An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

Energy Technology Data Exchange (ETDEWEB)

Damiani, R.D. Jr.; Wessler, S.R. (Univ. of Georgia, Athens, GA (United States))

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

Russian upstream joint ventures logging progress

International Nuclear Information System (INIS)

Anon.

1992-01-01

This paper reports that Occidental Petroleum Corp. has begun exporting oil from Russia as part of an enhanced recovery joint venture in western Siberia. Oxy holds a 50% interest in the joint venture company, Vanyoganneft, and will market the oil. In other activity, two Canadian companies are marking progress with Russian upstream joint ventures

Meeting the challenge : capturing the upstream

International Nuclear Information System (INIS)

Bogle, E.W.

1998-01-01

The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

Science.gov (United States)

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Genes involved in complex adaptive processes tend to have highly conserved upstream regions in mammalian genomes

Directory of Open Access Journals (Sweden)

Kohane Isaac

2005-11-01

Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

Science.gov (United States)

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Outline of a genome navigation system based on the properties of GA-sequences and their flanks.

Directory of Open Access Journals (Sweden)

Guenter Albrecht-Buehler

Full Text Available Introducing a new method to visualize large stretches of genomic DNA (see Appendix S1 the article reports that most GA-sequences [1] shared chains of tetra-GA-motifs and contained upstream poly(A-segments. Although not integral parts of them, Alu-elements were found immediately upstream of all human and chimpanzee GA-sequences with an upstream poly(A-segment. The article hypothesizes that genome navigation uses these properties of GA-sequences in the following way. (1 Poly(A binding proteins interact with the upstream poly(A-segments and arrange adjacent GA-sequences side-by-side ('GA-ribbon', while folding the intervening DNA sequences between them into loops ('associated DNA-loops'. (2 Genome navigation uses the GA-ribbon as a search path for specific target genes that is up to 730-fold shorter than the full-length chromosome. (3 As to the specificity of the search, each molecule of a target protein is assumed to catalyze the formation of specific oligomers from a set of transcription factors that recognize tetra-GA-motifs. Their specific combinations of tetra-GA motifs are assumed to be present in the particular GA-sequence whose associated loop contains the gene for the target protein. As long as the target protein is abundant in the cell it produces sufficient numbers of such oligomers which bind to their specific GA-sequences and, thereby, inhibit locally the transcription of the target protein in the associated loop. However, if the amount of target protein drops below a certain threshold, the resultant reduction of specific oligomers leaves the corresponding GA-sequence 'denuded'. In response, the associated DNA-loop releases its nucleosomes and allows transcription of the target protein to proceed. (4 The Alu-transcripts may help control the general background of protein synthesis proportional to the number of transcriptionally active associated loops, especially in stressed cells. (5 The model offers a new mechanism of co-regulation of

Spectrometric study of the folding process of i-motif-forming DNA sequences upstream of the c-kit transcription initiation site

International Nuclear Information System (INIS)

Bucek, Pavel; Gargallo, Raimundo; Kudrev, Andrei

2010-01-01

The c-kit oncogene shows a cytosine-rich DNA region upstream of the transcription initiation site which forms an i-motif structure at slightly acidic pH values (Bucek et al. ). In the present study, the pH-induced formation of i-motif - forming sequences 5'-CCC CTC CCT CGC GCC CGC CCG-3' (ckitC1, native), 5'-CCC TTC CCT TGT GCC CGC CCG-3' (ckitC2) and 5'-CCCTT CCC TTTTT CCC T CCC T-3' (ckitC3) was studied by spectroscopic techniques, such as UV molecular absorption and circular dichroism (CD), in tandem with two multivariate data analysis methods, the hard modelling-based matrix method and the soft modelling-based MCR-ALS approach. Use of the hard chemical modelling enabled us to propose the equilibrium model, which describes spectral changes as functions of solution acidity. Additionally, the intrinsic protonation constant, K in , and the cooperativity parameters, ω c , and ω a , were calculated from the fitting procedure of the coupled CD and molecular absorption spectra. In the case of ckitC2 and ckitC3, the hard model correctly reproduced the spectral variations observed experimentally. The results indicated that folding was accompanied by a cooperative process, i.e. the enhancement of protonated structure stability upon protonation. In contrast, unfolding was accompanied by an anticooperative process. Finally, folding of the native sequence, ckitC1, seemed to follow a more complex mechanism.

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

Science.gov (United States)

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

Complexes between the LKB1 tumor suppressor, STRADα/β and MO25α/β are upstream kinases in the AMP-activated protein kinase cascade

Directory of Open Access Journals (Sweden)

Alessi Dario R

2003-09-01

Full Text Available Abstract Background The AMP-activated protein kinase (AMPK cascade is a sensor of cellular energy charge that acts as a 'metabolic master switch' and inhibits cell proliferation. Activation requires phosphorylation of Thr172 of AMPK within the activation loop by upstream kinases (AMPKKs that have not been identified. Recently, we identified three related protein kinases acting upstream of the yeast homolog of AMPK. Although they do not have obvious mammalian homologs, they are related to LKB1, a tumor suppressor that is mutated in the human Peutz-Jeghers cancer syndrome. We recently showed that LKB1 exists as a complex with two accessory subunits, STRADα/β and MO25α/β. Results We report the following observations. First, two AMPKK activities purified from rat liver contain LKB1, STRADα and MO25α, and can be immunoprecipitated using anti-LKB1 antibodies. Second, both endogenous and recombinant complexes of LKB1, STRADα/β and MO25α/β activate AMPK via phosphorylation of Thr172. Third, catalytically active LKB1, STRADα or STRADβ and MO25α or MO25β are required for full activity. Fourth, the AMPK-activating drugs AICA riboside and phenformin do not activate AMPK in HeLa cells (which lack LKB1, but activation can be restored by stably expressing wild-type, but not catalytically inactive, LKB1. Fifth, AICA riboside and phenformin fail to activate AMPK in immortalized fibroblasts from LKB1-knockout mouse embryos. Conclusions These results provide the first description of a physiological substrate for the LKB1 tumor suppressor and suggest that it functions as an upstream regulator of AMPK. Our findings indicate that the tumors in Peutz-Jeghers syndrome could result from deficient activation of AMPK as a consequence of LKB1 inactivation.

Canada's upstream petroleum industry : 1997 perspective

International Nuclear Information System (INIS)

1997-06-01

A review of the trends and activities in the upstream petroleum industry during 1996 were presented, emphasizing the significance of the industry' contribution to Canada's economy. Among the areas included were highlights of Canada's hydrocarbon reserves, conventional production, frontier production, and non-conventional (oil sands) production. New market opportunities and activities in the pipeline transportation sector were also discussed. Environmental issues including health and safety received due attention. In this regard, the industry's efforts to work with government and other stakeholders to ensure that requirements for land use are balanced with the need to protect wilderness and wildlife habitat, received special mention. 16 figs

Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

International Nuclear Information System (INIS)

Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth

2009-01-01

The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

Science.gov (United States)

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

The WW domain protein Kibra acts upstream of Hippo in Drosophila

DEFF Research Database (Denmark)

Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie

2010-01-01

inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...

Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

International Nuclear Information System (INIS)

Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

1997-01-01

A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Genome-Wide Search for Translated Upstream Open Reading Frames in Arabidopsis Thaliana.

Science.gov (United States)

Hu, Qiwen; Merchante, Catharina; Stepanova, Anna N; Alonso, Jose M; Heber, Steffen

2016-03-01

Upstream open reading frames (uORFs) are open reading frames that occur within the 5' UTR of an mRNA. uORFs have been found in many organisms. They play an important role in gene regulation, cell development, and in various metabolic processes. It is believed that translated uORFs reduce the translational efficiency of the main coding region. However, only few uORFs are experimentally characterized. In this paper, we use ribosome footprinting together with a semi-supervised approach based on stacking classification models to identify translated uORFs in Arabidopsis thaliana. Our approach identified 5360 potentially translated uORFs in 2051 genes. GO terms enriched in genes with translated uORFs include catalytic activity, binding, transferase activity, phosphotransferase activity, kinase activity, and transcription regulator activity. The reported uORFs occur with a higher frequency in multi-isoform genes, and some uORFs are affected by alternative transcript start sites or alternative splicing events. Association rule mining revealed sequence features associated with the translation status of the uORFs. We hypothesize that uORF translation is a complex process that might be regulated by multiple factors. The identified uORFs are available online at:https://www.dropbox.com/sh/zdutupedxafhly8/AABFsdNR5zDfiozB7B4igFcja?dl=0. This paper is the extended version of our research presented at ISBRA 2015.

The economic impacts of the upstream activities after the reform of the Brazilian oil industry; Impactos economicos da exploracao e producao apos a abertura da industria petrolifera brasileira

Energy Technology Data Exchange (ETDEWEB)

Canelas, Andre [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Planejamento Energetico

2004-07-01

This paper analyzes the macroeconomic impacts of the investments in the oil and gas upstream, which took place after the reform of the Brazilian oil industry. The reason why I chose to analyze such a period of time was the institutional change which took place in the Brazilian oil industry after the Brazilian Parliament approved Law n. 9.478 in 1997. The law represented the new regulation of the activities related to the oil industry in Brazil. Since then, there has been a very large amount of capital spending in the oil and gas upstream, not only by PETROBRAS, the state-owned oil company, but also by the oil companies which entered the Brazilian oil industry after it was opened to foreign and private upstream investments. This paper analyses the economic impacts of these upstream investments by PETROBRAS and by the new players in Brazil, addressing the impacts of these investments on the generation of aggregate value and yield and the economic activity of other industries. This paper is dedicated, in its entirety, to Prof. Carmen Alveal, whose knowledge, support, encouragement and friendship were, for me, the most important of all, professionally and morally. (author)

POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

Energy Technology Data Exchange (ETDEWEB)

ANDERSON,C.W.APPELLA,E.

2003-10-23

The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

Science.gov (United States)

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

Science.gov (United States)

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

Science.gov (United States)

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

DEFF Research Database (Denmark)

Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

1988-01-01

Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

Sequence Matters but How Exactly? A Method for Evaluating Activity Sequences from Data

Science.gov (United States)

Doroudi, Shayan; Holstein, Kenneth; Aleven, Vincent; Brunskill, Emma

2016-01-01

How should a wide variety of educational activities be sequenced to maximize student learning? Although some experimental studies have addressed this question, educational data mining methods may be able to evaluate a wider range of possibilities and better handle many simultaneous sequencing constraints. We introduce Sequencing Constraint…

CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation.

Science.gov (United States)

Tang, Tiantian; Lang, Xueting; Xu, Congfei; Wang, Xiaqiong; Gong, Tao; Yang, Yanqing; Cui, Jun; Bai, Li; Wang, Jun; Jiang, Wei; Zhou, Rongbin

2017-08-04

The NLRP3 inflammasome can sense different pathogens or danger signals, and has been reported to be involved in the development of many human diseases. Potassium efflux and mitochondrial damage are both reported to mediate NLRP3 inflammasome activation, but the underlying, orchestrating signaling events are still unclear. Here we show that chloride intracellular channels (CLIC) act downstream of the potassium efflux-mitochondrial reactive oxygen species (ROS) axis to promote NLRP3 inflammasome activation. NLRP3 agonists induce potassium efflux, which causes mitochondrial damage and ROS production. Mitochondrial ROS then induces the translocation of CLICs to the plasma membrane for the induction of chloride efflux to promote NEK7-NLRP3 interaction, inflammasome assembly, caspase-1 activation, and IL-1β secretion. Thus, our results identify CLICs-dependent chloride efflux as an essential and proximal upstream event for NLRP3 activation.The NLRP3 inflammasome is key to the regulation of innate immunity against pathogens or stress, but the underlying signaling regulation is still unclear. Here the authors show that chloride intracellular channels (CLIC) interface between mitochondria stress and inflammasome activation to modulate inflammatory responses.

Upstream cash cloud

International Nuclear Information System (INIS)

Shepherd, R.

1998-01-01

This paper focuses on the effects of the slowdown in budgetary growth on the upstream business and offshore services. The dangers facing investors, the strong growth in energy demand, oil company priorities, the dip in profits of the oil companies, new field economics, the budgets for exploration and production, and the rig market outlook are discussed. (UK)

ENHANCING THE ROLE OF STAKEHOLDERS IN THE MANAGEMENT OF UPSTREAM CILIWUNG WATERSHED

Directory of Open Access Journals (Sweden)

Iis Alviya

2016-08-01

Full Text Available Stakeholders have a ver y important role interm of the management of upstream watershed. Thus, the common understanding on the existence and role of stakeholders is an important factor in order to achieve good governance of watershed management, leading to the attainment of environmental, social and economic benefits. This paper aims to analyse the role, interests, and cooperation among stakeholders and its relationship with the condition of upper Ciliwung watershed. Stakeholder analysis was used in this study to identify stakeholders, to categorize them, and to investigate the relationship between stakeholders. The analysis showed the lack of cooperation among stakeholders both between key stakeholders with primar y stakeholders. This resulted in lack of communities' understanding on the benefits and the importance of conservation activities in the upstream Ciliwung watershed. Meanwhile, the cooperation between key stakeholders and supporting stakeholders, especially the providers of funds, was relatively better/stronger. This can be seen from a better management of inter-agency cooperation in the upstream Ciliwung watershed, although the effort was tend to be project-oriented. Therefore, communication forum need to be established, to taking role for synchronizing , collaborating and coordinating stakeholders' efforts, so that the management programs of upstream Ciliwung watershed can be integrated.

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter

Energy Technology Data Exchange (ETDEWEB)

Kleinert, H.; Benecke, B.J.

1988-02-25

The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Science.gov (United States)

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

Science.gov (United States)

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

Energy Technology Data Exchange (ETDEWEB)

Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

1994-09-01

The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

Upstream Atlantic salmon (Salmo salar) passage

International Nuclear Information System (INIS)

Clay, C.H.

1993-01-01

Upstream salmon passage though a dam is discussed with respect to three main components: the fishway entrance, the fishway, and the exit. Design considerations and alternative types of components are presented. For fishway entrances, an important consideration is the positioning of the entrance as far upstream as the fish can swim with respect to obstacles. For powerhouses using water diverted from a river, the problem of leading fish past the powerhouse may be overcome by either installing a tailrace barrier or increasing the flow until the home stream odor is sufficient to attract fish. Swimming ability should be the first consideration in fishway design. Fishways with 50 cm drops per pool would be satisfactory in most cases. The problem of headwater fluctuation is overcome through careful fishway selection. Fish locks, hoists, and elevators are other alternatives to pool/weir fishways. The location for a fish exit must be decided on the basis of whether the fishway will be used only for upstream migrations. 5 refs., 1 fig., 1 tab

Restructuring: new relationships between the oil companies and the upstream oil firms

International Nuclear Information System (INIS)

Barreau, S.

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

Science.gov (United States)

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Directory of Open Access Journals (Sweden)

Feng-Yu Wang

Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Conserved upstream open reading frames in higher plants

Directory of Open Access Journals (Sweden)

Schultz Carolyn J

2008-07-01

Full Text Available Abstract Background Upstream open reading frames (uORFs can down-regulate the translation of the main open reading frame (mORF through two broad mechanisms: ribosomal stalling and reducing reinitiation efficiency. In distantly related plants, such as rice and Arabidopsis, it has been found that conserved uORFs are rare in these transcriptomes with approximately 100 loci. It is unclear how prevalent conserved uORFs are in closely related plants. Results We used a homology-based approach to identify conserved uORFs in five cereals (monocots that could potentially regulate translation. Our approach used a modified reciprocal best hit method to identify putative orthologous sequences that were then analysed by a comparative R-nomics program called uORFSCAN to find conserved uORFs. Conclusion This research identified new genes that may be controlled at the level of translation by conserved uORFs. We report that conserved uORFs are rare (

Upstream health law.

Science.gov (United States)

Sage, William M; McIlhattan, Kelley

2014-01-01

For the first time, entrepreneurs are aggressively developing new technologies and business models designed to improve individual and population health, not just to deliver specialized medical care. Consumers of these goods and services are not yet "patients"; they are simply people. As this sector of the health care industry expands, it is likely to require new forms of legal governance, which we term "upstream health law." © 2014 American Society of Law, Medicine & Ethics, Inc.

PROMoter uPstream Transcripts share characteristics with mRNAs and are produced upstream of all three major types of mammalian promoters

DEFF Research Database (Denmark)

Preker, Pascal; Almvig, Kristina; Christensen, Marianne S

2011-01-01

RNAs, PROMPTs are largely nuclear and rapidly turned over by the RNA exosome. PROMPT-transcribing DNA is occupied by RNA polymerase II (RNAPII) complexes with serine 2 phosphorylated C-terminal domains (CTDs), mimicking that of the associated genic region. Thus, the inefficient elongation capacity of PROMPT...... transcription cannot solely be assigned to poor CTD phosphorylation. Conditions that reduce gene transcription increase RNAPII occupancy of the upstream PROMPT region, suggesting that they reside in a common transcription compartment. Surprisingly, gene promoters that are actively transcribed by RNAPI...

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

Science.gov (United States)

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

Science.gov (United States)

Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

1989-01-01

The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

Science.gov (United States)

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Human Resource Local Content in Ghana's Upstream Petroleum Industry

Science.gov (United States)

Benin, Papa

Enactment of Ghana's Petroleum (Local Content and Local Participation) Regulations, 2013 (L.I. 2204) was intended to regulate the percentage of local products, personnel, financing, and goods and services rendered within Ghana's upstream petroleum industry value chain. Five years after the inception of Ghana's upstream oil and gas industry, a gap is evident between the requirements of L.I. 2204 and professional practice. Drawing on Lewin's change theory, a cross-sectional study was conducted to examine the extent of differences between the prevailing human resource local content and the requirements of L.I. 2204 in Ghana's upstream petroleum industry. The extent to which training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its upstream petroleum industry was also examined. Survey data were collected from 97 management, technical, and other staff in 2 multinational petroleum companies whose oil and gas development plans have been approved by the Petroleum Commission of Ghana. To answer the research questions and test their hypotheses, one-way ANOVA was performed with staff category (management, technical, and other) as the independent variable and prevalent local content as the dependent variable. Results indicated that prevailing local content in Ghana's upstream petroleum industry meets the requirements of L.I. 2204. Further, training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its offshore petroleum industry. Findings may encourage leaders within multinational oil companies and the Petroleum Commission of Ghana to organize educational seminars that equip indigenous Ghanaians with specialized skills for working in Ghana's upstream petroleum industry.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Clustering in large networks does not promote upstream reciprocity.

Directory of Open Access Journals (Sweden)

Naoki Masuda

Full Text Available Upstream reciprocity (also called generalized reciprocity is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

Clustering in large networks does not promote upstream reciprocity.

Science.gov (United States)

Masuda, Naoki

2011-01-01

Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

Science.gov (United States)

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

Solar-Type Activity in Main-Sequence Stars

CERN Document Server

Gershberg, Roald E

2005-01-01

Solar-type activity over the whole range of the electromagnetic spectrum is a phenomenon inherent in the majority of low- and moderate-mass main sequence stars. In this monograph observational results are summarized in a systematic and comprehensive fashion. The analysis of the various manifestations of such stellar activity leads to the identification of these phenomena with macroscopic non-linear processes in a magnetized plasma. Comparative study of flare stars and the Sun has become increasingly fruitful and is presently an active field of research involving stellar and solar physicists, experts in plasma physics and high-energy astrophysicists. This book will provide them with both an introduction and overview of observational results from the first optical photometry and spectroscopy, from the satellite telescopes International Ultraviolet Explorer to Hubble Space Telescope, XMM-Newton and Chandra, as well as with the present physical interpretation of solar-type activity in main sequence stars. Gershbe...

Noninvasive estimation of global activation sequence using the extended Kalman filter.

Science.gov (United States)

Liu, Chenguang; He, Bin

2011-03-01

A new algorithm for 3-D imaging of the activation sequence from noninvasive body surface potentials is proposed. After formulating the nonlinear relationship between the 3-D activation sequence and the body surface recordings during activation, the extended Kalman filter (EKF) is utilized to estimate the activation sequence in a recursive way. The state vector containing the activation sequence is optimized during iteration by updating the error variance/covariance matrix. A new regularization scheme is incorporated into the "predict" procedure of EKF to tackle the ill-posedness of the inverse problem. The EKF-based algorithm shows good performance in simulation under single-site pacing. Between the estimated activation sequences and true values, the average correlation coefficient (CC) is 0.95, and the relative error (RE) is 0.13. The average localization error (LE) when localizing the pacing site is 3.0 mm. Good results are also obtained under dual-site pacing (CC = 0.93, RE = 0.16, and LE = 4.3 mm). Furthermore, the algorithm shows robustness to noise. The present promising results demonstrate that the proposed EKF-based inverse approach can noninvasively estimate the 3-D activation sequence with good accuracy and the new algorithm shows good features due to the application of EKF.

Folding and activity of hybrid sequence, disulfide-stabilized peptides

Energy Technology Data Exchange (ETDEWEB)

Pease, J.H.B.; Storrs, R.W.; Wemmer, D.E. (Univ. of California, Berkeley (USA))

1990-08-01

Peptides have been synthesized that have hybrid sequences, partially derived from the bee venom peptide apamin and partially from the S peptide of ribonuclease A. The hybrid peptides were demonstrated by NMR spectroscopy to fold, forming the same disulfides and basic three-dimensional structure as native apamin, containing a {beta}-turn and an {alpha}-helix. These hybrids were active in complementing S protein, reactivating nuclease activity. In addition, the hybrid peptide was effective in inducing antibodies that cross-react with the RNase, without conjugation to a carrier protein. The stability of the folded structure of this peptide suggests that it should be possible to elicit antibodies that will react not only with a specific sequence, but also with a specific secondary structure. Hybrid sequence peptides also provide opportunities to study separately nucleation and propagation steps in formation of secondary structure. The authors show that in S peptide the {alpha}-helix does not end abruptly but rather terminates gradually over four or five residues. In general, these hybrid sequence peptides, which fold predictably because of disulfide bond formation, can provide opportunities for examining structure - function relationships for many biologically active sequences.

Folding and activity of hybrid sequence, disulfide-stabilized peptides

International Nuclear Information System (INIS)

Pease, J.H.B.; Storrs, R.W.; Wemmer, D.E.

1990-01-01

Peptides have been synthesized that have hybrid sequences, partially derived from the bee venom peptide apamin and partially from the S peptide of ribonuclease A. The hybrid peptides were demonstrated by NMR spectroscopy to fold, forming the same disulfides and basic three-dimensional structure as native apamin, containing a β-turn and an α-helix. These hybrids were active in complementing S protein, reactivating nuclease activity. In addition, the hybrid peptide was effective in inducing antibodies that cross-react with the RNase, without conjugation to a carrier protein. The stability of the folded structure of this peptide suggests that it should be possible to elicit antibodies that will react not only with a specific sequence, but also with a specific secondary structure. Hybrid sequence peptides also provide opportunities to study separately nucleation and propagation steps in formation of secondary structure. The authors show that in S peptide the α-helix does not end abruptly but rather terminates gradually over four or five residues. In general, these hybrid sequence peptides, which fold predictably because of disulfide bond formation, can provide opportunities for examining structure - function relationships for many biologically active sequences

Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

International Nuclear Information System (INIS)

Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.

2008-01-01

In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Participation costs can suppress the evolution of upstream reciprocity.

Science.gov (United States)

Peña, Jorge; Pestelacci, Enea; Berchtold, André; Tomassini, Marco

2011-03-21

Indirect reciprocity, one of the many mechanisms proposed to explain the evolution of cooperation, is the idea that altruistic actions can be rewarded by third parties. Upstream or generalized reciprocity is one type of indirect reciprocity in which individuals help someone if they have been helped by somebody else in the past. Although empirically found to be at work in humans, the evolution of upstream reciprocity is difficult to explain from a theoretical point of view. A recent model of upstream reciprocity, first proposed by Nowak and Roch (2007) and further analyzed by Iwagami and Masuda (2010), shows that while upstream reciprocity alone does not lead to the evolution of cooperation, it can act in tandem with mechanisms such as network reciprocity and increase the total level of cooperativity in the population. We argue, however, that Nowak and Roch's model systematically leads to non-uniform interaction rates, where more cooperative individuals take part in more games than less cooperative ones. As a result, the critical benefit-to-cost ratios derived under this model in previous studies are not invariant with respect to the addition of participation costs. We show that accounting for these costs can hinder and even suppress the evolution of upstream reciprocity, both for populations with non-random encounters and graph-structured populations. Copyright © 2011 Elsevier Ltd. All rights reserved.

Identification of sequence motifs significantly associated with antisense activity

Directory of Open Access Journals (Sweden)

Peek Andrew S

2007-06-01

Full Text Available Abstract Background Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. Results We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. Conclusion The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic

Suspension, abandonment, decontamination, and surface land reclamation of upstream oil and gas facilities : informational letter IL 98-2

International Nuclear Information System (INIS)

1998-01-01

This release of the Alberta Energy and Utilities Board (EUB) is intended to clarify the jurisdictional roles of Alberta Environmental Protection (AEP) and the EUB with regard to their respective responsibilities for the regulation of the suspension, abandonment, decontamination and surface land reclamation of active and inactive upstream oil and gas facilities. The EUB, AEP and industrial operators all have separate roles and responsibilities when active and inactive upstream facilities are suspended or reclaimed. In the future, industry operators will have more interaction with the AEP during the decontamination of a site, while the EUB will concentrate on pollution prevention and abandonment of non-economic facilities. All oilfield waste generated from suspension, abandonment, decontamination, and surface land reclamation of an active or inactive upstream oil and gas facility will fall under the jurisdiction of the EUB. Contaminated soils, sludges, and waters that are physically removed as a result of decontamination activities are considered to be oilfield wastes. The regulatory responsibility between the AEP and the EUB remains unchanged for the reclamation process of on-lease and off-lease spills, releases or pipeline breaks. Industry operators are no longer allowed to discharge any produced liquid to earthen pits or ponds and are encouraged to reclaim existing ones. 3 figs

Willingness of upstream and downstream resource managers to engage in compensation schemes for environmental services

Directory of Open Access Journals (Sweden)

Chapika Sangkapitux

2009-04-01

Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

Science.gov (United States)

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

2017-04-01

Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of

Inlet effect induced ''upstream'' critical heat flux in smooth tubes

International Nuclear Information System (INIS)

Kitto, J.B. Jr.

1986-01-01

An unusual form of ''upstream'' critical heat flux (CHF) has been observed and directly linked to the inlet flow pattern during an experimental study of high pressure (17 - 20 MPa) water flowing through a vertical 38.1 mm ID smooth bore tube with uniform axial and nonuniform circumferential heating. These upstream CHF data were characterized by temperature excursions which initially occurred at a relatively fixed axial location in the middle of the test section while the outlet and inlet heated lengths experienced no change. A rifled tube inlet flow conditioner could be substituted for a smooth tube section to generate the desired swirling inlet flow pattern. The upstream CHF data were found to match data from a uniformly heated smooth bore tube when the comparison was made using the peak local heat flux. The mechanism proposed to account for the upstream CHF observations involves the destructive interference between the decaying swirl flow and the secondary circumferential liquid flow field resulting from the one-sided heating

The LHCb Upstream Tracker Project

CERN Document Server

Steinkamp, Olaf

2015-01-01

The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...

Characterizing leader sequences of CRISPR loci

DEFF Research Database (Denmark)

Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

2016-01-01

The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

Brain activation during anticipation of sound sequences.

Science.gov (United States)

Leaver, Amber M; Van Lare, Jennifer; Zielinski, Brandon; Halpern, Andrea R; Rauschecker, Josef P

2009-02-25

Music consists of sound sequences that require integration over time. As we become familiar with music, associations between notes, melodies, and entire symphonic movements become stronger and more complex. These associations can become so tight that, for example, hearing the end of one album track can elicit a robust image of the upcoming track while anticipating it in total silence. Here, we study this predictive "anticipatory imagery" at various stages throughout learning and investigate activity changes in corresponding neural structures using functional magnetic resonance imaging. Anticipatory imagery (in silence) for highly familiar naturalistic music was accompanied by pronounced activity in rostral prefrontal cortex (PFC) and premotor areas. Examining changes in the neural bases of anticipatory imagery during two stages of learning conditional associations between simple melodies, however, demonstrates the importance of fronto-striatal connections, consistent with a role of the basal ganglia in "training" frontal cortex (Pasupathy and Miller, 2005). Another striking change in neural resources during learning was a shift between caudal PFC earlier to rostral PFC later in learning. Our findings regarding musical anticipation and sound sequence learning are highly compatible with studies of motor sequence learning, suggesting common predictive mechanisms in both domains.

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

Science.gov (United States)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

CSReport: A New Computational Tool Designed for Automatic Analysis of Class Switch Recombination Junctions Sequenced by High-Throughput Sequencing.

Science.gov (United States)

Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie

2017-05-15

B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.

Upstream waves simultaneously observed by ISEE and UKS

International Nuclear Information System (INIS)

Russell, C.T.; Luhmann, J.G.; Elphic, R.C.; Southwood, D.J.; Smith, M.F.; Johnstone, A.D.

1987-01-01

Measurements obtained in the solar wind by ISEE-2 and the United Kingdom Subsatellite (UKS) have been examined for observations of upstream waves. These data reveal that the waves in the foreshock region are enhanced at all frequencies from at least 0.003 Hz to 0.5 Hz. The wave spectra generally have a spectral peak, but this peak is usually broad and the peak frequency depends on the position of the spacecraft. Generally, the spectra seen at the two spacecraft are most similar at high frequencies and least similar at low frequencies. The geometry of the interaction is displayed in the plane containing the magnetic field, the solar wind velocity, and the spacecraft location. However, this coordinate system does not order all the observed wave properties. It does not clearly explain or order the handedness of the waves, or their direction of propagation. It is clear that the upstream region is inherently three-dimensional. The position-dependent nature of the upstream waves indicates that comparisons between ground-based measurements and in-situ observations must be undertaken with some caution

Sequencing and functional analysis of the nifENXorf1orf2 gene cluster of Herbaspirillum seropedicae.

Science.gov (United States)

Klassen, G; Pedrosa, F O; Souza, E M; Yates, M G; Rigo, L U

1999-12-01

A 5.1-kb DNA fragment from the nifHDK region of H. seropedicae was isolated and sequenced. Sequence analysis showed the presence of nifENXorf1orf2 but nifTY were not present. No nif or consensus promoter was identified. Furthermore, orf1 expression occurred only under nitrogen-fixing conditions and no promoter activity was detected between nifK and nifE, suggesting that these genes are expressed from the upstream nifH promoter and are parts of a unique nif operon. Mutagenesis studies indicate that nifN was essential for nitrogenase activity whereas nifXorf1orf2 were not. High homology between the C-terminal region of the NifX and NifB proteins from H. seropedicae was observed. Since the NifX and NifY proteins are important for FeMo cofactor (FeMoco) synthesis, we propose that alternative proteins with similar activities exist in H. seropedicae.

Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

Directory of Open Access Journals (Sweden)

L. Minieri

2010-04-01

Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

Meaningful spatial and temporal sequences of activities in dwelling

NARCIS (Netherlands)

Hematalikeikha, M.A.; Coolen, H.C.C.H.; Pourdeihimi, S.

2014-01-01

Human activities based on human needs are affected by affordances and meanings that occur in the dwelling. Activities over time and space have meaningful sequences. The meaningfulness of activities in the cultural framework is conditioned by its special temporality and spatiality. Also, temporal or

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. C. Anagnostopoulos

2000-01-01

Full Text Available We present for the first time a statistical study of \\geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. Kaliabetsos

Full Text Available We present for the first time a statistical study of geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Magnetic nanoparticle imaging by random and maximum length sequences of inhomogeneous activation fields.

Science.gov (United States)

Baumgarten, Daniel; Eichardt, Roland; Crevecoeur, Guillaume; Supriyanto, Eko; Haueisen, Jens

2013-01-01

Biomedical applications of magnetic nanoparticles require a precise knowledge of their biodistribution. From multi-channel magnetorelaxometry measurements, this distribution can be determined by means of inverse methods. It was recently shown that the combination of sequential inhomogeneous excitation fields in these measurements is favorable regarding the reconstruction accuracy when compared to homogeneous activation . In this paper, approaches for the determination of activation sequences for these measurements are investigated. Therefor, consecutive activation of single coils, random activation patterns and families of m-sequences are examined in computer simulations involving a sample measurement setup and compared with respect to the relative condition number of the system matrix. We obtain that the values of this condition number decrease with larger number of measurement samples for all approaches. Random sequences and m-sequences reveal similar results with a significant reduction of the required number of samples. We conclude that the application of pseudo-random sequences for sequential activation in the magnetorelaxometry imaging of magnetic nanoparticles considerably reduces the number of required sequences while preserving the relevant measurement information.

LHCb upstream tracker

CERN Multimedia

Artuso, Marina

2016-01-01

The detector for the LHCb upgrade is designed for 40MHz readout, allowing the experiment to run at an instantaneous luminosity of 2x10^33 cm$^2$s$^-1$. The upgrade of the tracker subsystem in front of the dipole magnet, the Upstream Tracker, is crucial for charged track reconstruction and fast trigger decisions based on a tracking algorithm involving also vertex detector information. The detector consists of 4 planes with a total area of about 8.5m$^2$, made of single sided silicon strip sensors read-out by a novel custom-made ASIC (SALT). Details on the performance of prototype sensors, front-end electronics, near-detector electronics and mechanical components are presented.

Inventories and upstream gasoline price dynamics

NARCIS (Netherlands)

Kuper, Gerard H.

This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

Genome-wide mapping of autonomous promoter activity in human cells.

Science.gov (United States)

van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

2017-02-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

An upstream open reading frame modulates ebola virus polymerase translation and virus replication.

Directory of Open Access Journals (Sweden)

Reed S Shabman

2013-01-01

Full Text Available Ebolaviruses, highly lethal zoonotic pathogens, possess longer genomes than most other non-segmented negative-strand RNA viruses due in part to long 5' and 3' untranslated regions (UTRs present in the seven viral transcriptional units. To date, specific functions have not been assigned to these UTRs. With reporter assays, we demonstrated that the Zaire ebolavirus (EBOV 5'-UTRs lack internal ribosomal entry site function. However, the 5'-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5'-UTR derived from the viral polymerase (L mRNA strongly suppressed translation of GFP compared to a β-actin 5'-UTR. The L 5'-UTR is one of four viral genes to possess upstream AUGs (uAUGs, and ablation of each uAUG enhanced translation of the primary ORF (pORF, most dramatically in the case of the L 5'-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a "weak" Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress. To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10-100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.

Upstream-downstream cooperation approach in Guanting Reservoir watershed.

Science.gov (United States)

Yang, Zhi-Feng; Zhang, Wen-Guo

2005-01-01

A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.

Mapping membrane activity in undiscovered peptide sequence space using machine learning.

Science.gov (United States)

Lee, Ernest Y; Fulan, Benjamin M; Wong, Gerard C L; Ferguson, Andrew L

2016-11-29

There are some ∼1,100 known antimicrobial peptides (AMPs), which permeabilize microbial membranes but have diverse sequences. Here, we develop a support vector machine (SVM)-based classifier to investigate ⍺-helical AMPs and the interrelated nature of their functional commonality and sequence homology. SVM is used to search the undiscovered peptide sequence space and identify Pareto-optimal candidates that simultaneously maximize the distance σ from the SVM hyperplane (thus maximize its "antimicrobialness") and its ⍺-helicity, but minimize mutational distance to known AMPs. By calibrating SVM machine learning results with killing assays and small-angle X-ray scattering (SAXS), we find that the SVM metric σ correlates not with a peptide's minimum inhibitory concentration (MIC), but rather its ability to generate negative Gaussian membrane curvature. This surprising result provides a topological basis for membrane activity common to AMPs. Moreover, we highlight an important distinction between the maximal recognizability of a sequence to a trained AMP classifier (its ability to generate membrane curvature) and its maximal antimicrobial efficacy. As mutational distances are increased from known AMPs, we find AMP-like sequences that are increasingly difficult for nature to discover via simple mutation. Using the sequence map as a discovery tool, we find a unexpectedly diverse taxonomy of sequences that are just as membrane-active as known AMPs, but with a broad range of primary functions distinct from AMP functions, including endogenous neuropeptides, viral fusion proteins, topogenic peptides, and amyloids. The SVM classifier is useful as a general detector of membrane activity in peptide sequences.

Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

Directory of Open Access Journals (Sweden)

Dilley Robert

2009-01-01

Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

Lead acetate induces EGFR activation upstream of SFK and PKCα linkage to the Ras/Raf-1/ERK signaling

International Nuclear Information System (INIS)

Wang, C.-Y.; Wang, Y.-T.; Tzeng, D.-W.; Yang, J.-L.

2009-01-01

Lead acetate (Pb), a probable human carcinogen, can activate protein kinase C (PKC) upstream of extracellular signal-regulated kinase 1 and 2 (ERK1/2). Yet, it remains unclear whether Pb activation of PKC → ERK1/2 involves receptor/non-receptor tyrosine kinases and the Ras signaling transducer. Here we demonstrate a novel mechanism elicited by Pb for transmitting ERK1/2 signaling in CL3 human non-small-cell lung adenocarcinoma cells. Pb induction of higher steady-state levels of Ras-GTP was essential for increasing phospho-Raf-1 S338 and phospho-ERK1/2. Pre-treatment of the cells with a conventional PKC inhibitor Goe6976 or depleting PKCα using specific small interfering RNA blocked Pb induction of Ras-GTP. Pb also activated cellular tyrosine kinases. Specific pharmacological inhibitors, PD153035 for epidermal growth factor receptor (EGFR) and SU6656 for Src family tyrosine kinases (SFK), but not AG1296 for platelet-derived growth factor receptor, could suppress the Pb-induced tyrosine kinases, PKCα, Ras-GTP, phospho-Raf-1 S338 and phospho-ERK1/2. Furthermore, phosphorylation of tyrosines on the EGFR multiple autophosphorylation sites and the conserved SFK autophosphorylation site occurred during exposure of cells to Pb for 1-5 min and 5-30 min, respectively. Intriguingly, Pb activation of EGFR required the intrinsic kinase activity but not dimerization of the receptor. Inhibition of SFK or PKCα activities did not affect EGFR phosphorylation, while knockdown of EGFR blocked SFK phosphorylation and PKCα activation following Pb. Together, these results indicate that immediate activation of EGFR in response to Pb is obligatory for activation of SFK and PKCα and subsequent the Ras-Raf-1-MKK1/2-ERK1/2 signaling cascade

A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

Directory of Open Access Journals (Sweden)

Lior Levy

2017-10-01

Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

Science.gov (United States)

Hampel, Stefanie; McKellar, Claire E

2017-01-01

A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

Neural correlates of skill acquisition: decreased cortical activity during a serial interception sequence learning task.

