WorldWideScience

Sample records for unveils important genome

  1. Tempo and mode of genomic mutations unveil human evolutionary history.

    Science.gov (United States)

    Hara, Yuichiro

    2015-01-01

    Mutations that have occurred in human genomes provide insight into various aspects of evolutionary history such as speciation events and degrees of natural selection. Comparing genome sequences between human and great apes or among humans is a feasible approach for inferring human evolutionary history. Recent advances in high-throughput or so-called 'next-generation' DNA sequencing technologies have enabled the sequencing of thousands of individual human genomes, as well as a variety of reference genomes of hominids, many of which are publicly available. These sequence data can help to unveil the detailed demographic history of the lineage leading to humans as well as the explosion of modern human population size in the last several thousand years. In addition, high-throughput sequencing illustrates the tempo and mode of de novo mutations, which are producing human genetic variation at this moment. Pedigree-based human genome sequencing has shown that mutation rates vary significantly across the human genome. These studies have also provided an improved timescale of human evolution, because the mutation rate estimated from pedigree analysis is half that estimated from traditional analyses based on molecular phylogeny. Because of the dramatic reduction in sequencing cost, sequencing on-demand samples designed for specific studies is now also becoming popular. To produce data of sufficient quality to meet the requirements of the study, it is necessary to set an explicit sequencing plan that includes the choice of sample collection methods, sequencing platforms, and number of sequence reads.

  2. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  3. Massive gene losses in Asian cultivated rice unveiled by comparative genome analysis

    Directory of Open Access Journals (Sweden)

    Itoh Takeshi

    2010-02-01

    Full Text Available Abstract Background Rice is one of the most important food crops in the world. With increasing world demand for food crops, there is an urgent need to develop new cultivars that have enhanced performance with regard to yield, disease resistance, and so on. Wild rice is expected to provide useful genetic resources that could improve the present cultivated species. However, the quantity and quality of these unexplored resources remain unclear. Recent accumulation of the genomic information of both cultivated and wild rice species allows for their comparison at the molecular level. Here, we compared the genome sequence of Oryza sativa ssp. japonica with sets of bacterial artificial chromosome end sequences (BESs from two wild rice species, O. rufipogon and O. nivara, and an African rice species, O. glaberrima. Results We found that about four to five percent of the BESs of the two wild rice species and about seven percent of the African rice could not be mapped to the japonica genome, suggesting that a substantial number of genes have been lost in the japonica rice lineage; however, their close relatives still possess their counterpart genes. We estimated that during evolution, O. sativa has lost at least one thousand genes that are still preserved in the genomes of the other species. In addition, our BLASTX searches against the non-redundant protein sequence database showed that disease resistance-related proteins were significantly overrepresented in the close relative-specific genomic portions. In total, 235 unmapped BESs of the three relatives matched 83 non-redundant proteins that contained a disease resistance protein domain, most of which corresponded to an NBS-LRR domain. Conclusion We found that the O. sativa lineage appears to have recently experienced massive gene losses following divergence from its wild ancestor. Our results imply that the domestication process accelerated large-scale genomic deletions in the lineage of Asian

  4. Genome-wide SNP data unveils the globalization of domesticated pigs.

    Science.gov (United States)

    Yang, Bin; Cui, Leilei; Perez-Enciso, Miguel; Traspov, Aleksei; Crooijmans, Richard P M A; Zinovieva, Natalia; Schook, Lawrence B; Archibald, Alan; Gatphayak, Kesinee; Knorr, Christophe; Triantafyllidis, Alex; Alexandri, Panoraia; Semiadi, Gono; Hanotte, Olivier; Dias, Deodália; Dovč, Peter; Uimari, Pekka; Iacolina, Laura; Scandura, Massimo; Groenen, Martien A M; Huang, Lusheng; Megens, Hendrik-Jan

    2017-09-21

    Pigs were domesticated independently in Eastern and Western Eurasia early during the agricultural revolution, and have since been transported and traded across the globe. Here, we present a worldwide survey on 60K genome-wide single nucleotide polymorphism (SNP) data for 2093 pigs, including 1839 domestic pigs representing 122 local and commercial breeds, 215 wild boars, and 39 out-group suids, from Asia, Europe, America, Oceania and Africa. The aim of this study was to infer global patterns in pig domestication and diversity related to demography, migration, and selection. A deep phylogeographic division reflects the dichotomy between early domestication centers. In the core Eastern and Western domestication regions, Chinese pigs show differentiation between breeds due to geographic isolation, whereas this is less pronounced in European pigs. The inferred European origin of pigs in the Americas, Africa, and Australia reflects European expansion during the sixteenth to nineteenth centuries. Human-mediated introgression, which is due, in particular, to importing Chinese pigs into the UK during the eighteenth and nineteenth centuries, played an important role in the formation of modern pig breeds. Inbreeding levels vary markedly between populations, from almost no runs of homozygosity (ROH) in a number of Asian wild boar populations, to up to 20% of the genome covered by ROH in a number of Southern European breeds. Commercial populations show moderate ROH statistics. For domesticated pigs and wild boars in Asia and Europe, we identified highly differentiated loci that include candidate genes related to muscle and body development, central nervous system, reproduction, and energy balance, which are putatively under artificial selection. Key events related to domestication, dispersal, and mixing of pigs from different regions are reflected in the 60K SNP data, including the globalization that has recently become full circle since Chinese pig breeders in the past

  5. Codon-triplet context unveils unique features of the Candida albicans protein coding genome

    Directory of Open Access Journals (Sweden)

    Oliveira José L

    2007-11-01

    Full Text Available Abstract Background The evolutionary forces that determine the arrangement of synonymous codons within open reading frames and fine tune mRNA translation efficiency are not yet understood. In order to tackle this question we have carried out a large scale study of codon-triplet contexts in 11 fungal species to unravel associations or relationships between codons present at the ribosome A-, P- and E-sites during each decoding cycle. Results Our analysis unveiled high bias within the context of codon-triplets, in particular strong preference for triplets of identical codons. We have also identified a surprisingly large number of codon-triplet combinations that vanished from fungal ORFeomes. Candida albicans exacerbated these features, showed an unbalanced tRNA population for decoding its pool of codons and used near-cognate decoding for a large set of codons, suggesting that unique evolutionary forces shaped the evolution of its ORFeome. Conclusion We have developed bioinformatics tools for large-scale analysis of codon-triplet contexts. These algorithms identified codon-triplets context biases, allowed for large scale comparative codon-triplet analysis, and identified rules governing codon-triplet context. They could also detect alterations to the standard genetic code.

  6. Complete mitochondrial genome of a Pleistocene jawbone unveils the origin of polar bear.

    Science.gov (United States)

    Lindqvist, Charlotte; Schuster, Stephan C; Sun, Yazhou; Talbot, Sandra L; Qi, Ji; Ratan, Aakrosh; Tomsho, Lynn P; Kasson, Lindsay; Zeyl, Eve; Aars, Jon; Miller, Webb; Ingólfsson, Olafur; Bachmann, Lutz; Wiig, Oystein

    2010-03-16

    The polar bear has become the flagship species in the climate-change discussion. However, little is known about how past climate impacted its evolution and persistence, given an extremely poor fossil record. Although it is undisputed from analyses of mitochondrial (mt) DNA that polar bears constitute a lineage within the genetic diversity of brown bears, timing estimates of their divergence have differed considerably. Using next-generation sequencing technology, we have generated a complete, high-quality mt genome from a stratigraphically validated 130,000- to 110,000-year-old polar bear jawbone. In addition, six mt genomes were generated of extant polar bears from Alaska and brown bears from the Admiralty and Baranof islands of the Alexander Archipelago of southeastern Alaska and Kodiak Island. We show that the phylogenetic position of the ancient polar bear lies almost directly at the branching point between polar bears and brown bears, elucidating a unique morphologically and molecularly documented fossil link between living mammal species. Molecular dating and stable isotope analyses also show that by very early in their evolutionary history, polar bears were already inhabitants of the Artic sea ice and had adapted very rapidly to their current and unique ecology at the top of the Arctic marine food chain. As such, polar bears provide an excellent example of evolutionary opportunism within a widespread mammalian lineage.

  7. Complete mitochondrial genome of a Pleistocene jawbone unveils the origin of polar bear

    Science.gov (United States)

    Lindqvist, Charlotte; Schuster, Stephan C.; Sun, Yazhou; Talbot, Sandra L.; Qi, Ji; Ratan, Aakrosh; Tomsho, Lynn P.; Kasson, Lindsay; Zeyl, Eve; Aars, Jon; Miller, Webb; Ingólfsson, Ólafur; Bachmann, Lutz; Wiig, Øystein

    2010-01-01

    The polar bear has become the flagship species in the climate-change discussion. However, little is known about how past climate impacted its evolution and persistence, given an extremely poor fossil record. Although it is undisputed from analyses of mitochondrial (mt) DNA that polar bears constitute a lineage within the genetic diversity of brown bears, timing estimates of their divergence have differed considerably. Using next-generation sequencing technology, we have generated a complete, high-quality mt genome from a stratigraphically validated 130,000- to 110,000-year-old polar bear jawbone. In addition, six mt genomes were generated of extant polar bears from Alaska and brown bears from the Admiralty and Baranof islands of the Alexander Archipelago of southeastern Alaska and Kodiak Island. We show that the phylogenetic position of the ancient polar bear lies almost directly at the branching point between polar bears and brown bears, elucidating a unique morphologically and molecularly documented fossil link between living mammal species. Molecular dating and stable isotope analyses also show that by very early in their evolutionary history, polar bears were already inhabitants of the Artic sea ice and had adapted very rapidly to their current and unique ecology at the top of the Arctic marine food chain. As such, polar bears provide an excellent example of evolutionary opportunism within a widespread mammalian lineage. PMID:20194737

  8. Complete mitochondrial genome of a Pleistocene jawbone unveils the origin of polar bear

    Science.gov (United States)

    Lindqvist, Charlotte; Schuster, Stephan C.; Sun, Yazhou; Talbot, Sandra L.; Qi, Ji; Ratan, Aakrosh; Tomsho, Lynn P.; Kasson, Lindsay; Zeyl, Eve; Aars, Jon; Miller, Webb; Ingólfsson, Ólafur; Bachmann, Lutz; Wiig, Øystein

    2010-01-01

    The polar bear has become the flagship species in the climate-change discussion. However, little is known about how past climate impacted its evolution and persistence, given an extremely poor fossil record. Although it is undisputed from analyses of mitochondrial (mt) DNA that polar bears constitute a lineage within the genetic diversity of brown bears, timing estimates of their divergence have differed considerably. Using next-generation sequencing technology, we have generated a complete, high-quality mt genome from a stratigraphically validated 130,000- to 110,000-year-old polar bear jawbone. In addition, six mt genomes were generated of extant polar bears from Alaska and brown bears from the Admiralty and Baranof islands of the Alexander Archipelago of southeastern Alaska and Kodiak Island. We show that the phylogenetic position of the ancient polar bear lies almost directly at the branching point between polar bears and brown bears, elucidating a unique morphologically and molecularly documented fossil link between living mammal species. Molecular dating and stable isotope analyses also show that by very early in their evolutionary history, polar bears were already inhabitants of the Artic sea ice and had adapted very rapidly to their current and unique ecology at the top of the Arctic marine food chain. As such, polar bears provide an excellent example of evolutionary opportunism within a widespread mammalian lineage.

  9. Proteomic analysis of the dysferlin protein complex unveils its importance for sarcolemmal maintenance and integrity.

    Directory of Open Access Journals (Sweden)

    Antoine de Morrée

    Full Text Available Dysferlin is critical for repair of muscle membranes after damage. Mutations in dysferlin lead to a progressive muscular dystrophy. Recent studies suggest additional roles for dysferlin. We set out to study dysferlin's protein-protein interactions to obtain comprehensive knowledge of dysferlin functionalities in a myogenic context. We developed a robust and reproducible method to isolate dysferlin protein complexes from cells and tissue. We analyzed the composition of these complexes in cultured myoblasts, myotubes and skeletal muscle tissue by mass spectrometry and subsequently inferred potential protein functions through bioinformatics analyses. Our data confirm previously reported interactions and support a function for dysferlin as a vesicle trafficking protein. In addition novel potential functionalities were uncovered, including phagocytosis and focal adhesion. Our data reveal that the dysferlin protein complex has a dynamic composition as a function of myogenic differentiation. We provide additional experimental evidence and show dysferlin localization to, and interaction with the focal adhesion protein vinculin at the sarcolemma. Finally, our studies reveal evidence for cross-talk between dysferlin and its protein family member myoferlin. Together our analyses show that dysferlin is not only a membrane repair protein but also important for muscle membrane maintenance and integrity.

  10. Genome-Wide Host-Pathogen Interaction Unveiled by Transcriptomic Response of Diamondback Moth to Fungal Infection.

    Directory of Open Access Journals (Sweden)

    Zhen-Jian Chu

    Full Text Available Genome-wide insight into insect pest response to the infection of Beauveria bassiana (fungal insect pathogen is critical for genetic improvement of fungal insecticides but has been poorly explored. We constructed three pairs of transcriptomes of Plutella xylostella larvae at 24, 36 and 48 hours post treatment of infection (hptI and of control (hptC for insight into the host-pathogen interaction at genomic level. There were 2143, 3200 and 2967 host genes differentially expressed at 24, 36 and 48 hptI/hptC respectively. These infection-responsive genes (~15% of the host genome were enriched in various immune processes, such as complement and coagulation cascades, protein digestion and absorption, and drug metabolism-cytochrome P450. Fungal penetration into cuticle and host defense reaction began at 24 hptI, followed by most intensive host immune response at 36 hptI and attenuated immunity at 48 hptI. Contrastingly, 44% of fungal genes were differentially expressed in the infection course and enriched in several biological processes, such as antioxidant activity, peroxidase activity and proteolysis. There were 1636 fungal genes co-expressed during 24-48 hptI, including 116 encoding putative secretion proteins. Our results provide novel insights into the insect-pathogen interaction and help to probe molecular mechanisms involved in the fungal infection to the global pest.

  11. Genome resource banking of biomedically important laboratory animals.

    Science.gov (United States)

    Agca, Yuksel

    2012-11-01

    Genome resource banking is the systematic collection, storage, and redistribution of biomaterials in an organized, logistical, and secure manner. Genome cryobanks usually contain biomaterials and associated genomic information essential for progression of biomedicine, human health, and research. In that regard, appropriate genome cryobanks could provide essential biomaterials for both current and future research projects in the form of various cell types and tissues, including sperm, oocytes, embryos, embryonic or adult stem cells, induced pluripotent stem cells, and gonadal tissues. In addition to cryobanked germplasm, cryobanking of DNA, serum, blood products, and tissues from scientifically, economically, and ecologically important species has become a common practice. For revitalization of the whole organism, cryopreserved germplasm in conjunction with assisted reproductive technologies, offer a powerful approach for research model management, as well as assisting in animal production for agriculture, conservation, and human reproductive medicine. Recently, many developed and developing countries have allocated substantial resources to establish genome resources banks which are responsible for safeguarding scientifically, economically, and ecologically important wild type, mutant, and transgenic plants, fish, and local livestock breeds, as well as wildlife species. This review is dedicated to the memory of Dr. John K. Critser, who has made profound contributions to the science of cryobiology and establishment of genome research and resources centers for mice, rats, and swine. Emphasis will be given to application of genome resource banks to species with substantial contributions to the advancement of biomedicine and human health. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Unveiling health attitudes and creating good-for-you foods: the genomics metaphor, consumer innovative web-based technologies.

    Science.gov (United States)

    Moskowitz, H R; German, J B; Saguy, I S

    2005-01-01

    This article presents an integrated analysis of three emerging knowledge bases in the nutrition and consumer products industries, and how they may effect the food industry. These knowledge bases produce new vistas for corporate product development, especially with respect to those foods that are positioned as 'good for you.' Couched within the current thinking of state-of-the-art knowledge and information, this article highlights how today's thinking about accelerated product development can be introduced into the food and health industries to complement these three research areas. The 3 knowledge bases are: the genomics revolution, which has opened new insights into understanding the interactions of personal needs of individual consumers with nutritionally relevant components of the foods; the investigation of food choice by scientific studies; the development of large scale databases (mega-studies) about the consumer mind. These knowledge bases, combined with new methods to understand the consumer through research, make possible a more focused development. The confluence of trends outlined in this article provides the corporation with the beginnings of a new path to a knowledge-based, principles-grounded product-development system. The approaches hold the potential to create foods based upon people's nutritional requirements combined with their individual preferences. Integrating these emerging knowledge areas with new consumer research techniques may well reshape how the food industry develops new products to satisfy consumer needs and wants.

  13. Whole genome sequence analysis of Geitlerinema sp. FC II unveils competitive edge of the strain in marine cultivation system for biofuel production.

    Science.gov (United States)

    Batchu, Navish Kumar; Khater, Shradha; Patil, Sonal; Nagle, Vinod; Das, Gautam; Bhadra, Bhaskar; Sapre, Ajit; Dasgupta, Santanu

    2018-03-05

    A filamentous cyanobacteria, Geitlerinema sp. FC II, was isolated from marine algae culture pond at Reliance Industries Limited (RIL), India. The 6.7 Mb draft genome of FC II encodes for 6697 protein coding genes. Analysis of the whole genome sequence revealed presence of nif gene cluster, supporting its capability to fix atmospheric nitrogen. FC II genome contains two variants of sulfide:quinone oxidoreductases (SQR), which is a crucial elector donor in cyanobacterial metabolic processes. FC II is characterized by the presence of multiple CRISPR- Cas (Clustered Regularly Interspaced Short Palindrome Repeats - CRISPR associated proteins) clusters, multiple variants of genes encoding photosystem reaction centres, biosynthetic gene clusters of alkane, polyketides and non-ribosomal peptides. Presence of these pathways will help FC II in gaining an ecological advantage over other strains for biomass production in large scale cultivation system. Hence, FC II may be used for production of biofuel and other industrially important metabolites. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Games Uniforms Unveiled

    Institute of Scientific and Technical Information of China (English)

    Linda

    2008-01-01

    The uniforms for Beijing Olympics’ workers, technical staff and volunteers have been unveiled to mark the 200-day countdown to the Games. The uniforms feature the key element of the clouds of promise and will be in three colors:red for Beijing Olympic Games Committee staff, blue

  15. Systems biology and genome-wide approaches to unveil the molecular players involved in the pre-germinative metabolism: implications on seed technology traits.

    Science.gov (United States)

    Macovei, Anca; Pagano, Andrea; Leonetti, Paola; Carbonera, Daniela; Balestrazzi, Alma; Araújo, Susana S

    2017-05-01

    The pre-germinative metabolism is among the most fascinating aspects of seed biology. The early seed germination phase, or pre-germination, is characterized by rapid water uptake (imbibition), which directs a series of dynamic biochemical events. Among those are enzyme activation, DNA damage and repair, and use of reserve storage compounds, such as lipids, carbohydrates and proteins. Industrial seedling production and intensive agricultural production systems require seed stocks with high rate of synchronized germination and low dormancy. Consequently, seed dormancy, a quantitative trait related to the activation of the pre-germinative metabolism, is probably the most studied seed trait in model species and crops. Single omics, systems biology, QTLs and GWAS mapping approaches have unveiled a list of molecules and regulatory mechanisms acting at transcriptional, post-transcriptional and post-translational levels. Most of the identified candidate genes encode for regulatory proteins targeting ROS, phytohormone and primary metabolisms, corroborating the data obtained from simple molecular biology approaches. Emerging evidences show that epigenetic regulation plays a crucial role in the regulation of these mentioned processes, constituting a still unexploited strategy to modulate seed traits. The present review will provide an up-date of the current knowledge on seed pre-germinative metabolism, gathering the most relevant results from physiological, genetics, and omics studies conducted in model and crop plants. The effects exerted by the biotic and abiotic stresses and priming are also addressed. The possible implications derived from the modulation of pre-germinative metabolism will be discussed from the point of view of seed quality and technology.

  16. Unveiling the pan-genome of the SXT/R391 family of ICEs: molecular characterisation of new variable regions of SXT/R391-like ICEs detected in Pseudoalteromonas sp. and Vibrio scophthalmi.

    Science.gov (United States)

    Rodríguez-Blanco, Arturo; Lemos, Manuel L; Osorio, Carlos R

    2016-08-01

    Integrating conjugative elements (ICEs) of the SXT/R391 family have been identified in fish-isolated bacterial strains collected from marine aquaculture environments of the northwestern Iberian Peninsula. Here we analysed the variable regions of two ICEs, one preliminarily characterised in a previous study (ICEVscSpa3) and one newly identified (ICEPspSpa1). Bacterial strains harboring these ICEs were phylogenetically assigned to Vibrio scophthalmi and Pseudoalteromonas sp., thus constituting the first evidence of SXT/R391-like ICEs in the genus Pseudoalteromonas to date. Variable DNA regions, which confer element-specific properties to ICEs of this family, were characterised. Interestingly, the two ICEs contained 29 genes not found in variable DNA insertions of previously described ICEs. Most notably, variable gene content for ICEVscSpa3 showed similarity to genes potentially involved in housekeeping functions of replication, nucleotide metabolism and transcription. For these genes, closest homologues were found clustered in the genome of Pseudomonas psychrotolerans L19, suggesting a transfer as a block to ICEVscSpa3. Genes encoding antibiotic resistance, restriction modification systems and toxin/antitoxin systems were absent from hotspots of ICEVscSpa3. In contrast, the variable gene content of ICEPspSpa1 included genes involved in restriction/modification functions in two different hotspots and genes related to ICE maintenance. The present study unveils a relatively large number of novel genes in SXT/R391-ICEs, and demonstrates the major role of ICE elements as contributors to horizontal gene transfer.

  17. ­Genomic data mining of the marine actinobacteria Streptomyces sp. H-KF8 unveils insights into multi-stress related genes and metabolic pathways involved in antimicrobial synthesis

    Directory of Open Access Journals (Sweden)

    Agustina Undabarrena

    2017-02-01

    Full Text Available Streptomyces sp. H-KF8 is an actinobacterial strain isolated from marine sediments of a Chilean Patagonian fjord. Morphological characterization together with antibacterial activity was assessed in various culture media, revealing a carbon-source dependent activity mainly against Gram-positive bacteria (S. aureus and L. monocytogenes. Genome mining of this antibacterial-producing bacterium revealed the presence of 26 biosynthetic gene clusters (BGCs for secondary metabolites, where among them, 81% have low similarities with known BGCs. In addition, a genomic search in Streptomyces sp. H-KF8 unveiled the presence of a wide variety of genetic determinants related to heavy metal resistance (49 genes, oxidative stress (69 genes and antibiotic resistance (97 genes. This study revealed that the marine-derived Streptomyces sp. H-KF8 bacterium has the capability to tolerate a diverse set of heavy metals such as copper, cobalt, mercury, chromate and nickel; as well as the highly toxic tellurite, a feature first time described for Streptomyces. In addition, Streptomyces sp. H-KF8 possesses a major resistance towards oxidative stress, in comparison to the soil reference strain Streptomyces violaceoruber A3(2. Moreover, Streptomyces sp. H-KF8 showed resistance to 88% of the antibiotics tested, indicating overall, a strong response to several abiotic stressors. The combination of these biological traits confirms the metabolic versatility of Streptomyces sp. H-KF8, a genetically well-prepared microorganism with the ability to confront the dynamics of the fjord-unique marine environment.

  18. Lord Shiva Statue Unveiled

    CERN Multimedia

    2004-01-01

    On 18 June, CERN unveiled an unusual new landmark, a 2m tall statue of the Indian deity Lord Shiva. The Director-General and Dr. Kakodkar watch as Mr.Chandrasekhar signs the Guest Book. The statue is a gift from India, celebrating CERN's long association with India which started in the 1960's and continues strongly today. It was unveiled by the Director General, Dr Robert Aymar, His Excellency Mr K. M. Chandrasekhar, Ambassador (WTO-Geneva) and Dr Anil Kakodkar, Chairman of the Atomic Energy Commission and Secretary, Dept of Atomic Energy, India. In the Hindu religion, this form of the dancing Lord Shiva is known as the Nataraj and symbolises Shakti, or life force. As a plaque alongside the statue explains, the belief is that Lord Shiva danced the Universe into existence, motivates it, and will eventually extinguish it. Carl Sagan drew the metaphor between the cosmic dance of the Nataraj and the modern study of the 'cosmic dance' of subatomic particles. The statue was made in India. The original sculpture was...

  19. Apophysomyces variabilis: draft genome sequence and comparison of predictive virulence determinants with other medically important Mucorales.

    Science.gov (United States)

    Prakash, Hariprasath; Rudramurthy, Shivaprakash Mandya; Gandham, Prasad S; Ghosh, Anup Kumar; Kumar, Milner M; Badapanda, Chandan; Chakrabarti, Arunaloke

    2017-09-18

    Apophysomyces species are prevalent in tropical countries and A. variabilis is the second most frequent agent causing mucormycosis in India. Among Apophysomyces species, A. elegans, A. trapeziformis and A. variabilis are commonly incriminated in human infections. The genome sequences of A. elegans and A. trapeziformis are available in public database, but not A. variabilis. We, therefore, performed the whole genome sequence of A. variabilis to explore its genomic structure and possible genes determining the virulence of the organism. The whole genome of A. variabilis NCCPF 102052 was sequenced and the genomic structure of A. variabilis was compared with already available genome structures of A. elegans, A. trapeziformis and other medically important Mucorales. The total size of genome assembly of A. variabilis was 39.38 Mb with 12,764 protein-coding genes. The transposable elements (TEs) were low in Apophysomyces genome and the retrotransposon Ty3-gypsy was the common TE. Phylogenetically, Apophysomyces species were grouped closely with Phycomyces blakesleeanus. OrthoMCL analysis revealed 3025 orthologues proteins, which were common in those three pathogenic Apophysomyces species. Expansion of multiple gene families/duplication was observed in Apophysomyces genomes. Approximately 6% of Apophysomyces genes were predicted to be associated with virulence on PHIbase analysis. The virulence determinants included the protein families of CotH proteins (invasins), proteases, iron utilisation pathways, siderophores and signal transduction pathways. Serine proteases were the major group of proteases found in all Apophysomyces genomes. The carbohydrate active enzymes (CAZymes) constitute the majority of the secretory proteins. The present study is the maiden attempt to sequence and analyze the genomic structure of A. variabilis. Together with available genome sequence of A. elegans and A. trapeziformis, the study helped to indicate the possible virulence determinants of

  20. Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

    Science.gov (United States)

    Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

    2018-01-01

    Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

  1. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  2. The Genome of Dendrobium officinale Illuminates the Biology of the Important Traditional Chinese Orchid Herb.

    Science.gov (United States)

    Yan, Liang; Wang, Xiao; Liu, Hui; Tian, Yang; Lian, Jinmin; Yang, Ruijuan; Hao, Shumei; Wang, Xuanjun; Yang, Shengchao; Li, Qiye; Qi, Shuai; Kui, Ling; Okpekum, Moses; Ma, Xiao; Zhang, Jiajin; Ding, Zhaoli; Zhang, Guojie; Wang, Wen; Dong, Yang; Sheng, Jun

    2015-06-01

    Dendrobium officinale Kimura et Migo is a traditional Chinese orchid herb that has both ornamental value and a broad range of therapeutic effects. Here, we report the first de novo assembled 1.35 Gb genome sequences for D. officinale by combining the second-generation Illumina Hiseq 2000 and third-generation PacBio sequencing technologies. We found that orchids have a complete inflorescence gene set and have some specific inflorescence genes. We observed gene expansion in gene families related to fungus symbiosis and drought resistance. We analyzed biosynthesis pathways of medicinal components of D. officinale and found extensive duplication of SPS and SuSy genes, which are related to polysaccharide generation, and that the pathway of D. officinale alkaloid synthesis could be extended to generate 16-epivellosimine. The D. officinale genome assembly demonstrates a new approach to deciphering large complex genomes and, as an important orchid species and a traditional Chinese medicine, the D. officinale genome will facilitate future research on the evolution of orchid plants, as well as the study of medicinal components and potential genetic breeding of the dendrobe. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  3. Importing statistical measures into Artemis enhances gene identification in the Leishmania genome project

    Directory of Open Access Journals (Sweden)

    McDonagh Paul D

    2003-06-01

    Full Text Available Abstract Background Seattle Biomedical Research Institute (SBRI as part of the Leishmania Genome Network (LGN is sequencing chromosomes of the trypanosomatid protozoan species Leishmania major. At SBRI, chromosomal sequence is annotated using a combination of trained and untrained non-consensus gene-prediction algorithms with ARTEMIS, an annotation platform with rich and user-friendly interfaces. Results Here we describe a methodology used to import results from three different protein-coding gene-prediction algorithms (GLIMMER, TESTCODE and GENESCAN into the ARTEMIS sequence viewer and annotation tool. Comparison of these methods, along with the CODONUSAGE algorithm built into ARTEMIS, shows the importance of combining methods to more accurately annotate the L. major genomic sequence. Conclusion An improvised and powerful tool for gene prediction has been developed by importing data from widely-used algorithms into an existing annotation platform. This approach is especially fruitful in the Leishmania genome project where there is large proportion of novel genes requiring manual annotation.

  4. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  5. The importance of the genomic landscape in Waldenström's Macroglobulinemia for targeted therapeutical interventions.

    Science.gov (United States)

    Sacco, Antonio; Fenotti, Adriano; Affò, Loredana; Bazzana, Stefano; Russo, Domenico; Presta, Marco; Malagola, Michele; Anastasia, Antonella; Motta, Marina; Patterson, Christopher J; Rossi, Giuseppe; Imberti, Luisa; Treon, Steven P; Ghobrial, Irene M; Roccaro, Aldo M

    2017-05-23

    The Literature has recently reported on the importance of genomics in the field of hematologic malignancies, including B-cell lymphoproliferative disorders such as Waldenström's Macrolgobulinemia (WM). Particularly, whole exome sequencing has led to the identification of the MYD88L265P and CXCR4C1013G somatic variants in WM, occurring in about 90% and 30% of the patients, respectively. Subsequently, functional studies have demonstrated their functional role in supporting WM pathogenesis and disease progression, both in vitro and in vivo, thus providing the pre-clinical evidences for extremely attractive targets for novel therapeutic interventions in WM. Of note, recent evidences have also approached and defined the transcriptome profiling of WM cells, revealing a signature that mirrors the somatic aberrations demonstrated within the tumor clone. A parallel research field has also reported on microRNAs (miRNAs), highlighting the oncogenic role of miRNA-155 in WM. In the present review, we focus on the latest reports on genomics and miRNAs in WM, providing an overview of the clinical relevance of the latest acquired knowledge about genomics and miRNA aberrations in WM.

  6. Compatible Solute Synthesis and Import by the Moderate Halophile Spiribacter salinus: Physiology and Genomics

    Directory of Open Access Journals (Sweden)

    María J. León

    2018-02-01

    Full Text Available Members of the genus Spiribacter are found worldwide and are abundant in ecosystems possessing intermediate salinities between seawater and saturated salt concentrations. Spiribacter salinus M19-40 is the type species of this genus and its first cultivated representative. In the habitats of S. salinus M19-40, high salinity is a key determinant for growth and we therefore focused on the cellular adjustment strategy to this persistent environmental challenge. We coupled these experimental studies to the in silico mining of the genome sequence of this moderate halophile with respect to systems allowing this bacterium to control its potassium and sodium pools, and its ability to import and synthesize compatible solutes. S. salinus M19-40 produces enhanced levels of the compatible solute ectoine, both under optimal and growth-challenging salt concentrations, but the genes encoding the corresponding biosynthetic enzymes are not organized in a canonical ectABC operon. Instead, they are scrambled (ectAC; ectB and are physically separated from each other on the S. salinus M19-40 genome. Genomes of many phylogenetically related bacteria also exhibit a non-canonical organization of the ect genes. S. salinus M19-40 also synthesizes trehalose, but this compatible solute seems to make only a minor contribution to the cytoplasmic solute pool under osmotic stress conditions. However, its cellular levels increase substantially in stationary phase cells grown under optimal salt concentrations. In silico genome mining revealed that S. salinus M19-40 possesses different types of uptake systems for compatible solutes. Among the set of compatible solutes tested in an osmostress protection growth assay, glycine betaine and arsenobetaine were the most effective. Transport studies with radiolabeled glycine betaine showed that S. salinus M19-40 increases the pool size of this osmolyte in a fashion that is sensitively tied to the prevalent salinity of the growth medium

  7. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  8. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  9. Complex analyses of inverted repeats in mitochondrial genomes revealed their importance and variability.

    Science.gov (United States)

    Cechová, Jana; Lýsek, Jirí; Bartas, Martin; Brázda, Václav

    2018-04-01

    The NCBI database contains mitochondrial DNA (mtDNA) genomes from numerous species. We investigated the presence and locations of inverted repeat sequences (IRs) in these mtDNA sequences, which are known to be important for regulating nuclear genomes. IRs were identified in mtDNA in all species. IR lengths and frequencies correlate with evolutionary age and the greatest variability was detected in subgroups of plants and fungi and the lowest variability in mammals. IR presence is non-random and evolutionary favoured. The frequency of IRs generally decreased with IR length, but not for IRs 24 or 30 bp long, which are 1.5 times more abundant. IRs are enriched in sequences from the replication origin, followed by D-loop, stem-loop and miscellaneous sequences, pointing to the importance of IRs in regulatory regions of mitochondrial DNA. Data were produced using Palindrome analyser, freely available on the web at http://bioinformatics.ibp.cz. vaclav@ibp.cz. Supplementary data are available at Bioinformatics online.

  10. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen.

    Science.gov (United States)

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya

    2014-08-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  12. Detection of yellow fever virus genomes from four imported cases in China.

    Science.gov (United States)

    Cui, Shujuan; Pan, Yang; Lyu, Yanning; Liang, Zhichao; Li, Jie; Sun, Yulan; Dou, Xiangfeng; Tian, Lili; Huo, Da; Chen, Lijuan; Li, Xinyu; Wang, Quanyi

    2017-07-01

    Yellow fever virus (YFV), as the first proven human-pathogenic virus, is still a major public health problem with a dramatic upsurge in recent years. This is a report on four imported cases of yellow fever virus into China identified by whole genome sequencing. Phylogenetic analysis was performed and the results showed that these four viruses were highly homologous with Angola 71 strains (AY968064). In addition, effective mutations of amino acids were not observed in the E protein domain of four viruses, thus confirming the effectiveness of the YFV-17D vaccine (X03700). Although there is low risk of local transmission in most part of China, the increasing public health risk of YF caused by international exchange should not be ignored. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus

    DEFF Research Database (Denmark)

    de Vries, Ronald P.; Riley, Robert; Wiebenga, Ad

    2017-01-01

    Background:  The fungal genus Aspergillus is of critical importance to humankind. Species include those with industrial applications, important pathogens of humans, animals and crops, a source of potent carcinogenic contaminants of food, and an important genetic model. The genome sequences of eig...

  14. France: the programme of festivities is unveiled

    CERN Multimedia

    2004-01-01

    The programme of events to be held in the local French area in honour of CERN's fiftieth anniversary was unveiled in the CMS hall on 26 April at a ceremony attended by many local authority representatives.

  15. The importance of identity-by-state information for the accuracy of genomic selection

    Directory of Open Access Journals (Sweden)

    Luan Tu

    2012-08-01

    Full Text Available Abstract Background It is commonly assumed that prediction of genome-wide breeding values in genomic selection is achieved by capitalizing on linkage disequilibrium between markers and QTL but also on genetic relationships. Here, we investigated the reliability of predicting genome-wide breeding values based on population-wide linkage disequilibrium information, based on identity-by-descent relationships within the known pedigree, and to what extent linkage disequilibrium information improves predictions based on identity-by-descent genomic relationship information. Methods The study was performed on milk, fat, and protein yield, using genotype data on 35 706 SNP and deregressed proofs of 1086 Italian Brown Swiss bulls. Genome-wide breeding values were predicted using a genomic identity-by-state relationship matrix and a genomic identity-by-descent relationship matrix (averaged over all marker loci. The identity-by-descent matrix was calculated by linkage analysis using one to five generations of pedigree data. Results We showed that genome-wide breeding values prediction based only on identity-by-descent genomic relationships within the known pedigree was as or more reliable than that based on identity-by-state, which implicitly also accounts for genomic relationships that occurred before the known pedigree. Furthermore, combining the two matrices did not improve the prediction compared to using identity-by-descent alone. Including different numbers of generations in the pedigree showed that most of the information in genome-wide breeding values prediction comes from animals with known common ancestors less than four generations back in the pedigree. Conclusions Our results show that, in pedigreed breeding populations, the accuracy of genome-wide breeding values obtained by identity-by-descent relationships was not improved by identity-by-state information. Although, in principle, genomic selection based on identity-by-state does not require

  16. Brucella abortus Strain 2308 Wisconsin Genome: Importance of the Definition of Reference Strains

    Science.gov (United States)

    Suárez-Esquivel, Marcela; Ruiz-Villalobos, Nazareth; Castillo-Zeledón, Amanda; Jiménez-Rojas, César; Roop II, R. Martin; Comerci, Diego J.; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Caswell, Clayton C.; Baker, Kate S.; Chaves-Olarte, Esteban; Thomson, Nicholas R.; Moreno, Edgardo; Letesson, Jean J.; De Bolle, Xavier; Guzmán-Verri, Caterina

    2016-01-01

    Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing analysis of the reference strain B. abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version through a link at https://en.wikipedia.org/wiki/Brucella#Genomics. Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised. PMID:27746773

  17. Georges Charpak street sign unveiled

    CERN Multimedia

    Paola Catapano

    2011-01-01

    While it might not be the only French street named in honour of the late Georges Charpak, who passed away in September 2010 at the age of 87, the street chosen by the mayor of Saint-Genis-Pouilly is certainly the only one located directly opposite the CERN "campus". The road overlooks buildings on the CERN Meyrin site, where Georges Charpak spent most of his career as a physicist, conducting the research that won him the Nobel Prize in Physics in 1992.   From left to right: Sigurd Lettow, Dominique Charpak and the mayor of Saint-Genis-Pouilly. The unveiling took place on 17 October and was organised by the mayor of Saint-Genis-Pouilly. George Charpak’s wife, Dominique, and Sigurd Lettow, CERN Director of Administration and General Infrastructure, attended what was an intimate and touching ceremony. The mayor’s speech at the event praised Georges’ commitment to scientific education. The highlight of the event, however, was a witty and humorous ...

  18. Complete sequence and analysis of plastid genomes of two economically important red algae: Pyropia haitanensis and Pyropia yezoensis.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics.We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp and P. yezoensis (191,975 bp, the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs, 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146 was much smaller than that of Porphyra purpurea and P. haitanensis (0.250, and P. yezoensis (0.251; this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved.These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene

  19. [The increasing importance of tumor and tissue banks in the light of genomic and proteomic research].

    Science.gov (United States)

    Tschulik, A; Zatloukal, K

    2001-09-01

    Recent technological advances in genome and proteome research offer new perspectives for diagnosis and therapy. The DNA chip technology as well as high-resolution two-dimensional gel electrophoresis in combination with mass spectrometry is able to provide comprehensive information on gene and protein expression patterns, which allow insights into the dynamic and functional aspects of diseases. The application of these techniques depends on the availability of unfixed fresh or cryopreserved tissue with short ischaemia time. For this reason tissue banks are of increasing importance. The pathologist with his expertise and responsibility for histopathological diagnosis, plays a central role in the collection of the human tissues, in accordance with medical, legal and ethical standards, not only for diagnostic purposes, but also for research. The scientific value of a tissue bank is markedly increased if tissue samples are accompanied by detailed patient data as well as blood samples. Informed consent given by the patient is an essential requirement for the use of human tissue banks in biomedical research. The informed consent should not be restricted to scientific investigations but also include the potential commercial use of the data generated.

  20. Brucella abortus strain 2308 Wisconsin genome: importance of the definition of reference strains

    Directory of Open Access Journals (Sweden)

    Marcela Suárez-Esquivel

    2016-09-01

    Full Text Available Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing (WGS analysis of the reference strain Brucella abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version at www.wikipedia.Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised.

  1. The Importance of Bacterial Culture to Food Microbiology in the Age of Genomics.

    Science.gov (United States)

    Gill, Alexander

    2017-01-01

    Culture-based and genomics methods provide different insights into the nature and behavior of bacteria. Maximizing the usefulness of both approaches requires recognizing their limitations and employing them appropriately. Genomic analysis excels at identifying bacteria and establishing the relatedness of isolates. Culture-based methods remain necessary for detection and enumeration, to determine viability, and to validate phenotype predictions made on the bias of genomic analysis. The purpose of this short paper is to discuss the application of culture-based analysis and genomics to the questions food microbiologists routinely need to ask regarding bacteria to ensure the safety of food and its economic production and distribution. To address these issues appropriate tools are required for the detection and enumeration of specific bacterial populations and the characterization of isolates for, identification, phylogenetics, and phenotype prediction.

  2. Complete genome sequence of the cystic fibrosis pathogen Achromobacter xylosoxidans NH44784-1996 complies with important pathogenic phenotypes

    DEFF Research Database (Denmark)

    Jakobsen, Tim Holm; Hansen, Martin Asser; Jensen, Peter Østrup

    2013-01-01

    Achromobacter xylosoxidans is an environmental opportunistic pathogen, which infects an increasing number of immunocompromised patients. In this study we combined genomic analysis of a clinical isolated A. xylosoxidans strain with phenotypic investigations of its important pathogenic features. We...... that render it an opportunistic human pathogen, We found genes involved in anaerobic growth and the pgaABCD operon encoding the biofilm adhesin poly-β-1,6-N-acetyl-D-glucosamin. Furthermore, the genome contains a range of antibiotic resistance genes coding efflux pump systems and antibiotic modifying enzymes....... In vitro studies of A. xylosoxidans NH44784-1996 confirmed the genomic evidence for its ability to form biofilms, anaerobic growth via denitrification, and resistance to a broad range of antibiotics. Our investigation enables further studies of the functionality of important identified genes contributing...

  3. Genome-wide analysis reveals signatures of selection for important traits in domestic sheep from different ecoregions.

    Science.gov (United States)

    Liu, Zhaohua; Ji, Zhibin; Wang, Guizhi; Chao, Tianle; Hou, Lei; Wang, Jianmin

    2016-11-03

    Throughout a long period of adaptation and selection, sheep have thrived in a diverse range of ecological environments. Mongolian sheep is the common ancestor of the Chinese short fat-tailed sheep. Migration to different ecoregions leads to changes in selection pressures and results in microevolution. Mongolian sheep and its subspecies differ in a number of important traits, especially reproductive traits. Genome-wide intraspecific variation is required to dissect the genetic basis of these traits. This research resequenced 3 short fat-tailed sheep breeds with a 43.2-fold coverage of the sheep genome. We report more than 17 million single nucleotide polymorphisms and 2.9 million indels and identify 143 genomic regions with reduced pooled heterozygosity or increased genetic distance to each other breed that represent likely targets for selection during the migration. These regions harbor genes related to developmental processes, cellular processes, multicellular organismal processes, biological regulation, metabolic processes, reproduction, localization, growth and various components of the stress responses. Furthermore, we examined the haplotype diversity of 3 genomic regions involved in reproduction and found significant differences in TSHR and PRL gene regions among 8 sheep breeds. Our results provide useful genomic information for identifying genes or causal mutations associated with important economic traits in sheep and for understanding the genetic basis of adaptation to different ecological environments.

  4. Enhancer Analysis Unveils Genetic Interactions between TLX and SOX2 in Neural Stem Cells and In Vivo Reprogramming.

    Science.gov (United States)

    Islam, Mohammed M; Smith, Derek K; Niu, Wenze; Fang, Sanhua; Iqbal, Nida; Sun, Guoqiang; Shi, Yanhong; Zhang, Chun-Li

    2015-11-10

    The orphan nuclear receptor TLX is a master regulator of postnatal neural stem cell (NSC) self-renewal and neurogenesis; however, it remains unclear how TLX expression is precisely regulated in these tissue-specific stem cells. Here, we show that a highly conserved cis-element within the Tlx locus functions to drive gene expression in NSCs. We demonstrate that the transcription factors SOX2 and MYT1 specifically interact with this genomic element to directly regulate Tlx enhancer activity in vivo. Knockdown experiments further reveal that SOX2 dominantly controls endogenous expression of TLX, whereas MYT1 only plays a modulatory role. Importantly, TLX is essential for SOX2-mediated in vivo reprogramming of astrocytes and itself is also sufficient to induce neurogenesis in the adult striatum. Together, these findings unveil functional genetic interactions among transcription factors that are critical to NSCs and in vivo cell reprogramming.

