion distributions are found upstream from shocks. Some distributions, such as field-aligned beams, are generated directly at the shock either through reflection processes or through leakage from the hotter downstream region. Other distributions, such as intermediate distributions, evolve from these parent distributions through wave-particle interactions. This paper reviews our current understanding of the creation and evolution of suprathermal distributions at shocks. Examples of suprathermal ion distributions are taken from observations at the Earth's bow shock. Particular emphasis is placed on the creation of field-aligned beams and specularly reflected ion distributions and on the evolution of these distributions in the Earth's ion foreshock. However, the results from this heavily studied region are applicable to interplanetary shocks, bow shocks at other planets, and comets.

  3. Optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Hyun Jong; Wi, Seung Gon; Kim, Su Bae; Shin, You Jung; Yi, Ju Hui [Chonnam National University, Bio-Energy Research Institute, Gwangju (Korea, Republic of)

    2010-10-15

    The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. Research scope includes 1) screening of various microorganisms from decayed biomass in order to search for more efficient lignocellulose degrading microorganism, 2) identification and verification of new cell wall degrading cellulase for application cellulose bioconversion process, and 3) identification and characterization of novel genes involved in cellulose degradation. To find good microorganism candidates for lignocellulose degrading, 75 decayed samples from different areas were assayed in triplicate and analyzed. For cloning new cell wall degrading enzymes, we selected microorganisms because it have very good lignocellulose degradation ability. From that microorganisms, we have apparently cloned a new cellulase genes (10 genes). We are applying the new cloned cellulase genes to characterize in lignocellulsoe degradation that are most important to cellulosic biofuels production

  4. Pump it out : the environmental costs of BC's upstream oil and gas industry

    International Nuclear Information System (INIS)

    2003-05-01

    West Coast Environmental Law published this web-based guide to provide information to concerned citizens interested in knowing more about the environmental consequences of upstream oil and gas activity in British Columbia. The report looked at global consequences such as greenhouse gas emissions, and local consequences such as seismic lines, roads, and processing facilities. At present, the government of British Columbia is implementing policies aimed at doubling oil and gas production in five years, de-regulate the oil and gas industry, and cut oversight and enforcement staff. The guide was designed to assist citizens and communities in making informed choices about energy options. The specific topics dealt with in this report were: the consequences to the environment; what laws are applicable, and their enforcement; changes required to reduce or eliminate environmental damage; and, actions that a concerned citizen can take. refs

  5. Optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production

    International Nuclear Information System (INIS)

    Bae, Hyeun Jong; Wi, Seung Gon; Lee, Yoon Gyo; Kim, Ho Myung; Kim, Su Bae

    2011-10-01

    The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. The 2nd year Research scope includes: 1) Optimization of pre-treatment conditions for enzymatic hydrolysis of lignocellulosic biomass and 2) Demonstration of enzymatic hydrolysis by recombinant enzymes. To optimize the pretreatment, we applied two processes: a wet process (wet milling + popping), and dry process (popping + dry milling). Out of these, the wet process presented the best glucose yield with a 93.1% conversion, while the dry process yielded 69.6%, and the unpretreated process yielded <20%. The recombinant cellulolytic enzymes showed very high specific activity, about 80-1000 times on CMC and 13-70 times on filter paper at pH 3.5 and 55 .deg. C

  6. Plasma and energetic particle structure upstream of a quasi-parallel interplanetary shock

    Science.gov (United States)

    Kennel, C. F.; Scarf, F. L.; Coroniti, F. V.; Russell, C. T.; Wenzel, K.-P.; Sanderson, T. R.; Van Nes, P.; Smith, E. J.; Tsurutani, B. T.; Scudder, J. D.

    1984-01-01

    ISEE 1, 2 and 3 data from 1978 on interplanetary magnetic fields, shock