Science.gov (United States)

Gobel, Eric W; Parrish, Todd B; Reber, Paul J

2011-10-15

Learning of complex motor skills requires learning of component movements as well as the sequential structure of their order and timing. Using a Serial Interception Sequence Learning (SISL) task, participants learned a sequence of precisely timed interception responses through training with a repeating sequence. Following initial implicit learning of the repeating sequence, functional MRI data were collected during performance of that known sequence and compared with activity evoked during novel sequences of actions, novel timing patterns, or both. Reduced activity was observed during the practiced sequence in a distributed bilateral network including extrastriate occipital, parietal, and premotor cortical regions. These reductions in evoked activity likely reflect improved efficiency in visuospatial processing, spatio-motor integration, motor planning, and motor execution for the trained sequence, which is likely supported by nondeclarative skill learning. In addition, the practiced sequence evoked increased activity in the left ventral striatum and medial prefrontal cortex, while the posterior cingulate was more active during periods of better performance. Many prior studies of perceptual-motor skill learning have found increased activity in motor areas of the frontal cortex (e.g., motor and premotor cortex, SMA) and striatal areas (e.g., the putamen). The change in activity observed here (i.e., decreased activity across a cortical network) may reflect skill learning that is predominantly expressed through more accurate performance rather than decreased reaction time. Copyright © 2011 Elsevier Inc. All rights reserved.

Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

International Nuclear Information System (INIS)

Moon, A.M.; Ley, T.J.

1990-01-01

DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

On-line soft sensing in upstream bioprocessing.

Science.gov (United States)

Randek, Judit; Mandenius, Carl-Fredrik

2018-02-01

This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

Genomic sequence and organization of two members of a human lectin gene family

International Nuclear Information System (INIS)

Gitt, M.A.; Barondes, S.H.

1991-01-01

The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

Mesozoic tectonomagmatic activity and uranium metallogenetic sequence in mid-Nanling tectonic belt

International Nuclear Information System (INIS)

Deng Ping; Shu Liangshu

2002-01-01

Based on the synthesis and analysis of the relationship of various Mesozoic intrusive massifs, the tectonic activity, and the hydrothermal veins, as well as data of isotopic geochronology, the author makes a time sequence of the tectonomagmatic activities, the hydrothermal activities and uranium mineralization, and summarizes characteristics of tectonomagmatic and hydrothermal activities of different stages, and discusses the time sequence of various ore-controlling factors for granite-type uranium metallogeny. Finally, authors conclude that uranium metallogeny shows a very close spatial and temporal relationship to Mesozoic tectonomagmatic and hydrothermal activities

A single, specific thymine mutation in the ComK-Binding site severely decreases binding and transcription activation by the competence transcription factor ComK of Bacillus subtilis

NARCIS (Netherlands)

Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.

The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.

THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

Energy Technology Data Exchange (ETDEWEB)

Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

2009-08-01

We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

International Nuclear Information System (INIS)

Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

2009-01-01

We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

Functional dissection of the alphavirus capsid protease: sequence requirements for activity.

Science.gov (United States)

Thomas, Saijo; Rai, Jagdish; John, Lijo; Günther, Stephan; Drosten, Christian; Pützer, Brigitte M; Schaefer, Stephan

2010-11-18

The alphavirus capsid is multifunctional and plays a key role in the viral life cycle. The nucleocapsid domain is released by the self-cleavage activity of the serine protease domain within the capsid. All alphaviruses analyzed to date show this autocatalytic cleavage. Here we have analyzed the sequence requirements for the cleavage activity of Chikungunya virus capsid protease of genus alphavirus. Amongst alphaviruses, the C-terminal amino acid tryptophan (W261) is conserved and found to be important for the cleavage. Mutating tryptophan to alanine (W261A) completely inactivated the protease. Other amino acids near W261 were not having any effect on the activity of this protease. However, serine protease inhibitor AEBSF did not inhibit the activity. Through error-prone PCR we found that isoleucine 227 is important for the effective activity. The loss of activity was analyzed further by molecular modelling and comparison of WT and mutant structures. It was found that lysine introduced at position 227 is spatially very close to the catalytic triad and may disrupt electrostatic interactions in the catalytic site and thus inactivate the enzyme. We are also examining other sequence requirements for this protease activity. We analyzed various amino acid sequence requirements for the activity of ChikV capsid protease and found that amino acids outside the catalytic triads are important for the activity.

A complex array of Hpr consensus DNA recognition sequences proximal to the enterotoxin gene in Clostridium perfringens type A.

Science.gov (United States)

Brynestad, S; Iwanejko, L A; Stewart, G S; Granum, P E

1994-01-01

Enterotoxin production in Clostridium perfringens is both strain dependent and sporulation associated. Underlying these phenotypic observations must lie a genetic and molecular explanation and the principal keys will be held within the DNA sequence both upstream and downstream of the structural gene cpe. In accordance with the above we have sequenced 4.1 kbp of DNA upstream of cpe in the type strain NCTC 8239. A region of DNA extending up to 1.5 kb 5' to cpe is conserved in all enterotoxin-positive strains. This region contains a putative ORF with substantial homology to an ORF in the Salmonella typhimurium IS200 insertion element and, in addition, contains multiple perfect consensus DNA-binding sequences for the Bacillus subtilis transition state regulator Hpr. The detailed structural elements revealed by the sequence analysis are presented and used to develop a new perspective on the molecular basis of enterotoxin production in this important food-poisoning bacterium.

Upstream structural management measures for an urban area flooding in Turkey

Science.gov (United States)

Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.

2015-06-01

In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.

DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

Energy Technology Data Exchange (ETDEWEB)

Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)

2016-03-01

Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.

Prediction of Human Activity by Discovering Temporal Sequence Patterns.

Science.gov (United States)

Li, Kang; Fu, Yun

2014-08-01

Early prediction of ongoing human activity has become more valuable in a large variety of time-critical applications. To build an effective representation for prediction, human activities can be characterized by a complex temporal composition of constituent simple actions and interacting objects. Different from early detection on short-duration simple actions, we propose a novel framework for long -duration complex activity prediction by discovering three key aspects of activity: Causality, Context-cue, and Predictability. The major contributions of our work include: (1) a general framework is proposed to systematically address the problem of complex activity prediction by mining temporal sequence patterns; (2) probabilistic suffix tree (PST) is introduced to model causal relationships between constituent actions, where both large and small order Markov dependencies between action units are captured; (3) the context-cue, especially interactive objects information, is modeled through sequential pattern mining (SPM), where a series of action and object co-occurrence are encoded as a complex symbolic sequence; (4) we also present a predictive accumulative function (PAF) to depict the predictability of each kind of activity. The effectiveness of our approach is evaluated on two experimental scenarios with two data sets for each: action-only prediction and context-aware prediction. Our method achieves superior performance for predicting global activity classes and local action units.

Optimal rotation sequences for active perception

Science.gov (United States)

Nakath, David; Rachuy, Carsten; Clemens, Joachim; Schill, Kerstin

2016-05-01

One major objective of autonomous systems navigating in dynamic environments is gathering information needed for self localization, decision making, and path planning. To account for this, such systems are usually equipped with multiple types of sensors. As these sensors often have a limited field of view and a fixed orientation, the task of active perception breaks down to the problem of calculating alignment sequences which maximize the information gain regarding expected measurements. Action sequences that rotate the system according to the calculated optimal patterns then have to be generated. In this paper we present an approach for calculating these sequences for an autonomous system equipped with multiple sensors. We use a particle filter for multi- sensor fusion and state estimation. The planning task is modeled as a Markov decision process (MDP), where the system decides in each step, what actions to perform next. The optimal control policy, which provides the best action depending on the current estimated state, maximizes the expected cumulative reward. The latter is computed from the expected information gain of all sensors over time using value iteration. The algorithm is applied to a manifold representation of the joint space of rotation and time. We show the performance of the approach in a spacecraft navigation scenario where the information gain is changing over time, caused by the dynamic environment and the continuous movement of the spacecraft

Exploring Social Learning through Upstream Engagement in Science and Technology

DEFF Research Database (Denmark)

Mortensen, Jonas Egmose

This discussion paper deliberates on how the concept of social learning can be used for evaluating upstream engagement initiatives in science and technology.  The paper briefly introduces to the concept of upstream engagement and a concrete case, the UK Citizen Science for Sustainability project...... (SuScit), as an outset for discussing how the concept of social learning can be used for analysing and understanding relations between citizen participation, Science and research, and sustainability. A number of relevant research questions and methodological considerations are distilled...

Monitoring upstream sinkhole development by detailed sonar profiling

Energy Technology Data Exchange (ETDEWEB)

Rigbey, S. [Acres International Ltd., Niagara Falls, ON (Canada)

2004-09-01

This paper describes the development and use of a simple sonar system that has been used by engineers for routine monitoring of small sinkholes on the upstream face of a distressed earth dam. Improper construction of the dam led to the development of several sinkholes measuring 10 to 20 m in diameter upstream from the dam which is founded on deep alluvial sands and gravels. The dam has a central core of silt and leakage varies between 200 and 500 l/s, depending on the water level of the reservoir. The main issues with the upstream blanket are: improper fill placement due to the inability to dewater the area properly; omission of a filter material between the blanket and the alluvium foundation; thin placement of fill and runnelling of the blanket prior to impoundment; and, short upstream extent of the blanket. A downstream weighting toe of material was placed to address the seepage and piping that developed immediately following impounding. Other incidents continued over the years, such as downstream sinkholes, slumping of the crest and repairs about 12 years after construction. An inverter filter was also constructed to better control the seepage. Simple bathymetric surveys conducted by sounding the bottom of the reservoir from the ice surface each winter revealed the presence of several large sinkholes. Although infilling programs were conducted, sinkholes redeveloped after each program. The bathymetric surveys were found to be limited in accuracy and repeatability. Therefore, it was not possible to monitor small developments on a yearly basis. A 3-dimensional seepage model was developed to reconcile some of the unexplained piezometric patterns and to better understand the seepage patterns. However, this was also unsuccessful on its own. A trial sonar survey was then undertaken in 2002 by a Vancouver-based sonar company using an Imagenix profiling sonar head. It was successful in locating a small, previously unknown sinkhole measuring a few metres in diameter at

PRO40 is a scaffold protein of the cell wall integrity pathway, linking the MAP kinase module to the upstream activator protein kinase C.

Directory of Open Access Journals (Sweden)

Ines Teichert

2014-09-01

Full Text Available Mitogen-activated protein kinase (MAPK pathways are crucial signaling instruments in eukaryotes. Most ascomycetes possess three MAPK modules that are involved in key developmental processes like sexual propagation or pathogenesis. However, the regulation of these modules by adapters or scaffolds is largely unknown. Here, we studied the function of the cell wall integrity (CWI MAPK module in the model fungus Sordaria macrospora. Using a forward genetic approach, we found that sterile mutant pro30 has a mutated mik1 gene that encodes the MAPK kinase kinase (MAPKKK of the proposed CWI pathway. We generated single deletion mutants lacking MAPKKK MIK1, MAPK kinase (MAPKK MEK1, or MAPK MAK1 and found them all to be sterile, cell fusion-deficient and highly impaired in vegetative growth and cell wall stress response. By searching for MEK1 interaction partners via tandem affinity purification and mass spectrometry, we identified previously characterized developmental protein PRO40 as a MEK1 interaction partner. Although fungal PRO40 homologs have been implicated in diverse developmental processes, their molecular function is currently unknown. Extensive affinity purification, mass spectrometry, and yeast two-hybrid experiments showed that PRO40 is able to bind MIK1, MEK1, and the upstream activator protein kinase C (PKC1. We further found that the PRO40 N-terminal disordered region and the central region encompassing a WW interaction domain are sufficient to govern interaction with MEK1. Most importantly, time- and stress-dependent phosphorylation studies showed that PRO40 is required for MAK1 activity. The sum of our results implies that PRO40 is a scaffold protein for the CWI pathway, linking the MAPK module to the upstream activator PKC1. Our data provide important insights into the mechanistic role of a protein that has been implicated in sexual and asexual development, cell fusion, symbiosis, and pathogenicity in different fungal systems.

Evolutionist approach of upstream activities competitiveness of the petroleum industry in a long term perspective

International Nuclear Information System (INIS)

Dos Santos, E.M.

1997-01-01

The purpose of this work is to analyze the concept of competitiveness of companies and nations in the upstream sector of the international oil industry, trying to identify the possibilities of future development of this sector as well as the interactions that may exist between different actors such as governments, consumers and oil companies to boost or re-launch the competitive position of their enterprises and countries in the international context of the industry. In order to attain that, we analyze the developments of the most important economic attributes that characterize the oil activity as well as its most crucial political aspects. We develop a model of 'oil competition' and a definition of 'oil competitiveness' that take clearly into consideration both the differences between various oil actors and the dynamic aspects linked to the evolution of the oil industry. We do so by constructing an evolutionist model of competition and competitiveness. This approach emulates a 'biological process' where firms and the economic environment interact with each other within a process similar to 'natural selection' with the survival of the fittest. This evolutionist model adopts some analytical instruments established by Michael Porter, from the University of Harvard, to interpret the changes and the dissimilarities of behavior of various oil actors as well as to explain their respective role in the new oil world that is being organized. Thus, we introduce the notions of 'dominant form of competition' and 'generic strategy of enterprises'. Then, we use our methodology to analyze the past of the oil industry (the stability and the instability). We conclude this work by discussing about the future evolution of the oil activities in the context of a new long term cycle of investment for the sector. (author)

A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.

Science.gov (United States)

Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K

2013-11-06

Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.

A de novo 1.58 Mb deletion, including MAP2K6 and mapping 1.28 Mb upstream to SOX9, identified in a patient with Pierre Robin sequence and osteopenia with multiple fractures.

Science.gov (United States)

Smyk, Marta; Roeder, Elizabeth; Cheung, Sau Wai; Szafranski, Przemyslaw; Stankiewicz, Paweł

2015-08-01

Defects of long-range regulatory elements of dosage-sensitive genes represent an under-recognized mechanism underlying genetic diseases. Haploinsufficiency of SOX9, the gene essential for development of testes and differentiation of chondrocytes, results in campomelic dysplasia, a skeletal malformation syndrome often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.6 Mb up- and downstream to SOX9, and disrupting its distant cis-regulatory elements, have been described in patients with milder forms of campomelic dysplasia, Pierre Robin sequence, and sex reversal. We present an ∼1.58 Mb deletion mapping ∼1.28 Mb upstream to SOX9 that encompasses its putative long-range cis-regulatory element(s) and MAP2K6 in a patient with Pierre Robin sequence and osteopenia with multiple fractures. Low bone mass panel testing using massively parallel sequencing of 23 nuclear genes, including COL1A1 and COL1A2 was negative. Based on the previous mouse model of Map2k6, suggesting that Sox9 is likely a downstream target of the p38 MAPK pathway, and our previous chromosome conformation capture-on-chip (4C) data showing potential interactions between SOX9 promoter and MAP2K6, we hypothesize that deletion of MAP2K6 might have affected SOX9 expression and contributed to our patient's phenotype. © 2015 Wiley Periodicals, Inc.

Sequence learning in differentially activated dendrites

DEFF Research Database (Denmark)

Nielsen, Bjørn Gilbert

2003-01-01

. It is proposed that the neural machinery required in such a learning/retrieval mechanism could involve the NMDA receptor, in conjunction with the ability of dendrites to maintain differentially activated regions. In particular, it is suggested that such a parcellation of the dendrite allows the neuron......Differentially activated areas of a dendrite permit the existence of zones with distinct rates of synaptic modification, and such areas can be individually accessed using a reference signal which localizes synaptic plasticity and memory trace retrieval to certain subregions of the dendrite...... to participate in multiple sequences, which can be learned without suffering from the 'wash-out' of synaptic efficacy associated with superimposition of training patterns. This is a biologically plausible solution to the stability-plasticity dilemma of learning in neural networks....

Upstream passage, spawning, and stock identification of fall chinook in the Snake River, 1992 and 1993. Final report

International Nuclear Information System (INIS)

Blankenship, H.L.; Mendel, G.W.

1997-05-01

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, and ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs

Sequences within both the 5' untranslated region and the Gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA

International Nuclear Information System (INIS)

Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.

2003-01-01

It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant

Optical power equalization for upstream traffic with injection-locked Fabry-Perot lasers in TDM-PON

Science.gov (United States)

Huang, Ting-Tsan; Sheu, Lih-Gen; Chi, Sien

2010-10-01

An optical power equalization of upstream traffic in time-division-multiplexed passive optical network (TDM-PON) based on injection-locked Fabry-Perot lasers has been experimentally investigated. The upstream transmitters with stable spectrum are achieved by using an external injection light source in the optical line terminal (OLT). The different upstream powers can be equalized by injection locking a Fabry-Perot laser diode (FP-LD) biased below threshold current in OLT. The dynamic upstream power range from - 8.5 to - 19.5 db m is reduced to a 1.6 dB maximal power variation, when the uplink signal is directly modulated at 1.25 Gb/s.

Anatomy of top 100 upstream players

International Nuclear Information System (INIS)

Burk, V.A.

1992-01-01

A brief review is given of a recent survey of the top one hundred upstream oil and gas companies which file financial data with the US Securities and Exchange Commission. The analysis indicates the increasing globalisation of the industry with exploration and development spending increasing dramatically outside the US. To survive, companies must operate as efficient low cost finders and producers of oil and gas and anticipate and meet changing market demands quickly. (UK)

Statistical handbook for Canada's upstream petroleum industry: '96 updates

International Nuclear Information System (INIS)

1997-01-01

The Statistical Handbook of CAPP is an annual compilation of useful information about the Canadian petroleum and natural gas industry. It has been published since 1955, and is a key source of upstream petroleum statistics. It presents a historical summary of the petroleum industry''s progress and provides detailed statistical information on the production and consumption of petroleum, petroleum products, natural gas and natural gas liquids, imports and exports, land sales, pipelines, reserves, drilling and refinery activities, and prices in Canada. The information, mostly in tabular form, is based on the latest available data (generally up to and including 1996). For the first time in 1997, the Handbook is also made available in CD-ROM format (EXCEL 5.0). Plans are also underway to publish the Handbook on a secure site on the Internet

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

Science.gov (United States)

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

Functional brain activation differences in stuttering identified with a rapid fMRI sequence

Science.gov (United States)

Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.

2011-01-01

The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409

Multiple upstream modules regulate zebrafish myf5 expression

Directory of Open Access Journals (Sweden)

Weng Chih-Wei

2007-01-01

Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

DEFF Research Database (Denmark)

Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

2015-01-01

Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

Multispacecraft observations of energetic ions upstream and downstream of the bow shock

International Nuclear Information System (INIS)

Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)

1989-01-01

We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989

Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field

Directory of Open Access Journals (Sweden)

Nicole L. Key

2014-01-01

Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.

Upstream waves in Saturn's foreshock

Science.gov (United States)

Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.

1991-01-01

An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.

Atmospheric emissions from the upstream oil and gas industry

International Nuclear Information System (INIS)

Taylor, B.G.S.

1994-01-01

The results are presented of a study set up to determine the nature and levels of atmospheric emissions resulting from United Kingdom oil and gas exploration and production activities. The study was commissioned by the UK Offshore Operators Association. Emissions by the upstream oil and gas industry of common pollutants, such as carbon monoxide, sulphur dioxide and nitrous oxide, and ozone depletion chemicals were shown in each case to be less than 1% of total UK emissions. Greenhouse gas emissions in the industry arise mainly from production operations with a small but significant contribution from onshore activities. Carbon dioxide is the major component followed in descending order by nitrogen oxides, methane and volatile organic compounds. In 1991, these emissions formed 3.2%, 4.6%, 2.9% and 2.8% of the UK totals respectively; overall this represented only about 3% of UK global warming emissions. The evidence of this study illustrates that the industry, which produces 67% of the UK's primary energy, is successfully managing its operations in an environmentally responsible way. (3 figures, 3 tables) (UK)

Analysis of an upstream weighted collocation approximation to the transport equation

International Nuclear Information System (INIS)

Shapiro, A.; Pinder, G.F.

1981-01-01

The numerical behavior of a modified orthogonal collocation method, as applied to the transport equations, can be examined through the use of a Fourier series analysis. The necessity of such a study becomes apparent in the analysis of several techniques which emulate classical upstream weighting schemes. These techniques are employed in orthogonal collocation and other numerical methods as a means of handling parabolic partial differential equations with significant first-order terms. Divergent behavior can be shown to exist in one upstream weighting method applied to orthogonal collocation

Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

Science.gov (United States)

Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

2014-10-01

This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

Science.gov (United States)

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY

OpenAIRE

Miah Muhammad Adel

2012-01-01

Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...

Inclusion of Moloney murine leukemia virus elements upstream of the transgene cassette in an E1-deleted adenovirus leads to an unusual genomic integration in epithelial cells

International Nuclear Information System (INIS)

Zheng Changyu; O'Connell, Brian C.; Baum, Bruce J.

2003-01-01

Classically, the 5' and 3' long terminal repeats (LTRs) are considered necessary but not sufficient for retroviral integration. Recently, we reported that inclusion of these and additional elements from Moloney murine leukemia virus (MoMLV) facilitated transgene integration, without retroviral integrase, when placed in an adenoviral context (AdLTR-luc vector) (Nat. Biotech. 18 (2000), 176; Biochem. Biophys. Res. Commun. 300 (2003), 115). To help understand this nonhomologous DNA recombination event, we constructed another vector, AdELP-luc, with 2.7 kb of MoMLV elements identically placed into an E1-deleted adenovirus type 5 backbone upstream of a luciferase cDNA reporter gene. Unlike AdLTR-luc, no MoMLV elements were placed downstream of the expression cassette. AdELP-luc readily infected epithelial cells in vitro. Southern hybridizations with DNA from cloned cells showed that disruption of the MoMLV sequences occurred. One cell clone, grown in vitro without any special selection medium for 9 months, exhibited stable vector integration and luciferase activity. Importantly, both Southern hybridization and FISH analyses showed that in addition to the MoMLV elements and expression cassette, substantial adenoviral sequence downstream of the luciferase cDNA was genomically integrated. These results suggest that the 2.7 kb of MoMLV sequence included in AdELP-luc have cis-acting functions and mediates an unusual integration event

Impact of upstream industrial effluents on irrigation water quality ...

African Journals Online (AJOL)

Impact of upstream industrial effluents on irrigation water quality, soils and ... Knowledge of irrigation water quality is critical to predicting, managing and reducing salt ... Presence of heavy metals in concentration higher than the recommended ...

The serine protease inhibitor TLCK attenuates intrinsic death pathways in neurons upstream of mitochondrial demise.

Science.gov (United States)

Reuther, C; Ganjam, G K; Dolga, A M; Culmsee, C

2014-11-01

It is well-established that activation of proteases, such as caspases, calpains and cathepsins are essential components in signaling pathways of programmed cell death (PCD). Although these proteases have also been linked to mechanisms of neuronal cell death, they are dispensable in paradigms of intrinsic death pathways, e.g. induced by oxidative stress. However, emerging evidence implicated a particular role for serine proteases in mechanisms of PCD in neurons. Here, we investigated the role of trypsin-like serine proteases in a model of glutamate toxicity in HT-22 cells. In these cells glutamate induces oxytosis, a form of caspase-independent cell death that involves activation of the pro-apoptotic protein BH3 interacting-domain death agonist (Bid), leading to mitochondrial demise and ensuing cell death. In this model system, the trypsin-like serine protease inhibitor Nα-tosyl-l-lysine chloromethyl ketone hydrochloride (TLCK) inhibited mitochondrial damage and cell death. Mitochondrial morphology alterations, the impairment of the mitochondrial membrane potential and ATP depletion were prevented and, moreover, lipid peroxidation induced by glutamate was completely abolished. Strikingly, truncated Bid-induced cell death was not affected by TLCK, suggesting a detrimental activity of serine proteases upstream of Bid activation and mitochondrial demise. In summary, this study demonstrates the protective effect of serine protease inhibition by TLCK against oxytosis-induced mitochondrial damage and cell death. These findings indicate that TLCK-sensitive serine proteases play a crucial role in cell death mechanisms upstream of mitochondrial demise and thus, may serve as therapeutic targets in diseases, where oxidative stress and intrinsic pathways of PCD mediate neuronal cell death.

Water Stress in Global Transboundary River Basins: Significance of Upstream Water Use on Downstream Stress

Science.gov (United States)

Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.

Sector report: Malaysia. Upstream oil and gas industry

International Nuclear Information System (INIS)

1997-01-01

This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market in oil and natural gas. The report includes Malaysia's oil and gas reserves, production, exploration, major profits upstream, production sharing contracts, pipeline construction, operators in production, service sector, and Petronas. (UK)

Upstream Structural Management Measures for an Urban Area Flooding in Turkey and their Consequences on Flood Risk Management

Science.gov (United States)

Akyurek, Z.; Bozoglu, B.; Girayhan, T.

2015-12-01

Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is done. MIKE21 with flexible grid is used in 2- dimensional shallow water flow modelling. 1/1000 scaled maps with the buildings for the urbanized area and 1/5000 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of Q5 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The effects of the available structures like bridges across the river on the flooding are presented. The upstream structural measures are studied on scenario basis. Four sub-catchments of Terme River are considered as contributing the downstream flooding. The existing circumstance of the Terme River states that the meanders of the river have a major effect on the flood situation and lead to approximately 35% reduction in the peak discharge between upstream and downstream of the river. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in at least two of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed. Flood risk is obtained by using the flood hazard maps and water depth-damage functions plotted for a variety of building types and occupancies

A novel pathogenic variant in an Iranian Ataxia telangiectasia family revealed by next-generation sequencing followed by in silico analysis.

Science.gov (United States)

Tabatabaiefar, Mohammad Amin; Alipour, Paria; Pourahmadiyan, Azam; Fattahi, Najmeh; Shariati, Laleh; Golchin, Neda; Mohammadi-Asl, Javad

2017-08-15

Ataxia telangiectasia (A-T) is a neurodegenerative autosomal recessive disorder with the main characteristics of progressive cerebellar degeneration, sensitivity to ionizing radiation, immunodeficiency, telangiectasia, premature aging, recurrent sinopulmonary infections, and increased risk of malignancy, especially of lymphoid origin. Ataxia Telangiectasia Mutated gene, ATM, as a causative gene for the A-T disorder, encodes the ATM protein, which plays an important role in the activation of cell-cycle checkpoints and initiation of DNA repair in response to DNA damage. Targeted next-generation sequencing (NGS) was performed on an Iranian 5-year-old boy presented with truncal and limb ataxia, telangiectasia of the eye, Hodgkin lymphoma, hyper pigmentation, total alopecia, hepatomegaly, and dysarthria. Sanger sequencing was used to confirm the candidate pathogenic variants. Computational docking was done using the HEX software to examine how this change affects the interactions of ATM with the upstream and downstream proteins. Three different variants were identified comprising two homozygous SNPs and one novel homozygous frameshift variant (c.80468047delTA, p.Thr2682ThrfsX5), which creates a stop codon in exon 57 leaving the protein truncated at its C-terminal portion. Therefore, the activation and phosphorylation of target proteins are lost. Moreover, the HEX software confirmed that the mutated protein lost its interaction with upstream and downstream proteins. The variant was classified as pathogenic based on the American College of Medical Genetics and Genomics guideline. This study expands the spectrum of ATM pathogenic variants in Iran and demonstrates the utility of targeted NGS in genetic diagnostics. Copyright © 2017. Published by Elsevier B.V.

Strategic human resources study of the upstream petroleum industry : the decade ahead

International Nuclear Information System (INIS)

2003-10-01

This report presents the results of a 10 month study of the human resources issues in Canada's upstream petroleum industry. The study identifies workforce demographics, skills, and supply and demand. It also discusses the impact of technology and other key challenges facing human resources issues. The upstream petroleum industry includes exploration and production, service industries, pipeline transmission, natural gas processing, and heavy oil and bitumen extracting and upgrading. The study defined four regions in Canada: Western Canada Sedimentary Basin, the oil sands, the north, and the east coast. The main influences on the management practices within the upstream petroleum industry are: globalization; cyclical economic conditions; operational excellence business models; government regulatory requirements; stakeholder expectations for involvement; technological advances; changing demographics, and workplace skills. The study also presented suggestions for changes in best practices to improve the efficiency and effectiveness of product and service delivery. refs., tabs., figs

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

The upstream escape of energized solar wind protons from the bow shock

International Nuclear Information System (INIS)

Greenstadt, E.W.

1975-01-01

Recently, there have been some systematic observations of backstreaming protons at the Earth's bow shock with parallel velocity components and total energies much too high to be associated with the usual long-period upstream waves or to be produced by Sonnerup's simple reflection process (Lin et al., 1974), and these protons (30-100keV) were attributed to some unknown acceleration mechanism in the upstream region. The observations of Lof et al. involved protons in high pitch angle, and, although their reasons for favoring an upstream acceleration were quite different, it may seem intuitive that high pitch angle particles would have difficulty escaping the shock, especially at large field-normal angles. Such an inference would superficially support the notion of energization outside the bow shock. It seems worthwhile therefore to examine the extent to which the geometry of individual particle motion alone might select among reflected particles those that can escape upstream and those that cannot. In this paper the geometry of escape is described and some simple numerical examples are worked out for a few special cases. It is found that protons with rather high energies and pitch angles can escape the shock at only marginally quasi-parallel field orientations (i.e., thetasub(nB) approximately 50 0 ), even if they have quite moderate speeds parallel to B. (Auth.)

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

Science.gov (United States)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Upstream pressure variations associated with the bow shock and their effects on the magnetosphere

International Nuclear Information System (INIS)

Fairfield, D.H.; Baumjohann, W.; Paschmann, G.; Luehr, H.; Sibeck, D.G.

1990-01-01

Magnetic field enhancements and depressions on the time scales of minutes were frequently observed simultaneously by the AMPTE CCE, GOES 5, and GOES 6 spacecraft in the subsolar magnetosphere. The source of these perturbations has been detected in the high time resolution AMPTE IRM measurements of the kinetic pressure of the solar wind upstream of the bow shock. It is argued that these upstream pressure variations are not inherent in the solar wind but rather are associated with the bow shock. This conclusion follows from the facts that (1) the upstream field strength and the density associated with the perturbations are highly correlated with each other whereas these quantities tend to be anticorrelated in the undisturbed solar wind, and (2) the upstream perturbations occur within the foreshock or at its boundary. The results imply a mode of interaction between the solar wind and the magnetosphere whereby density changes produced in the foreshock subsequently convect through the bow shock and impinge on the magnetosphere. Also velocity decreases deep within the foreshock sometimes reach many tens of kilometers per second and may be associated with further pressure variations as a changing interplanetary field direction changes the foreshock geometry. Upstream pressure perturbations should create significant effects on the magnetopause and at the foot of nearby field lines that lead to the polar cusp ionosphere

Multiple spacecraft observations of interplanetary shocks: characteristics of the upstream ulf turbulence

International Nuclear Information System (INIS)

Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.

1982-01-01

All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

Science.gov (United States)

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.

Science.gov (United States)

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-06-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.

Monomorphism in humans and sequence differences among higher primates for a sequence tagged site (STS) in homeo box cluster 2 as assayed by denaturing gradient electrophoresis

Energy Technology Data Exchange (ETDEWEB)

Ruano, G.; Ruddle, F.H.; Kidd, K.K. (Yale Univ., New Haven, CT (United States)); Gray, M.R. (Tufts Univ., Boston, MA (United States)); Miki, Tetsuro (Osaka Univ. (Japan)); Ferguson-Smith, A.C. (Inst. of Animal Physiology and Genetics Research, Cambridge (United Kingdom))

1990-03-11

The human homeo box cluster 2 (HOX2) contains genes coding for DNA binding proteins involved in developmental control and is highly conserved between mouse and man. The authors have applied in concert the Polymerase Chain Reaction (PCR) and Denaturing Gradient Electrophoresis (DGE) to amplify defined primate HOX2 segments and to detect sequence differences among them. They have sequenced a PstI fragment 4 kb upstream from HOX 2.2 and synthesized primers delimiting both halves of 630 bp segment within it PCR on various unrelated humans and SC-PCR on chimpanzee, gorilla, orangutan and gibbon yielded products of the same length for each primer pair.

Torque fluctuations caused by upstream mean flow and turbulence

Science.gov (United States)

Farr, T. D.; Hancock, P. E.

2014-12-01

A series of studies are in progress investigating the effects of turbine-array-wake interactions for a range of atmospheric boundary layer states by means of the EnFlo meteorological wind tunnel. The small, three-blade model wind turbines drive 4-quadrant motor-generators. Only a single turbine in neutral flow is considered here. The motor-generator current can be measured with adequate sensitivity by means of a current sensor allowing the mean and fluctuating torque to be inferred. Spectra of torque fluctuations and streamwise velocity fluctuations ahead of the rotor, between 0.1 and 2 diameters, show that only the large-scale turbulent motions contribute significantly to the torque fluctuations. Time-lagged cross-correlation between upstream velocity and torque fluctuations are largest over the inner part of the blade. They also show the turbulence to be frozen in behaviour over the 2 diameters upstream of the turbine.

Standardization and quality management in next-generation sequencing.

Science.gov (United States)

Endrullat, Christoph; Glökler, Jörn; Franke, Philipp; Frohme, Marcus

2016-09-01

DNA sequencing continues to evolve quickly even after > 30 years. Many new platforms suddenly appeared and former established systems have vanished in almost the same manner. Since establishment of next-generation sequencing devices, this progress gains momentum due to the continually growing demand for higher throughput, lower costs and better quality of data. In consequence of this rapid development, standardized procedures and data formats as well as comprehensive quality management considerations are still scarce. Here, we listed and summarized current standardization efforts and quality management initiatives from companies, organizations and societies in form of published studies and ongoing projects. These comprise on the one hand quality documentation issues like technical notes, accreditation checklists and guidelines for validation of sequencing workflows. On the other hand, general standard proposals and quality metrics are developed and applied to the sequencing workflow steps with the main focus on upstream processes. Finally, certain standard developments for downstream pipeline data handling, processing and storage are discussed in brief. These standardization approaches represent a first basis for continuing work in order to prospectively implement next-generation sequencing in important areas such as clinical diagnostics, where reliable results and fast processing is crucial. Additionally, these efforts will exert a decisive influence on traceability and reproducibility of sequence data.

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

OpenAIRE

W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

2017-01-01

The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

Analysis and Modeling of Time-Correlated Characteristics of Rainfall-Runoff Similarity in the Upstream Red River Basin

Directory of Open Access Journals (Sweden)

Xiuli Sang

2012-01-01

Full Text Available We constructed a similarity model (based on Euclidean distance between rainfall and runoff to study time-correlated characteristics of rainfall-runoff similar patterns in the upstream Red River Basin and presented a detailed evaluation of the time correlation of rainfall-runoff similarity. The rainfall-runoff similarity was used to determine the optimum similarity. The results showed that a time-correlated model was found to be capable of predicting the rainfall-runoff similarity in the upstream Red River Basin in a satisfactory way. Both noised and denoised time series by thresholding the wavelet coefficients were applied to verify the accuracy of model. And the corresponding optimum similar sets obtained as the equation solution conditions showed an interesting and stable trend. On the whole, the annual mean similarity presented a gradually rising trend, for quantitatively estimating comprehensive influence of climate change and of human activities on rainfall-runoff similarity.

Collisionless shocks and upstream waves and particles: Introductory remarks

International Nuclear Information System (INIS)

Kennel, C.F.

1981-01-01

We discuss more aspects of collisionless shock theory that might be pertinent to the problem of upstream waves and particles. It is hoped that our qualititive remarks may be a useful guide for the general reader as he goes through the detailed papers to come

Research on performance of upstream pumping mechanical seal with different deep spiral groove

International Nuclear Information System (INIS)

Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H

2012-01-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Research on performance of upstream pumping mechanical seal with different deep spiral groove

Science.gov (United States)

Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.

2012-11-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

Science.gov (United States)

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Upstream and Downstream Co-inhibition of Mitogen-Activated Protein Kinase and PI3K/Akt/mTOR Pathways in Pancreatic Ductal Adenocarcinoma

Directory of Open Access Journals (Sweden)

Matthew H. Wong

2016-07-01

Full Text Available BACKGROUND: Extensive cross talk exists between PI3K/Akt/mTOR and mitogen-activated protein kinase (MAPK pathways, and both are upregulated in pancreatic ductal adenocarcinoma (PDAC. Our previous study suggested that epidermal growth factor receptor inhibitor erlotinib which acts upstream of these pathways acts synergistically with PI3K inhibitors in PDAC. Horizontal combined blockade upstream and downstream of these two pathways is therefore explored. METHODS: Erlotinib paired with PI3K inhibitor (BYL719 was tested against erlotinib plus dual PI3K/mTOR inhibitor BEZ-235, and MEK inhibitor (PD98059 plus BEZ235, on five primary PDAC cell lines and on two pairs of parent and erlotinib-resistant (ER cell lines. A range of in vitro assays including cell proliferation, Western blotting, migration, clonogenic, cell cycle, and apopotic assays was used to test for the efficacy of combined blockade. RESULTS: Dual downstream blockade of the MAPK and PAM pathways was more effective in attenuating downstream molecular signals. Synergy was demonstrated for erlotinib and BEZ235 and for PD-98059 and BEZ-235. This resulted in a trend of increased growth cell cycle arrest, apoptosis, cell proliferation, and colony and migration suppression. This combination showed more efficacy in cell lines with acquired resistance to erlotinib. CONCLUSIONS: The additional mTOR blockade provided by BEZ235 in combined blockade resulted in increased anticancer effect. The hypersensitivity of ER cell lines to additional mTOR blockade suggested PAM pathway oncogenic dependence via mTOR. Dual downstream combined blockade of MAPK and PAM pathways with MEK and PI3K/mTOR inhibitor appeared most effective and represents an attractive therapeutic strategy against pancreatic cancer and its associated drug resistance.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

OpenAIRE

Lanciano, Sophie; Carpentier, M. C.; Llauro, C.; Jobet, E.; Robakowska-Hyzorek, D.; Lasserre, E.; Ghesquière, Alain; Panaud, O.; Mirouze, Marie

2017-01-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposon...

Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

Science.gov (United States)

Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

1995-01-01

The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

Science.gov (United States)

Brule, C E; Dean, K M; Grayhack, E J

2016-01-01

The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

OpenAIRE

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-01-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...

Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

Directory of Open Access Journals (Sweden)

Javier Villacreses

2015-04-01

Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

Employee assistance programs in the upstream petroleum industry

International Nuclear Information System (INIS)

Crutcher, R.A.; Yip, R.Y.; Young, M.R.

1991-01-01

This paper is a descriptive overview of Employee Assistance Programs (EAPs) in the upstream Canadian petroleum industry. The authors review current EAP models within the occupational health setting and the Canadian health care context. This article also explores the challenging issues of EAP's emergent functions in workplace substance abuse programs, its changing role in organizational effectiveness and its professional identity

OGJ group weathered tough times upstream and downstream in 1991

International Nuclear Information System (INIS)

Biggs, J.B.; Price, R.B.