  5. Enhancer Analysis Unveils Genetic Interactions between TLX and SOX2 in Neural Stem Cells and In Vivo Reprogramming

    Science.gov (United States)

    Islam, Mohammed M.; Smith, Derek K.; Niu, Wenze; Fang, Sanhua; Iqbal, Nida; Sun, Guoqiang; Shi, Yanhong; Zhang, Chun-Li

    2015-01-01

    Summary The orphan nuclear receptor TLX is a master regulator of postnatal neural stem cell (NSC) self-renewal and neurogenesis; however, it remains unclear how TLX expression is precisely regulated in these tissue-specific stem cells. Here, we show that a highly conserved cis-element within the Tlx locus functions to drive gene expression in NSCs. We demonstrate that the transcription factors SOX2 and MYT1 specifically interact with this genomic element to directly regulate Tlx enhancer activity in vivo. Knockdown experiments further reveal that SOX2 dominantly controls endogenous expression of TLX, whereas MYT1 only plays a modulatory role. Importantly, TLX is essential for SOX2-mediated in vivo reprogramming of astrocytes and itself is also sufficient to induce neurogenesis in the adult striatum. Together, these findings unveil functional genetic interactions among transcription factors that are critical to NSCs and in vivo cell reprogramming. PMID:26607952

  6. Enhancer Analysis Unveils Genetic Interactions between TLX and SOX2 in Neural Stem Cells and In Vivo Reprogramming

    Directory of Open Access Journals (Sweden)

    Mohammed M. Islam

    2015-11-01

    Full Text Available The orphan nuclear receptor TLX is a master regulator of postnatal neural stem cell (NSC self-renewal and neurogenesis; however, it remains unclear how TLX expression is precisely regulated in these tissue-specific stem cells. Here, we show that a highly conserved cis-element within the Tlx locus functions to drive gene expression in NSCs. We demonstrate that the transcription factors SOX2 and MYT1 specifically interact with this genomic element to directly regulate Tlx enhancer activity in vivo. Knockdown experiments further reveal that SOX2 dominantly controls endogenous expression of TLX, whereas MYT1 only plays a modulatory role. Importantly, TLX is essential for SOX2-mediated in vivo reprogramming of astrocytes and itself is also sufficient to induce neurogenesis in the adult striatum. Together, these findings unveil functional genetic interactions among transcription factors that are critical to NSCs and in vivo cell reprogramming.

  7. Improvement of industrially important microbial strains by genome shuffling: Current status and future prospects.

    Science.gov (United States)

    Magocha, Tinashe Archbold; Zabed, H; Yang, Miaomiao; Yun, Junhua; Zhang, Huanhuan; Qi, Xianghui

    2018-06-01

    The growing demand for biotechnological products against limited metabolic capacity of industrially used microorganisms has led to an increased interest on strain-improvement over the last several decades, which aimed to enhance metabolite yield, substrate uptake and tolerance of the strains. Among a few techniques of strain-improvement, genome shuffling is the most recent and promising approach used for rapid strain-improvement that can yield a new strain by combining whole genomes of multi-parental microorganisms using the principles of protoplast fusion. Genome shuffling has brought a major breakthrough in the strain-improvement concept as it is found to be effective and reliable for expressing complex phenotypes. This review will discuss the technical aspects and applications of genome shuffling for various industrial strains to present its current status and recent progress. In the concluding remarks, a summary will be presented focusing on the major challenges and future outlooks of this technology. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Draft Genome Sequence of Pontibacter sp. nov. BAB1700, a Halotolerant, Industrially Important Bacterium

    Science.gov (United States)

    Joshi, M. N.; Sharma, A. C.; Pandya, R. V.; Patel, R. P.; Saiyed, Z. M.; Saxena, A. K.

    2012-01-01

    Pontibacter sp. nov. BAB1700 is a halotolerant, Gram-negative, rod-shaped, pink-pigmented, menaquinone-7-producing bacterium isolated from sediments of a drilling well. The draft genome sequence of the strain, consisting of one chromosome of 4.5 Mb, revealed vital gene clusters involved in vitamin biosynthesis and resistance against various metals and antibiotics. PMID:23105068

  9. Grand challenges in evolutionary and population genetics: The importance of integrating epigenetics, genomics, modeling, and experimentation

    Science.gov (United States)

    Samuel A. Cushman

    2014-01-01

    This is a time of explosive growth in the fields of evolutionary and population genetics, with whole genome sequencing and bioinformatics driving a transformative paradigm shift (Morozova and Marra, 2008). At the same time, advances in epigenetics are thoroughly transforming our understanding of evolutionary processes and their implications for populations, species and...

  10. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  11. The mitochondrial genomes of Ancylostoma caninum and Bunostomum phlebotomum – two hookworms of animal health and zoonotic importance

    Directory of Open Access Journals (Sweden)

    Littlewood D Timothy J

    2009-02-01

    Full Text Available Abstract Background Hookworms are blood-feeding nematodes that parasitize the small intestines of many mammals, including humans and cattle. These nematodes are of major socioeconomic importance and cause disease, mainly as a consequence of anaemia (particularly in children or young animals, resulting in impaired development and sometimes deaths. Studying genetic variability within and among hookworm populations is central to addressing epidemiological and ecological questions, thus assisting in the control of hookworm disease. Mitochondrial (mt genes are known to provide useful population markers for hookworms, but mt genome sequence data are scant. Results The present study characterizes the complete mt genomes of two species of hookworm, Ancylostoma caninum (from dogs and Bunostomum phlebotomum (from cattle, each sequenced (by 454 technology or primer-walking, following long-PCR amplification from genomic DNA (~20–40 ng isolated from individual adult worms. These mt genomes were 13717 bp and 13790 bp in size, respectively, and each contained 12 protein coding, 22 transfer RNA and 2 ribosomal RNA genes, typical for other secernentean nematodes. In addition, phylogenetic analysis (by Bayesian inference and maximum likelihood of concatenated mt protein sequence data sets for 12 nematodes (including Ancylostoma caninum and Bunostomum phlebotomum, representing the Ascaridida, Spirurida and Strongylida, was conducted. The analysis yielded maximum statistical support for the formation of monophyletic clades for each recognized nematode order assessed, except for the Rhabditida. Conclusion The mt genomes characterized herein represent a rich source of population genetic markers for epidemiological and ecological studies. The strong statistical support for the construction of phylogenetic clades and consistency between the two different tree-building methods employed indicate the value of using whole mt genome data sets for systematic studies of

  12. Importance of databases of nucleic acids for bioinformatic analysis focused to genomics

    Science.gov (United States)

    Jimenez-Gutierrez, L. R.; Barrios-Hernández, C. J.; Pedraza-Ferreira, G. R.; Vera-Cala, L.; Martinez-Perez, F.

    2016-08-01

    Recently, bioinformatics has become a new field of science, indispensable in the analysis of millions of nucleic acids sequences, which are currently deposited in international databases (public or private); these databases contain information of genes, RNA, ORF, proteins, intergenic regions, including entire genomes from some species. The analysis of this information requires computer programs; which were renewed in the use of new mathematical methods, and the introduction of the use of artificial intelligence. In addition to the constant creation of supercomputing units trained to withstand the heavy workload of sequence analysis. However, it is still necessary the innovation on platforms that allow genomic analyses, faster and more effectively, with a technological understanding of all biological processes.

  13. Aye-aye population genomic analyses highlight an important center of endemism in northern Madagascar.

    Science.gov (United States)

    Perry, George H; Louis, Edward E; Ratan, Aakrosh; Bedoya-Reina, Oscar C; Burhans, Richard C; Lei, Runhua; Johnson, Steig E; Schuster, Stephan C; Miller, Webb

    2013-04-09

    We performed a population genomics study of the aye-aye, a highly specialized nocturnal lemur from Madagascar. Aye-ayes have low population densities and extensive range requirements that could make this flagship species particularly susceptible to extinction. Therefore, knowledge of genetic diversity and differentiation among aye-aye populations is critical for conservation planning. Such information may also advance our general understanding of Malagasy biogeography, as aye-ayes have the largest species distribution of any lemur. We generated and analyzed whole-genome sequence data for 12 aye-ayes from three regions of Madagascar (North, West, and East). We found that the North population is genetically distinct, with strong differentiation from other aye-ayes over relatively short geographic distances. For comparison, the average FST value between the North and East aye-aye populations--separated by only 248 km--is over 2.1-times greater than that observed between human Africans and Europeans. This finding is consistent with prior watershed- and climate-based hypotheses of a center of endemism in northern Madagascar. Taken together, these results suggest a strong and long-term biogeographical barrier to gene flow. Thus, the specific attention that should be directed toward preserving large, contiguous aye-aye habitats in northern Madagascar may also benefit the conservation of other distinct taxonomic units. To help facilitate future ecological- and conservation-motivated population genomic analyses by noncomputational biologists, the analytical toolkit used in this study is available on the Galaxy Web site.

  14. Germany unveils €18bn research plan

    Science.gov (United States)

    Banks, Michael

    2009-07-01

    The German government has unveiled an ambitious plan to inject a total of €18bn into teaching and research over the next decade. The German chancellor Angela Merkel, who has a degree in physics, announced that she was releasing the funds despite concerns from her social-democrat coalition partners that financing the package could be difficult in the economic downturn.

  15. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics-An Important Nutri-Cereal of Future.

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B Kalyana; Gaur, Vikram S; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [ Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  16. Gene Discovery and Advances in Finger millet [Eleusine coracana (L. Gaertn.] Genomics - An Important Nutri-cereal of Future

    Directory of Open Access Journals (Sweden)

    Salej Sood

    2016-11-01

    Full Text Available The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L. Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologues from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  17. Genome Editing with Engineered Nucleases in Economically Important Animals and Plants: State of the Art in the Research Pipeline.

    Science.gov (United States)

    Sovová, Tereza; Kerins, Gerard; Demnerová, Kateřina; Ovesná, Jaroslava

    2017-01-01

    After induced mutagenesis and transgenesis, genome editing is the next step in the development of breeding techniques. Genome editing using site-directed nucleases - including meganucleases, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system - is based on the mechanism of double strand breaks. The nuclease is directed to cleave the DNA at a specific place of the genome which is then repaired by natural repair mechanisms. Changes are introduced during the repair that are either accidental or can be targeted if a DNA template with the desirable sequence is provided. These techniques allow making virtually any change to the genome including specific DNA sequence changes, gene insertion, replacements or deletions with unprecedented precision and specificity while being less laborious and more straightforward compared to traditional breeding techniques or transgenesis. Therefore, the research in this field is developing quickly and, apart from model species, multiple studies have focused on economically important species and agronomically important traits that were the key subjects of this review. In plants, studies have been undertaken on disease resistance, herbicide tolerance, nutrient metabolism and nutritional value. In animals, the studies have mainly focused on disease resistance, meat production and allergenicity of milk. However, none of the promising studies has led to commercialization despite several patent applications. The uncertain legal status of genome-editing methods is one of the reasons for poor commercial development, as it is not clear whether the products would fall under the GMO regulation. We believe this issue should be clarified soon in order to allow promising methods to reach their full potential.

  18. Genomes

    National Research Council Canada - National Science Library

    Brown, T. A. (Terence A.)

    2002-01-01

    ... of genome expression and replication processes, and transcriptomics and proteomics. This text is richly illustrated with clear, easy-to-follow, full color diagrams, which are downloadable from the book's website...

  19. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    Science.gov (United States)

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Genomics in cardiovascular diseases: analysis of the importance of the toll-like receptor signaling pathway

    Directory of Open Access Journals (Sweden)

    Bustamante J

    2012-10-01

    Full Text Available J Bustamante,1 E Tamayo,2 J Herreros3,41Department of Cardiovascular Surgery, Hospital Universitario La Princesa, Madrid, 2Department of Anesthesiology and Intensive Care, Hospital Clinico Universitario de Valladolid, Valladolid, 3Department of Cardiovascular Surgery, Hospital Universitario Valdecilla, Santander, 4Biomedical Engineering Institute of Santander, Santander, SpainAbstract: The development of techniques for genomics study makes it possible for us to further our knowledge about the physiopathology of various immunological or infectious diseases. These techniques improve our understanding of the development and evolution of such diseases, including those of cardiovascular origin, whilst they help to bring about the design of new therapeutic strategies. We are reviewing the genetic alterations of immunity in said field, and focusing on the signaling pathway of toll-like receptors because not only does this play a decisive role in response to microorganisms, it is also heavily involved in modulating the inflammatory response to tissue damage, a side effect of numerous cardiovascular diseases. These alterations in tissue homeostasis are present under a wide range of circumstances, such as reperfusion ischemia (myocardial infarction phenomena, arteriosclerosis, or valvulopathy.Keywords: genome-wide association study, single-nucleotide polymorphism, innate immune system, ischemic/reperfusion, myocardial infarction

  1. Exploration of genetic diversity among medicinally important genus Epimedium species based on genomic and EST-SSR marker.

    Science.gov (United States)

    Yousaf, Zubaida; Hu, Weiming; Zhang, Yanjun; Zeng, Shaohua; Wang, Ying

    2015-01-01

    Epimedium species has gained prime importance due to their medicinal and economic values. Therefore, in this study, 26 genomic SSR and 10 EST-SSR markers were developed for 13 medicinal species of the Epimedium genus and one out-group species Vancouveria hexandra W. J. Hooker to explore the existing genetic diversity. A total of 100 alleles by genomic SSR and 65 by EST-SSR were detected. The genomic SSR markers were presented between 2-7 alleles per locus. The observed heterozygosity (Ho) and expected heterozygosity (He) ranged from 0.00 to 4.5 and 0.0254 to 2.8108, respectively. Similarly, for EST-SSR, these values were ranged from 3.00 to 4.00 and 1.9650 to 2.7142. The number of alleles for EST-SSR markers ranged from 3 to 10 with an average of 3.51 per loci. It has been concluded that medicinally important species of the genus Epimedium possesses lower intraspecific genetic variation.

  2. Rapid evolution in insect pests: the importance of space and time in population genomics studies.

    Science.gov (United States)

    Pélissié, Benjamin; Crossley, Michael S; Cohen, Zachary Paul; Schoville, Sean D

    2018-04-01

    Pest species in agroecosystems often exhibit patterns of rapid evolution to environmental and human-imposed selection pressures. Although the role of adaptive processes is well accepted, few insect pests have been studied in detail and most research has focused on selection at insecticide resistance candidate genes. Emerging genomic datasets provide opportunities to detect and quantify selection in insect pest populations, and address long-standing questions about mechanisms underlying rapid evolutionary change. We examine the strengths of recent studies that stratify population samples both in space (along environmental gradients and comparing ancestral vs. derived populations) and in time (using chronological sampling, museum specimens and comparative phylogenomics), resulting in critical insights on evolutionary processes, and providing new directions for studying pests in agroecosystems. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. The genome of Cyanothece 51142, a unicellular diazotrophic cyanobacterium important in the marine nitrogen cycle

    Energy Technology Data Exchange (ETDEWEB)

    Welsh, Eric A.; Liberton, Michelle L.; Stockel, Jana; Loh, Thomas; Elvitigala, Thanura R.; Wang, Chunyan; Wollam, Aye; Fulton, Robert S.; Clifton, Sandra W.; Jacobs, Jon M.; Aurora, Rajeev; Ghosh, Bijoy K.; Sherman, Louis A.; Smith, Richard D.; Wilson, Richard K.; Pakrasi, Himadri B.

    2008-09-30

    Cyanobacteria are oxygenic photosynthetic bacteria that have significant roles in global biological carbon sequestration and oxygen production. They occupy a diverse range of habitats, from open ocean, to hot springs, deserts, and arctic waters. Cyanobacteria are known as the progenitors of the chloroplasts of plants and algae, and are the simplest known organisms to exhibit circadian behavior4. Cyanothece sp. ATCC 51142 is a unicellular marine cyanobacterium capable of N2-fixation, a process that is biochemically incompatible with oxygenic photosynthesis. To resolve this problem, Cyanothece performs photosynthesis during the day and nitrogen fixation at night, thus temporally separating these processes in the same cell. The genome of Cyanothece 51142 was completely sequenced and found to contain a unique arrangement of one large circular chromosome, four small plasmids, and one linear chromosome, the first report of such a linear element in a photosynthetic bacterium. Annotation of the Cyanothece genome was aided by the use of highthroughput proteomics data, enabling the reclassification of 25% of the proteins with no informative sequence homology. Phylogenetic analysis suggests that nitrogen fixation is an ancient process that arose early in evolution and has subsequently been lost in many cyanobacterial strains. In cyanobacterial cells, the circadian clock influences numerous processes, including carbohydrate synthesis, nitrogen fixation, photosynthesis, respiration, and the cell division cycle. During a diurnal period, Cyanothece cells actively accumulate and degrade different storage inclusion bodies for the products of photosynthesis and N2-fixation. This ability to utilize metabolic compartmentalization and energy storage makes Cyanothece an ideal system for bioenergy research, as well as studies of how a unicellular organism balances multiple, often incompatible, processes in the same cell.

  4. Cash boost to Great British science unveiled

    CERN Multimedia

    2002-01-01

    "Trade and Industry Secretary, Patricia Hewitt today unveiled new plans for the DTI's record science budget over the next three years, to keep Britain at the forefront of world science. The plans include funding to develop life saving new health techniques, to seek alternative energy sources, to help our rural economy, to develop the computers of tomorrow and boost business with the next generation of leading edge technologies" (1 page).

  5. Unveiling the biotransformation mechanism of indole in a Cupriavidus sp. strain.

    Science.gov (United States)

    Qu, Yuanyuan; Ma, Qiao; Liu, Ziyan; Wang, Weiwei; Tang, Hongzhi; Zhou, Jiti; Xu, Ping

    2017-12-01

    Indole, an important signaling molecule as well as a typical N-heterocyclic aromatic pollutant, is widespread in nature. However, the biotransformation mechanisms of indole are still poorly studied. Here, we sought to unlock the genetic determinants of indole biotransformation in strain Cupriavidus sp. SHE based on genomics, proteomics and functional studies. A total of 177 proteins were notably altered (118 up- and 59 downregulated) in cells grown in indole mineral salt medium when compared with that in sodium citrate medium. RT-qPCR and gene knockout assays demonstrated that an indole oxygenase gene cluster was responsible for the indole upstream metabolism. A functional indole oxygenase, termed IndA, was identified in the cluster, and its catalytic efficiency was higher than those of previously reported indole oxidation enzymes. Furthermore, the indole downstream metabolism was found to proceed via the atypical CoA-thioester pathway rather than conventional gentisate and salicylate pathways. This unusual pathway was catalyzed by a conserved 2-aminobenzoyl-CoA gene cluster, among which the 2-aminobenzoyl-CoA ligase initiated anthranilate transformation. This study unveils the genetic determinants of indole biotransformation and will provide new insights into our understanding of indole biodegradation in natural environments and its functional studies. © 2017 John Wiley & Sons Ltd.

  6. Importation, Mitigation, and Genomic Epidemiology of Candida auris at a Large Teaching Hospital.

    Science.gov (United States)

    Lesho, Emil P; Bronstein, Melissa Z; McGann, Patrick; Stam, Jason; Kwak, Yoon; Maybank, Rosslyn; McNamara, Jodi; Callahan, Megan; Campbell, Jean; Hinkle, Mary K; Walsh, Edward E

    2018-01-01

    OBJECTIVE Candida auris (CA) is an emerging multidrug-resistant pathogen associated with increased mortality. The environment may play a role, but transmission dynamics remain poorly understood. We sought to limit environmental and patient CA contamination following a sustained unsuspected exposure. DESIGN Quasi-experimental observation. SETTING A 528-bed teaching hospital. PATIENTS The index case patient and 17 collocated ward mates. INTERVENTION Immediately after confirmation of CA in the bloodstream and urine of a patient admitted 6 days previously, active surveillance, enhanced transmission-based precautions, environmental cleaning with peracetic acid-hydrogen peroxide and ultraviolet light, and patient relocation were undertaken. Pre-existing agreements and foundational relationships among internal multidisciplinary teams and external partners were leveraged to bolster detection and mitigation efforts and to provide genomic epidemiology. RESULTS Candida auris was isolated from 3 of 132 surface samples on days 8, 9, and 15 of ward occupancy, and from no patient samples (0 of 48). Environmental and patient isolates were genetically identical (4-8 single-nucleotide polymorphisms [SNPs]) and most closely related to the 2013 India CA-6684 strain (~200 SNPs), supporting the epidemiological hypothesis that the source of environmental contamination was the index case patient, who probably acquired the South Asian strain from another New York hospital. All isolates contained a mutation associated with azole resistance (K163R) found in the India 2105 VPCI strain but not in CA-6684. The index patient remained colonized until death. No surfaces were CA-positive 1 month later. CONCLUSION Compared to previous descriptions, CA dissemination was minimal. Immediate access to rapid CA diagnostics facilitates early containment strategies and outbreak investigations. Infect Control Hosp Epidemiol 2018;39:53-57.

  7. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, Ahmad; Jansen, Rick; Prins, Bram P.; Hottenga, Jouke-Jan; de Geus, Eco J. C.; Boomsma, Dorret I.; Penninx, Brenda W. J. H.; Nolte, Ilja M.; Snieder, Harold; Alizadeh, Behrooz Z.

    Background Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  8. In Silico Post Genome-Wide Association Studies Analysis of C-Reactive Protein Loci Suggests an Important Role for Interferons

    NARCIS (Netherlands)

    Vaez, A.; Jansen, R.; Prins, B.P.; Hottenga, J.J.; de Geus, E.J.C.; Boomsma, D.I.; Penninx, B.W.J.H.; Nolte, I.M.; Snieder, H.; Alizadeh, BZ

    2015-01-01

    Background - Genome-wide association studies (GWASs) have successfully identified several single nucleotide polymorphisms (SNPs) associated with serum levels of C-reactive protein (CRP). An important limitation of GWASs is that the identified variants merely flag the nearby genomic region and do not

  9. Genome Wide Association Study for Drought, Aflatoxin Resistance, and Important Agronomic Traits of Maize Hybrids in the Sub-Tropics

    Science.gov (United States)

    Farfan, Ivan D. Barrero; De La Fuente, Gerald N.; Murray, Seth C.; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L.; Kolomiets, Mike

    2015-01-01

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5–10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

  10. Unveiling the Secrets of Archimedes

    International Nuclear Information System (INIS)

    Turner, Manisha

    2008-01-01

    Progress has been made at the Stanford Linear Accelerator Center (SLAC) toward deciphering the remaining 10-20% of ancient Greek text contained in the Archimedes palimpsest. The text is known to contain valuable works by the mathematician, including the Method of Mechanical Theorems, the Equilibrium of Planes, On Floating Bodies, and several diagrams. The only surviving copy of the text was recycled into a prayer book in the Middle Ages. The ink used to write on the goat skin parchment is partly composed of iron, which is visible by x-ray radiation. To image the palimpsest pages, the parchment was framed and placed in a stage that moved according to the raster method. When an x-ray beam was incident upon the parchment the iron in the ink was detected by a germanium detector. The resultant signal was converted to a gray-scale image. It was extremely important that each line of data was well aligned with the line that came before it. The objectives of this experiment were to determine the best parameters for producing well-aligned images and to reduce the scanning time. Imaging half a page of parchment during previous beam time for this project was achieved in thirty hours. Equations were produced to evaluate count time, shutter time, and the number of pixels in this experiment. On Beamline 6-2 at the Stanford Synchrotron Radiation Laboratory (SSRL), actual scanning time was reduced by one fourth. The remaining pages were successfully imaged and sent to ancient Greek experts for translation

  11. Nucleoporin NUP153 guards genome integrity by promoting nuclear import of 53BP1

    Czech Academy of Sciences Publication Activity Database

    Moudrý, Pavel; Lukas, C.; Macůrek, Libor; Neumann, B.; Heriche, J.K.; Pepperkok, R.; Ellenberg, J.; Hodný, Zdeněk; Lukas, J.; Bartek, Jiří

    2012-01-01

    Roč. 19, č. 5 (2012), s. 798-807 ISSN 1350-9047 R&D Projects: GA ČR GA301/08/0353; GA ČR GAP301/10/1525; GA ČR GPP305/10/P420 Grant - others:7.RP EU(XE) CZ.1.05/2.1.00/01.0030 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage response * NUP153 * 53BP1 nuclear import Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.371, year: 2012

  12. Astronomers Unveiling Life's Cosmic Origins

    Science.gov (United States)

    2009-02-01

    Processes that laid the foundation for life on Earth -- star and planet formation and the production of complex organic molecules in interstellar space -- are yielding their secrets to astronomers armed with powerful new research tools, and even better tools soon will be available. Astronomers described three important developments at a symposium on the "Cosmic Cradle of Life" at the annual meeting of the American Association for the Advancement of Science in Chicago, IL. Chemistry Cycle The Cosmic Chemistry Cycle CREDIT: Bill Saxton, NRAO/AUI/NSF Full Size Image Files Chemical Cycle Graphic (above image, JPEG, 129K) Graphic With Text Blocks (JPEG, 165K) High-Res TIFF (44.2M) High-Res TIFF With Text Blocks (44.2M) In one development, a team of astrochemists released a major new resource for seeking complex interstellar molecules that are the precursors to life. The chemical data released by Anthony Remijan of the National Radio Astronomy Observatory (NRAO) and his university colleagues is part of the Prebiotic Interstellar Molecule Survey, or PRIMOS, a project studying a star-forming region near the center of our Milky Way Galaxy. PRIMOS is an effort of the National Science Foundation's Center for Chemistry of the Universe, started at the University of Virginia (UVa) in October 2008, and led by UVa Professor Brooks H. Pate. The data, produced by the NSF's Robert C. Byrd Green Bank Telescope (GBT) in West Virginia, came from more than 45 individual observations totalling more than nine GigaBytes of data and over 1.4 million individual frequency channels. Scientists can search the GBT data for specific radio frequencies, called spectral lines -- telltale "fingerprints" -- naturally emitted by molecules in interstellar space. "We've identified more than 720 spectral lines in this collection, and about 240 of those are from unknown molecules," Remijan said. He added, "We're making available to all scientists the best collection of data below 50 GHz ever produced for

  13. Replication protein A, the laxative that keeps DNA regular: The importance of RPA phosphorylation in maintaining genome stability.

    Science.gov (United States)

    Byrne, Brendan M; Oakley, Gregory G

    2018-04-20

    The eukaryotic ssDNA-binding protein, Replication protein A (RPA), was first discovered almost three decades ago. Since then, much progress has been made to elucidate the critical roles for RPA in DNA metabolic pathways that help promote genomic stability. The canonical RPA heterotrimer (RPA1-3) is an essential coordinator of DNA metabolism that interacts with ssDNA and numerous protein partners to coordinate its roles in DNA replication, repair, recombination and telomere maintenance. An alternative form of RPA, termed aRPA, is formed by a complex of RPA4 with RPA1 and RPA3. aRPA is expressed differentially in cells compared to canonical RPA and has been shown to inhibit canonical RPA function while allowing for regular maintenance of cell viability. Interestingly, while aRPA is defective in DNA replication and cell cycle progression, it was shown to play a supporting role in nucleotide excision repair and recombination. The binding domains of canonical RPA interact with a growing number of partners involved in numerous genome maintenance processes. The protein interactions of the RPA-ssDNA complex are not only governed by competition between the binding proteins but also by post-translation modifications such as phosphorylation. Phosphorylation of RPA2 is an important post-translational modification of the RPA complex, and is essential for directing context-specific functions of the RPA complex in the DNA damage response. Due to the importance of RPA in cellular metabolism, it was identified as an appealing target for chemotherapeutic drug development that could be used in future cancer treatment regimens. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Photonic integrated circuits unveil crisis-induced intermittency.

    Science.gov (United States)

    Karsaklian Dal Bosco, Andreas; Akizawa, Yasuhiro; Kanno, Kazutaka; Uchida, Atsushi; Harayama, Takahisa; Yoshimura, Kazuyuki

    2016-09-19

    We experimentally investigate an intermittent route to chaos in a photonic integrated circuit consisting of a semiconductor laser with time-delayed optical feedback from a short external cavity. The transition from a period-doubling dynamics to a fully-developed chaos reveals a stage intermittently exhibiting these two dynamics. We unveil the bifurcation mechanism underlying this route to chaos by using the Lang-Kobayashi model and demonstrate that the process is based on a phenomenon of attractor expansion initiated by a particular distribution of the local Lyapunov exponents. We emphasize on the crucial importance of the distribution of the steady-state solutions introduced by the time-delayed feedback on the existence of this intermittent dynamics.

  15. A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization

    International Nuclear Information System (INIS)

    Valles, Steven M.; Strong, Charles A.; Dang, Phat M.; Hunter, Wayne B.; Pereira, Roberto M.; Oi, David H.; Shapiro, Alexandra M.; Williams, David F.

    2004-01-01

    We report the first discovery and genome sequence of a virus infecting the red imported fire ant, Solenopsis invicta. The 8026 nucleotide, polyadenylated, RNA genome encoded two large open reading frames (ORF1 and ORF2), flanked and separated by 27, 223, and 171 nucleotide untranslated regions, respectively. The predicted amino acid sequence of the 5' proximal ORF1 (nucleotides 28 to 4218) exhibited significant identity and possessed consensus sequences characteristic of the helicase, cysteine protease, and RNA-dependent RNA polymerase sequence motifs from picornaviruses, picorna-like viruses, comoviruses, caliciviruses, and sequiviruses. The predicted amino acid sequence of the 3' proximal ORF2 (nucleotides 4390-7803) showed similarity to structural proteins in picorna-like viruses, especially the acute bee paralysis virus. Electron microscopic examination of negatively stained samples from virus-infected fire ants revealed isometric particles with a diameter of 31 nm, consistent with Picornaviridae. A survey for the fire ant virus from areas around Florida revealed a pattern of fairly widespread distribution. Among 168 nests surveyed, 22.9% were infected. The virus was found to infect all fire ant caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates ( male and female ), and queens. The virus, tentatively named S. invicta virus (SINV-1), appears to belong to the picorna-like viruses. We did not observe any perceptible symptoms among infected nests in the field. However, in every case where an SINV-1-infected colony was excavated from the field with an inseminated queen and held in the laboratory, all of the brood in these colonies died within 3 months

  16. Relationships Between Health Literacy and Genomics-Related Knowledge, Self-Efficacy, Perceived Importance, and Communication in a Medically Underserved Population.

    Science.gov (United States)

    Kaphingst, Kimberly A; Blanchard, Melvin; Milam, Laurel; Pokharel, Manusheela; Elrick, Ashley; Goodman, Melody S

    2016-01-01

    The increasing importance of genomic information in clinical care heightens the need to examine how individuals understand, value, and communicate about this information. Based on a conceptual framework of genomics-related health literacy, we examined whether health literacy was related to knowledge, self-efficacy, and perceived importance of genetics and family health history (FHH) and communication about FHH in a medically underserved population. The analytic sample was composed of 624 patients at a primary care clinic in a large urban hospital. About half of the participants (47%) had limited health literacy; 55% had no education beyond high school, and 58% were Black. In multivariable models, limited health literacy was associated with lower genetic knowledge (β = -0.55, SE = 0.10, p interval [CI; 0.28, 0.90], p = .020), and greater perceived importance of genetic information (OR = 1.95, 95% CI [1.27, 3.00], p = .0022) but lower perceived importance of FHH information (OR = 0.47, 95% CI [0.26, 0.86], p = .013) and more frequent communication with a doctor about FHH (OR = 2.02, 95% CI [1.27, 3.23], p = .0032). The findings highlight the importance of considering domains of genomics-related health literacy (e.g., knowledge, oral literacy) in developing educational strategies for genomic information. Health literacy research is essential to avoid increasing disparities in information and health outcomes as genomic information reaches more patients.

  17. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  18. Genome-Based Studies of Marine Microorganisms to Maximize the Diversity of Natural Products Discovery for Medical Treatments

    Directory of Open Access Journals (Sweden)

    Xin-Qing Zhao

    2011-01-01

    Full Text Available Marine microorganisms are rich source for natural products which play important roles in pharmaceutical industry. Over the past decade, genome-based studies of marine microorganisms have unveiled the tremendous diversity of the producers of natural products and also contributed to the efficiency of harness the strain diversity and chemical diversity, as well as the genetic diversity of marine microorganisms for the rapid discovery and generation of new natural products. In the meantime, genomic information retrieved from marine symbiotic microorganisms can also be employed for the discovery of new medical molecules from yet-unculturable microorganisms. In this paper, the recent progress in the genomic research of marine microorganisms is reviewed; new tools of genome mining as well as the advance in the activation of orphan pathways and metagenomic studies are summarized. Genome-based research of marine microorganisms will maximize the biodiscovery process and solve the problems of supply and sustainability of drug molecules for medical treatments.

  19. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  20. The Complete Chloroplast Genome Sequence of Tree of Heaven (Ailanthus altissima (Mill. (Sapindales: Simaroubaceae, an Important Pantropical Tree

    Directory of Open Access Journals (Sweden)

    Josphat K. Saina

    2018-03-01

    Full Text Available Ailanthus altissima (Mill. Swingle (Simaroubaceae is a deciduous tree widely distributed throughout temperate regions in China, hence suitable for genetic diversity and evolutionary studies. Previous studies in A. altissima have mainly focused on its biological activities, genetic diversity and genetic structure. However, until now there is no published report regarding genome of this plant species or Simaroubaceae family. Therefore, in this paper, we first characterized A. altissima complete chloroplast genome sequence. The tree of heaven chloroplast genome was found to be a circular molecule 160,815 base pairs (bp in size and possess a quadripartite structure. The A. altissima chloroplast genome contains 113 unique genes of which 79 and 30 are protein coding and transfer RNA (tRNA genes respectively and also 4 ribosomal RNA genes (rRNA with overall GC content of 37.6%. Microsatellite marker detection identified A/T mononucleotides as majority SSRs in all the seven analyzed genomes. Repeat analyses of seven Sapindales revealed a total of 49 repeats in A. altissima, Rhus chinensis, Dodonaea viscosa, Leitneria floridana, while Azadirachta indica, Boswellia sacra, and Citrus aurantiifolia had a total of 48 repeats. The phylogenetic analysis using protein coding genes revealed that A. altissima is a sister to Leitneria floridana and also suggested that Simaroubaceae is a sister to Rutaceae family. The genome information reported here could be further applied for evolution and invasion, population genetics, and molecular studies in this plant species and family.

  1. The importance of information on relatives for the prediction of genomic breeding values and the implications for the makeup of reference data sets in livestock breeding schemes.

    Science.gov (United States)

    Clark, Samuel A; Hickey, John M; Daetwyler, Hans D; van der Werf, Julius H J

    2012-02-09

    The theory of genomic selection is based on the prediction of the effects of genetic markers in linkage disequilibrium with quantitative trait loci. However, genomic selection also relies on relationships between individuals to accurately predict genetic value. This study aimed to examine the importance of information on relatives versus that of unrelated or more distantly related individuals on the estimation of genomic breeding values. Simulated and real data were used to examine the effects of various degrees of relationship on the accuracy of genomic selection. Genomic Best Linear Unbiased Prediction (gBLUP) was compared to two pedigree based BLUP methods, one with a shallow one generation pedigree and the other with a deep ten generation pedigree. The accuracy of estimated breeding values for different groups of selection candidates that had varying degrees of relationships to a reference data set of 1750 animals was investigated. The gBLUP method predicted breeding values more accurately than BLUP. The most accurate breeding values were estimated using gBLUP for closely related animals. Similarly, the pedigree based BLUP methods were also accurate for closely related animals, however when the pedigree based BLUP methods were used to predict unrelated animals, the accuracy was close to zero. In contrast, gBLUP breeding values, for animals that had no pedigree relationship with animals in the reference data set, allowed substantial accuracy. An animal's relationship to the reference data set is an important factor for the accuracy of genomic predictions. Animals that share a close relationship to the reference data set had the highest accuracy from genomic predictions. However a baseline accuracy that is driven by the reference data set size and the overall population effective population size enables gBLUP to estimate a breeding value for unrelated animals within a population (breed), using information previously ignored by pedigree based BLUP methods.

  2. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  3. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  4. Draft Genome Sequences of Two Avian Pathogenic Escherichia coli Strains of Clinical Importance, E44 and E51

    DEFF Research Database (Denmark)

    Ronco, Troels; Stegger, Marc; Andersen, Paal S

    2016-01-01

    Avian pathogenic Escherichia coli strains have remarkable impacts on animal welfare and the production economy in the poultry industry worldwide. Here, we present the draft genomes of two isolates from chickens (E44 and E51) obtained from field outbreaks and subsequently investigated for their po......Avian pathogenic Escherichia coli strains have remarkable impacts on animal welfare and the production economy in the poultry industry worldwide. Here, we present the draft genomes of two isolates from chickens (E44 and E51) obtained from field outbreaks and subsequently investigated...

  5. Microevolution analysis of Bacillus coahuilensis unveils differences in phosphorus acquisition strategies and their regulation

    Directory of Open Access Journals (Sweden)

    Zulema eGómez-Lunar

    2016-02-01

    Full Text Available Bacterial genomes undergo numerous events of gene losses and gains that generate genome variability among strains of the same species (microevolution. Our aim was to compare the genomes and relevant phenotypes of three Bacillus coahuilensis strains from two oligotrophic hydrological systems in the Cuatro Ciénegas Basin (México, to unveil the environmental challenges that this species cope with, and the microevolutionary differences in these genotypes. Since the strains were isolated from a low P environment, we placed emphasis on the search of different phosphorus acquisition strategies. The three B. coahuilensis strains exhibited similar numbers of coding DNA sequences, of which 82% (2, 893 constituted the core genome, and 18% corresponded to accessory genes. Most of the genes in this last group were associated with mobile genetic elements or were annotated as hypothetical proteins. Ten percent of the pangenome consisted of strain-specific genes. Alignment of the three B. coahuilensis genomes indicated a high level of synteny and revealed the presence of several genomic islands. Unexpectedly, one of these islands contained genes that encode the 2-keto-3-deoxymannooctulosonic acid (Kdo biosynthesis enzymes, a feature associated to cell walls of Gram-negative bacteria. Some microevolutionary changes were clearly associated with mobile genetic elements. Our analysis revealed inconsistencies between phenotype and genotype, which we suggest result from the impossibility to map regulatory features to genome analysis. Experimental results revealed variability in the types and numbers of auxotrophies between the strains that could not consistently be explained by in silico metabolic models. Several intraspecific differences in preferences for carbohydrate and phosphorus utilization were observed. Regarding phosphorus recycling, scavenging, and storage, variations were found between the three genomes. The three strains exhibited differences regarding

  6. Unveiling protein functions through the dynamics of the interaction network.

    Directory of Open Access Journals (Sweden)

    Irene Sendiña-Nadal

    Full Text Available Protein interaction networks have become a tool to study biological processes, either for predicting molecular functions or for designing proper new drugs to regulate the main biological interactions. Furthermore, such networks are known to be organized in sub-networks of proteins contributing to the same cellular function. However, the protein function prediction is not accurate and each protein has traditionally been assigned to only one function by the network formalism. By considering the network of the physical interactions between proteins of the yeast together with a manual and single functional classification scheme, we introduce a method able to reveal important information on protein function, at both micro- and macro-scale. In particular, the inspection of the properties of oscillatory dynamics on top of the protein interaction network leads to the identification of misclassification problems in protein function assignments, as well as to unveil correct identification of protein functions. We also demonstrate that our approach can give a network representation of the meta-organization of biological processes by unraveling the interactions between different functional classes.

  7. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  8. Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (Pungitius pungitius

    Directory of Open Access Journals (Sweden)

    Shimada Yukinori

    2010-05-01

    Full Text Available Abstract Background Identification of genes involved in adaptation and speciation by targeting specific genes of interest has become a plausible strategy also for non-model organisms. We investigated the potential utility of available sequenced fish genomes to develop microsatellite (cf. simple sequence repeat, SSR markers for functionally important genes in nine-spined sticklebacks (Pungitius pungitius, as well as cross-species transferability of SSR primers from three-spined (Gasterosteus aculeatus to nine-spined sticklebacks. In addition, we examined the patterns and degree of SSR conservation between these species using their aligned sequences. Results Cross-species amplification success was lower for SSR markers located in or around functionally important genes (27 out of 158 than for those randomly derived from genomic (35 out of 101 and cDNA (35 out of 87 libraries. Polymorphism was observed at a large proportion (65% of the cross-amplified loci independently of SSR type. To develop SSR markers for functionally important genes in nine-spined sticklebacks, SSR locations were surveyed in or around 67 target genes based on the three-spined stickleback genome and these regions were sequenced with primers designed from conserved sequences in sequenced fish genomes. Out of the 81 SSRs identified in the sequenced regions (44,084 bp, 57 exhibited the same motifs at the same locations as in the three-spined stickleback. Di- and trinucleotide SSRs appeared to be highly conserved whereas mononucleotide SSRs were less so. Species-specific primers were designed to amplify 58 SSRs using the sequences of nine-spined sticklebacks. Conclusions Our results demonstrated that a large proportion of SSRs are conserved in the species that have diverged more than 10 million years ago. Therefore, the three-spined stickleback genome can be used to predict SSR locations in the nine-spined stickleback genome. While cross-species utility of SSR primers is limited due

  9. Gene clusters of Hafnia alvei strain FB1 important in survival and pathogenesis: a draft genome perspective.

    Science.gov (United States)

    Tan, Jia-Yi; Yin, Wai-Fong; Chan, Kok-Gan

    2014-01-01

    Hafnia alvei is an opportunistic pathogen involved in various types of nosocomical infections. The species has been found to inhabit food and mammalian guts. However, its status as an enteropathogen, and whether the food-inhabiting strains could be a source of gastrointestinal infection remains obscure. In this report we present a draft genome of H. alvei strain FB1 isolated from fish paste meatball, a food popular among Malaysian and Chinese populations. The data was generated on the Illumina MiSeq platform. A comparative study was carried out on FB1 against two other previously sequenced H. alvei genomes. Several gene clusters putatively involved in survival and pathogenesis of H. alvei FB1 in food and gut environment were characterised in this study. These include the widespread colonisation island (WCI), the tad locus that is known to play an essential role in biofilm formation, a eut operon that might contribute to advantage in nutrient acquisition in gut environment, and genes responsible for siderophore production This features enable the bacteria to successful colonise in the host gut environment. With the whole genome data of H. alvei FB1 presented in this study, we hope to provide an insight into future studies on this candidate of enteropathogen by looking into the possible mechanisms employed to survive stresses and gain advantage in competitions, which eventually leads to successful colonisation and pathogenesis. This is to serve as the basis for more effective clinical diagnosis and treatment.

  10. Understanding intratumor heterogeneity by combining genome analysis and mathematical modeling.

    Science.gov (United States)

    Niida, Atsushi; Nagayama, Satoshi; Miyano, Satoru; Mimori, Koshi

    2018-04-01

    Cancer is composed of multiple cell populations with different genomes. This phenomenon called intratumor heterogeneity (ITH) is supposed to be a fundamental cause of therapeutic failure. Therefore, its principle-level understanding is a clinically important issue. To achieve this goal, an interdisciplinary approach combining genome analysis and mathematical modeling is essential. For example, we have recently performed multiregion sequencing to unveil extensive ITH in colorectal cancer. Moreover, by employing mathematical modeling of cancer evolution, we demonstrated that it is possible that this ITH is generated by neutral evolution. In this review, we introduce recent advances in a research field related to ITH and also discuss strategies for exploiting novel findings on ITH in a clinical setting. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  11. ESA Unveils Its New Comet Chaser.

    Science.gov (United States)

    1999-07-01

    The objective is to study one of these primordial objects at close quarters by placing a lander on its surface and chasing, with an orbiter, the comet for millions of kilometres through space. Comets - among the oldest (4.6 billion years!) and last altered objects in the solar system - are regarded as the building blocks from which the planets formed. Thus the Rosetta's discoveries will allow the scientists to learn more about birth and evolution of the planets and about the origin of life on the Earth. The final design of the Rosetta orbiter will be revealed for the first time at the Royal Society in London on 1 July when a 1:4 scale model will be unveiled by ESA's Director of Science, Prof.. Roger Bonnet. (The full size version of the spacecraft is 32 metres across, so large that it would stretch the entire width of a football pitch. Almost 90 of this is accounted for by the giant solar panels which are needed to provide electrical power in the dark depths of the Solar System). "Rosetta is a mission of major scientific importance," said Prof. Bonnet. "It will build on the discoveries made by Giotto and confirm ESA's leading role in the exploration of the Solar System and the Universe as a whole." The timing of this event has been chosen to coincide with the London meeting of the Rosetta Science Working Team and the second Earth flyby of the now non-operational Giotto spacecraft. In addition, the opening of the British Museum's 'Cracking Codes' Exhibition, for which the Rosetta Stone is the centrepiece, is set to take place on 10 July. The Rosetta mission. Rosetta is the third Cornerstone in ESA's 'Horizon 2000' long-term scientific programme. It will be launched by Ariane 5 rocket from Kourou spaceport in French Guiana in January 2003. In order to gain sufficient speed to reach the distant comet, Rosetta will require gravity assists from the Earth (twice) and Mars. After swinging around Mars in May 2005, Rosetta will return to Earth's vicinity in October 2005 and

  12. Complete Genome Sequence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) from the First Imported MERS-CoV Case in China.

    Science.gov (United States)

    Lu, Roujian; Wang, Yanqun; Wang, Wenling; Nie, Kai; Zhao, Yanjie; Su, Juan; Deng, Yao; Zhou, Weimin; Li, Yang; Wang, Huijuan; Wang, Wen; Ke, Changwen; Ma, Xuejun; Wu, Guizhen; Tan, Wenjie

    2015-08-13

    On 26 May 2015, an imported Middle East respiratory syndrome coronavirus (MERS-CoV) was identified in Guangdong Province, China, and found to be closely related to the MERS-CoV strain prevalent in South Korea. The full genome of the ChinaGD01 strain was sequenced and analyzed to investigate the epidemiology and evolution of MERS-CoV circulating in South Korea and China. Copyright © 2015 Lu et al.