1992-01-01

With an upstream sector hit by low oil and gas prices and downstream operations squeezed by weak petroleum demand, 1991, was a tough year for the group of 22 major integrated U.S. companies Oil and Gas Journal tracks. This paper reports that the brief respite caused by the oil price spike in second half 1990 ended abruptly early in first half 1991, and it turned into a year of buckling down for most companies. They shed non-core assets, implemented strategic restructuring moves, and reduced staff. Although low prices slowed overall drilling activity for the group, oil and gas production increased slightly, and most companies reported reserves gains. Recession in the U.S. and Europe depressed demand for the group's fined products enough to pinch downstream earnings even as buoyant Asia-Pacific demand helped jack up world product sales

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

Directory of Open Access Journals (Sweden)

Ana Maria Salazar-Bryam

2017-06-01

Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology

Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

International Nuclear Information System (INIS)

Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

1987-01-01

The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

Method for priming and DNA sequencing

Energy Technology Data Exchange (ETDEWEB)

Mugasimangalam, R.C.; Ulanovsky, L.E.

1997-12-01

A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

Increased risk of oesophageal adenocarcinoma among upstream petroleum workers

Science.gov (United States)

Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C

2013-01-01

Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

Science.gov (United States)

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

The influence of cis-acting P1 protein and translational elements on the expression of Potato virus Y helper-component proteinase (HCPro) in heterologous systems and its suppression of silencing activity.

Science.gov (United States)

Tena Fernández, Fátima; González, Inmaculada; Doblas, Paula; Rodríguez, César; Sahana, Nandita; Kaur, Harpreet; Tenllado, Francisco; Praveen, Shelly; Canto, Tomas

2013-06-01

In the Potyvirus genus, the P1 protein is the first N-terminal product processed from the viral polyprotein, followed by the helper-component proteinase (HCPro). In silencing suppression patch assays, we found that Potato virus Y (PVY) HCPro expressed from a P1-HCPro sequence increased the accumulation of a reporter gene, whereas protein expressed from an HCPro sequence did not, even with P1 supplied in trans. This enhancing effect of P1 has been noted in other potyviruses, but has remained unexplained. We analysed the accumulation of PVY HCPro in infiltrated tissues and found that it was higher when expressed from P1-HCPro than from HCPro sequences. Co-expression of heterologous suppressors increased the steady-state level of mRNA expressed from the HCPro sequence, but not that of protein. This suggests that, in the absence of P1 upstream, either HCPro acquires a conformation that affects negatively its activity or stability, or that its translation is reduced. To test these options, we purified HCPro expressed in the presence or absence of upstream P1, and found no difference in purification pattern and final soluble state. By contrast, alteration of the Kozak context in the HCPro mRNA sequence to favour translation increased partially suppressor accumulation and activity. Furthermore, protein activity was not lower than in protein expressed from P1-HCPro sequences. Thus, a direct role for P1 on HCPro suppressor activity or stability, by influencing its conformation during translation, can be excluded. However, P1 could still have an indirect effect favouring HCPro accumulation. Our data highlight the relevance of cis-acting translational elements in the heterologous expression of HCPro. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Upstream oil and gas. Subsector no. 7: Oil and gas exploration and development 1995 to 1999

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-08-01

Prepared by the Alberta Human Resources and Employment, this report provides a summary of the lost-time injuries and disease descriptions of workers injured while employed in the upstream oil and gas industries in Alberta during the period 1995 to 1999. The report includes the characteristics of the injured worker and the risk of injury to workers in the industries in Alberta, as well as the cost of injuries and revenue by means of total premiums paid by the employers. The occupational fatalities that were accepted by the Workers Compensation Board and investigated by the Occupational Health and Safety were summarized in the report along with a brief description of the injuries. The aim was to provide information concerning health and safety issues to government, employers, workers, and health and safety officers in the industries in Alberta about health and safety issues. The focus was placed on the oil and gas exploration and development sub-sector. Defined as all upstream oil field activities of employers which generate revenue from the production and sale of crude oil and/or natural gas, the sub-sector comprises major integrated oil and gas companies and small independent producers. In those cases where the owner/producer operates its own upstream production/processing facilities, they form an integral part of this sub-section. In addition, oil and gas marketing firms are included. Oil/gas well, well head equipment; flow lines/gathering systems tied into field processing facilities; battery sites/compressors stations; crude oil separators and natural gas dehydrators/treaters; natural gas/sulfur processing plants; heavy oil projects including steam generation; and other enhanced recovery methods are all included in the sub-sector. The other sub-sectors in the upstream oil and gas industries are: exploration, oilfield maintenance and construction, well servicing with service rigs and power swivels, drilling of oil and gas wells, oilfield downhole and other

Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

NARCIS (Netherlands)

Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

1998-01-01

Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A

Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

Science.gov (United States)

Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

2017-01-01

A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

Science.gov (United States)

Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

2011-03-01

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

Wind Predictions Upstream Wind Turbines from a LiDAR Database

Directory of Open Access Journals (Sweden)

Soledad Le Clainche

2018-03-01

Full Text Available This article presents a new method to predict the wind velocity upstream a horizontal axis wind turbine from a set of light detection and ranging (LiDAR measurements. The method uses higher order dynamic mode decomposition (HODMD to construct a reduced order model (ROM that can be extrapolated in space. LiDAR measurements have been carried out upstream a wind turbine at six different planes perpendicular to the wind turbine axis. This new HODMD-based ROM predicts with high accuracy the wind velocity during a timespan of 24 h in a plane of measurements that is more than 225 m far away from the wind turbine. Moreover, the technique introduced is general and obtained with an almost negligible computational cost. This fact makes it possible to extend its application to both vertical axis wind turbines and real-time operation.

Relation of chromospheric activity to convection, rotation, and pre-main-sequence evolution

International Nuclear Information System (INIS)

Gilliland, R.L.

1986-01-01

Pre-main-sequence, or T Tauri, stars are characterized by much larger fluxes of nonradiative origin than their main-sequence counterparts. As a class, the T Tauri stars have only moderate rotation rates, making an explanation of their chromospheric properties based on rapid rotation problematic. The recent success of correlating nonradiative fluxes to the Rossby number, Ro = P/sub rot//tau/sub conv/, a central parameter of simple dynamo theories of magnetic field generation, has led to the suggestion that the same relation might be of use in explaining the pre-main-sequence (PMS) stars if tau/sub conv/ is very large. We show that tau/sub conv/ does depend strongly on evolutionary effects above the main sequence (MS), but that this dependence alone cannot account for the high observed nonradiative fluxes. The acoustic flux is also strongly dependent on PMS evolutionary state, and when coupled to the parameterization of magnetic activity based on Ro, these two mechanisms seem capable of explaining the high observed level of chromospheric activity in T Tauri stars. The moment of inertia decreases by two to three order of magnitude during PMS evolution. Since young MS stars do not rotate two to three orders of magnitude faster than PMS stars, rapid loss or redistribution of angular momentum must occur

How downstream sub-basins depend on upstream inflows to avoid scarcity: typology and global analysis of transboundary rivers

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph H. A.; Mirumachi, Naho; Wada, Yoshihide; Kummu, Matti

2018-05-01

Countries sharing river basins are often dependent upon water originating outside their boundaries; meaning that without that upstream water, water scarcity may occur with flow-on implications for water use and management. We develop a formalisation of this concept drawing on ideas about the transition between regimes from resilience literature, using water stress and water shortage as indicators of water scarcity. In our analytical framework, dependency occurs if water from upstream is needed to avoid scarcity. This can be diagnosed by comparing different types of water availability on which a sub-basin relies, in particular local runoff and upstream inflows. At the same time, possible upstream water withdrawals reduce available water downstream, influencing the latter water availability. By developing a framework of scarcity and dependency, we contribute to the understanding of transitions between system regimes. We apply our analytical framework to global transboundary river basins at the scale of sub-basin areas (SBAs). Our results show that 1175 million people live under water stress (42 % of the total transboundary population). Surprisingly, the majority (1150 million) of these currently suffer from stress only due to their own excessive water use and possible water from upstream does not have impact on the stress status - i.e. they are not yet dependent on upstream water to avoid stress - but could still impact on the intensity of the stress. At the same time, 386 million people (14 %) live in SBAs that can avoid stress owing to available water from upstream and have thus upstream dependency. In the case of water shortage, 306 million people (11 %) live in SBAs dependent on upstream water to avoid possible shortage. The identification of transitions between system regimes sheds light on how SBAs may be affected in the future, potentially contributing to further refined analysis of inter- and intrabasin hydro-political power relations and strategic planning

Comparative genomic analysis of translation initiation mechanisms for genes lacking the Shine–Dalgarno sequence in prokaryotes

KAUST Repository

Nakagawa, So

2017-02-15

In prokaryotes, translation initiation is believed to occur through an interaction between the 3\\' tail of a 16S rRNA and a corresponding Shine-Dalgarno (SD) sequence in the 5\\' untranslated region (UTR) of an mRNA. However, some genes lack SD sequences (non-SD genes), and the fraction of non-SD genes in a genome varies depending on the prokaryotic species. To elucidate non-SD translation initiation mechanisms in prokaryotes from an evolutionary perspective, we statistically examined the nucleotide frequencies around the initiation codons in non-SD genes from 260 prokaryotes (235 bacteria and 25 archaea). We identified distinct nucleotide frequency biases upstream of the initiation codon in bacteria and archaea, likely because of the presence of leaderless mRNAs lacking a 5\\' UTR. Moreover, we observed overall similarities in the nucleotide patterns between upstream and downstream regions of the initiation codon in all examined phyla. Symmetric nucleotide frequency biases might facilitate translation initiation by preventing the formation of secondary structures around the initiation codon. These features are more prominent in species\\' genomes that harbor large fractions of non-SD sequences, suggesting that a reduced stability around the initiation codon is important for efficient translation initiation in prokaryotes.

Comparative genomic analysis of translation initiation mechanisms for genes lacking the Shine–Dalgarno sequence in prokaryotes

KAUST Repository

Nakagawa, So; Niimura, Yoshihito; Gojobori, Takashi

2017-01-01

In prokaryotes, translation initiation is believed to occur through an interaction between the 3' tail of a 16S rRNA and a corresponding Shine-Dalgarno (SD) sequence in the 5' untranslated region (UTR) of an mRNA. However, some genes lack SD sequences (non-SD genes), and the fraction of non-SD genes in a genome varies depending on the prokaryotic species. To elucidate non-SD translation initiation mechanisms in prokaryotes from an evolutionary perspective, we statistically examined the nucleotide frequencies around the initiation codons in non-SD genes from 260 prokaryotes (235 bacteria and 25 archaea). We identified distinct nucleotide frequency biases upstream of the initiation codon in bacteria and archaea, likely because of the presence of leaderless mRNAs lacking a 5' UTR. Moreover, we observed overall similarities in the nucleotide patterns between upstream and downstream regions of the initiation codon in all examined phyla. Symmetric nucleotide frequency biases might facilitate translation initiation by preventing the formation of secondary structures around the initiation codon. These features are more prominent in species' genomes that harbor large fractions of non-SD sequences, suggesting that a reduced stability around the initiation codon is important for efficient translation initiation in prokaryotes.

Environmental regulatory framework for the upstream petroleum industry

International Nuclear Information System (INIS)

1996-01-01

In order to provide its member companies with a useful reference document in environmental analysis and compliance, CAPP compiled a list of Canadian legislation, regulations and guidelines which relate to the upstream petroleum industry. Text of all federal, Alberta, British Columbia and Saskatchewan legislation, regulations, guidelines and related documents were provided. Pending legislation, regulations and government policy have been identified. Annual updates will be provided to all subscribers

Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam

Directory of Open Access Journals (Sweden)

Sutham Visutimeteegorn

2007-11-01

Full Text Available During the flooding events, the operation of Chao Phraya Dam to control downstream water discharge is one of the causes of the inundation occuring over the upstream area. The purposes of this research are to study the effects of the operation of Chao Phraya Dam upon the upstream flood inundation and to find out the new measures of the flood mitigation in the upstream areas of Chao Phraya Dam by using a hydrodynamic model. The results show that Manning's n in the Chao Phraya River and its tributaries is 0.030-0.035 in the main channels and 0.050-0.070 in the flood plain areas. The backwater due to the operation of the Chao Praya dam affects as far as 110 kilometers upstream. New methods of water diversion can mitigate the flood inundation without the effect on the floating rice fields. The construction of reservoirs in the Upper Sakaekang River Basin and the Upper Yom River Basin will mitigate the flood not only in their own basins but also in the Lower Chao Phraya River Basin. The coordinated operation of the Chao Phraya Dam, the regulators and the upper basin reservoirs will efficiently mitigate the flood inundation.

Observations of two distinct populations of bow shock ions in the upstream solar wind

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.; Bame, S.J.; Paschmann, G.; Sckopke, N.

1978-01-01

Observations upstream of the earth's bow shock with the LASL/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above approx. 10 keV/ion and 2) relatively collimated flow coming from the direction of the shock. On the other hand, the ''diffuse'' ions are distinguished by relatively flat energy spectra above approx. 10 keV and broad angular distributions. They are by far the most commonly observed upstream ion event. A close causal association is suggested between the diffuse ion population in the upstream solar wind and energetic plasma ions observed within the magnetosheath

MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

Science.gov (United States)

Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

2012-01-01

The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

EMMPRIN, an upstream regulator of MMPs, in CNS biology.

Science.gov (United States)

Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

2015-01-01

Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

International Nuclear Information System (INIS)

Straehle, U.; Klock, G.; Schuetz, G.

1987-01-01

To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

Antiprotozoal activities of benzimidazoles and correlations with beta-tubulin sequence.

Science.gov (United States)

Katiyar, S K; Gordon, V R; McLaughlin, G L; Edlind, T D

1994-01-01

Benzimidazoles have been widely used since the 1960s as anthelmintic agents in veterinary and human medicine and as antifungal agents in agriculture. More recently, selected benzimidazole derivatives were shown to be active in vitro against two protozoan parasites, Trichomonas vaginalis and Giardia lamblia, and clinical studies with AIDS patients have suggested that microsporidia are susceptible as well. Here, we first present in vitro susceptibility data for T. vaginalis and G. lamblia using an expanded set of benzimidazole derivatives. Both parasites were highly susceptible to four derivatives, including mebendazole, flubendazole, and fenbendazole (50% inhibitory concentrations of 0.005 to 0.16 microgram/ml). These derivatives also had lethal activity that was time dependent: 90% of T. vaginalis cells failed to recover following a 20-h exposure to mebendazole at 0.17 microgram/ml. G. lamblia, but not T. vaginalis, was highly susceptible to five additional derivatives. Next, we examined in vitro activity of benzimidazoles against additional protozoan parasites: little or no activity was observed against Entamoeba histolytica, Leishmania major, and Acanthamoeba polyphaga. Since the microtubule protein beta-tubulin has been identified as the benzimidazole target in helminths and fungi, potential correlations between benzimidazole activity and beta-tubulin sequence were examined. This analysis included partial sequences (residues 108 to 259) from the organisms mentioned above, as well as the microsporidia Encephalitozoon hellem and Encephalitozoon cuniculi and the sporozoan Cryptosporidium parvum. beta-tubulin residues Glu-198 and, in particular, Phe-200 are strong predictors of benzimidazole susceptibility; both are present in Encephalitozoon spp. but absent in C. parvum. PMID:7811023

Entrepreneurial Leadership in Upstream Oil and Gas Industry

OpenAIRE

Kalu, Mona Ukpai

2015-01-01

The study examined Entrepreneurial leadership in Upstream Oil and Gas industry and its ability to accelerate innovative energy technology development. The declining deliverability from existing reservoirs and ever increasing demand for energy to fuel growth in many parts of the world is driving oil and gas exploration into more difficult to access reservoirs like bituminous sands and shale gas. Accelerating new innovative technology development to access these new streams of profitable oil an...

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Science.gov (United States)

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Directory of Open Access Journals (Sweden)

Adam G Marsh

Full Text Available Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera and an anemone (Nematostella vectensis. Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to

The clinical impact of chromosomal rearrangements with breakpoints upstream of the SOX9 gene: two novel de novo balanced translocations associated with acampomelic campomelic dysplasia.

Science.gov (United States)

Fonseca, Ana Carolina S; Bonaldi, Adriano; Bertola, Débora R; Kim, Chong A; Otto, Paulo A; Vianna-Morgante, Angela M

2013-05-07

The association of balanced rearrangements with breakpoints near SOX9 [SRY (sex determining region Y)-box 9] with skeletal abnormalities has been ascribed to the presumptive altering of SOX9 expression by the direct disruption of regulatory elements, their separation from SOX9 or the effect of juxtaposed sequences. We report on two sporadic apparently balanced translocations, t(7;17)(p13;q24) and t(17;20)(q24.3;q11.2), whose carriers have skeletal abnormalities that led to the diagnosis of acampomelic campomelic dysplasia (ACD; MIM 114290). No pathogenic chromosomal imbalances were detected by a-CGH. The chromosome 17 breakpoints were mapped, respectively, 917-855 kb and 601-585 kb upstream of the SOX9 gene. A distal cluster of balanced rearrangements breakpoints on chromosome 17 associated with SOX9-related skeletal disorders has been mapped to a segment 932-789 kb upstream of SOX9. In this cluster, the breakpoint of the herein described t(17;20) is the most telomeric to SOX9, thus allowing the redefining of the telomeric boundary of the distal breakpoint cluster region related to skeletal disorders to 601-585 kb upstream of SOX9. Although both patients have skeletal abnormalities, the t(7;17) carrier presents with relatively mild clinical features, whereas the t(17;20) was detected in a boy with severe broncheomalacia, depending on mechanical ventilation. Balanced and unbalanced rearrangements associated with disorders of sex determination led to the mapping of a regulatory region of SOX9 function on testicular differentiation to a 517-595 kb interval upstream of SOX9, in addition to TESCO (Testis-specific enhancer of SOX9 core). As the carrier of t(17;20) has an XY sex-chromosome constitution and normal male development for his age, the segment of chromosome 17 distal to the translocation breakpoint should contain the regulatory elements for normal testis development. These two novel translocations illustrate the clinical variability in carriers of balanced

Restructuring: new relationships between the oil companies and the upstream oil firms; Alliances et restructurations: nouvelles relations entre maitres d'oeuvre et parapetrolier

Energy Technology Data Exchange (ETDEWEB)

Barreau, S

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform.

Science.gov (United States)

Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

2014-10-01

In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Technological acceleration and organizational transformations in the upstream oil and gas industry

International Nuclear Information System (INIS)

Isabelle, M.

2000-12-01

The upstream oil and gas industry experienced a dramatic technological acceleration in the early 1970's. The relationships between the agents in this industry have themselves undergone deep changes since that date. This thesis shows that a tight link exists between the technological acceleration and the organizational transformations in the upstream oil and gas industry. In a first part, it focuses on the economic theory's developments concerning industrial organization. In a second part, it applies these developments to three types of relations: those between the owner-states of hydrocarbon resources and the international petroleum companies; those between the international petroleum companies and their subcontractors; and finally those between the international petroleum companies themselves. (author)

Upstream petroleum industry flaring guide : review draft

International Nuclear Information System (INIS)

1999-03-01

The Alberta requirements and expectations for upstream petroleum flaring are presented. Flaring is associated with a wide range of energy activities including oil and gas well drilling and well completion operations. The guide incorporates the recommendations made to the Alberta Energy and Utilities Board (EUB) in June 1998 by the multi-stakeholder Clean Air Strategic Alliance (CASA) on associated or solution gas flaring. Additional requirements which address flaring issues not covered in the CASA report are also included in this guide. The Guide requires a 15 per cent reduction in solution gas flare volume by the end of year 2000 from the 1996 baseline, and a 25 per cent reduction by the end of 2001. The Guide prescribes new flare performance requirements for all flares, within three years for existing solution gas flares, five years for flares at other existing permanent facilities. It sets personal consultation and public notification requirements for new and existing solution gas batteries, and new sulphur recovery requirements for facilities not covered by existing EUB regulations. The Guide also addresses the question of conflict resolution to deal with flaring concerns, the release of flaring and venting data, the proposed reduction of flare limits, progress towards minimizing requirements for electricity generators using otherwise flared gas, annual reporting to the EUB, and management framework review in 2001

Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

Science.gov (United States)

Biedler, James K; Hu, Wanqi; Tae, Hongseok; Tu, Zhijian

2012-01-01

During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs) in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression) EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001) and 143 (P<0.05) nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1) contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

Directory of Open Access Journals (Sweden)

James K Biedler

Full Text Available During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001 and 143 (P<0.05 nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1 contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

The economic benefits of vegetation in the upstream area of Ciliwung watershed

Science.gov (United States)

Saridewi, T. R.; Nazaruddin

2018-04-01

Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

RNA sequence determinants of a coupled termination-reinitiation strategy for downstream open reading frame translation in Helminthosporium victoriae virus 190S and other victoriviruses (Family Totiviridae).

Science.gov (United States)

Li, Hua; Havens, Wendy M; Nibert, Max L; Ghabrial, Said A

2011-07-01

The genome-length, dicistronic mRNA of the double-stranded RNA fungal virus Helminthosporium victoriae virus 190S (genus Victorivirus, family Totiviridae) contains two long open reading frames (ORFs) that overlap in the tetranucleotide AUGA. Translation of the downstream ORF, which encodes the RNA-dependent RNA polymerase (RdRp), has been proposed to depend on ribosomal reinitiation following termination of the upstream ORF, which encodes the capsid protein. In the current study, we examined the RNA sequence determinants for RdRp translation in this virus and demonstrated that a coupled termination-reinitiation (stop-restart) strategy is indeed used. Signals for termination-reinitiation are found within a 32-nucleotide stretch of RNA immediately upstream of the AUGA motif, including a predicted pseudoknot structure. The close proximity in which this predicted structure is followed by the upstream ORF's stop codon appears to be especially important for promoting translation of the downstream ORF. The normal strong preferences for an AUG start codon and the canonical sequence context to favor translation initiation appear somewhat relaxed for the downstream ORF. Similar sequence motifs and predicted RNA structures in other victoriviruses suggest that they all share a related stop-restart strategy for RdRp translation. Members of the genus Victorivirus thus provide new and unique opportunities for exploring the molecular mechanisms of translational coupling, which remain only partly understood in this and other systems.

Annual and seasonal variations In the gamma activities in Sava river sediments upstream and downstream of NPP Krsko

International Nuclear Information System (INIS)

Stipe, Lulic

2006-01-01

Results of the five years monitoring of artificial and natural occurring radionuclides in the Sava river sediments are presented. Measurements were conducted as a part of the regular Krsko Nuclear Power Plant radioactivity control and the independent supervisions of the input of radionuclides into larger environment (immission). In order to estimate seasonal variations samples were taken from seven locations (one upstream and five downstream of the Krsko NPP) during four sampling period (seasonal) in each year. Selected radionuclides in the sediment fraction less than 0.5 mm were determined with gamma spectrometer equipped with BE3830 model High Purity Ge detector with 30% relative efficiency. (authors)

Annual and seasonal variations In the gamma activities in Sava river sediments upstream and downstream of NPP Krsko

Energy Technology Data Exchange (ETDEWEB)

Stipe, Lulic [Rudjer Boskovic Institute, Lab. for radioecology, Zagreb (Croatia)

2006-07-01

Results of the five years monitoring of artificial and natural occurring radionuclides in the Sava river sediments are presented. Measurements were conducted as a part of the regular Krsko Nuclear Power Plant radioactivity control and the independent supervisions of the input of radionuclides into larger environment (immission). In order to estimate seasonal variations samples were taken from seven locations (one upstream and five downstream of the Krsko NPP) during four sampling period (seasonal) in each year. Selected radionuclides in the sediment fractiess than 0.5 mm were determined with gamma spectrometer equipped with BE3830 model High Purity Ge detector with 30% relative efficiency. (authors)

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

Science.gov (United States)

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Variability in a three-generation family with Pierre Robin sequence, acampomelic campomelic dysplasia, and intellectual disability due to a novel ∼1 Mb deletion upstream of SOX9, and including KCNJ2 and KCNJ16.

Science.gov (United States)

Castori, Marco; Bottillo, Irene; Morlino, Silvia; Barone, Chiara; Cascone, Piero; Grammatico, Paola; Laino, Luigi

2016-01-01

Campomelic dysplasia and acampomelic campomelic dysplasia (ACD) are allelic disorders due to heterozygous mutations in or around SOX9. Translocations and deletions involving the SOX9 5' regulatory region are rare causes of these disorders, as well as Pierre Robin sequence (PRS) and 46,XY gonadal dysgenesis. Genotype-phenotype correlations are not straightforward due to the complex epigenetic regulation of SOX9 expression during development. We report a three-generation pedigree with a novel ∼1 Mb deletion upstream of SOX9 and including KCNJ2 and KCNJ16, and ascertained for dominant transmission of PRS. Further characterization of the family identified subtle appendicular anomalies and a variable constellation of axial skeletal features evocative of ACD in several members. Affected males showed learning disability. The identified deletion was smaller than all other chromosome rearrangements associated with ACD. Comparison with other reported translocations and deletions involving this region allowed further refining of genotype-phenotype correlations and an update of the smallest regions of overlap associated with the different phenotypes. Intrafamilial variability in this pedigree suggests a phenotypic continuity between ACD and PRS in patients carrying mutations in the SOX9 5' regulatory region. © 2015 Wiley Periodicals, Inc.

ISEE/IMP Observations of simultaneous upstream ion events

International Nuclear Information System (INIS)

Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.

1983-01-01

Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft

Ion acceleration at the earth's bow shock: A review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Ion acceleration at the earth's bow shock: a review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Restructuring: new relationships between the oil companies and the upstream oil firms; Alliances et restructurations: nouvelles relations entre maitres d'oeuvre et parapetrolier

Energy Technology Data Exchange (ETDEWEB)

Barreau, S

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

[Neuronal activity of monkey dorso-lateral premotor cortex during tasks of figure recognition guided motor sequence vs memorized spatial motor sequence].

Science.gov (United States)

Chen, Y C; Huang, F D; Chen, N H; Shou, J Y; Wu, L

1998-04-01

In the last 2-3 decades the role of the premotor cortex (PM) of monkey in memorized spatial sequential (MSS) movements has been amply investigated. However, it is as yet not known whether PM participates in the movement sequence behaviour guided by recognition of visual figures (i.e. the figure-recognition sequence, FRS). In the present work three monkeys were trained to perform both FRS and MSS tasks. Postmortem examination showed that 202 cells were in the dorso-lateral premotor cortex. Among 111 cells recorded during the two tasks, more than 50% changed their activity during the cue periods in either task. During the response period, the ratios of cells with changes of firing rate in both FRS and MSS were high and roughly equal to each other, while during the image period, the proportion in the FRS (83.7%) was significantly higher than that in the MSS (66.7%). Comparison of neuronal activities during same motor sequence of two different tasks showed that during the image periods PM neuronal activities were more closely related to the FRS task, while during the cue periods no difference could be found. Analysis of cell responses showed that the neurons with longer latency were much more in MSS than in FRS in either cue or image period. The present results indicate that the premotor cortex participates in FRS motor sequence as well as in MSS and suggest that the dorso-lateral PM represents another subarea in function shared by both FRS and MSS tasks. However, in view of the differences of PM neuronal responses in cue or image periods of FRS and MSS tasks, it seems likely that neural networks involved in FRS and MSS tasks are different.

Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase

International Nuclear Information System (INIS)

Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.

1990-01-01

The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6

San Joaquin River Up-Stream DO TMDL Project Task 4: MonitoringStudy Interim Task Report #3

Energy Technology Data Exchange (ETDEWEB)

Stringfellow, William; Borglin, Sharon; Dahlgren, Randy; Hanlon,Jeremy; Graham, Justin; Burks, Remie; Hutchinson, Kathleen

2007-03-30

The purpose of the Dissolved Oxygen Total Maximum Daily LoadProject (DO TMDLProject) is to provide a comprehensive understanding ofthe sources and fate of oxygen consuming materials in the San JoaquinRiver (SJR) watershed between Channel Point and Lander Avenue (upstreamSJR). When completed, this study will provide the stakeholders anunderstanding of the baseline conditions of the basin, provide input foran allocation decision, and provide the stakeholders with a tool formeasuring the impact of any waterquality management program that may beimplemented as part of the DO TMDL process. Previous studies haveidentified algal biomass as the most significant oxygen-demandingsubstance in the DO TMDL Project study-area between of Channel Point andLander Ave onthe SJR. Other oxygen-demanding substances found in theupstream SJR include ammonia and organic carbon from sources other thanalgae. The DO TMDL Project study-area contains municipalities, dairies,wetlands, cattle ranching, irrigated agriculture, and industries thatcould potentially contribute biochemical oxygen demand (BOD) to the SJR.This study is designed to discriminate between algal BOD and othersources of BOD throughout the entire upstream SJR watershed. Algalbiomass is not a conserved substance, but grows and decays in the SJR;hence, characterization of oxygen-demanding substances in the SJR isinherently complicated and requires an integrated effort of extensivemonitoring, scientific study, and modeling. In order to achieve projectobjectives, project activities were divided into a number of Tasks withspecific goals and objectives. In this report, we present the results ofmonitoring and research conducted under Task 4 of the DO TMDL Project.The major objective of Task 4 is to collect sufficient hydrologic (flow)and water quality (WQ) data to characterize the loading of algae, otheroxygen-demanding materials, and nutrients fromindividual tributaries andsub-watersheds of the upstream SJR between Mossdale and

Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

NARCIS (Netherlands)

Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

2001-01-01

Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

Science.gov (United States)

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

A scheme for regulating toxic substances to water quality of Chamsil upstream water system

Energy Technology Data Exchange (ETDEWEB)

Kim, Kang Suk; Kim, Jee Hoon [Korea Environment Institute, Seoul (Korea)

1998-12-01

This study asserts to reflect a concept of toxicity thoroughly in the present water quality concept. It presents an appropriate solution to control toxic substances flowing into the Chamsil upstream water system. Although a regulation of toxic substances into major rivers in Korea other than Han river is also required urgently, it will be studied in future. It is expected that this study on Chamsil upstream would be a cornerstone for establishing a national regulation policy of toxic substances into water system. 28 refs., 1 fig., 36 tabs.

Increase in posterior alpha activity during rehearsal predicts successful long-term memory formation of word sequences.

Science.gov (United States)

Meeuwissen, Esther B; Takashima, Atsuko; Fernández, Guillén; Jensen, Ole

2011-12-01

It is becoming increasingly clear that demanding cognitive tasks rely on an extended network engaging task-relevant areas and, importantly, disengaging task-irrelevant areas. Given that alpha activity (8-12 Hz) has been shown to reflect the disengagement of task-irrelevant regions in attention and working memory tasks, we here ask if alpha activity plays a related role for long-term memory formation. Subjects were instructed to encode and maintain the order of word sequences while the ongoing brain activity was recorded using magnetoencephalography (MEG). In each trial, three words were presented followed by a 3.4 s rehearsal interval. Considering the good temporal resolution of MEG this allowed us to investigate the word presentation and rehearsal interval separately. The sequences were grouped in trials where word order either could be tested immediately (working memory trials; WM) or later (LTM trials) according to instructions. Subjects were tested on their ability to retrieve the order of the three words. The data revealed that alpha power in parieto-occipital regions was lower during word presentation compared to rehearsal. Our key finding was that parieto-occipital alpha power during the rehearsal period was markedly stronger for successfully than unsuccessfully encoded LTM sequences. This subsequent memory effect demonstrates that high posterior alpha activity creates an optimal brain state for successful LTM formation possibly by actively reducing parieto-occipital activity that might interfere with sequence encoding. Copyright © 2010 Wiley Periodicals, Inc.

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

Science.gov (United States)

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Experimental Branch Retinal Vein Occlusion Induces Upstream Pericyte Loss and Vascular Destabilization.

Directory of Open Access Journals (Sweden)

Elisa Dominguez

Full Text Available Branch retinal vein occlusion (BRVO leads to extensive vascular remodeling and is important cause of visual impairment. Although the vascular morphological changes following experimental vein occlusion have been described in a variety of models using angiography, the underlying cellular events are ill defined.We here show that laser-induced experimental BRVO in mice leads to a wave of TUNEL-positive endothelial cell (EC apoptosis in the upstream vascular network associated with a transient edema and hemorrhages. Subsequently, we observe an induction of EC proliferation within the dilated vein and capillaries, detected by EdU incorporation, and the edema resolves. However, the pericytes of the upstream capillaries are severely reduced, which was associated with continuing EC apoptosis and proliferation. The vascular remodeling was associated with increased expression of TGFβ, TSP-1, but also FGF2 expression. Exposure of the experimental animals to hypoxia, when pericyte (PC dropout had occurred, led to a dramatic increase in endothelial cell proliferation, confirming the vascular instability induced by the experimental BRVO.Experimental BRVO leads to acute endothelial cells apoptosis and increased permeability. Subsequently the upstream vascular network remains destabilized, characterized by pericyte dropout, un-physiologically high endothelial cells turnover and sensitivity to hypoxia. These early changes might pave the way for capillary loss and subsequent chronic ischemia and edema that characterize the late stage disease.

Characterization of wind velocities in the upstream induction zone of a wind turbine using scanning continuous-wave lidars

DEFF Research Database (Denmark)

Simley, Eric; Angelou, Nikolas; Mikkelsen, Torben Krogh

2016-01-01

As a wind turbine generates power, induced velocities, lower than the freestream velocity, will be present upstream of the turbine due to perturbation of the flow by the rotor. In this study, the upstream induction zone of a 225kW horizontal axis Vestas V27 wind turbine located at the Danish...... Technical University’s Risø campus is investigated using a scanning Light Detection and Ranging (lidar) system. Three short-range continuous-wave “WindScanner” lidars are positioned in the field around the V27 turbine allowing detection of all three components of the wind velocity vectors within...... the induction zone. The time-averaged mean wind speeds at different locations in the upstream induction zone are measured by scanning a horizontal plane at hub height and a vertical plane centered at the middle of the rotor extending roughly 1.5 rotor diameters (D) upstream of the rotor. Turbulence statistics...

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

Directory of Open Access Journals (Sweden)

W.S.I. de Silva

2017-07-01

Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

Adaptive upstream rate adjustment by RSOA-ONU depending on different injection power of seeding light in standard-reach and long-reach PON systems

Science.gov (United States)

Yeh, C. H.; Chow, C. W.; Shih, F. Y.; Pan, C. L.

2012-08-01

The wavelength division multiplexing-time division multiplexing (WDM-TDM) passive optical network (PON) using reflective semiconductor optical amplifier (RSOA)-based colorless optical networking units (ONUs) is considered as a promising candidate for the realization of fiber-to-the-home (FTTH). And this architecture is actively considered by Industrial Technology Research Institute (ITRI) for the realization of FTTH in Taiwan. However, different fiber distances and optical components would introduce different power budgets to different ONUs in the PON. Besides, due to the aging of optical transmitter (Tx), the power decay of the distributed optical carrier from the central office (CO) could also reduce the injection power into each ONU. The situation will be more severe in the long-reach (LR) PON, which is considered as an option for the future access. In this work, we investigate a WDM-TDM PON using RSOA-based ONU for upstream data rate adjustment depending on different continuous wave (CW) injection powers. Both standard-reach (25 km) and LR (100 km) transmissions are evaluated. Moreover, a detail analysis of the upstream signal bit-error rate (BER) performances at different injection powers, upstream data rates, PON split-ratios under stand-reach and long-reach is presented.

Protein Coexpression Using FMDV 2A: Effect of “Linker” Residues

Directory of Open Access Journals (Sweden)

Ekaterina Minskaia

2013-01-01

Full Text Available Many biomedical applications absolutely require, or are substantially enhanced by, coexpression of multiple proteins from a single vector. Foot-and-mouth disease virus 2A (F2A and “2A-like” sequences (e.g., Thosea asigna virus 2A; T2A are used widely for this purpose since multiple proteins can be coexpressed by linking open reading frames (ORFs to form a single cistron. The activity of F2A “cleavage” may, however, be compromised by both the use of shorter versions of F2A and the sequences (derived from multiple-purpose cloning sites used to link F2A to the upstream protein. To characterise these effects, different lengths of F2A and T2A were inserted between green and cherry fluorescent proteins. Mutations were introduced in the linker region immediately upstream of both F2A- and T2A-based constructs and activities determined using both cell-free translation systems and transfected cells. In shorter versions of F2A, activity may be affected by both the C-terminal sequence of the protein upstream and, equally strikingly, the residues immediately upstream introduced during cloning. Mutations significantly improved activity for shorter versions of F2A but could decrease activity in the case of T2A. These data will aid the design of cloning strategies for the co-expression of multiple proteins in biomedical/biotechnological applications.

Targeting the upstream transcriptional activator of PD-L1 as an alternative strategy in melanoma therapy.

Science.gov (United States)

Zhu, Bo; Tang, Liming; Chen, Shuyang; Yin, Chengqian; Peng, Shiguang; Li, Xin; Liu, Tongzheng; Liu, Wei; Han, Changpeng; Stawski, Lukasz; Xu, Zhi-Xiang; Zhou, Guangbiao; Chen, Xiang; Gao, Xiumei; Goding, Colin R; Xu, Nan; Cui, Rutao; Cao, Peng

2018-05-22

Programmed cell death ligand 1 (PD-L1) interacts with programmed cell death protein-1 (PD-1) as an immune checkpoint. Reactivating the immune response by inhibiting PD-L1 using therapeutic antibodies provides substantial clinical benefits in many, though not all, melanoma patients. However, transcriptional suppression of PD-L1 expression as an alternative therapeutic anti-melanoma strategy has not been exploited. Here we provide biochemical evidence demonstrating that ultraviolet radiation (UVR) induction of PD-L1 in skin is directly controlled by nuclear factor E2-related transcription factor 2 (NRF2). Depletion of NRF2 significantly induces tumor infiltration by both CD8 + and CD4 + T cells to suppress melanoma progression, and combining NRF2 inhibition with anti-PD-1 treatment enhanced its anti-tumor function. Our studies identify a critical and targetable PD-L1 upstream regulator and provide an alternative strategy to inhibit the PD-1/PD-L1 signaling in melanoma treatment.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

Science.gov (United States)

Wang, Cheng; Yu, Jie; Kallen, Caleb B

2008-01-01

The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

Directory of Open Access Journals (Sweden)

Grover Atul

2007-07-01

Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

Accessibility of the Shine-Dalgarno sequence dictates N-terminal codon bias in E. coli

OpenAIRE

Shakhnovich, Eugene; Zhang, Wenli; Yan, Jin; Adkar, Bharat; Jacobs, William; Bhattacharyya, Sanchari; Adkar, Bharat

2018-01-01

Despite considerable efforts, no physical mechanism has been shown to explain N-terminal codon bias in prokaryotic genomes. Using a systematic study of synonymous substitutions in two endogenous E. coli genes, we show that interactions between the coding region and the upstream Shine-Dalgarno (SD) sequence modulate the efficiency of translation initiation, affecting both intracellular mRNA and protein levels due to the inherent coupling of transcription and translation in E. coli. We further ...

Experience of molecular monitoring techniques in upstream oil and gas operations

Energy Technology Data Exchange (ETDEWEB)

Mitchell, Anthony F.; Anfindsen, Hilde; Liengen, Turid; Molid, Solfrid [Statoil ASA (Denmark)

2011-07-01

For a numbers of years, molecular monitoring tools have been used in upstream oil and gas operations but the results have given only limited added value. This paper discusses the various techniques available for upstream molecular monitoring which provides scope for identification of microbial influenced problems. The methodology, which consists of analyzing solid samples using traditional as well as molecular techniques, is detailed. Two cases were studied with the objective of determining if microbial contamination was contributing to the problem. The first case was a study of amorphous deposits in production wells and mainly iron sulphide was found. The second study was of amorphous deposits in water injection wells and the analysis showed typical components of drilling and completion fluids with some organic material. Two more cases, corrosion of tubing in a water injection well and flow line corrosion, are discussed and the results are given. From the study, it can be concluded that failure can be due to several factors, chemical and biological.

Role of nitric oxide in vasodilation in upstream muscle during intermittent pneumatic compression.

Science.gov (United States)

Chen, Long-En; Liu, Kang; Qi, Wen-Ning; Joneschild, Elizabeth; Tan, Xiangling; Seaber, Anthony V; Stamler, Jonathan S; Urbaniak, James R

2002-02-01

This study investigated the dosage effects of nitric oxide synthase (NOS) inhibitor N(G)-monomethyl-L-arginine (L-NMMA) on intermittent pneumatic compression (IPC)-induced vasodilation in uncompressed upstream muscle and the effects of IPC on endothelial NOS (eNOS) expression in upstream muscle. After L-NMMA infusion, mean arterial pressure increased by 5% from baseline (99.5 +/- 18.7 mmHg; P < 0.05). Heart rate and respiratory rate were not significantly affected. One-hour IPC application on legs induced a 10% dilation from baseline in 10- to 20-microm arterioles and a 10-20% dilation in 21- to 40 microm arterioles and 41- to 70-microm arteries in uncompressed cremaster muscle. IPC-induced vasodilation was dose dependently reduced, abolished, or even reversed by concurrently infused L-NMMA. Moreover, expression of eNOS mRNA in uncompressed cremaster muscle was upregulated to 2 and 2.5 times normal at the end of 1- and 5-h IPC on legs, respectively, and the expression of eNOS protein was upregulated to 1.8 times normal. These increases returned to baseline level after cessation of IPC. The results suggest that eNOS plays an important role in regulating the microcirculation in upstream muscle during IPC.

Sodium Pick-Up Ion Observations in the Solar Wind Upstream of Mercury

Science.gov (United States)

Jasinski, J. M.; Raines, J. M.; Slavin, J. A.; Regoli, L. R.; Murphy, N.

2018-05-01

We present the first observations of sodium pick-up ions upstream of Mercury’s magnetosphere. From these observations we infer properties of Mercury’s sodium exosphere and implications for the solar wind interaction with Mercury’s magnetosphere.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

Directory of Open Access Journals (Sweden)

Sophie Lanciano

2017-02-01

Full Text Available Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

Science.gov (United States)

Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

2017-02-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

Energy Technology Data Exchange (ETDEWEB)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

1987-10-16

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

[Study on method of tracking the active cells in image sequences based on EKF-PF].

Science.gov (United States)

Tang, Chunming; Liu, Ying

2013-02-01

In cell image sequences, due to the nonlinear and nonGaussian motion characteristics of active cells, the accurate prediction and tracking is still an unsolved problem. We applied extended Kalman particle filter (EKF-PF) here in our study, attempting to solve the problem. Firstly we confirmed the existence and positions of the active cells. Then we established a motion model and improved it via adding motion angle estimation. Next we predicted motion parameters, such as displacement, velocity, accelerated velocity and motion angle, in region centers of the cells being tracked. Finally we obtained the motion traces of active cells. There were fourteen active cells in three image sequences which have been tracked. The errors were less than 2.5 pixels when the prediction values were compared with actual values. It showed that the presented algorithm may basically reach the solution of accurate predition and tracking of the active cells.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

Science.gov (United States)

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

Directory of Open Access Journals (Sweden)

Lindberg Pia

2009-03-01

Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.

Bottom-up driven involuntary auditory evoked field change: constant sound sequencing amplifies but does not sharpen neural activity.

Science.gov (United States)

Okamoto, Hidehiko; Stracke, Henning; Lagemann, Lothar; Pantev, Christo

2010-01-01

The capability of involuntarily tracking certain sound signals during the simultaneous presence of noise is essential in human daily life. Previous studies have demonstrated that top-down auditory focused attention can enhance excitatory and inhibitory neural activity, resulting in sharpening of frequency tuning of auditory neurons. In the present study, we investigated bottom-up driven involuntary neural processing of sound signals in noisy environments by means of magnetoencephalography. We contrasted two sound signal sequencing conditions: "constant sequencing" versus "random sequencing." Based on a pool of 16 different frequencies, either identical (constant sequencing) or pseudorandomly chosen (random sequencing) test frequencies were presented blockwise together with band-eliminated noises to nonattending subjects. The results demonstrated that the auditory evoked fields elicited in the constant sequencing condition were significantly enhanced compared with the random sequencing condition. However, the enhancement was not significantly different between different band-eliminated noise conditions. Thus the present study confirms that by constant sound signal sequencing under nonattentive listening the neural activity in human auditory cortex can be enhanced, but not sharpened. Our results indicate that bottom-up driven involuntary neural processing may mainly amplify excitatory neural networks, but may not effectively enhance inhibitory neural circuits.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

Science.gov (United States)

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Canadian upstream oil and gas industry profitability: Historical review and future perspectives [with executive summary

International Nuclear Information System (INIS)

1991-09-01

The profitability of the Canadian upstream oil and gas industry is examined by analyzing return on equity and return on capital invested. By all measures and interpretations, the upstream industry has been unprofitable since the mid-1980s; returns generated are far below the industry's own historical cost of capital, and are inadequate relative to other sectors of the Canadian economy and to international oil and gas companies. This poor profitability is attributed to such factors as: overly optimistic price forecasts and healthy cash flows generated in the early 1980s, which led to excess capital spending; poor returns on capital reflective of the physical limitations of the Western Canadian Sedimentary Basin; high capital and operating costs; and a high royalty burden imposed by provincial governments. The consequences of low profitability include inadequate returns to equity investors, a drop in spending on upstream services such as drilling and exploration, a reduced ability of the industry to generate employment, and an adverse effect on the economy of Alberta. Forecasts indicate that the upstream sector is extremely vulnerable to a scenario of relatively flat prices due to high and increasing operating costs and depletion charges, and the significant royalty payments that still are in effect. Little scope is foreseen for industry profitability to return to acceptable levels over the first half of the 1990s. Reduced royalties have the potential to make a significant contribution to improved profitability. 52 figs., 40 tabs

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

Science.gov (United States)

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

APE1 incision activity at abasic sites in tandem repeat sequences.

Science.gov (United States)

Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M

2014-05-29

Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.

Frequency effects of upstream wake and blade interaction on the unsteady boundary layer flow

International Nuclear Information System (INIS)

Kang, Dong Jin; Bae, Sang Su

2002-01-01

Effects of the reduced frequency of upstream wake on downstream unsteady boundary layer flow were simulated by using a Navier-Stokes code. The Navier-Stokes code is based on an unstructured finite volume method and uses a low Reynolds number turbulence model to close the momentum equations. The geometry used in this paper is the MIT flapping foil experimental set-up and the reduced frequency of the upstream wake is varied in the range of 0.91 to 10.86 to study its effect on the unsteady boundary layer flow. Numerical solutions show that they can be divided into two categories. One is so called the low frequency solution, and behaves quite similar to a Stokes layer. Its characteristics is found to be quite similar to those due to either a temporal or spatial wave. The low frequency solutions are observed clearly when reduced frequency is smaller than 3.26. The other one is the high frequency solution. It is observed for the reduced frequency larger than 7.24. It shows a sudden shift of the phase angle of the unsteady velocity around the edge of the boundary layer. The shift of phase angle is about 180 degree, and leads to separation of the boundary layer flow from corresponding outer flow. The high frequency solution shows the characteristics of a temporal wave whose wave length is half of the upstream frequency. This characteristics of the high frequency solution is found to be caused by the strong interaction between unsteady vortices. This strong interaction also leads to destroy of the upstream wake stripe inside the viscous sublayer as well as the buffer layer

New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

Science.gov (United States)

Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

2018-02-10

The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Wake flow behaviour behind a smaller cylinder oscillating in the wake of an upstream stationary cylinder

Energy Technology Data Exchange (ETDEWEB)

Gao, Yangyang; Sun, Zhilin [Ocean College, Zhejiang University, Hangzhou 310058 (China); Tan, Danielle S [Maritime Research Centre, Nanyang Technological University, Singapore 639798 (Singapore); Yu, Dingyong [College of Engineering, Ocean University of China, 266100 (China); Tan, Soon Keat, E-mail: yygao@zju.edu.cn [Nanyang Environment and Water Research Institute, Nanyang Technological University, Singapore 639798 (Singapore)

2014-04-01

The flow patterns around a cylinder oscillating freely in the wake of a larger cylinder upstream were investigated using the particle image velocimetry technique. The upstream cylinder was fixed at both ends while the downstream smaller cylinder was held by springs such that it was free to oscillate in the transverse direction. The flow patterns, amplitudes of oscillation and vortex shedding frequencies were compared with those of a single cylinder. In the presence of the upstream cylinder, the three parameters characterizing the oscillation response of the smaller cylinder—amplitude of oscillation, vortex shedding frequency and Reynolds stresses—were greatly reduced. While their magnitude increased with gap ratio, these three parameters were still smaller than the corresponding magnitudes for a single oscillating cylinder. The peak values of turbulence statistics such as Reynolds shear stress and normal stress behind the oscillating downstream cylinder were similarly reduced, and increased with gap ratios. (paper)

Transmembrane-sequence-dependent overexpression and secretion of glycoproteins in Saccharomyces cerevisiae.

Science.gov (United States)

Schuster, M; Wasserbauer, E; Aversa, G; Jungbauer, A

2001-02-01

Protein expression using the secretory pathway in Saccharomyces cerevisiae can lead to high amounts of overexpressed and secreted proteins in culture supernatants in a short period of time. These post-translational modified expression products can be purified up to >90% in a single step. The overexpression and secretion of the transmembrane glycoprotein signaling lymphocytic activation molecule (SLAM) was studied. SLAM belongs to the immunoglobulin superfamily and its engagement results in T-cell expansion and INF-gamma production. The molecule is composed of an extracellular, a single-span transmembrane and a cytoplasmatic domain. The extracellular part may be relevant for stimulation studies in vitro since SLAM is a high-affinity self-ligand. Therefore several fragments of this region have been expressed as Flag-fusions in S. cerevisiae: a full-length fragment containing the transmembrane region and the autologous signal sequence, another without the transmembrane region, and two fragments without the autologous signal sequence with and without the transmembrane region. By molecular cloning, the different deletion mutants of the cDNA encoding the full-length construct have been inserted in a yeast episomal plasmid. Upstream of the cDNA, the alpha-leader sequence of a yeast mating pheromone has been cloned to direct the fusion proteins into the secretory protein maturation pathway. All four fragments were expressed but yield, location, and maturation were highly influenced by the transmembrane domain and the autologous signal sequence. Only the fragment without autologous signal sequence and transmembrane domain could be efficiently secreted. High-mannose glycosylation was analyzed by lectin mapping and digestion with specific glycosidases. After enzyme treatment, a single band product with the theoretical size could be detected and identified as SLAM by a specific monoclonal antibody. The fusion protein concentration in the supernatant was 30 microg/ml. The

Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

International Nuclear Information System (INIS)

Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

1988-01-01

HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

Decrease in gamma-band activity tracks sequence learning

Science.gov (United States)

Madhavan, Radhika; Millman, Daniel; Tang, Hanlin; Crone, Nathan E.; Lenz, Fredrick A.; Tierney, Travis S.; Madsen, Joseph R.; Kreiman, Gabriel; Anderson, William S.

2015-01-01

Learning novel sequences constitutes an example of declarative memory formation, involving conscious recall of temporal events. Performance in sequence learning tasks improves with repetition and involves forming temporal associations over scales of seconds to minutes. To further understand the neural circuits underlying declarative sequence learning over trials, we tracked changes in intracranial field potentials (IFPs) recorded from 1142 electrodes implanted throughout temporal and frontal cortical areas in 14 human subjects, while they learned the temporal-order of multiple sequences of images over trials through repeated recall. We observed an increase in power in the gamma frequency band (30–100 Hz) in the recall phase, particularly in areas within the temporal lobe including the parahippocampal gyrus. The degree of this gamma power enhancement decreased over trials with improved sequence recall. Modulation of gamma power was directly correlated with the improvement in recall performance. When presenting new sequences, gamma power was reset to high values and decreased again after learning. These observations suggest that signals in the gamma frequency band may play a more prominent role during the early steps of the learning process rather than during the maintenance of memory traces. PMID:25653598

Impacts of shape and height of upstream roof on airflow and pollutant dispersion inside an urban street canyon.

Science.gov (United States)

Huang, Yuan-Dong; He, Wen-Rong; Kim, Chang-Nyung

2015-02-01

A two-dimensional numerical model for simulating flow and pollutant dispersion in an urban street canyon is firstly developed using the FLUENT code and then validated against the wind tunnel results. After this, the flow field and pollutant dispersion inside an urban street canyon with aspect ratio W/H = 1 are examined numerically considering five different shapes (vaulted, trapezoidal, slanted, upward wedged, and downward wedged roofs) as well as three different roof height to building height ratios (Z H /H = 1/6, 1/3, and 1/2) for the upstream building roof. The results obtained reveal that the shape and height of an upstream roof have significant influences on flow pattern and pollutant distribution in an urban canyon. A large single clockwise vortex is generated in the canyon for the vaulted upstream roof at Z H /H = 1/6, 1/3, and 1/2, the trapezoidal and downward wedged roofs at Z H /H = 1/6 and 1/3, and the slanted and upward wedged roofs at Z H /H = 1/6, while a main clockwise vortex and a secondary counterclockwise vortex are established for the trapezoidal and downward wedged roofs at Z H /H = 1/2 and the slanted and upward wedged roofs at Z H /H = 1/3 and 1/2. In the one-vortex flow regime, the clockwise vortex moves upward and grows in size with increasing upstream roof height for the vaulted, trapezoidal, and downward wedged roofs. In the two-vortex flow regime, the size and rotational velocity of both upper clockwise and lower counterclockwise vortices increase with the upstream roof height for the slanted and upward wedged roofs. At Z H /H = 1/6, the pollution levels in the canyon are close among all the upstream roof shapes studied. At Z H /H = 1/3, the pollution levels in the canyon for the upward wedged roof and slanted roof are much higher than those for the vaulted, trapezoidal, and downward wedged roofs. At Z H /H = 1/2, the lowest pollution level appears in the canyon for the vaulted upstream roof, while

Cellular specificity of HIV-1 replication can be controlled by LTR sequences

International Nuclear Information System (INIS)

Reed-Inderbitzin, Edward; Maury, Wendy

2003-01-01

Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

How to use Big Data technologies to optimize operations in Upstream Petroleum Industry

Directory of Open Access Journals (Sweden)

Abdelkader Baaziz

2013-12-01

Full Text Available “Big Data is the oil of the new economy” is the most famous citation during the three last years. It has even been adopted by the World Economic Forum in 2011. In fact, Big Data is like crude! It’s valuable, but if unrefined it cannot be used. It must be broken down, analyzed for it to have value. But what about Big Data generated by the Petroleum Industry and particularly its upstream segment? Upstream is no stranger to Big Data. Understanding and leveraging data in the upstream segment enables firms to remain competitive throughout planning, exploration, delineation, and field development.Oil & Gas Companies conduct advanced geophysics modeling and simulation to support operations where 2D, 3D & 4D Seismic generate significant data during exploration phases. They closely monitor the performance of their operational assets. To do this, they use tens of thousands of data-collecting sensors in subsurface wells and surface facilities to provide continuous and real-time monitoring of assets and environmental conditions. Unfortunately, this information comes in various and increasingly complex forms, making it a challenge to collect, interpret, and leverage the disparate data. As an example, Chevron’s internal IT traffic alone exceeds 1.5 terabytes a day.Big Data technologies integrate common and disparate data sets to deliver the right information at the appropriate time to the correct decision-maker. These capabilities help firms act on large volumes of data, transforming decision-making from reactive to proactive and optimizing all phases of exploration, development and production. Furthermore, Big Data offers multiple opportunities to ensure safer, more responsible operations. Another invaluable effect of that would be shared learning.The aim of this paper is to explain how to use Big Data technologies to optimize operations. How can Big Data help experts to decision-making leading the desired outcomes?Keywords:Big Data; Analytics

Investigating the Applicability of Upstream Detection Strategy at Pedestrian Signalised Crossings

Directory of Open Access Journals (Sweden)

Sitti A Hassan

2017-10-01

Full Text Available In the UK, the Puffin crossing has provision to extend pedestrian green time for those who take longer to cross. However, even at such a pedestrian friendly facility, the traffic signal control is usually designed to minimise vehicle delay while providing the crossing facility. This situation is rather contrary to the current policies to encourage walking. It is this inequity that has prompted the need to re-examine the traffic control of signalised crossings to provide more benefit to both pedestrians and vehicles. In this context, this paper explores the possibility of implementing an Upstream Detection strategy at a Puffin crossing to provide a user friendly crossing. The study has been carried out by simulating a mid-block Puffin crossing for various detector distances and a number of combinations of pedestrian and traffic flows. This paper presents the simulation results and recommends the situations at which Upstream Detection would be suitable.

Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

Science.gov (United States)

Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

2007-07-01

A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.

Upstream pumping of radial lip seals by tangentially deforming, rough seal surfaces

NARCIS (Netherlands)

Bavel, van P.G.M.; Ruijl, T.A.M.; Leeuwen, van H.J.; Muijderman, E.A.

1996-01-01

This paper aims at a theoretical explanation of the following two experimental observations of radial lip seals: fluid film formation and upstream pumping action. The origins of these observations are still poorly understood. A hydrodynamic analysis is presented for the fully flooded contact zone of

Pump it out : the environmental costs of BC's upstream oil and gas industry

International Nuclear Information System (INIS)

2003-05-01

West Coast Environmental Law published this web-based guide to provide information to concerned citizens interested in knowing more about the environmental consequences of upstream oil and gas activity in British Columbia. The report looked at global consequences such as greenhouse gas emissions, and local consequences such as seismic lines, roads, and processing facilities. At present, the government of British Columbia is implementing policies aimed at doubling oil and gas production in five years, de-regulate the oil and gas industry, and cut oversight and enforcement staff. The guide was designed to assist citizens and communities in making informed choices about energy options. The specific topics dealt with in this report were: the consequences to the environment; what laws are applicable, and their enforcement; changes required to reduce or eliminate environmental damage; and, actions that a concerned citizen can take. refs

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Analysis of the pelE promoter in Erwinia chrysanthemi EC16.

Science.gov (United States)

Gold, S; Nishio, S; Tsuyumu, S; Keen, N T

1992-01-01

The pelE gene of Erwinia chrysanthemi strain EC16 encodes an extracellular pectate lyase protein that is important in virulence on plants. Control of pelE expression is complex, because the gene is regulated by catabolite repression, substrate induction, and growth-phase inhibition. A Tn7-lux reporter gene system was employed to define DNA sequences comprising the pelE promoter. When EC16 cells were grown on medium containing sodium polypectate, pelE transcriptional start sites were observed only at 95 and 96 bases upstream of the translational start site. However, DNA sequences required for pelE expression were also shown by deletion analysis to reside between 196 and 215 base pairs upstream of the translational start site. In addition to these upstream elements, two putative operator sequences that interact with negative regulatory factors occurred downstream of the transcriptional start. Finally, deletion of three bases from a putative catabolite gene activator protein binding site in the pelE promoter eliminated activity. The data demonstrate that the pelE promoter is complex and suggest that it interacts with several regulatory proteins.

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

(LBA-and-WRM)-based DBA scheme for multi-wavelength upstream transmission supporting 10 Gbps and 1 Gbps in MAN

Science.gov (United States)

Zhang, Yuchao; Gan, Chaoqin; Gou, Kaiyu; Xu, Anni; Ma, Jiamin

2018-01-01

DBA scheme based on Load balance algorithm (LBA) and wavelength recycle mechanism (WRM) for multi-wavelength upstream transmission is proposed in this paper. According to 1 Gbps and 10 Gbps line rates, ONUs are grouped into different VPONs. To facilitate wavelength management, resource pool is proposed to record wavelength state. To realize quantitative analysis, a mathematical model describing metro-access network (MAN) environment is presented. To 10G-EPON upstream, load balance algorithm is designed to ensure load distribution fairness for 10G-OLTs. To 1G-EPON upstream, wavelength recycle mechanism is designed to share remained wavelengths. Finally, the effectiveness of the proposed scheme is demonstrated by simulation and analysis.

Cloning and sequence of the human adrenodoxin reductase gene

International Nuclear Information System (INIS)

Lin, Dong; Shi, Y.; Miller, W.L.

1990-01-01

Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

Low power consumption O-band VCSEL sources for upstream channels in PON systems

DEFF Research Database (Denmark)

Vegas Olmos, Juan José; Rodes Lopez, Roberto; Tafur Monroy, Idelfonso

2012-01-01

This paper presents an experimental validation of a low power optical network unit employing vertical-cavity surface-emitting lasers as upstream sources for passive optical networks with an increased power budget, enabling even larger splitting ratios....

Explosion Clad for Upstream Oil and Gas Equipment

Science.gov (United States)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO2 and/or H2S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

Explosion Clad for Upstream Oil and Gas Equipment

International Nuclear Information System (INIS)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO 2 and/or H 2 S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

Exploring Patterns of Upstream Internationalization: The Role of Home-region ‘Stickiness’

NARCIS (Netherlands)

A.R. Muller (Allan); R.J.M. van Tulder (Rob)

2005-01-01

textabstractRecent work has emphasized the importance of regional strategies downstream, adding new depth to the debate on ‘globalization’. This paper adds to the debate by exploring the regional dimension upstream for a sample of Triad-based Fortune 500 firms. We find support for our hypothesis

Effect of longitudinal and transverse vibrations of an upstream square cylinder on vortex shedding behind two inline square cylinders

International Nuclear Information System (INIS)

Patil, Pratish P; Tiwari, Shaligram

2009-01-01

The characteristics of unsteady wakes behind a stationary square cylinder and another upstream vibrating square cylinder have been investigated numerically with the help of a developed computational code. The effect of longitudinal as well as transverse vibrations of the upstream cylinder is studied on the coupled wake between the two cylinders, which is found to control the vortex shedding behavior behind the downstream stationary cylinder. Computations are carried out for a fixed value of Reynolds number (Re = 200) and three different values of excitation frequencies of the upstream cylinder, namely less than, equal to and greater than the natural frequency of vortex shedding corresponding to flow past a stationary square cylinder. The vortex shedding characteristics of the unsteady wakes behind the vibrating and stationary cylinders are found to differ significantly for longitudinal and transverse modes of vibration of the upstream cylinder. The wake of the downstream stationary cylinder is found to depict a synchronization behavior with the upstream cylinder vibration. The spacing between the two cylinders has been identified to be the key parameter influencing the synchronization phenomenon. The effect of cylinder spacing on the wake synchronization and the hydrodynamic forces has been examined. In addition, a comparison of the drag forces for flow past transversely vibrating square and circular cylinders for similar amplitudes and frequencies of cylinder vibration has been presented while employing the tested computational code.

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

Directory of Open Access Journals (Sweden)

Cheng Wang

Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

A Survey of Agreement Rate between Simple MTC and Post Contrast T1 Sequence MRI for Diagnosing Active Multiple Sclerosis Plaques

Directory of Open Access Journals (Sweden)

N. Farshchian

2016-07-01

Full Text Available Introduction & Objective: MS is the most common disabling neurological disorder. Identifying new active MS plaques at the onset and clinical status and faster onset of treatment as well as evaluating the response to treatment is important and MRI with contrast is the best indicator for these measures. Materials & Methods: This study was cross-sectional including 62 patients with diagnosed MS. Whose clinical symptoms suggested the recurrence of MS. They were referred to the radiol-ogy department to undergo brain MRI with injection for the diagnosis of active plaques by a neurologist,The Data were analyzed using statistical tests and SPSS 21 software. Results: Based on the sequences of post contrast T1, pre contrast MTC and post contrast MTC 74, 272 and 271 plaques were respectively discovered. Detection of active MS plaques on T1 sequences after injection were in poor accordance and had significant difference with MTC before and after injection. Moreover, detection of active MS plaques on MTC sequences be-fore injection were in good accordance and did not show significant difference with MTC se-quences after injection. Conclusion: Based on these results, it seems that the purpose of MRI in MS patients is deter-mining the amount of active plaques. Sequences of pre contrast and post contrast MTC are significantly more than sequences of post contrast T1. Therefore, using sequences of MTC can be helpful in MRI. (Sci J Hamadan Univ Med Sci 2016; 23 (2:97-102

Optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production

International Nuclear Information System (INIS)

Bae, Hyeun Jong; Wi, Seung Gon; Lee, Yoon Gyo; Kim, Ho Myung; Kim, Su Bae

2011-10-01

The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. The 2nd year Research scope includes: 1) Optimization of pre-treatment conditions for enzymatic hydrolysis of lignocellulosic biomass and 2) Demonstration of enzymatic hydrolysis by recombinant enzymes. To optimize the pretreatment, we applied two processes: a wet process (wet milling + popping), and dry process (popping + dry milling). Out of these, the wet process presented the best glucose yield with a 93.1% conversion, while the dry process yielded 69.6%, and the unpretreated process yielded <20%. The recombinant cellulolytic enzymes showed very high specific activity, about 80-1000 times on CMC and 13-70 times on filter paper at pH 3.5 and 55 .deg. C

Regulation of expression of the c-sis proto-oncogene

Energy Technology Data Exchange (ETDEWEB)

Ratner, L. (Washington Univ., St. Louis, MO (USA))

1989-06-12

Regulation of expression of platelet derived growth factor polypeptide B encoded by the c-sis proto-oncogene is important in a number of physiological and pathological conditions. Sequences in the 1,028 nucleotide long 5{prime} untranslated region of the c-sis mRNA were found to inhibit protein synthesis. The inhibition is relieved by deletion of nucleotides 154-378 or 398-475. Sequences within 375 nucleotides upstream of the RNA initiation sites are important for transcriptional activity. Sequences in two portions of this region, between {minus}375 and {minus}235 nucleotides and between {minus}235 and {minus}99 nucleotides relative to the RNA CAP site are important for full activity. A transcriptional enhancer activity is demonstrated by its ability to increase the activity of the human T lymphotropic virus type (HTLV) I promoter at a distance and in an orientation-independent manner. Furthermore, sequences upstream of the c-sis RNA CAP site respond to the HTLV I transactivator protein to increase RNA synthesis from either the c-sis or HTLV I promoter.

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

Science.gov (United States)

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

The role of the ionosphere in coupling upstream ULF wave power into the dayside magnetosphere

International Nuclear Information System (INIS)

Engebretson, M.J.; Cahill, L.J. Jr.; Arnoldy, R.L.; Anderson, B.J.; Rosenberg, T.J.; Carpenter, D.L.; Inan, U.S.; Eather, R.H.

1991-01-01

A series of recent studies of Pc 3 magnetic pulsations in the dayside outer magnetosphere has given new insights into the possible mechanisms of entry of ULF wave power into the magnetosphere from a bow shock related upstream source. In this paper, the authors first review many of these new observational results by presenting a comparison of data from two 10-hour intervals on successive days in April 1986 and then present a possible model for transmission of pulsation signals from the magnetosheath into the dayside magnetosphere. Simultaneous multi-instrument observations at South Pole Station, located below the cusp/cleft ionosphere near local noon, magnetic field observations by the AMPTE CCE satellite in the dayside outer magnetosphere, and upstream magnetic field observations by the IMP 8 satellite show clear interplanetary magnetic field field magnitude control of dayside resonant harmonic pulsations and band-limited very high latitude pulsations, as well as pulsation-modulated precipitation of what appear to be magnetosheath/boundary layer electrons. They believe that this modulated precipitation may be responsible for the propagation of upstream wave power in the Pc 3 frequency band into the high-latitude ionosphere, from whence it may be transported throughout the dayside outer magnetosphere by means of an ionospheric transistor. In this model, modulations in ionospheric conductivity caused by cusp/cleft precipitation cause varying ionospheric currents with frequency spectra determined by the upstream waves; these modulations will be superimposed on the Birkeland currents, which close via these ionospheric currents. Modulated region 2 Birkeland currents will in turn provide a narrow-band source of wave energy to a wide range of dayside local times in the outer magnetosphere

A semelparous fish continues upstream migration when exposed to alarm cue, but adjusts movement speed and timing

Science.gov (United States)

Luhring, Thomas M; Meckley, Trevor D.; Johnson, Nicholas S.; Siefkes, Michael J.; Hume, John B.; Wagner, C. Michael

2016-01-01

Animals make trade-offs between predation risk and pursuit of opportunities such as foraging and reproduction. Trade-offs between antipredator behaviours and foraging are well suited to manipulation in laboratory and field settings and have generated a vast compendium of knowledge. However, much less is known about how animals manage trade-offs between predation risk and pursuit of reproductive opportunities in the absence of the confounding effects of foraging. In the present study, we investigated how the nonfeeding migratory life stage of sea lamprey, Petromyzon marinus, responds to odour from dead conspecifics (a cue that induces avoidance behaviours in laboratory and field studies). We released groups of PIT-tagged sea lamprey 65 m from the shore of Lake Michigan or 287 m upstream in Carp Lake River and used antennas to detect their movements in the river. As the breeding season progressed, sea lamprey initiated upstream movement earlier and were more likely to enter the river. Sea lamprey that began the night in Lake Michigan entered Carp Lake River at higher rates and accelerated upstream when exposed to high concentrations of alarm cue, consistent with animals attempting to minimize time spent in risky areas. Sea lampreys that began the night in the river delayed upstream movement when exposed to alarm cue, consistent with animals sheltering and gathering information about a source of risk. We attribute this context-specific reaction to alarm cue to differences in perceived vulnerability to predation in sheltered positions in the river versus exposed positions in the lake. Once in the river, the vast majority of sea lamprey moved upstream independent of alarm cue or Julian date. Although life-history-induced time and energy budgets place rigid constraints on the direction of migration, sea lamprey attend to predation risk by modifying movement timing and speed.

Antitumor activity of sequence-specific alkylating agents: pyrolle-imidazole CBI conjugates with indole linker.

Science.gov (United States)

Shinohara, Ken-ichi; Bando, Toshikazu; Sasaki, Shunta; Sakakibara, Yogo; Minoshima, Masafumi; Sugiyama, Hiroshi

2006-03-01

DNA-targeting agents, including cisplatin, bleomycin and mitomycin C, are used routinely in cancer treatments. However, these drugs are extremely toxic, attacking normal cells and causing severe side effects. One important question to consider in designing anticancer agents is whether the introduction of sequence selectivity to DNA-targeting agents can improve their efficacy as anticancer agents. In the present study, the growth inhibition activities of an indole-seco 1,2,9,9a-tetrahydrocyclopropa[1,2-c]benz[1,2-e]indol-4-one (CBI) (1) and five conjugates with hairpin pyrrole-imidazole polyamides (2-6), which have different sequence specificities for DNA alkylation, were compared using 10 different cell lines. The average values of -log GI50 (50% growth inhibition concentration) for compounds 1-6 against the 10 cell lines were 8.33, 8.56, 8.29, 8.04, 8.23 and 8.83, showing that all of these compounds strongly inhibit cell growth. Interestingly, each alkylating agent caused significantly different growth inhibition patterns with each cell line. In particular, the correlation coefficients between the -log GI50 of compound 1 and its conjugates 2-6 showed extremely low values (Ralkylation lead to marked differences in biological activity. Comparison of the correlation coefficients between compounds 6 and 7, with the same sequence specificity as 6, and MS-247, with sequence specificity different from 6, when used against a panel of 37 human cancer cell lines further confirmed the above hypothesis.

Predicting human activities in sequences of actions in RGB-D videos

Science.gov (United States)

Jardim, David; Nunes, Luís.; Dias, Miguel

2017-03-01

In our daily activities we perform prediction or anticipation when interacting with other humans or with objects. Prediction of human activity made by computers has several potential applications: surveillance systems, human computer interfaces, sports video analysis, human-robot-collaboration, games and health-care. We propose a system capable of recognizing and predicting human actions using supervised classifiers trained with automatically labeled data evaluated in our human activity RGB-D dataset (recorded with a Kinect sensor) and using only the position of the main skeleton joints to extract features. Using conditional random fields (CRFs) to model the sequential nature of actions in a sequence has been used before, but where other approaches try to predict an outcome or anticipate ahead in time (seconds), we try to predict what will be the next action of a subject. Our results show an activity prediction accuracy of 89.9% using an automatically labeled dataset.

A cost-effective structure of a centralized-light-source WDM-PON utilizing inverse-duobinary-RZ downstream and DPSK upstream

International Nuclear Information System (INIS)

Chen Long-Quan; Qiao Yao-Jun; Ji Yue-Feng

2013-01-01

In this paper, we propose a new structure of a centralized-light-source wavelength division multiplexed passive optical network (WDM-PON) utilizing inverse-duobinary-return-to-zero (inverse-duobinary-RZ) downstream and DPSK upstream. It reuses downstream light for the upstream modulation, which retrenches lasers assembled at each optical network unit (ONU), and ultimately cuts down the cost of ONUs a great deal. Meanwhile, a 50-km-reach WDM-PON experiment with 10-Gb/s inverse-duobinary-RZ downstream and 6-Gb/s DPSK upstream is demonstrated here. It is revealed to be a novel cost-effective alternative for the next generation access network. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Risk assessment in the upstream crude oil supply chain: Leveraging analytic hierarchy process

Science.gov (United States)

Briggs, Charles Awoala

For an organization to be successful, an effective strategy is required, and if implemented appropriately the strategy will result in a sustainable competitive advantage. The importance of decision making in the oil industry is reflected in the magnitude and nature of the industry. Specific features of the oil industry supply chain, such as its longer chain, the complexity of its transportation system, its complex production and storage processes, etc., pose challenges to its effective management. Hence, understanding the risks, the risk sources, and their potential impacts on the oil industry's operations will be helpful in proposing a risk management model for the upstream oil supply chain. The risk-based model in this research uses a three-level analytic hierarchy process (AHP), a multiple-attribute decision-making technique, to underline the importance of risk analysis and risk management in the upstream crude oil supply chain. Level 1 represents the overall goal of risk management; Level 2 is comprised of the various risk factors; and Level 3 represents the alternative criteria of the decision maker as indicated on the hierarchical structure of the crude oil supply chain. Several risk management experts from different oil companies around the world were surveyed, and six major types of supply chain risks were identified: (1) exploration and production, (2) environmental and regulatory compliance, (3) transportation, (4) availability of oil, (5) geopolitical, and (6) reputational. Also identified are the preferred methods of managing risks which include; (1) accept and control the risks, (2) avoid the risk by stopping the activity, or (3) transfer or share the risks to other companies or insurers. The results from the survey indicate that the most important risk to manage is transportation risk with a priority of .263, followed by exploration/production with priority of .198, with an overall inconsistency of .03. With respect to major objectives the most

"Upstream Thinking": the catchment management approach of a water provider

Science.gov (United States)

Grand-Clement, E.; Ross, M.; Smith, D.; Anderson, K.; Luscombe, D.; Le Feuvre, N.; Brazier, R. E.

2012-04-01

Human activities have large impacts on water quality and provision. Water companies throughout the UK are faced with the consequences of poor land management and need to find appropriate solutions to decreasing water quality. This is particularly true in the South West of England, where 93% of the drinking water is sourced from rivers and reservoirs: large areas of drained peatlands (i.e. Exmoor and Dartmoor National Parks) are responsible for a significant input of dissolved organic carbon (DOC) discolouring the water, whilst poorly managed farming activities can lead to diffuse pollution. Alongside the direct environmental implications, poor water quality is partly increasing water treatment costs and will drive significant future investment in additional water treatment, with further repercussions on customers. This highlights the need for water companies throughout the UK, and further afield, to be more involved in catchment management. "Upstream Thinking" is South West Water's (SWW) approach to catchment management, where working with stakeholders to improve water quality upstream aims to avoid increasingly costly solutions downstream. This approach has led the company to invest in two major areas of work: (1) The Farmland programme where problematic farm management practices and potential solutions are identified, typically 40% of the required investment is then offered in exchange for a legal undertaking to maintain the new farm assets in good condition for 25 years; (2) The Mires programme which involves heavy investment in peatland restoration through the blocking of open ditches in order to improve water storage and quality in the long term. From these two projects, it has been clear that stakeholder involvement of groups such as local farmers, the Westcountry Rivers Trust, the Exmoor National Park Authority, the Environment Agency, Natural England and the Exmoor Society is essential, first because it draws in catchment improvement expertise which is not

Small-World Optimization Algorithm and Its Application in a Sequencing Problem of Painted Body Storage in a Car Company

Directory of Open Access Journals (Sweden)

Tian Zhipeng

2015-01-01

Full Text Available In the car company, the painted body storage (PBS is set up between the paint shop and the assembly shop. It stores the vehicles in production and reorders the vehicles sequence. To improve production efficiency of assembly shop, a mathematical model is developed aiming at minimizing the consumption rate of options and the total overtime and idle time. As the PBS sequencing process contains upstream sequence inbound and downstream sequence outbound, this paper proposes an algorithm with two phases. In the first phase, the discrete small-world optimization algorithm (DSWOA is applied to schedule the inbound sequence by employing the short-range nodes and the long-range nodes in order to realize the global searching. In the second phase, the heuristic algorithm is applied to schedule the outbound sequencing. The proposed model and algorithm are applied in an automobile enterprise. The results indicate that the two-phase algorithm is suitable for the PBS sequencing problem and the DSWOA has a better searching performance than GA in this problem. The sensitivity of model parameters is analyzed as well.

Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

Directory of Open Access Journals (Sweden)

Luis V. Rodríguez-Durán

2011-01-01

Full Text Available Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

Novel strategies for upstream and downstream processing of tannin acyl hydrolase.