  13. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands.

    Science.gov (United States)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L

    2017-08-31

    Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.

  14. The genomes of three Bradyrhizobium sp. isolated from root nodules of Lupinus albescens grown in extremely poor soils display important genes for resistance to environmental stress.

    Science.gov (United States)

    Granada, Camille E; Vargas, Luciano K; Sant'Anna, Fernando Hayashi; Balsanelli, Eduardo; Baura, Valter Antonio de; Oliveira Pedrosa, Fábio de; Souza, Emanuel Maltempi de; Falcon, Tiago; Passaglia, Luciane M P

    2018-05-17

    Lupinus albescens is a resistant cover plant that establishes symbiotic relationships with bacteria belonging to the Bradyrhizobium genus. This symbiosis helps the development of these plants in adverse environmental conditions, such as the ones found in arenized areas of Southern Brazil. This work studied three Bradyrhizobium sp. (AS23, NAS80 and NAS96) isolated from L. albescens plants that grow in extremely poor soils (arenized areas and adjacent grasslands). The genomes of these three strains were sequenced in the Ion Torrent platform using the IonXpress library preparation kit, and presented a total number of bases of 1,230,460,823 for AS23, 1,320,104,022 for NAS80, and 1,236,105,093 for NAS96. The genome comparison with closest strains Bradyrhizobium japonicum USDA6 and Bradyrhizobium diazoefficiens USDA110 showed important variable regions (with less than 80% of similarity). Genes encoding for factors for resistance/tolerance to heavy metal, flagellar motility, response to osmotic and oxidative stresses, heat shock proteins (present only in the three sequenced genomes) could be responsible for the ability of these microorganisms to survive in inhospitable environments. Knowledge about these genomes will provide a foundation for future development of an inoculant bioproduct that should optimize the recovery of degraded soils using cover crops.

  15. A genome-wide association study to detect QTL for commercially important traits in Swiss Large White boars.

    Directory of Open Access Journals (Sweden)

    Doreen Becker

    Full Text Available The improvement of meat quality and production traits has high priority in the pork industry. Many of these traits show a low to moderate heritability and are difficult and expensive to measure. Their improvement by targeted breeding programs is challenging and requires knowledge of the genetic and molecular background. For this study we genotyped 192 artificial insemination boars of a commercial line derived from the Swiss Large White breed using the PorcineSNP60 BeadChip with 62,163 evenly spaced SNPs across the pig genome. We obtained 26 estimated breeding values (EBVs for various traits including exterior, meat quality, reproduction, and production. The subsequent genome-wide association analysis allowed us to identify four QTL with suggestive significance for three of these traits (p-values ranging from 4.99×10⁻⁶ to 2.73×10⁻⁵. Single QTL for the EBVs pH one hour post mortem (pH1 and carcass length were on pig chromosome (SSC 14 and SSC 2, respectively. Two QTL for the EBV rear view hind legs were on SSC 10 and SSC 16.

  16. Unveiling Reality of the Mind: Cultural Arbitrary of Consumerism

    Science.gov (United States)

    Choi, Su-Jin

    2012-01-01

    This paper discusses the cultural arbitrary of consumerism by focusing on a personal realm. That is, I discuss what consumerism appeals to and how it flourishes in relation to our minds. I argue that we need to unveil reality of the mind, be aware of ourselves in relation to the perpetuation of consumerism, in order to critically intervene in the…

  17. Book review: Unveiling the Whale: Discourses on Whales and Whaling

    Science.gov (United States)

    John Schelhas

    2012-01-01

    Whaling represents one of the most internationally controversial and highly polarized environmental issues of recent times. Arne Kalland, in Unveiling the Whale: Discourses on Whales and Whaling, examines the whaling issue from the perspective of a pro-whaling country with an emphasis on analysis of discourse in international arenas, primarily the International Whaling...

  18. Proofpoint unveils the industry's most advanced anti-spam laboratory

    CERN Multimedia

    2003-01-01

    "Proofpoint, Inc., the leader in large enterprise anti-spam solutions, today unveiled its Anti-Spam Laboratory, the world's most advanced center for spam research and analysis, and the first to be based on advanced Machine Learning science" (1 page).

  19. First National Picture of Trends in the Humanities Is Unveiled

    Science.gov (United States)

    Howard, Jennifer

    2009-01-01

    When it comes to hard data about what they do, policy makers and educators in the humanities have been mostly left out in the cold, forced to rely on isolated statistics that do not give an overview of the field. That changed this month, as the American Academy of Arts and Sciences unveiled the prototype of its long-awaited Humanities Indicators…

  20. The first complete mitochondrial genome of a Belostomatidae species, Lethocerus indicus, the giant water bug: An important edible insect.

    Science.gov (United States)

    Devi, Kshetrimayum Miranda; Shantibala, Tourangbam; Debaraj, Hajarimayum

    2016-10-10

    Lethocerus indicus of the family Belostomatidae is one of the most preferred and delicious edible insects in different parts of South-East Asia including North-East, India. The mitogenome of L. indicus represents the first complete mitogenome sequence of a Belostomatidae species in Heteroptera order. The mitogenome of L. indicus is 16,251bp and contains 37 genes including 13 protein coding genes (PCGs), 22 tRNA genes, two rRNA genes, and a large non-coding region. The genome has a typical gene order which is identical to other Heteroptera species. All tRNAs exhibit the classic cloverleaf secondary structure except tRNASer (AGN). All the PCGs employ a complete translation termination codon either TAA or TAG except COII. The nucleotide composition showed heavy biased toward AT accounting to 70.9% of total mitogenome. The overall A+T content of L. indicus mitogenome was comparatively lower than some other Heteropteran bugs mitogenomes. The control region is divided into seven different parts which includes the putative stem loop, repeats, tandem repeats, GC and AT rich regions. The phylogenetic relationship based on maximum-likelihood method using all protein coding genes was congruent with the traditional morphological classification that Belostomatidae is closely related to Nepidae. The complete mitogenome sequence of L. indicus provides fundamental data useful in conservation genetics and aquaculture diversification. Copyright © 2016. Published by Elsevier B.V.

  1. Decoding the genome with an integrative analysis tool: combinatorial CRM Decoder.

    Science.gov (United States)

    Kang, Keunsoo; Kim, Joomyeong; Chung, Jae Hoon; Lee, Daeyoup

    2011-09-01

    The identification of genome-wide cis-regulatory modules (CRMs) and characterization of their associated epigenetic features are fundamental steps toward the understanding of gene regulatory networks. Although integrative analysis of available genome-wide information can provide new biological insights, the lack of novel methodologies has become a major bottleneck. Here, we present a comprehensive analysis tool called combinatorial CRM decoder (CCD), which utilizes the publicly available information to identify and characterize genome-wide CRMs in a species of interest. CCD first defines a set of the epigenetic features which is significantly associated with a set of known CRMs as a code called 'trace code', and subsequently uses the trace code to pinpoint putative CRMs throughout the genome. Using 61 genome-wide data sets obtained from 17 independent mouse studies, CCD successfully catalogued ∼12 600 CRMs (five distinct classes) including polycomb repressive complex 2 target sites as well as imprinting control regions. Interestingly, we discovered that ∼4% of the identified CRMs belong to at least two different classes named 'multi-functional CRM', suggesting their functional importance for regulating spatiotemporal gene expression. From these examples, we show that CCD can be applied to any potential genome-wide datasets and therefore will shed light on unveiling genome-wide CRMs in various species.

  2. Data analysis unveils a new stylized fact in foreign currency markets

    Science.gov (United States)

    Nacher, J. C.; Ochiai, T.

    2012-09-01

    The search for stylized facts (i.e., simplified empirical facts) is of capital importance in econophysics because the stylized facts constitute the experimental empirical body on which theories and models should be tested. At the moment they are too few and this is an important limitation to the progress in the field. In this work, we unveil a new stylized fact, which consists of resistance effect and breaking-acceleration effect that implicitly requires a long memory feature in price movement. By analyzing a vast amount of historical data, we demonstrate that the financial market tends to exceed a past (historical) extreme price less often than expected by a classic short-memory model (e.g., Black-Scholes model). We call it resistance effect. However, when the market does it, we predict that the average volatility at that time point will be much higher (accelerates more). It means, in average, volatility accelerates more when the price breaks the highest (lowest) value. We refer to this as breaking-acceleration effect. These observed empirical facts are actually an effect which may arise from technical trading and psychological effects. Taken together, these results indicate that, beyond the predictive capability of this unveiled stylized fact, traditional short-memory models do not faithfully capture the market dynamics.

  3. Universe unveiled the cosmos in my bubble bath

    CERN Document Server

    Vishveshwara, C V

    2015-01-01

    The bubbles were swirling all around me, massaging my body. As I luxuriated in this fantastic bath, I gasped realizing that those bubbles carried with them miniature galaxies bringing the entire Cosmos into my bathtub... Alfie is back. And so are George and other characters from the author’s previous book Einstein’s Enigma or Black Holes in My Bubble Bath. While the present book, Universe Unveiled - The Cosmos in My Bubble Bath, is completely independent, its storyline can be considered a sequel to the previous one. The scientific content spanning ancient world models to the most recent mysteries of cosmology is presented in an entirely nontechnical and descriptive style through the discussions between Alfie, the enlightened learner, and George, professor of astrophysics. Fantasies, based on these discussions that cover the scientific facts, are created by the magical bubble baths taken by Alfie. Universe Unveiled blends accurate science with philosophy, drama, humour, and fantasy to create an exciting co...

  4. Large scale comparative codon-pair context analysis unveils general rules that fine-tune evolution of mRNA primary structure.

    Directory of Open Access Journals (Sweden)

    Gabriela Moura

    Full Text Available BACKGROUND: Codon usage and codon-pair context are important gene primary structure features that influence mRNA decoding fidelity. In order to identify general rules that shape codon-pair context and minimize mRNA decoding error, we have carried out a large scale comparative codon-pair context analysis of 119 fully sequenced genomes. METHODOLOGIES/PRINCIPAL FINDINGS: We have developed mathematical and software tools for large scale comparative codon-pair context analysis. These methodologies unveiled general and species specific codon-pair context rules that govern evolution of mRNAs in the 3 domains of life. We show that evolution of bacterial and archeal mRNA primary structure is mainly dependent on constraints imposed by the translational machinery, while in eukaryotes DNA methylation and tri-nucleotide repeats impose strong biases on codon-pair context. CONCLUSIONS: The data highlight fundamental differences between prokaryotic and eukaryotic mRNA decoding rules, which are partially independent of codon usage.

  5. Discovering human germ cell mutagens with whole genome sequencing: Insights from power calculations reveal the importance of controlling for between-family variability.

    Science.gov (United States)

    Webster, R J; Williams, A; Marchetti, F; Yauk, C L

    2018-07-01

    Mutations in germ cells pose potential genetic risks to offspring. However, de novo mutations are rare events that are spread across the genome and are difficult to detect. Thus, studies in this area have generally been under-powered, and no human germ cell mutagen has been identified. Whole Genome Sequencing (WGS) of human pedigrees has been proposed as an approach to overcome these technical and statistical challenges. WGS enables analysis of a much wider breadth of the genome than traditional approaches. Here, we performed power analyses to determine the feasibility of using WGS in human families to identify germ cell mutagens. Different statistical models were compared in the power analyses (ANOVA and multiple regression for one-child families, and mixed effect model sampling between two to four siblings per family). Assumptions were made based on parameters from the existing literature, such as the mutation-by-paternal age effect. We explored two scenarios: a constant effect due to an exposure that occurred in the past, and an accumulating effect where the exposure is continuing. Our analysis revealed the importance of modeling inter-family variability of the mutation-by-paternal age effect. Statistical power was improved by models accounting for the family-to-family variability. Our power analyses suggest that sufficient statistical power can be attained with 4-28 four-sibling families per treatment group, when the increase in mutations ranges from 40 to 10% respectively. Modeling family variability using mixed effect models provided a reduction in sample size compared to a multiple regression approach. Much larger sample sizes were required to detect an interaction effect between environmental exposures and paternal age. These findings inform study design and statistical modeling approaches to improve power and reduce sequencing costs for future studies in this area. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  6. Unveiling the Microfoundations of Absorptive Capacity

    DEFF Research Database (Denmark)

    Distel, Andreas Philipp

    2017-01-01

    to absorptive capacity at the organizational level and that this relationship is mediated through a microlevel process. The findings reveal that knowledge workers’ cognitive process of perspective taking and their creative behavior are important microfoundations of absorptive capacity. Moreover, the results...... emphasize the critical role of key employees in explaining firm-level heterogeneity in building organizational capabilities....

  7. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    Directory of Open Access Journals (Sweden)

    Ronne Hans

    2008-11-01

    Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.

  8. Genome-Wide Sensitivity Analysis of the Microsymbiont Sinorhizobium meliloti to Symbiotically Important, Defensin-Like Host Peptides

    Directory of Open Access Journals (Sweden)

    Markus F. F. Arnold

    2017-08-01

    Full Text Available The model legume species Medicago truncatula expresses more than 700 nodule-specific cysteine-rich (NCR signaling peptides that mediate the differentiation of Sinorhizobium meliloti bacteria into nitrogen-fixing bacteroids. NCR peptides are essential for a successful symbiosis in legume plants of the inverted-repeat-lacking clade (IRLC and show similarity to mammalian defensins. In addition to signaling functions, many NCR peptides exhibit antimicrobial activity in vitro and in vivo. Bacterial resistance to these antimicrobial activities is likely to be important for symbiosis. However, the mechanisms used by S. meliloti to resist antimicrobial activity of plant peptides are poorly understood. To address this, we applied a global genetic approach using transposon mutagenesis followed by high-throughput sequencing (Tn-seq to identify S. meliloti genes and pathways that increase or decrease bacterial competitiveness during exposure to the well-studied cationic NCR247 peptide and also to the unrelated model antimicrobial peptide polymyxin B. We identified 78 genes and several diverse pathways whose interruption alters S. meliloti resistance to NCR247. These genes encode the following: (i cell envelope polysaccharide biosynthesis and modification proteins, (ii inner and outer membrane proteins, (iii peptidoglycan (PG effector proteins, and (iv non-membrane-associated factors such as transcriptional regulators and ribosome-associated factors. We describe a previously uncharacterized yet highly conserved peptidase, which protects S. meliloti from NCR247 and increases competitiveness during symbiosis. Additionally, we highlight a considerable number of uncharacterized genes that provide the basis for future studies to investigate the molecular basis of symbiotic development as well as chronic pathogenic interactions.

  9. DNA microarray-based genome comparison of a pathogenic and a nonpathogenic strain of Xylella fastidiosa delineates genes important for bacterial virulence.

    Science.gov (United States)

    Koide, Tie; Zaini, Paulo A; Moreira, Leandro M; Vêncio, Ricardo Z N; Matsukuma, Adriana Y; Durham, Alan M; Teixeira, Diva C; El-Dorry, Hamza; Monteiro, Patrícia B; da Silva, Ana Claudia R; Verjovski-Almeida, Sergio; da Silva, Aline M; Gomes, Suely L

    2004-08-01

    Xylella fastidiosa is a phytopathogenic bacterium that causes serious diseases in a wide range of economically important crops. Despite extensive comparative analyses of genome sequences of Xylella pathogenic strains from different plant hosts, nonpathogenic strains have not been studied. In this report, we show that X. fastidiosa strain J1a12, associated with citrus variegated chlorosis (CVC), is nonpathogenic when injected into citrus and tobacco plants. Furthermore, a DNA microarray-based comparison of J1a12 with 9a5c, a CVC strain that is highly pathogenic and had its genome completely sequenced, revealed that 14 coding sequences of strain 9a5c are absent or highly divergent in strain J1a12. Among them, we found an arginase and a fimbrial adhesin precursor of type III pilus, which were confirmed to be absent in the nonpathogenic strain by PCR and DNA sequencing. The absence of arginase can be correlated to the inability of J1a12 to multiply in host plants. This enzyme has been recently shown to act as a bacterial survival mechanism by down-regulating host nitric oxide production. The lack of the adhesin precursor gene is in accordance with the less aggregated phenotype observed for J1a12 cells growing in vitro. Thus, the absence of both genes can be associated with the failure of the J1a12 strain to establish and spread in citrus and tobacco plants. These results provide the first detailed comparison between a nonpathogenic strain and a pathogenic strain of X. fastidiosa, constituting an important step towards understanding the molecular basis of the disease.

  10. Unveiling the formation and evolution of comets

    Science.gov (United States)

    Lasue, J.; Levasseur-Regourd, A. C.; Botet, R.; Coradini, A.; Desanctis, M. C.; Kofman, W.

    2007-08-01

    Comet nuclei are considered as the most pristine bodies of the solar system and consequently their study sheds an important light on the processes occurring during the initial stages of the solar system formation. The analysis of the porosity and bulk density of such primordial bodies is especially important to understand their capacity to retain volatile components (organics and ices) present in the early solar nebula. Typical tensile strengths deduced for comet nuclei range from below 102N.m-2 from the Deep Impact mission [1] up to 104N.m-2 from the study of comet C/1999 S4 LINEAR breakup [2] and meteoroids [3]. A bulk density of about 350 kg/m3 has been obtained for 9P/Tempel 1 from the Deep Impact mission [4]. Moreover the properties of dust released from the comets strongly confirm such values. Instruments flying-by comet 1P/Halley had discovered the presence of organics, and pointed out the dust low albedo and extremely low density while analyses of Interplanetary Dust Particles collected in the stratosphere and remote spectroscopic observations have indicated that cometary dust consists of an un-equilibrated heterogeneous mixture of organic refractory materials and of amorphous and crystalline silicate minerals [5], as recently confirmed by Stardust [6]. Observations of the solar scattered light, together with elaborate simulations, give an estimation of the mass ratio between silicates and absorbing organics, the size distribution and the structure of the dust particles, suggesting that a fair amount consists in fluffy aggregates built up from submicronic grains [7,8], as recently confirmed by the analysis of dust craters and aerogel tracks on Stardust collector showing for some large particles (up to 100 μm) an extraordinary fluffy structure [9]. Simulations have been developed in our teams to describe the aspects of comet aggregation and evolution that have not been thoroughly explained yet. Particle aggregation simulations taking into account cohesive

  11. Genome-Wide Search for Quantitative Trait Loci Controlling Important Plant and Flower Traits in Petunia Using an Interspecific Recombinant Inbred Population of Petunia axillaris and Petunia exserta.

    Science.gov (United States)

    Cao, Zhe; Guo, Yufang; Yang, Qian; He, Yanhong; Fetouh, Mohammed; Warner, Ryan M; Deng, Zhanao

    2018-05-15

    A major bottleneck in plant breeding has been the much limited genetic base and much reduced genetic diversity in domesticated, cultivated germplasm. Identification and utilization of favorable gene loci or alleles from wild or progenitor species can serve as an effective approach to increasing genetic diversity and breaking this bottleneck in plant breeding. This study was conducted to identify quantitative trait loci (QTL) in wild or progenitor petunia species that can be used to improve important horticultural traits in garden petunia. An F 7 recombinant inbred population derived between Petunia axillaris and P. exserta was phenotyped for plant height, plant spread, plant size, flower counts, flower diameter, flower length, and days to anthesis, in Florida in two consecutive years. Transgressive segregation was observed for all seven traits in both years. The broad-sense heritability estimates for the traits ranged from 0.20 (days to anthesis) to 0.62 (flower length). A genome-wide genetic linkage map consisting 368 single nucleotide polymorphism bins and extending over 277 cM was searched to identify QTL for these traits. Nineteen QTL were identified and localized to five linkage groups. Eleven of the loci were identified consistently in both years; several loci explained up to 34.0% and 24.1% of the phenotypic variance for flower length and flower diameter, respectively. Multiple loci controlling different traits are co-localized in four intervals in four linkage groups. These intervals contain desirable alleles that can be introgressed into commercial petunia germplasm to expand the genetic base and improve plant performance and flower characteristics in petunia. Copyright © 2018, G3: Genes, Genomes, Genetics.

  12. A novel pathogenic aviadenovirus from red-bellied parrots (Poicephalus rufiventris) unveils deep recombination events among avian host lineages

    International Nuclear Information System (INIS)

    Das, Shubhagata; Fearnside, Kathleen; Sarker, Subir; Forwood, Jade K.; Raidal, Shane R.

    2017-01-01

    Competing roles of coevolution, selective pressure and recombination are an emerging interest in virus evolution. We report a novel aviadenovirus from captive red-bellied parrots (Poicephalus rufiventris) that uncovers evidence of deep recombination among aviadenoviruses. The sequence identity of the virus was most closely related to Turkey adenovirus D (42% similarity) and other adenoviruses in chickens, turkeys and pigeons. Sequencing and comparative analysis showed that the genome comprised 40,930 nucleotides containing 42 predicted open reading frames (ORFs) 19 of which had strong similarity with genes from other adenovirus species. The new genome unveiled a lineage that likely participated in deep recombination events across the genus Aviadenovirus accounting for an ancient evolutionary relationship. We hypothesize frequent host switch events and recombination among adenovirus progenitors in Galloanserae hosts caused the radiation of extant aviadenoviruses and the newly assembled Poicephalus adenovirus genome points to a potentially broader host range of these viruses among birds. - Highlights: •Shows how a single new genome can change overall phylogeny. •Reveals host switch events among adenovirus progenitors in Galloanserae hosts. •Points to a potentially broader host range of adenoviruses among birds and wildlife .

  13. A novel pathogenic aviadenovirus from red-bellied parrots (Poicephalus rufiventris) unveils deep recombination events among avian host lineages

    Energy Technology Data Exchange (ETDEWEB)

    Das, Shubhagata, E-mail: sdas@csu.edu.au [School of Animal and Veterinary Sciences, Faculty of Science, Charles Sturt University, New South Wales 2678 (Australia); Fearnside, Kathleen, E-mail: kathyfearnside@exemail.com.au [Hills District Veterinary Hospital, Unit 1, 276 New Line Road, Dural, NSW 2158 (Australia); Sarker, Subir, E-mail: S.Sarker@latrobe.edu.au [Department of Physiology, Anatomy and Microbiology, School of Life Sciences, La Trobe University, Melbourne, VIC 3086 (Australia); Forwood, Jade K., E-mail: jforwood@csu.edu.au [School of Biomedical Sciences, Faculty of Science, Charles Sturt University, Wagga Wagga, NSW 2650 (Australia); Raidal, Shane R., E-mail: shraidal@csu.edu.au [School of Animal and Veterinary Sciences, Faculty of Science, Charles Sturt University, New South Wales 2678 (Australia)

    2017-02-15

    Competing roles of coevolution, selective pressure and recombination are an emerging interest in virus evolution. We report a novel aviadenovirus from captive red-bellied parrots (Poicephalus rufiventris) that uncovers evidence of deep recombination among aviadenoviruses. The sequence identity of the virus was most closely related to Turkey adenovirus D (42% similarity) and other adenoviruses in chickens, turkeys and pigeons. Sequencing and comparative analysis showed that the genome comprised 40,930 nucleotides containing 42 predicted open reading frames (ORFs) 19 of which had strong similarity with genes from other adenovirus species. The new genome unveiled a lineage that likely participated in deep recombination events across the genus Aviadenovirus accounting for an ancient evolutionary relationship. We hypothesize frequent host switch events and recombination among adenovirus progenitors in Galloanserae hosts caused the radiation of extant aviadenoviruses and the newly assembled Poicephalus adenovirus genome points to a potentially broader host range of these viruses among birds. - Highlights: •Shows how a single new genome can change overall phylogeny. •Reveals host switch events among adenovirus progenitors in Galloanserae hosts. •Points to a potentially broader host range of adenoviruses among birds and wildlife .

  14. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  15. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  16. Exploring Other Genomes: Bacteria.

    Science.gov (United States)

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  17. A genome-wide scan reveals important roles of DNA methylation in human longevity by regulating age-related disease genes.

    Directory of Open Access Journals (Sweden)

    Fu-Hui Xiao

    Full Text Available It is recognized that genetic factors contribute to human longevity. Besides the hypothesis of existence of longevity genes, another suggests that a lower frequency of risk alleles decreases the incidence of age-related diseases in the long-lived people. However, the latter finds no support from recent genetic studies. Considering the crucial role of epigenetic modification in gene regulation, we then hypothesize that suppressing disease-related genes in longevity individuals is likely achieved by epigenetic modification, e.g. DNA methylation. To test this hypothesis, we investigated the genome-wide methylation profile in 4 Chinese female centenarians and 4 middle-aged controls using methyl-DNA immunoprecipitation sequencing. 626 differentially methylated regions (DMRs were observed between both groups. Interestingly, genes with these DMRs were enriched in age-related diseases, including type-2 diabetes, cardiovascular disease, stroke and Alzheimer's disease. This pattern remains rather stable after including methylomes of two white individuals. Further analyses suggest that the observed DMRs likely have functional roles in regulating disease-associated gene expressions, with some genes [e.g. caspase 3 (CASP3] being down-regulated whereas the others [i.e. interleukin 1 receptor, type 2 (IL1R2] up-regulated. Therefore, our study suggests that suppressing the disease-related genes via epigenetic modification is an important contributor to human longevity.

  18. Importance of tributary streams for rainbow trout reproduction: insights from a small stream in Georgia and a bi-genomic approach

    Science.gov (United States)

    Lee, D.; Lack, Justin B.; Van Den Bussche, Ronald A.; Long, James M.

    2012-01-01

    Tributaries of tailwater fisheries in the southeastern USA have been used for spawning by stocked rainbow trout (Oncorhynchus mykiss), but their importance may have been underestimated using traditional fish survey methods such as electrofishing and redd counts. We used a bi-genomic approach, mitochondrial DNA sequences and nuclear microsatellite loci, to estimate the number of spawning adults in one small tributary (Cabin Creek) of the Chattahoochee River, Georgia, where rainbow trout are known to spawn and have successful recruitment. We extracted and analysed DNA from seven mature male rainbow trout and four juveniles that were captured in February 2006 in Cabin Creek and from 24 young-of-year (YOY) trout that were captured in April 2006. From these samples, we estimated that 24 individuals were spawning to produce the amount of genetic variation observed in the juveniles and YOY, although none of the mature males we sampled were indicated as sires. Analysis of the mitochondrial D-loop region identified four distinct haplotypes, suggesting that individuals representing four maternal lineages contributed to the offspring. Our analyses indicated that many more adults were spawning in this system than previously estimated with direct count methods and provided insight into rainbow trout spawning behavior.

  19. A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data

    Directory of Open Access Journals (Sweden)

    Stefan eSpring

    2015-04-01

    Full Text Available In recent years a large number of isolates were obtained from saline environments that are phylogenetically related to distinct clades of oligotrophic marine gammaproteobacteria, which were originally identified in seawater samples using cultivation independent methods and are characterized by high seasonal abundances in coastal environments. To date a sound taxonomic framework for the classification of these ecologically important isolates and related species in accordance with their evolutionary relationships is missing.In this study we demonstrate that a reliable allocation of members of the oligotrophic marine gammaproteobacteria (OMG group and related species to higher taxonomic ranks is possible by phylogenetic analyses of whole proteomes but also of the RNA polymerase beta subunit, whereas phylogenetic reconstructions based on 16S rRNA genes alone resulted in unstable tree topologies with only insignificant bootstrap support. The identified clades could be correlated with distinct phenotypic traits illustrating an adaptation to common environmental factors in their evolutionary history. Genome wide gene-content analyses revealed the existence of two distinct ecological guilds within the analyzed lineage of marine gammaproteobacteria which can be distinguished by their trophic strategies. Based on our results a novel order within the class Gammaproteobacteria is proposed, which is designated Cellvibrionales ord. nov. and comprises the five novel families Cellvibrionaceae fam. nov., Halieaceae fam. nov., Microbulbiferaceae fam. nov., Porticoccaceae fam. nov., and Spongiibacteraceae fam. nov.

  20. 'THE UNVEILED HEART' a teaching program in cardiovascular nuclear medicine

    International Nuclear Information System (INIS)

    Itti, Roland; Merabet, Yasmina; Roca, Ramona; Bontemps, Laurence; Itti, Emmanuel

    2004-01-01

    The functional investigation of cardiac diseases using nuclear techniques involves several variables, such as myocardial perfusion, cellular viability or mechanical contraction. The combined, topographical and quantitative assessment of these variables can characterize the functional state of the heart in terms of normal myocardium, ischemia, hibernation or necrosis. The teaching program, 'The Unveiled Heart', has been designed in order to help nuclear physicians or cardiologists approaching these concepts and their implications for diagnosis of coronary artery disease, optimization of therapeutic strategies and prognosis evaluation. Anatomical correlations with coronary angiographic results obtained during balloon occlusion at the time of coronary angioplasty demonstrate the complementary role of imaging techniques and highlight the patient to patient variability of risk areas. A sectorial model derived from a polar projection of the myocardium presents for each sector the probability of involvement of a given coronary artery

  1. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species.

    Directory of Open Access Journals (Sweden)

    Darshan Shimoga Chandrashekar

    Full Text Available Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses.We developed the 'Genomic Repeat Element Analyzer for Mammals' (GREAM for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a enrichment within chromosomal region(s of interest, and b comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20 known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species.GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting repeats in various

  2. The molecular genetic linkage map of the model legume Medicago truncatula: an essential tool for comparative legume genomics and the isolation of agronomically important genes

    Directory of Open Access Journals (Sweden)

    Ané Jean-Michel

    2002-01-01

    Full Text Available Abstract Background The legume Medicago truncatula has emerged as a model plant for the molecular and genetic dissection of various plant processes involved in rhizobial, mycorrhizal and pathogenic plant-microbe interactions. Aiming to develop essential tools for such genetic approaches, we have established the first genetic map of this species. Two parental homozygous lines were selected from the cultivar Jemalong and from the Algerian natural population (DZA315 on the basis of their molecular and phenotypic polymorphism. Results An F2 segregating population of 124 individuals between these two lines was obtained using an efficient manual crossing technique established for M. truncatula and was used to construct a genetic map. This map spans 1225 cM (average 470 kb/cM and comprises 289 markers including RAPD, AFLP, known genes and isoenzymes arranged in 8 linkage groups (2n = 16. Markers are uniformly distributed throughout the map and segregation distortion is limited to only 3 linkage groups. By mapping a number of common markers, the eight linkage groups are shown to be homologous to those of diploid alfalfa (M. sativa, implying a good level of macrosynteny between the two genomes. Using this M. truncatula map and the derived F3 populations, we were able to map the Mtsym6 symbiotic gene on linkage group 8 and the SPC gene, responsible for the direction of pod coiling, on linkage group 7. Conclusions These results demonstrate that Medicago truncatula is amenable to diploid genetic analysis and they open the way to map-based cloning of symbiotic or other agronomically-important genes using this model plant.

  3. Association analysis of genomic loci important for grain weight control in elite common wheat varieties cultivated with variable water and fertiliser supply.

    Directory of Open Access Journals (Sweden)

    Kunpu Zhang

    Full Text Available Grain weight, an essential yield component, is under strong genetic control and markedly influenced by the environment. Here, by genome-wide association analysis with a panel of 94 elite common wheat varieties, 37 loci were found significantly associated with thousand-grain weight (TGW in one or more environments differing in water and fertiliser levels. Five loci were stably associated with TGW under all 12 environments examined. Their elite alleles had positive effects on TGW. Four, two, three, and two loci were consistently associated with TGW in the irrigated and fertilised (IF, rainfed (RF, reduced nitrogen (RN, and reduced phosphorus (RP environments. The elite alleles of the IF-specific loci enhanced TGW under well-resourced conditions, whereas those of the RF-, RN-, or RP-specific loci conferred tolerance to the TGW decrease when irrigation, nitrogen, or phosphorus were reduced. Moreover, the elite alleles of the environment-independent and -specific loci often acted additively to enhance TGW. Four additional loci were found associated with TGW in specific locations, one of which was shown to contribute to the TGW difference between two experimental sites. Further analysis of 14 associated loci revealed that nine affected both grain length and width, whereas the remaining loci influenced either grain length or width, indicating that these loci control grain weight by regulating kernel size. Finally, the elite allele of Xpsp3152 frequently co-segregated with the larger grain haplotype of TaGW2-6A, suggesting probable genetic and functional linkages between Xpsp3152 and GW2 that are important for grain weight control in cereal plants. Our study provides new knowledge on TGW control in elite common wheat lines, which may aid the improvement of wheat grain weight trait in further research.

  4. Unveiling the importance of being a preferred customer in order to develop innovations with suppliers

    NARCIS (Netherlands)

    Schiele, Holger

    2010-01-01

    Purpose of the paper and literature addressed: The purpose of this research is to understand why early supplier integration in new product development repeatedly fails and how to select the right suppliers to avoid supplier obstructionism. We review the literature on early supplier integration.

  5. Traditional Islamic cities unveiled: the quest for urban design regularity

    Directory of Open Access Journals (Sweden)

    Jorge Correia

    2015-08-01

    Full Text Available Traditional Islamic cities have generally gathered orientalized gazes and perspectives, picking up from misconceptions and stereotypes that during the second half af the 19th century andwere perpectuated by colonialism. More recent scholarship has shed light on the urban organizationand composition of such tissues; most of them confined to old quarters or historical centres ofthriving contemporary cities within the Arab-Muslim world. In fact, one of the most striking featureshas been the unveiling of layered urban assemblages where exterior agents have somehowlaunched or interrupted an apparent islamicized continuum. Primarly, this paper wishes to search forexternal political factors that have designed regularly geometrized patterns in medium-sized Arabtowns. For that, two case studies from different geographies - Maghreb and the Near East - will bemorphologically analysed through updated urban surveys. Whereas Nablus (Palestine ows the urbanmatrix of its old town to its Roman past, in Azemmour’s medina (Morocco it is still possible to trackthe thin European early-modern colonial stratum. However, both cases show how regularity patternschallenge Western concepts of geometrical design to embrace levels of rationality related to tradionalIslamic urban forms, societal configurations and built environment. Urban morphology becomes afundamental tool for articulating the history with me processes of sedimentation and evolution in orderto read current urban prints and dynamics. Thus, the paper will also interpret alternative logics ofrational urban display in Azemmour and Nablus, linked to ways of living within the Islamic sphere.

  6. Hidden temporal order unveiled in stock market volatility variance

    Directory of Open Access Journals (Sweden)

    Y. Shapira

    2011-06-01

    Full Text Available When analyzed by standard statistical methods, the time series of the daily return of financial indices appear to behave as Markov random series with no apparent temporal order or memory. This empirical result seems to be counter intuitive since investor are influenced by both short and long term past market behaviors. Consequently much effort has been devoted to unveil hidden temporal order in the market dynamics. Here we show that temporal order is hidden in the series of the variance of the stocks volatility. First we show that the correlation between the variances of the daily returns and means of segments of these time series is very large and thus cannot be the output of random series, unless it has some temporal order in it. Next we show that while the temporal order does not show in the series of the daily return, rather in the variation of the corresponding volatility series. More specifically, we found that the behavior of the shuffled time series is equivalent to that of a random time series, while that of the original time series have large deviations from the expected random behavior, which is the result of temporal structure. We found the same generic behavior in 10 different stock markets from 7 different countries. We also present analysis of specially constructed sequences in order to better understand the origin of the observed temporal order in the market sequences. Each sequence was constructed from segments with equal number of elements taken from algebraic distributions of three different slopes.

  7. Transcription facilitated genome-wide recruitment of topoisomerase I and DNA gyrase.

    Science.gov (United States)

    Ahmed, Wareed; Sala, Claudia; Hegde, Shubhada R; Jha, Rajiv Kumar; Cole, Stewart T; Nagaraja, Valakunja

    2017-05-01

    Movement of the transcription machinery along a template alters DNA topology resulting in the accumulation of supercoils in DNA. The positive supercoils generated ahead of transcribing RNA polymerase (RNAP) and the negative supercoils accumulating behind impose severe topological constraints impeding transcription process. Previous studies have implied the role of topoisomerases in the removal of torsional stress and the maintenance of template topology but the in vivo interaction of functionally distinct topoisomerases with heterogeneous chromosomal territories is not deciphered. Moreover, how the transcription-induced supercoils influence the genome-wide recruitment of DNA topoisomerases remains to be explored in bacteria. Using ChIP-Seq, we show the genome-wide occupancy profile of both topoisomerase I and DNA gyrase in conjunction with RNAP in Mycobacterium tuberculosis taking advantage of minimal topoisomerase representation in the organism. The study unveils the first in vivo genome-wide interaction of both the topoisomerases with the genomic regions and establishes that transcription-induced supercoils govern their recruitment at genomic sites. Distribution profiles revealed co-localization of RNAP and the two topoisomerases on the active transcriptional units (TUs). At a given locus, topoisomerase I and DNA gyrase were localized behind and ahead of RNAP, respectively, correlating with the twin-supercoiled domains generated. The recruitment of topoisomerases was higher at the genomic loci with higher transcriptional activity and/or at regions under high torsional stress compared to silent genomic loci. Importantly, the occupancy of DNA gyrase, sole type II topoisomerase in Mtb, near the Ter domain of the Mtb chromosome validates its function as a decatenase.

  8. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  9. Complete mitochondrial genome of a Pleistocene jawbone unveils the origin of polar bear

    OpenAIRE

    Lindqvist, Charlotte; Schuster, Stephan C.; Sun, Yazhou; Talbot, Sandra L.; Qi, Ji; Ratan, Aakrosh; Tomsho, Lynn P.; Kasson, Lindsay; Zeyl, Eve; Aars, Jon; Miller, Webb; Ingólfsson, Ólafur; Bachmann, Lutz; Wiig, Øystein

    2010-01-01

    The polar bear has become the flagship species in the climate-change discussion. However, little is known about how past climate impacted its evolution and persistence, given an extremely poor fossil record. Although it is undisputed from analyses of mitochondrial (mt) DNA that polar bears constitute a lineage within the genetic diversity of brown bears, timing estimates of their divergence have differed considerably. Using next-generation sequencing technology, we have generated a complete, ...

  10. Cephalopod genomics

    DEFF Research Database (Denmark)

    Albertin, Caroline B.; Bonnaud, Laure; Brown, C. Titus

    2012-01-01

    The Cephalopod Sequencing Consortium (CephSeq Consortium) was established at a NESCent Catalysis Group Meeting, ``Paths to Cephalopod Genomics-Strategies, Choices, Organization,'' held in Durham, North Carolina, USA on May 24-27, 2012. Twenty-eight participants representing nine countries (Austria......, Australia, China, Denmark, France, Italy, Japan, Spain and the USA) met to address the pressing need for genome sequencing of cephalopod mollusks. This group, drawn from cephalopod biologists, neuroscientists, developmental and evolutionary biologists, materials scientists, bioinformaticians and researchers...... active in sequencing, assembling and annotating genomes, agreed on a set of cephalopod species of particular importance for initial sequencing and developed strategies and an organization (CephSeq Consortium) to promote this sequencing. The conclusions and recommendations of this meeting are described...

  11. Called to respond: The potential of unveiling hiddens

    Directory of Open Access Journals (Sweden)

    Alison L Black

    2014-12-01

    Full Text Available Interested in exploring how personal stories and aesthetic modes of representing experiences can nudge open academic and educational spaces, this article/collection of particles seeks to document our encounters of being affected and called to respond to things the other has written and represented. As a way of engaging with questions about what research and research data might be and become, our attention has been drawn to stories and images from our lives that we have not shaken off – and to how, as we have opened these to the other, making once private moments public, our hiddens have morphed tenderly into a shared knowing and being. As we have acted on the call we have felt to respond we have found ourselves entering spaces of collaboration, communion, contemplation, and conversation – spaces illuminated by what we have not been able to – and cannot – set aside. Using visual and poetic materials we explore heartfelt and heartbroken aspects of our educational worlds and lives, to be present with each other and our (reemerging personal and professional meanings. We see the shared body (of work, of writing, of image that develops from the taking of brave steps and the risky slipping off of academic masks and language, as a manifestation of the trusted and nurturing spaces that can be generated through collaborative opportunities to gather together. These steps towards unveiling hiddens are producing in us and of us a friendship, fluency, and fluidity as we write new ways of becoming. In turn, we hope the uncovering and revealing of our dialogue in the public gathering of this journal might supports readers’ telling of their own life stories through what calls them to respond.

  12. Mitotic accumulation of dimethylated lysine 79 of histone H3 is important for maintaining genome integrity during mitosis in human cells.

    Science.gov (United States)

    Guppy, Brent J; McManus, Kirk J

    2015-02-01

    The loss of genome stability is an early event that drives the development and progression of virtually all tumor types. Recent studies have revealed that certain histone post-translational modifications exhibit dynamic and global increases in abundance that coincide with mitosis and exhibit essential roles in maintaining genomic stability. Histone H2B ubiquitination at lysine 120 (H2Bub1) is regulated by RNF20, an E3 ubiquitin ligase that is altered in many tumor types. Through an evolutionarily conserved trans-histone pathway, H2Bub1 is an essential prerequisite for subsequent downstream dimethylation events at lysines 4 (H3K4me2) and 79 (H3K79me2) of histone H3. Although the role that RNF20 plays in tumorigenesis has garnered much attention, the downstream components of the trans-histone pathway, H3K4me2 and H3K79me2, and their potential contributions to genome stability remain largely overlooked. In this study, we employ single-cell imaging and biochemical approaches to investigate the spatial and temporal patterning of RNF20, H2Bub1, H3K4me2, and H3K79me2 throughout the cell cycle, with a particular focus on mitosis. We show that H2Bub1, H3K4me2, and H3K79me2 exhibit distinct temporal progression patterns throughout the cell cycle. Most notably, we demonstrate that H3K79me2 is a highly dynamic histone post-translational modification that reaches maximal abundance during mitosis in an H2Bub1-independent manner. Using RNAi and chemical genetic approaches, we identify DOT1L as a histone methyltransferase required for the mitotic-associated increases in H3K79me2. We also demonstrate that the loss of mitotic H3K79me2 levels correlates with increases in chromosome numbers and increases in mitotic defects. Collectively, these data suggest that H3K79me2 dynamics during mitosis are normally required to maintain genome stability and further implicate the loss of H3K79me2 during mitosis as a pathogenic event that contributes to the development and progression of tumors

  13. The other side of comparative genomics: genes with no orthologs between the cow and other mammalian species

    Directory of Open Access Journals (Sweden)

    Ajmone-Marsan Paolo

    2009-12-01

    Full Text Available Abstract Background With the rapid growth in the availability of genome sequence data, the automated identification of orthologous genes between species (orthologs is of fundamental importance to facilitate functional annotation and studies on comparative and evolutionary genomics. Genes with no apparent orthologs between the bovine and human genome may be responsible for major differences between the species, however, such genes are often neglected in functional genomics studies. Results A BLAST-based method was exploited to explore the current annotation and orthology predictions in Ensembl. Genes with no orthologs between the two genomes were classified into groups based on alignments, ontology, manual curation and publicly available information. Starting from a high quality and specific set of orthology predictions, as provided by Ensembl, hidden relationship between genes and genomes of different mammalian species were unveiled using a highly sensitive approach, based on sequence similarity and genomic comparison. Conclusions The analysis identified 3,801 bovine genes with no orthologs in human and 1010 human genes with no orthologs in cow, among which 411 and 43 genes, respectively, had no match at all in the other species. Most of the apparently non-orthologous genes may potentially have orthologs which were missed in the annotation process, despite having a high percentage of identity, because of differences in gene length and structure. The comparative analysis reported here identified gene variants, new genes and species-specific features and gave an overview of the other side of orthology which may help to improve the annotation of the bovine genome and the knowledge of structural differences between species.

  14. Cellular therapies for heart disease: unveiling the ethical and public policy challenges.

    Science.gov (United States)

    Raval, Amish N; Kamp, Timothy J; Hogle, Linda F

    2008-10-01

    Cellular therapies have emerged as a potential revolutionary treatment for cardiovascular disease. Promising preclinical results have resulted in a flurry of basic research activity and spawned multiple clinical trials worldwide. However, the optimal cell type and delivery mode have not been determined for target patient populations. Nor have the mechanisms of benefit for the range of cellular interventions been clearly defined. Experiences to date have unveiled a myriad of ethical and public policy challenges which will affect the way researchers and clinicians make decisions for both basic and clinical research. Stem cells derived from embryos are at the forefront of the ethical and political debate, raising issues of which derivation methods are morally and socially permissible to pursue, as much as which are technically feasible. Adult stem cells are less controversial; however, important challenges exist in determining study design, cell processing, delivery mode, and target patient population. Pathways to successful commercialization and hence broad accessibility of cellular therapies for heart disease are only beginning to be explored. Comprehensive, multi-disciplinary and collaborative networks involving basic researchers, clinicians, regulatory officials and policymakers are required to share information, develop research, regulatory and policy standards and enable rational and ethical cell-based treatment approaches.