Science.gov (United States)

Rodríguez-Durán, Luis V; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N

2011-01-01

Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

Antimicrobial Activity of Truncated and Polyvalent Peptides Derived from the FKCRRQWQWRMKKGLA Sequence against Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923

Directory of Open Access Journals (Sweden)

Nataly de Jesús Huertas

2017-06-01

Full Text Available Peptides derived from LfcinB were designed and synthesized, and their antibacterial activity was tested against Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923. Specifically, a peptide library was constructed by systemically removing the flanking residues (N or C-terminal of Lfcin 17–31 (17FKCRRWQWRMKKLGA31, maintaining in all peptides the 20RRWQWR25 sequence that corresponds to the minimal antimicrobial motif. For this research, also included were (i a peptide containing an Ala instead of Cys ([Ala19]-LfcinB 17–31 and (ii polyvalent peptides containing the RRWQWR sequence and a non-natural amino acid (aminocaproic acid. We established that the lineal peptides LfcinB 17–25 and LfcinB 17–26 exhibited the greatest activity against E. coli ATCC 25922 and S. aureus ATCC 25923, respectively. On the other hand, polyvalent peptides, a dimer and a tetramer, exhibited the greatest antibacterial activity, indicating that multiple copies of the sequence increase the activity. Our results suggest that the dimeric and tetrameric sequence forms potentiate the antibacterial activity of lineal sequences that have exhibited moderate antibacterial activity.

Upstream Disaster Management to Support People Experiencing Homelessness.

Science.gov (United States)

Sundareswaran, Madura; Ghazzawi, Andrea; O'Sullivan, Tracey L

2015-08-18

The unique context of day-to-day living for people who are chronically homeless or living with housing insecurity puts them at high risk during community disasters. The impacts of extreme events, such as flooding, storms, riots, and other sources of community disruption, underscore the importance of preparedness efforts and fostering community resilience. This study is part of larger initiative focused on enhancing resilience and preparedness among high risk populations. The purpose of this study was to explore critical issues and strategies to promote resilience and disaster preparedness among people who are homeless in Canada. A sample of interviews (n=21) from key informants across Canada was analyzed to explore existing programs and supports for homeless populations. The data was selected from a larger sample of (n=43) interviews focused on programs and supports for people who are at heightened risk for negative impacts during disasters. Qualitative content analysis was used to extract emergent themes and develop a model of multi-level collaboration to support disaster resilience among people who are homeless. The results indicate there is a need for more upstream continuity planning, collaboration and communication between the emergency management sector and community service organizations that support people who are homeless. Prioritization and investment in the social determinants of health and community supports is necessary to promote resilience among this high-risk population. The findings from this study highlight the importance of acknowledging community support organizations as assets in disaster preparedness. Day-to-day resilience is an ongoing theme for people who are chronically homeless or living with housing insecurity. Upstream investment to build adaptive capacity and collaborate with community organizations is an important strategy to enhance community resilience.

Upstream particles observed in the earth's foreshock region

International Nuclear Information System (INIS)

Eastman, T.E.; Anderson, R.R.; Frank, L.A.; Parks, G.K.

1981-01-01

On the basis of primarily an extensive study of fully three-dimensional plasma data, we describe the interrelationships of the upstream particles and plasma waves observed in the earth's foreshock region. The University of Iowa LEPEDEAs detect ions and electrons from 1 eV to 45 keV over all except approx.2% of the unit sphere. Comparisons are made with high time resolution particle data obtained by the University of California (Berkeley) instruments and plasma wave data collected by the University of Iowa plasma wave instruments on the two ISEE spacecraft. The presence of ion beams or dispersed ion distributions is found to be a sufficient condition for the presence of electrostatic and electromagnetic wave emissions. Detailed correlations of ions with plasma waves down to a tenth of an ion gyroperiod indicate that ion acoustic emission is enhanced when increased anisotropies and gyrophase organization are observed. Time aliasing effects limit the interpretation of velocity distributions taken within the foreshock region. High time resolution correlations between the different instruments, however, demonstrate that time variations of a single isotropic or anisotropic distribution cannot produce the dispersed ion distributions. Detailed analysis of high time resolution data reveals that the upstream particles undergo significant spatial and temporal variations including gyrophase organization. Gyrophase organization comprises groups of ion clusters each one of which includes ions with similar pitch angles that gyrate together about a common guiding center. On the basis of our high time resolution analysis of three-dimensional plasma data combined with magnetic field and plasma wave data, we conclude that (1) ions observed in the foreshock region display gyrophase organization produced by ion clusters with a spatial scale <1 R/sub g/, and (2) dispersed ion distributions are produced primarily by direct sources at or near the bow shock

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

Science.gov (United States)

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean

Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

International Nuclear Information System (INIS)

Sassone-Corsi, P.; Borrelli, E.

1987-01-01

The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

DEVELOPMENT OF A VIRTUAL INTELLIGENCE TECHNIQUE FOR THE UPSTREAM OIL INDUSTRY

Energy Technology Data Exchange (ETDEWEB)

Iraj A. Salehi; Shahab D. Mohaghegh; Samuel Ameri

2004-09-01

The objective of the research and development work reported in this document was to develop a Virtual Intelligence Technique for optimization of the Preferred Upstream Management Practices (PUMP) for the upstream oil industry. The work included the development of a software tool for identification and optimization of the most influential parameters in upstream common practices as well as geological, geophysical and reservoir engineering studies. The work was performed in cooperation with three independent producing companies--Newfield Exploration, Chesapeake Energy, and Triad Energy--operating in the Golden Trend, Oklahoma. In order to protect data confidentiality, these companies are referred to as Company One, Two, Three in a randomly selected order. These producing companies provided geological, completion, and production data on 320 wells and participated in frequent technical discussions throughout the project. Research and development work was performed by Gas Technology Institute (GTI), West Virginia University (WVU), and Intelligent Solutions Inc. (ISI). Oklahoma Independent Petroleum Association (OIPA) participated in technology transfer and data acquisition efforts. Deliverables from the project are the present final report and a user-friendly software package (Appendix D) with two distinct functions: a characterization tool that identifies the most influential parameters in the upstream operations, and an optimization tool that seeks optimization by varying a number of influential parameters and investigating the coupled effects of these variations. The electronic version of this report is also included in Appendix D. The Golden Trend data were used for the first cut optimization of completion procedures. In the subsequent step, results from soft computing runs were used as the guide for detailed geophysical and reservoir engineering studies that characterize the cause-and-effect relationships between various parameters. The general workflow and the main

Application of SCALE 6.1 MAVRIC Sequence for Activation Calculation in Reactor Primary Shield Concrete

International Nuclear Information System (INIS)

Kim, Yong IL

2014-01-01

Activation calculation requires flux information at desired location and reaction cross sections for the constituent elements to obtain production rate of activation products. Generally it is not an easy task to obtain fluxes or reaction rates with low uncertainties in a reasonable time for deep penetration problems by using standard Monte Carlo methods. The MAVRIC (Monaco with Automated Variance Reduction using Importance Calculations) sequence in SCALE 6.1 code package is intended to perform radiation transport on problems that are too challenging for standard, unbiased Monte Carlo methods. And the SCALE code system provides plenty of ENDF reaction types enough to consider almost all activation reactions in the nuclear reactor materials. To evaluate the activation of the important isotopes in primary shield, SCALE 6.1 MAVRIC sequence has been utilized for the KSNP reactor model and the calculated results are compared to the isotopic activity concentration of related standard. Related to the planning for decommission, the activation products in concrete primary shield such as Fe-55, Co-60, Ba-133, Eu-152, and Eu-154 are identified as important elements according to the comparisons with related standard for exemption. In this study, reference data are used for the concrete compositions in the activation calculation to see the applicability of MAVRIC code to the evaluation of activation inventory in the concrete primary shield. The composition data of trace elements as shown in Table 1 are obtained from various US power plant sites and accordingly they have large variations in quantity due to the characteristics of concrete composition. In practical estimation of activation radioactivity for a specific plant related to decommissioning, rigorous chemical analysis of concrete samples of the plant would first have to be performed to get exact information for compositions of concrete. Considering the capability of solving deep penetration transport problems and richness

Independents in European Gas Markets after liberalisation - downstream integration of upstream oil and gas companies

International Nuclear Information System (INIS)

Eikeland, Per Ove

2005-01-01

A central objective of gas market liberalisation in Europe in the 1990s was to increase competition by opening end-use markets for independent suppliers. Upstream oil and gas companies in Europe reacted to this opportunity by announcing strategies to integrate forward in European gas markets. By late 2004, however, upstream companies still recorded generally weak downstream strategy implementation in Europe. The article concludes that this general implementation gap should be explained by political failure in EU member states to abolish gas market barriers to entry for independents. Variation between companies in degree of implementation should be explained by variation in conditions in the companies' home markets / wider business spheres and internal company factors. (Author)

Performance of upstream interaction region detectors for the FIRST experiment at GSI

CERN Document Server

Abou-Haidar, Z; Alvarez, M A G; Anelli, M; Aumann, T; Battistoni, G; Bocci, A; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cirrone, G A P; Cortes-Giraldo, M A; Cuttone, G; De Napoli, M; Durante, M; Fernandez-Garcia, J P; Finck, C; Gallardo, M I; Golosio, B; Iarocci, E; Iazzi, F; Ickert, G; Introzzi, R; Juliani, D; Krimmer, J; Kurz, N; Labalme, M; Leifels, Y; Le Fevre, A; Leray, S; Marchetto, F; Monaco, V; Morone, M C; Oliva, P; Paoloni, A; Patera, V; Piersanti, L; Pleskac, R; Quesada, J M; Randazzo, N; Romano, F; Rossi, D; Rosso, V; Rousseau, M; Sacchi, R; Sala, P; Sarti, A; Schuy, C; Sciubba, A; Sfienti, C; Simon, H; Sipala, V; Spiriti, E; Stuttge, L; Tropea, S; Younis, H

2012-01-01

The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at GSI has been designed to study carbon fragmentation, measuring (12)C double differential cross sections (- (2)I /- - E) for different beam energies between 100 and 1000 MeV/u. The experimental setup integrates newly designed detectors in the, so called, Interaction Region around the graphite target. The Interaction Region upstream detectors are a 250 mum thick scintillator and a drift chamber optimized for a precise measurement of the ions interaction time and position on the target. In this article we review the design of the upstream detectors along with the preliminary results of the data taking performed on August 2011 with 400 MeV/u fully stripped carbon ion beam at GSI. Detectors performances will be reviewed and compared to those obtained during preliminary tests, performed with 500 MeV electrons (at the BTF facility in the INFN Frascati Laboratories) and 80 MeV/u protons and carbon ions (at the INFN LNS Laboratories in Cata...

Influence of upstream stator on rotor flutter stability in a low pressure steam turbine stage

Energy Technology Data Exchange (ETDEWEB)

Huang, X.; He, L. [University of Durham (United Kingdom). School of Engineering; Bell, D. [ALSTOM Power Ltd., Rugby (United Kingdom)

2006-07-01

Conventional blade flutter prediction is normally based on an isolated blade row model, however, little is known about the influence of adjacent blade rows. In this article, an investigation is presented into the influence of the upstream stator row on the aero-elastic stability of rotor blades in the last stage of a low pressure (LP) steam turbine. The influence of the upstream blade row is computed directly by a time-marching, unsteady, Navier-Stokes flow solver in a stator-rotor coupled computational domain. The three-dimensional flutter solution is obtained, with adequate mesh resolution, in a single passage domain through application of the Fourier-Transform based Shape-Correction method. The capability of this single-passage method is examined through comparison with predictions obtained from a complete annulus model, and the results demonstrate a good level of accuracy, while achieving a speed up factor of 25. The present work shows that the upstream stator blade row can significantly change the aero-elastic behaviour of an LP steam turbine rotor. Caution is, therefore, advised when using an isolated blade row model for blade flutter prediction. The results presented also indicated that the intra-row interaction is of a strong three-dimensional nature. (author)

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

Science.gov (United States)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Identification of putative regulatory upstream ORFs in the yeast genome using heuristics and evolutionary conservation

Directory of Open Access Journals (Sweden)

Bilsland Elizabeth

2007-08-01

Full Text Available Abstract Background The translational efficiency of an mRNA can be modulated by upstream open reading frames (uORFs present in certain genes. A uORF can attenuate translation of the main ORF by interfering with translational reinitiation at the main start codon. uORFs also occur by chance in the genome, in which case they do not have a regulatory role. Since the sequence determinants for functional uORFs are not understood, it is difficult to discriminate functional from spurious uORFs by sequence analysis. Results We have used comparative genomics to identify novel uORFs in yeast with a high likelihood of having a translational regulatory role. We examined uORFs, previously shown to play a role in regulation of translation in Saccharomyces cerevisiae, for evolutionary conservation within seven Saccharomyces species. Inspection of the set of conserved uORFs yielded the following three characteristics useful for discrimination of functional from spurious uORFs: a length between 4 and 6 codons, a distance from the start of the main ORF between 50 and 150 nucleotides, and finally a lack of overlap with, and clear separation from, neighbouring uORFs. These derived rules are inherently associated with uORFs with properties similar to the GCN4 locus, and may not detect most uORFs of other types. uORFs with high scores based on these rules showed a much higher evolutionary conservation than randomly selected uORFs. In a genome-wide scan in S. cerevisiae, we found 34 conserved uORFs from 32 genes that we predict to be functional; subsequent analysis showed the majority of these to be located within transcripts. A total of 252 genes were found containing conserved uORFs with properties indicative of a functional role; all but 7 are novel. Functional content analysis of this set identified an overrepresentation of genes involved in transcriptional control and development. Conclusion Evolutionary conservation of uORFs in yeasts can be traced up to 100

Pattern recognition in complex activity travel patterns : comparison of Euclidean distance, signal-processing theoretical, and multidimensional sequence alignment methods

NARCIS (Netherlands)

Joh, C.H.; Arentze, T.A.; Timmermans, H.J.P.

2001-01-01

The application of a multidimensional sequence alignment method for classifying activity travel patterns is reported. The method was developed as an alternative to the existing classification methods suggested in the transportation literature. The relevance of the multidimensional sequence alignment

Upstream migration of Pacific lampreys in the John Day River, Oregon: Behavior, timing, and habitat use

Science.gov (United States)

Robinson, T. Craig; Bayer, J.M.

2005-01-01

Adult Pacific lamprey migration and habitat preferences for over-winter holding and spawning, and larval rearing in tributaries to the Columbia River are not well understood. The John Day River is one such tributary where larval and adult stages of this species have been documented, and its free-flowing character provided the opportunity to study migration of Pacific lampreys unimpeded by passage constraints. Forty-two adult Pacific lampreys were captured in the John Day River near its mouth during their upstream migration. Pacific lampreys were surgically implanted with radio transmitters and released onsite, and tracked by fixed-site, aerial, and terrestrial telemetry methods for nearly one year. Adults moved upstream exclusively at night, with a mean rate of 11.1 ?? 6.3 km/day. They halted upstream migration by September, and held a single position for approximately six months in the lateral margins of riffles and glides, using boulders for cover. More than half of Pacific lampreys resumed migration in March before ending movement in early May. Pacific lampreys that resumed migration in spring completed a median of 87% of their upstream migration before over-winter holding. Upon completing migration. Pacific lampreys briefly held position before beginning downstream movement at the end of May. Though not directly observed, halting migration and movement downstream were likely the result of spawning and death. Gains in adult Pacific lamprey passage through the Columbia River hydrosystem and tributaries may be made by improvements that would expedite migration during spring and summer and increase the quantity and variety of cover and refuge opportunities. ?? 2005 by the Northwest Scientific Association. All rights reserved.

Influence of upstream disturbance on the draft-tube flow of Francis turbine under part-load conditions

Science.gov (United States)

Chen, Ting; Zheng, Xianghao; Zhang, Yu-ning; Li, Shengcai

2018-02-01

Owing to the part-load operations for the enhancement of grid flexibility, the Francis turbine often suffers from severe low-frequency and large-amplitude hydraulic instability, which is mostly pertinent to the highly unsteady swirling vortex rope in the draft tube. The influence of disturbances in the upstream (e.g., large-scale vortex structures in the spiral casing) on the draft-tube vortex flow is not well understood yet. In the present paper, the influence of the upstream disturbances on the vortical flow in the draft tube is studied based on the vortex identification method and the analysis of several important parameters (e.g., the swirl number and the velocity profile). For a small guide vane opening (representing the part-load condition), the vortices triggered in the spiral casing propagate downstream and significantly affect the swirling vortex-rope precession in the draft tube, leading to the changes of the intensity and the processional frequency of the swirling vortex rope. When the guide vane opening approaches the optimum one (representing the full-load condition), the upstream disturbance becomes weaker and thus its influences on the downstream flow are very limited.

A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

OpenAIRE

Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

1989-01-01

The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...

SAP and life-cycle management in the upstream

International Nuclear Information System (INIS)

Davis, B.

1997-01-01

Business relationships today depend more than ever on changing alliances and partnerships to leverage risk in a commodity market. SAP is a fully integrated, enterprise-wide software system that uses business processes tightly integrated around a common data model to facilitate these business relationships across the oil and gas supply chain. The SAP modules contain the business processes that are needed to handle the logistics and operations maintenance for operating an oil or gas field. Each industry has unique business-process requirements that the core SAP application set may not cover. In the oil and gas business, there are unique financial requirements in the upstream for working in joint ventures. In the downstream business segment, handling bulk hydrocarbons requires additional functionality

Differential expression of upstream stimulatory factor (USF 2 variants in eutopic endometria from women with endometriosis: estradiol regulation

Directory of Open Access Journals (Sweden)

Jazmin Castro

2015-01-01

Full Text Available BACKGROUND: Endometriosis, pro-inflammatory and invasive benign disease estrogen dependent, abnormally express in endometria the enzyme P450Arom, positively regulated by steroid factor-1 (SF-1. Our objective was to study the nuclear protein contents of upstream stimulating factor 2 (USF2a and USF2b, a positive regulator of SF-1, throughout the menstrual cycle in eutopic endometria from women with and without (control endometriosis and the involvement of nuclear estrogen receptors (ER and G-coupled protein estrogen receptor (GPER-1 RESULTS: Upstream stimulating factor 2 protein contents were higher in mid (USF2b and late (USF2a and USF2b secretory phase in eutopic endometria from endometriosis than control (p < 0.05. In isolated control epithelial cells incubated with E2 and PGE2, to resemble the endometriosis condition, the data showed: (a significant increase of USF2a and USF2b nuclear protein contents when treated with E2, PPT (specific agonist for ERa or G1 (specific agonist for GPER1; (b no increase in USF2 binding to SF-1 E-Box/DNA consensus sequence in E2-treated cells; (c USF2 variants protein contents were not modified by PGE2; (d SF-1 nuclear protein content was significantly higher than basal when treated with PGE2, E2 or G1, stimulation unaffected by ICI (nuclear ER antagonist; and (e increased (p < 0.05 cytosolic protein contents of P450Arom when treated with PGE2, E2, PPT or G1 compared to basal, effect that was additive with E2 + PGE2 together. Nevertheless, in endometriosis cells, the high USF2, SF-1 and P450Arom protein contents in basal condition were unmodified CONCLUSION: These data strongly suggest that USF2 variants and P450Arom are regulated by E2 through ERa and GPER1, whereas SF-1 through GPER1, visualized by the response of the cells obtained from control endometria, being unaffected the endogenously stimulated cells from endometriosis origin. The lack of E2 stimulation on USF2/SF-1 E-Box/DNA-sequence binding and the

Is sequence awareness mandatory for perceptual sequence learning: An assessment using a pure perceptual sequence learning design.

Science.gov (United States)

Deroost, Natacha; Coomans, Daphné

2018-02-01

We examined the role of sequence awareness in a pure perceptual sequence learning design. Participants had to react to the target's colour that changed according to a perceptual sequence. By varying the mapping of the target's colour onto the response keys, motor responses changed randomly. The effect of sequence awareness on perceptual sequence learning was determined by manipulating the learning instructions (explicit versus implicit) and assessing the amount of sequence awareness after the experiment. In the explicit instruction condition (n = 15), participants were instructed to intentionally search for the colour sequence, whereas in the implicit instruction condition (n = 15), they were left uninformed about the sequenced nature of the task. Sequence awareness after the sequence learning task was tested by means of a questionnaire and the process-dissociation-procedure. The results showed that the instruction manipulation had no effect on the amount of perceptual sequence learning. Based on their report to have actively applied their sequence knowledge during the experiment, participants were subsequently regrouped in a sequence strategy group (n = 14, of which 4 participants from the implicit instruction condition and 10 participants from the explicit instruction condition) and a no-sequence strategy group (n = 16, of which 11 participants from the implicit instruction condition and 5 participants from the explicit instruction condition). Only participants of the sequence strategy group showed reliable perceptual sequence learning and sequence awareness. These results indicate that perceptual sequence learning depends upon the continuous employment of strategic cognitive control processes on sequence knowledge. Sequence awareness is suggested to be a necessary but not sufficient condition for perceptual learning to take place. Copyright © 2018 Elsevier B.V. All rights reserved.

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data.

Science.gov (United States)

Nuel, Gregory; Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

2010-01-26

In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of

Combining Amplification Typing of L1 Active Subfamilies (ATLAS) with High-Throughput Sequencing.

Science.gov (United States)

Rahbari, Raheleh; Badge, Richard M

2016-01-01

With the advent of new generations of high-throughput sequencing technologies, the catalog of human genome variants created by retrotransposon activity is expanding rapidly. However, despite these advances in describing L1 diversity and the fact that L1 must retrotranspose in the germline or prior to germline partitioning to be evolutionarily successful, direct assessment of de novo L1 retrotransposition in the germline or early embryogenesis has not been achieved for endogenous L1 elements. A direct study of de novo L1 retrotransposition into susceptible loci within sperm DNA (Freeman et al., Hum Mutat 32(8):978-988, 2011) suggested that the rate of L1 retrotransposition in the germline is much lower than previously estimated (ATLAS L1 display technique (Badge et al., Am J Hum Genet 72(4):823-838, 2003) to investigate de novo L1 retrotransposition in human genomes. In this chapter, we describe how we combined a high-coverage ATLAS variant with high-throughput sequencing, achieving 11-25× sequence depth per single amplicon, to study L1 retrotransposition in whole genome amplified (WGA) DNAs.

A barrier to upstream migration in the fish passage of Itaipu Dam (Canal da Piracema), Paraná River basin

Science.gov (United States)

,; Fontes Júnior, Hélio Martins; Makrakis, Sergio; Gomes, Luiz Carlos; Latini, João Dirço

2012-01-01

The majority of the fish passages built in the Neotropical region are characterised by low efficiency and high selectivity; in many cases, the benefits to fish populations are uncertain. Studies conducted in the Canal da Piracema at Itaipu dam on the Parana River indicate that the system component designated as the Discharge channel in the Bela Vista River (herein named Canal de deságue no rio Bela Vista or CABV), a 200 m long technical section, was the main barrier to the upstream migration. The aim of this study was to evaluate the degree of restriction imposed by the CABV on upstream movements of Prochilodus lineatus and Leporinus elongatus, Characiformes. Fish were tagged with passive integrated transponders (PIT tags) and released both downstream and upstream of this critical section. Individuals of both species released downstream of the CABV took much more time to reach the upper end of the system (43.6 days vs. 15.9 days), and passed in much lower proportions (18% vs. 60.8%) than those tagged upstream of this component. Although more work is needed to differentiate between fishway effects and natural variation in migratory motivation, the results clearly demonstrate passage problems at the CABV.

Comparison of Muscle Onset Activation Sequences between a Golf or Tennis Swing and Common Training Exercises Using Surface Electromyography: A Pilot Study

Directory of Open Access Journals (Sweden)

John M. Vasudevan

2016-01-01

Full Text Available Aim. The purpose of this pilot study is to use surface electromyography to determine an individual athlete’s typical muscle onset activation sequence when performing a golf or tennis forward swing and to use the method to assess to what degree the sequence is reproduced with common conditioning exercises and a machine designed for this purpose. Methods. Data for 18 healthy male subjects were collected for 15 muscles of the trunk and lower extremities. Data were filtered and processed to determine the average onset of muscle activation for each motion. A Spearman correlation estimated congruence of activation order between the swing and each exercise. Correlations of each group were pooled with 95% confidence intervals using a random effects meta-analytic strategy. Results. The averaged sequences differed among each athlete tested, but pooled correlations demonstrated a positive association between each exercise and the participants’ natural muscle onset activation sequence. Conclusion. The selected training exercises and Turning Point™ device all partially reproduced our athletes’ averaged muscle onset activation sequences for both sports. The results support consideration of a larger, adequately powered study using this method to quantify to what degree each of the selected exercises is appropriate for use in both golf and tennis.

Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

Science.gov (United States)

1976-11-01

periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

Science.gov (United States)

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Long-term oil strategy - creating an appropriate fiscal regime in OPEC countries to keep the upstream sector competitive

International Nuclear Information System (INIS)

Olorunfemi, M.A.

1992-01-01

The focus of this paper is to examine the factors that governed the upstream activities in OPEC countries during three distinct periods, namely: 1950 to 1973, 1974 to 1985 and 1986 to the present. Particular emphasis will be placed on the fiscal and legal instruments adopted by a number of OPEC countries in attracting oil companies to their respective countries, so as to maintain the momentum of oil exploration and production which is commensurate with their huge hydrocarbon reserves and also be in consonance with their pace of economic development while continuing to exercise their sovereign rights. The first part of the paper reviews the concepts governing the strategic behaviour of oil companies and oil-producing countries. Part two is devoted to the evolution of fiscal regimes in OPEC countries showing how the behaviour of OPEC Member Countries and oil companies illustrates the concepts in part one. How the dynamics of the oil market influence the upstream planning in OPEC Member Countries is examined in part three of the paper. Part four looks at the new cooperation and strategic alliances that are evolving between some OPEC countries and a number of oil companies to ensure that OPEC retains a leadership position which is commensurate with its Members' hydrocarbon resources. Conclusions are drawn in part five. (author)

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

MAVEN Observation of an Obliquely Propagating Low-Frequency Wave Upstream of Mars

Science.gov (United States)

Ruhunusiri, Suranga; Halekas, J. S.; Connerney, J. E. P.; Espley, J. R.; McFadden, J. P.; Mazelle, C.; Brain, D.; Collinson, G.; Harada, Y.; Larson, D. E.;

Coordination in the upstream supply chain of the Dutch railway sector : a research agenda

NARCIS (Netherlands)

Schlicher, L.P.J.; Slikker, M.; van Houtum, G.J.J.A.N.; Pombo, J.

2016-01-01

In this paper, we present a research agenda which identifies three research directions for the upstream supply chain of the Dutch railway sector. The first research direction focusses on coordination of spare parts with criticality differences and related allocations of potential cost savings

ULF Waves Upstream from Planetary Bow Shocks: Application to the Interball-Tail Observations at the Earth

International Nuclear Information System (INIS)

Trotignon, J.G.; Rauch, J.L.; Klimov, S.; Nozdrachev, M.; Romanov, S.; Savin, S.; Skalsky, A.; Blecki, J.; Juchniewicz, J.; Amata, E.

1999-01-01

One of the outstanding problems in solar system plasma physics is the morphology of planetary and cometary foreshocks. A large variety of electron and ion velocity distribution functions, as well as electrostatic and electromagnetic waves phenomena, are indeed currently observed in these regions located upstream from, and magnetically connected to, bow shocks. Foreshocks being complex and highly dynamic, it is not easy to get a comprehensive description of them. Nevertheless, simple geometrical considerations can be of help to order foreshock structures. In light of the great number of results obtained in planetary foreshocks, which are briefly reviewed, we present an ongoing study of the upstream waves observed by the INTERBALL-TAIL magnetometers in the Ultra Low Frequency range. (author)

Upstream from OPERA: extreme attention to detail

CERN Multimedia

CERN Bulletin

2011-01-01

Two weeks ago, at a seminar held at CERN, the OPERA collaboration revealed their astonishing observation: neutrinos might move faster than light. The finding is currently under scrutiny in the scientific community. While the result downstream at Gran Sasso speaks for itself, upstream at CERN things are no less intriguing, with high-tech GPS systems, novel techniques for accurately measuring the time, and unique ways keeping the initial particle beam stable. Take away one ingredient and the accuracy needed for the final measurement is spoiled.   Underground installations of the CERN Neutrinos to Gran Sasso (CNGS) project. First ingredient: a stable beam CERN produces neutrinos by sending a beam of protons to hit a target. The collisions produce a secondary beam, which mostly consists of pions and kaons that decay in flight within an evacuated tunnel. Their decay products are muons and muon-neutrinos. An absorber stops the pions and kaons that do not decay, while the resulting muons are absorb...

From Worker Health To Citizen Health: Moving Upstream

Science.gov (United States)

Sepulveda, Martin-Jose

2014-01-01

New rapid growth economies, urbanization, health systems crises and “big data” are causing fundamental changes in social structures and systems including health. These forces for change have significant consequences for occupational and environmental medicine and will challenge the specialty to think beyond workers and workplaces as the principal locus of innovation for health and performance. These trends are placing great emphasis on upstream strategies for addressing the complex systems dynamics of the social determinants of health. The need to engage systems in communities for healthier workforces is a shift in orientation from worker and workplace centric to citizen and community centric. This change for occupational and environmental medicine requires extending systems approaches in the workplace to communities which are systems of systems and which require different skills, data, tools and partnerships. PMID:24284749

Ions upstream of the earth's bow shock: a theoretical comparison of alternative source populations

International Nuclear Information System (INIS)

Schwartz, S.J.; Thomsen, M.F.; Gosling, J.T.

1983-01-01

A theoretical framework is developed for studying trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field. We include the effects of a sharp shock potential rise. Expressions are derived for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field: the appropriate equations are also provided to transform these motions back to the observer's frame. The utility of these expressions is illustrated by comparing the predicted upstream motions for four different source models for upstream ions: magnetic moment-conserving reflection of the solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal. This comparison reveals that, for identical geometries, the reflection models produce higher energies and/or gyromotion than do the leakage models. We further argue that in a single simple encounter with the shock, an ion should behave in an unmagnetized manner and hence should not conserve its magnetic moment. Conservation of magnetic moment, if it is to occur, would seem to require multiple encounters with the shock. We investigate the conditions under which such multiple encounters can occur and find that under most quasi-parallel geometries neither leaked nor reflected ions should probably conserve their magnetic moments

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

Science.gov (United States)

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

Bidirectional 3.125 Gbps downstream / 2 Gbps upstream impulse radio ultrawide-band (UWB) over combined fiber and wireless link

DEFF Research Database (Denmark)

Jensen, Jesper Bevensee; Gibbon, Timothy Braidwood; Yu, Xianbin

2010-01-01

We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors.......We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors....

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

Science.gov (United States)

May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

2017-04-15

To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil.

Directory of Open Access Journals (Sweden)

Claire L Donald

2016-10-01

Full Text Available The outbreak of Zika virus (ZIKV in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions.We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action.The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions.

Enhancement of the Enterocin CRL35 Activity by a Synthetic Peptide Derived from the NH2-Terminal Sequence

Science.gov (United States)

Saavedra, Lucila; Minahk, Carlos; de Ruiz Holgado, Aída P.; Sesma, Fernando

2004-01-01

The enterocin CRL35 biosynthetic gene cluster was cloned and sequenced. The sequence was revealed to be highly identical to that of the mundticin KS gene cluster (S. Kawamoto, J. Shima, R. Sato, T. Eguchi, S. Ohmomo, J. Shibato, N. Horikoshi, K. Takeshita, and T. Sameshima, Appl. Environ. Microbiol. 68:3830-3840, 2002). Short synthetic peptides were designed based on the bacteriocin sequence and were evaluated in antimicrobial competitive assays. The peptide KYYGNGVSCNKKGCS produced an enhancement of enterocin CRL35 antimicrobial activity in a buffer system. PMID:15215149

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Is it a must to add upstream devices for high GVF multiphase

Energy Technology Data Exchange (ETDEWEB)

Dou, Jianwen; Guo, Jason; Gokulnath, R.

2005-07-01

High accuracies in measurement of the gross liquid and net oil flow rates at high GVF levels in the multiphase flow is identified as one of the most demanding needs of the industry, especially in high water cut environments. The underlying factor that decides the accuracy of the net oil flow rate measurement is the accuracy at which the gross liquid and water cut are measured and the prevailing water cut in the flow. It is an established fact that accuracies falter with increasing GVF in the multiphase flow. The purpose of this paper is to present the performance results of a newly developed Compact High GVF Haimo multiphase meter that addresses the above needs, without having to use an Upstream Separation Device for high GVF application while retaining the accuracies within +2% absolute for water cut and 10% relative for liquid and gas flow rates at 90% confidence level. while also optimising the footprint, the cost, the weight of the solution Further developmental work and trials are in progress to achieve the targeted accuracy levels under very high GVF conditions as well. Contents of the Paper:1) Definitions. 2) MFM 2000 + Upstream Separation Device. 3) Haimo's experience with upstream devices. 4) Motivation to develop the new Compact meter solution. 5) Description of the Compact solution. 6) Performance testing of the Compact solution in a third party test facility. 7) Conclusion and Benefit which are: The objective of working out a new solution for high GVF without having to use a Upstream Separation Device seem to have been achieved with excellent test results; The new configuration of Compact High GVF meter successfully met and exceeded its Acceptance criteria. The main objective was to asses its performance, confirm the quality of the measurements and check its compliance with the Accuracy specifications. The consistency of the absolute error on water cut much lower than 2% for the full range of the GVF and liquid flow rates re-establishes the

Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD

Science.gov (United States)

Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.

2016-12-01

The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.

Complete Sequence of p07-406, a 24,179-base-pair plasmid harboring the blaVIM-7 metallo-beta-lactamase gene in a Pseudomonas aeruginosa isolate from the United States.

Science.gov (United States)

Li, Hongyang; Toleman, Mark A; Bennett, Peter M; Jones, Ronald N; Walsh, Timothy R

2008-09-01

An outbreak involving a Pseudomonas aeruginosa strain that was resistant to all tested antimicrobials except polymyxin B occurred in a hospital in Houston, TX. Previous studies on this strain showed that it possesses a novel mobile metallo-beta-lactamase (MBL) gene, designated bla(VIM-7), located on a plasmid (p07-406). Here, we report the complete sequence, annotation, and functional characterization of this plasmid. p07-406 is 24,179 bp in length, and 29 open reading frames were identified related to known or putatively recognized proteins. Analysis of this plasmid showed it to be comprised of four distinct regions: (i) a region of 5,200 bp having a Tn501-like mercuric resistance (mer) transposon upstream of the replication region; (ii) a Tn3-like transposon carrying a truncated integron with a bla(VIM-7) gene and an insertion sequence inserted at the other end of this transposon; (iii) a region of four genes, upstream of the Tn3-like transposon, possessing very high similarity to plasmid pXcB from Xanthomonas campestris pv. citri commonly associated with plants; (iv) a backbone sequence similar to the backbone structure of the IncP group plasmid Rms149, pB10, and R751. This is the first plasmid to be sequenced carrying an MBL gene and highlights the amelioration of DNA segments from disparate origins, most noticeably from plant pathogens.

Polycyclic aromatic hydrocarbons in upstream riverine runoff of the Pearl River Delta, China: An assessment of regional input sources

International Nuclear Information System (INIS)

Zhang Kai; Liang Bo; Wang Jizhong; Guan Yufeng; Zeng, Eddy Y.

2012-01-01

Water samples collected from upstream tributaries of the Pearl River Delta (PRD) and from locations within the PRD (South China) were analyzed for 27 polycyclic aromatic hydrocarbons (PAHs). Average concentrations (aqueous plus particulate) of total 27 PAHs (Σ 27 PAH), 16 priority PAHs designated by the United States Environmental Protection Agency (USEPA) except naphthalene (Σ 15 PAH), and the seven carcinogenic PAHs (Σ 7 PAH) classified by the USEPA were 260 ± 410, 130 ± 310, and 15 ± 12 ng/L, respectively. Riverine PAHs were predominantly generated from coal and vegetation combustion, coke production, vehicle exhausts, and petroleum residues, accounting for 28%, 25%, 22% and 21%, respectively, on average. Upstream riverine fluxes of Σ 27 PAH and Σ 15 PAH amounted to 38.9 and 12.9 tons/year, respectively. The net contributions of Σ 27 PAH and Σ 15 PAH from sources within the PRD were estimated at 21.4 and 21.0 tons/year, respectively. - Highlights: ► Upstream PAH levels were lower than downstream PAHs and pose low ecological risk. ► Riverine PAHs are predominantly pyrogenic. ► Parent PAHs in Pearl River are mainly derived from within the PRD. ► The 15 priority PAHs were mainly generated within the Pearl River Delta. - The 15 priority PAHs are mainly generated within the PRD while the other 12 PAHs from upstream areas.

Combined effect of upstream surge chamber and sloping ceiling tailrace tunnel on dynamic performance of turbine regulating system of hydroelectric power plant

International Nuclear Information System (INIS)

Guo, Wencheng; Yang, Jiandong

2017-01-01

Highlights: • Nonlinear mathematical model and Hopf bifurcation analysis of turbine regulating system are presented. • Dynamic performance of turbine regulating system under 0.5 times Thoma sectional area is analyzed and a novel dynamic performance is revealed. • Relationship between two bifurcation lines and wave superposition is studied. • Combined effect mechanisms of upstream surge chamber and sloping ceiling tailrace tunnel on stability are revealed and optimization methods are proposed. - Abstract: Based on the nonlinear mathematical model of the turbine regulating system of hydroelectric power plant with upstream surge chamber and sloping ceiling tailrace tunnel and the Hopf bifurcation theory, this paper firstly studies the dynamic performance of the turbine regulating system under 0.5 times Thoma sectional area of surge chamber, and reveals a novel dynamic performance. Then, the relationship between the two bifurcation lines and the wave superposition of upstream surge chamber and sloping ceiling tailrace tunnel is analyzed. Finally, the effect mechanisms of the wave superposition on the system stability are investigated, and the methods to improve the system stability are proposed. The results indicate that: Under the combined effect of upstream surge chamber and sloping ceiling tailrace tunnel, the dynamic performance of the turbine regulating system of hydroelectric power plant shows an obvious difference on the two sides of the critical sectional area of surge chamber. There are two bifurcation lines for the condition of 0.5 times Thoma sectional area, i.e. Bifurcation line 1 and Bifurcation line 2, which represent the stability characteristics of the flow oscillation of “penstock-sloping ceiling tailrace tunnel” and the water-level fluctuation in upstream surge chamber, respectively. The stable domain of the system is determined by Bifurcation line 2. The effect of upstream surge chamber mainly depends on its sectional area, while the

Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

Science.gov (United States)

Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

2011-04-29

Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

Sequence-specific targeting of dosage compensation in Drosophila favors an active chromatin context.

Directory of Open Access Journals (Sweden)

Artyom A Alekseyenko

Full Text Available The Drosophila MSL complex mediates dosage compensation by increasing transcription of the single X chromosome in males approximately two-fold. This is accomplished through recognition of the X chromosome and subsequent acetylation of histone H4K16 on X-linked genes. Initial binding to the X is thought to occur at "entry sites" that contain a consensus sequence motif ("MSL recognition element" or MRE. However, this motif is only ∼2 fold enriched on X, and only a fraction of the motifs on X are initially targeted. Here we ask whether chromatin context could distinguish between utilized and non-utilized copies of the motif, by comparing their relative enrichment for histone modifications and chromosomal proteins mapped in the modENCODE project. Through a comparative analysis of the chromatin features in male S2 cells (which contain MSL complex and female Kc cells (which lack the complex, we find that the presence of active chromatin modifications, together with an elevated local GC content in the surrounding sequences, has strong predictive value for functional MSL entry sites, independent of MSL binding. We tested these sites for function in Kc cells by RNAi knockdown of Sxl, resulting in induction of MSL complex. We show that ectopic MSL expression in Kc cells leads to H4K16 acetylation around these sites and a relative increase in X chromosome transcription. Collectively, our results support a model in which a pre-existing active chromatin environment, coincident with H3K36me3, contributes to MSL entry site selection. The consequences of MSL targeting of the male X chromosome include increase in nucleosome lability, enrichment for H4K16 acetylation and JIL-1 kinase, and depletion of linker histone H1 on active X-linked genes. Our analysis can serve as a model for identifying chromatin and local sequence features that may contribute to selection of functional protein binding sites in the genome.

INDIRECT UPSTREAM EFFECTS OF DAMS: CONSEQUENCES OF MIGRATORY CONSUMER EXTIRPATION IN PUERTO RICO

Science.gov (United States)

EFFIE A. GREATHOUSE; CATHERINE M. PRINGLE; WILLIAM H. MCDOWELL; JEFF G. HOLMQUIST

2006-01-01

Large dams degrade the integrity of a wide variety of ecosystems, yet direct downstream effects of dams have received the most attention from ecosystem managers and researchers. We investigated indirect upstream effects of dams resulting from decimation of migratory freshwater shrimp and fish populations in Puerto Rico, USA, in both high- and low-gradient streams. In...

Upstream oil and gas industry options paper : report of the upstream oil and gas working group of the Industry Issues Table to the National Climate Change Secretariat

International Nuclear Information System (INIS)

1999-09-01

The Canadian Association of Petroleum Producers (CAPP) has coordinated the efforts of the upstream oil and natural gas industry to draft a foundation paper to provide data on industry greenhouse gas (GHG) emissions and actions. This paper is a technical piece targeted at government officials and stakeholders involved in the National Climate Change Secretariat process. The paper also outlines the context for considering policies aimed at reducing oil and gas industry emissions on climate change. The 6 key messages that CAPP wanted to emphasize in this paper were: (1) Canada's situation is very different from that of the U.S. and most other industrial countries, (2) GHG emissions are primarily an end-use consumption issue, (3) the climate change issue and the Kyoto Protocol present a major uncertainty that could undermine Canadian oil and natural gas development opportunities, (4) Canada should not be penalised by its growth of oil and natural gas resources, (5) the ability to reduce emissions by changing production technology is limited because large reductions in Canadian upstream emissions would only mean a shift of production to other countries which would not help to reduce global emissions, and (6) Canada should focus on promoting cost-effective action, research and development and international flexibility, and ensure that recognition is given to those companies that reduce emissions. tabs., figs

Isolation and genome sequencing of four Arctic marine Psychrobacter strains exhibiting multicopper oxidase activity.

Science.gov (United States)

Moghadam, Morteza Shojaei; Albersmeier, Andreas; Winkler, Anika; Cimmino, Lorenzo; Rise, Kjersti; Hohmann-Marriott, Martin Frank; Kalinowski, Jörn; Rückert, Christian; Wentzel, Alexander; Lale, Rahmi

2016-02-16

Marine cold-temperature environments are an invaluable source of psychrophilic microbial life for new biodiscoveries. An Arctic marine bacterial strain collection was established consisting of 1448 individual isolates originating from biota, water and sediment samples taken at a various depth in the Barents Sea, North of mainland Norway, with an all year round seawater temperature of 4 °C. The entire collection was subjected to high-throughput screening for detection of extracellular laccase activity with guaiacol as a substrate. In total, 13 laccase-positive isolates were identified, all belonging to the Psychrobacter genus. From the most diverse four strains, based on 16S rRNA gene sequence analysis, all originating from the same Botryllus sp. colonial ascidian tunicate sample, genomic DNA was isolated and genome sequenced using a combined approach of whole genome shotgun and 8 kb mate-pair library sequencing on an Illumina MiSeq platform. The genomes were assembled and revealed genome sizes between 3.29 and 3.52 Mbp with an average G + C content of around 42%, with one to seven plasmids present in the four strains. Bioinformatics based genome mining was performed to describe the metabolic potential of these four strains and to identify gene candidates potentially responsible for the observed laccase-positive phenotype. Up to two different laccase-like multicopper oxidase (LMCO) encoding gene candidates were identified in each of the four strains. Heterologous expression of P11F6-LMCO and P11G5-LMCO2 in Escherichia coli BL21 (DE3) resulted in recombinant proteins exhibiting 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) and guaiacol oxidizing activity. Thirteen Psychrobacter species with laccase-positive phenotype were isolated from a collection of Arctic marine bacteria. Four of the isolates were genome sequenced. The overall genome features were similar to other publicly available Psychrobacter genome sequences except for P11G5 harboring seven

Enhancement of axial momentum lost to the radial wall by the upstream magnetic field in a helicon source

Science.gov (United States)

Takahashi, Kazunori; Ando, Akira

2017-05-01

Individual measurements of forces exerted to an upstream back wall, a radial source wall, and a magnetic field of a helicon plasma thruster, which has two solenoids upstream and downstream of a radiofrequency antenna, are precisely measured. Two different structures of magnetic field lines in the source are tested, where the solenoid current is supplied to either only the downstream solenoid or to both the solenoids. It is observed that the high density plasma exists upstream of the rf antenna when both the solenoids are powered, while the maximum density exists near the rf antenna when only the downstream solenoid is powered. Although the force exerted to the back wall is increased for the two solenoids case, the axial momentum lost to the radial wall is simultaneously enhanced; then the total force exerted to the whole structure of the thruster is found to be very similar for the two magnetic field configurations. It is shown that the individual force measurement provides useful information on the plasma momentum interacting with the physical boundaries and the magnetic fields.

A trans-activator function is generated by integration of hepatitis B virus preS/S sequences in human hepatocellular carcinoma DNA

International Nuclear Information System (INIS)

Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.

1990-01-01

The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

Science.gov (United States)

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

1987-01-01

DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

DEFF Research Database (Denmark)

Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

communities, and in this study activated sludge sampled from 32 Wastewater Treatment Plants (WWTPs) around the world was described and compared. The top abundant bacteria in the global activated sludge ecosystem were found and the core population shared by multiple samples was investigated. The results......Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

Investigating altered nitric oxide signalling as an up-stream mediator of the antidepressant action of ketamine

DEFF Research Database (Denmark)

Liebenberg, N.; Muller, H. K.; Elfving, B.

2012-01-01

Background and Aim: Stress-induced excessive glutamate transmission at N-methyl-D-aspartate (NMDA) receptors may underlie a major mechanism in the pathophysiology that leads to depression, while ketamine, an NMDA receptor antagonist, has been shown to induce a rapid antidepressant effect in depre......Background and Aim: Stress-induced excessive glutamate transmission at N-methyl-D-aspartate (NMDA) receptors may underlie a major mechanism in the pathophysiology that leads to depression, while ketamine, an NMDA receptor antagonist, has been shown to induce a rapid antidepressant effect...... in depressed patients following a single intravenous administration that is sustained for (plus or minus) 7 days. A number of downstream cellular mechanisms appear to mediate the antidepressant action of ketamine, and the majority of evidence point to a rapid activation of protein translation leading...... to and activated by NMDA receptors, while the uncoupling of the nNOS-NMDA receptor complex prevents NMDA-induced excitotoxicity. Thus, it is possible that the inhibition of nitric oxide (NO) signalling underlies a key upstream mechanism in the antidepressant action of ketamine. Methods: We used a genetic rat model...

Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

OpenAIRE

Leoni, L; Ciervo, A; Orsi, N; Visca, P

1996-01-01

The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...

Changes, challenges, choices: Human resources in the upstream oil and gas industry

International Nuclear Information System (INIS)

Manthey, M.

1993-01-01

A comprehensive study of human resources in the Canadian upstream oil and gas industry was conducted in 1992. Three segments of the industry were examined: exploration and production companies; geophysical, drilling, and oilfield services and supply firms; and two oil sands operations. Between 1988 and 1991, total employment in these segments fell from 79,500 to 68,000. Much of this downsizing occurred with the second segment companies, where staff was reduced by 27%. Continued property rationalization and organizational restructuring are expected until 1994 or 1995, with attendant reductions in the workforce. Then, depending on favorable economic trends for oil and natural gas, activity and demand for employees may begin to recover. However, employment levels at the end of the decade are not expected to rebound to pre-1991 levels. Workforce reduction has been accomplished by layoffs, induced retirements, and cutbacks in recruitment. The low inflow of new talent coupled with an outflow of experienced staff may eventually cause shortages in certain industry-specific occupations. A disproportionately high proportion of employees was found to be in their late thirties, and this will present another challenge in the future. 3 figs., 2 tabs

Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

International Nuclear Information System (INIS)

Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

1988-01-01

The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

Source characteristics of the Fairview, OK, earthquake sequence and its relationship to industrial activities

Science.gov (United States)

Yeck, W. L.; Weingarten, M.; Benz, H.; McNamara, D. E.; Herrmann, R. B.; Rubinstein, J. L.; Earle, P. S.; Bergman, E.

2016-12-01

We characterize the spatio-temporal patterns of seismicity surrounding the February 13, 2016, Mw 5.1 Fairview, Oklahoma earthquake. This earthquake sequence accounts for the largest moment release in the central and eastern US since the November 06, 2011 Mw 5.6 Prague, OK earthquake sequence. To improve the location accuracy of the sequence and measure near-source ground motions, the United States Geological Survey (USGS) deployed eight seismometers and accelerometers in the epicentral region. With the added depth control from these stations, we show that earthquakes primarily occur in the Precambrian basement, at depths of 6-10 km below sea level. The Mw 5.1 mainshock, the largest event in the cluster, locates near the base of the seismicity. Relocated aftershocks delineate a partially unmapped, 14-km-long fault segment that strikes approximately N40°E, partially bridging the gap between previously mapped basement faults to the southwest and northeast. Gas production and hydraulic fracking data from the region show no evidence that either of these activities correlates spatio-temporally with the Fairview sequence. Instead, we suggest that a series of high-rate, Arbuckle injection wells (> 300,000 bbls/month) 8-25 km northeast of this sequence pressurized the reservoir in the far field. Regional injection into the Arbuckle formation increased 7-fold in the 24 months before the initiation of the sequence with some wells operating at rates greater than 1 million barrels per month. Seismicity in the proximity of the high-rate wells is diffuse whilst the energetic Fairview sequence occurs more than 15 km from this region. Our observations point to the critical role pre-existing geologic structures play in the occurrence of large induced earthquakes. This study demonstrates the need for a better understanding of the role of far-field pressurization. High-quality data sets such as this facilitate the USGS mission to improve earthquake hazard identification, especially

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure : background, aims and design of the RACE 3 study

NARCIS (Netherlands)

Alings, M.; Smit, M. D.; Moes, M. L.; Crijns, H. J. G. M.; Tijssen, J. G. P.; Brugemann, J.; Hillege, H. L.; Lane, D. A.; Lip, G. Y. H.; Smeets, J. R. L. M.; Tieleman, R. G.; Tukkie, R.; Willems, F. F.; Vermond, R. A.; Van Veldhuisen, D. J.; Van Gelder, I. C.

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study

NARCIS (Netherlands)

Alings, M.; Smit, M. D.; Moes, M. L.; Crijns, H. J. G. M.; Tijssen, J. G. P.; Brügemann, J.; Hillege, H. L.; Lane, D. A.; Lip, G. Y. H.; Smeets, J. R. L. M.; Tieleman, R. G.; Tukkie, R.; Willems, F. F.; Vermond, R. A.; van Veldhuisen, D. J.; van Gelder, I. C.

2013-01-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control

Activity of posaconazole and other antifungal agents against Mucorales strains identified by sequencing of internal transcribed spacers.

Science.gov (United States)

Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis

2009-04-01

The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.

Assessment of whether upstream passage for Lake Sturgeon is needed at the Pointe du Bois Generating Station (Winnipeg River)

International Nuclear Information System (INIS)

Pratt, T.

2010-01-01

This document reviewed Manitoba Hydro's proposal to modernize the Pointe du Bois Generating Station (GS) on the Winnipeg River, with particular reference to the potential impacts on Lake Sturgeon in Management Unit 5 (MU5) where large numbers of the fish spawn at the base of the falls. The modernization will involve replacing the spillway, dam segments and replacing or repairing the powerhouse. The pros and cons of providing upstream fish passage for Lake Sturgeon and the generating station were outlined. The only spawning area in the MU5 area may be altered considerably due to changes in water flow, depending on the design chosen for modernization. A potential benefit of providing upstream fish passage for Lake Sturgeon would be to increase genetic diversity within the Winnipeg River. Another potential benefit would be to allow Lake Sturgeon, from the relatively dense population below the GS, to move upstream into MU4 where unfilled habitat may be available and Lake Sturgeon abundance is lower. A potential disadvantage of providing fish passage would be the loss of individual Lake Sturgeon from the healthy population in MU5 with no accompanying benefit to MU4. There would be no net gain to MU4 or MU5 if migrating Lake Sturgeon returned to MU5 rather than proceeding upstream. It was concluded that these current gaps in knowledge must be filled in order to fully assess the environmental impacts. 2 figs.

Hindbrain A2 noradrenergic neuron adenosine 5'-monophosphate-activated protein kinase activation, upstream kinase/phosphorylase protein expression, and receptivity to hormone and fuel reporters of short-term food deprivation are regulated by estradiol.

Science.gov (United States)

Briski, Karen P; Alenazi, Fahaad S H; Shakya, Manita; Sylvester, Paul W

2017-07-01

Estradiol (E) mitigates acute and postacute adverse effects of 12 hr-food deprivation (FD) on energy balance. Hindbrain 5'-monophosphate-activated protein kinase (AMPK) regulates hyperphagic and hypothalamic metabolic neuropeptide and norepinephrine responses to FD in an E-dependent manner. Energy-state information from AMPK-expressing hindbrain A2 noradrenergic neurons shapes neural responses to metabolic imbalance. Here we investigate the hypothesis that FD causes divergent changes in A2 AMPK activity in E- vs. oil (O)-implanted ovariectomized female rats, alongside dissimilar adjustments in circulating metabolic fuel (glucose, free fatty acids [FFA]) and energy deficit-sensitive hormone (corticosterone, glucagon, leptin) levels. FD decreased blood glucose in oil (O)- but not E-implanted ovariectomized female rats and elevated and reduced glucagon levels in O and E, respectively. FD decreased circulating leptin in O and E, but increased corticosterone and FFA concentrations in E only. Western blot analysis of laser-microdissected A2 neurons showed that glucocorticoid receptor type II and very-long-chain acyl-CoA synthetase 3 protein profiles were amplified in FD/E vs. FD/O. A2 total AMPK protein was elevated without change in activity in FD/O, whereas FD/E exhibited increased AMPK activation along with decreased upstream phosphatase expression. The catecholamine biosynthetic enzyme dopamine-β-hydroxylase (DβH) was increased in FD/O but not FD/E A2 cells. The data show discordance between A2 AMPK activation and glycemic responses to FD; sensor activity was refractory to glucose decrements in FD/O but augmented in FD/E despite stabilized glucose and elevated FFA levels. E-dependent amplification of AMPK activity may reflect adaptive conversion to fatty acid oxidation and/or glucocorticoid stimulation. FD augmentation of A2 DβH protein profiles in FD/O but not FD/E animals suggests that FD may correspondingly regulate NE synthesis vs. metabolism/release in the

Evidence for Human Fronto-Central Gamma Activity during Long-Term Memory Encoding of Word Sequences

Science.gov (United States)

Meeuwissen, Esther Berendina; Takashima, Atsuko; Fernández, Guillén; Jensen, Ole

2011-01-01

Although human gamma activity (30–80 Hz) associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM) formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM) maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG) we identified significant differences in the gamma and beta activity. Robust gamma activity (55–65 Hz) in left BA6 (supplementary motor area (SMA)/pre-SMA) was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions. PMID:21738641

Evidence for human fronto-central gamma activity during long-term memory encoding of word sequences.

Directory of Open Access Journals (Sweden)

Esther Berendina Meeuwissen

Full Text Available Although human gamma activity (30-80 Hz associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG we identified significant differences in the gamma and beta activity. Robust gamma activity (55-65 Hz in left BA6 (supplementary motor area (SMA/pre-SMA was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions.

BmTx3, a scorpion toxin with two putative functional faces separately active on A-type K+ and HERG currents.

OpenAIRE

Huys, Isabelle; Xu, Chen-Qi; Wang, Cheng-Zhong; Vacher, Hélène; Martin-Eauclaire, Marie-France; Chi, Cheng-Wu; Tytgat, Jan

2004-01-01

A novel HERG channel blocker was isolated from the venom of the scorpion Buthus martensi Karsch, sequenced and characterized at the pharmacological level after chemical synthesis. According to the determined amino acid sequence, the cDNA and genomic genes were then cloned. The genomic gene consists of two exons interrupted by an intron of 65 bp at position -6 upstream from the mature toxin. The protein sequence of this toxin was completely identical with that of a known A-type K+ current bloc...

Physiological and Pathological Transcriptional Activation of Endogenous Retroelements Assessed by RNA-Sequencing of B Lymphocytes

Directory of Open Access Journals (Sweden)

Jan Attig

2017-12-01

Full Text Available In addition to evolutionarily-accrued sequence mutation or deletion, endogenous retroelements (EREs in eukaryotic genomes are subject to epigenetic silencing, preventing or reducing their transcription, particularly in the germplasm. Nevertheless, transcriptional activation of EREs, including endogenous retroviruses (ERVs and long interspersed nuclear elements (LINEs, is observed in somatic cells, variably upon cellular differentiation and frequently upon cellular transformation. ERE transcription is modulated during physiological and pathological immune cell activation, as well as in immune cell cancers. However, our understanding of the potential consequences of such modulation remains incomplete, partly due to the relative scarcity of information regarding genome-wide ERE transcriptional patterns in immune cells. Here, we describe a methodology that allows probing RNA-sequencing (RNA-seq data for genome-wide expression of EREs in murine and human cells. Our analysis of B cells reveals that their transcriptional response during immune activation is dominated by induction of gene transcription, and that EREs respond to a much lesser extent. The transcriptional activity of the majority of EREs is either unaffected or reduced by B cell activation both in mice and humans, albeit LINEs appear considerably more responsive in the latter host. Nevertheless, a small number of highly distinct ERVs are strongly and consistently induced during B cell activation. Importantly, this pattern contrasts starkly with B cell transformation, which exhibits widespread induction of EREs, including ERVs that minimally overlap with those responsive to immune stimulation. The distinctive patterns of ERE induction suggest different underlying mechanisms and will help separate physiological from pathological expression.

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data

Directory of Open Access Journals (Sweden)

Regad Leslie

2010-01-01

Full Text Available Abstract Background In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.. Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. Results The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Conclusions Our algorithms prove to be effective and able to handle real data sets with

Chandra's Observations of Jupiter's X-Ray Aurora During Juno Upstream and Apojove Intervals

Science.gov (United States)

Jackman, C.M.; Dunn, W.; Kraft, R.; Gladstone, R.; Branduardi-Raymont, G.; Knigge, C.; Altamirano, D.; Elsner, R.

2017-01-01

The Chandra space telescope has recently conducted a number of campaigns to observe Jupiter's X-ray aurora. The first set of campaigns took place in summer 2016 while the Juno spacecraft was upstream of the planet sampling the solar wind. The second set of campaigns took place in February, June and August 2017 at times when the Juno spacecraft was at apojove (expected close to the magnetopause). We report on these upstream and apojove campaigns including intensities and periodicities of auroral X-ray emissions. This new era of jovian X-ray astronomy means we have more data than ever before, long observing windows (up to 72 kiloseconds for this Chandra set), and successive observations relatively closely spaced in time. These features combine to allow us to pursue novel methods for examining periodicities in the X-ray emission. Our work will explore significance testing of emerging periodicities, and the search for coherence in X-ray pulsing over weeks and months, seeking to understand the robustness and regularity of previously reported hot spot X-ray emissions. The periods that emerge from our analysis will be compared against those which emerge from radio and UV wavelengths.

Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

Science.gov (United States)

Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

2017-01-01

The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

On the upstream boundary of electron foreshocks in the solar wind

International Nuclear Information System (INIS)

Zimbardo, G.; Veltri, P.

1996-01-01

The backstreaming of electrons from planetary and interplanetary shocks creates foreshocks of fast particles propagating along the magnetic field. The effect of low frequency magnetic fluctuations is to create both a broadening and a fine structure of the foreshock upstream boundary. This is studied by means of a newly developed 3-D numerical simulation of turbulent magnetic fields. Applications to the Earth and to the termination shock electron foreshocks are done, and some implications on the observations of the spreading and of the bursty structure of the foreshocks are discussed

Electromagnetic ion beam instability upstream of the earth's bow shock

International Nuclear Information System (INIS)

Gary, S.P.; Gosling, J.T.; Forslund, D.W.

1981-01-01

The linear theory of the electromagnetic ion beam instability for arbitrary angles of propagation has been studied. The parameters considered in the theory are typical of the solar wind upstream of the earth's bow shock when a 'reflected' proton beam is present. Maximum growth occurs for propagation parallel to the ambient field B, but this instability also displays significant growth at wave-vectors oblique to B, Oblique, unstable modes seem to be the likely source of the compressive magnetic fluctuations recently observed in conjunction with 'diffuse' ion population. An energetic ion beam does not directly give rise to linear growth of either ion acoustic or whistler mode instabilities

Activity of Posaconazole and Other Antifungal Agents against Mucorales Strains Identified by Sequencing of Internal Transcribed Spacers▿

Science.gov (United States)

Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis

2009-01-01

The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801

A unique nuclear receptor direct repeat 17 (DR17) is present within the upstream region of Schistosoma mansoni female-specific p14 gene

International Nuclear Information System (INIS)

Fantappie, Marcelo Rosado; Furtado, Daniel Rodrigues; Rumjanek, Franklin David; LoVerde, Philip T.

2008-01-01

The eggs produced by sexually mature female Schistosma mansoni are responsible for the pathogenesis of the disease. The eggshell precursor gene p14 is expressed only in the vitelline cells of sexually mature female worms in response to a yet unidentified male stimulus. Herein, we report the identification of a novel nuclear receptor response element in the upstream region of the p14 gene. This element contains the canonical hexameric DNA core motif, 5'-PuGGTCA, composed of an atypically spaced direct repeat (DR17). Schistosome nuclear receptors SmRXR1 and SmNR1 specifically bound to the p14-DR17 element as a heterodimer. SmRXR1, but not SmNR1, bound to the motif as a monomer. Introduction of mutations in the TCA core sequence completely abolished the binding by SmRXR1/SmNR1 heterodimer. This finding supports our hypothesis that the expression of Schistosoma mansonip14 gene is regulated through the nuclear receptor signaling pathway

Water stress in global transboundary river basins : Significance of upstream water use on downstream stress

NARCIS (Netherlands)

Munia, H.; Guillaume, J. H A; Mirumachi, N.; Porkka, M.; Wada, Y.|info:eu-repo/dai/nl/341387819; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analysed in many of these international river basins, this has

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study.

Science.gov (United States)

Alings, M; Smit, M D; Moes, M L; Crijns, H J G M; Tijssen, J G P; Brügemann, J; Hillege, H L; Lane, D A; Lip, G Y H; Smeets, J R L M; Tieleman, R G; Tukkie, R; Willems, F F; Vermond, R A; Van Veldhuisen, D J; Van Gelder, I C

2013-07-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control for prevention of Early AF in heart failure (RACE 3) study hypothesises that aggressive upstream rhythm control increases persistence of sinus rhythm compared with conventional rhythm control in patients with early AF and mild-to-moderate early systolic or diastolic heart failure undergoing electrical cardioversion. RACE 3 is a prospective, randomised, open, multinational, multicenter trial. Upstream rhythm control consists of angiotensin converting enzyme inhibitors and/or angiotensin receptor blockers, mineralocorticoid receptor antagonists, statins, cardiac rehabilitation therapy, and intensive counselling on dietary restrictions, exercise maintenance, and drug adherence. Conventional rhythm control consists of routine rhythm control therapy without cardiac rehabilitation therapy and intensive counselling. In both arms, every effort is made to keep patients in the rhythm control strategy, and ion channel antiarrhythmic drugs or pulmonary vein ablation may be instituted if AF relapses. Total inclusion will be 250 patients. If upstream therapy proves to be effective in improving maintenance of sinus rhythm, it could become a new approach to rhythm control supporting conventional pharmacological and non-pharmacological rhythm control.

Innovation and performance: The case of the upstream petroleum sector

Science.gov (United States)

Persaud, A. C. Jai

This thesis investigates innovation in the upstream crude oil and natural gas sector, a strategic part of the Canadian economy and a vital industry for North American energy trade and security. Significant interest exists in understanding innovation in this sector from a private and public policy perspective. Interest in the sector has intensified recently due to concerns about world oil supply, Canada's oil sands development, and the potential that Canada may become an "energy superpower." The study examines the factors that drive companies involved in exploration, development, and production in the upstream petroleum sector to innovate and the impact of their innovation activities through major technologies on their performance. The thesis focuses on process innovation, which involves the adoption of new or significantly improved production processes, and is distinct from product innovation, which is based on the development and commercialization of a product with improved product characteristics to deliver new services to the consumer. The thesis provides a comprehensive review of the literature and develops an investigative model framework to examine the drivers of innovation and the impact of innovation on performance in the upstream petroleum sector. The research employs a survey questionnaire that was developed to obtain data and information, which was missing in the literature or not publicly available to test key relationships of innovation and performance indicators. In addition to the survey questionnaire, a number of knowledgeable experts in the industry were also interviewed. A total of 68 respondents completed the survey questionnaire, accounting for 40 percent of the firms in the industry. This percentage goes up to over 50 percent when account is taken of extremely small firms who could not fill out the survey. Further, the 68 respondents account for most of the industry revenues, production, and employment. The respondents include most of the key

The amino acid sequences and activities of synergistic hemolysins from Staphylococcus cohnii.

Science.gov (United States)

Mak, Pawel; Maszewska, Agnieszka; Rozalska, Malgorzata

2008-10-01

Staphylococcus cohnii ssp. cohnii and S. cohnii ssp. urealyticus are a coagulase-negative staphylococci considered for a long time as unable to cause infections. This situation changed recently and pathogenic strains of these bacteria were isolated from hospital environments, patients and medical staff. Most of the isolated strains were resistant to many antibiotics. The present work describes isolation and characterization of several synergistic peptide hemolysins produced by these bacteria and acting as virulence factors responsible for hemolytic and cytotoxic activities. Amino acid sequences of respective hemolysins from S. cohnii ssp. cohnii (named as H1C, H2C and H3C) and S. cohnii ssp. urealyticus (H1U, H2U and H3U) were identical. Peptides H1 and H3 possessed significant amino acid homology to three synergistic hemolysins secreted by Staphylococcus lugdunensis and to putative antibacterial peptide produced by Staphylococcus saprophyticus ssp. saprophyticus. On the other hand, hemolysin H2 had a unique sequence. All isolated peptides lysed red cells from different mammalian species and exerted a cytotoxic effect on human fibroblasts.

Hydrodynamic response of fuel rod with longitudinal fins to upstream generated vortices

International Nuclear Information System (INIS)

Naot, D.; Oron, A.; Technion-Israel Inst. of Tech., Haifa. Dept. of Mechanical Engineering)

1984-01-01

The hydrodynamic response of turbulent channel flow to upstream generated vortices was numerically simulated for fuel element with longitudinal cooling fins. Turbulence is modelled by an algebraic stress model and an energy-dissipation model. The developing flow is solved using a parabolic pressure correction algorithm. The decay of the initial vortices in non-circular sub-channel in the presence of geometry driven secondary currents is described and the uncertainty in the local turbulent shear stresses is discussed. (orig.)

Upstream effects of dams on alluvial channels: state-of-the-art and future challenges

Science.gov (United States)

Liro, Maciej

2017-04-01

More than 50,000 large dams (with the height above 15 m) operate all over the world and, thus, they significantly disturb water and sediment transport in river systems. These disturbances are recognized as one of the most important factors shaping river morphology in the Anthropocene. Downstream effects of dams have been well documented in numerous case studies and supported by predictions from existing models. In contrast, little is known on the upstream effects of dams on alluvial channels. This review highlights the lack of studies on sedimentological, hydromorphological and biogeomorphological adjustments of alluvial rivers in the base-level raised zones of backwater upstream of dam reservoirs where water level fluctuations occur. Up to date, it has been documented that backwater effects may facilitate fine and coarse sediment deposition, increase groundwater level, provide higher and more frequent channel and floodplain inundation and lead to significant morphological changes. But there have been no studies quantifying short- and long-term consequences of these disturbances for the hydromorphological and biogeomorphological feedbacks that control development of alluvial channels. Some recent studies carried out on gravel-bed and fine-grained bed rivers show that the above mentioned disturbances facilitate vegetation expansion on exposed channel sediments and floodplain influencing river morphology, which suggests that backwater area of alluvial rivers may be treated as the hotspot of bio-geomorphological changes in a fluvial system. To set the stage for future research on upstream effects of dams, this work presents the existing state-of-art and proposes some hypotheses which may be tested in future studies. This study was carried out within the scope of the Research Project 2015/19/N/ST10/01526 financed by the National Science Centre of Poland

PENGUASAAN KERAJAAN TARUMANEGARA TERHADAP KAWASAN HULU CI SADANE THE CONTROL OF TARUMANEGARA KINGDOM TO THE CI SADANE UPSTREAM AREA

Directory of Open Access Journals (Sweden)

Endang Widyastuti

2016-06-01

Full Text Available ABSTRACT As we know that the oldest kingdom in West Java is the Kingdom Tarumanegara. Authentic evidence of the existence of such is the kingdom of seven inscriptions, of which five were found in the upstream region is now administratively Cisadane including Bogor regency. Three of the five inscriptions indicate the possession of territory by Tarumanegara kingdom. This indicates that the upstream region Cisadane is an area that is quite important and has the potential to be controlled by Tarumanegara.   Key words:upstream of Ci Sadane, Tarumanegara kingdom, control area   ABSTRAK Sebagaimana diketahui bahwa kerajaan tertua di Jawa Barat adalah Kerajaan Tarumanegara. Bukti otentik mengenai keberadaan kerajaan tersebut adalah adanya tujuh prasasti, yang lima diantaranya ditemukan di kawasan Hulu Cisadane yang sekarang secara administratif termasuk wilayah Kabupaten Bogor. Tiga diantara kelima prasasti tersebut menunjukkan penguasaan wilayah tersebut oleh Kerajaan Tarumanegara. Hal ini mengindikasikan bahwa kawasan hulu cisadane merupakan kawasan yang cukup penting dan mempunyai potensi yang harus dikuasai oleh Tarumanegara.   Kata Kunci:hulu Ci Sadane, Kerajaan Tarumanegara, penguasaan wilayah.

Buzz words in the upstream

International Nuclear Information System (INIS)

Knoll, B.

1998-01-01

Examples of misleading or misunderstood 'buzz' words that are prevalent in modern upstream technology are illustrated. The terms underbalanced drilling, horizontal wells, and geo-steering, which were unheard of in the early 1980s, have become key 'buzz' words in modern exploitation terminology. The terms are not only misused, but the technologies themselves are frequently mis-applied as shown by the frequency of economic failures, or less than optimal technical successes which have occurred when these technologies have been employed. Two examples, 'horizontal drilling' and 'geosteering', are used to illustrate the point. With regard to horizontal drilling, many oil field professionals consider it as merely a more advanced method of directional drilling. This represents a serious, yet common, misconception. In truth, horizontal wells are not just an altered drilling process, but a fundamental change in exploitation technology. A more appropriate definition would be that a horizontal well is an enhanced oil recovery process, clearly implying a relationship to the exploitation benefit potential of horizontal wells. The other term, 'geo-steering' refers to defining, generating and monitoring a wellpath on geology rather than geometry. It, too, is frequently misused in the technical media. The term is also misrepresented by implying that it is applicable only to the horizontal section of a well, which in fact is far from the truth. To counter these misconceptions, the paper provides appropriate definitions for each of these terms, and defines the conditions under which the techniques themselves are most appropriately used. 7 figs

Evaluation of synthetic rainfall application with respect to the flow volume at upstream Brantas watershed, East Java Province of Indonesia

Directory of Open Access Journals (Sweden)

Limantara Lily Montarcih

2017-12-01

Full Text Available Indonesian Technical Implementation Unit (UPT of Synthetic Rainfall has modified climate by generating synthetic rainfall from 9th May until 4th June 2013. This unit has cooperated with the Department of Technological Study and Application (BPPT of Indonesia and Perum Jasa Tirta I and TNI AU Lanud Abdulrachman Saleh. This study intended to increase reservoirs water level in upstream Brantas watershed, one of them is Sutami reservoir. Successive grade evaluation of synthetic rainfall used the method of Double Ratio and Flow Discharge. The target area is upstream Brantas watershed that is represented by 12 rainfall stations and the control area is in the distance of ±30 km from the boundary of upstream Brantas watershed and is represented by 5 rainfall stations. Results show rainfall increasing by 152.05% according to the Double Ratio method and the increase of flow discharge from Sutami reservoir by 74.19% according to the Flow Discharge method.

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

International Nuclear Information System (INIS)

Simley, Eric; Pao, Lucy Y; Gebraad, Pieter; Churchfield, Matthew

2014-01-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone

Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle.

Science.gov (United States)

Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu

2017-12-06

Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.

Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes.

Science.gov (United States)

Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S

2010-10-01

Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (Pc) 2010 Elsevier B.V. All rights reserved.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

Directory of Open Access Journals (Sweden)

Hou Jinna

2012-12-01

Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Joshi NV

2009-01-01

Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

The role of the upstream oil and gas industry in the Canadian economy and the macroeconomic impacts of increased taxation

International Nuclear Information System (INIS)

Anon.

1996-01-01

The direct, indirect and overall impacts of the upstream oil and gas industry on the Canadian economy and the impact of increased taxation on the industry and the overall economy was assessed. The industry's value of production in 1995 was $25 billion, two-thirds of which were exports that contributed to Canada's trade surplus. In the same year, the industry also spent more than $10 billion in exploration and development. About five per cent of Canadian gross domestic product (GDP) and three per cent of national employment can be traced to the upstream oil and gas industry, therefore, increased taxation on the industry would have significant impacts on overall economic activity. For the purposes of this analysis, three assumptions were made: (1) a one-time $100 million tax increase on the industry, (2) the tax revenue to go toward government debt reduction, and (3) the reduction in industry net revenue to produce an investment impact equal with the average behaviour of the industry in recent years. Given these factors, it was concluded that a one-time $100 million tax increase could reduce national GDP by $250 million and employment by 3000 jobs. The balance of payments impact would be about -$75 million. Once factors related to expectations and capital mobility have been factored in, the negative macroeconomic impacts could be even greater. 6 tabs., 24 figs

Genome Sequence of an Endophytic Fungus, Fusarium solani JS-169, Which Has Antifungal Activity.

Science.gov (United States)

Kim, Jung A; Jeon, Jongbum; Park, Sook-Young; Kim, Ki-Tae; Choi, Gobong; Lee, Hyun-Jung; Kim, Yangsun; Yang, Hee-Sun; Yeo, Joo-Hong; Lee, Yong-Hwan; Kim, Soonok

2017-10-19

An endophytic fungus, Fusarium solani strain JS-169, isolated from a mulberry twig, showed considerable antifungal activity. Here, we report the draft genome sequence of this strain. The assembly comprises 17 scaffolds, with an N 50 value of 4.93 Mb. The assembled genome was 45,813,297 bp in length, with a G+C content of 49.91%. Copyright © 2017 Kim et al.

Development of a GAL4-VP16/UAS trans-activation system for tissue specific expression in Medicago truncatula.

Directory of Open Access Journals (Sweden)

Amélie Sevin-Pujol

Full Text Available Promoters with tissue-specific activity are very useful to address cell-autonomous and non cell autonomous functions of candidate genes. Although this strategy is widely used in Arabidopsis thaliana, its use to study tissue-specific regulation of root symbiotic interactions in legumes has only started recently. Moreover, using tissue specific promoter activity to drive a GAL4-VP16 chimeric transcription factor that can bind short upstream activation sequences (UAS is an efficient way to target and enhance the expression of any gene of interest. Here, we developed a collection of promoters with different root cell layers specific activities in Medicago truncatula and tested their abilities to drive the expression of a chimeric GAL4-VP16 transcription factor in a trans-activation UAS: β-Glucuronidase (GUS reporter gene system. By developing a binary vector devoted to modular Golden Gate cloning together with a collection of adapted tissue specific promoters and coding sequences we could test the activity of four of these promoters in trans-activation GAL4/UAS systems and compare them to "classical" promoter GUS fusions. Roots showing high levels of tissue specific expression of the GUS activity could be obtained with this trans-activation system. We therefore provide the legume community with new tools for efficient modular Golden Gate cloning, tissue specific expression and a trans-activation system. This study provides the ground work for future development of stable transgenic lines in Medicago truncatula.

Magnetic resonance enteroclysis in patients with Crohn's disease: fat saturated T2-weighted sequences for evaluation of inflammatory activity.

Science.gov (United States)

Grieser, Christian; Denecke, Timm; Steffen, Ingo G; Werner, Scarlett; Kröncke, Thomas; Guckelberger, Olaf; Pape, Ulrich-Frank; Meier, Johannes; Thiel, Regina; Kivelitz, Dietmar; Sturm, Andreas; Hamm, Bernd; Röttgen, Rainer

2012-04-01

To evaluate fat saturated (fs) T2-weighted (w) fast relaxation fast spin echo (FRFSE)-sequences compared to the standard protocol with contrast agent for the evaluation of inflammatory activity in patients with Crohn's Disease (CD). Fourty-eight patients (male, 17; female, 33; mean age, 37 years) with suspicion of inflammatory activity in proven CD who underwent MR enteroclysis (MRE) at 1.5T (GE Healthcare) were retrospectively included. Two blinded radiologists analyzed MRE images for presence and extent of CD lesions and degree of local inflammation for fsT2-w FRFSE and contrast enhanced T1-w images (T2-activity; T1-activity; score, 1-4) in consensus. Furthermore, mural signal intensity (SI) ratios (T2-ratio; T1-ratio) were recorded. Patient based MRE findings were correlated with endoscopic (45 patients), surgical (6 patients), histopathological, and clinical data (CDAI) as a surrogate reference standard. In total, 24 of 48 eligible patients presented with acute inflammatory activity with 123 affected bowel segments. ROC analysis of the total inflammatory score presented an AUC of 0.93 (pT2-activity (T1-activity, AUC 0.63; p=0.019). ROC analysis revealed an AUC of 0.76 (pT2-ratio (T1-ratio, AUC 0.51; p=0.93). General linear regression model revealed T2-activity (p=0.001) and age (p=0.024) as predictive factors of acute bowel inflammation. T2-w FRFSE-sequences can depict CD lesions and help to assess the inflammation activity, even with improved accuracy as compared to contrast-enhanced T1-w sequences. Copyright © 2011 European Crohn's and Colitis Organisation. Published by Elsevier B.V. All rights reserved.