  15. Genome Maps, a new generation genome browser.

    Science.gov (United States)

    Medina, Ignacio; Salavert, Francisco; Sanchez, Rubén; de Maria, Alejandro; Alonso, Roberto; Escobar, Pablo; Bleda, Marta; Dopazo, Joaquín

    2013-07-01

    Genome browsers have gained importance as more genomes and related genomic information become available. However, the increase of information brought about by new generation sequencing technologies is, at the same time, causing a subtle but continuous decrease in the efficiency of conventional genome browsers. Here, we present Genome Maps, a genome browser that implements an innovative model of data transfer and management. The program uses highly efficient technologies from the new HTML5 standard, such as scalable vector graphics, that optimize workloads at both server and client sides and ensure future scalability. Thus, data management and representation are entirely carried out by the browser, without the need of any Java Applet, Flash or other plug-in technology installation. Relevant biological data on genes, transcripts, exons, regulatory features, single-nucleotide polymorphisms, karyotype and so forth, are imported from web services and are available as tracks. In addition, several DAS servers are already included in Genome Maps. As a novelty, this web-based genome browser allows the local upload of huge genomic data files (e.g. VCF or BAM) that can be dynamically visualized in real time at the client side, thus facilitating the management of medical data affected by privacy restrictions. Finally, Genome Maps can easily be integrated in any web application by including only a few lines of code. Genome Maps is an open source collaborative initiative available in the GitHub repository (https://github.com/compbio-bigdata-viz/genome-maps). Genome Maps is available at: http://www.genomemaps.org.

  16. Replication and functional genomic analyses of the breast cancer susceptibility locus at 6q25.1 generalize its importance in women of chinese, Japanese, and European ancestry.

    Science.gov (United States)

    Cai, Qiuyin; Wen, Wanqing; Qu, Shimian; Li, Guoliang; Egan, Kathleen M; Chen, Kexin; Deming, Sandra L; Shen, Hongbing; Shen, Chen-Yang; Gammon, Marilie D; Blot, William J; Matsuo, Keitaro; Haiman, Christopher A; Khoo, Ui Soon; Iwasaki, Motoki; Santella, Regina M; Zhang, Lina; Fair, Alecia Malin; Hu, Zhibin; Wu, Pei-Ei; Signorello, Lisa B; Titus-Ernstoff, Linda; Tajima, Kazuo; Henderson, Brian E; Chan, Kelvin Y K; Kasuga, Yoshio; Newcomb, Polly A; Zheng, Hong; Cui, Yong; Wang, Furu; Shieh, Ya-Lan; Iwata, Hiroji; Le Marchand, Loic; Chan, Sum Yin; Shrubsole, Martha J; Trentham-Dietz, Amy; Tsugane, Shoichiro; Garcia-Closas, Montserrat; Long, Jirong; Li, Chun; Shi, Jiajun; Huang, Bo; Xiang, Yong-Bing; Gao, Yu-Tang; Lu, Wei; Shu, Xiao-Ou; Zheng, Wei

    2011-02-15

    We evaluated the generalizability of a single nucleotide polymorphism (SNP), rs2046210 (A/G allele), associated with breast cancer risk that was initially identified at 6q25.1 in a genome-wide association study conducted among Chinese women. In a pooled analysis of more than 31,000 women of East-Asian, European, and African ancestry, we found a positive association for rs2046210 and breast cancer risk in Chinese women [ORs (95% CI) = 1.30 (1.22-1.38) and 1.64 (1.50-1.80) for the AG and AA genotypes, respectively, P for trend = 1.54 × 10⁻³⁰], Japanese women [ORs (95% CI) = 1.31 (1.13-1.52) and 1.37 (1.06-1.76), P for trend = 2.51 × 10⁻⁴], and European-ancestry American women [ORs (95% CI) = 1.07 (0.99-1.16) and 1.18 (1.04-1.34), P for trend = 0.0069]. No association with this SNP, however, was observed in African American women [ORs (95% CI) = 0.81 (0.63-1.06) and 0.85 (0.65-1.11) for the AG and AA genotypes, respectively, P for trend = 0.4027]. In vitro functional genomic studies identified a putative functional variant, rs6913578. This SNP is 1,440 bp downstream of rs2046210 and is in high linkage disequilibrium with rs2046210 in Chinese (r(2) = 0.91) and European-ancestry (r² = 0.83) populations, but not in Africans (r² = 0.57). SNP rs6913578 was found to be associated with breast cancer risk in Chinese and European-ancestry American women. After adjusting for rs2046210, the association of rs6913578 with breast cancer risk in African Americans approached borderline significance. Results from this large consortium study confirmed the association of rs2046210 with breast cancer risk among women of Chinese, Japanese, and European ancestry. This association may be explained in part by a putatively functional variant (rs6913578) identified in the region. ©2011 AACR.

  17. Nasa Unveils Cosmic Images Book in Braille for Blind Readers

    Science.gov (United States)

    2008-01-01

    BALTIMORE - At a Tuesday ceremony at the National Federation of the Blind, NASA unveiled a new book that brings majestic images taken by its Great Observatories to the fingertips of the blind. "Touch the Invisible Sky" is a 60-page book with color images of nebulae, stars, galaxies and some of the telescopes that captured the original pictures. Each image is embossed with lines, bumps and other textures. These raised patterns translate colors, shapes and other intricate details of the cosmic objects, allowing visually impaired people to experience them. Braille and large-print descriptions accompany each of the book's 28 photographs, making the book's design accessible to readers of all visual abilities. Sample page Sample page The book contains spectacular images from the Hubble Space Telescope, Chandra X-ray Observatory, Spitzer Space Telescope and powerful ground-based telescopes. The celestial objects are presented as they appear through visible-light telescopes and different spectral regions invisible to the naked eye, from radio to infrared, visible, ultraviolet and X-ray light. The book introduces the concept of light and the spectrum and explains how the different observatories complement each others' findings. Readers take a cosmic journey beginning with images of the sun, and travel out into the galaxy to visit relics of exploding and dying stars, as well as the Whirlpool galaxy and colliding Antennae galaxies. People Who Read This Also Read... Chandra Data Reveal Rapidly Whirling Black Holes Jet Power and Black Hole Assortment Revealed in New Chandra Image Action Replay of Powerful Stellar Explosion Black Holes Are The Rhythm at The Heart of Galaxies "Touch the Invisible Sky" was written by astronomy educator and accessibility specialist Noreen Grice of You Can Do Astronomy LLC and the Museum of Science, Boston, with authors Simon Steel, an astronomer with the Harvard-Smithsonian Center for Astrophysics in Cambridge, Mass., and Doris Daou, an astronomer

  18. Ultrafast comparison of personal genomes

    OpenAIRE

    Mauldin, Denise; Hood, Leroy; Robinson, Max; Glusman, Gustavo

    2017-01-01

    We present an ultra-fast method for comparing personal genomes. We transform the standard genome representation (lists of variants relative to a reference) into 'genome fingerprints' that can be readily compared across sequencing technologies and reference versions. Because of their reduced size, computation on the genome fingerprints is fast and requires little memory. This enables scaling up a variety of important genome analyses, including quantifying relatedness, recognizing duplicative s...

  19. Old Wine in New Wine Skins: Tombstone Unveiling as a Case of ...

    African Journals Online (AJOL)

    This article reflects on the practice of Tombstone Unveiling, a recent phenomenon among Shona Christians in Zimbabwe, as a case of religious change. Historically, many church doctrines and practices have been negative towards African Traditional Religions (ATRs). Shona Christians have reacted by trying to ...

  20. Atomic Force Microscopy - A Tool to Unveil the Mystery of Biological ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Atomic Force Microscopy - A Tool to Unveil the Mystery of Biological Systems ... Transcription and Disease Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore 560 ...

  1. A Phylogenetic Analysis of Chloroplast Genomes Elucidates the Relationships of the Six Economically Important Brassica Species Comprising the Triangle of U

    NARCIS (Netherlands)

    Li, Peirong; Zhang, Shujiang; Li, Fei; Zhang, Shifan; Zhang, Hui; Wang, Xiaowu; Sun, Rifei; Bonnema, Guusje; Borm, Theo J.A.

    2017-01-01

    The Brassica genus comprises many economically important worldwide cultivated crops. The well-established model of the Brassica genus, U’s triangle, consists of three basic diploid plant species (Brassica rapa, Brassica oleracea, and Brassica nigra) and three amphidiploid species (Brassica napus,

  2. Novel human mutation and CRISPR/Cas genome-edited mice reveal the importance of C-terminal domain of MSX1 in tooth and palate development.

    Science.gov (United States)

    Mitsui, Silvia Naomi; Yasue, Akihiro; Masuda, Kiyoshi; Naruto, Takuya; Minegishi, Yoshiyuki; Oyadomari, Seiichi; Noji, Sumihare; Imoto, Issei; Tanaka, Eiji

    2016-12-05

    Several mutations, located mainly in the MSX1 homeodomain, have been identified in non-syndromic tooth agenesis predominantly affecting premolars and third molars. We identified a novel frameshift mutation of the highly conserved C-terminal domain of MSX1, known as Msx homology domain 6 (MH6), in a Japanese family with non-syndromic tooth agenesis. To investigate the importance of MH6 in tooth development, Msx1 was targeted in mice with CRISPR/Cas system. Although heterozygous MH6 disruption did not alter craniofacial development, homozygous mice exhibited agenesis of lower incisors with or without cleft palate at E16.5. In addition, agenesis of the upper third molars and the lower second and third molars were observed in 4-week-old mutant mice. Although the upper second molars were present, they were abnormally small. These results suggest that the C-terminal domain of MSX1 is important for tooth and palate development, and demonstrate that that CRISPR/Cas system can be used as a tool to assess causality of human disorders in vivo and to study the importance of conserved domains in genes.

  3. Automated Extraction of Genomic DNA from Medically Important Yeast Species and Filamentous Fungi by Using the MagNA Pure LC System

    OpenAIRE

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-01-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (105 to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sen...

  4. QTL mapping of root traits in phosphorus-deficient soils reveals important genomic regions for improving NDVI and grain yield in barley.

    Science.gov (United States)

    Gong, Xue; McDonald, Glenn

    2017-09-01

    Major QTLs for root rhizosheath size are not correlated with grain yield or yield response to phosphorus. Important QTLs were found to improve phosphorus efficiency. Root traits are important for phosphorus (P) acquisition, but they are often difficult to characterize and their breeding values are seldom assessed under field conditions. This has shed doubts on using seedling-based criteria of root traits to select and breed for P efficiency. Eight root traits were assessed under controlled conditions in a barley doubled-haploid population in soils differing in P levels. The population was also phenotyped for grain yield, normalized difference vegetation index (NDVI), grain P uptake and P utilization efficiency at maturity (PutE GY ) under field conditions. Several quantitative traits loci (QTLs) from the root screening and the field trials were co-incident. QTLs for root rhizosheath size and root diameter explained the highest phenotypic variation in comparison to QTLs for other root traits. Shared QTLs were found between root diameter and grain yield, and total root length and PutE GY . A common major QTL for rhizosheath size and NDVI was mapped to the HvMATE gene marker on chromosome 4H. Collocations between major QTLs for NDVI and grain yield were detected on chromosomes 6H and 7H. When results from BIP and MET were combined, QTLs detected for grain yield were also those QTLs found for NDVI. QTLs qGY5H, qGY6H and qGY7Hb on 7H were robust QTLs in improving P efficiency. A selection of multiple loci may be needed to optimize the breeding outcomes due to the QTL x Environment interaction. We suggest that rhizosheath size alone is not a reliable trait to predict P efficiency or grain yield.

  5. Safeguarding genome integrity

    DEFF Research Database (Denmark)

    Sørensen, Claus Storgaard; Syljuåsen, Randi G

    2012-01-01

    Mechanisms that preserve genome integrity are highly important during the normal life cycle of human cells. Loss of genome protective mechanisms can lead to the development of diseases such as cancer. Checkpoint kinases function in the cellular surveillance pathways that help cells to cope with D...

  6. Genome Writing: Current Progress and Related Applications

    Directory of Open Access Journals (Sweden)

    Yueqiang Wang

    2018-02-01

    Full Text Available The ultimate goal of synthetic biology is to build customized cells or organisms to meet specific industrial or medical needs. The most important part of the customized cell is a synthetic genome. Advanced genomic writing technologies are required to build such an artificial genome. Recently, the partially-completed synthetic yeast genome project represents a milestone in this field. In this mini review, we briefly introduce the techniques for de novo genome synthesis and genome editing. Furthermore, we summarize recent research progresses and highlight several applications in the synthetic genome field. Finally, we discuss current challenges and future prospects. Keywords: Synthetic biology, Genome writing, Genome editing, Bioethics, Biosafety

  7. Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system.

    Science.gov (United States)

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-06-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (10(5) to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sensitivity when DNA was extracted manually; in 9 of 28 runs, we could achieve a higher sensitivity of 1 CFU/ml blood, which was found to be significant (p DNA from all fungal species analyzed could be extracted and amplified by real-time PCR. Negative controls from all MagNA Pure isolations remained negative. Sixty-three clinical samples showed identical results by both methods, whereas in 4 of 67 samples, discordant results were obtained. Thus, the MagNA Pure LC technique offers a fast protocol for automated DNA isolation from numerous fungi, revealing high sensitivity and purity.

  8. Genomic research in Eucalyptus.

    Science.gov (United States)

    Poke, Fiona S; Vaillancourt, René E; Potts, Brad M; Reid, James B

    2005-09-01

    Eucalyptus L'Hérit. is a genus comprised of more than 700 species that is of vital importance ecologically to Australia and to the forestry industry world-wide, being grown in plantations for the production of solid wood products as well as pulp for paper. With the sequencing of the genomes of Arabidopsis thaliana and Oryza sativa and the recent completion of the first tree genome sequence, Populus trichocarpa, attention has turned to the current status of genomic research in Eucalyptus. For several eucalypt species, large segregating families have been established, high-resolution genetic maps constructed and large EST databases generated. Collaborative efforts have been initiated for the integration of diverse genomic projects and will provide the framework for future research including exploiting the sequence of the entire eucalypt genome which is currently being sequenced. This review summarises the current position of genomic research in Eucalyptus and discusses the direction of future research.

  9. Genome-scale comparison and constraint-based metabolic reconstruction of the facultative anaerobic Fe(III-reducer Rhodoferax ferrireducens

    Directory of Open Access Journals (Sweden)

    Daugherty Sean

    2009-09-01

    Full Text Available Abstract Background Rhodoferax ferrireducens is a metabolically versatile, Fe(III-reducing, subsurface microorganism that is likely to play an important role in the carbon and metal cycles in the subsurface. It also has the unique ability to convert sugars to electricity, oxidizing the sugars to carbon dioxide with quantitative electron transfer to graphite electrodes in microbial fuel cells. In order to expand our limited knowledge about R. ferrireducens, the complete genome sequence of this organism was further annotated and then the physiology of R. ferrireducens was investigated with a constraint-based, genome-scale in silico metabolic model and laboratory studies. Results The iterative modeling and experimental approach unveiled exciting, previously unknown physiological features, including an expanded range of substrates that support growth, such as cellobiose and citrate, and provided additional insights into important features such as the stoichiometry of the electron transport chain and the ability to grow via fumarate dismutation. Further analysis explained why R. ferrireducens is unable to grow via photosynthesis or fermentation of sugars like other members of this genus and uncovered novel genes for benzoate metabolism. The genome also revealed that R. ferrireducens is well-adapted for growth in the subsurface because it appears to be capable of dealing with a number of environmental insults, including heavy metals, aromatic compounds, nutrient limitation and oxidative stress. Conclusion This study demonstrates that combining genome-scale modeling with the annotation of a new genome sequence can guide experimental studies and accelerate the understanding of the physiology of under-studied yet environmentally relevant microorganisms.

  10. [Advances in microbial genome reduction and modification].

    Science.gov (United States)

    Wang, Jianli; Wang, Xiaoyuan

    2013-08-01

    Microbial genome reduction and modification are important strategies for constructing cellular chassis used for synthetic biology. This article summarized the essential genes and the methods to identify them in microorganisms, compared various strategies for microbial genome reduction, and analyzed the characteristics of some microorganisms with the minimized genome. This review shows the important role of genome reduction in constructing cellular chassis.

  11. Experimental Induction of Genome Chaos.

    Science.gov (United States)

    Ye, Christine J; Liu, Guo; Heng, Henry H

    2018-01-01

    Genome chaos, or karyotype chaos, represents a powerful survival strategy for somatic cells under high levels of stress/selection. Since the genome context, not the gene content, encodes the genomic blueprint of the cell, stress-induced rapid and massive reorganization of genome topology functions as a very important mechanism for genome (karyotype) evolution. In recent years, the phenomenon of genome chaos has been confirmed by various sequencing efforts, and many different terms have been coined to describe different subtypes of the chaotic genome including "chromothripsis," "chromoplexy," and "structural mutations." To advance this exciting field, we need an effective experimental system to induce and characterize the karyotype reorganization process. In this chapter, an experimental protocol to induce chaotic genomes is described, following a brief discussion of the mechanism and implication of genome chaos in cancer evolution.

  12. In silico analysis of the fucosylation-associated genome of the human blood fluke Schistosoma mansoni: cloning and characterization of the enzymes involved in GDP-L-fucose synthesis and Golgi import.

    Science.gov (United States)

    Peterson, Nathan A; Anderson, Tavis K; Wu, Xiao-Jun; Yoshino, Timothy P

    2013-07-09

    Carbohydrate structures of surface-expressed and secreted/excreted glycoconjugates of the human blood fluke Schistosoma mansoni are key determinants that mediate host-parasite interactions in both snail and mammalian hosts. Fucose is a major constituent of these immunologically important glycans, and recent studies have sought to characterize fucosylation-associated enzymes, including the Golgi-localized fucosyltransferases that catalyze the transfer of L-fucose from a GDP-L-fucose donor to an oligosaccharide acceptor. Importantly, GDP-L-fucose is the only nucleotide-sugar donor used by fucosyltransferases and its availability represents a bottleneck in fucosyl-glycotope expression. A homology-based genome-wide bioinformatics approach was used to identify and molecularly characterize the enzymes that contribute to GDP-L-fucose synthesis and Golgi import in S. mansoni. Putative functions were further investigated through molecular phylogenetic and immunocytochemical analyses. We identified homologs of GDP-D-mannose-4,6-dehydratase (GMD) and GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase (GMER), which constitute a de novo pathway for GDP-L-fucose synthesis, in addition to a GDP-L-fucose transporter (GFT) that putatively imports cytosolic GDP-L-fucose into the Golgi. In silico primary sequence analyses identified characteristic Rossman loop and short-chain dehydrogenase/reductase motifs in GMD and GMER as well as 10 transmembrane domains in GFT. All genes are alternatively spliced, generating variants of unknown function. Observed quantitative differences in steady-state transcript levels between miracidia and primary sporocysts may contribute to differential glycotope expression in early larval development. Additionally, analyses of protein expression suggest the occurrence of cytosolic GMD and GMER in the ciliated epidermal plates and tegument of miracidia and primary sporocysts, respectively, which is consistent with previous localization of highly

  13. Musa sebagai Model Genom

    Directory of Open Access Journals (Sweden)

    RITA MEGIA

    2005-12-01

    Full Text Available During the meeting in Arlington, USA in 2001, the scientists grouped in PROMUSA agreed with the launching of the Global Musa Genomics Consortium. The Consortium aims to apply genomics technologies to the improvement of this important crop. These genome projects put banana as the third model species after Arabidopsis and rice that will be analyzed and sequenced. Comparing to Arabidopsis and rice, banana genome provides a unique and powerful insight into structural and in functional genomics that could not be found in those two species. This paper discussed these subjects-including the importance of banana as the fourth main food in the world, the evolution and biodiversity of this genetic resource and its parasite.

  14. IMA Genome-F 5G

    OpenAIRE

    Wingfield, Brenda D.; Barnes, Irene; Wilhelm de Beer, Z.; De Vos, Lieschen; Duong, Tuan A.; Kanzi, Aquillah M.; Naidoo, Kershney; Nguyen, Hai D.T.; Santana, Quentin C.; Sayari, Mohammad; Seifert, Keith A.; Steenkamp, Emma T.; Trollip, Conrad; van der Merwe, Nicolaas A.; van der Nest, Magriet A.

    2015-01-01

    The genomes of Ceratocystis eucalypticola, Chrysoporthe cubensis, Chrysoporthe deuterocubensis, Davidsoniella virescens, Fusarium temperatum, Graphilbum fragrans, Penicillium nordicum and Thielaviopsis musarum are presented in this genome announcement. These seven genomes are from plant pathogens and otherwise economically important fungal species. The genome sizes range from 28 Mb in the case of T. musarum to 45 Mb for Fusarium temperatum. These genomes include the first reports of genomes f...

  15. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  16. Statistical Methods in Integrative Genomics

    Science.gov (United States)

    Richardson, Sylvia; Tseng, George C.; Sun, Wei

    2016-01-01

    Statistical methods in integrative genomics aim to answer important biology questions by jointly analyzing multiple types of genomic data (vertical integration) or aggregating the same type of data across multiple studies (horizontal integration). In this article, we introduce different types of genomic data and data resources, and then review statistical methods of integrative genomics, with emphasis on the motivation and rationale of these methods. We conclude with some summary points and future research directions. PMID:27482531

  17. Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-03-12

    The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scale genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.

  18. Chromatin dynamics in genome stability

    DEFF Research Database (Denmark)

    Nair, Nidhi; Shoaib, Muhammad; Sørensen, Claus Storgaard

    2017-01-01

    Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote...... access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance...... of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage....

  19. Extreme genomes

    OpenAIRE

    DeLong, Edward F

    2000-01-01

    The complete genome sequence of Thermoplasma acidophilum, an acid- and heat-loving archaeon, has recently been reported. Comparative genomic analysis of this 'extremophile' is providing new insights into the metabolic machinery, ecology and evolution of thermophilic archaea.

  20. Grass genomes

    OpenAIRE

    Bennetzen, Jeffrey L.; SanMiguel, Phillip; Chen, Mingsheng; Tikhonov, Alexander; Francki, Michael; Avramova, Zoya

    1998-01-01

    For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that in...

  1. [Evolutionary process unveiled by the maximum genetic diversity hypothesis].

    Science.gov (United States)

    Huang, Yi-Min; Xia, Meng-Ying; Huang, Shi

    2013-05-01

    As two major popular theories to explain evolutionary facts, the neutral theory and Neo-Darwinism, despite their proven virtues in certain areas, still fail to offer comprehensive explanations to such fundamental evolutionary phenomena as the genetic equidistance result, abundant overlap sites, increase in complexity over time, incomplete understanding of genetic diversity, and inconsistencies with fossil and archaeological records. Maximum genetic diversity hypothesis (MGD), however, constructs a more complete evolutionary genetics theory that incorporates all of the proven virtues of existing theories and adds to them the novel concept of a maximum or optimum limit on genetic distance or diversity. It has yet to meet a contradiction and explained for the first time the half-century old Genetic Equidistance phenomenon as well as most other major evolutionary facts. It provides practical and quantitative ways of studying complexity. Molecular interpretation using MGD-based methods reveal novel insights on the origins of humans and other primates that are consistent with fossil evidence and common sense, and reestablished the important role of China in the evolution of humans. MGD theory has also uncovered an important genetic mechanism in the construction of complex traits and the pathogenesis of complex diseases. We here made a series of sequence comparisons among yeasts, fishes and primates to illustrate the concept of limit on genetic distance. The idea of limit or optimum is in line with the yin-yang paradigm in the traditional Chinese view of the universal creative law in nature.

  2. Cancer genomics

    DEFF Research Database (Denmark)

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  3. Amazing structure of respirasome: unveiling the secrets of cell respiration.

    Science.gov (United States)

    Guo, Runyu; Gu, Jinke; Wu, Meng; Yang, Maojun

    2016-12-01

    Respirasome, a huge molecular machine that carries out cellular respiration, has gained growing attention since its discovery, because respiration is the most indispensable biological process in almost all living creatures. The concept of respirasome has renewed our understanding of the respiratory chain organization, and most recently, the structure of respirasome solved by Yang's group from Tsinghua University (Gu et al. Nature 237(7622):639-643, 2016) firstly presented the detailed interactions within this huge molecular machine, and provided important information for drug design and screening. However, the study of cellular respiration went through a long history. Here, we briefly showed the detoured history of respiratory chain investigation, and then described the amazing structure of respirasome.

  4. Unveiling galaxies the role of images in astronomical discovery

    CERN Document Server

    Roy, Jean-René

    2017-01-01

    Galaxies are known as the building blocks of the universe, but arriving at this understanding has been a thousand-year odyssey. This journey is told through the lens of the evolving use of images as investigative tools. Initial chapters explore how early insights developed in line with new methods of scientific imaging, particularly photography. The volume then explores the impact of optical, radio and x-ray imaging techniques. The final part of the story discusses the importance of atlases of galaxies; how astronomers organised images in ways that educated, promoted ideas and pushed for new knowledge. Images that created confusion as well as advanced knowledge are included to demonstrate the challenges faced by astronomers and the long road to understanding galaxies. By examining developments in imaging, this text places the study of galaxies in its broader historical context, contributing to both astronomy and the history of science.

  5. Unveiling the Hidden Bat Diversity of a Neotropical Montane Forest.

    Directory of Open Access Journals (Sweden)

    Gloriana Chaverri

    Full Text Available Mountain environments, characterized by high levels of endemism, are at risk of experiencing significant biodiversity loss due to current trends in global warming. While many acknowledge their importance and vulnerability, these ecosystems still remain poorly studied, particularly for taxa that are difficult to sample such as bats. Aiming to estimate the amount of cryptic diversity among bats of a Neotropical montane cloud forest in Talamanca Range-south-east Central America-, we performed a 15-night sampling campaign, which resulted in 90 captured bats belonging to 8 species. We sequenced their mitochondrial cytochrome c oxidase subunit I (COI and screened their inter- and intraspecific genetic variation. Phylogenetic relations with conspecifics and closely related species from other geographic regions were established using Maximum Likelihood and Bayesian inference methods, as well as median-joining haplotype networks. Mitochondrial lineages highly divergent from hitherto characterized populations (> 9% COI dissimilarity were found in Myotis oxyotus and Hylonycteris underwoodi. Sturnira burtonlimi and M. keaysi also showed distinct mitochondrial structure with sibling species and/or populations. These results suggest that mountains in the region hold a high degree of endemicity potential that has previously been ignored in bats. They also warn of the high extinction risk montane bats may be facing due to climatic change, particularly in isolated mountain systems like Talamanca Range.

  6. Unveiling the curtain of superposition: Recent gedanken and laboratory experiments

    Science.gov (United States)

    Cohen, E.; Elitzur, A. C.

    2017-08-01

    What is the true meaning of quantum superposition? Can a particle genuinely reside in several places simultaneously? These questions lie at the heart of this paper which presents an updated survey of some important stages in the evolution of the three-boxes paradox, as well as novel conclusions drawn from it. We begin with the original thought experiment of Aharonov and Vaidman, and proceed to its non-counterfactual version. The latter was recently realized by Okamoto and Takeuchi using a quantum router. We then outline a dynamic version of this experiment, where a particle is shown to “disappear” and “re-appear” during the time evolution of the system. This surprising prediction based on self-cancellation of weak values is directly related to our notion of Quantum Oblivion. Finally, we present the non-counterfactual version of this disappearing-reappearing experiment. Within the near future, this last version of the experiment is likely to be realized in the lab, proving the existence of exotic hitherto unknown forms of superposition. With the aid of Bell’s theorem, we prove the inherent nonlocality and nontemporality underlying such pre- and post-selected systems, rendering anomalous weak values ontologically real.

  7. Unveiling the Formation Pathway of Single Crystalline Porous Silicon Nanowires

    Science.gov (United States)

    Zhong, Xing; Qu, Yongquan; Lin, Yung-Chen; Liao, Lei; Duan, Xiangfeng

    2011-01-01

    Porous silicon nanowire is emerging as an interesting material system due to its unique combination of structural, chemical, electronic, and optical properties. To fully understand their formation mechanism is of great importance for controlling the fundamental physical properties and enabling potential applications. Here we present a systematic study to elucidate the mechanism responsible for the formation of porous silicon nanowires in a two-step silver-assisted electroless chemical etching method. It is shown that silicon nanowire arrays with various porosities can be prepared by varying multiple experimental parameters such as the resistivity of the starting silicon wafer, the concentration of oxidant (H2O2) and the amount of silver catalyst. Our study shows a consistent trend that the porosity increases with the increasing wafer conductivity (dopant concentration) and oxidant (H2O2) concentration. We further demonstrate that silver ions, formed by the oxidation of silver, can diffuse upwards and re-nucleate on the sidewalls of nanowires to initiate new etching pathways to produce porous structure. The elucidation of this fundamental formation mechanism opens a rational pathway to the production of wafer-scale single crystalline porous silicon nanowires with tunable surface areas ranging from 370 m2·g−1 to 30 m2·g−1, and can enable exciting opportunities in catalysis, energy harvesting, conversion, storage, as well as biomedical imaging and therapy. PMID:21244020

  8. Unveiling Hidden Dynamics of Hippo Signalling: A Systems Analysis

    Directory of Open Access Journals (Sweden)

    Sung-Young Shin

    2016-08-01

    Full Text Available The Hippo signalling pathway has recently emerged as an important regulator of cell apoptosis and proliferation with significant implications in human diseases. In mammals, the pathway contains the core kinases MST1/2, which phosphorylate and activate LATS1/2 kinases. The pro-apoptotic function of the MST/LATS signalling axis was previously linked to the Akt and ERK MAPK pathways, demonstrating that the Hippo pathway does not act alone but crosstalks with other signalling pathways to coordinate network dynamics and cellular outcomes. These crosstalks were characterised by a multitude of complex regulatory mechanisms involving competitive protein-protein interactions and phosphorylation mediated feedback loops. However, how these different mechanisms interplay in different cellular contexts to drive the context-specific network dynamics of Hippo-ERK signalling remains elusive. Using mathematical modelling and computational analysis, we uncovered that the Hippo-ERK network can generate highly diverse dynamical profiles that can be clustered into distinct dose-response patterns. For each pattern, we offered mechanistic explanation that defines when and how the observed phenomenon can arise. We demonstrated that Akt displays opposing, dose-dependent functions towards ERK, which are mediated by the balance between the Raf-1/MST2 protein interaction module and the LATS1 mediated feedback regulation. Moreover, Ras displays a multi-functional role and drives biphasic responses of both MST2 and ERK activities; which are critically governed by the competitive protein interaction between MST2 and Raf-1. Our study represents the first in-depth and systematic analysis of the Hippo-ERK network dynamics and provides a concrete foundation for future studies.

  9. The Banana Genome Hub

    Science.gov (United States)

    Droc, Gaëtan; Larivière, Delphine; Guignon, Valentin; Yahiaoui, Nabila; This, Dominique; Garsmeur, Olivier; Dereeper, Alexis; Hamelin, Chantal; Argout, Xavier; Dufayard, Jean-François; Lengelle, Juliette; Baurens, Franc-Christophe; Cenci, Alberto; Pitollat, Bertrand; D’Hont, Angélique; Ruiz, Manuel; Rouard, Mathieu; Bocs, Stéphanie

    2013-01-01

    Banana is one of the world’s favorite fruits and one of the most important crops for developing countries. The banana reference genome sequence (Musa acuminata) was recently released. Given the taxonomic position of Musa, the completed genomic sequence has particular comparative value to provide fresh insights about the evolution of the monocotyledons. The study of the banana genome has been enhanced by a number of tools and resources that allows harnessing its sequence. First, we set up essential tools such as a Community Annotation System, phylogenomics resources and metabolic pathways. Then, to support post-genomic efforts, we improved banana existing systems (e.g. web front end, query builder), we integrated available Musa data into generic systems (e.g. markers and genetic maps, synteny blocks), we have made interoperable with the banana hub, other existing systems containing Musa data (e.g. transcriptomics, rice reference genome, workflow manager) and finally, we generated new results from sequence analyses (e.g. SNP and polymorphism analysis). Several uses cases illustrate how the Banana Genome Hub can be used to study gene families. Overall, with this collaborative effort, we discuss the importance of the interoperability toward data integration between existing information systems. Database URL: http://banana-genome.cirad.fr/ PMID:23707967

  10. Traditional medicine and genomics

    Directory of Open Access Journals (Sweden)

    Kalpana Joshi

    2010-01-01

    Full Text Available ′Omics′ developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  11. Traditional medicine and genomics.

    Science.gov (United States)

    Joshi, Kalpana; Ghodke, Yogita; Shintre, Pooja

    2010-01-01

    'Omics' developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  12. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.

    Science.gov (United States)

    Machado, Henrique; Gram, Lone

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.

  13. The human genome project

    International Nuclear Information System (INIS)

    Worton, R.

    1996-01-01

    The Human Genome Project is a massive international research project, costing 3 to 5 billion dollars and expected to take 15 years, which will identify the all the genes in the human genome - i.e. the complete sequence of bases in human DNA. The prize will be the ability to identify genes causing or predisposing to disease, and in some cases the development of gene therapy, but this new knowledge will raise important ethical issues

  14. ESA unveils Spanish antenna for unique space mission

    Science.gov (United States)

    2000-05-01

    Teamwork. Industrial enterprises in almost all of the 14 ESA member states and the United States have provided hardware for Cluster II, and several Spanish companies have made important contributions to the project. SENER in Bilbao has designed and built the communication and experiment booms for the spacecraft, while Alcatel Espacio in Tres Cantos (Madrid) has provided on-board transponders and high power amplifiers for the spacecraft. Construction of the eight Cluster / Cluster II spacecraft has been a major undertaking for European industry. Built into each 550 kg satellite are six propellant tanks, two pressure tanks, eight thrusters, 80 metres of pipework, about 5 km of wiring, 380 connectors and more than 14,000 electrical contacts. All of the spacecraft have been assembled at the Friedrichshafen (Germany) plant of prime contractor Dornier Satellitensysteme, and then sent to IABG in Ottobrunn, near Munich, for intensive vibration, thermal, vacuum and magnetic testing. Various companies have also participated in the relocation and upgrading of the VIL-1 antenna hardware. MAN (Germany) was responsible for the dismantling of the Odenwald antenna and installation of the dish at VILSPA, while VITROCISET (Italy) handled the transfer of the antenna 'back-end' equipment, which included the computers to process the satellite telemetry and telecommunications signals. These companies were supported by Spanish contractors and local industry.

  15. Unveiling EFL and Self-Contained Teachers’ Discourses on Bilingualism Within the Context of Professional Development

    Directory of Open Access Journals (Sweden)

    Jennyfer Paola Camargo Cely

    2018-01-01

    Full Text Available Throughout time, the predominant use of certain languages has allowed some nations to take control over others and assure for them a privileged position. This study unveiled how certain practices and ideologies in regard to bilingualism have influenced teachers’ professional development. Data were collected through discussion group sessions, reflective journals, and protocols from five teachers from a private K-11 school in Bogota. Analysis indicated participants’ discourses drew on hegemonic, colonial, and manipulative ideas. Nevertheless, when dialoguing and peer coaching, a discourse of resistance was constituted. The study suggested further research into teachers’ professional growth, bilingualism, and bilingual education in monolingual contexts as the Colombian one.

  16. The promise of insect genomics

    DEFF Research Database (Denmark)

    Grimmelikhuijzen, Cornelis J P; Cazzamali, Giuseppe; Williamson, Michael

    2007-01-01

    Insects are the largest animal group in the world and are ecologically and economically extremely important. This importance of insects is reflected by the existence of currently 24 insect genome projects. Our perspective discusses the state-of-the-art of these genome projects and the impacts...

  17. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  18. The perennial ryegrass GenomeZipper: targeted use of genome resources for comparative grass genomics.

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F X; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-02-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species.

  19. Genomic instability following irradiation

    International Nuclear Information System (INIS)

    Hacker-Klom, U.B.; Goehde, W.

    2001-01-01

    Ionising irradiation may induce genomic instability. The broad spectrum of stress reactions in eukaryontic cells to irradiation complicates the discovery of cellular targets and pathways inducing genomic instability. Irradiation may initiate genomic instability by deletion of genes controlling stability, by induction of genes stimulating instability and/or by activating endogeneous cellular viruses. Alternatively or additionally it is discussed that the initiation of genomic instability may be a consequence of radiation or other agents independently of DNA damage implying non nuclear targets, e.g. signal cascades. As a further mechanism possibly involved our own results may suggest radiation-induced changes in chromatin structure. Once initiated the process of genomic instability probably is perpetuated by endogeneous processes necessary for proliferation. Genomic instability may be a cause or a consequence of the neoplastic phenotype. As a conclusion from the data available up to now a new interpretation of low level radiation effects for radiation protection and in radiotherapy appears useful. The detection of the molecular mechanisms of genomic instability will be important in this context and may contribute to a better understanding of phenomenons occurring at low doses <10 cSv which are not well understood up to now. (orig.)

  20. Uzbekistan unveiled

    International Nuclear Information System (INIS)

    Mazurkevich, A.P.

    1993-01-01

    Through centuries of revolution, war and strife, the people of Uzbekistan have built a reputation as skilled and tenacious merchants. Since antiquity, when the Silk Road from China turned toward Europe at Smarakand, they have been master traders of such valuable commodities as cotton, fruits, vegetables, spices and gold. Now, they're about to introduce another of their specialties to the world: Uranium. Uranium mining in the country is controlled by a new, independent company, the Kizilkumredmetzoloto, parent of the Navoi Mining ampersand Metallurgy Combine [NMMC]. Established in 1958 at the height of the Cold War, when uranium mining for military stockpiles got started in earnest, Navoi was wholly owned by the USSR's Ministry of Medium Machine Building. Up until 1991, virtually all of Navoi's uranium production, strictly in the form of uranium concentrates, was used for either military purposes or for nuclear power plants within the former Soviet Union. The republic exerted no control over the final destination of its uranium. All production and operating decisions for Navoi's mines were dictated by the Soviet Union's Ministry of Atomic Power ampersand Industry [MAPI], which developed annual quotas for uranium production in each republic of the country. Uranium from the republics was sold to Techsnabexport [Tenex], the distribution and marketing arm of MAPI. Exports to other countries were handled strictly by Tenex

  1. From Multilatina to Global Latina: Unveiling the corporate-level international strategy choices of Grupo Nutresa

    Directory of Open Access Journals (Sweden)

    MARIA A DE VILLA

    Full Text Available Research on Multilatinas has underexplored multinationals from Colombia and their corporate-level international strategy choices to develop into Global Latinas. Building on interviews, documents, and archival data about Grupo Nutresa -Colombia's most international firm in manufactured goods-, this study unveils and discusses this firm's corporate-level international strategy choices between 1960 and 2014. A prevailing notion is that most multinationals from Latin America continue to target international operations to focus mainly on their home region through an export, multidomestic or transnational corporate-level international strategy. In contrast, data show that Grupo Nutresa chose to evolve through a sequential approach from an export to a transnational corporate-level international strategy while its international operations were able to transcend its home region to reach North America, Asia, Europe, Africa, and Oceania. These results add to international business research on emergent market multinational companies (EMNCs from Latin America by unveiling the corporate-level international strategy choices of a Colombian origin Multilatina that transformed into a Global Latina.

  2. Expectations and satisfaction of pregnant women: unveiling prenatal care in primary care.

    Science.gov (United States)

    Aparecida Maciel Cardelli, Alexandrina; Li Marrero, Tai; Aparecida Pimenta Ferrari, Rosângela; Trevisan Martins, Júlia; Serafim, Deise

    2016-06-01

    To analyze the perception of primiparous women about prenatal care in Basic Health Units in a municipality in southern Brazil. This is a qualitative research from the perspective of Social Representation Theory, from the following question: How has been the pre-natal care for you? Eighteen pregnant women were interviewed. The analysis resulted in three categories: Expectation representation about prenatal care; Rescuing the care offered in prenatal consultation; Unveiling the (dis) satisfaction with prenatal consultation. The prenatal care was apprehended as an essential moment for safe pregnancy, although centered on the doctor's figure and guarantee access to early laboratory and imaging tests. On the other hand, dissatisfaction was revealed from the reception at the entrance to the health unit to the consultations access, although some statements suggest timely satisfaction. Prenatal care did not meet the specific expectations of the study group and unveiled that the nurse did not supply it, as a member of the multidisciplinary team. The organization of the nursing work process in primary care, related to prenatal care, needs to be revisited to promote the effectiveness of its actions.

  3. Expectations and satisfaction of pregnant women: unveiling prenatal care in primary care

    Directory of Open Access Journals (Sweden)

    Alexandrina Aparecida Maciel Cardelli

    Full Text Available Objective.To analyze the perception of primiparous women about prenatal care in Basic Health Units in a municipality in southern Brazil. Methods. This is a qualitative research from the perspective of Social Representation Theory, from the following question: How has been the pre-natal care for you? Eighteen pregnant women were interviewed. Results. The analysis resulted in three categories: Expectation representation about prenatal care; Rescuing the care offered in prenatal consultation; Unveiling the (dis satisfaction with prenatal consultation. The prenatal care was apprehended as an essential moment for safe pregnancy, although centered on the doctor's figure and guarantee access to early laboratory and imaging tests. On the other hand, dissatisfaction was revealed from the reception at the entrance to the health unit to the consultations access, although some statements suggest timely satisfaction. Conclusion. Prenatal care did not meet the specific expectations of the study group and unveiled that the nurse did not supply it, as a member of the multidisciplinary team. The organization of the nursing work process in primary care, related to prenatal care, needs to be revisited to promote the effectiveness of its actions.

  4. Genomic research perspectives in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Ainur Akilzhanova

    2014-01-01

    Full Text Available Introduction: Technological advancements rapidly propel the field of genome research. Advances in genetics and genomics such as the sequence of the human genome, the human haplotype map, open access databases, cheaper genotyping and chemical genomics, have transformed basic and translational biomedical research. Several projects in the field of genomic and personalized medicine have been conducted at the Center for Life Sciences in Nazarbayev University. The prioritized areas of research include: genomics of multifactorial diseases, cancer genomics, bioinformatics, genetics of infectious diseases and population genomics. At present, DNA-based risk assessment for common complex diseases, application of molecular signatures for cancer diagnosis and prognosis, genome-guided therapy, and dose selection of therapeutic drugs are the important issues in personalized medicine. Results: To further develop genomic and biomedical projects at Center for Life Sciences, the development of bioinformatics research and infrastructure and the establishment of new collaborations in the field are essential. Widespread use of genetic tools will allow the identification of diseases before the onset of clinical symptoms, the individualization of drug treatment, and could induce individual behavioral changes on the basis of calculated disease risk. However, many challenges remain for the successful translation of genomic knowledge and technologies into health advances, such as medicines and diagnostics. It is important to integrate research and education in the fields of genomics, personalized medicine, and bioinformatics, which will be possible with opening of the new Medical Faculty at Nazarbayev University. People in practice and training need to be educated about the key concepts of genomics and engaged so they can effectively apply their knowledge in a matter that will bring the era of genomic medicine to patient care. This requires the development of well

  5. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    OpenAIRE

    Henrique Machado; Henrique Machado; Lone Gram

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationship...

  6. NASA's Great Observatories Celebrate the International Year of Astronomy With a National Unveiling of Spectacular Images

    Science.gov (United States)

    2009-02-01

    In 1609, Galileo first turned his telescope to the heavens and gave birth to modern astronomy. To commemorate four hundred years of exploring the universe, 2009 is designated the International Year of Astronomy. NASA's Great Observatories - the Hubble Space Telescope, Spitzer Space Telescope, and Chandra X-ray Observatory - are marking the occasion with the release of a suite of images at over 100 planetariums, museums, nature centers, and schools across the country in conjunction with Galileo's birthday on February 15. The selected sites will unveil a large 9-square-foot print of the spiral galaxy Messier 101 that combines the optical view of Hubble, the infrared view of Spitzer, and the X-ray view of Chandra into one multi-wavelength picture. "It's like using your eyes, night vision goggles, and X-ray vision all at the same time," says Dr. Hashima Hasan, lead scientist for the International Year of Astronomy at NASA Headquarters in Washington. Cas A animation Chandra X-ray Image of M101 Participating institutions also will display a matched trio of Hubble, Spitzer, and Chandra images of Messier 101. Each image shows a different wavelength view of the galaxy that illustrates not only the different science uncovered by each observatory, but also just how far astronomy has come since Galileo. Messier 101 is a face-on spiral galaxy about 22 million light-years away in the constellation Ursa Major. It is in many ways similar to, but larger than, our own Milky Way galaxy. Hubble's visible light view shows off the swirls of bright stars and glowing gas that give the galaxy its nickname the Pinwheel Galaxy. In contrast, Spitzer's infrared-light image sees into the spiral arms and reveals the glow of dust lanes where dense clouds can collapse to form new stars. Chandra's X-ray picture uncovers the high-energy features in the galaxy, such as remnants of exploded stars or matter zooming around black holes. The juxtaposition of observations from these three telescopes

  7. Genomics and fish adaptation

    Directory of Open Access Journals (Sweden)

    Agostinho Antunes

    2015-12-01

    Full Text Available The completion of the human genome sequencing in 2003 opened a new perspective into the importance of whole genome sequencing projects, and currently multiple species are having their genomes completed sequenced, from simple organisms, such as bacteria, to more complex taxa, such as mammals. This voluminous sequencing data generated across multiple organisms provides also the framework to better understand the genetic makeup of such species and related ones, allowing to explore the genetic changes underlining the evolution of diverse phenotypic traits. Here, recent results from our group retrieved from comparative evolutionary genomic analyses of varied fish species will be considered to exemplify how gene novelty and gene enhancement by positive selection might have been determinant in the success of adaptive radiations into diverse habitats and lifestyles.

  8. Annotating individual human genomes.

    Science.gov (United States)

    Torkamani, Ali; Scott-Van Zeeland, Ashley A; Topol, Eric J; Schork, Nicholas J

    2011-10-01

    Advances in DNA sequencing technologies have made it possible to rapidly, accurately and affordably sequence entire individual human genomes. As impressive as this ability seems, however, it will not likely amount to much if one cannot extract meaningful information from individual sequence data. Annotating variations within individual genomes and providing information about their biological or phenotypic impact will thus be crucially important in moving individual sequencing projects forward, especially in the context of the clinical use of sequence information. In this paper we consider the various ways in which one might annotate individual sequence variations and point out limitations in the available methods for doing so. It is arguable that, in the foreseeable future, DNA sequencing of individual genomes will become routine for clinical, research, forensic, and personal purposes. We therefore also consider directions and areas for further research in annotating genomic variants. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. ANNOTATING INDIVIDUAL HUMAN GENOMES*

    Science.gov (United States)

    Torkamani, Ali; Scott-Van Zeeland, Ashley A.; Topol, Eric J.; Schork, Nicholas J.

    2014-01-01

    Advances in DNA sequencing technologies have made it possible to rapidly, accurately and affordably sequence entire individual human genomes. As impressive as this ability seems, however, it will not likely to amount to much if one cannot extract meaningful information from individual sequence data. Annotating variations within individual genomes and providing information about their biological or phenotypic impact will thus be crucially important in moving individual sequencing projects forward, especially in the context of the clinical use of sequence information. In this paper we consider the various ways in which one might annotate individual sequence variations and point out limitations in the available methods for doing so. It is arguable that, in the foreseeable future, DNA sequencing of individual genomes will become routine for clinical, research, forensic, and personal purposes. We therefore also consider directions and areas for further research in annotating genomic variants. PMID:21839162

  10. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  11. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  12. Genome Imprinting

    Indian Academy of Sciences (India)

    the cell nucleus (mitochondrial and chloroplast genomes), and. (3) traits governed ... tively good embryonic development but very poor development of membranes and ... Human homologies for the type of situation described above are naturally ..... imprint; (b) New modifications of the paternal genome in germ cells of each ...

  13. Baculovirus Genomics

    NARCIS (Netherlands)

    Oers, van M.M.; Vlak, J.M.

    2007-01-01

    Baculovirus genomes are covalently closed circles of double stranded-DNA varying in size between 80 and 180 kilobase-pair. The genomes of more than fourty-one baculoviruses have been sequenced to date. The majority of these (37) are pathogenic to lepidopteran hosts; three infect sawflies

  14. Genomic Testing

    Science.gov (United States)

    ... this database. Top of Page Evaluation of Genomic Applications in Practice and Prevention (EGAPP™) In 2004, the Centers for Disease Control and Prevention launched the EGAPP initiative to establish and test a ... and other applications of genomic technology that are in transition from ...

  15. Ancient genomes

    OpenAIRE

    Hoelzel, A Rus

    2005-01-01

    Ever since its invention, the polymerase chain reaction has been the method of choice for work with ancient DNA. In an application of modern genomic methods to material from the Pleistocene, a recent study has instead undertaken to clone and sequence a portion of the ancient genome of the cave bear.

  16. Informational laws of genome structures

    Science.gov (United States)

    Bonnici, Vincenzo; Manca, Vincenzo

    2016-06-01

    In recent years, the analysis of genomes by means of strings of length k occurring in the genomes, called k-mers, has provided important insights into the basic mechanisms and design principles of genome structures. In the present study, we focus on the proper choice of the value of k for applying information theoretic concepts that express intrinsic aspects of genomes. The value k = lg2(n), where n is the genome length, is determined to be the best choice in the definition of some genomic informational indexes that are studied and computed for seventy genomes. These indexes, which are based on information entropies and on suitable comparisons with random genomes, suggest five informational laws, to which all of the considered genomes obey. Moreover, an informational genome complexity measure is proposed, which is a generalized logistic map that balances entropic and anti-entropic components of genomes and is related to their evolutionary dynamics. Finally, applications to computational synthetic biology are briefly outlined.

  17. Collaborative Genomics Study Advances Precision Oncology

    Science.gov (United States)

    A collaborative study conducted by two Office of Cancer Genomics (OCG) initiatives highlights the importance of integrating structural and functional genomics programs to improve cancer therapies, and more specifically, contribute to precision oncology treatments for children.

  18. The genome of Arabidopsis thaliana.

    OpenAIRE

    Goodman, H M; Ecker, J R; Dean, C

    1995-01-01

    Arabidopsis thaliana is a small flowering plant that is a member of the family cruciferae. It has many characteristics--diploid genetics, rapid growth cycle, relatively low repetitive DNA content, and small genome size--that recommend it as the model for a plant genome project. The current status of the genetic and physical maps, as well as efforts to sequence the genome, are presented. Examples are given of genes isolated by using map-based cloning. The importance of the Arabidopsis project ...

  19. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    DEFF Research Database (Denmark)

    Machado, Henrique; Gram, Lone

    2017-01-01

    was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.......Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand...... the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur, amino-acid usage, ANI), which allowed us to identify two...

  20. Comparative Genome Viewer

    International Nuclear Information System (INIS)

    Molineris, I.; Sales, G.

    2009-01-01

    The amount of information about genomes, both in the form of complete sequences and annotations, has been exponentially increasing in the last few years. As a result there is the need for tools providing a graphical representation of such information that should be comprehensive and intuitive. Visual representation is especially important in the comparative genomics field since it should provide a combined view of data belonging to different genomes. We believe that existing tools are limited in this respect as they focus on a single genome at a time (conservation histograms) or compress alignment representation to a single dimension. We have therefore developed a web-based tool called Comparative Genome Viewer (Cgv): it integrates a bidimensional representation of alignments between two regions, both at small and big scales, with the richness of annotations present in other genome browsers. We give access to our system through a web-based interface that provides the user with an interactive representation that can be updated in real time using the mouse to move from region to region and to zoom in on interesting details.

  1. White House Unveils America's College Promise Proposal: Tuition-Free Community College for Responsible Students. Fact Sheet

    Science.gov (United States)

    The White House, 2015

    2015-01-01

    In January, 2015, the President unveiled the America's College Promise proposal, which would make two years of community college free for responsible students, letting students earn the first half of a bachelor's degree and earn skills needed in the workforce at no cost. This proposal will require everyone to do their part: community colleges must…

  2. Unveiling EFL and Self-Contained Teachers' Discourses on Bilingualism within the Context of Professional Development

    Science.gov (United States)

    Camargo Cely, Jennyfer Paola

    2018-01-01

    Throughout time, the predominant use of certain languages has allowed some nations to take control over others and assure for them a privileged position. This study unveiled how certain practices and ideologies in regard to bilingualism have influenced teachers' professional development. Data were collected through discussion group sessions,…

  3. Genome U-Plot: a whole genome visualization.

    Science.gov (United States)

    Gaitatzes, Athanasios; Johnson, Sarah H; Smadbeck, James B; Vasmatzis, George

    2018-05-15

    The ability to produce and analyze whole genome sequencing (WGS) data from samples with structural variations (SV) generated the need to visualize such abnormalities in simplified plots. Conventional two-dimensional representations of WGS data frequently use either circular or linear layouts. There are several diverse advantages regarding both these representations, but their major disadvantage is that they do not use the two-dimensional space very efficiently. We propose a layout, termed the Genome U-Plot, which spreads the chromosomes on a two-dimensional surface and essentially quadruples the spatial resolution. We present the Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities. We compare conventional visualization schemas with the Genome U-Plot using visualization metrics such as number of line crossings and crossing angle resolution measures. Based on our metrics, we improve the readability of the resulting graph by at least 2-fold, making apparent important features and making it easy to identify important genomic changes. A whole genome visualization tool with high spatial resolution and improved aesthetic qualities. An implementation and documentation of the Genome U-Plot is publicly available at https://github.com/gaitat/GenomeUPlot. vasmatzis.george@mayo.edu. Supplementary data are available at Bioinformatics online.

  4. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  5. Unveiling non-stationary coupling between Amazon and ocean during recent extreme events

    Science.gov (United States)

    Ramos, Antônio M. de T.; Zou, Yong; de Oliveira, Gilvan Sampaio; Kurths, Jürgen; Macau, Elbert E. N.

    2018-02-01

    The interplay between extreme events in the Amazon's precipitation and the anomaly in the temperature of the surrounding oceans is not fully understood, especially its causal relations. In this paper, we investigate the climatic interaction between these regions from 1999 until 2012 using modern tools of complex system science. We identify the time scale of the coupling quantitatively and unveil the non-stationary influence of the ocean's temperature. The findings show consistently the distinctions between the coupling in the recent major extreme events in Amazonia, such as the two droughts that happened in 2005 and 2010 and the three floods during 1999, 2009 and 2012. Interestingly, the results also reveal the influence over the anomalous precipitation of Southwest Amazon has become increasingly lagged. The analysis can shed light on the underlying dynamics of the climate network system and consequently can improve predictions of extreme rainfall events.

  6. Unveiling the molecular bipolar outflow of the peculiar red supergiant VY Canis Majoris

    Science.gov (United States)

    Shinnaga, Hiroko; Claussen, Mark J.; Lim, Jeremy; Dinh-van-Trung; Tsuboi, Masato

    2003-04-01

    We carried out polarimetric spectral-line imaging of the molecular outflow of the peculiar red supergiant VY Canis Majoris in SiO J=1-0 line in the ground vibrational state, which contains highly linearly-polarized velocity components, using the Very Large Array. We succeeded in unveiling the highly linearly polarized bipolar outflow for the first time at subarcsecond spatial resolution. The results clearly show that the direction of linear polarization of the brightest maser components is parallel to the outflow axis. The results strongly suggest that the linear polarization of the SiO maser is closely related to the outflow phenomena of the star. Furthermore, the results indicate that the linear polarization observed in the optical and infrared also occur due to the outflow phenomena.

  7. The Green Bank Ammonia Survey: Unveiling the Dynamics of the Barnard 59 Star-forming Clump

    Science.gov (United States)

    Redaelli, E.; Alves, F. O.; Caselli, P.; Pineda, J. E.; Friesen, R. K.; Chacón-Tanarro, A.; Matzner, C. D.; Ginsburg, A.; Rosolowsky, E.; Keown, J.; Offner, S. S. R.; Di Francesco, J.; Kirk, H.; Myers, P. C.; Hacar, A.; Cimatti, A.; Chen, H. H.; Chen, M. C.; Lee, K. I.; Seo, Y. M.

    2017-12-01

    Understanding the early stages of star formation is a research field of ongoing development, both theoretically and observationally. In this context, molecular data have been continuously providing observational constraints on the gas dynamics at different excitation conditions and depths in the sources. We have investigated the Barnard 59 core, the only active site of star formation in the Pipe Nebula, to achieve a comprehensive view of the kinematic properties of the source. This information was derived by simultaneously fitting ammonia inversion transition lines (1, 1) and (2, 2). Our analysis unveils the imprint of protostellar feedback, such as increasing line widths, temperature, and turbulent motions in our molecular data. Combined with complementary observations of dust thermal emission, we estimate that the core is gravitationally bound following a virial analysis. If the core is not contracting, another source of internal pressure, most likely the magnetic field, is supporting it against gravitational collapse and limits its star formation efficiency.

  8. Understanding the mechanism of catalytic fast pyrolysis by unveiling reactive intermediates in heterogeneous catalysis

    Science.gov (United States)

    Hemberger, Patrick; Custodis, Victoria B. F.; Bodi, Andras; Gerber, Thomas; van Bokhoven, Jeroen A.

    2017-06-01

    Catalytic fast pyrolysis is a promising way to convert lignin into fine chemicals and fuels, but current approaches lack selectivity and yield unsatisfactory conversion. Understanding the pyrolysis reaction mechanism at the molecular level may help to make this sustainable process more economic. Reactive intermediates are responsible for product branching and hold the key to unveiling these mechanisms, but are notoriously difficult to detect isomer-selectively. Here, we investigate the catalytic pyrolysis of guaiacol, a lignin model compound, using photoelectron photoion coincidence spectroscopy with synchrotron radiation, which allows for isomer-selective detection of reactive intermediates. In combination with ambient pressure pyrolysis, we identify fulvenone as the central reactive intermediate, generated by catalytic demethylation to catechol and subsequent dehydration. The fulvenone ketene is responsible for the phenol formation. This technique may open unique opportunities for isomer-resolved probing in catalysis, and holds the potential for achieving a mechanistic understanding of complex, real-life catalytic processes.

  9. Herbarium genomics

    DEFF Research Database (Denmark)

    Bakker, Freek T.; Lei, Di; Yu, Jiaying

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...... up to 146 years old. We use genome skimming and an automated assembly pipeline, Iterative Organelle Genome Assembly, that assembles paired-end reads into a series of candidate assemblies, the best one of which is selected based on likelihood estimation. We used 93 specimens from 12 different...... correlation between plastome coverage and nuclear genome size (C value) in our samples, but the range of C values included is limited. Finally, we conclude that routine plastome sequencing from herbarium specimens is feasible and cost-effective (compared with Sanger sequencing or plastome...

  10. Bam35 tectivirus intraviral interaction map unveils new function and localization of phage ORFan proteins.

    Science.gov (United States)

    Berjón-Otero, Mónica; Lechuga, Ana; Mehla, Jitender; Uetz, Peter; Salas, Margarita; Redrejo-Rodríguez, Modesto

    2017-07-26

    Tectiviridae comprises a group of tail-less, icosahedral, membrane-containing bacteriophages that can be divided into two groups by their hosts, either Gram-negative or Gram-positive bacteria. While the first group is composed of PRD1 and nearly identical well characterized lytic viruses, the second one includes more variable temperate phages, like GIL16 or Bam35, whose hosts are Bacillus cereus and related Gram-positive bacteria.In the genome of Bam35, nearly half of the 32 annotated open reading frames (ORFs) have no homologs in databases (ORFans), being putative proteins of unknown function, which hinders the understanding of their biology. With the aim of increasing the knowledge of the viral proteome, we carried out a comprehensive yeast two-hybrid analysis among all the putative proteins encoded by the Bam35 genome. The resulting protein interactome comprises 76 unique interactions among 24 proteins, of which 12 have an unknown function. These results suggested that the P17 protein is the minor capsid protein of Bam35 and P24 is the penton protein, being the latter also supported by iterative threading protein modeling. Moreover, the inner membrane transglycosylase protein P26 could have an additional structural role. We also detected interactions involving non-structural proteins, such as the DNA binding protein P1 and the genome terminal protein (P4), which was confirmed by co-immunoprecipitation of recombinant proteins. Altogether, our results provide a functional view of the Bam35 viral proteome, with a focus on the composition and organization of the viral particle. IMPORTANCE Tail-less viruses of the family Tectiviridae can infect commensal and pathogenic Gram-positive and Gram-negative bacteria. Moreover, they have been proposed to be at the evolutionary origin of several groups of large eukaryotic DNA viruses and self-replicating plasmids. However, due to their ancient origin and complex diversity, many tectiviral proteins are ORFans of unknown

  11. Comparative Genomics in Homo sapiens.

    Science.gov (United States)

    Oti, Martin; Sammeth, Michael

    2018-01-01

    Genomes can be compared at different levels of divergence, either between species or within species. Within species genomes can be compared between different subpopulations, such as human subpopulations from different continents. Investigating the genomic differences between different human subpopulations is important when studying complex diseases that are affected by many genetic variants, as the variants involved can differ between populations. The 1000 Genomes Project collected genome-scale variation data for 2504 human individuals from 26 different populations, enabling a systematic comparison of variation between human subpopulations. In this chapter, we present step-by-step a basic protocol for the identification of population-specific variants employing the 1000 Genomes data. These variants are subsequently further investigated for those that affect the proteome or RNA splice sites, to investigate potentially biologically relevant differences between the populations.

  12. Better chocolate through genomics

    Science.gov (United States)

    Theobroma cacao, the cacao or chocolate tree, is a tropical understory tree whose seeds are used to make chocolate. And like any important crop, cacao is the subject of much research. On September 15, 2010, scientists publicly released a preliminary sequence of the cacao genome--which contains all o...

  13. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  14. Body Covering and Body Image: A Comparison of Veiled and Unveiled Muslim Women, Christian Women, and Atheist Women Regarding Body Checking, Body Dissatisfaction, and Eating Disorder Symptoms.

    Science.gov (United States)

    Wilhelm, Leonie; Hartmann, Andrea S; Becker, Julia C; Kişi, Melahat; Waldorf, Manuel; Vocks, Silja

    2018-02-21

    Although Islam is the fastest growing religion worldwide, only few studies have investigated body image in Muslim women, and no study has investigated body checking. Therefore, the present study examined whether body image, body checking, and disordered eating differ between veiled and unveiled Muslim women, Christian women, and atheist women. While the groups did not differ regarding body dissatisfaction, unveiled Muslim women reported more checking than veiled Muslim and Christian women, and higher bulimia scores than Christian. Thus, prevention against eating disorders should integrate all women, irrespective of religious affiliation or veiling, with a particular focus on unveiled Muslim women.

  15. Single-cell sequencing unveils the lifestyle and CRISPR-based population history of Hydrotalea sp. in acid mine drainage.

    Science.gov (United States)

    Medeiros, J D; Leite, L R; Pylro, V S; Oliveira, F S; Almeida, V M; Fernandes, G R; Salim, A C M; Araújo, F M G; Volpini, A C; Oliveira, G; Cuadros-Orellana, S

    2017-10-01

    Acid mine drainage (AMD) is characterized by an acid and metal-rich run-off that originates from mining systems. Despite having been studied for many decades, much remains unknown about the microbial community dynamics in AMD sites, especially during their early development, when the acidity is moderate. Here, we describe draft genome assemblies from single cells retrieved from an early-stage AMD sample. These cells belong to the genus Hydrotalea and are closely related to Hydrotalea flava. The phylogeny and average nucleotide identity analysis suggest that all single amplified genomes (SAGs) form two clades that may represent different strains. These cells have the genomic potential for denitrification, copper and other metal resistance. Two coexisting CRISPR-Cas loci were recovered across SAGs, and we observed heterogeneity in the population with regard to the spacer sequences, together with the loss of trailer-end spacers. Our results suggest that the genomes of Hydrotalea sp. strains studied here are adjusting to a quickly changing selective pressure at the microhabitat scale, and an important form of this selective pressure is infection by foreign DNA. © 2017 John Wiley & Sons Ltd.

  16. Three-dimensional Structure of a Viral Genome-delivery Portal Vertex

    Energy Technology Data Exchange (ETDEWEB)

    A Olia; P Prevelige Jr.; J Johnson; G Cingolani

    2011-12-31

    DNA viruses such as bacteriophages and herpesviruses deliver their genome into and out of the capsid through large proteinaceous assemblies, known as portal proteins. Here, we report two snapshots of the dodecameric portal protein of bacteriophage P22. The 3.25-{angstrom}-resolution structure of the portal-protein core bound to 12 copies of gene product 4 (gp4) reveals a {approx}1.1-MDa assembly formed by 24 proteins. Unexpectedly, a lower-resolution structure of the full-length portal protein unveils the unique topology of the C-terminal domain, which forms a {approx}200-{angstrom}-long {alpha}-helical barrel. This domain inserts deeply into the virion and is highly conserved in the Podoviridae family. We propose that the barrel domain facilitates genome spooling onto the interior surface of the capsid during genome packaging and, in analogy to a rifle barrel, increases the accuracy of genome ejection into the host cell.

  17. Genomics of Preterm Birth

    Science.gov (United States)

    Swaggart, Kayleigh A.; Pavlicev, Mihaela; Muglia, Louis J.

    2015-01-01

    The molecular mechanisms controlling human birth timing at term, or resulting in preterm birth, have been the focus of considerable investigation, but limited insights have been gained over the past 50 years. In part, these processes have remained elusive because of divergence in reproductive strategies and physiology shown by model organisms, making extrapolation to humans uncertain. Here, we summarize the evolution of progesterone signaling and variation in pregnancy maintenance and termination. We use this comparative physiology to support the hypothesis that selective pressure on genomic loci involved in the timing of parturition have shaped human birth timing, and that these loci can be identified with comparative genomic strategies. Previous limitations imposed by divergence of mechanisms provide an important new opportunity to elucidate fundamental pathways of parturition control through increasing availability of sequenced genomes and associated reproductive physiology characteristics across diverse organisms. PMID:25646385

  18. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  19. SWIM: a computational tool to unveiling crucial nodes in complex biological networks.

    Science.gov (United States)

    Paci, Paola; Colombo, Teresa; Fiscon, Giulia; Gurtner, Aymone; Pavesi, Giulio; Farina, Lorenzo

    2017-03-20

    SWItchMiner (SWIM) is a wizard-like software implementation of a procedure, previously described, able to extract information contained in complex networks. Specifically, SWIM allows unearthing the existence of a new class of hubs, called "fight-club hubs", characterized by a marked negative correlation with their first nearest neighbors. Among them, a special subset of genes, called "switch genes", appears to be characterized by an unusual pattern of intra- and inter-module connections that confers them a crucial topological role, interestingly mirrored by the evidence of their clinic-biological relevance. Here, we applied SWIM to a large panel of cancer datasets from The Cancer Genome Atlas, in order to highlight switch genes that could be critically associated with the drastic changes in the physiological state of cells or tissues induced by the cancer development. We discovered that switch genes are found in all cancers we studied and they encompass protein coding genes and non-coding RNAs, recovering many known key cancer players but also many new potential biomarkers not yet characterized in cancer context. Furthermore, SWIM is amenable to detect switch genes in different organisms and cell conditions, with the potential to uncover important players in biologically relevant scenarios, including but not limited to human cancer.

  20. Genomes to Proteomes

    Energy Technology Data Exchange (ETDEWEB)

    Panisko, Ellen A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Grigoriev, Igor [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Daly, Don S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Webb-Robertson, Bobbie-Jo [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2009-03-01

    Biologists are awash with genomic sequence data. In large part, this is due to the rapid acceleration in the generation of DNA sequence that occurred as public and private research institutes raced to sequence the human genome. In parallel with the large human genome effort, mostly smaller genomes of other important model organisms were sequenced. Projects following on these initial efforts have made use of technological advances and the DNA sequencing infrastructure that was built for the human and other organism genome projects. As a result, the genome sequences of many organisms are available in high quality draft form. While in many ways this is good news, there are limitations to the biological insights that can be gleaned from DNA sequences alone; genome sequences offer only a bird's eye view of the biological processes endemic to an organism or community. Fortunately, the genome sequences now being produced at such a high rate can serve as the foundation for other global experimental platforms such as proteomics. Proteomic methods offer a snapshot of the proteins present at a point in time for a given biological sample. Current global proteomics methods combine enzymatic digestion, separations, mass spectrometry and database searching for peptide identification. One key aspect of proteomics is the prediction of peptide sequences from mass spectrometry data. Global proteomic analysis uses computational matching of experimental mass spectra with predicted spectra based on databases of gene models that are often generated computationally. Thus, the quality of gene models predicted from a genome sequence is crucial in the generation of high quality peptide identifications. Once peptides are identified they can be assigned to their parent protein. Proteins identified as expressed in a given experiment are most useful when compared to other expressed proteins in a larger biological context or biochemical pathway. In this chapter we will discuss the automatic

  1. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  2. Comparative Genomics

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 8. Comparative Genomics - A Powerful New Tool in Biology. Anand K Bachhawat. General Article Volume 11 Issue 8 August 2006 pp 22-40. Fulltext. Click here to view fulltext PDF. Permanent link:

  3. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  4. Insights into structural variations and genome rearrangements in prokaryotic genomes.

    Science.gov (United States)

    Periwal, Vinita; Scaria, Vinod

    2015-01-01

    Structural variations (SVs) are genomic rearrangements that affect fairly large fragments of DNA. Most of the SVs such as inversions, deletions and translocations have been largely studied in context of genetic diseases in eukaryotes. However, recent studies demonstrate that genome rearrangements can also have profound impact on prokaryotic genomes, leading to altered cell phenotype. In contrast to single-nucleotide variations, SVs provide a much deeper insight into organization of bacterial genomes at a much better resolution. SVs can confer change in gene copy number, creation of new genes, altered gene expression and many other functional consequences. High-throughput technologies have now made it possible to explore SVs at a much refined resolution in bacterial genomes. Through this review, we aim to highlight the importance of the less explored field of SVs in prokaryotic genomes and their impact. We also discuss its potential applicability in the emerging fields of synthetic biology and genome engineering where targeted SVs could serve to create sophisticated and accurate genome editing. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. The Chlamydomonas genome project: a decade on

    Science.gov (United States)

    Blaby, Ian K.; Blaby-Haas, Crysten; Tourasse, Nicolas; Hom, Erik F. Y.; Lopez, David; Aksoy, Munevver; Grossman, Arthur; Umen, James; Dutcher, Susan; Porter, Mary; King, Stephen; Witman, George; Stanke, Mario; Harris, Elizabeth H.; Goodstein, David; Grimwood, Jane; Schmutz, Jeremy; Vallon, Olivier; Merchant, Sabeeha S.; Prochnik, Simon

    2014-01-01

    The green alga Chlamydomonas reinhardtii is a popular unicellular organism for studying photosynthesis, cilia biogenesis and micronutrient homeostasis. Ten years since its genome project was initiated, an iterative process of improvements to the genome and gene predictions has propelled this organism to the forefront of the “omics” era. Housed at Phytozome, the Joint Genome Institute’s (JGI) plant genomics portal, the most up-to-date genomic data include a genome arranged on chromosomes and high-quality gene models with alternative splice forms supported by an abundance of RNA-Seq data. Here, we present the past, present and future of Chlamydomonas genomics. Specifically, we detail progress on genome assembly and gene model refinement, discuss resources for gene annotations, functional predictions and locus ID mapping between versions and, importantly, outline a standardized framework for naming genes. PMID:24950814

  6. A strategy to unveil transient sources of ultra-high-energy cosmic rays

    Directory of Open Access Journals (Sweden)

    Takami Hajime

    2013-06-01

    Full Text Available Transient generation of ultra-high-energy cosmic rays (UHECRs has been motivated from promising candidates of UHECR sources such as gamma-ray bursts, flares of active galactic nuclei, and newly born neutron stars and magnetars. Here we propose a strategy to unveil transient sources of UHECRs from UHECR experiments. We demonstrate that the rate of UHECR bursts and/or flares is related to the apparent number density of UHECR sources, which is the number density estimated on the assumption of steady sources, and the time-profile spread of the bursts produced by cosmic magnetic fields. The apparent number density strongly depends on UHECR energies under a given rate of the bursts, which becomes observational evidence of transient sources. It is saturated at the number density of host galaxies of UHECR sources. We also derive constraints on the UHECR burst rate and/or energy budget of UHECRs per source as a function of the apparent source number density by using models of cosmic magnetic fields. In order to obtain a precise constraint of the UHECR burst rate, high event statistics above ∼ 1020 eV for evaluating the apparent source number density at the highest energies and better knowledge on cosmic magnetic fields by future observations and/or simulations to better estimate the time-profile spread of UHECR bursts are required. The estimated rate allows us to constrain transient UHECR sources by being compared with the occurrence rates of known energetic transient phenomena.

  7. Surprisal analysis of Glioblastoma Multiform (GBM) microRNA dynamics unveils tumor specific phenotype.

    Science.gov (United States)

    Zadran, Sohila; Remacle, Francoise; Levine, Raphael

    2014-01-01

    Gliomablastoma multiform (GBM) is the most fatal form of all brain cancers in humans. Currently there are limited diagnostic tools for GBM detection. Here, we applied surprisal analysis, a theory grounded in thermodynamics, to unveil how biomolecule energetics, specifically a redistribution of free energy amongst microRNAs (miRNAs), results in a system deviating from a non-cancer state to the GBM cancer -specific phenotypic state. Utilizing global miRNA microarray expression data of normal and GBM patients tumors, surprisal analysis characterizes a miRNA system response capable of distinguishing GBM samples from normal tissue biopsy samples. We indicate that the miRNAs contributing to this system behavior is a disease phenotypic state specific to GBM and is therefore a unique GBM-specific thermodynamic signature. MiRNAs implicated in the regulation of stochastic signaling processes crucial in the hallmarks of human cancer, dominate this GBM-cancer phenotypic state. With this theory, we were able to distinguish with high fidelity GBM patients solely by monitoring the dynamics of miRNAs present in patients' biopsy samples. We anticipate that the GBM-specific thermodynamic signature will provide a critical translational tool in better characterizing cancer types and in the development of future therapeutics for GBM.

  8. Unveiling the water-associated conformational mobility in the active site of ascorbate peroxidase.

    Science.gov (United States)

    Chao, Wei-Chih; Lin, Li-Ju; Lu, Jyh-Feng; Wang, Jinn-Shyan; Lin, Tzu-Chieh; Chen, Yi-Han; Chen, Yi-Ting; Yang, Hsiao-Ching; Chou, Pi-Tai

    2018-03-01

    We carried out comprehensive spectroscopic studies of wild type and mutants of ascorbate peroxidase (APX) to gain understanding of the conformational mobility of the active site. In this approach, three unnatural tryptophans were applied to replace the distal tryptophan (W41) in an aim to probe polarity/water environment near the edge of the heme-containing active site. 7-azatryptophan ((7-aza)Trp) is sensitive to environment polarity, while 2,7-azatryptophan ((2,7-aza)Trp) and 2,6-diazatryptophan ((2,6-aza)Trp) undergo excited-state water-catalyzed double and triple proton transfer, respectively, and are sensitive to the water network. The combination of their absorption, emission bands and the associated relaxation dynamics of these fluorescence probes, together with the Soret-band difference absorption and resonance Raman spectroscopy, lead us to unveil the water associated conformational mobility in the active site of APX. The results are suggestive of the existence of equilibrium between two different environments surrounding W41 in APX, i.e., the water-rich and water-scant forms with distinct fluorescence relaxation. Our results thus demonstrate for the first time the power of integrating multiple sensors (7-aza)Trp, (2,7-aza)Trp and (2,6-aza)Trp in probing the water environment of a specifically targeted Trp in proteins. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Unveiling the geography of historical patents in the United States from 1836 to 1975

    Science.gov (United States)

    Petralia, Sergio; Balland, Pierre-Alexandre; Rigby, David L.

    2016-01-01

    It is clear that technology is a key driver of economic growth. Much less clear is where new technologies are produced and how the geography of U.S. invention has changed over the last two hundred years. Patent data report the geography, history, and technological characteristics of invention. However, those data have only recently become available in digital form and at the present time there exists no comprehensive dataset on the geography of knowledge production in the United States prior to 1975. The database presented in this paper unveils the geography of historical patents granted by the United States Patent and Trademark Office (USPTO) from 1836 to 1975. This historical dataset, HistPat, is constructed using digitalized records of original patent documents that are publicly available. We describe a methodological procedure that allows recovery of geographical information on patents from the digital records. HistPat can be used in different disciplines ranging from geography, economics, history, network science, and science and technology studies. Additionally, it is easily merged with post-1975 USPTO digital patent data to extend it until today. PMID:27576103

  10. Unveiling the development of intracranial injury using dynamic brain EIT: an evaluation of current reconstruction algorithms.

    Science.gov (United States)

    Li, Haoting; Chen, Rongqing; Xu, Canhua; Liu, Benyuan; Tang, Mengxing; Yang, Lin; Dong, Xiuzhen; Fu, Feng

    2017-08-21

    Dynamic brain electrical impedance tomography (EIT) is a promising technique for continuously monitoring the development of cerebral injury. While there are many reconstruction algorithms available for brain EIT, there is still a lack of study to compare their performance in the context of dynamic brain monitoring. To address this problem, we develop a framework for evaluating different current algorithms with their ability to correctly identify small intracranial conductivity changes. Firstly, a simulation 3D head phantom with realistic layered structure and impedance distribution is developed. Next several reconstructing algorithms, such as back projection (BP), damped least-square (DLS), Bayesian, split Bregman (SB) and GREIT are introduced. We investigate their temporal response, noise performance, location and shape error with respect to different noise levels on the simulation phantom. The results show that the SB algorithm demonstrates superior performance in reducing image error. To further improve the location accuracy, we optimize SB by incorporating the brain structure-based conductivity distribution priors, in which differences of the conductivities between different brain tissues and the inhomogeneous conductivity distribution of the skull are considered. We compare this novel algorithm (called SB-IBCD) with SB and DLS using anatomically correct head shaped phantoms with spatial varying skull conductivity. Main results and Significance: The results showed that SB-IBCD is the most effective in unveiling small intracranial conductivity changes, where it can reduce the image error by an average of 30.0% compared to DLS.

  11. Lentiviral Delivery of Proteins for Genome Engineering.

    Science.gov (United States)

    Cai, Yujia; Mikkelsen, Jacob Giehm

    2016-01-01

    Viruses have evolved to traverse cellular barriers and travel to the nucleus by mechanisms that involve active transport through the cytoplasm and viral quirks to resist cellular restriction factors and innate immune responses. Virus-derived vector systems exploit the capacity of viruses to ferry genetic information into cells, and now - more than three decades after the discovery of HIV - lentiviral vectors based on HIV-1 have become instrumental in biomedical research and gene therapies that require genomic insertion of transgenes. By now, the efficacy of lentiviral gene delivery to stem cells, cells of the immune system including T cells, hepatic cells, and many other therapeutically relevant cell types is well established. Along with nucleic acids, HIV-1 virions carry the enzymatic tools that are essential for early steps of infection. Such capacity to package enzymes, even proteins of nonviral origin, has unveiled new ways of exploiting cellular intrusion of HIV-1. Based on early findings demonstrating the packaging of heterologous proteins into virus particles as part of the Gag and GagPol polypeptides, we have established lentiviral protein transduction for delivery of DNA transposases and designer nucleases. This strategy for delivering genome-engineering proteins facilitates high enzymatic activity within a short time frame and may potentially improve the safety of genome editing. Exploiting the full potential of lentiviral vectors, incorporation of foreign protein can be combined with the delivery of DNA transposons or a donor sequence for homology-directed repair in so-called 'all-in-one' lentiviral vectors. Here, we briefly describe intracellular restrictions that may affect lentiviral gene and protein delivery and review the current status of lentiviral particles as carriers of tool kits for genome engineering.

  12. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  13. Personal genomics services: whose genomes?

    Science.gov (United States)

    Gurwitz, David; Bregman-Eschet, Yael

    2009-07-01

    New companies offering personal whole-genome information services over the internet are dynamic and highly visible players in the personal genomics field. For fees currently ranging from US$399 to US$2500 and a vial of saliva, individuals can now purchase online access to their individual genetic information regarding susceptibility to a range of chronic diseases and phenotypic traits based on a genome-wide SNP scan. Most of the companies offering such services are based in the United States, but their clients may come from nearly anywhere in the world. Although the scientific validity, clinical utility and potential future implications of such services are being hotly debated, several ethical and regulatory questions related to direct-to-consumer (DTC) marketing strategies of genetic tests have not yet received sufficient attention. For example, how can we minimize the risk of unauthorized third parties from submitting other people's DNA for testing? Another pressing question concerns the ownership of (genotypic and phenotypic) information, as well as the unclear legal status of customers regarding their own personal information. Current legislation in the US and Europe falls short of providing clear answers to these questions. Until the regulation of personal genomics services catches up with the technology, we call upon commercial providers to self-regulate and coordinate their activities to minimize potential risks to individual privacy. We also point out some specific steps, along the trustee model, that providers of DTC personal genomics services as well as regulators and policy makers could consider for addressing some of the concerns raised below.

  14. Prospects for Genomic Research in Forestry

    Directory of Open Access Journals (Sweden)

    K. V. Krutovsky

    2014-08-01

    Full Text Available Conifers are keystone species of boreal forests. Their whole genome sequencing, assembly and annotation will allow us to understand the evolution of the complex ancient giant conifer genomes that are 4 times larger in larch and 7–9 times larger in pines than the human genome. Genomic studies will allow also to obtain important whole genome sequence data and develop highly polymorphic and informative genetic markers, such as microsatellites and single nucleotide polymorphisms (SNPs that can be efficiently used in timber origin identification, for genetic variation monitoring, to study local and climate change adaptation and in tree improvement and conservation programs.

  15. Value of a newly sequenced bacterial genome

    DEFF Research Database (Denmark)

    Barbosa, Eudes; Aburjaile, Flavia F; Ramos, Rommel Tj

    2014-01-01

    and annotation will not be undertaken. It is important to know what is lost when we settle for a draft genome and to determine the "scientific value" of a newly sequenced genome. This review addresses the expected impact of newly sequenced genomes on antibacterial discovery and vaccinology. Also, it discusses...... heightened expectations that NGS would boost antibacterial discovery and vaccine development. Although many possible drug and vaccine targets have been discovered, the success rate of genome-based analysis has remained below expectations. Furthermore, NGS has had consequences for genome quality, resulting...

  16. Cardiac troponin and tropomyosin: structural and cellular perspectives to unveil the Hypertrophic Cardiomyopathy phenotype

    Directory of Open Access Journals (Sweden)

    Mayra de A. Marques

    2016-09-01

    Full Text Available Inherited myopathies affect both skeletal and cardiac muscle and are commonly associated with genetic dysfunctions, leading to the production of anomalous proteins. In cardiomyopathies, mutations frequently occur in sarcomeric genes, but the cause-effect scenario between genetic alterations and pathological processes remains elusive. Hypertrophic cardiomyopathy (HCM was the first cardiac disease associated with a genetic background. Since the discovery of the first mutation in the β-myosin heavy chain, more than 1,400 new mutations in 11 sarcomeric genes have been reported, awarding HCM the title of the disease of the sarcomere. The most common macroscopic phenotypes are left ventricle and interventricular septal thickening, but because the clinical profile of this disease is quite heterogeneous, these phenotypes are not suitable for an accurate diagnosis. The development of genomic approaches for clinical investigation allows for diagnostic progress and understanding at the molecular level. Meanwhile, the lack of accurate in vivo models to better comprehend the cellular events triggered by this pathology has become a challenge. Notwithstanding, the imbalance of Ca2+ concentrations, altered signaling pathways, induction of apoptotic factors, and heart remodeling leading to abnormal anatomy have already been reported. Of note, a misbalance of signaling biomolecules, such as kinases and tumor suppressors (e.g., Akt and p53, seems to participate in apoptotic and fibrotic events. In HCM, structural and cellular information about defective sarcomeric proteins and their altered interactome is emerging but still represents a bottleneck for developing new concepts in basic research and for future therapeutic interventions. This review focuses on the structural and cellular alterations triggered by HCM-causing mutations in troponin and tropomyosin proteins and how structural biology can aid in the discovery of new platforms for therapeutics. We

  17. Visualization for genomics: the Microbial Genome Viewer.

    NARCIS (Netherlands)

    Kerkhoven, R.; Enckevort, F.H.J. van; Boekhorst, J.; Molenaar, D; Siezen, R.J.

    2004-01-01

    SUMMARY: A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a

  18. The Perennial Ryegrass GenomeZipper: Targeted Use of Genome Resources for Comparative Grass Genomics1[C][W

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F.X.; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-01-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species. PMID:23184232

  19. Genome projects and the functional-genomic era.

    Science.gov (United States)

    Sauer, Sascha; Konthur, Zoltán; Lehrach, Hans

    2005-12-01

    The problems we face today in public health as a result of the -- fortunately -- increasing age of people and the requirements of developing countries create an urgent need for new and innovative approaches in medicine and in agronomics. Genomic and functional genomic approaches have a great potential to at least partially solve these problems in the future. Important progress has been made by procedures to decode genomic information of humans, but also of other key organisms. The basic comprehension of genomic information (and its transfer) should now give us the possibility to pursue the next important step in life science eventually leading to a basic understanding of biological information flow; the elucidation of the function of all genes and correlative products encoded in the genome, as well as the discovery of their interactions in a molecular context and the response to environmental factors. As a result of the sequencing projects, we are now able to ask important questions about sequence variation and can start to comprehensively study the function of expressed genes on different levels such as RNA, protein or the cell in a systematic context including underlying networks. In this article we review and comment on current trends in large-scale systematic biological research. A particular emphasis is put on technology developments that can provide means to accomplish the tasks of future lines of functional genomics.

  20. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  1. Searching for genomic constraints

    Energy Technology Data Exchange (ETDEWEB)

    Lio` , P [Cambridge, Univ. (United Kingdom). Genetics Dept.; Ruffo, S [Florence, Univ. (Italy). Fac. di Ingegneria. Dipt. di Energetica ` S. Stecco`

    1998-01-01

    The authors have analyzed general properties of very long DNA sequences belonging to simple and complex organisms, by using different correlation methods. They have distinguished those base compositional rules that concern the entire genome which they call `genomic constraints` from the rules that depend on the `external natural selection` acting on single genes, i. e. protein-centered constraints. They show that G + C content, purine / pyrimidine distributions and biological complexity of the organism are the most important factors which determine base compositional rules and genome complexity. Three main facts are here reported: bacteria with high G + C content have more restrictions on base composition than those with low G + C content; at constant G + C content more complex organisms, ranging from prokaryotes to higher eukaryotes (e.g. human) display an increase of repeats 10-20 nucleotides long, which are also partly responsible for long-range correlations; work selection of length 3 to 10 is stronger in human and in bacteria for two distinct reasons. With respect to previous studies, they have also compared the genomic sequence of the archeon Methanococcus jannaschii with those of bacteria and eukaryotes: it shows sometimes an intermediate statistical behaviour.

  2. Searching for genomic constraints

    International Nuclear Information System (INIS)

    Lio', P.; Ruffo, S.

    1998-01-01

    The authors have analyzed general properties of very long DNA sequences belonging to simple and complex organisms, by using different correlation methods. They have distinguished those base compositional rules that concern the entire genome which they call 'genomic constraints' from the rules that depend on the 'external natural selection' acting on single genes, i. e. protein-centered constraints. They show that G + C content, purine / pyrimidine distributions and biological complexity of the organism are the most important factors which determine base compositional rules and genome complexity. Three main facts are here reported: bacteria with high G + C content have more restrictions on base composition than those with low G + C content; at constant G + C content more complex organisms, ranging from prokaryotes to higher eukaryotes (e.g. human) display an increase of repeats 10-20 nucleotides long, which are also partly responsible for long-range correlations; work selection of length 3 to 10 is stronger in human and in bacteria for two distinct reasons. With respect to previous studies, they have also compared the genomic sequence of the archeon Methanococcus jannaschii with those of bacteria and eukaryotes: it shows sometimes an intermediate statistical behaviour

  3. Genomic diversity of Lactobacillus salivarius

    OpenAIRE

    Raftis, Emma J.

    2015-01-01

    Lactobacillus salivarius is unusual among the lactobacilli due to its multireplicon genome architecture. The circular megaplasmids harboured by L. salivarius strains encode strain-specific traits for intestinal survival and probiotic activity. L. salivarius strains are increasingly being exploited for their probiotic properties in humans and animals. In terms of probiotic strain selection, it is important to have an understanding of the level of genomic diversity present in this species. Comp...

  4. [Ethical considerations in genomic cohort study].

    Science.gov (United States)

    Choi, Eun Kyung; Kim, Ock-Joo

    2007-03-01

    During the last decade, genomic cohort study has been developed in many countries by linking health data and genetic data in stored samples. Genomic cohort study is expected to find key genetic components that contribute to common diseases, thereby promising great advance in genome medicine. While many countries endeavor to build biobank systems, biobank-based genome research has raised important ethical concerns including genetic privacy, confidentiality, discrimination, and informed consent. Informed consent for biobank poses an important question: whether true informed consent is possible in population-based genomic cohort research where the nature of future studies is unforeseeable when consent is obtained. Due to the sensitive character of genetic information, protecting privacy and keeping confidentiality become important topics. To minimize ethical problems and achieve scientific goals to its maximum degree, each country strives to build population-based genomic cohort research project, by organizing public consultation, trying public and expert consensus in research, and providing safeguards to protect privacy and confidentiality.

  5. Wukong Sharpens Its Eyes and Unveils the Nature of Dark Matter

    Science.gov (United States)

    Cong, Kun-Lin

    2016-07-01

    Dark matter does not emit light or reflect electromagnetic radiation, but its existence can be inferred from the effects of measurements such as gravity and mass. Unveiling the nature of dark matter is one of the biggest mysteries of modern science. Exploration of dark matter could give scientists a clearer understanding of the past and future of galaxies and the universe. Chinese scientists have been engaged actively in dark matter research in recent years, and made some significant achievements in theoretical studies, numerical simulations, and experimental investigation. The Dark Matter Particles Explorer Satellite (DAMPE) was launched by LM launch vehicle on 17th December 2015. It was constructed as a scientific satellite that has four major parts - a plastic scintillator array detector, a silicon array detector, a BGO calorimeter and a neutron detector - together comprising about 76,000 minor detectors. The main scientific purpose of DAMPE is to investigate dark matter particle from deep space, via high resolution observation of gamma-rays and electrons spectra, and its space distribution. It will also help scientists study the transportation and acceleration of cosmic rays in the galaxy by measuring the energy spectra of heavy ions. DAMPE was dubbed Wukong after the Monkey King character from the Chinese classic legend Journey to the West. "Wu" means becoming aware of through the senses, and "Kong" refers to the space. The figurative meaning of "Wukong" is to know and comprehend the nature of the space. DAMPE is the most sensitive and accurate detectors designed for dark matter with the highest performance among the similar explorers. It will find the evidence that can certify the existence of dark matter.