Compact flow diagrams for state sequences

NARCIS (Netherlands)

Buchin, K.A.; Buchin, M.E.; Gudmundsson, J.; Horton, M.J.; Sijben, S.

2016-01-01

We introduce the concept of compactly representing a large number of state sequences, e.g., sequences of activities, as a flow diagram. We argue that the flow diagram representation gives an intuitive summary that allows the user to detect patterns among large sets of state sequences. Simplified,

Upstream petroleum licensing: a comparative approach on regulatory frameworks and economic impacts

Energy Technology Data Exchange (ETDEWEB)

Cunha, Amanda L. [Felsberg e Associados, Sao Paulo, SP (Brazil)

2008-07-01

The recent discoveries hit in the pre-salt area, such as Tupi, Jupiter, Bem-te-vi and Carioca may place Brazil amongst the largest oil producers in the world. As a result, the Brazilian regulatory framework, which was originally envisaged in a scenario of higher exploration risk, has been under heavy public scrutiny. The Brazilian Government has already taken the first steps towards substantial changes in the country's contracting model for upstream activities. By means of Resolution No. 6/2007, the National Council for Energy Policy ('CNPE') not only determined the removal of 41 blocks with sub-salt geology from the ANP 9 Th Bid Round, but also stressed the need for a different regime for E and P activities in the country's continental shelf. At this moment, there is a great deal of controversy on the contracting model to be adopted, mainly whether the concession model should be maintained, but subject to higher levels of government take, or a production sharing model should apply. This paper goes through the evolution of international oil agreements, from early concessions to modern agreements. A special emphasis is placed on concession/license regimes as well as on production sharing agreements (PSAs). Besides drawing a comparative line between such models, this article assesses their economic impacts and whether the regulatory framework currently in force in Brazil is suitable for a scenario of lower risk, showing that any desired level of regulation may be achieved in the context of a PSA as easily as in a exclusive concession. (author)

Virtual Genome Walking across the 32 Gb Ambystoma mexicanum genome; assembling gene models and intronic sequence.

Science.gov (United States)

Evans, Teri; Johnson, Andrew D; Loose, Matthew

2018-01-12

Large repeat rich genomes present challenges for assembly using short read technologies. The 32 Gb axolotl genome is estimated to contain ~19 Gb of repetitive DNA making an assembly from short reads alone effectively impossible. Indeed, this model species has been sequenced to 20× coverage but the reads could not be conventionally assembled. Using an alternative strategy, we have assembled subsets of these reads into scaffolds describing over 19,000 gene models. We call this method Virtual Genome Walking as it locally assembles whole genome reads based on a reference transcriptome, identifying exons and iteratively extending them into surrounding genomic sequence. These assemblies are then linked and refined to generate gene models including upstream and downstream genomic, and intronic, sequence. Our assemblies are validated by comparison with previously published axolotl bacterial artificial chromosome (BAC) sequences. Our analyses of axolotl intron length, intron-exon structure, repeat content and synteny provide novel insights into the genic structure of this model species. This resource will enable new experimental approaches in axolotl, such as ChIP-Seq and CRISPR and aid in future whole genome sequencing efforts. The assembled sequences and annotations presented here are freely available for download from https://tinyurl.com/y8gydc6n . The software pipeline is available from https://github.com/LooseLab/iterassemble .

The DNA Inflammasome in Human Myeloid Cells Is Initiated by a STING-Cell Death Program Upstream of NLRP3

Science.gov (United States)

Gaidt, Moritz M.; Ebert, Thomas S.; Chauhan, Dhruv; Ramshorn, Katharina; Pinci, Francesca; Zuber, Sarah; O’Duill, Fionan; Schmid-Burgk, Jonathan L.; Hoss, Florian; Buhmann, Raymund; Wittmann, Georg; Latz, Eicke; Subklewe, Marion; Hornung, Veit

2018-01-01

Summary Detection of cytosolic DNA constitutes a central event in the context of numerous infectious and sterile inflammatory conditions. Recent studies have uncovered a bipartite mode of cytosolic DNA recognition, in which the cGAS-STING axis triggers antiviral immunity, whereas AIM2 triggers inflammasome activation. Here, we show that AIM2 is dispensable for DNA-mediated inflammasome activation in human myeloid cells. Instead, detection of cytosolic DNA by the cGAS-STING axis induces a cell death program initiating potassium efflux upstream of NLRP3. Forward genetics identified regulators of lysosomal trafficking to modulate this cell death program, and subsequent studies revealed that activated STING traffics to the lysosome, where it triggers membrane permeabilization and thus lysosomal cell death (LCD). Importantly, the cGAS-STING-NLRP3 pathway constitutes the default inflammasome response during viral and bacterial infections in human myeloid cells. We conclude that targeting the cGAS-STING-LCD-NLRP3 pathway will ameliorate pathology in inflammatory conditions that are associated with cytosolic DNA sensing. PMID:29033128

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Shape and shear guide sperm cells spiraling upstream

Science.gov (United States)

Kantsler, Vasily; Dunkel, Jorn; Goldstein, Raymond E.

2014-11-01

A major puzzle in biology is how mammalian sperm determine and maintain the correct swimming direction during the various phases of the sexual reproduction process. Currently debated mechanisms for sperm long range travel vary from peristaltic pumping to temperature sensing (thermotaxis) and direct response to fluid flow (rheotaxis), but little is known quantitatively about their relative importance. Here, we report the first quantitative experimental study of mammalian sperm rheotaxis. Using microfluidic devices, we investigate systematically the swimming behavior of human and bull sperm over a wide range of physiologically relevant shear rates and viscosities. Our measurements show that the interplay of fluid shear, steric surface-interactions and chirality of the flagellar beat leads to a stable upstream spiraling motion of sperm cells, thus providing a generic and robust rectification mechanism to support mammalian fertilization. To rationalize these findings, we identify a minimal mathematical model that is capable of describing quantitatively the experimental observations.

Cell-cycle-specific interaction of nuclear DNA-binding proteins with a CCAAT sequence from the human thymidine kinase gene

International Nuclear Information System (INIS)

Knight, G.B.; Gudas, J.M.; Pardee, A.B.

1987-01-01

Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene

A search for upstream pressure pulses associated with flux transfer events: An AMPTE/ISEE case study

Science.gov (United States)

Elphic, R. C.; Baumjohann, W.; Cattell, C. A.; Luehr, H.; Smith, M. F.

1994-01-01

On September 19, 1984, the Active Magnetospheric Particle Tracers Explorers (AMPTE) United Kingdom Satellite (UKS) and Ion Release Module (IRM) and International Sun Earth Explorers (ISEE) 1 and 2 spacecraft passed outbound through the dayside magnetopause at about the same time. The AMPTE spacecraft pair crossed first and were in the near-subsolar magnetosheath for more than an hour. Meanwhile the ISEE pair, about 5 R(sub E) to the south, observed flux transfer event (FTE) signatures. We use the AMPTE UKS and IRM plasma and field observations of magnetosheath conditions directly upstream of the subsolar magnetopause to check whether pressure pulses are responsible for the FTE signatures seen at ISEE. Pulses in both the ion thermal pressure and the dynamic pressure are observed in the magnetosheath early on when IRM and UKS are close to the magnetopause, but not later. These large pulses appear to be related to reconnection going on at the magnetopause nearby. AMPTE magnetosheath data far from the magnetopause do not show a pressure pulse correlation with FTEs at ISEE. Moreover, the magnetic pressure and tension effects seen in the ISEE FTEs are much larger than any pressure effects seen in the magnetosheath. A superposed epoch analysis based on small-amplitude peaks in the AMPTE magnetosheath total static pressure (nkT + B(exp 2)/2 mu(sub 0)) hint at some boundary effects, less than 5 nT peak-to-peak variations in the ISEE 1 and 2 B(sub N) signature starting about 1 min after the pressure peak epoch. However, these variations are much smaller than the standard deviations of the B(sub N) field component. Thus the evidence from this case study suggests that upstream magnetosheath pressure pulses do not give rise to FTEs, but may produce very small amplitude signatures in the magnetic field at the magnetopause.

Computational methods in sequence and structure prediction

Science.gov (United States)

Lang, Caiyi

This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed

Hydrolytic activities of extracellular enzymes in thermophilic and mesophilic anaerobic sequencing-batch reactors treating organic fractions of municipal solid wastes.

Science.gov (United States)

Kim, Hyun-Woo; Nam, Joo-Youn; Kang, Seok-Tae; Kim, Dong-Hoon; Jung, Kyung-Won; Shin, Hang-Sik

2012-04-01

Extracellular enzymes offer active catalysis for hydrolysis of organic solid wastes in anaerobic digestion. To evidence the quantitative significance of hydrolytic enzyme activities for major waste components, track studies of thermophilic and mesophilic anaerobic sequencing-batch reactors (TASBR and MASBR) were conducted using a co-substrate of real organic wastes. During 1day batch cycle, TASBR showed higher amylase activity for carbohydrate (46%), protease activity for proteins (270%), and lipase activity for lipids (19%) than MASBR. In particular, the track study of protease identified that thermophilic anaerobes degraded protein polymers much more rapidly. Results revealed that differences in enzyme activities eventually affected acidogenic and methanogenic performances. It was demonstrated that the superior nature of enzymatic capability at thermophilic condition led to successive high-rate acidogenesis and 32% higher CH(4) recovery. Consequently, these results evidence that the coupling thermophilic digestion with sequencing-batch operation is a viable option to promote enzymatic hydrolysis of organic particulates. Copyright © 2012 Elsevier Ltd. All rights reserved.

Nucleocytoplasmic shuttling activity of ataxin-3.

Directory of Open Access Journals (Sweden)

Sandra Macedo-Ribeiro

2009-06-01

Full Text Available Spinocerebellar ataxia type-3, also known as Machado-Joseph Disease (MJD, is one of many inherited neurodegenerative disorders caused by polyglutamine-encoding CAG repeat expansions in otherwise unrelated genes. Disease protein misfolding and aggregation, often within the nucleus of affected neurons, characterize polyglutamine disorders. Several evidences have implicated the nucleus as the primary site of pathogenesis for MJD. However, the molecular determinants for the nucleocytoplasmic transport of human ataxin-3 (Atx3, the protein which is mutated in patients with MJD, are not characterized. In order to characterize the nuclear shuttling activity of Atx3, we performed yeast nuclear import assays and found that Atx3 is actively imported into the nucleus, by means of a classical nuclear localizing sequence formed by a cluster of lysine and arginine residues. On the other hand, when active nuclear export was inhibited using leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, both endogenous Atx3 and transfected GFP-Atx3 accumulated inside the nucleus of a subpopulation of COS-7 cells, whereas both proteins are normally predominant in the cytoplasm. Additionally, using a Rev(1.4-GFP nuclear export assay, we performed an extensive analysis of six putative aliphatic nuclear export motifs identified in Atx3 amino acid sequence. Although none of the tested peptide sequences were found to drive nuclear export when isolated, we have successfully mapped the region of Atx3 responsible for its CRM1-independent nuclear export activity. Curiously, the N-terminal Josephin domain alone is exported into the cytoplasm, but the nuclear export activity of Atx3 is significantly enhanced in a longer construct that is truncated after the two ubiquitin interaction motifs, upstream from the polyQ tract. Our data show that Atx3 is actively imported to and exported from the cell nucleus, and that its nuclear export activity is dependent on a motif

Anthropogenic Phosphorus Inputs to a River Basin and Their Impacts on Phosphorus Fluxes Along Its Upstream-Downstream Continuum

Science.gov (United States)

Zhang, Wangshou; Swaney, Dennis P.; Hong, Bongghi; Howarth, Robert W.

2017-12-01

The increasing trend in riverine phosphorus (P) loads resulting from anthropogenic inputs has gained wide attention because of the well-known role of P in eutrophication. So far, however, there is still limited scientific understanding of anthropogenic P inputs and their impacts on riverine flux in river reaches along the upstream-to-downstream continuum. Here we investigated P budgets in a series of nested watersheds draining into Hongze Lake of China and developed an empirical function to describe the relationship between anthropogenic inputs and riverine P fluxes. Our results indicated that there are obvious gradients regarding P budgets in response to changes in human activities. Fertilizer application and food and feed P import was always the dominant source of P inputs in all sections, followed by nonfood P. Further interpretation using the model revealed the processes of P loading to the lake. About 2%-9% of anthropogenic P inputs are transported from the various sections into the corresponding tributaries of the river systems, depending upon local precipitation rates. Of this amount, around 41%-95% is delivered to the main stem of the Huai River after in-stream attenuation in its tributaries. Ultimately, 55%-86% of the P loads delivered to different locations of the main stem are transported into the receiving lake of the downstream, due to additional losses in the main stem. An integrated P management strategy that considers the gradients of P loss along the upstream-to-downstream continuum is required to assess and optimize P management to protect the region's freshwater resource.

Natural gas domestic market development for total elimination of routine flares in Nigeria's upstream petroleum operations

International Nuclear Information System (INIS)

Sonibare, J.A.; Akeredolu, F.A.

2006-01-01

Several research findings confirmed that gaseous emissions and thermal radiation emanate from flaring activities during separation of oil from gas in the petroleum upstream operations. This, coupled with identified degradation potential of flares, makes flaring of about 71 million m 3 /day of associated gas a great concern. In this paper, several efforts hitherto made by government and organized private sectors at monetizing associated natural gas being flared on daily basis in Nigeria were reviewed. Domestic market development, if adopted, could eliminate routine gas flaring by 2008, meeting a goal set by Nigerian Government. Various scenarios considered showed that relatively minor amounts of natural gas could be consumed domestically for cooking; the balance would be absorbed by thermal electricity generation. It could lead to total consumption of between 92 and 140 million m 3 /day of natural gas in the country, representing a fraction of the domestic energy market

Functional assessment of human enhancer activities using whole-genome STARR-sequencing.

Science.gov (United States)

Liu, Yuwen; Yu, Shan; Dhiman, Vineet K; Brunetti, Tonya; Eckart, Heather; White, Kevin P

2017-11-20

Genome-wide quantification of enhancer activity in the human genome has proven to be a challenging problem. Recent efforts have led to the development of powerful tools for enhancer quantification. However, because of genome size and complexity, these tools have yet to be applied to the whole human genome.  In the current study, we use a human prostate cancer cell line, LNCaP as a model to perform whole human genome STARR-seq (WHG-STARR-seq) to reliably obtain an assessment of enhancer activity. This approach builds upon previously developed STARR-seq in the fly genome and CapSTARR-seq techniques in targeted human genomic regions. With an improved library preparation strategy, our approach greatly increases the library complexity per unit of starting material, which makes it feasible and cost-effective to explore the landscape of regulatory activity in the much larger human genome. In addition to our ability to identify active, accessible enhancers located in open chromatin regions, we can also detect sequences with the potential for enhancer activity that are located in inaccessible, closed chromatin regions. When treated with the histone deacetylase inhibitor, Trichostatin A, genes nearby this latter class of enhancers are up-regulated, demonstrating the potential for endogenous functionality of these regulatory elements. WHG-STARR-seq provides an improved approach to current pipelines for analysis of high complexity genomes to gain a better understanding of the intricacies of transcriptional regulation.

THE ACTUAL CONDITIONS OF WETLANDS FROM THE UPSTREAM OF HĂRPĂŞEŞETI RIVER (BAHLUI HYDROGRAPHICAL BASIN

Directory of Open Access Journals (Sweden)

Gheorghe Romanescu

2005-10-01

Full Text Available The Hărpăşeşti river is a right side affluent of the Bahluieţ river. It junctions with the latter in the river-collecting “market” from near Podu Iloaiei. The physico-chemical analysis conducted in the waters and the marshes of the creek relieve an increase of the content of dissolved salts and of the water chemical content as we advance upstream, as a consequence of the fact that these salts are transported from the upstream hydrographical basin. The temperature is higher in the low waters, and the dissolved oxygen has a higher importance in the waters with high depths, lower temperatures and rare aquatic vegetation.

Fall Detection for Elderly from Partially Observed Depth-Map Video Sequences Based on View-Invariant Human Activity Representation

Directory of Open Access Journals (Sweden)

Rami Alazrai

2017-03-01

Full Text Available This paper presents a new approach for fall detection from partially-observed depth-map video sequences. The proposed approach utilizes the 3D skeletal joint positions obtained from the Microsoft Kinect sensor to build a view-invariant descriptor for human activity representation, called the motion-pose geometric descriptor (MPGD. Furthermore, we have developed a histogram-based representation (HBR based on the MPGD to construct a length-independent representation of the observed video subsequences. Using the constructed HBR, we formulate the fall detection problem as a posterior-maximization problem in which the posteriori probability for each observed video subsequence is estimated using a multi-class SVM (support vector machine classifier. Then, we combine the computed posteriori probabilities from all of the observed subsequences to obtain an overall class posteriori probability of the entire partially-observed depth-map video sequence. To evaluate the performance of the proposed approach, we have utilized the Kinect sensor to record a dataset of depth-map video sequences that simulates four fall-related activities of elderly people, including: walking, sitting, falling form standing and falling from sitting. Then, using the collected dataset, we have developed three evaluation scenarios based on the number of unobserved video subsequences in the testing videos, including: fully-observed video sequence scenario, single unobserved video subsequence of random lengths scenarios and two unobserved video subsequences of random lengths scenarios. Experimental results show that the proposed approach achieved an average recognition accuracy of 93 . 6 % , 77 . 6 % and 65 . 1 % , in recognizing the activities during the first, second and third evaluation scenario, respectively. These results demonstrate the feasibility of the proposed approach to detect falls from partially-observed videos.

A novel polymorphic repeat in the upstream regulatory region of the estrogen-induced gene EIG121 is not associated with the risk of developing breast or endometrial cancer.

Science.gov (United States)

Bolton, Katherine A; Holliday, Elizabeth G; Attia, John; Bowden, Nikola A; Avery-Kiejda, Kelly A; Scott, Rodney J

2016-05-26

The estrogen-induced gene 121 (EIG121) has been associated with breast and endometrial cancers, but its mechanism of action remains unknown. In a genome-wide search for tandem repeats, we found that EIG121 contains a short tandem repeat (STR) in its upstream regulatory region which has the potential to alter gene expression. The presence of this STR has not previously been analysed in relation to breast or endometrial cancer risk. In this study, the lengths of this STR were determined by PCR, fragment analysis and sequencing using DNA from 223 breast cancer patients, 204 endometrial cancer patients and 220 healthy controls to determine if they were associated with the risk of developing breast or endometrial cancer. We found this repeat to be highly variable with the number of copies of the AG motif ranging from 27 to 72 and having a bimodal distribution. No statistically significant association was identified between the length of this STR and the risk of developing breast or endometrial cancer or age at diagnosis. The STR in the upstream regulatory region of EIG121 is highly polymorphic, but is not associated with the risk of developing breast or endometrial cancer in the cohorts analysed here. While this polymorphic STR in the regulatory region of EIG121 appears to have no impact on the risk of developing breast or endometrial cancer, its association with disease recurrence or overall survival remains to be determined.

Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a ...

Indian Academy of Sciences (India)

RESEARCH ARTICLE. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a child ... whereby genes are expressed in a parent-of-origin dependent manner. One of the ... lity, neurodevelopmental delay, features of attention deficit hyperactivity .... Received 16 December 2015; accepted 8 January 2016. Unedited ...

Developmental Origins, Epigenetics, and Equity: Moving Upstream.

Science.gov (United States)

Wallack, Lawrence; Thornburg, Kent

2016-05-01

The Developmental Origins of Health and Disease and the related science of epigenetics redefines the meaning of what constitutes upstream approaches to significant social and public health problems. An increasingly frequent concept being expressed is "When it comes to your health, your zip code may be more important than your genetic code". Epigenetics explains how the environment-our zip code-literally gets under our skin, creates biological changes that increase our vulnerability for disease, and even children's prospects for social success, over their life course and into future generations. This science requires us to rethink where disease comes from and the best way to promote health. It identifies the most fundamental social equity issue in our society: that initial social and biological disadvantage, established even prior to birth, and linked to the social experience of prior generations, is made worse by adverse environments throughout the life course. But at the same time, it provides hope because it tells us that a concerted focus on using public policy to improve our social, physical, and economic environments can ultimately change our biology and the trajectory of health and social success into future generations.

A numerical study on the flow upstream of a wind turbine on complex terran

DEFF Research Database (Denmark)

Meyer Forsting, Alexander Raul; Bechmann, Andreas; Troldborg, Niels

2016-01-01

The interaction of a wind turbine with the upstream flow-field in complex and flat terrain is studied using Reynolds-averaged Navier-Stokes (RANS) simulations with a two equation turbulence closure. The complex site modelled is Perdigao (Portugal), where a turbine is located on one of two parallel...... the wind turbine wake trajectory which in turn governs the orientation of the induction zone...

cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

International Nuclear Information System (INIS)

Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

1987-01-01

The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

Measurements of energy spectra of fast electrons from PF-1000 in the upstream and downstream directions

Energy Technology Data Exchange (ETDEWEB)

Kwiatkowski, R.; Czaus, K.; Skladnik-Sadowska, E.; Malinowski, K.; Zebrowski, J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Sadowski, M.J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Karpinski, L.; Paduch, M.; Scholz, M. [Institute of Plasma Physics and Laser Microfusion (IPPLM), 01-497 Warsaw (Poland); Kubes, P. [Czech Technical University (CVUT), 166-27 Prague, (Czech Republic)

2011-07-01

The paper describes measurements of energy spectra of electrons emitted in the upstream direction along the symmetry-axis of the PF-1000 facility, operated with the deuterium filling at 21 kV, 290 kJ. The measurements were performed with a magnetic analyzer. The same analyzer was used to measure also electron beams emitted in along the symmetry-axis in the downstream direction. The recorded spectra showed that the electron-beams emitted in the upstream direction have energies in the range from about 40 keV to about 800 keV, while those in the downstream direction have energies in the range from about 60 keV to about 200 keV. These spectra confirm that in the PF (Plasma Focus) plasma column there appear strong local fields accelerating charged particles in different directions. This document is composed of a paper and a poster. (authors)

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

Science.gov (United States)

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

The role of heterologous chloroplast sequence elements in transgene integration and expression.

Science.gov (United States)

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-04-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

Sequencing Larger Intact Proteins (30-70 kDa) with Activated Ion Electron Transfer Dissociation

Science.gov (United States)

Riley, Nicholas M.; Westphall, Michael S.; Coon, Joshua J.

2018-01-01

The analysis of intact proteins via mass spectrometry can offer several benefits to proteome characterization, although the majority of top-down experiments focus on proteoforms in a relatively low mass range (AI-ETD) to proteins in the 30-70 kDa range. AI-ETD leverages infrared photo-activation concurrent to ETD reactions to improve sequence-informative product ion generation. This method generates more product ions and greater sequence coverage than conventional ETD, higher-energy collisional dissociation (HCD), and ETD combined with supplemental HCD activation (EThcD). Importantly, AI-ETD provides the most thorough protein characterization for every precursor ion charge state investigated in this study, making it suitable as a universal fragmentation method in top-down experiments. Additionally, we highlight several acquisition strategies that can benefit characterization of larger proteins with AI-ETD, including combination of spectra from multiple ETD reaction times for a given precursor ion, multiple spectral acquisitions of the same precursor ion, and combination of spectra from two different dissociation methods (e.g., AI-ETD and HCD). In all, AI-ETD shows great promise as a method for dissociating larger intact protein ions as top-down proteomics continues to advance into larger mass ranges. [Figure not available: see fulltext.

Sequencing Events: Exploring Art and Art Jobs.

Science.gov (United States)

Stephens, Pamela Geiger; Shaddix, Robin K.

2000-01-01

Presents an activity for upper-elementary students that correlates the actions of archaeologists, patrons, and artists with the sequencing of events in a logical order. Features ancient Egyptian art images. Discusses the preparation of materials, motivation, a pre-writing activity, and writing a story in sequence. (CMK)

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

Science.gov (United States)

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

The Colliding Beams Sequencer

International Nuclear Information System (INIS)

Johnson, D.E.; Johnson, R.P.

1989-01-01

The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

Research on Cavitation Regions of Upstream Pumping Mechanical Seal Based on Dynamic Mesh Technique

Directory of Open Access Journals (Sweden)

Huilong Chen

2014-08-01

Full Text Available In order to study the cavitation area of the Upstream Pumping Mechanical Seal, three-dimensional microgap inner flow field of the Upstream Pumping Mechanical Seal was simulated with multiphase flow cavitation model and dynamic mesh technique based on hydrodynamic lubrication theory. Furthermore, the simulated result was compared with the experimental data. The results show that the simulated result with the Zwart-Gerber-Belamri cavitation model was much closer to the experimental data. The area of cavitation inception mainly occurred at the concave side of the spiral groove and surrounding region without spiral grooves, which was nearly covered by the inner diameter to roots of grooves; in addition, the region near the surface of the stationary ring was primary cavitation location. The area of cavitation has little relationship with the medium pressure; however, it became larger following increasing rotating speed in the range of researched operating conditions. Moreover the boundary of cavitated area was transformed from smooth to rough, which occurred in similar film thickness. When cavitation number was decreasing, which was conducive to improving the lubrication performance of sealed auxiliary, it made the sealing stability decline.

Detailed study of electron plasma waves upstream of the earth's bow shock

International Nuclear Information System (INIS)

Etcheto, J.; Faucheux, M.

1984-01-01

A detailed study of electron plasma waves observed upstream of the earth's bow shock and of their relationships to the position of the satellite in the foreshock and to the electron measurements has been carried out. The wave characteristics depend on the position in the electron foreshock: a narrow-bnd (a few percent) and intense (a few millivolts per meter) noise is observed at the plasma frequency at the edge of the foreshock while the spectrum widens (Δf/fapprox. =0.3) at the same time as the power decreases (hundreds of microvolts per meter) deeper (a few earth radii) inside the foreshock. Signals below the plasma frequency are also observed. These waves are polarized along the magnetic field, with long wavelengths below and at the plasma frequency and short wavelengths above it. They appear as short bursts, the duration of which depends on the frequency: longer close to the plasma frequency (50 ms), they shorten with increasing separation from the plasma frequency, the usual duration being 15 ms. While the correlation of the wave characteristics with the reflected electrons is good as the satellite moves inside the foreshock, no evolution is found with the distance to the bow shock, neither for the noise nor for the particles. These results are discussed in the frame of various mechanisms which have been proposed to explain these upstream waves but no satisfactory agreement is found with any of them

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

Science.gov (United States)

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Involvement of JAK2 upstream of the PI 3-kinase in cell-cell adhesion regulation by gastrin

International Nuclear Information System (INIS)

Ferrand, Audrey; Kowalski-Chauvel, Aline; Bertrand, Claudine; Pradayrol, Lucien; Fourmy, Daniel; Dufresne, Marlene; Seva, Catherine

2004-01-01

The Janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling pathway has been implicated in cell transformation and proliferation. Besides aberrant cell proliferation, loss of cell-cell adhesion during epithelial-mesenchymal transition (EMT) is an important event which occurs during development of epithelial cancers. However, the role of JAK-dependent pathways in this process is not known. We analyzed the involvement of these pathways in the regulation of E-cadherin-dependent cell-cell adhesion by gastrin, a mitogenic factor for gastrointestinal (GI) tract. We identified JAK2/STAT3 as a new pathway in gastrin signaling. We demonstrated that JAK2 functions as an upstream mediator of the phosphatidylinositol 3 (PI 3)-kinase activity in gastrin signaling. Indeed, we observed a coprecipitation of both kinases and an inhibition of gastrin-induced PI 3-kinase activation when JAK2 activity is blocked. We also demonstrated that loss of cell-cell adhesion and the increase in cell motility induced by gastrin required the activation of JAK2 and the PI 3-kinase. Indeed, the modifications in localization of adherens junctions proteins and the migration, observed in gastrin-stimulated cells, were reversed by inhibition of both kinases. These results described the involvement of JAK2 in the modulation of cell-cell adhesion in epithelial cells. They support a possible role of JAK2 in the epithelial-mesenchymal transition which occurs during malignant development

Noninvasive reconstruction of the three-dimensional ventricular activation sequence during pacing and ventricular tachycardia in the canine heart.

Science.gov (United States)

Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

2012-01-01

Single-beat imaging of myocardial activation promises to aid in both cardiovascular research and clinical medicine. In the present study we validate a three-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of simultaneous 3D intracardiac mapping to assess its capability to localize endocardial and epicardial initiation sites and image global activation sequences during pacing and ventricular tachycardia (VT) in the canine heart. Body surface potentials were measured simultaneously with bipolar electrical recordings in a closed-chest condition in healthy canines. Computed tomography images were obtained after the mapping study to construct realistic geometry models. Data analysis was performed on paced rhythms and VTs induced by norepinephrine (NE). The noninvasively reconstructed activation sequence was in good agreement with the simultaneous measurements from 3D cardiac mapping with a correlation coefficient of 0.74 ± 0.06, a relative error of 0.29 ± 0.05, and a root mean square error of 9 ± 3 ms averaged over 460 paced beats and 96 ectopic beats including premature ventricular complexes, couplets, and nonsustained monomorphic VTs and polymorphic VTs. Endocardial and epicardial origins of paced beats were successfully predicted in 72% and 86% of cases, respectively, during left ventricular pacing. The NE-induced ectopic beats initiated in the subendocardium by a focal mechanism. Sites of initial activation were estimated to be ∼7 mm from the measured initiation sites for both the paced beats and ectopic beats. For the polymorphic VTs, beat-to-beat dynamic shifts of initiation site and activation pattern were characterized by the reconstruction. The present results suggest that 3DCEI can noninvasively image the 3D activation sequence and localize the origin of activation of paced beats and NE-induced VTs in the canine heart with good accuracy. This 3DCEI technique offers the potential to aid interventional therapeutic procedures for

The Giant Mottled Eel, Anguilla marmorata, Uses Blue-Shifted Rod Photoreceptors during Upstream Migration

OpenAIRE

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity ...

Draft Genome Sequence of Pseudomonas sp. Strain In5 Isolated from a Greenlandic Disease Suppressive Soil with Potent Antimicrobial Activity

DEFF Research Database (Denmark)

Hennessy, Rosanna C.; Glaring, Mikkel Andreas; Frydenlund Michelsen, Charlotte

2015-01-01

Pseudomonas sp. In5 is an isolate of disease suppressive soil with potent activity against pathogens. Its antifungal activity has been linked to a gene cluster encoding nonribosomal peptide synthetases producing the peptides nunamycin and nunapeptin. The genome sequence will provide insight into ...

Interaction of Energetic Particles with Discontinuities Upstream of Strong Shocks

Science.gov (United States)

Malkov, Mikhail; Diamond, Patrick

2008-11-01

Acceleration of particles in strong astrophysical shocks is known to be accompanied and promoted by a number of instabilities which are driven by the particles themselves. One of them is an acoustic (also known as Drury's) instability driven by the pressure gradient of accelerated particles upstream. The generated sound waves naturally steepen into shocks thus forming a shocktrain. Similar magnetoacoustic or Alfven type structures may be driven by pick-up ions, for example. We consider the solutions of kinetic equation for accelerated particles within the shocktrain. The accelerated particles are assumed to be coupled to the flow by an intensive pitch-angle scattering on the self-generated Alfven waves. The implications for acceleration and confinement of cosmic rays in this shock environment will be discussed.

Universal sequence replication, reversible polymerization and early functional biopolymers: a model for the initiation of prebiotic sequence evolution.

Directory of Open Access Journals (Sweden)

Sara Imari Walker

Full Text Available Many models for the origin of life have focused on understanding how evolution can drive the refinement of a preexisting enzyme, such as the evolution of efficient replicase activity. Here we present a model for what was, arguably, an even earlier stage of chemical evolution, when polymer sequence diversity was generated and sustained before, and during, the onset of functional selection. The model includes regular environmental cycles (e.g. hydration-dehydration cycles that drive polymers between times of replication and functional activity, which coincide with times of different monomer and polymer diffusivity. Template-directed replication of informational polymers, which takes place during the dehydration stage of each cycle, is considered to be sequence-independent. New sequences are generated by spontaneous polymer formation, and all sequences compete for a finite monomer resource that is recycled via reversible polymerization. Kinetic Monte Carlo simulations demonstrate that this proposed prebiotic scenario provides a robust mechanism for the exploration of sequence space. Introduction of a polymer sequence with monomer synthetase activity illustrates that functional sequences can become established in a preexisting pool of otherwise non-functional sequences. Functional selection does not dominate system dynamics and sequence diversity remains high, permitting the emergence and spread of more than one functional sequence. It is also observed that polymers spontaneously form clusters in simulations where polymers diffuse more slowly than monomers, a feature that is reminiscent of a previous proposal that the earliest stages of life could have been defined by the collective evolution of a system-wide cooperation of polymer aggregates. Overall, the results presented demonstrate the merits of considering plausible prebiotic polymer chemistries and environments that would have allowed for the rapid turnover of monomer resources and for

Suboptimal Partial Transmit Sequence-Active Interference Cancellation with Particle Swarm Optimization

Directory of Open Access Journals (Sweden)

Tarasak Poramate

2010-01-01

Full Text Available Active interference cancellation (AIC is an effective technique to provide interference avoidance feature for an ultrawideband (UWB OFDM transmitter. Partial transmit sequence-AIC (PTS-AIC, which was recently proposed as an improvement of AIC, requires high computational complexity by doing the exhaustive search of all possible weighting factors whose number grows exponentially with the number of subblocks used. To reduce the complexity of PTS-AIC, this paper proposes a suboptimal way, called particle swarm optimization (PSO, to choose the weighting factors suboptimally without much performance degradation. Both continuous and discrete versions of PSO have been evaluated, and it has been shown that the discrete PSO is able to reduce the complexity significantly without sacrificing the performance of PTS-AIC in many cases.

Noncanonical Expression of a Murine Cytomegalovirus Early Protein CD8 T-Cell Epitope as an Immediate Early Epitope Based on Transcription from an Upstream Gene

Directory of Open Access Journals (Sweden)

Annette Fink

2014-02-01

Full Text Available Viral CD8 T-cell epitopes, represented by viral peptides bound to major histocompatibility complex class-I (MHC-I glycoproteins, are often identified by “reverse immunology”, a strategy not requiring biochemical and structural knowledge of the actual viral protein from which they are derived by antigen processing. Instead, bioinformatic algorithms predicting the probability of C-terminal cleavage in the proteasome, as well as binding affinity to the presenting MHC-I molecules, are applied to amino acid sequences deduced from predicted open reading frames (ORFs based on the genomic sequence. If the protein corresponding to an antigenic ORF is known, it is usually inferred that the kinetic class of the protein also defines the phase in the viral replicative cycle during which the respective antigenic peptide is presented for recognition by CD8 T cells. We have previously identified a nonapeptide from the predicted ORFm164 of murine cytomegalovirus that is presented by the MHC-I allomorph H-2 Dd and that is immunodominant in BALB/c (H-2d haplotype mice. Surprisingly, although the ORFm164 protein gp36.5 is expressed as an Early (E phase protein, the m164 epitope is presented already during the Immediate Early (IE phase, based on the expression of an upstream mRNA starting within ORFm167 and encompassing ORFm164.

Noninvasive imaging of three-dimensional cardiac activation sequence during pacing and ventricular tachycardia.

Science.gov (United States)

Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

2011-08-01

Imaging cardiac excitation within ventricular myocardium is important in the treatment of cardiac arrhythmias and might help improve our understanding of arrhythmia mechanisms. This study sought to rigorously assess the imaging performance of a 3-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of 3D intracardiac mapping from up to 216 intramural sites during paced rhythm and norepinephrine (NE)-induced ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in 13 healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous NE. Computed tomography images were obtained to construct geometry models. The noninvasively imaged activation sequence correlated well with invasively measured counterpart, with a correlation coefficient of 0.72 ± 0.04, and a relative error of 0.30 ± 0.02 averaged over 520 paced beats as well as 73 NE-induced PVCs and VT beats. All PVCs and VT beats initiated in the subendocardium by a nonreentrant mechanism. The averaged distance from the imaged site of initial activation to the pacing site or site of arrhythmias determined from intracardiac mapping was ∼5 mm. For dual-site pacing, the double origins were identified when they were located at contralateral sides of ventricles or at the lateral wall and the apex. 3DCEI can noninvasively delineate important features of focal or multifocal ventricular excitation. It offers the potential to aid in localizing the origins and imaging activation sequences of ventricular arrhythmias, and to provide noninvasive assessment of the underlying arrhythmia mechanisms. Copyright © 2011 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Implications of Upstream Flow Availability for Watershed Surface Water Supply Across the Conterminous United States

Science.gov (United States)

Kai Duan; Ge Sun; Peter V. Caldwell; Steven G. McNulty; Yang Zhang

2018-01-01

Although it is well established that the availability of upstream flow (AUF) affects downstream water supply, its significance has not been rigorously categorized and quantified at fine resolutions. This study aims to fill this gap by providing a nationwide inventory of AUF and local water resource, and assessing their roles in securing water supply across the 2,099 8-...

Complete Genome Sequence of Bacillus velezensis CN026 Exhibiting Antagonistic Activity against Gram-Negative Foodborne Pathogens

OpenAIRE

Nannan, Catherine; Gillis, Annika; Caulier, Simon; Mahillon, Jacques

2018-01-01

ABSTRACT We report here the complete genome sequence of Bacillus velezensis strain CN026, a member of the B. subtilis group, which is known for its many industrial applications. The genome contains 3,995,812 bp and displays six gene clusters potentially involved in strain CN026’s activity against Gram-negative foodborne pathogens.

Decreasing Sports Activity with Increasing Age? Findings from a 20-Year Longitudinal and Cohort Sequence Analysis

Science.gov (United States)

Breuer, Christoph; Wicker, Pamela

2009-01-01

According to cross-sectional studies in sport science literature, decreasing sports activity with increasing age is generally assumed. In this paper, the validity of this assumption is checked by applying more effective methods of analysis, such as longitudinal and cohort sequence analyses. With the help of 20 years' worth of data records from the…

Origin of 30 approximately 100 keV protons observed in the upstream region of the earth's bow shock

International Nuclear Information System (INIS)

Terasawa, T.