  6. Unveiled Risks in a Telecoupled Arena Dependent on Agricultural Commodity Trade

    Science.gov (United States)

    Batistella, M.; Silva, R. F. B. D.; Liu, J.; Moran, E. F.; Torres, S.; Dou, Y.

    2017-12-01

    In less than five years, a new field of interdisciplinary research has been widely developed within the coupled human-natural systems (CHANS) community. Based on well-known concepts acting over long distances, such as teleconnections for biophysical sciences and globalization for human sciences, the telecoupling framework states that long distant CHANS may be integrated through flows of capital, information, and matter, shaping environmental and socioeconomic changes within local systems. An international project including researchers from Brazil, China, United Kingdom (UK), and United States of America (USA) is using such a framework to study the flows of agricultural commodities between sending systems such as Brazil and the USA, and receiving systems such as China with soybean trade as a case in point. Many findings have already shown that these dynamics are intrinsically connected and changes in environmental conditions in one system may affect economic conditions in other systems. In the case of the double-crop practice (i.e., soybean followed by maize, two crops year round) used in some regions of Brazil, maize production is strongly connected with soybean production through the supply chain, logistics, producer regions, and farmers. Consequently, maize has been displaced to second-crop status, making it more vulnerable to rain shortfalls. The use of the telecoupling framework has also unveiled a possible threat for soybean production in the long run if it only relies on international demand and inputs. The telecoupled soybean production system has put some Brazilian farmers at economic risk, and is pushing them towards diversification and alternative production practices (e.g., non-GMO crops, biological control, in-farm seed production) to reduce their risk. This, in turn, may affect the demand-consumption relationship among traditional trading partners. With this paper, we also highlight the role of cascading effects and spillover systems of telecoupling in

  7. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  8. Ancient genomics

    DEFF Research Database (Denmark)

    Der Sarkissian, Clio; Allentoft, Morten Erik; Avila Arcos, Maria del Carmen

    2015-01-01

    throughput of next generation sequencing platforms and the ability to target short and degraded DNA molecules. Many ancient specimens previously unsuitable for DNA analyses because of extensive degradation can now successfully be used as source materials. Additionally, the analytical power obtained...... by increasing the number of sequence reads to billions effectively means that contamination issues that have haunted aDNA research for decades, particularly in human studies, can now be efficiently and confidently quantified. At present, whole genomes have been sequenced from ancient anatomically modern humans...

  9. Marine genomics

    DEFF Research Database (Denmark)

    Oliveira Ribeiro, Ângela Maria; Foote, Andrew David; Kupczok, Anne

    2017-01-01

    Marine ecosystems occupy 71% of the surface of our planet, yet we know little about their diversity. Although the inventory of species is continually increasing, as registered by the Census of Marine Life program, only about 10% of the estimated two million marine species are known. This lag......-throughput sequencing approaches have been helping to improve our knowledge of marine biodiversity, from the rich microbial biota that forms the base of the tree of life to a wealth of plant and animal species. In this review, we present an overview of the applications of genomics to the study of marine life, from...

  10. The life cycle of a genome project: perspectives and guidelines inspired by insect genome projects.

    Science.gov (United States)

    Papanicolaou, Alexie

    2016-01-01

    Many research programs on non-model species biology have been empowered by genomics. In turn, genomics is underpinned by a reference sequence and ancillary information created by so-called "genome projects". The most reliable genome projects are the ones created as part of an active research program and designed to address specific questions but their life extends past publication. In this opinion paper I outline four key insights that have facilitated maintaining genomic communities: the key role of computational capability, the iterative process of building genomic resources, the value of community participation and the importance of manual curation. Taken together, these ideas can and do ensure the longevity of genome projects and the growing non-model species community can use them to focus a discussion with regards to its future genomic infrastructure.

  11. Importance of intrapreneurial practices prevalent among secondary school teachers in Kalungu District (Uganda

    Directory of Open Access Journals (Sweden)

    Genza Musoke Gyaviira

    2016-02-01

    Full Text Available The study examines teachers' business initiatives within school (intrapreneurial ventures and highlights the economic and educational importance of these initiatives. It first unveils the prevalence of different intrapreneurial ventures among teachers, before going on to state the meaning of these practices for both the economic and professional welfare of teachers in particular, and schools in general. The study concludes with several conclusions for the development of education on the African continent.

  12. A perspective on the importance of oceanic fronts in promoting aggregation of visitors to seamounts

    OpenAIRE

    Morato, T; Miller, PI; Dunn, DC; Nicol, SJ; Bowcott, J; Halpin, PN

    2016-01-01

    Recent evidence has demonstrated that not all seamounts are areas where productivity, biomass and biodiversity of marine life thrive. Therefore, understanding the drivers and mechanisms underlying seamount productivity is a major challenge in today's seamount research. Incorporating oceanographic data in future analyses has been suggested to be of paramount importance to unveil many of the seamount ecology paradigms. Persistent hydrographic features, such as oceanic fronts, have been recogniz...

  13. PGSB/MIPS Plant Genome Information Resources and Concepts for the Analysis of Complex Grass Genomes.

    Science.gov (United States)

    Spannagl, Manuel; Bader, Kai; Pfeifer, Matthias; Nussbaumer, Thomas; Mayer, Klaus F X

    2016-01-01

    PGSB (Plant Genome and Systems Biology; formerly MIPS-Munich Institute for Protein Sequences) has been involved in developing, implementing and maintaining plant genome databases for more than a decade. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable datasets for model plant genomes as a backbone against which experimental data, e.g., from high-throughput functional genomics, can be organized and analyzed. In addition, genomes from both model and crop plants form a scaffold for comparative genomics, assisted by specialized tools such as the CrowsNest viewer to explore conserved gene order (synteny) between related species on macro- and micro-levels.The genomes of many economically important Triticeae plants such as wheat, barley, and rye present a great challenge for sequence assembly and bioinformatic analysis due to their enormous complexity and large genome size. Novel concepts and strategies have been developed to deal with these difficulties and have been applied to the genomes of wheat, barley, rye, and other cereals. This includes the GenomeZipper concept, reference-guided exome assembly, and "chromosome genomics" based on flow cytometry sorted chromosomes.

  14. Insights into Conifer Giga-Genomes1

    Science.gov (United States)

    De La Torre, Amanda R.; Birol, Inanc; Bousquet, Jean; Ingvarsson, Pär K.; Jansson, Stefan; Jones, Steven J.M.; Keeling, Christopher I.; MacKay, John; Nilsson, Ove; Ritland, Kermit; Street, Nathaniel; Yanchuk, Alvin; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    Insights from sequenced genomes of major land plant lineages have advanced research in almost every aspect of plant biology. Until recently, however, assembled genome sequences of gymnosperms have been missing from this picture. Conifers of the pine family (Pinaceae) are a group of gymnosperms that dominate large parts of the world’s forests. Despite their ecological and economic importance, conifers seemed long out of reach for complete genome sequencing, due in part to their enormous genome size (20–30 Gb) and the highly repetitive nature of their genomes. Technological advances in genome sequencing and assembly enabled the recent publication of three conifer genomes: white spruce (Picea glauca), Norway spruce (Picea abies), and loblolly pine (Pinus taeda). These genome sequences revealed distinctive features compared with other plant genomes and may represent a window into the past of seed plant genomes. This Update highlights recent advances, remaining challenges, and opportunities in light of the publication of the first conifer and gymnosperm genomes. PMID:25349325

  15. Genome Improvement at JGI-HAGSC

    Energy Technology Data Exchange (ETDEWEB)

    Grimwood, Jane; Schmutz, Jeremy J.; Myers, Richard M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the Joint Genome Institute (JGI) has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  16. Genomic Diversity and Evolution of the Lyssaviruses

    Science.gov (United States)

    Delmas, Olivier; Holmes, Edward C.; Talbi, Chiraz; Larrous, Florence; Dacheux, Laurent; Bouchier, Christiane; Bourhy, Hervé

    2008-01-01

    Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as ‘Lagos Bat’. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses. PMID:18446239

  17. Genomic diversity and evolution of the lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Olivier Delmas

    2008-04-01

    Full Text Available Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as 'Lagos Bat'. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses.

  18. Gain-of-function mutagenesis approaches in rice for functional genomics and improvement of crop productivity.

    Science.gov (United States)

    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Kirti, P B

    2017-07-01

    The epitome of any genome research is to identify all the existing genes in a genome and investigate their roles. Various techniques have been applied to unveil the functions either by silencing or over-expressing the genes by targeted expression or random mutagenesis. Rice is the most appropriate model crop for generating a mutant resource for functional genomic studies because of the availability of high-quality genome sequence and relatively smaller genome size. Rice has syntenic relationships with members of other cereals. Hence, characterization of functionally unknown genes in rice will possibly provide key genetic insights and can lead to comparative genomics involving other cereals. The current review attempts to discuss the available gain-of-function mutagenesis techniques for functional genomics, emphasizing the contemporary approach, activation tagging and alterations to this method for the enhancement of yield and productivity of rice. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. De novo assembly of a haplotype-resolved human genome.

    Science.gov (United States)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  20. Unveiling the UHE Universe from space: the JEM-EUSO mission

    Energy Technology Data Exchange (ETDEWEB)

    Santangelo, A.; Fenu, F. [Institute of Astronomy and Astrophysics, Kepler Center for Astro and Particle Physics, Eberhard-Karls-Universitaet, Sand 1, 72076, Tuebingen (Germany); RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako 351-0198 (Japan); Ebisuzaki, T.; Shinozaki, K. [RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako 351-0198 (Japan)

    2011-03-15

    The Extreme Universe Space Observatory onboard the Japanese Experiment Module (JEM-EUSO) is an international mission designed to explore the origin and nature of the of ultra high-energy cosmic rays (UHECR), with energies E>5.5x10{sup 19} eV, aiming at an integrated exposure of {approx}10{sup 6} km{sup 2} sr yr at E>10{sup 20} eV. Consisting of a near-UV 2.65 m diameter telescope with a field of view of 60{sup o}, JEM-EUSO looks down from space, monitoring the dark side of the Earth, to detect the fluorescence and Cherenkov light emitted along the linear track generated by a cosmic particle traversing the atmosphere. The energy and the arrival direction of each particle will be measured while the all 4{pi} sky is monitored. The primary science goal of the mission is to identify the sources of the highest energy particles, and to measure their flux and spectrum, to unveil the mechanisms for the production, acceleration, and in situ propagation of these extreme particles. Other exploratory objectives of the mission include the study of the galactic and local extragalactic magnetic field; the detection of high-energy gamma rays and neutrinos, and tests of relativity and quantum gravity effects at extreme energies. Other aspects of fundamental physics that will be studied include the top-down models and the behavior of the neutrino cross sections at extreme energies. JEM-EUSO is also expected to conduct a systematic survey of the not yet well known energetic phenomena of the Earth's atmosphere. The mission is currently in the phase A study by JAXA and has been included in the ELIPS research pool of the European Space Agency. JEM-EUSO will be launched by an H2B rocket in the Japanese fiscal year 2016 and will be transferred to the ISS by an H2 Transfer Vehicle (HTV). It will be attached to the external experiment platform of the Japanese 'KIBO' module of the ISS. In this paper we summarize the science case, the science objectives, the technological and

  1. Ensembl Genomes 2016: more genomes, more complexity.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Armean, Irina; Boddu, Sanjay; Bolt, Bruce J; Carvalho-Silva, Denise; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Aranganathan, Naveen K; Langridge, Nicholas; Lowy, Ernesto; McDowall, Mark D; Maheswari, Uma; Nuhn, Michael; Ong, Chuang Kee; Overduin, Bert; Paulini, Michael; Pedro, Helder; Perry, Emily; Spudich, Giulietta; Tapanari, Electra; Walts, Brandon; Williams, Gareth; Tello-Ruiz, Marcela; Stein, Joshua; Wei, Sharon; Ware, Doreen; Bolser, Daniel M; Howe, Kevin L; Kulesha, Eugene; Lawson, Daniel; Maslen, Gareth; Staines, Daniel M

    2016-01-04

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species, complementing the resources for vertebrate genomics developed in the context of the Ensembl project (http://www.ensembl.org). Together, the two resources provide a consistent set of programmatic and interactive interfaces to a rich range of data including reference sequence, gene models, transcriptional data, genetic variation and comparative analysis. This paper provides an update to the previous publications about the resource, with a focus on recent developments. These include the development of new analyses and views to represent polyploid genomes (of which bread wheat is the primary exemplar); and the continued up-scaling of the resource, which now includes over 23 000 bacterial genomes, 400 fungal genomes and 100 protist genomes, in addition to 55 genomes from invertebrate metazoa and 39 genomes from plants. This dramatic increase in the number of included genomes is one part of a broader effort to automate the integration of archival data (genome sequence, but also associated RNA sequence data and variant calls) within the context of reference genomes and make it available through the Ensembl user interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Rodent malaria parasites : genome organization & comparative genomics

    NARCIS (Netherlands)

    Kooij, Taco W.A.

    2006-01-01

    The aim of the studies described in this thesis was to investigate the genome organization of rodent malaria parasites (RMPs) and compare the organization and gene content of the genomes of RMPs and the human malaria parasite P. falciparum. The release of the complete genome sequence of P.

  3. Current development and application of soybean genomics

    Institute of Scientific and Technical Information of China (English)

    Lingli HE; Jing ZHAO; Man ZHAO; Chaoying HE

    2011-01-01

    Soybean (Glycine max),an important domesticated species originated in China,constitutes a major source of edible oils and high-quality plant proteins worldwide.In spite of its complex genome as a consequence of an ancient tetraploidilization,platforms for map-based genomics,sequence-based genomics,comparative genomics and functional genomics have been well developed in the last decade,thus rich repertoires of genomic tools and resources are available,which have been influencing the soybean genetic improvement.Here we mainly review the progresses of soybean (including its wild relative Glycine soja) genomics and its impetus for soybean breeding,and raise the major biological questions needing to be addressed.Genetic maps,physical maps,QTL and EST mapping have been so well achieved that the marker assisted selection and positional cloning in soybean is feasible and even routine.Whole genome sequencing and transcriptomic analyses provide a large collection of molecular markers and predicted genes,which are instrumental to comparative genomics and functional genomics.Comparative genomics has started to reveal the evolution of soybean genome and the molecular basis of soybean domestication process.Microarrays resources,mutagenesis and efficient transformation systems become essential components of soybean functional genomics.Furthermore,phenotypic functional genomics via both forward and reverse genetic approaches has inferred functions of many genes involved in plant and seed development,in response to abiotic stresses,functioning in plant-pathogenic microbe interactions,and controlling the oil and protein content of seed.These achievements have paved the way for generation of transgenic or genetically modified (GM) soybean crops.

  4. Unveiling topographical changes using LiDAR mapping capability: case study of Belaga in Sarawak, East-Malaysia

    Science.gov (United States)

    Ganendra, T. R.; Khan, N. M.; Razak, W. J.; Kouame, Y.; Mobarakeh, E. T.

    2016-06-01

    The use of Light Detection and Ranging (LiDAR) remote sensing technology to scan and map landscapes has proven to be one of the most popular techniques to accurately map topography. Thus, LiDAR technology is the ultimate method of unveiling the surface feature under dense vegetation, and, this paper intends to emphasize the diverse techniques that can be utilized to elucidate topographical changes over the study area, using multi-temporal airborne full waveform LiDAR datasets collected in 2012 and 2014. Full waveform LiDAR data offers access to an almost unlimited number of returns per shot, which enables the user to explore in detail topographical changes, such as vegetation growth measurement. The study also found out topography changes at the study area due to earthwork activities contributing to soil consolidation, soil erosion and runoff, requiring cautious monitoring. The implications of this study not only concurs with numerous investigations undertaken by prominent researchers to improve decision making, but also corroborates once again that investigations employing multi-temporal LiDAR data to unveil topography changes in vegetated terrains, produce more detailed and accurate results than most other remote sensing data.

  5. Dilemmas in the (un)veiling of the diagnosis of Alzheimer's disease: walking an ethical and professional tight rope.

    Science.gov (United States)

    Karnieli-Miller, Orit; Werner, Perla; Aharon-Peretz, Judith; Eidelman, Shmuel

    2007-08-01

    To enhance the understanding and effect of physician's difficulties, attitudes and communication styles on the disclosure of the diagnosis of AD in practice. Qualitative, phenomenological study, combining pre-encounter interviews with physicians, observations of actual encounters of diagnosis disclosure of AD, and post-encounter interviews. There were various ways or tactics to (un)veil the bad news that may be perceived as different ways of dulling the impact and avoiding full and therefore problematic statements. In the actual encounters this was accomplished by keeping encounters short, avoiding elaboration, confirmation of comprehension and explicit terminology and using fractured sentences. The present study's findings highlight the difficulties encountered in breaking the news about AD, in the way it is actually done, and the problems that may arise from this way of un/veiling the news. The main problem is that the reluctance to make a candid disclosure of the diagnosis as was demonstrated in this study may violate basic moral and legal rights and may also deprive patients and caregivers of some of the benefits of early disclosure of diagnosis. There is a need for assisting physicians to cope with their personal difficulties, problems and pitfalls in breaking the news.

  6. Reference-quality genome sequence of Aegilops tauschii, the source of wheat D genome, shows that recombination shapes genome structure and evolution

    Science.gov (United States)

    Aegilops tauschii is the diploid progenitor of the D genome of hexaploid wheat and an important genetic resource for wheat. A reference-quality sequence for the Ae. tauschii genome was produced with a combination of ordered-clone sequencing, whole-genome shotgun sequencing, and BioNano optical geno...

  7. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  8. GI-POP: a combinational annotation and genomic island prediction pipeline for ongoing microbial genome projects.

    Science.gov (United States)

    Lee, Chi-Ching; Chen, Yi-Ping Phoebe; Yao, Tzu-Jung; Ma, Cheng-Yu; Lo, Wei-Cheng; Lyu, Ping-Chiang; Tang, Chuan Yi

    2013-04-10

    Sequencing of microbial genomes is important because of microbial-carrying antibiotic and pathogenetic activities. However, even with the help of new assembling software, finishing a whole genome is a time-consuming task. In most bacteria, pathogenetic or antibiotic genes are carried in genomic islands. Therefore, a quick genomic island (GI) prediction method is useful for ongoing sequencing genomes. In this work, we built a Web server called GI-POP (http://gipop.life.nthu.edu.tw) which integrates a sequence assembling tool, a functional annotation pipeline, and a high-performance GI predicting module, in a support vector machine (SVM)-based method called genomic island genomic profile scanning (GI-GPS). The draft genomes of the ongoing genome projects in contigs or scaffolds can be submitted to our Web server, and it provides the functional annotation and highly probable GI-predicting results. GI-POP is a comprehensive annotation Web server designed for ongoing genome project analysis. Researchers can perform annotation and obtain pre-analytic information include possible GIs, coding/non-coding sequences and functional analysis from their draft genomes. This pre-analytic system can provide useful information for finishing a genome sequencing project. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. The eastern oyster genome: A resource for comparative genomics in shellfish aquaculture species

    Science.gov (United States)

    Oyster aquaculture is an important sector of world food production. As such, it is imperative to develop a high quality reference genome for the eastern oyster, Crassostrea virginica, to assist in the elucidation of the genomic basis of commercially important traits. All genetic, gene expression and...

  10. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  11. The dynamic genome of Hydra

    Science.gov (United States)

    Chapman, Jarrod A.; Kirkness, Ewen F.; Simakov, Oleg; Hampson, Steven E.; Mitros, Therese; Weinmaier, Therese; Rattei, Thomas; Balasubramanian, Prakash G.; Borman, Jon; Busam, Dana; Disbennett, Kathryn; Pfannkoch, Cynthia; Sumin, Nadezhda; Sutton, Granger G.; Viswanathan, Lakshmi Devi; Walenz, Brian; Goodstein, David M.; Hellsten, Uffe; Kawashima, Takeshi; Prochnik, Simon E.; Putnam, Nicholas H.; Shu, Shengquiang; Blumberg, Bruce; Dana, Catherine E.; Gee, Lydia; Kibler, Dennis F.; Law, Lee; Lindgens, Dirk; Martinez, Daniel E.; Peng, Jisong; Wigge, Philip A.; Bertulat, Bianca; Guder, Corina; Nakamura, Yukio; Ozbek, Suat; Watanabe, Hiroshi; Khalturin, Konstantin; Hemmrich, Georg; Franke, André; Augustin, René; Fraune, Sebastian; Hayakawa, Eisuke; Hayakawa, Shiho; Hirose, Mamiko; Hwang, Jung Shan; Ikeo, Kazuho; Nishimiya-Fujisawa, Chiemi; Ogura, Atshushi; Takahashi, Toshio; Steinmetz, Patrick R. H.; Zhang, Xiaoming; Aufschnaiter, Roland; Eder, Marie-Kristin; Gorny, Anne-Kathrin; Salvenmoser, Willi; Heimberg, Alysha M.; Wheeler, Benjamin M.; Peterson, Kevin J.; Böttger, Angelika; Tischler, Patrick; Wolf, Alexander; Gojobori, Takashi; Remington, Karin A.; Strausberg, Robert L.; Venter, J. Craig; Technau, Ulrich; Hobmayer, Bert; Bosch, Thomas C. G.; Holstein, Thomas W.; Fujisawa, Toshitaka; Bode, Hans R.; David, Charles N.; Rokhsar, Daniel S.; Steele, Robert E.

    2015-01-01

    The freshwater cnidarian Hydra was first described in 17021 and has been the object of study for 300 years. Experimental studies of Hydra between 1736 and 1744 culminated in the discovery of asexual reproduction of an animal by budding, the first description of regeneration in an animal, and successful transplantation of tissue between animals2. Today, Hydra is an important model for studies of axial patterning3, stem cell biology4 and regeneration5. Here we report the genome of Hydra magnipapillata and compare it to the genomes of the anthozoan Nematostella vectensis6 and other animals. The Hydra genome has been shaped by bursts of transposable element expansion, horizontal gene transfer, trans-splicing, and simplification of gene structure and gene content that parallel simplification of the Hydra life cycle. We also report the sequence of the genome of a novel bacterium stably associated with H. magnipapillata. Comparisons of the Hydra genome to the genomes of other animals shed light on the evolution of epithelia, contractile tissues, developmentally regulated transcription factors, the Spemann–Mangold organizer, pluripotency genes and the neuromuscular junction. PMID:20228792

  12. Funding Opportunity: Genomic Data Centers

    Science.gov (United States)

    Funding Opportunity CCG, Funding Opportunity Center for Cancer Genomics, CCG, Center for Cancer Genomics, CCG RFA, Center for cancer genomics rfa, genomic data analysis network, genomic data analysis network centers,

  13. Genome sequence of Lactobacillus rhamnosus ATCC 8530.

    Science.gov (United States)

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R; Ziola, Barry

    2012-02-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  14. Genome Sequence of Lactobacillus rhamnosus ATCC 8530

    OpenAIRE

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R.; Ziola, Barry

    2012-01-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  15. Comparison of 61 Sequenced Escherichia coli Genomes

    DEFF Research Database (Denmark)

    Lukjancenko, Oksana; Wassenaar, T. M.; Ussery, David

    2010-01-01

    Escherichia coli is an important component of the biosphere and is an ideal model for studies of processes involved in bacterial genome evolution. Sixty-one publically available E. coli and Shigella spp. sequenced genomes are compared, using basic methods to produce phylogenetic and proteomics...

  16. GENOME ANALYSIS OF BURKHOLDERIA CEPACIA AC1100

    Science.gov (United States)

    Burkholderia cepacia is an important organism in bioremediation of environmental pollutants and it is also of increasing interest as a human pathogen. The genomic organization of B. cepacia is being studied in order to better understand its unusual adaptive capacity and genome pl...

  17. Initiating genomic selection in tetraploid potato

    DEFF Research Database (Denmark)

    Sverrisdóttir, Elsa; Janss, Luc; Byrne, Stephen

    Breeding for more space and resource efficient crops is important to feed the world’s increasing population. Potatoes produce approximately twice the amount of calories per hectare compared to cereals. The traditional “mate and phenotype” breeding approach is costly and time-consuming; however......, the completion of the genome sequence of potato has enabled the application of genomics-assisted breeding technologies. Genomic selection using genome-wide molecular markers is becoming increasingly applicable to crops as the genotyping costs continue to reduce and it is thus an attractive breeding alternative...... selection, can be obtained with good prediction accuracies in tetraploid potato....

  18. Genomic instability and radiation effects

    International Nuclear Information System (INIS)

    Christian Streffer

    2007-01-01

    malformations) develop by going through several mutation steps, an increase of genomic instability can have the consequence that the probability for the necessary mutation steps after the initiation processes will be enhanced and facilitated. In this connection it is of high interest that genomic instability is increased in several human populations who have developed or will develop a cancer with/or without radiation. The genomic instability was studied in peripheral lymphocytes of these patients. Such an effect has been found in patients with head and neck cancers before treatment. It has been observed in uranium miners and patients with Morbus Hodgkin who developed secondary cancers after exposures. The implications of these phenomena for low dose radiation seem to be important.

  19. Genome Evolution of Plant-Parasitic Nematodes.

    Science.gov (United States)

    Kikuchi, Taisei; Eves-van den Akker, Sebastian; Jones, John T

    2017-08-04

    Plant parasitism has evolved independently on at least four separate occasions in the phylum Nematoda. The application of next-generation sequencing (NGS) to plant-parasitic nematodes has allowed a wide range of genome- or transcriptome-level comparisons, and these have identified genome adaptations that enable parasitism of plants. Current genome data suggest that horizontal gene transfer, gene family expansions, evolution of new genes that mediate interactions with the host, and parasitism-specific gene regulation are important adaptations that allow nematodes to parasitize plants. Sequencing of a larger number of nematode genomes, including plant parasites that show different modes of parasitism or that have evolved in currently unsampled clades, and using free-living taxa as comparators would allow more detailed analysis and a better understanding of the organization of key genes within the genomes. This would facilitate a more complete understanding of the way in which parasitism has shaped the genomes of plant-parasitic nematodes.

  20. Extreme-Scale De Novo Genome Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Georganas, Evangelos [Intel Corporation, Santa Clara, CA (United States); Hofmeyr, Steven [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint Genome Inst.; Egan, Rob [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Computational Research Division; Buluc, Aydin [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint Genome Inst.; Oliker, Leonid [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint Genome Inst.; Rokhsar, Daniel [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Computational Research Division; Yelick, Katherine [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint Genome Inst.

    2017-09-26

    De novo whole genome assembly reconstructs genomic sequence from short, overlapping, and potentially erroneous DNA segments and is one of the most important computations in modern genomics. This work presents HipMER, a high-quality end-to-end de novo assembler designed for extreme scale analysis, via efficient parallelization of the Meraculous code. Genome assembly software has many components, each of which stresses different components of a computer system. This chapter explains the computational challenges involved in each step of the HipMer pipeline, the key distributed data structures, and communication costs in detail. We present performance results of assembling the human genome and the large hexaploid wheat genome on large supercomputers up to tens of thousands of cores.

  1. The genome of Chenopodium quinoa

    KAUST Repository

    Jarvis, David Erwin; Ho, Yung Shwen; Lightfoot, Damien; Schmö ckel, Sandra M.; Li, Bo; Borm, Theo J. A.; Ohyanagi, Hajime; Mineta, Katsuhiko; Michell, Craig; Saber, Noha; Kharbatia, Najeh M.; Rupper, Ryan R.; Sharp, Aaron R.; Dally, Nadine; Boughton, Berin A.; Woo, Yong; Gao, Ge; Schijlen, Elio G. W. M.; Guo, Xiujie; Momin, Afaque Ahmad Imtiyaz; Negrã o, Só nia; Al-Babili, Salim; Gehring, Christoph A; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T.; Gojobori, Takashi; Linden, C. Gerard van der; Loo, Eibertus N. van; Jellen, Eric N.; Maughan, Peter J.; Tester, Mark A.

    2017-01-01

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  2. The genome of Chenopodium quinoa

    KAUST Repository

    Jarvis, David Erwin

    2017-02-08

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  3. The genome of Chenopodium quinoa.

    Science.gov (United States)

    Jarvis, David E; Ho, Yung Shwen; Lightfoot, Damien J; Schmöckel, Sandra M; Li, Bo; Borm, Theo J A; Ohyanagi, Hajime; Mineta, Katsuhiko; Michell, Craig T; Saber, Noha; Kharbatia, Najeh M; Rupper, Ryan R; Sharp, Aaron R; Dally, Nadine; Boughton, Berin A; Woo, Yong H; Gao, Ge; Schijlen, Elio G W M; Guo, Xiujie; Momin, Afaque A; Negrão, Sónia; Al-Babili, Salim; Gehring, Christoph; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T; Gojobori, Takashi; Linden, C Gerard van der; van Loo, Eibertus N; Jellen, Eric N; Maughan, Peter J; Tester, Mark

    2017-02-16

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  4. Genomics With Cloud Computing

    OpenAIRE

    Sukhamrit Kaur; Sandeep Kaur

    2015-01-01

    Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computin...

  5. Genome plasticity and systems evolution in Streptomyces

    Science.gov (United States)

    2012-01-01

    Background Streptomycetes are filamentous soil-dwelling bacteria. They are best known as the producers of a great variety of natural products such as antibiotics, antifungals, antiparasitics, and anticancer agents and the decomposers of organic substances for carbon recycling. They are also model organisms for the studies of gene regulatory networks, morphological differentiation, and stress response. The availability of sets of genomes from closely related Streptomyces strains makes it possible to assess the mechanisms underlying genome plasticity and systems adaptation. Results We present the results of a comprehensive analysis of the genomes of five Streptomyces species with distinct phenotypes. These streptomycetes have a pan-genome comprised of 17,362 orthologous families which includes 3,096 components in the core genome, 5,066 components in the dispensable genome, and 9,200 components that are uniquely present in only one species. The core genome makes up about 33%-45% of each genome repertoire. It contains important genes for Streptomyces biology including those involved in gene regulation, secretion, secondary metabolism and morphological differentiation. Abundant duplicate genes have been identified, with 4%-11% of the whole genomes composed of lineage-specific expansions (LSEs), suggesting that frequent gene duplication or lateral gene transfer events play a role in shaping the genome diversification within this genus. Two patterns of expansion, single gene expansion and chromosome block expansion are observed, representing different scales of duplication. Conclusions Our results provide a catalog of genome components and their potential functional roles in gene regulatory networks and metabolic networks. The core genome components reveal the minimum requirement for streptomycetes to sustain a successful lifecycle in the soil environment, reflecting the effects of both genome evolution and environmental stress acting upon the expressed phenotypes. A

  6. Unveiling novel RecO distant orthologues involved in homologous recombination.

    Directory of Open Access Journals (Sweden)

    Stéphanie Marsin

    2008-08-01

    Full Text Available The generation of a RecA filament on single-stranded DNA is a critical step in homologous recombination. Two main pathways leading to the formation of the nucleofilament have been identified in bacteria, based on the protein complexes mediating RecA loading: RecBCD (AddAB and RecFOR. Many bacterial species seem to lack some of the components involved in these complexes. The current annotation of the Helicobacter pylori genome suggests that this highly diverse bacterial pathogen has a reduced set of recombination mediator proteins. While it is now clear that homologous recombination plays a critical role in generating H. pylori diversity by allowing genomic DNA rearrangements and integration through transformation of exogenous DNA into the chromosome, no complete mediator complex is deduced from the sequence of its genome. Here we show by bioinformatics analysis the presence of a RecO remote orthologue that allowed the identification of a new set of RecO proteins present in all bacterial species where a RecR but not RecO was previously identified. HpRecO shares less than 15% identity with previously characterized homologues. Genetic dissection of recombination pathways shows that this novel RecO and the remote RecB homologue present in H. pylori are functional in repair and in RecA-dependent intrachromosomal recombination, defining two initiation pathways with little overlap. We found, however, that neither RecOR nor RecB contributes to transformation, suggesting the presence of a third, specialized, RecA-dependent pathway responsible for the integration of transforming DNA into the chromosome of this naturally competent bacteria. These results provide insight into the mechanisms that this successful pathogen uses to generate genetic diversity and adapt to changing environments and new hosts.

  7. Seasonal patterns in Arctic prasinophytes and inferred ecology of Bathycoccus unveiled in an Arctic winter metagenome.

    Science.gov (United States)

    Joli, Nathalie; Monier, Adam; Logares, Ramiro; Lovejoy, Connie

    2017-06-01

    Prasinophytes occur in all oceans but rarely dominate phytoplankton populations. In contrast, a single ecotype of the prasinophyte Micromonas is frequently the most abundant photosynthetic taxon reported in the Arctic from summer through autumn. However, seasonal dynamics of prasinophytes outside of this period are little known. To address this, we analyzed high-throughput V4 18S rRNA amplicon data collected from November to July in the Amundsen Gulf Region, Beaufort Sea, Arctic. Surprisingly during polar sunset in November and December, we found a high proportion of reads from both DNA and RNA belonging to another prasinophyte, Bathycoccus. We then analyzed a metagenome from a December sample and the resulting Bathycoccus metagenome assembled genome (MAG) covered ~90% of the Bathycoccus Ban7 reference genome. In contrast, only ~20% of a reference Micromonas genome was found in the metagenome. Our phylogenetic analysis of marker genes placed the Arctic Bathycoccus in the B1 coastal clade. In addition, substitution rates of 129 coding DNA sequences were ~1.6% divergent between the Arctic MAG and coastal Chilean upwelling MAGs and 17.3% between it and a South East Atlantic open ocean MAG in the B2 Clade. The metagenomic analysis also revealed a winter viral community highly skewed toward viruses targeting Micromonas, with a much lower diversity of viruses targeting Bathycoccus. Overall a combination of Micromonas being relatively less able to maintain activity under dark winter conditions and viral suppression of Micromonas may have contributed to the success of Bathycoccus in the Amundsen Gulf during winter.

  8. The genome of Chenopodium quinoa

    NARCIS (Netherlands)

    Jarvis, D.E.; Shwen Ho, Yung; Lightfoot, Damien J.; Schmöckel, Sandra M.; Li, Bo; Borm, T.J.A.; Ohyanagi, Hajime; Mineta, Katsuhiko; Mitchell, Craig T.; Saber, Noha; Kharbatia, Najeh M.; Rupper, Ryan R.; Sharp, Aaron R.; Dally, Nadine; Boughton, Berin A.; Woo, Yong H.; Gao, Ge; Schijlen, E.G.W.M.; Guo, Xiujie; Momin, Afaque A.; Negräo, Sónia; Al-Babili, Salim; Gehring, Christoph; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T.; Gojobori, Takashi; Linden, van der C.G.; Loo, van E.N.; Jellen, Eric N.; Maughan, Peter J.; Tester, Mark

    2017-01-01

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for

  9. A Broad Phylogenetic Survey Unveils the Diversity and Evolution of Telomeres in Eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Fulnečková, Jana; Ševčíková, Tereza; Fajkus, Jiří; Lukešová, Alena; Lukeš, Martin; Vlček, Čestmír; Lang, B.F.; Kim, E.; Eliáš, M.; Sýkorová, Eva

    2013-01-01

    Roč. 5, č. 3 (2013), s. 468-483 ISSN 1759-6653 R&D Projects: GA ČR(CZ) GA521/09/1912 Grant - others:GA ČR(CZ) GAP506/10/0705; GA MŠk(CZ) ED1.1.00/02.0068 Program:GA; ED Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z60660521 Institutional support: RVO:68081707 ; RVO:60077344 ; RVO:61388971 ; RVO:68378050 Keywords : MOLECULAR PHYLOGENY * SEQUENCE DATA * GENOME Subject RIV: BO - Biophysics; EE - Microbiology, Virology (MBU-M); EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 4.532, year: 2013

  10. The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

    Science.gov (United States)

    Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

    2016-10-11

    Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

  11. The importance of proper bioinformatics analysis and clinical interpretation of tumor genomic profiling: a case study of undifferentiated sarcoma and a constitutional pathogenic BRCA2 mutation and an MLH1 variant of uncertain significance.

    Science.gov (United States)

    Varga, Elizabeth; Chao, Elizabeth C; Yeager, Nicholas D

    2015-09-01

    Next-generation sequencing (NGS) technology is increasingly utilized to identify therapeutic targets for patients with malignancy. This technology also has the capability to reveal the presence of constitutional genetic alterations, which may have significant implications for patients and their family members. Here we present the case of a 23 year old Caucasian patient with recurrent undifferentiated sarcoma who had NGS-based tumor analysis using an assay which simultaneously analyzed the entire coding sequence of 236 cancer-related genes (3769 exons) plus 47 introns from 19 genes often rearranged or altered in cancer. Pathogenic alterations were reported in tumor as the predicted protein alterations, BRCA2 "R645fs*15″ and MLH1 "E694*". Because constitutional BRCA2 and MLH1 gene mutations are associated with Hereditary Breast Ovarian Cancer Syndrome (HBOCS) and Lynch syndrome respectively, sequence analysis of DNA isolated from peripheral blood was performed. The presence of the alterations, BRCA2 c.1929delG and MLH1 c.2080G>T, corresponding to the previously reported predicted protein alterations, were confirmed by Sanger sequencing in the constitutional DNA. An additional DNA finding was reported in this analysis, MLH1 c.2081A>C at the neighboring nucleotide. Further evaluation of the family revealed that all alterations were paternally inherited and the two MLH1 substitutions were in cis, more appropriately referred to as MLH1 c.2080_2081delGAinsTC, which is classified as a variant of uncertain significance. This case illustrates important considerations related to appropriate interpretation of NGS tumor results and follow-up of patients with potentially deleterious constitutional alterations.

  12. Genome Sequences of Marine Shrimp Exopalaemon carinicauda Holthuis Provide Insights into Genome Size Evolution of Caridea.

    Science.gov (United States)

    Yuan, Jianbo; Gao, Yi; Zhang, Xiaojun; Wei, Jiankai; Liu, Chengzhang; Li, Fuhua; Xiang, Jianhai

    2017-07-05

    Crustacea, particularly Decapoda, contains many economically important species, such as shrimps and crabs. Crustaceans exhibit enormous (nearly 500-fold) variability in genome size. However, limited genome resources are available for investigating these species. Exopalaemon carinicauda Holthuis, an economical caridean shrimp, is a potential ideal experimental animal for research on crustaceans. In this study, we performed low-coverage sequencing and de novo assembly of the E. carinicauda genome. The assembly covers more than 95% of coding regions. E. carinicauda possesses a large complex genome (5.73 Gb), with size twice higher than those of many decapod shrimps. As such, comparative genomic analyses were implied to investigate factors affecting genome size evolution of decapods. However, clues associated with genome duplication were not identified, and few horizontally transferred sequences were detected. Ultimately, the burst of transposable elements, especially retrotransposons, was determined as the major factor influencing genome expansion. A total of 2 Gb repeats were identified, and RTE-BovB, Jockey, Gypsy, and DIRS were the four major retrotransposons that significantly expanded. Both recent (Jockey and Gypsy) and ancestral (DIRS) originated retrotransposons responsible for the genome evolution. The E. carinicauda genome also exhibited potential for the genomic and experimental research of shrimps.

  13. Single-molecule FRET unveils induced-fit mechanism for substrate selectivity in flap endonuclease 1

    KAUST Repository

    Rashid, Fahad

    2017-02-23

    Human flap endonuclease 1 (FEN1) and related structure-specific 5\\'nucleases precisely identify and incise aberrant DNA structures during replication, repair and recombination to avoid genomic instability. Yet, it is unclear how the 5\\'nuclease mechanisms of DNA distortion and protein ordering robustly mediate efficient and accurate substrate recognition and catalytic selectivity. Here, single-molecule sub-millisecond and millisecond analyses of FEN1 reveal a protein-DNA induced-fit mechanism that efficiently verifies substrate and suppresses off-target cleavage. FEN1 sculpts DNA with diffusion-limited kinetics to test DNA substrate. This DNA distortion mutually \\'locks\\' protein and DNA conformation and enables substrate verification with extreme precision. Strikingly, FEN1 never misses cleavage of its cognate substrate while blocking probable formation of catalytically competent interactions with noncognate substrates and fostering their pre-incision dissociation. These findings establish FEN1 has practically perfect precision and that separate control of induced-fit substrate recognition sets up the catalytic selectivity of the nuclease active site for genome stability.

  14. IEEE Milestone at CERN - W Cleon Anderson (right), president of the Institute of Electrical and Electronics Engineers, unveils the Milestone plaque at CERN, together with Georges Charpak

    CERN Multimedia

    Maximilien Brice

    2005-01-01

    At a ceremony on 26 September at CERN, W Cleon Anderson, president of the Institute of Electrical and Electronics Engineers (IEEE), formally dedicated a "Milestone" plaque in recognition of the invention of electronic particle detectors at CERN. The plaque was unveiled by Anderson and Georges Charpak, the Nobel-prize winning inventor of wire-chamber technology at CERN.

  15. BRITE-Constellation high-precision time-dependent photometry of the early O-type supergiant ζ Puppis unveils the photospheric drivers of its small- and large-scale wind structures

    Science.gov (United States)

    Ramiaramanantsoa, Tahina; Moffat, Anthony F. J.; Harmon, Robert; Ignace, Richard; St-Louis, Nicole; Vanbeveren, Dany; Shenar, Tomer; Pablo, Herbert; Richardson, Noel D.; Howarth, Ian D.; Stevens, Ian R.; Piaulet, Caroline; St-Jean, Lucas; Eversberg, Thomas; Pigulski, Andrzej; Popowicz, Adam; Kuschnig, Rainer; Zocłońska, Elżbieta; Buysschaert, Bram; Handler, Gerald; Weiss, Werner W.; Wade, Gregg A.; Rucinski, Slavek M.; Zwintz, Konstanze; Luckas, Paul; Heathcote, Bernard; Cacella, Paulo; Powles, Jonathan; Locke, Malcolm; Bohlsen, Terry; Chené, André-Nicolas; Miszalski, Brent; Waldron, Wayne L.; Kotze, Marissa M.; Kotze, Enrico J.; Böhm, Torsten

    2018-02-01

    From 5.5 months of dual-band optical photometric monitoring at the 1 mmag level, BRITE-Constellation has revealed two simultaneous types of variability in the O4I(n)fp star ζ Puppis: one single periodic non-sinusoidal component superimposed on a stochastic component. The monoperiodic component is the 1.78-d signal previously detected by Coriolis/Solar Mass Ejection Imager, but this time along with a prominent first harmonic. The shape of this signal changes over time, a behaviour that is incompatible with stellar oscillations but consistent with rotational modulation arising from evolving bright surface inhomogeneities. By means of a constrained non-linear light-curve inversion algorithm, we mapped the locations of the bright surface spots and traced their evolution. Our simultaneous ground-based multisite spectroscopic monitoring of the star unveiled cyclical modulation of its He II λ4686 wind emission line with the 1.78-d rotation period, showing signatures of corotating interaction regions that turn out to be driven by the bright photospheric spots observed by BRITE. Traces of wind clumps are also observed in the He II λ4686 line and are correlated with the amplitudes of the stochastic component of the light variations probed by BRITE at the photosphere, suggesting that the BRITE observations additionally unveiled the photospheric drivers of wind clumps in ζ Pup and that the clumping phenomenon starts at the very base of the wind. The origins of both the bright surface inhomogeneities and the stochastic light variations remain unknown, but a subsurface convective zone might play an important role in the generation of these two types of photospheric variability.

  16. Surface Induced Dissociation Coupled with High Resolution Mass Spectrometry Unveils Heterogeneity of a 211 kDa Multicopper Oxidase Protein Complex

    Science.gov (United States)

    Zhou, Mowei; Yan, Jing; Romano, Christine A.; Tebo, Bradley M.; Wysocki, Vicki H.; Paša-Tolić, Ljiljana

    2018-01-01

    Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase, Mnx, from Bacillus sp. PL-12 has been successfully overexpressed in active form as a protein complex with a molecular mass of 211 kDa. We have recently used surface induced dissociation (SID) and ion mobility-mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data from the native mass spectrometry experiments led to a plausible structural model of this multicopper oxidase, which has been difficult to study by conventional structural biology methods. It was also revealed that each Mnx subunit binds a variable number of copper ions. Becasue of the heterogeneity of the protein and limited mass resolution, ambiguities in assigning some of the observed peaks remained as a barrier to fully understanding the role of metals and potential unknown ligands in Mnx. In this study, we performed SID in a modified Fourier transform-ion cyclotron resonance (FTICR) mass spectrometer. The high mass accuracy and resolution offered by FTICR unveiled unexpected artificial modifications on the protein that had been previously thought to be iron bound species based on lower resolution spectra. Additionally, isotopically resolved spectra of the released subcomplexes revealed the metal binding stoichiometry at different structural levels. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes. [Figure not available: see fulltext.

  17. JGI Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  18. Genomic Encyclopedia of Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-08-10

    Genomes of fungi relevant to energy and environment are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 150 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such parts suggested by comparative genomics and functional analysis in these areas are presented here.

  19. Coconut, date and oil palm genomics

    Science.gov (United States)

    A review of genomics research is presented for the three most economically important palm crops, coconut (Cocos nucifera), date palm (Phoenix dactylifera) and oil palm (Elaeis guineensis), encompassing molecular markers studies of genetic diversity, genetic mapping, quantitative trait loci discovery...

  20. Unveiling the strangeness secrets: low-energy kaon-nucleon/nuclei interactions studies at DAΦNE

    Directory of Open Access Journals (Sweden)

    Curceanu C.

    2014-03-01

    Full Text Available The DAΦNE electron-positron collider at the Laboratori Nazionali di Frascati of INFN, Italy has made available a unique quality low-energy negatively charged kaons “beam”, which is used to unveil the secrets of the kaon-nucleon/nuclei interactions at low energies by the SIDDHARTA-2 and AMADEUS experiments. SIDDHARTA has already performed unprecedented precision measurements of kaonic atoms, and is being presently upgraded, as SIDDHARTA-2, to approach new frontiers. The AMADEUS experiment plans to perform in the coming years precision measurements on kaon-nuclei interactions at low-energies, to study the possible formation of kaonic nuclei, of the Λ(1405 and of many other processes involving strangeness.

  1. Social Networking Sites in the Classroom: Unveiling New Roles for Teachers and New Approaches to Online Course Design

    Directory of Open Access Journals (Sweden)

    Jorge Eduardo Pineda Hoyos

    2014-12-01

    Full Text Available Web 2.0 tools in general and social networking sites in particular are very popular today in everyday life. However, their use in education has not been explored. This paper reports the findings of the implementation of a web 2.0 tool namely a social networking site as a web support for a face-to-face course. The findings show that the implementation of a web-based environment in a face-to-face course can be viewed from 5 different managerial areas: (1 logistics management, (2 information/knowledge management, (3 communication management, (4 class work extension management and (5 web-based environment easiness of accessibility. The conclusions of the study show that the implementation of the web-based environment unveils new roles for teachers and new approaches to design online or blended courses.

  2. The Pediatric Cancer Genome Project

    Science.gov (United States)

    Downing, James R; Wilson, Richard K; Zhang, Jinghui; Mardis, Elaine R; Pui, Ching-Hon; Ding, Li; Ley, Timothy J; Evans, William E

    2013-01-01

    The St. Jude Children’s Research Hospital–Washington University Pediatric Cancer Genome Project (PCGP) is participating in the international effort to identify somatic mutations that drive cancer. These cancer genome sequencing efforts will not only yield an unparalleled view of the altered signaling pathways in cancer but should also identify new targets against which novel therapeutics can be developed. Although these projects are still deep in the phase of generating primary DNA sequence data, important results are emerging and valuable community resources are being generated that should catalyze future cancer research. We describe here the rationale for conducting the PCGP, present some of the early results of this project and discuss the major lessons learned and how these will affect the application of genomic sequencing in the clinic. PMID:22641210

  3. Genome technologies and personalized dental medicine.

    Science.gov (United States)

    Eng, G; Chen, A; Vess, T; Ginsburg, G S

    2012-04-01

    The addition of genomic information to our understanding of oral disease is driving important changes in oral health care. It is anticipated that genome-derived information will promote a deeper understanding of disease etiology and permit earlier diagnosis, allowing for preventative measures prior to disease onset rather than treatment that attempts to repair the diseased state. Advances in genome technologies have fueled expectations for this proactive healthcare approach. Application of genomic testing is expanding and has already begun to find its way into the practice of clinical dentistry. To take full advantage of the information and technologies currently available, it is vital that dental care providers, consumers, and policymakers be aware of genomic approaches to understanding of oral diseases and the application of genomic testing to disease diagnosis and treatment. Ethical, legal, clinical, and educational initiatives are also required to responsibly incorporate genomic information into the practice of dentistry. This article provides an overview of the application of genomic technologies to oral health care and introduces issues that require consideration if we are to realize the full potential of genomics to enable the practice of personalized dental medicine. © 2011 John Wiley & Sons A/S.

  4. Genomics With Cloud Computing

    Directory of Open Access Journals (Sweden)

    Sukhamrit Kaur

    2015-04-01

    Full Text Available Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computing to genomics are like easy access and sharing of data security of data less cost to pay for resources but still there are some demerits like large time needed to transfer data less network bandwidth.

  5. Five important advances in hematopathology.

    Science.gov (United States)

    Shi, Min; Xiao, Ruobing; Woda, Bruce A; Yu, Hongbo

    2014-03-01

    Hematopathology is a dynamic field that has always been on the frontier of clinical research within the scope of pathology. Several recent developments in hematopathology will likely affect its practice clinically. To review 5 important recent advances in hematopathology: (1) detection and prognostic implication of MYC in diffuse large B-cell lymphomas, (2) determining origin and prognosis through immunoglobulin gene usage in mature B-cell neoplasms, (3)detecting minimal residual disease in multiple myeloma, (4) using genome-wide analysis in myelodysplastic syndromes, and (5) employing whole-genome sequencing in acute myeloid leukemias. Literature review and the authors' experiences in an academic center. These advances will bring hematopathology into a new molecular era and help us to better understand the molecular, pathologic mechanisms of lymphomas, leukemias, myelomas, and myelodysplastic syndromes. They will help us to identify diagnostic and prognostic markers and eventually provide new therapeutic targets and treatments for these diseases.

  6. The genome of Prunus mume.

    Science.gov (United States)

    Zhang, Qixiang; Chen, Wenbin; Sun, Lidan; Zhao, Fangying; Huang, Bangqing; Yang, Weiru; Tao, Ye; Wang, Jia; Yuan, Zhiqiong; Fan, Guangyi; Xing, Zhen; Han, Changlei; Pan, Huitang; Zhong, Xiao; Shi, Wenfang; Liang, Xinming; Du, Dongliang; Sun, Fengming; Xu, Zongda; Hao, Ruijie; Lv, Tian; Lv, Yingmin; Zheng, Zequn; Sun, Ming; Luo, Le; Cai, Ming; Gao, Yike; Wang, Junyi; Yin, Ye; Xu, Xun; Cheng, Tangren; Wang, Jun

    2012-01-01

    Prunus mume (mei), which was domesticated in China more than 3,000 years ago as ornamental plant and fruit, is one of the first genomes among Prunus subfamilies of Rosaceae been sequenced. Here, we assemble a 280M genome by combining 101-fold next-generation sequencing and optical mapping data. We further anchor 83.9% of scaffolds to eight chromosomes with genetic map constructed by restriction-site-associated DNA sequencing. Combining P. mume genome with available data, we succeed in reconstructing nine ancestral chromosomes of Rosaceae family, as well as depicting chromosome fusion, fission and duplication history in three major subfamilies. We sequence the transcriptome of various tissues and perform genome-wide analysis to reveal the characteristics of P. mume, including its regulation of early blooming in endodormancy, immune response against bacterial infection and biosynthesis of flower scent. The P. mume genome sequence adds to our understanding of Rosaceae evolution and provides important data for improvement of fruit trees.

  7. Unveiling the Biodiversity of Deep-Sea Nematodes through Metabarcoding: Are We Ready to Bypass the Classical Taxonomy?

    Science.gov (United States)

    Dell'Anno, Antonio; Carugati, Laura; Corinaldesi, Cinzia; Riccioni, Giulia; Danovaro, Roberto

    2015-01-01

    Nematodes inhabiting benthic deep-sea ecosystems account for >90% of the total metazoan abundances and they have been hypothesised to be hyper-diverse, but their biodiversity is still largely unknown. Metabarcoding could facilitate the census of biodiversity, especially for those tiny metazoans for which morphological identification is difficult. We compared, for the first time, different DNA extraction procedures based on the use of two commercial kits and a previously published laboratory protocol and tested their suitability for sequencing analyses of 18S rDNA of marine nematodes. We also investigated the reliability of Roche 454 sequencing analyses for assessing the biodiversity of deep-sea nematode assemblages previously morphologically identified. Finally, intra-genomic variation in 18S rRNA gene repeats was investigated by Illumina MiSeq in different deep-sea nematode morphospecies to assess the influence of polymorphisms on nematode biodiversity estimates. Our results indicate that the two commercial kits should be preferred for the molecular analysis of biodiversity of deep-sea nematodes since they consistently provide amplifiable DNA suitable for sequencing. We report that the morphological identification of deep-sea nematodes matches the results obtained by metabarcoding analysis only at the order-family level and that a large portion of Operational Clustered Taxonomic Units (OCTUs) was not assigned. We also show that independently from the cut-off criteria and bioinformatic pipelines used, the number of OCTUs largely exceeds the number of individuals and that 18S rRNA gene of different morpho-species of nematodes displayed intra-genomic polymorphisms. Our results indicate that metabarcoding is an important tool to explore the diversity of deep-sea nematodes, but still fails in identifying most of the species due to limited number of sequences deposited in the public databases, and in providing quantitative data on the species encountered. These aspects

  8. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    Science.gov (United States)

    Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

    2013-01-01

    Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  9. Fungal biology: compiling genomes and exploiting them

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Uehling, Jessie K [ORNL; Payen, Thibaut [INRA; Plett, Jonathan [University of Western Sydney, Australia

    2014-01-01

    The last 10 years have seen the cost of sequencing complete genomes decrease at an incredible speed. This has led to an increase in the number of genomes sequenced in all the fungal tree of life as well as a wide variety of plant genomes. The increase in sequencing has permitted us to study the evolution of organisms on a genomic scale. A number of talks during the conference discussed the importance of transposable elements (TEs) that are present in almost all species of fungi. These TEs represent an especially large percentage of genomic space in fungi that interact with plants. Thierry Rouxel (INRA, Nancy, France) showed the link between speciation in the Leptosphaeria complex and the expansion of TE families. For example in the Leptosphaeria complex, one species associated with oilseed rape has experienced a recent and massive burst of movement by a few TE families. The alterations caused by these TEs took place in discrete regions of the genome leading to shuffling of the genomic landscape and the appearance of genes specific to the species, such as effectors useful for the interactions with a particular plant (Rouxel et al., 2011). Other presentations showed the importance of TEs in affecting genome organization. For example, in Amanita different species appear to have been invaded by different TE families (Veneault-Fourrey & Martin, 2011).

  10. Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes.

    Science.gov (United States)

    Jeong, Young-Min; Kim, Namshin; Ahn, Byung Ohg; Oh, Mijin; Chung, Won-Hyong; Chung, Hee; Jeong, Seongmun; Lim, Ki-Byung; Hwang, Yoon-Jung; Kim, Goon-Bo; Baek, Seunghoon; Choi, Sang-Bong; Hyung, Dae-Jin; Lee, Seung-Won; Sohn, Seong-Han; Kwon, Soo-Jin; Jin, Mina; Seol, Young-Joo; Chae, Won Byoung; Choi, Keun Jin; Park, Beom-Seok; Yu, Hee-Ju; Mun, Jeong-Hwan

    2016-07-01

    This study presents a chromosome-scale draft genome sequence of radish that is assembled into nine chromosomal pseudomolecules. A comprehensive comparative genome analysis with the Brassica genomes provides genomic evidences on the evolution of the mesohexaploid radish genome. Radish (Raphanus sativus L.) is an agronomically important root vegetable crop and its origin and phylogenetic position in the tribe Brassiceae is controversial. Here we present a comprehensive analysis of the radish genome based on the chromosome sequences of R. sativus cv. WK10039. The radish genome was sequenced and assembled into 426.2 Mb spanning >98 % of the gene space, of which 344.0 Mb were integrated into nine chromosome pseudomolecules. Approximately 36 % of the genome was repetitive sequences and 46,514 protein-coding genes were predicted and annotated. Comparative mapping of the tPCK-like ancestral genome revealed that the radish genome has intermediate characteristics between the Brassica A/C and B genomes in the triplicated segments, suggesting an internal origin from the genus Brassica. The evolutionary characteristics shared between radish and other Brassica species provided genomic evidences that the current form of nine chromosomes in radish was rearranged from the chromosomes of hexaploid progenitor. Overall, this study provides a chromosome-scale draft genome sequence of radish as well as novel insight into evolution of the mesohexaploid genomes in the tribe Brassiceae.

  11. Genome-wide comparative analysis reveals human-mouse regulatory landscape and evolution.

    Science.gov (United States)

    Denas, Olgert; Sandstrom, Richard; Cheng, Yong; Beal, Kathryn; Herrero, Javier; Hardison, Ross C; Taylor, James

    2015-02-14

    Because species-specific gene expression is driven by species-specific regulation, understanding the relationship between sequence and function of the regulatory regions in different species will help elucidate how differences among species arise. Despite active experimental and computational research, relationships among sequence, conservation, and function are still poorly understood. We compared transcription factor occupied segments (TFos) for 116 human and 35 mouse TFs in 546 human and 125 mouse cell types and tissues from the Human and the Mouse ENCODE projects. We based the map between human and mouse TFos on a one-to-one nucleotide cross-species mapper, bnMapper, that utilizes whole genome alignments (WGA). Our analysis shows that TFos are under evolutionary constraint, but a substantial portion (25.1% of mouse and 25.85% of human on average) of the TFos does not have a homologous sequence on the other species; this portion varies among cell types and TFs. Furthermore, 47.67% and 57.01% of the homologous TFos sequence shows binding activity on the other species for human and mouse respectively. However, 79.87% and 69.22% is repurposed such that it binds the same TF in different cells or different TFs in the same cells. Remarkably, within the set of repurposed TFos, the corresponding genome regions in the other species are preferred locations of novel TFos. These events suggest exaptation of some functional regulatory sequences into new function. Despite TFos repurposing, we did not find substantial changes in their predicted target genes, suggesting that CRMs buffer evolutionary events allowing little or no change in the TFos - target gene associations. Thus, the small portion of TFos with strictly conserved occupancy underestimates the degree of conservation of regulatory interactions. We mapped regulatory sequences from an extensive number of TFs and cell types between human and mouse using WGA. A comparative analysis of this correspondence unveiled the

  12. Comparative Genome Analysis and Genome Evolution

    NARCIS (Netherlands)

    Snel, Berend

    2002-01-01

    This thesis described a collection of bioinformatic analyses on complete genome sequence data. We have studied the evolution of gene content and find that vertical inheritance dominates over horizontal gene trasnfer, even to the extent that we can use the gene content to make genome phylogenies.

  13. A Genome-Wide Association Study Suggests Novel Loci Associated with a Schizophrenia-Related Brain-Based Phenotype.

    Directory of Open Access Journals (Sweden)

    Johanna Hass

    Full Text Available Patients with schizophrenia and their siblings typically show subtle changes of brain structures, such as a reduction of hippocampal volume. Hippocampal volume is heritable, may explain a variety of cognitive symptoms of schizophrenia and is thus considered an intermediate phenotype for this mental illness. The aim of our analyses was to identify single-nucleotide polymorphisms (SNP related to hippocampal volume without making prior assumptions about possible candidate genes. In this study, we combined genetics, imaging and neuropsychological data obtained from the Mind Clinical Imaging Consortium study of schizophrenia (n = 328. A total of 743,591 SNPs were tested for association with hippocampal volume in a genome-wide association study. Gene expression profiles of human hippocampal tissue were investigated for gene regions of significantly associated SNPs. None of the genetic markers reached genome-wide significance. However, six highly correlated SNPs (rs4808611, rs35686037, rs12982178, rs1042178, rs10406920, rs8170 on chromosome 19p13.11, located within or in close proximity to the genes NR2F6, USHBP1, and BABAM1, as well as four SNPs in three other genomic regions (chromosome 1, 2 and 10 had p-values between 6.75×10(-6 and 8.3×10(-7. Using existing data of a very recently published GWAS of hippocampal volume and additional data of a multicentre study in a large cohort of adolescents of European ancestry, we found supporting evidence for our results. Furthermore, allelic differences in rs4808611 and rs8170 were highly associated with differential mRNA expression in the cis-acting region. Associations with memory functioning indicate a possible functional importance of the identified risk variants. Our findings provide new insights into the genetic architecture of a brain structure closely linked to schizophrenia. In silico replication, mRNA expression and cognitive data provide additional support for the relevance of our findings

  14. Genomic Data Commons launches

    Science.gov (United States)

    The Genomic Data Commons (GDC), a unified data system that promotes sharing of genomic and clinical data between researchers, launched today with a visit from Vice President Joe Biden to the operations center at the University of Chicago.

  15. Rat Genome Database (RGD)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Rat Genome Database (RGD) is a collaborative effort between leading research institutions involved in rat genetic and genomic research to collect, consolidate,...

  16. Visualization for genomics: the Microbial Genome Viewer.

    Science.gov (United States)

    Kerkhoven, Robert; van Enckevort, Frank H J; Boekhorst, Jos; Molenaar, Douwe; Siezen, Roland J

    2004-07-22

    A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a MySQL database. The generated images are in scalable vector graphics (SVG) format, which is suitable for creating high-quality scalable images and dynamic Web representations. Gene-related data such as transcriptome and time-course microarray experiments can be superimposed on the maps for visual inspection. The Microbial Genome Viewer 1.0 is freely available at http://www.cmbi.kun.nl/MGV

  17. Genomic prediction using subsampling

    OpenAIRE

    Xavier, Alencar; Xu, Shizhong; Muir, William; Rainey, Katy Martin

    2017-01-01

    Background Genome-wide assisted selection is a critical tool for the?genetic improvement of plants and animals. Whole-genome regression models in Bayesian framework represent the main family of prediction methods. Fitting such models with a large number of observations involves a prohibitive computational burden. We propose the use of subsampling bootstrap Markov chain in genomic prediction. Such method consists of fitting whole-genome regression models by subsampling observations in each rou...

  18. Genomic Resource and Genome Guided Comparison of Twenty Type Strains of the Genus Methylobacterium

    Directory of Open Access Journals (Sweden)

    Vasvi Chaudhry

    2017-12-01

    Full Text Available Bacteria of the genus Methylobacterium are widespread in diverse habitats ranging from soil, water and plant (phyllosphere, rhizosphere and endosphere. In the present study, we in house generated genomic data resource of six type strains along with fourteen database genomes of the Methylobacterium genus to carry out phylogenomic, taxonomic, comparative and ecological studies of this genus. Overall, the genus shows high diversity and genetic variation primarily due to its ability to acquire genetic material from diverse sources through horizontal gene transfer. As majority of species identified in this study are plant associated with their genomes equipped with methylotrophy and photosynthesis related gene along with genes for plant probiotic traits. Most of the species genomes are equipped with genes for adaptation and defense for UV radiation, oxidative stress and desiccation. The genus has an open pan-genome and we predicted the role of gain/loss of prophages and CRISPR elements in diversity and evolution. Our genomic resource with annotation and analysis provides a platform for interspecies genomic comparisons in the genus Methylobacterium, and to unravel their natural genome diversity and to study how natural selection shapes their genome with the adaptive mechanisms which allow them to acquire diverse habitat lifestyles. This type strains genomic data display power of Next Generation Sequencing in rapidly creating resource paving the way for studies on phylogeny and taxonomy as well as for basic and applied research for this important genus.

  19. Ebolavirus comparative genomics

    DEFF Research Database (Denmark)

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat

    2015-01-01

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms...

  20. Transcription as a Threat to Genome Integrity.

    Science.gov (United States)

    Gaillard, Hélène; Aguilera, Andrés

    2016-06-02

    Genomes undergo different types of sporadic alterations, including DNA damage, point mutations, and genome rearrangements, that constitute the basis for evolution. However, these changes may occur at high levels as a result of cell pathology and trigger genome instability, a hallmark of cancer and a number of genetic diseases. In the last two decades, evidence has accumulated that transcription constitutes an important natural source of DNA metabolic errors that can compromise the integrity of the genome. Transcription can create the conditions for high levels of mutations and recombination by its ability to open the DNA structure and remodel chromatin, making it more accessible to DNA insulting agents, and by its ability to become a barrier to DNA replication. Here we review the molecular basis of such events from a mechanistic perspective with particular emphasis on the role of transcription as a genome instability determinant.

  1. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

  2. Aligning the unalignable: bacteriophage whole genome alignments.

    Science.gov (United States)

    Bérard, Sèverine; Chateau, Annie; Pompidor, Nicolas; Guertin, Paul; Bergeron, Anne; Swenson, Krister M

    2016-01-13

    In recent years, many studies focused on the description and comparison of large sets of related bacteriophage genomes. Due to the peculiar mosaic structure of these genomes, few informative approaches for comparing whole genomes exist: dot plots diagrams give a mostly qualitative assessment of the similarity/dissimilarity between two or more genomes, and clustering techniques are used to classify genomes. Multiple alignments are conspicuously absent from this scene. Indeed, whole genome aligners interpret lack of similarity between sequences as an indication of rearrangements, insertions, or losses. This behavior makes them ill-prepared to align bacteriophage genomes, where even closely related strains can accomplish the same biological function with highly dissimilar sequences. In this paper, we propose a multiple alignment strategy that exploits functional collinearity shared by related strains of bacteriophages, and uses partial orders to capture mosaicism of sets of genomes. As classical alignments do, the computed alignments can be used to predict that genes have the same biological function, even in the absence of detectable similarity. The Alpha aligner implements these ideas in visual interactive displays, and is used to compute several examples of alignments of Staphylococcus aureus and Mycobacterium bacteriophages, involving up to 29 genomes. Using these datasets, we prove that Alpha alignments are at least as good as those computed by standard aligners. Comparison with the progressive Mauve aligner - which implements a partial order strategy, but whose alignments are linearized - shows a greatly improved interactive graphic display, while avoiding misalignments. Multiple alignments of whole bacteriophage genomes work, and will become an important conceptual and visual tool in comparative genomics of sets of related strains. A python implementation of Alpha, along with installation instructions for Ubuntu and OSX, is available on bitbucket (https://bitbucket.org/thekswenson/alpha).

  3. Novel epigenetic changes unveiled by monozygotic twins discordant for smoking habits.

    Science.gov (United States)

    Allione, Alessandra; Marcon, Francesca; Fiorito, Giovanni; Guarrera, Simonetta; Siniscalchi, Ester; Zijno, Andrea; Crebelli, Riccardo; Matullo, Giuseppe

    2015-01-01

    Exposure to cigarette smoking affects the epigenome and could increase the risk of developing diseases such as cancer and cardiovascular disorders. Changes in DNA methylation associated with smoking may help to identify molecular pathways that contribute to disease etiology. Previous studies are not completely concordant in the identification of differentially methylated regions in the DNA of smokers. We performed an epigenome-wide DNA methylation study in a group of monozygotic (MZ) twins discordant for smoking habits to determine the effect of smoking on DNA methylation. As MZ twins are considered genetically identical, this model allowed us to identify smoking-related DNA methylation changes independent from genetic components. We investigated the whole blood genome-wide DNA methylation profiles in 20 MZ twin pairs discordant for smoking habits by using the Illumina HumanMethylation450 BeadChip. We identified 22 CpG sites that were differentially methylated between smoker and non-smoker MZ twins by intra-pair analysis. We confirmed eight loci already described by other groups, located in AHRR, F2RL3, MYOG1 genes, at 2q37.1 and 6p21.33 regions, and also identified several new loci. Moreover, pathway analysis showed an enrichment of genes involved in GTPase regulatory activity. Our study confirmed the evidence of smoking-related DNA methylation changes, emphasizing that well-designed MZ twin models can aid the discovery of novel DNA methylation signals, even in a limited sample population.

  4. De novo assembly of a haplotype-resolved human genome

    DEFF Research Database (Denmark)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang

    2015-01-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-...

  5. Mechanism of membranous tunnelling nanotube formation in viral genome delivery.

    Directory of Open Access Journals (Sweden)

    Bibiana Peralta

    2013-09-01

    Full Text Available In internal membrane-containing viruses, a lipid vesicle enclosed by the icosahedral capsid protects the genome. It has been postulated that this internal membrane is the genome delivery device of the virus. Viruses built with this architectural principle infect hosts in all three domains of cellular life. Here, using a combination of electron microscopy techniques, we investigate bacteriophage PRD1, the best understood model for such viruses, to unveil the mechanism behind the genome translocation across the cell envelope. To deliver its double-stranded DNA, the icosahedral protein-rich virus membrane transforms into a tubular structure protruding from one of the 12 vertices of the capsid. We suggest that this viral nanotube exits from the same vertex used for DNA packaging, which is biochemically distinct from the other 11. The tube crosses the capsid through an aperture corresponding to the loss of the peripentonal P3 major capsid protein trimers, penton protein P31 and membrane protein P16. The remodeling of the internal viral membrane is nucleated by changes in osmolarity and loss of capsid-membrane interactions as consequence of the de-capping of the vertices. This engages the polymerization of the tail tube, which is structured by membrane-associated proteins. We have observed that the proteo-lipidic tube in vivo can pierce the gram-negative bacterial cell envelope allowing the viral genome to be shuttled to the host cell. The internal diameter of the tube allows one double-stranded DNA chain to be translocated. We conclude that the assembly principles of the viral tunneling nanotube take advantage of proteo-lipid interactions that confer to the tail tube elastic, mechanical and functional properties employed also in other protein-membrane systems.

  6. The Arab genome: Health and wealth.

    Science.gov (United States)

    Zayed, Hatem

    2016-11-05

    The 22 Arab nations have a unique genetic structure, which reflects both conserved and diverse gene pools due to the prevalent endogamous and consanguineous marriage culture and the long history of admixture among different ethnic subcultures descended from the Asian, European, and African continents. Human genome sequencing has enabled large-scale genomic studies of different populations and has become a powerful tool for studying disease predictions and diagnosis. Despite the importance of the Arab genome for better understanding the dynamics of the human genome, discovering rare genetic variations, and studying early human migration out of Africa, it is poorly represented in human genome databases, such as HapMap and the 1000 Genomes Project. In this review, I demonstrate the significance of sequencing the Arab genome and setting an Arab genome reference(s) for better understanding the molecular pathogenesis of genetic diseases, discovering novel/rare variants, and identifying a meaningful genotype-phenotype correlation for complex diseases. Copyright © 2016. Published by Elsevier B.V.

  7. Observing copepods through a genomic lens

    Science.gov (United States)

    2011-01-01

    Background Copepods outnumber every other multicellular animal group. They are critical components of the world's freshwater and marine ecosystems, sensitive indicators of local and global climate change, key ecosystem service providers, parasites and predators of economically important aquatic animals and potential vectors of waterborne disease. Copepods sustain the world fisheries that nourish and support human populations. Although genomic tools have transformed many areas of biological and biomedical research, their power to elucidate aspects of the biology, behavior and ecology of copepods has only recently begun to be exploited. Discussion The extraordinary biological and ecological diversity of the subclass Copepoda provides both unique advantages for addressing key problems in aquatic systems and formidable challenges for developing a focused genomics strategy. This article provides an overview of genomic studies of copepods and discusses strategies for using genomics tools to address key questions at levels extending from individuals to ecosystems. Genomics can, for instance, help to decipher patterns of genome evolution such as those that occur during transitions from free living to symbiotic and parasitic lifestyles and can assist in the identification of genetic mechanisms and accompanying physiological changes associated with adaptation to new or physiologically challenging environments. The adaptive significance of the diversity in genome size and unique mechanisms of genome reorganization during development could similarly be explored. Genome-wide and EST studies of parasitic copepods of salmon and large EST studies of selected free-living copepods have demonstrated the potential utility of modern genomics approaches for the study of copepods and have generated resources such as EST libraries, shotgun genome sequences, BAC libraries, genome maps and inbred lines that will be invaluable in assisting further efforts to provide genomics tools for

  8. Observing copepods through a genomic lens

    Directory of Open Access Journals (Sweden)

    Johnson Stewart C

    2011-09-01

    Full Text Available Abstract Background Copepods outnumber every other multicellular animal group. They are critical components of the world's freshwater and marine ecosystems, sensitive indicators of local and global climate change, key ecosystem service providers, parasites and predators of economically important aquatic animals and potential vectors of waterborne disease. Copepods sustain the world fisheries that nourish and support human populations. Although genomic tools have transformed many areas of biological and biomedical research, their power to elucidate aspects of the biology, behavior and ecology of copepods has only recently begun to be exploited. Discussion The extraordinary biological and ecological diversity of the subclass Copepoda provides both unique advantages for addressing key problems in aquatic systems and formidable challenges for developing a focused genomics strategy. This article provides an overview of genomic studies of copepods and discusses strategies for using genomics tools to address key questions at levels extending from individuals to ecosystems. Genomics can, for instance, help to decipher patterns of genome evolution such as those that occur during transitions from free living to symbiotic and parasitic lifestyles and can assist in the identification of genetic mechanisms and accompanying physiological changes associated with adaptation to new or physiologically challenging environments. The adaptive significance of the diversity in genome size and unique mechanisms of genome reorganization during development could similarly be explored. Genome-wide and EST studies of parasitic copepods of salmon and large EST studies of selected free-living copepods have demonstrated the potential utility of modern genomics approaches for the study of copepods and have generated resources such as EST libraries, shotgun genome sequences, BAC libraries, genome maps and inbred lines that will be invaluable in assisting further efforts to

  9. Discovering regulatory motifs in the Plasmodium genome using comparative genomics

    OpenAIRE

    Wu, Jie; Sieglaff, Douglas H.; Gervin, Joshua; Xie, Xiaohui S.

    2008-01-01

    Motivation: Understanding gene regulation in Plasmodium, the causative agent of malaria, is an important step in deciphering its complex life cycle as well as leading to possible new targets for therapeutic applications. Very little is known about gene regulation in Plasmodium, and in particular, few regulatory elements have been identified. Such discovery has been significantly hampered by the high A-T content of some of the genomes of Plasmodium species, as well as the challenge in associat...

  10. The evolution of genome size in ants

    Directory of Open Access Journals (Sweden)

    Spagna Joseph C

    2008-02-01

    Full Text Available Abstract Background Despite the economic and ecological importance of ants, genomic tools for this family (Formicidae remain woefully scarce. Knowledge of genome size, for example, is a useful and necessary prerequisite for the development of many genomic resources, yet it has been reported for only one ant species (Solenopsis invicta, and the two published estimates for this species differ by 146.7 Mb (0.15 pg. Results Here, we report the genome size for 40 species of ants distributed across 10 of the 20 currently recognized subfamilies, thus making Formicidae the 4th most surveyed insect family and elevating the Hymenoptera to the 5th most surveyed insect order. Our analysis spans much of the ant phylogeny, from the less derived Amblyoponinae and Ponerinae to the more derived Myrmicinae, Formicinae and Dolichoderinae. We include a number of interesting and important taxa, including the invasive Argentine ant (Linepithema humile, Neotropical army ants (genera Eciton and Labidus, trapjaw ants (Odontomachus, fungus-growing ants (Apterostigma, Atta and Sericomyrmex, harvester ants (Messor, Pheidole and Pogonomyrmex, carpenter ants (Camponotus, a fire ant (Solenopsis, and a bulldog ant (Myrmecia. Our results show that ants possess small genomes relative to most other insects, yet genome size varies three-fold across this insect family. Moreover, our data suggest that two whole-genome duplications may have occurred in the ancestors of the modern Ectatomma and Apterostigma. Although some previous studies of other taxa have revealed a relationship between genome size and body size, our phylogenetically-controlled analysis of this correlation did not reveal a significant relationship. Conclusion This is the first analysis of genome size in ants (Formicidae and the first across multiple species of social insects. We show that genome size is a variable trait that can evolve gradually over long time spans, as well as rapidly, through processes that may

  11. Recent progress in genetics, epigenetics and metagenomics unveils the pathophysiology of human obesity.

    Science.gov (United States)

    Pigeyre, Marie; Yazdi, Fereshteh T; Kaur, Yuvreet; Meyre, David

    2016-06-01

    In high-, middle- and low-income countries, the rising prevalence of obesity is the underlying cause of numerous health complications and increased mortality. Being a complex and heritable disorder, obesity results from the interplay between genetic susceptibility, epigenetics, metagenomics and the environment. Attempts at understanding the genetic basis of obesity have identified numerous genes associated with syndromic monogenic, non-syndromic monogenic, oligogenic and polygenic obesity. The genetics of leanness are also considered relevant as it mirrors some of obesity's aetiologies. In this report, we summarize ten genetically elucidated obesity syndromes, some of which are involved in ciliary functioning. We comprehensively review 11 monogenic obesity genes identified to date and their role in energy maintenance as part of the leptin-melanocortin pathway. With the emergence of genome-wide association studies over the last decade, 227 genetic variants involved in different biological pathways (central nervous system, food sensing and digestion, adipocyte differentiation, insulin signalling, lipid metabolism, muscle and liver biology, gut microbiota) have been associated with polygenic obesity. Advances in obligatory and facilitated epigenetic variation, and gene-environment interaction studies have partly accounted for the missing heritability of obesity and provided additional insight into its aetiology. The role of gut microbiota in obesity pathophysiology, as well as the 12 genes associated with lipodystrophies is discussed. Furthermore, in an attempt to improve future studies and merge the gap between research and clinical practice, we provide suggestions on how high-throughput '-omic' data can be integrated in order to get closer to the new age of personalized medicine. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  12. Her Excellency Mrs Sarah Gillett Her Majesty's Ambassador to the Swiss Confederation United Kingdom of Great Britain and Northern Ireland on the occasion of the Antony Gormley sculpture unveiling ceremony Wednesday 7th December 2011

    CERN Document Server

    Maximilien Brice

    2011-01-01

    Her Excellency Mrs Sarah Gillett Her Majesty's Ambassador to the Swiss Confederation United Kingdom of Great Britain and Northern Ireland on the occasion of the Antony Gormley sculpture unveiling ceremony Wednesday 7th December 2011

  13. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  14. Whole genome shotgun sequencing of Indian strains of Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Balaji Veeraraghavan

    2017-12-01

    Full Text Available Group B streptococcus is known as a leading cause of neonatal infections in developing countries. The present study describes the whole genome shotgun sequences of four Group B Streptococcus (GBS isolates. Molecular data on clonality is lacking for GBS in India. The present genome report will add important information on the scarce genome data of GBS and will help in deriving comparative genome studies of GBS isolates at global level. This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession numbers NHPL00000000 – NHPO00000000.

  15. Genome instability: Linking ageing and brain degeneration.

    Science.gov (United States)

    Barzilai, Ari; Schumacher, Björn; Shiloh, Yosef

    2017-01-01

    Ageing is a multifactorial process affected by cumulative physiological changes resulting from stochastic processes combined with genetic factors, which together alter metabolic homeostasis. Genetic variation in maintenance of genome stability is emerging as an important determinant of ageing pace. Genome instability is also closely associated with a broad spectrum of conditions involving brain degeneration. Similarities and differences can be found between ageing-associated decline of brain functionality and the detrimental effect of genome instability on brain functionality and development. This review discusses these similarities and differences and highlights cell classes whose role in these processes might have been underestimated-glia and microglia. Copyright © 2016. Published by Elsevier B.V.

  16. Polyploidy: adaptation to the genomic environment.

    Science.gov (United States)

    Hollister, Jesse D

    2015-02-01

    Genomic evidence of ancestral whole genome duplication (WGD) and polyploidy is widespread among eukaryotic species, and especially among plants. WGD is thought to provide the raw material for adaptation in the form of duplicated genes, and polyploids are thought to benefit from both physiological and genetic buffering. Comparatively little attention has focused on the genomic challenge of polyploidy, however, although much evidence exists that polyploidy severely perturbs important cellular functions. Here, I review recent progress in the study of the re-establishment of stable meiosis in recently evolved polyploids, focusing on four plant species. This work has yielded an insight into the mechanisms underlying stabilization of genome transmission in polyploids, and is revealing remarkable parallels among diverse taxa. Importantly, these studies also provide a road map for investigating how polyploids respond to the challenge of WGD.

  17. Sequencing of a new target genome: the Pediculus humanus humanus (Phthiraptera: Pediculidae) genome project.

    Science.gov (United States)

    Pittendrigh, B R; Clark, J M; Johnston, J S; Lee, S H; Romero-Severson, J; Dasch, G A

    2006-11-01

    The human body louse, Pediculus humanus humanus (L.), and the human head louse, Pediculus humanus capitis, belong to the hemimetabolous order Phthiraptera. The body louse is the primary vector that transmits the bacterial agents of louse-borne relapsing fever, trench fever, and epidemic typhus. The genomes of the bacterial causative agents of several of these aforementioned diseases have been sequenced. Thus, determining the body louse genome will enhance studies of host-vector-pathogen interactions. Although not important as a major disease vector, head lice are of major social concern. Resistance to traditional pesticides used to control head and body lice have developed. It is imperative that new molecular targets be discovered for the development of novel compounds to control these insects. No complete genome sequence exists for a hemimetabolous insect species primarily because hemimetabolous insects often have large (2000 Mb) to very large (up to 16,300 Mb) genomes. Fortuitously, we determined that the human body louse has one of the smallest genome sizes known in insects, suggesting it may be a suitable choice as a minimal hemimetabolous genome in which many genes have been eliminated during its adaptation to human parasitism. Because many louse species infest birds and mammals, the body louse genome-sequencing project will facilitate studies of their comparative genomics. A 6-8X coverage of the body louse genome, plus sequenced expressed sequence tags, should provide the entomological, evolutionary biology, medical, and public health communities with useful genetic information.

  18. Xylella fastidiosa comparative genomic database is an information resource to explore the annotation, genomic features, and biology of different strains

    Directory of Open Access Journals (Sweden)

    Alessandro M. Varani

    2012-01-01

    Full Text Available The Xylella fastidiosa comparative genomic database is a scientific resource with the aim to provide a user-friendly interface for accessing high-quality manually curated genomic annotation and comparative sequence analysis, as well as for identifying and mapping prophage-like elements, a marked feature of Xylella genomes. Here we describe a database and tools for exploring the biology of this important plant pathogen. The hallmarks of this database are the high quality genomic annotation, the functional and comparative genomic analysis and the identification and mapping of prophage-like elements. It is available from web site http://www.xylella.lncc.br.

  19. Next-Generation Genomics Facility at C-CAMP: Accelerating Genomic Research in India

    Science.gov (United States)

    S, Chandana; Russiachand, Heikham; H, Pradeep; S, Shilpa; M, Ashwini; S, Sahana; B, Jayanth; Atla, Goutham; Jain, Smita; Arunkumar, Nandini; Gowda, Malali

    2014-01-01

    Next-Generation Sequencing (NGS; http://www.genome.gov/12513162) is a recent life-sciences technological revolution that allows scientists to decode genomes or transcriptomes at a much faster rate with a lower cost. Genomic-based studies are in a relatively slow pace in India due to the non-availability of genomics experts, trained personnel and dedicated service providers. Using NGS there is a lot of potential to study India's national diversity (of all kinds). We at the Centre for Cellular and Molecular Platforms (C-CAMP) have launched the Next Generation Genomics Facility (NGGF) to provide genomics service to scientists, to train researchers and also work on national and international genomic projects. We have HiSeq1000 from Illumina and GS-FLX Plus from Roche454. The long reads from GS FLX Plus, and high sequence depth from HiSeq1000, are the best and ideal hybrid approaches for de novo and re-sequencing of genomes and transcriptomes. At our facility, we have sequenced around 70 different organisms comprising of more than 388 genomes and 615 transcriptomes – prokaryotes and eukaryotes (fungi, plants and animals). In addition we have optimized other unique applications such as small RNA (miRNA, siRNA etc), long Mate-pair sequencing (2 to 20 Kb), Coding sequences (Exome), Methylome (ChIP-Seq), Restriction Mapping (RAD-Seq), Human Leukocyte Antigen (HLA) typing, mixed genomes (metagenomes) and target amplicons, etc. Translating DNA sequence data from NGS sequencer into meaningful information is an important exercise. Under NGGF, we have bioinformatics experts and high-end computing resources to dissect NGS data such as genome assembly and annotation, gene expression, target enrichment, variant calling (SSR or SNP), comparative analysis etc. Our services (sequencing and bioinformatics) have been utilized by more than 45 organizations (academia and industry) both within India and outside, resulting several publications in peer-reviewed journals and several genomic

  20. Shame veiled and unveiled: the shame affect and its re-emergence in the clinical setting.

    Science.gov (United States)

    Mann, Mali

    2010-09-01

    The paper examines the psychoanalytic theory of shame and the importance of developmental aspects of the shame affect. In a clinical setting, the discovery of the shame affect, stemming from unconscious and early traumatic situations, is an important and useful approach in helping the patient access painful memories and defenses against them. The defenses disguise the underlying shame affect; furthermore, vision is being bound up with the searing painful affect of shame. The anticipatory dread of scornful gaze of another person, similar to objective self-awareness can cause mortification. Fear of mortification and being exposed emerges in the clinical setting. Through the recognition of enactments in the transference and countertransference interchange, the analyst helps the patient working through them. Several case vignettes demonstrate these important concepts. Finally, the author discusses how shame in certain situations can be a powerful, positive motivator for human interactions.

  1. Genome-wide characterization of centromeric satellites from multiple mammalian genomes.

    Science.gov (United States)

    Alkan, Can; Cardone, Maria Francesca; Catacchio, Claudia Rita; Antonacci, Francesca; O'Brien, Stephen J; Ryder, Oliver A; Purgato, Stefania; Zoli, Monica; Della Valle, Giuliano; Eichler, Evan E; Ventura, Mario

    2011-01-01

    Despite its importance in cell biology and evolution, the centromere has remained the final frontier in genome assembly and annotation due to its complex repeat structure. However, isolation and characterization of the centromeric repeats from newly sequenced species are necessary for a complete understanding of genome evolution and function. In recent years, various genomes have been sequenced, but the characterization of the corresponding centromeric DNA has lagged behind. Here, we present a computational method (RepeatNet) to systematically identify higher-order repeat structures from unassembled whole-genome shotgun sequence and test whether these sequence elements correspond to functional centromeric sequences. We analyzed genome datasets from six species of mammals representing the diversity of the mammalian lineage, namely, horse, dog, elephant, armadillo, opossum, and platypus. We define candidate monomer satellite repeats and demonstrate centromeric localization for five of the six genomes. Our analysis revealed the greatest diversity of centromeric sequences in horse and dog in contrast to elephant and armadillo, which showed high-centromeric sequence homogeneity. We could not isolate centromeric sequences within the platypus genome, suggesting that centromeres in platypus are not enriched in satellite DNA. Our method can be applied to the characterization of thousands of other vertebrate genomes anticipated for sequencing in the near future, providing an important tool for annotation of centromeres.

  2. The research progress of genomic selection in livestock.

    Science.gov (United States)

    Li, Hong-wei; Wang, Rui-jun; Wang, Zhi-ying; Li, Xue-wu; Wang, Zhen-yu; Yanjun, Zhang; Rui, Su; Zhihong, Liu; Jinquan, Li

    2017-05-20

    With the development of gene chip and breeding technology, genomic selection in plants and animals has become research hotspots in recent years. Genomic selection has been extensively applied to all kinds of economic livestock, due to its high accuracy, short generation intervals and low breeding costs. In this review, we summarize genotyping technology and the methods for genomic breeding value estimation, the latter including the least square method, RR-BLUP, GBLUP, ssGBLUP, BayesA and BayesB. We also cover basic principles of genomic selection and compare their genetic marker ranges, genomic selection accuracy and operational speed. In addition, we list common indicators, methods and influencing factors that are related to genomic selection accuracy. Lastly, we discuss latest applications and the current problems of genomic selection at home and abroad. Importantly, we envision future status of genomic selection research, including multi-trait and multi-population genomic selection, as well as impact of whole genome sequencing and dominant effects on genomic selection. This review will provide some venues for other breeders to further understand genome selection.

  3. Draft genome sequence of Penicillium marneffei strain PM1.

    Science.gov (United States)

    Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung

    2011-12-01

    Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.

  4. The genome draft of coconut (Cocos nucifera).

    Science.gov (United States)

    Xiao, Yong; Xu, Pengwei; Fan, Haikuo; Baudouin, Luc; Xia, Wei; Bocs, Stéphanie; Xu, Junyang; Li, Qiong; Guo, Anping; Zhou, Lixia; Li, Jing; Wu, Yi; Ma, Zilong; Armero, Alix; Issali, Auguste Emmanuel; Liu, Na; Peng, Ming; Yang, Yaodong

    2017-11-01

    Coconut palm (Cocos nucifera,2n = 32), a member of genus Cocos and family Arecaceae (Palmaceae), is an important tropical fruit and oil crop. Currently, coconut palm is cultivated in 93 countries, including Central and South America, East and West Africa, Southeast Asia and the Pacific Islands, with a total growth area of more than 12 million hectares [1]. Coconut palm is generally classified into 2 main categories: "Tall" (flowering 8-10 years after planting) and "Dwarf" (flowering 4-6 years after planting), based on morphological characteristics and breeding habits. This Palmae species has a long growth period before reproductive years, which hinders conventional breeding progress. In spite of initial successes, improvements made by conventional breeding have been very slow. In the present study, we obtained de novo sequences of the Cocos nucifera genome: a major genomic resource that could be used to facilitate molecular breeding in Cocos nucifera and accelerate the breeding process in this important crop. A total of 419.67 gigabases (Gb) of raw reads were generated by the Illumina HiSeq 2000 platform using a series of paired-end and mate-pair libraries, covering the predicted Cocos nucifera genome length (2.42 Gb, variety "Hainan Tall") to an estimated ×173.32 read depth. A total scaffold length of 2.20 Gb was generated (N50 = 418 Kb), representing 90.91% of the genome. The coconut genome was predicted to harbor 28 039 protein-coding genes, which is less than in Phoenix dactylifera (PDK30: 28 889), Phoenix dactylifera (DPV01: 41 660), and Elaeis guineensis (EG5: 34 802). BUSCO evaluation demonstrated that the obtained scaffold sequences covered 90.8% of the coconut genome and that the genome annotation was 74.1% complete. Genome annotation results revealed that 72.75% of the coconut genome consisted of transposable elements, of which long-terminal repeat retrotransposons elements (LTRs) accounted for the largest proportion (92.23%). Comparative analysis of the

  5. Multi-source self-calibration: Unveiling the microJy population of compact radio sources

    NARCIS (Netherlands)

    Radcliffe, J. F.; Garrett, M. A.; Beswick, R. J.; Muxlow, T. W. B.; Barthel, P. D.; Deller, A. T.; Middelberg, E.