1979-01-01

A Fermi-type acceleration model is constructed to explain the origin of energetic protons (30 approximately 100 keV) which have been observed upstream of the bow shock. It is shown that the suprathermal protons (with energy of several keV) can be accelerated up to several tens of keV through the Fermi-type process in which the reflection at the shock front and the scattering in the upstream region are coupled. The efficiency of the scattering process is estimated by using the results of Barnes' quasilinear treatment of the wave excitation. The resultant energy spectrum and flux intensity (10 3 approximately 10 4 protons/(cm 2 s ster keV) in 32 approximately 45.3 keV) are consistent with the observation, and the softening of the energy spectrum observed in the dawn region can be explained by the decrease in the efficiency of the acceleration process in the dawn region due to the curvature of the bow shock and the reduction of shock strength. The spatial distribution of the flux predicted by the model is also consistent with the observation. In view of these consistencies of the Fermi-type acceleration process is suggested as a possible candidate mechanism to explain the upstream protons although it is not intended to exclude other possibilities. (author)

Large eddy simulation of a T-Junction with upstream elbow: The role of Dean vortices in thermal fatigue

International Nuclear Information System (INIS)

Tunstall, R.; Laurence, D.; Prosser, R.; Skillen, A.

2016-01-01

Highlights: • A T-Junction with an upstream bend is studied using wall-resolved LES and POD. • The bend generates Dean vortices which remain prominent downstream of the junction. • Dean vortex swirl-switching results in an unsteady secondary flow about the pipe axis. • This provides a further mechanism for near-wall temperature fluctuations. • Upstream bends can have a crucial role in T-Junction thermal fatigue problems. - Abstract: Turbulent mixing of fluids in a T-Junction can generate oscillating thermal stresses in pipe walls, which may lead to high cycle thermal fatigue. This thermal stripping problem is an important safety issue in nuclear plant thermal-hydraulic systems, since it can lead to unexpected failure of the pipe material. Here, we carry out a large eddy simulation (LES) of a T-Junction with an upstream bend and use proper orthogonal decomposition (POD) to identify the dominant structures in the flow. The bend generates an unsteady secondary flow about the pipe axis, known as Dean vortex swirl-switching. This provides an additional mechanism for low-frequency near-wall temperature fluctuations downstream of the T-Junction, over those that would be produced by mixing in the same T-Junction with straight inlets. The paper highlights the important role of neighbouring pipe bends in T-Junction thermal fatigue problems and the need to include them when using CFD as a predictive tool.

Triple basepair changes within and adjacent to the conserved YY1 motif upstream of the U3 enhancer repeats of SL3-3 murine leukemia virus cause a small but significant shortening of latency of T-lymphoma induction

International Nuclear Information System (INIS)

Ma Shiliang; Lovmand, Jette; Soerensen, Annette Balle; Luz, Arne; Schmidt, Joerg; Pedersen, Finn Skou

2003-01-01

A highly conserved sequence upstream of the transcriptional enhancer in the U3 of murine leukemia viruses (MLVs) was reported to mediate negative regulation of their expression. In transient expression studies, negative regulation was reported to be conferred by coexpression of the transcription factor YY1, which binds to a motif in the upstream conserved region (UCR). To address the function of the UCR and its YY1-motif in an in vivo model of MLV-host interactions we introduced six consecutive triple basepair mutations into this region of the potent T-lymphomagenic SL3-3 MLV. We report that all mutants have retained their replication competence and that they all, like the SL3-3 wild type (wt), induce T-cell lymphomas when injected into newborn mice of the SWR strain. However, all mutants induced disease with slightly shorter latency periods than the wt SL3-3, suggesting that the YY1 motif as well as its immediate context in the UCR have a negative effect on the pathogenicity of the virus. This result may have implications for the design of retroviral vectors

An in situ Comparison of Electron Acceleration at Collisionless Shocks under Differing Upstream Magnetic Field Orientations

Energy Technology Data Exchange (ETDEWEB)

Masters, A.; Dougherty, M. K. [The Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2AZ (United Kingdom); Sulaiman, A. H. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); Stawarz, Ł. [Astronomical Observatory, Jagiellonian University, ul. Orla 171, 30-244 Krakow (Poland); Reville, B. [School of Mathematics and Physics, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Sergis, N. [Office of Space Research and Technology, Academy of Athens, Soranou Efesiou 4, 11527 Athens (Greece); Fujimoto, M. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Burgess, D. [School of Physics and Astronomy, Queen Mary University of London, London E1 4NS (United Kingdom); Coates, A. J., E-mail: a.masters@imperial.ac.uk [Mullard Space Science Laboratory, Department of Space and Climate Physics, University College London, Holmbury St. Mary, Dorking RH5 6NT (United Kingdom)

2017-07-10

A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at a quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.

An assessment of the parameters and experimental data of the continuous water activity monitors operating in the upstream and downstream channels of the Paks nuclear power plant

International Nuclear Information System (INIS)

Nagy, Gy.; Feher, I.

1986-03-01

A NaI(Tl) scintillator was placed into a measuring vessel of 8 msup(3) volume for monitoring the effluents in the upstream and downstream channels of the Paks nuclear power plant. The effects of radioactivity, meteorological parameters, and the atmospheric pressure on the counting rates, and their daily and monthly average values in both channels were analyzed. The short-term increases of the monitor signals could be attributed to rainy weather. The sup(222)Rn countent of water was also evaluated. (author)

Influence of seasonal, diel, lunar, and other environmental factors on upstream fish passage in the igarapava fish ladder, Brazil

Science.gov (United States)

Bizzotto, P.M.; Godinho, Alexandre L.; Vono, V.; Kynard, B.; Godinho, Hugo P.

2009-01-01

Upstream fish passage was evaluated during 12 months in the vertical-slot Igarapava Fish Ladder constructed around Igarapava Dam, in the heavily dammed Grande River, Southeast Brazil. A video monitoring system was used to observe 61,621 fish that passed the ladder, of which 93.5% were identified to 15 taxa. Among the migratory species, the most abundant were Pimelodus maculatus (33.6% of all fish), Leporinus octofasciatus (31.4%), Leporinus friderici (4.5%), and Prochilodus lineatus (3.1%). Seven taxa were classified as nonmigratory, and of these taxa, the small Bryconamericus stramineus was the most abundant (12.7%) of all fishes. Passage of the 'nonmigratory' taxa upstream in the ladder shows they are migratory in this system and have a strong behavioural drive to move to upstream habitat. Passage of most taxa had a strong seasonal pattern. While some species passed primarily during the day, others showed a distinct nocturnal pattern. Lunar phase and water temperature also strongly affected passage of some taxa. Rainfall and dam discharge had a small or null influence on most taxa; perhaps due to the fairly small catchment area of the reservoir and the highly regulated discharge at Igarapava Dam. ?? 2009 John Wiley & Sons A/S.

Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences.

LENUS (Irish Health Repository)

Ivanov, Ivaylo P

2011-05-01

In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5\\' cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized--both for increased coding capacity and potentially also for novel regulatory mechanisms--remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5\\' untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data.

E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

Directory of Open Access Journals (Sweden)

Minami Mazda

Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

Complete Genome Sequence of Bacillus velezensis CN026 Exhibiting Antagonistic Activity against Gram-Negative Foodborne Pathogens.

Science.gov (United States)

Nannan, Catherine; Gillis, Annika; Caulier, Simon; Mahillon, Jacques

2018-01-25

We report here the complete genome sequence of Bacillus velezensis strain CN026, a member of the B. subtilis group, which is known for its many industrial applications. The genome contains 3,995,812 bp and displays six gene clusters potentially involved in strain CN026's activity against Gram-negative foodborne pathogens. Copyright © 2018 Nannan et al.

Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

Science.gov (United States)

Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

2017-08-31

Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

Large-eddy simulations of velocity and temperature fluctuations in hot and cold fluids mixing in a tee junction with an upstream straight or elbow main pipe

International Nuclear Information System (INIS)

Lu, T.; Attinger, D.; Liu, S.M.

2013-01-01

Highlights: • Temperature and velocity fluctuations in a tee junction are predicted using LES. • The numerical results are in good agreement with the experimental data. • Upstream elbow pipe has significant influence on those fluctuations. -- Abstract: Thermal striping resulting in thermal fatigue is an important safety issue for nuclear power plants. In this work, temperature and velocity fluctuations in hot and cold fluids mixing in a tee junction with the main pipe connected either to an upstream straight or elbow pipe have been numerically predicted using large-eddy simulations (LES) on the FLUENT platform with the assumption of fully-developed velocity at both main and branch pipe inlets. The numerical results for the case with an upstream straight pipe were found to be in reasonable agreement with the available experimental data. The reason for the small discrepancy between the numerical results and experimental data can be attributed to the turbulence velocity being 10% of the fully-developed velocity at the main and branch pipe inlets in the LES calculations, while in the experiments the turbulence velocity was about 10% of the average velocity upstream of the tee junction. The simulated normalized mean and root-mean square (RMS) temperatures and the velocities at both straight and elbow tees were then compared, as well as the power spectrum densities (PSD) of the temperature fluctuations. The elbow pipe upstream of the main pipe has a significant influence on the mixing, resulting in increased temperature and velocity fluctuations. The flow pattern of the elbow tee deviates from the wall jet due to the secondary flow in the upstream elbow pipe

Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

Science.gov (United States)

Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

1994-10-01

Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

Production, purification, sequencing and activity spectra of mutacins D-123.1 and F-59.1.

Science.gov (United States)

Nicolas, Guillaume G; LaPointe, Gisèle; Lavoie, Marc C

2011-04-10

The increase in bacterial resistance to antibiotics impels the development of new anti-bacterial substances. Mutacins (bacteriocins) are small antibacterial peptides produced by Streptococcus mutans showing activity against bacterial pathogens. The objective of the study was to produce and characterise additional mutacins in order to find new useful antibacterial substances. Mutacin F-59.1 was produced in liquid media by S. mutans 59.1 while production of mutacin D-123.1 by S. mutans 123.1 was obtained in semi-solid media. Mutacins were purified by hydrophobic chromatography. The amino acid sequences of the mutacins were obtained by Edman degradation and their molecular mass was determined by mass spectrometry. Mutacin F-59.1 consists of 25 amino acids, containing the YGNGV consensus sequence of pediocin-like bacteriocins with a molecular mass calculated at 2719 Da. Mutacin D-123.1 has an identical molecular mass (2364 Da) with the same first 9 amino acids as mutacin I. Mutacins D-123.1 and F-59.1 have wide activity spectra inhibiting human and food-borne pathogens. The lantibiotic mutacin D-123.1 possesses a broader activity spectrum than mutacin F-59.1 against the bacterial strains tested. Mutacin F-59.1 is the first pediocin-like bacteriocin identified and characterised that is produced by Streptococcus mutans. Mutacin D-123.1 appears to be identical to mutacin I previously identified in different strains of S. mutans.

Production, purification, sequencing and activity spectra of mutacins D-123.1 and F-59.1

Directory of Open Access Journals (Sweden)

LaPointe Gisèle

2011-04-01

Full Text Available Abstract Background The increase in bacterial resistance to antibiotics impels the development of new anti-bacterial substances. Mutacins (bacteriocins are small antibacterial peptides produced by Streptococcus mutans showing activity against bacterial pathogens. The objective of the study was to produce and characterise additional mutacins in order to find new useful antibacterial substances. Results Mutacin F-59.1 was produced in liquid media by S. mutans 59.1 while production of mutacin D-123.1 by S. mutans 123.1 was obtained in semi-solid media. Mutacins were purified by hydrophobic chromatography. The amino acid sequences of the mutacins were obtained by Edman degradation and their molecular mass was determined by mass spectrometry. Mutacin F-59.1 consists of 25 amino acids, containing the YGNGV consensus sequence of pediocin-like bacteriocins with a molecular mass calculated at 2719 Da. Mutacin D-123.1 has an identical molecular mass (2364 Da with the same first 9 amino acids as mutacin I. Mutacins D-123.1 and F-59.1 have wide activity spectra inhibiting human and food-borne pathogens. The lantibiotic mutacin D-123.1 possesses a broader activity spectrum than mutacin F-59.1 against the bacterial strains tested. Conclusion Mutacin F-59.1 is the first pediocin-like bacteriocin identified and characterised that is produced by Streptococcus mutans. Mutacin D-123.1 appears to be identical to mutacin I previously identified in different strains of S. mutans.

Energy-Saving Mechanism in WDM/TDM-PON Based on Upstream Network Traffic

Directory of Open Access Journals (Sweden)

Paola Garfias

2014-08-01

Full Text Available One of the main challenges of Passive Optical Networks (PONs is the resource (bandwidth and wavelength management. Since it has been shown that access networks consume a significant part of the overall energy of the telecom networks, the resource management schemes should also consider energy minimization strategies. To sustain the increased bandwidth demand of emerging applications in the access section of the network, it is expected that next generation optical access networks will adopt the wavelength division/time division multiplexing (WDM/TDM technique to increase PONs capacity. Compared with traditional PONs, the architecture of a WDM/TDM-PON requires more transceivers/receivers, hence they are expected to consume more energy. In this paper, we focus on the energy minimization in WDM/TDM-PONs and we propose an energy-efficient Dynamic Bandwidth and Wavelength Allocation mechanism whose objective is to turn off, whenever possible, the unnecessary upstream traffic receivers at the Optical Line Terminal (OLT. We evaluate our mechanism in different scenarios and show that the proper use of upstream channels leads to relevant energy savings. Our proposed energy-saving mechanism is able to save energy at the OLT while maintaining the introduced penalties in terms of packet delay and cycle time within an acceptable range. We might highlight the benefits of our proposal as a mechanism that maximizes the channel utilization. Detailed implementation of the proposed algorithm is presented, and simulation results are reported to quantify energy savings and effects on network performance on different network scenarios.

Does timing and sequencing of transitions to adulthood make a difference? Stress, smoking, and physical activity among young Australian women.

Science.gov (United States)

Bell, Sandra; Lee, Christina

2006-01-01

The major changes of the transition to adulthood are argued to be stressful, and health-related behaviors such as smoking and physical activity may be adopted, consolidated, or abandoned at this time. On the other hand, research has suggested that the normative transitions of emerging adulthood, although involving considerable change, may be associated with low stress because they are perceived as both positive and normal at this life stage. This article examines relations between the timing and sequencing of life transitions and stress and health-related behaviors, focusing on the transition to young adulthood among Australian women. A total of 853 women aged 22 to 27 provided information about the timing and sequencing of 6 life transitions: moving out of home, stopping full-time education, starting full-time work, having the first live-in relationship, marriage, and motherhood-and stress, smoking, and physical activity. Most had moved out of home, stopped full-time education, and started full-time work, but only 14% had undertaken all 6 transitions. Overall, 70% of participants had made transitions "in order." Overall, the findings suggest that the relations between timing and sequencing of transitions, and indicators of health, are moderate for smoking, but small for stress and for physical activity. These effects remained after controlling for socioeconomic status of the participants' families of origin. Matching current social norms for the timing and sequencing of life changes may be of less importance for women's well-being than is commonly believed. Although the significant relations between early or "out of order" transitions and smoking are of concern, the smaller relations with stress and with sedentariness suggest that such transitions may have limited negative consequences, and support the view that individuals are active in choosing the life path that is appropriate for them and their circumstances.

Environmental remediation for the upstream of Yotsugi Mill Tailings Pond, Ningyo-toge Uranium Mine

International Nuclear Information System (INIS)

Saito, Hiroshi; Torikai, Kazuyoshi; Fukushima, Shigeru; Sakao, Ryota; Taki, Tomihiro; Sato, Yasushi; Sakamoto, Atsushi

2016-03-01

Ningyo-toge Environmental Engineering Center has been conducting environmental remediation of the Ningyo-toge Uranium Mine, after decades of mine-related activities including uranium exploration, mining and test milling were terminated. The main purposes of the remediation are to take measures to ensure safety and radiation protection from the exposure pathways to humans in future, and to prevent the occurrence of mining pollution. As part of the remediation, upstream part of the Yotsugi Mill Tailings Pond, the highest prioritized facility among all of the mine-related facilities, has been remediated to fiscal year 2012. In the remediation, multi-layered capping has been constructed using natural material on ground surface, after specifications and whole remediation procedure being examined in terms of long-term stability, radiation protection, economics, and other aspects. Monitoring has been carried out to confirm the effectiveness of the capping, in terms of settlement, underground temperature, dose-rate and radon exhalation rate. Monitoring of drainage volume of penetrated rainwater is planned to begin in future. Accumulated data will be examined and its result will be used for remediation of downstream part of the Pond. (author)

Neurodevelopmental disease-associated de novo mutations and rare sequence variants affect TRIO GDP/GTP exchange factor activity.

Science.gov (United States)

Katrancha, Sara M; Wu, Yi; Zhu, Minsheng; Eipper, Betty A; Koleske, Anthony J; Mains, Richard E

2017-12-01

Bipolar disorder, schizophrenia, autism and intellectual disability are complex neurodevelopmental disorders, debilitating millions of people. Therapeutic progress is limited by poor understanding of underlying molecular pathways. Using a targeted search, we identified an enrichment of de novo mutations in the gene encoding the 330-kDa triple functional domain (TRIO) protein associated with neurodevelopmental disorders. By generating multiple TRIO antibodies, we show that the smaller TRIO9 isoform is the major brain protein product, and its levels decrease after birth. TRIO9 contains two guanine nucleotide exchange factor (GEF) domains with distinct specificities: GEF1 activates both Rac1 and RhoG; GEF2 activates RhoA. To understand the impact of disease-associated de novo mutations and other rare sequence variants on TRIO function, we utilized two FRET-based biosensors: a Rac1 biosensor to study mutations in TRIO (T)GEF1, and a RhoA biosensor to study mutations in TGEF2. We discovered that one autism-associated de novo mutation in TGEF1 (K1431M), at the TGEF1/Rac1 interface, markedly decreased its overall activity toward Rac1. A schizophrenia-associated rare sequence variant in TGEF1 (F1538Intron) was substantially less active, normalized to protein level and expressed poorly. Overall, mutations in TGEF1 decreased GEF1 activity toward Rac1. One bipolar disorder-associated rare variant (M2145T) in TGEF2 impaired inhibition by the TGEF2 pleckstrin-homology domain, resulting in dramatically increased TGEF2 activity. Overall, genetic damage to both TGEF domains altered TRIO catalytic activity, decreasing TGEF1 activity and increasing TGEF2 activity. Importantly, both GEF changes are expected to decrease neurite outgrowth, perhaps consistent with their association with neurodevelopmental disorders. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Imaging cardiac activation sequence during ventricular tachycardia in a canine model of nonischemic heart failure.

Science.gov (United States)

Han, Chengzong; Pogwizd, Steven M; Yu, Long; Zhou, Zhaoye; Killingsworth, Cheryl R; He, Bin

2015-01-15

Noninvasive cardiac activation imaging of ventricular tachycardia (VT) is important in the clinical diagnosis and treatment of arrhythmias in heart failure (HF) patients. This study investigated the ability of the three-dimensional cardiac electrical imaging (3DCEI) technique for characterizing the activation patterns of spontaneously occurring and norepinephrine (NE)-induced VTs in a newly developed arrhythmogenic canine model of nonischemic HF. HF was induced by aortic insufficiency followed by aortic constriction in three canines. Up to 128 body-surface ECGs were measured simultaneously with bipolar recordings from up to 232 intramural sites in a closed-chest condition. Data analysis was performed on the spontaneously occurring VTs (n=4) and the NE-induced nonsustained VTs (n=8) in HF canines. Both spontaneously occurring and NE-induced nonsustained VTs initiated by a focal mechanism primarily from the subendocardium, but occasionally from the subepicardium of left ventricle. Most focal initiation sites were located at apex, right ventricular outflow tract, and left lateral wall. The NE-induced VTs were longer, more rapid, and had more focal sites than the spontaneously occurring VTs. Good correlation was obtained between imaged activation sequence and direct measurements (averaged correlation coefficient of ∼0.70 over 135 VT beats). The reconstructed initiation sites were ∼10 mm from measured initiation sites, suggesting good localization in such a large animal model with cardiac size similar to a human. Both spontaneously occurring and NE-induced nonsustained VTs had focal initiation in this canine model of nonischemic HF. 3DCEI is feasible to image the activation sequence and help define arrhythmia mechanism of nonischemic HF-associated VTs. Copyright © 2015 the American Physiological Society.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

An upstream open reading frame controls translation of var2csa, a gene implicated in placental malaria

DEFF Research Database (Denmark)

Amulic, Borko; Salanti, Ali; Lavstsen, Thomas

2009-01-01

contains a small upstream open reading frame that acts to repress translation of the resulting mRNA, revealing a novel form of gene regulation in malaria parasites. The mechanism underlying this translational repression is reversible, allowing high levels of protein translation upon selection, thus...

Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

International Nuclear Information System (INIS)

Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

1987-01-01

Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis

Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

Energy Technology Data Exchange (ETDEWEB)

Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

1987-12-01

Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis.

Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.

Science.gov (United States)

Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd

2015-04-01

SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

Science.gov (United States)

Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

2017-09-06

Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the

Test of a non-physical barrier consisting of light, sound, and bubble screen to block upstream movement of sea lamprey in an experimental raceway

Science.gov (United States)

Miehls, Scott M.; Johnson, Nicholas S.; Hrodey, Pete J.

2017-01-01

Control of the invasive Sea Lamprey Petromyzon marinus is critical for management of commercial and recreational fisheries in the Laurentian Great Lakes. Use of physical barriers to block Sea Lampreys from spawning habitat is a major component of the control program. However, the resulting interruption of natural streamflow and blockage of nontarget species present substantial challenges. Development of an effective nonphysical barrier would aid the control of Sea Lampreys by eliminating their access to spawning locations while maintaining natural streamflow. We tested the effect of a nonphysical barrier consisting of strobe lights, low-frequency sound, and a bubble screen on the movement of Sea Lampreys in an experimental raceway designed as a two-choice maze with a single main channel fed by two identical inflow channels (one control and one blocked). Sea Lampreys were more likely to move upstream during trials when the strobe light and low-frequency sound were active compared with control trials and trials using the bubble screen alone. For those Sea Lampreys that did move upstream to the confluence of inflow channels, no combination of stimuli or any individual stimulus significantly influenced the likelihood that Sea Lampreys would enter the blocked inflow channel, enter the control channel, or return downstream.

Upstream vertical cavity surface-emitting lasers for fault monitoring and localization in WDM passive optical networks

Science.gov (United States)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.

2008-04-01

As wavelength division multiplexed passive optical networks (WDM-PONs) are expected to be first deployed to transport high capacity services to business customers, real-time knowledge of fiber/device faults and the location of such faults will be a necessity to guarantee reliability. Nonetheless, the added benefit of implementing fault monitoring capability should only incur minimal cost associated with upgrades to the network. In this work, we propose and experimentally demonstrate a fault monitoring and localization scheme based on a highly-sensitive and potentially low-cost monitor in conjunction with vertical cavity surface-emitting lasers (VCSELs). The VCSELs are used as upstream transmitters in the WDM-PON. The proposed scheme benefits from the high reflectivity of the top distributed Bragg reflector (DBR) mirror of optical injection-locked (OIL) VCSELs to reflect monitoring channels back to the central office for monitoring. Characterization of the fault monitor demonstrates high sensitivity, low bandwidth requirements, and potentially low output power. The added advantage of the proposed fault monitoring scheme incurs only a 0.5 dB penalty on the upstream transmissions on the existing infrastructure.

Translational database selection and multiplexed sequence capture for up front filtering of reliable breast cancer biomarker candidates.

Directory of Open Access Journals (Sweden)

Patrik L Ståhl

Full Text Available Biomarker identification is of utmost importance for the development of novel diagnostics and therapeutics. Here we make use of a translational database selection strategy, utilizing data from the Human Protein Atlas (HPA on differentially expressed protein patterns in healthy and breast cancer tissues as a means to filter out potential biomarkers for underlying genetic causatives of the disease. DNA was isolated from ten breast cancer biopsies, and the protein coding and flanking non-coding genomic regions corresponding to the selected proteins were extracted in a multiplexed format from the samples using a single DNA sequence capture array. Deep sequencing revealed an even enrichment of the multiplexed samples and a great variation of genetic alterations in the tumors of the sampled individuals. Benefiting from the upstream filtering method, the final set of biomarker candidates could be completely verified through bidirectional Sanger sequencing, revealing a 40 percent false positive rate despite high read coverage. Of the variants encountered in translated regions, nine novel non-synonymous variations were identified and verified, two of which were present in more than one of the ten tumor samples.

Noninvasive reconstruction of the three-dimensional ventricular activation sequence during pacing and ventricular tachycardia in the rabbit heart.

Science.gov (United States)

Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

2011-01-01

Ventricular arrhythmias represent one of leading causes for sudden cardiac death, a significant problem in public health. Noninvasive imaging of cardiac electric activities associated with ventricular arrhythmias plays an important role in better our understanding of the mechanisms and optimizing the treatment options. The present study aims to rigorously validate a novel three-dimensional (3-D) cardiac electrical imaging (3-DCEI) technique with the aid of 3-D intra-cardiac mapping during paced rhythm and ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in thirteen healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous norepinephrine (NE). The non-invasively imaged activation sequence correlated well with invasively measured counterparts, with a correlation coefficient of 0.72 and a relative error of 0.30 averaged over all paced beats and NE-induced PVCs and VT beats. The averaged distance from imaged site of initial activation to measured site determined from intra-cardiac mapping was ∼5mm. These promising results suggest that 3-DCEI is feasible to non-invasively localize the origins and image activation sequence of focal ventricular arrhythmias.

Improvement in Product Development: Use of back-end data to support upstream efforts of Robust Design Methodology

Directory of Open Access Journals (Sweden)

Vanajah Siva

2012-12-01

Full Text Available In the area of Robust Design Methodology (RDM less is done on how to use and work with data from the back-end of the product development process to support upstream improvement. The purpose of this paper is to suggest RDM practices for the use of customer claims data in early design phases as a basis for improvements. The back-end data, when systematically analyzed and fed back into the product development process, aids in closing the product development loop from claims to improvement in the design phase. This is proposed through a flow of claims data analysis tied to an existing tool, namely Failure Mode and Effects Analysis (FMEA. The systematic and integrated analysis of back-end data is suggested as an upstream effort of RDM to increase understanding of noise factors during product usage based on the feedback of claims data to FMEA and to address continuous improvement in product development.

Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

Science.gov (United States)

Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

2016-11-18

Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

Beyond police crisis intervention: moving "upstream" to manage cases and places of behavioral health vulnerability.

Science.gov (United States)

Wood, Jennifer D; Beierschmitt, Laura

2014-01-01

Law enforcement officers continue to serve on the front lines as mental health interventionists, and as such have been subject to a wave of "first generation" reform designed to enhance their crisis response capabilities. Yet, this focus on crisis intervention has not answered recent calls to move "upstream" and bolster early intervention in the name of long-term recovery. This paper reports on findings from an action research project in Philadelphia aimed at exploring opportunities for enhanced upstream engagement. Study methods include spatial analyses of police mental health transportations from an eight year period (2004-2011) and qualitative data from twenty-three "framing conversations" with partners and other stakeholders, seven focus groups with police and outreach workers, five key informant interviews as well as document reviews of the service delivery system in Philadelphia. Recommendations include the need to move beyond a focus on what police can do to a wider conception of city agencies and business stakeholders who can influence vulnerable people and vulnerable spaces of the city. We argue for the need to develop shared principles and rules of engagement that clarify roles and stipulate how best to enlist city resources in a range of circumstances. Since issues of mental health, substance use and disorder are so tightly coupled, we stress the importance of establishing a data-driven approach to crime and disorder reduction in areas of the city we term "hotspots of vulnerability". In line with a recovery philosophy, such an approach should reduce opportunities for anti-social behavior among the "dually labeled" in ways consistent with "procedural justice". Furthermore, crime and disorder data flowing from police and security to behavioral health analysts could contribute to a more focused case management of "repeat utilizers" across the two systems. Our central argument is that a twin emphasis on "case management" and "place management" may provide

A time series based sequence prediction algorithm to detect activities of daily living in smart home.

Science.gov (United States)

Marufuzzaman, M; Reaz, M B I; Ali, M A M; Rahman, L F

2015-01-01

The goal of smart homes is to create an intelligent environment adapting the inhabitants need and assisting the person who needs special care and safety in their daily life. This can be reached by collecting the ADL (activities of daily living) data and further analysis within existing computing elements. In this research, a very recent algorithm named sequence prediction via enhanced episode discovery (SPEED) is modified and in order to improve accuracy time component is included. The modified SPEED or M-SPEED is a sequence prediction algorithm, which modified the previous SPEED algorithm by using time duration of appliance's ON-OFF states to decide the next state. M-SPEED discovered periodic episodes of inhabitant behavior, trained it with learned episodes, and made decisions based on the obtained knowledge. The results showed that M-SPEED achieves 96.8% prediction accuracy, which is better than other time prediction algorithms like PUBS, ALZ with temporal rules and the previous SPEED. Since human behavior shows natural temporal patterns, duration times can be used to predict future events more accurately. This inhabitant activity prediction system will certainly improve the smart homes by ensuring safety and better care for elderly and handicapped people.

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

Science.gov (United States)

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Upstream transcription factor 1 (USF1) in risk of type 2 diabetes: association study in 2000 Dutch Caucasians

NARCIS (Netherlands)

Meex, S.J.; Vliet-Ostaptchouk, J.V.; Kallen, van der C.J.H.; Greevenbroek, M.M.; Schalkwijk, C.G.; Feskens, E.J.M.; Blaak, E.E.; Wijmenga, C.; Hofker, M.H.; Stehouwer, C.D.; Bruin, T.W.

2008-01-01

Type 2 diabetes shares substantial genetic and phenotypic overlap with familial combined hyperlipidemia. Upstream stimulatory factor 1 (USF1), a well-established susceptibility gene for familial combined hyperlipidemia, is postulated to be such a shared genetic determinant. We evaluated two

NMDA receptor activation upstream of methyl farnesoate signaling for short day-induced male offspring production in the water flea, Daphnia pulex.

Science.gov (United States)

Toyota, Kenji; Miyakawa, Hitoshi; Yamaguchi, Katsushi; Shigenobu, Shuji; Ogino, Yukiko; Tatarazako, Norihisa; Miyagawa, Shinichi; Iguchi, Taisen

2015-03-14

The cladoceran crustacean Daphnia pulex produces female offspring by parthenogenesis under favorable conditions, but in response to various unfavorable external stimuli, it produces male offspring (environmental sex determination: ESD). We recently established an innovative system for ESD studies using D. pulex WTN6 strain, in which the sex of the offspring can be controlled simply by changes in the photoperiod: the long-day and short-day conditions can induce female and male offspring, respectively. Taking advantage of this system, we demonstrated that de novo methyl farnesoate (MF) synthesis is necessary for male offspring production. These results indicate the key role of innate MF signaling as a conductor between external environmental stimuli and the endogenous male developmental pathway. Despite these findings, the molecular mechanisms underlying up- and downstream signaling of MF have not yet been well elucidated in D. pulex. To elucidate up- and downstream events of MF signaling during sex determination processes, we compared the transcriptomes of daphnids reared under the long-day (female) condition with short-day (male) and MF-treated (male) conditions. We found that genes involved in ionotropic glutamate receptors, known to mediate the vast majority of excitatory neurotransmitting processes in various organisms, were significantly activated in daphnids by the short-day condition but not by MF treatment. Administration of specific agonists and antagonists, especially for the N-methyl-D-aspartic acid (NMDA) receptor, strongly increased or decreased, respectively, the proportion of male-producing mothers. Moreover, we also identified genes responsible for male production (e.g., protein kinase C pathway-related genes). Such genes were generally shared between the short-day reared and MF-treated daphnids. We identified several candidate genes regulating ESD which strongly suggests that these genes may be essential factors for male offspring production as an

Key concerns of U.K. oil and gas company directors for upstream oil developments

International Nuclear Information System (INIS)

Anon.

1996-01-01

Energy 2006 is a survey published by Ernst and Young presenting the main concerns over the past decade of the UK company directors. The upstream conclusions are presented here. In the medium term (3 years) and long term (10 years), the main concerns were with replacing reserves and with oil price changes. Company re-organisation etc., de-regulation of the gas market, maximising production, return of Iraq to the oil market, and environmental issues were also of concern. (author)

Deep brine recognition upstream the EBE syndicate. Geochemical and isotopic investigations. Final report

International Nuclear Information System (INIS)

2009-01-01

The authors report and discuss the results obtained after performing a drilling upstream the drinkable water harnessing field of a water supply syndicate in Alsace (Ensisheim, Bollwiller and surroundings), in order to confirm the existence of a deep brine source. This brine is diluted by recent waters. The first isotopic investigations do not allow the origin of this brine to be identified, but fractures due to some seismic events are suspected. The report presents the drilling and the various aspects of the chemical and isotopic studies (sampling, physico-chemical analysis, dating, identification of various isotopes)

Sequence Comparison: Close and Open problems

NARCIS (Netherlands)

Lenzini, Gabriele; Cerrai, P.; Freguglia, P.

Comparing sequences is a very important activity both in computer science and in a many other areas as well. For example thank to text editors, everyone knows the particular instance of a sequence comparison problem knonw as ``string mathcing problem''. It consists in searching a given work

Systematic identification of cis-regulatory sequences active in mouse and human embryonic stem cells.

Directory of Open Access Journals (Sweden)

Marica Grskovic

2007-08-01

Full Text Available Understanding the transcriptional regulation of pluripotent cells is of fundamental interest and will greatly inform efforts aimed at directing differentiation of embryonic stem (ES cells or reprogramming somatic cells. We first analyzed the transcriptional profiles of mouse ES cells and primordial germ cells and identified genes upregulated in pluripotent cells both in vitro and in vivo. These genes are enriched for roles in transcription, chromatin remodeling, cell cycle, and DNA repair. We developed a novel computational algorithm, CompMoby, which combines analyses of sequences both aligned and non-aligned between different genomes with a probabilistic segmentation model to systematically predict short DNA motifs that regulate gene expression. CompMoby was used to identify conserved overrepresented motifs in genes upregulated in pluripotent cells. We show that the motifs are preferentially active in undifferentiated mouse ES and embryonic germ cells in a sequence-specific manner, and that they can act as enhancers in the context of an endogenous promoter. Importantly, the activity of the motifs is conserved in human ES cells. We further show that the transcription factor NF-Y specifically binds to one of the motifs, is differentially expressed during ES cell differentiation, and is required for ES cell proliferation. This study provides novel insights into the transcriptional regulatory networks of pluripotent cells. Our results suggest that this systematic approach can be broadly applied to understanding transcriptional networks in mammalian species.

The evolution of coronal activity in main sequence cool stars

International Nuclear Information System (INIS)

Stern, R.A.

1984-01-01

Stars spend most of their lifetime and show the least amount of nuclear evolution on the main sequence. However, the x-ray luminosities of cool star coronas change by orders of magnitude as a function of main sequence age. Such coronal evolution is discussed in relation to our knowledge of the solar corona, solar and stellar flares, stellar rotation and binarity. The relevance of X-ray observations to current speculations on stellar dynamos is also considered

Factors Affecting the Survival of Upstream Migrant Adult Salmonids in the Columbia River Basin : Recovery Issues for Threatened and Endangered Snake River Salmon : Technical Report 9 of 11.

Energy Technology Data Exchange (ETDEWEB)

Dauble, Dennis D.; Mueller, Robert P.

1993-06-01

The Bonneville Power Administration (BPA) is developing conservation planning documentation to support the National Marine Fisheries Service`s (NMFS) recovery plan for Columbia Basin salmonid stocks that are currently listed under the Endangered Species Act (ESA). Information from the conservation planning documentation will be used as a partial scientific basis for identifying alternative conservation strategies and to make recommendations toward conserving, rebuilding, and ultimately removing these salmon stocks from the list of endangered species. This report describes the adult upstream survival study, a synthesis of biological analyses related to conditions affecting the survival of adult upstream migrant salmonids in the Columbia River system. The objective of the adult upstream survival study was to analyze existing data related to increasing the survival of adult migrant salmonids returning to the Snake River system. The fate and accountability of each stock during its upstream migration period and the uncertainties associated with measurements of escapement and survival were evaluated. Operational measures that affected the survival of adult salmon were evaluated including existing conditions, augmented flows from upstream storage release, and drawdown of mainstem reservoirs. The potential impacts and benefits of these measures to each ESA stock were, also described based on considerations of species behavior and run timing.

Neural Sequence Generation Using Spatiotemporal Patterns of Inhibition.

Directory of Open Access Journals (Sweden)

Jonathan Cannon

2015-11-01

Full Text Available Stereotyped sequences of neural activity are thought to underlie reproducible behaviors and cognitive processes ranging from memory recall to arm movement. One of the most prominent theoretical models of neural sequence generation is the synfire chain, in which pulses of synchronized spiking activity propagate robustly along a chain of cells connected by highly redundant feedforward excitation. But recent experimental observations in the avian song production pathway during song generation have shown excitatory activity interacting strongly with the firing patterns of inhibitory neurons, suggesting a process of sequence generation more complex than feedforward excitation. Here we propose a model of sequence generation inspired by these observations in which a pulse travels along a spatially recurrent excitatory chain, passing repeatedly through zones of local feedback inhibition. In this model, synchrony and robust timing are maintained not through redundant excitatory connections, but rather through the interaction between the pulse and the spatiotemporal pattern of inhibition that it creates as it circulates the network. These results suggest that spatially and temporally structured inhibition may play a key role in sequence generation.

Neural Sequence Generation Using Spatiotemporal Patterns of Inhibition.

Science.gov (United States)

Cannon, Jonathan; Kopell, Nancy; Gardner, Timothy; Markowitz, Jeffrey

2015-11-01

Stereotyped sequences of neural activity are thought to underlie reproducible behaviors and cognitive processes ranging from memory recall to arm movement. One of the most prominent theoretical models of neural sequence generation is the synfire chain, in which pulses of synchronized spiking activity propagate robustly along a chain of cells connected by highly redundant feedforward excitation. But recent experimental observations in the avian song production pathway during song generation have shown excitatory activity interacting strongly with the firing patterns of inhibitory neurons, suggesting a process of sequence generation more complex than feedforward excitation. Here we propose a model of sequence generation inspired by these observations in which a pulse travels along a spatially recurrent excitatory chain, passing repeatedly through zones of local feedback inhibition. In this model, synchrony and robust timing are maintained not through redundant excitatory connections, but rather through the interaction between the pulse and the spatiotemporal pattern of inhibition that it creates as it circulates the network. These results suggest that spatially and temporally structured inhibition may play a key role in sequence generation.

Sleep-Active Neurons: Conserved Motors of Sleep