    2016-01-01

    Context. Very long baseline interferometry (VLBI) data are extremely sensitive to the phase stability of the VLBI array. This is especially important when we reach μJy rms sensitivities. Calibration using standard phase-referencing techniques is often used to improve the phase stability of VLBI

  6. (Un)Becoming Tourist-Teachers: Unveiling White Racial Identity in Cross-Cultural Teaching Programmes

    Science.gov (United States)

    Enriquez-Gibson, Judith; Gibson, Ian

    2015-01-01

    The importance of cross-cultural experiences in teacher education has become more pressing than ever. The composition of schools across Australia is increasingly more diverse, therefore it is pertinent to examine and develop pre-service teachers' worldview and culturally sensitive dispositions critical for teaching in predominantly multicultural…

  7. Comparative Fecal Metagenomics Unveils Unique Functional Capacity of the Swine Gut

    Science.gov (United States)

    Uncovering the taxonomic composition and functional capacity within the swine gut microbial consortia is of great importance to animal physiology and health and to food and water safety due to the presence of human pathogens in pig feces. Limited information on the physiological...

  8. Bioinformatics decoding the genome

    CERN Multimedia

    CERN. Geneva; Deutsch, Sam; Michielin, Olivier; Thomas, Arthur; Descombes, Patrick

    2006-01-01

    Extracting the fundamental genomic sequence from the DNA From Genome to Sequence : Biology in the early 21st century has been radically transformed by the availability of the full genome sequences of an ever increasing number of life forms, from bacteria to major crop plants and to humans. The lecture will concentrate on the computational challenges associated with the production, storage and analysis of genome sequence data, with an emphasis on mammalian genomes. The quality and usability of genome sequences is increasingly conditioned by the careful integration of strategies for data collection and computational analysis, from the construction of maps and libraries to the assembly of raw data into sequence contigs and chromosome-sized scaffolds. Once the sequence is assembled, a major challenge is the mapping of biologically relevant information onto this sequence: promoters, introns and exons of protein-encoding genes, regulatory elements, functional RNAs, pseudogenes, transposons, etc. The methodological ...

  9. Genome packaging in viruses

    OpenAIRE

    Sun, Siyang; Rao, Venigalla B.; Rossmann, Michael G.

    2010-01-01

    Genome packaging is a fundamental process in a viral life cycle. Many viruses assemble preformed capsids into which the genomic material is subsequently packaged. These viruses use a packaging motor protein that is driven by the hydrolysis of ATP to condense the nucleic acids into a confined space. How these motor proteins package viral genomes had been poorly understood until recently, when a few X-ray crystal structures and cryo-electron microscopy structures became available. Here we discu...

  10. Mind the gap; seven reasons to close fragmented genome assemblies.

    Science.gov (United States)

    Thomma, Bart P H J; Seidl, Michael F; Shi-Kunne, Xiaoqian; Cook, David E; Bolton, Melvin D; van Kan, Jan A L; Faino, Luigi

    2016-05-01

    Like other domains of life, research into the biology of filamentous microbes has greatly benefited from the advent of whole-genome sequencing. Next-generation sequencing (NGS) technologies have revolutionized sequencing, making genomic sciences accessible to many academic laboratories including those that study non-model organisms. Thus, hundreds of fungal genomes have been sequenced and are publically available today, although these initiatives have typically yielded considerably fragmented genome assemblies that often lack large contiguous genomic regions. Many important genomic features are contained in intergenic DNA that is often missing in current genome assemblies, and recent studies underscore the significance of non-coding regions and repetitive elements for the life style, adaptability and evolution of many organisms. The study of particular types of genetic elements, such as telomeres, centromeres, repetitive elements, effectors, and clusters of co-regulated genes, but also of phenomena such as structural rearrangements, genome compartmentalization and epigenetics, greatly benefits from having a contiguous and high-quality, preferably even complete and gapless, genome assembly. Here we discuss a number of important reasons to produce gapless, finished, genome assemblies to help answer important biological questions. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. A genomic approach to examine the complex evolution of laurasiatherian mammals.

    Directory of Open Access Journals (Sweden)

    Björn M Hallström

    Full Text Available Recent phylogenomic studies have failed to conclusively resolve certain branches of the placental mammalian tree, despite the evolutionary analysis of genomic data from 32 species. Previous analyses of single genes and retroposon insertion data yielded support for different phylogenetic scenarios for the most basal divergences. The results indicated that some mammalian divergences were best interpreted not as a single bifurcating tree, but as an evolutionary network. In these studies the relationships among some orders of the super-clade Laurasiatheria were poorly supported, albeit not studied in detail. Therefore, 4775 protein-coding genes (6,196,263 nucleotides were collected and aligned in order to analyze the evolution of this clade. Additionally, over 200,000 introns were screened in silico, resulting in 32 phylogenetically informative long interspersed nuclear elements (LINE insertion events. The present study shows that the genome evolution of Laurasiatheria may best be understood as an evolutionary network. Thus, contrary to the common expectation to resolve major evolutionary events as a bifurcating tree, genome analyses unveil complex speciation processes even in deep mammalian divergences. We exemplify this on a subset of 1159 suitable genes that have individual histories, most likely due to incomplete lineage sorting or introgression, processes that can make the genealogy of mammalian genomes complex. These unexpected results have major implications for the understanding of evolution in general, because the evolution of even some higher level taxa such as mammalian orders may sometimes not be interpreted as a simple bifurcating pattern.

  12. Between Two Fern Genomes

    Science.gov (United States)

    2014-01-01

    Ferns are the only major lineage of vascular plants not represented by a sequenced nuclear genome. This lack of genome sequence information significantly impedes our ability to understand and reconstruct genome evolution not only in ferns, but across all land plants. Azolla and Ceratopteris are ideal and complementary candidates to be the first ferns to have their nuclear genomes sequenced. They differ dramatically in genome size, life history, and habit, and thus represent the immense diversity of extant ferns. Together, this pair of genomes will facilitate myriad large-scale comparative analyses across ferns and all land plants. Here we review the unique biological characteristics of ferns and describe a number of outstanding questions in plant biology that will benefit from the addition of ferns to the set of taxa with sequenced nuclear genomes. We explain why the fern clade is pivotal for understanding genome evolution across land plants, and we provide a rationale for how knowledge of fern genomes will enable progress in research beyond the ferns themselves. PMID:25324969

  13. Causes of genome instability

    DEFF Research Database (Denmark)

    Langie, Sabine A S; Koppen, Gudrun; Desaulniers, Daniel

    2015-01-01

    function, chromosome segregation, telomere length). The purpose of this review is to describe the crucial aspects of genome instability, to outline the ways in which environmental chemicals can affect this cancer hallmark and to identify candidate chemicals for further study. The overall aim is to make......Genome instability is a prerequisite for the development of cancer. It occurs when genome maintenance systems fail to safeguard the genome's integrity, whether as a consequence of inherited defects or induced via exposure to environmental agents (chemicals, biological agents and radiation). Thus...

  14. MIPS plant genome information resources.

    Science.gov (United States)

    Spannagl, Manuel; Haberer, Georg; Ernst, Rebecca; Schoof, Heiko; Mayer, Klaus F X

    2007-01-01

    The Munich Institute for Protein Sequences (MIPS) has been involved in maintaining plant genome databases since the Arabidopsis thaliana genome project. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable data sets for model plant genomes as a backbone against which experimental data, for example from high-throughput functional genomics, can be organized and evaluated. In addition, model genomes also form a scaffold for comparative genomics, and much can be learned from genome-wide evolutionary studies.

  15. Genome Sequence of the Palaeopolyploid soybean

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.

    2009-08-03

    Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.

  16. A genômica funcional no âmbito da produção animal: estado da arte e perspectivas Functional genomics in the field of animal science: state-of-the-art and perspectives

    Directory of Open Access Journals (Sweden)

    Luiz Roberto Furlan

    2007-07-01

    Full Text Available Os últimos vinte anos caracterizaram-se pela proliferação de tecnologias que tornaram possível decifrar o genoma das espécies, localizar e identificar particularidades na sua seqüência, elucidar as suas funções dentro dos sistemas biológicos e, sobretudo, começar a entender os mecanismos que controlam as interações entre os genótipos e os estímulos ambientais, que são responsáveis pela diversidade fenotípica. Estes estudos sobre as bases moleculares da variabilidade fenotípica abriram uma nova abordagem científica, caracterizada pela multiplicidade das questões envolvidas, que resultou no surgimento de novas áreas de pesquisa, cujos conhecimentos estão sendo aplicados em diversos campos da biologia, inclusive na zootecnia. Tendo em vista o grande impacto que tais conhecimentos estão tendo sobre a compreensão dos fenômenos biológicos, parece ser oportuno fazer uma avaliação das potencialidades de aplicação das abordagens de Genômica Funcional em pesquisas de nutrição e alimentação de ruminantes. Nesse contexto, este artigo está focado na descrição das principais "ferramentas genômicas" disponíveis e na discussão sobre a viabilidade de se utilizar as informações por elas geradas em benefício da produção animal.The last twenty years have been characterized by some remarkable technological advances in the field of genomics which were essential to unveil the genome of varies species. Furthermore, these genomic advances contributed to pinpoint particularities in genome sequences which might be associated with phenotypic variations, therefore, it became possible to study functions associated with specific sequences in a more holistic context within biological systems. More importantly, the blossoming in genomics contributed to a better understanding on the mechanisms that control the interactions between genotype and environmental factors which are responsible for phenotypic variability. Genomic advances

  17. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes

    Science.gov (United States)

    Liu, Shengyi; Liu, Yumei; Yang, Xinhua; Tong, Chaobo; Edwards, David; Parkin, Isobel A. P.; Zhao, Meixia; Ma, Jianxin; Yu, Jingyin; Huang, Shunmou; Wang, Xiyin; Wang, Junyi; Lu, Kun; Fang, Zhiyuan; Bancroft, Ian; Yang, Tae-Jin; Hu, Qiong; Wang, Xinfa; Yue, Zhen; Li, Haojie; Yang, Linfeng; Wu, Jian; Zhou, Qing; Wang, Wanxin; King, Graham J; Pires, J. Chris; Lu, Changxin; Wu, Zhangyan; Sampath, Perumal; Wang, Zhuo; Guo, Hui; Pan, Shengkai; Yang, Limei; Min, Jiumeng; Zhang, Dong; Jin, Dianchuan; Li, Wanshun; Belcram, Harry; Tu, Jinxing; Guan, Mei; Qi, Cunkou; Du, Dezhi; Li, Jiana; Jiang, Liangcai; Batley, Jacqueline; Sharpe, Andrew G; Park, Beom-Seok; Ruperao, Pradeep; Cheng, Feng; Waminal, Nomar Espinosa; Huang, Yin; Dong, Caihua; Wang, Li; Li, Jingping; Hu, Zhiyong; Zhuang, Mu; Huang, Yi; Huang, Junyan; Shi, Jiaqin; Mei, Desheng; Liu, Jing; Lee, Tae-Ho; Wang, Jinpeng; Jin, Huizhe; Li, Zaiyun; Li, Xun; Zhang, Jiefu; Xiao, Lu; Zhou, Yongming; Liu, Zhongsong; Liu, Xuequn; Qin, Rui; Tang, Xu; Liu, Wenbin; Wang, Yupeng; Zhang, Yangyong; Lee, Jonghoon; Kim, Hyun Hee; Denoeud, France; Xu, Xun; Liang, Xinming; Hua, Wei; Wang, Xiaowu; Wang, Jun; Chalhoub, Boulos; Paterson, Andrew H

    2014-01-01

    Polyploidization has provided much genetic variation for plant adaptive evolution, but the mechanisms by which the molecular evolution of polyploid genomes establishes genetic architecture underlying species differentiation are unclear. Brassica is an ideal model to increase knowledge of polyploid evolution. Here we describe a draft genome sequence of Brassica oleracea, comparing it with that of its sister species B. rapa to reveal numerous chromosome rearrangements and asymmetrical gene loss in duplicated genomic blocks, asymmetrical amplification of transposable elements, differential gene co-retention for specific pathways and variation in gene expression, including alternative splicing, among a large number of paralogous and orthologous genes. Genes related to the production of anticancer phytochemicals and morphological variations illustrate consequences of genome duplication and gene divergence, imparting biochemical and morphological variation to B. oleracea. This study provides insights into Brassica genome evolution and will underpin research into the many important crops in this genus. PMID:24852848

  18. Genomics Research: World Survey of Public Funding

    Directory of Open Access Journals (Sweden)

    Cook-Deegan Robert M

    2008-10-01

    Full Text Available Abstract Background Over the past two decades, genomics has evolved as a scientific research discipline. Genomics research was fueled initially by government and nonprofit funding sources, later augmented by private research and development (R&D funding. Citizens and taxpayers of many countries have funded much of the research, and have expectations about access to the resulting information and knowledge. While access to knowledge gained from all publicly funded research is desired, access is especially important for fields that have broad social impact and stimulate public dialogue. Genomics is one such field, where public concerns are raised for reasons such as health care and insurance implications, as well as personal and ancestral identification. Thus, genomics has grown rapidly as a field, and attracts considerable interest. Results One way to study the growth of a field of research is to examine its funding. This study focuses on public funding of genomics research, identifying and collecting data from major government and nonprofit organizations around the world, and updating previous estimates of world genomics research funding, including information about geographical origins. We initially identified 89 publicly funded organizations; we requested information about each organization's funding of genomics research. Of these organizations, 48 responded and 34 reported genomics research expenditures (of those that responded but did not supply information, some did not fund such research, others could not quantify it. The figures reported here include all the largest funders and we estimate that we have accounted for most of the genomics research funding from government and nonprofit sources. Conclusion Aggregate spending on genomics research from 34 funding sources averaged around $2.9 billion in 2003 – 2006. The United States spent more than any other country on genomics research, corresponding to 35% of the overall worldwide public

  19. Unveiling the Mysteries of Mars with a Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM)

    Science.gov (United States)

    Edmunson, J.; Gaskin, J. A.; Doloboff, I. J.; Jerman, G.

    2017-01-01

    Development of a miniaturized scanning electron microscope that will utilize the martian atmosphere to dissipate charge during analysis continues. This instrument is expected to be used on a future rover or lander to answer fundamental Mars science questions. To identify the most important questions, a survey was taken at the 47th Lunar and Planetary Science Conference (LPSC). From the gathered information initial topics were identified for a SEM on the martian surface. These priorities are identified and discussed below. Additionally, a concept of operations is provided with the goal of maximizing the science obtained with the minimum amount of communication with the instrument.

  20. A comprehensive crop genome research project: the Superhybrid Rice Genome Project in China.

    Science.gov (United States)

    Yu, Jun; Wong, Gane Ka-Shu; Liu, Siqi; Wang, Jian; Yang, Huanming

    2007-06-29

    In May 2000, the Beijing Institute of Genomics formally announced the launch of a comprehensive crop genome research project on rice genomics, the Chinese Superhybrid Rice Genome Project. SRGP is not simply a sequencing project targeted to a single rice (Oryza sativa L.) genome, but a full-swing research effort with an ultimate goal of providing inclusive basic genomic information and molecular tools not only to understand biology of the rice, both as an important crop species and a model organism of cereals, but also to focus on a popular superhybrid rice landrace, LYP9. We have completed the first phase of SRGP and provide the rice research community with a finished genome sequence of an indica variety, 93-11 (the paternal cultivar of LYP9), together with ample data on subspecific (between subspecies) polymorphisms, transcriptomes and proteomes, useful for within-species comparative studies. In the second phase, we have acquired the genome sequence of the maternal cultivar, PA64S, together with the detailed catalogues of genes uniquely expressed in the parental cultivars and the hybrid as well as allele-specific markers that distinguish parental alleles. Although SRGP in China is not an open-ended research programme, it has been designed to pave a way for future plant genomics research and application, such as to interrogate fundamentals of plant biology, including genome duplication, polyploidy and hybrid vigour, as well as to provide genetic tools for crop breeding and to carry along a social burden-leading a fight against the world's hunger. It began with genomics, the newly developed and industry-scale research field, and from the world's most populous country. In this review, we summarize our scientific goals and noteworthy discoveries that exploit new territories of systematic investigations on basic and applied biology of rice and other major cereal crops.

  1. Comparative scaffolding and gap filling of ancient bacterial genomes applied to two ancient Yersinia pestis genomes

    Science.gov (United States)

    Doerr, Daniel; Chauve, Cedric

    2017-01-01

    Yersinia pestis is the causative agent of the bubonic plague, a disease responsible for several dramatic historical pandemics. Progress in ancient DNA (aDNA) sequencing rendered possible the sequencing of whole genomes of important human pathogens, including the ancient Y. pestis strains responsible for outbreaks of the bubonic plague in London in the 14th century and in Marseille in the 18th century, among others. However, aDNA sequencing data are still characterized by short reads and non-uniform coverage, so assembling ancient pathogen genomes remains challenging and often prevents a detailed study of genome rearrangements. It has recently been shown that comparative scaffolding approaches can improve the assembly of ancient Y. pestis genomes at a chromosome level. In the present work, we address the last step of genome assembly, the gap-filling stage. We describe an optimization-based method AGapEs (ancestral gap estimation) to fill in inter-contig gaps using a combination of a template obtained from related extant genomes and aDNA reads. We show how this approach can be used to refine comparative scaffolding by selecting contig adjacencies supported by a mix of unassembled aDNA reads and comparative signal. We applied our method to two Y. pestis data sets from the London and Marseilles outbreaks, for which we obtained highly improved genome assemblies for both genomes, comprised of, respectively, five and six scaffolds with 95 % of the assemblies supported by ancient reads. We analysed the genome evolution between both ancient genomes in terms of genome rearrangements, and observed a high level of synteny conservation between these strains. PMID:29114402

  2. Evidence that personal genome testing enhances student learning in a course on genomics and personalized medicine.

    Directory of Open Access Journals (Sweden)

    Keyan Salari

    Full Text Available An emerging debate in academic medical centers is not about the need for providing trainees with fundamental education on genomics, but rather the most effective educational models that should be deployed. At Stanford School of Medicine, a novel hands-on genomics course was developed in 2010 that provided students the option to undergo personal genome testing as part of the course curriculum. We hypothesized that use of personal genome testing in the classroom would enhance the learning experience of students. No data currently exist on how such methods impact student learning; thus, we surveyed students before and after the course to determine its impact. We analyzed responses using paired statistics from the 31 medical and graduate students who completed both pre-course and post-course surveys. Participants were stratified by those who did (N = 23 or did not (N = 8 undergo personal genome testing. In reflecting on the experience, 83% of students who underwent testing stated that they were pleased with their decision compared to 12.5% of students who decided against testing (P = 0.00058. Seventy percent of those who underwent personal genome testing self-reported a better understanding of human genetics on the basis of having undergone testing. Further, students who underwent personal genome testing demonstrated an average 31% increase in pre- to post-course scores on knowledge questions (P = 3.5×10(-6; this was significantly higher (P = 0.003 than students who did not undergo testing, who showed a non-significant improvement. Undergoing personal genome testing and using personal genotype data in the classroom enhanced students' self-reported and assessed knowledge of genomics, and did not appear to cause significant anxiety. At least for self-selected students, the incorporation of personal genome testing can be an effective educational tool to teach important concepts of clinical genomic testing.

  3. Genomic dark matter: the reliability of short read mapping illustrated by the genome mappability score.

    Science.gov (United States)

    Lee, Hayan; Schatz, Michael C

    2012-08-15

    Genome resequencing and short read mapping are two of the primary tools of genomics and are used for many important applications. The current state-of-the-art in mapping uses the quality values and mapping quality scores to evaluate the reliability of the mapping. These attributes, however, are assigned to individual reads and do not directly measure the problematic repeats across the genome. Here, we present the Genome Mappability Score (GMS) as a novel measure of the complexity of resequencing a genome. The GMS is a weighted probability that any read could be unambiguously mapped to a given position and thus measures the overall composition of the genome itself. We have developed the Genome Mappability Analyzer to compute the GMS of every position in a genome. It leverages the parallelism of cloud computing to analyze large genomes, and enabled us to identify the 5-14% of the human, mouse, fly and yeast genomes that are difficult to analyze with short reads. We examined the accuracy of the widely used BWA/SAMtools polymorphism discovery pipeline in the context of the GMS, and found discovery errors are dominated by false negatives, especially in regions with poor GMS. These errors are fundamental to the mapping process and cannot be overcome by increasing coverage. As such, the GMS should be considered in every resequencing project to pinpoint the 'dark matter' of the genome, including of known clinically relevant variations in these regions. The source code and profiles of several model organisms are available at http://gma-bio.sourceforge.net

  4. Advances in Genomics of Entomopathogenic Fungi.

    Science.gov (United States)

    Wang, J B; St Leger, R J; Wang, C

    2016-01-01

    Fungi are the commonest pathogens of insects and crucial regulators of insect populations. The rapid advance of genome technologies has revolutionized our understanding of entomopathogenic fungi with multiple Metarhizium spp. sequenced, as well as Beauveria bassiana, Cordyceps militaris, and Ophiocordyceps sinensis among others. Phylogenomic analysis suggests that the ancestors of many of these fungi were plant endophytes or pathogens, with entomopathogenicity being an acquired characteristic. These fungi now occupy a wide range of habitats and hosts, and their genomes have provided a wealth of information on the evolution of virulence-related characteristics, as well as the protein families and genomic structure associated with ecological and econutritional heterogeneity, genome evolution, and host range diversification. In particular, their evolutionary transition from plant pathogens or endophytes to insect pathogens provides a novel perspective on how new functional mechanisms important for host switching and virulence are acquired. Importantly, genomic resources have helped make entomopathogenic fungi ideal model systems for answering basic questions in parasitology, entomology, and speciation. At the same time, identifying the selective forces that act upon entomopathogen fitness traits could underpin both the development of new mycoinsecticides and further our understanding of the natural roles of these fungi in nature. These roles frequently include mutualistic relationships with plants. Genomics has also facilitated the rapid identification of genes encoding biologically useful molecules, with implications for the development of pharmaceuticals and the use of these fungi as bioreactors. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Harnessing Whole Genome Sequencing in Medical Mycology.

    Science.gov (United States)

    Cuomo, Christina A

    2017-01-01

    Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

  6. The Salmonella enterica Pan-genome

    DEFF Research Database (Denmark)

    Jacobsen, Annika; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2011-01-01

    Salmonella enterica is divided into four subspecies containing a large number of different serovars, several of which are important zoonotic pathogens and some show a high degree of host specificity or host preference. We compare 45 sequenced S. enterica genomes that are publicly available (22......, and the core and pan-genome of Salmonella were estimated to be around 2,800 and 10,000 gene families, respectively. The constructed pan-genomic dendrograms suggest that gene content is often, but not uniformly correlated to serotype. Any given Salmonella strain has a large stable core, whilst...... there is an abundance of accessory genes, including the Salmonella pathogenicity islands (SPIs), transposable elements, phages, and plasmid DNA. We visualize conservation in the genomes in relation to chromosomal location and DNA structural features and find that variation in gene content is localized in a selection...

  7. Convergent functional genomics of psychiatric disorders.

    Science.gov (United States)

    Niculescu, Alexander B

    2013-10-01

    Genetic and gene expression studies, in humans and animal models of psychiatric and other medical disorders, are becoming increasingly integrated. Particularly for genomics, the convergence and integration of data across species, experimental modalities and technical platforms is providing a fit-to-disease way of extracting reproducible and biologically important signal, in contrast to the fit-to-cohort effect and limited reproducibility of human genetic analyses alone. With the advent of whole-genome sequencing and the realization that a major portion of the non-coding genome may contain regulatory variants, Convergent Functional Genomics (CFG) approaches are going to be essential to identify disease-relevant signal from the tremendous polymorphic variation present in the general population. Such work in psychiatry can provide an example of how to address other genetically complex disorders, and in turn will benefit by incorporating concepts from other areas, such as cancer, cardiovascular diseases, and diabetes. © 2013 Wiley Periodicals, Inc.

  8. Copy number variation in the bovine genome

    DEFF Research Database (Denmark)

    Fadista, João; Thomsen, Bo; Holm, Lars-Erik

    2010-01-01

    to genetic variation in cattle. Results We designed and used a set of NimbleGen CGH arrays that tile across the assayable portion of the cattle genome with approximately 6.3 million probes, at a median probe spacing of 301 bp. This study reports the highest resolution map of copy number variation...... in the cattle genome, with 304 CNV regions (CNVRs) being identified among the genomes of 20 bovine samples from 4 dairy and beef breeds. The CNVRs identified covered 0.68% (22 Mb) of the genome, and ranged in size from 1.7 to 2,031 kb (median size 16.7 kb). About 20% of the CNVs co-localized with segmental...... duplications, while 30% encompass genes, of which the majority is involved in environmental response. About 10% of the human orthologous of these genes are associated with human disease susceptibility and, hence, may have important phenotypic consequences. Conclusions Together, this analysis provides a useful...

  9. Application of genomic tools in plant breeding.

    Science.gov (United States)

    Pérez-de-Castro, A M; Vilanova, S; Cañizares, J; Pascual, L; Blanca, J M; Díez, M J; Prohens, J; Picó, B

    2012-05-01

    Plant breeding has been very successful in developing improved varieties using conventional tools and methodologies. Nowadays, the availability of genomic tools and resources is leading to a new revolution of plant breeding, as they facilitate the study of the genotype and its relationship with the phenotype, in particular for complex traits. Next Generation Sequencing (NGS) technologies are allowing the mass sequencing of genomes and transcriptomes, which is producing a vast array of genomic information. The analysis of NGS data by means of bioinformatics developments allows discovering new genes and regulatory sequences and their positions, and makes available large collections of molecular markers. Genome-wide expression studies provide breeders with an understanding of the molecular basis of complex traits. Genomic approaches include TILLING and EcoTILLING, which make possible to screen mutant and germplasm collections for allelic variants in target genes. Re-sequencing of genomes is very useful for the genome-wide discovery of markers amenable for high-throughput genotyping platforms, like SSRs and SNPs, or the construction of high density genetic maps. All these tools and resources facilitate studying the genetic diversity, which is important for germplasm management, enhancement and use. Also, they allow the identification of markers linked to genes and QTLs, using a diversity of techniques like bulked segregant analysis (BSA), fine genetic mapping, or association mapping. These new markers are used for marker assisted selection, including marker assisted backcross selection, 'breeding by design', or new strategies, like genomic selection. In conclusion, advances in genomics are providing breeders with new tools and methodologies that allow a great leap forward in plant breeding, including the 'superdomestication' of crops and the genetic dissection and breeding for complex traits.

  10. Unveiling hidden properties of young star clusters: differential reddening, star-formation spread, and binary fraction

    Science.gov (United States)

    Bonatto, C.; Lima, E. F.; Bica, E.

    2012-04-01

    Context. Usually, important parameters of young, low-mass star clusters are very difficult to obtain by means of photometry, especially when differential reddening and/or binaries occur in large amounts. Aims: We present a semi-analytical approach (ASAmin) that, when applied to the Hess diagram of a young star cluster, is able to retrieve the values of mass, age, star-formation spread, distance modulus, foreground and differential reddening, and binary fraction. Methods: The global optimisation method known as adaptive simulated annealing (ASA) is used to minimise the residuals between the observed and simulated Hess diagrams of a star cluster. The simulations are realistic and take the most relevant parameters of young clusters into account. Important features of the simulations are a normal (Gaussian) differential reddening distribution, a time-decreasing star-formation rate, the unresolved binaries, and the smearing effect produced by photometric uncertainties on Hess diagrams. Free parameters are cluster mass, age, distance modulus, star-formation spread, foreground and differential reddening, and binary fraction. Results: Tests with model clusters built with parameters spanning a broad range of values show that ASAmin retrieves the input values with a high precision for cluster mass, distance modulus, and foreground reddening, but they are somewhat lower for the remaining parameters. Given the statistical nature of the simulations, several runs should be performed to obtain significant convergence patterns. Specifically, we find that the retrieved (absolute minimum) parameters converge to mean values with a low dispersion as the Hess residuals decrease. When applied to actual young clusters, the retrieved parameters follow convergence patterns similar to the models. We show how the stochasticity associated with the early phases may affect the results, especially in low-mass clusters. This effect can be minimised by averaging out several twin clusters in the

  11. Preliminary Genomic Characterization of Ten Hardwood Tree Species from Multiplexed Low Coverage Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Margaret Staton

    Full Text Available Forest health issues are on the rise in the United States, resulting from introduction of alien pests and diseases, coupled with abiotic stresses related to climate change. Increasingly, forest scientists are finding genetic/genomic resources valuable in addressing forest health issues. For a set of ten ecologically and economically important native hardwood tree species representing a broad phylogenetic spectrum, we used low coverage whole genome sequencing from multiplex Illumina paired ends to economically profile their genomic content. For six species, the genome content was further analyzed by flow cytometry in order to determine the nuclear genome size. Sequencing yielded a depth of 0.8X to 7.5X, from which in silico analysis yielded preliminary estimates of gene and repetitive sequence content in the genome for each species. Thousands of genomic SSRs were identified, with a clear predisposition toward dinucleotide repeats and AT-rich repeat motifs. Flanking primers were designed for SSR loci for all ten species, ranging from 891 loci in sugar maple to 18,167 in redbay. In summary, we have demonstrated that useful preliminary genome information including repeat content, gene content and useful SSR markers can be obtained at low cost and time input from a single lane of Illumina multiplex sequence.

  12. Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

    Science.gov (United States)

    Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

    2014-07-01

    Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  13. Ginseng Genome Database: an open-access platform for genomics of Panax ginseng.

    Science.gov (United States)

    Jayakodi, Murukarthick; Choi, Beom-Soon; Lee, Sang-Choon; Kim, Nam-Hoon; Park, Jee Young; Jang, Woojong; Lakshmanan, Meiyappan; Mohan, Shobhana V G; Lee, Dong-Yup; Yang, Tae-Jin

    2018-04-12

    The ginseng (Panax ginseng C.A. Meyer) is a perennial herbaceous plant that has been used in traditional oriental medicine for thousands of years. Ginsenosides, which have significant pharmacological effects on human health, are the foremost bioactive constituents in this plant. Having realized the importance of this plant to humans, an integrated omics resource becomes indispensable to facilitate genomic research, molecular breeding and pharmacological study of this herb. The first draft genome sequences of P. ginseng cultivar "Chunpoong" were reported recently. Here, using the draft genome, transcriptome, and functional annotation datasets of P. ginseng, we have constructed the Ginseng Genome Database http://ginsengdb.snu.ac.kr /, the first open-access platform to provide comprehensive genomic resources of P. ginseng. The current version of this database provides the most up-to-date draft genome sequence (of approximately 3000 Mbp of scaffold sequences) along with the structural and functional annotations for 59,352 genes and digital expression of genes based on transcriptome data from different tissues, growth stages and treatments. In addition, tools for visualization and the genomic data from various analyses are provided. All data in the database were manually curated and integrated within a user-friendly query page. This database provides valuable resources for a range of research fields related to P. ginseng and other species belonging to the Apiales order as well as for plant research communities in general. Ginseng genome database can be accessed at http://ginsengdb.snu.ac.kr /.

  14. Computational genomics of hyperthermophiles

    NARCIS (Netherlands)

    Werken, van de H.J.G.

    2008-01-01

    With the ever increasing number of completely sequenced prokaryotic genomes and the subsequent use of functional genomics tools, e.g. DNA microarray and proteomics, computational data analysis and the integration of microbial and molecular data is inevitable. This thesis describes the computational

  15. Human genome I

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    An international conference, Human Genome I, was held Oct. 2-4, 1989 in San Diego, Calif. Selected speakers discussed: Current Status of the Genome Project; Technique Innovations; Interesting regions; Applications; and Organization - Different Views of Current and Future Science and Procedures. Posters, consisting of 119 presentations, were displayed during the sessions. 119 were indexed for inclusion to the Energy Data Base

  16. Genome size of 14 species of fireflies (Insecta, Coleoptera, Lampyridae

    Directory of Open Access Journals (Sweden)

    Gui-Chun Liu

    2017-11-01

    Full Text Available Eukaryotic genome size data are important both as the basis for comparative research into genome evolution and as estimators of the cost and difficulty of genome sequencing programs for non-model organisms. In this study, the genome size of 14 species of fireflies (Lampyridae (two genera in Lampyrinae, three genera in Luciolinae, and one genus in subfamily incertae sedis were estimated by propidium iodide (PI-based flow cytometry. The haploid genome sizes of Lampyridae ranged from 0.42 to 1.31 pg, a 3.1-fold span. Genome sizes of the fireflies varied within the tested subfamilies and genera. Lamprigera and Pyrocoelia species had large and small genome sizes, respectively. No correlation was found between genome size and morphological traits such as body length, body width, eye width, and antennal length. Our data provide additional information on genome size estimation of the firefly family Lampyridae. Furthermore, this study will help clarify the cost and difficulty of genome sequencing programs for non-model organisms and will help promote studies on firefly genome evolution.

  17. Genome-wide DNA polymorphism analyses using VariScan

    Directory of Open Access Journals (Sweden)

    Vilella Albert J

    2006-09-01

    Full Text Available Abstract Background DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. Results We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i exhaustive population-genetic analyses including those based on the coalescent theory; ii analysis adapted to the shallow data generated by the high-throughput genome projects; iii use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v visualization of the results integrated with current genome annotations in commonly available genome browsers. Conclusion VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.

  18. Unveiling Research Agendas: a study of the influences on research problem selection among academic researchers

    Energy Technology Data Exchange (ETDEWEB)

    Bianco, M.; Sutz, J.

    2016-07-01

    Research problem selection is central to the dynamics of scientific knowledge production. Research agendas result from the selection of research problems and the formulation of individual and/or collective academic strategies to address them. But, why researchers study what they study? This paper presents incipient research focused on the way different factors influence the construction of academic research agendas. It takes a researcher-oriented approach relying on opinions and perspectives of a wide range of researchers in all fields of knowledge. The empirical work is carried out in Uruguay, a country in the periphery of mainstream science, whose academic community struggles in search of a balance between the requirements of the world community of scholars and the demands from different national stakeholders. The methodology and research results from this study may be relevant to other countries, at different peripheries. Further, understanding the interplay of influences that shape research agendas is an important tool for policy analysis and planning everywhere. (Author)

  19. Lipid Droplets: A New Player in Colorectal Cancer Stem Cells Unveiled by Spectroscopic Imaging

    KAUST Repository

    Tirinato, Luca; Liberale, Carlo; Di Franco, Simone; Candeloro, Patrizio; Benfante, Antonina; La Rocca, Rosanna; Potze, Lisette; Marotta, Roberto; Ruffilli, Roberta; Rajamanickam, Vijayakumar P.; Malerba, Mario; De Angelis, Francesco; Falqui, Andrea; Carbone, Ennio; Todaro, Matilde; Medema, Jan Paul; Stassi, Giorgio; Di Fabrizio, Enzo M.

    2015-01-01

    The cancer stem cell (CSC) model is describing tumors as a hierarchical organized system and CSCs are suggested to be responsible for cancer recurrence after therapy. The identification of specific markers of CSCs is therefore of paramount importance. Here, we show that high levels of lipid droplets (LDs) are a distinctive mark of CSCs in colorectal (CR) cancer. This increased lipid content was clearly revealed by label-free Raman spectroscopy and it directly correlates with well-accepted CR-CSC markers as CD133 and Wnt pathway activity. By xenotransplantation experiments, we have finally demonstrated that CR-CSCs overexpressing LDs retain most tumorigenic potential. A relevant conceptual advance in this work is the demonstration that a cellular organelle, the LD, is a signature of CSCs, in addition to molecular markers. A further functional characterization of LDs could lead soon to design new target therapies against CR-CSCs.

  20. On the way to unveiling the atomic structure of superheavy elements

    International Nuclear Information System (INIS)

    Laatiaoui, Mustapha

    2016-01-01

    Optical spectroscopy of the transfermium elements (atomic number Z > 100) is nowadays one of the most fascinating and simultaneously challenging tasks in atomic physics. On the one hand, key atomic and even nuclear ground-state properties may be obtained by studying the spectral lines of these heaviest elements. On the other hand, these elements have to be produced “online” by heavy-ion induced fusion-evaporation reactions yielding rates on the order of a few atoms per second at most, which renders their optical spectroscopy extremely difficult. Only recently, a first foray of laser spectroscopy into this heaviest element region was reported. Several atomic transitions in the element nobelium (Z = 102) were observed and characterized, using an ultra-sensitive and highly efficient resonance ionization technique. The findings confirm the predictions and additionally provide a benchmark for theoretical modelling. The work represents an important stepping stone towards experimental studies of the atomic structure of superheavy elements.

  1. Different Evolutionary History for Basque Diaspora Populations in USA and Argentina Unveiled by Mitochondrial DNA Analysis.

    Science.gov (United States)

    Baeta, Miriam; Núñez, Carolina; Cardoso, Sergio; Palencia-Madrid, Leire; Piñeiro-Hermida, Sergio; Arriba-Barredo, Miren; Villanueva-Millán, María Jesús; M de Pancorbo, Marian

    2015-01-01

    The Basque Diaspora in Western USA and Argentina represents two populations which have maintained strong Basque cultural and social roots in a completely different geographic context. Hence, they provide an exceptional opportunity to study the maternal genetic legacy from the ancestral Basque population and assess the degree of genetic introgression from the host populations in two of the largest Basque communities outside the Basque Country. For this purpose, we analyzed the complete mitochondrial DNA control region of Basque descendants living in Western USA (n = 175) and in Argentina (n = 194). The Diaspora populations studied here displayed a genetic diversity in their European maternal input which was similar to that of the Basque source populations, indicating that not important founder effects would have occurred. Actually, the genetic legacy of the Basque population still prevailed in their present-day maternal pools, by means of a haplogroup distribution similar to the source population characterized by the presence of autochthonous Basque lineages, such as U5b1f1a and J1c5c1. However, introgression of non-Basque lineages, mostly Native American, has been observed in the Diaspora populations, particularly in Argentina, where the quick assimilation of the newcomers would have favored a wider admixture with host populations. In contrast, a longer isolation of the Diaspora groups in USA, because of language and cultural differences, would have limited the introgression of local lineages. This study reveals important differences in the maternal evolutionary histories of these Basque Diaspora populations, which have to be taken into consideration in forensic and medical genetic studies.

  2. Unveiling clusters of RNA transcript pairs associated with markers of Alzheimer's disease progression.

    Directory of Open Access Journals (Sweden)

    Ahmed Shamsul Arefin

    Full Text Available BACKGROUND: One primary goal of transcriptomic studies is identifying gene expression patterns correlating with disease progression. This is usually achieved by considering transcripts that independently pass an arbitrary threshold (e.g. p<0.05. In diseases involving severe perturbations of multiple molecular systems, such as Alzheimer's disease (AD, this univariate approach often results in a large list of seemingly unrelated transcripts. We utilised a powerful multivariate clustering approach to identify clusters of RNA biomarkers strongly associated with markers of AD progression. We discuss the value of considering pairs of transcripts which, in contrast to individual transcripts, helps avoid natural human transcriptome variation that can overshadow disease-related changes. METHODOLOGY/PRINCIPAL FINDINGS: We re-analysed a dataset of hippocampal transcript levels in nine controls and 22 patients with varying degrees of AD. A large-scale clustering approach determined groups of transcript probe sets that correlate strongly with measures of AD progression, including both clinical and neuropathological measures and quantifiers of the characteristic transcriptome shift from control to severe AD. This enabled identification of restricted groups of highly correlated probe sets from an initial list of 1,372 previously published by our group. We repeated this analysis on an expanded dataset that included all pair-wise combinations of the 1,372 probe sets. As clustering of this massive dataset is unfeasible using standard computational tools, we adapted and re-implemented a clustering algorithm that uses external memory algorithmic approach. This identified various pairs that strongly correlated with markers of AD progression and highlighted important biological pathways potentially involved in AD pathogenesis. CONCLUSIONS/SIGNIFICANCE: Our analyses demonstrate that, although there exists a relatively large molecular signature of AD progression, only

  3. The Relationship between Growth-Inequality-Poverty Triangle and Environmental Degradation: Unveiling the Reality

    Directory of Open Access Journals (Sweden)

    Syeda Anam Hassan

    2015-06-01

    Full Text Available It is important to recognize that increase in well-being is no longer dependent on further economic growth, but on economic and social well-being, which means that the decline in carbon dioxide emission without reducing real wellbeing and growth. The aim of this study is to investigate the main driving forces affecting short and long-run carbon emissions pattern due to changes in growth, inequality and poverty triangle in Pakistan over the period 1980 – 2011 by using multivariate cointegration approach. This study uses five different models i.e., each model have an important policy implication in the context of Pakistan. The results indicate that, on the short run, there is a significant negative relationship between economic growth & carbon emissions and economic growth & poverty while there is a positive relationship between i economic growth & income inequality; and ii poverty & income inequality. On the long-run, there is a significant positive relationship between GDP & income inequality, carbon dioxide emissions & income inequality, and poverty & income inequality in Pakistan. On the other side, there is a negative relationship between carbon emissions & economic growth, carbon emissions & income inequality, and economic growth & income inequality. The results of environmental Kuznets curve (EKC hypothesis show an inverted U-shaped trajectory in relation to economic growth in Pakistan. This study contributes to the debate on the existence and policy relevance of the EKC for Pakistan. The conclusion ensures the sustainability of an urgent need to look beyond the EKC by adopting courageous policy measures of environmental preservation in Pakistan irrespective of the country's level of income. For reduction of CO2 emission, environmental progressive management policies, economic transport system regulations, and low emit fuel consumption by industries are the need of the world.

  4. Anticipation of Personal Genomics Data Enhances Interest and Learning Environment in Genomics and Molecular Biology Undergraduate Courses.

    Science.gov (United States)

    Weber, K Scott; Jensen, Jamie L; Johnson, Steven M

    2015-01-01

    An important discussion at colleges is centered on determining more effective models for teaching undergraduates. As personalized genomics has become more common, we hypothesized it could be a valuable tool to make science education more hands on, personal, and engaging for college undergraduates. We hypothesized that providing students with personal genome testing kits would enhance the learning experience of students in two undergraduate courses at Brigham Young University: Advanced Molecular Biology and Genomics. These courses have an emphasis on personal genomics the last two weeks of the semester. Students taking these courses were given the option to receive personal genomics kits in 2014, whereas in 2015 they were not. Students sent their personal genomics samples in on their own and received the data after the course ended. We surveyed students in these courses before and after the two-week emphasis on personal genomics to collect data on whether anticipation of obtaining their own personal genomic data impacted undergraduate student learning. We also tested to see if specific personal genomic assignments improved the learning experience by analyzing the data from the undergraduate students who completed both the pre- and post-course surveys. Anticipation of personal genomic data significantly enhanced student interest and the learning environment based on the time students spent researching personal genomic material and their self-reported attitudes compared to those who did not anticipate getting their own data. Personal genomics homework assignments significantly enhanced the undergraduate student interest and learning based on the same criteria and a personal genomics quiz. We found that for the undergraduate students in both molecular biology and genomics courses, incorporation of personal genomic testing can be an effective educational tool in undergraduate science education.

  5. Genome Architecture and Its Roles in Human Copy Number Variation

    Directory of Open Access Journals (Sweden)

    Lu Chen

    2014-12-01

    Full Text Available Besides single-nucleotide variants in the human genome, large-scale genomic variants, such as copy number variations (CNVs, are being increasingly discovered as a genetic source of human diversity and the pathogenic factors of diseases. Recent experimental findings have shed light on the links between different genome architectures and CNV mutagenesis. In this review, we summarize various genomic features and discuss their contributions to CNV formation. Genomic repeats, including both low-copy and high-copy repeats, play important roles in CNV instability, which was initially known as DNA recombination events. Furthermore, it has been found that human genomic repeats can also induce DNA replication errors and consequently result in CNV mutations. Some recent studies showed that DNA replication timing, which reflects the high-order information of genomic organization, is involved in human CNV mutations. Our review highlights that genome architecture, from DNA sequence to high-order genomic organization, is an important molecular factor in CNV mutagenesis and human genomic instability.

  6. New perspectives on microbial community distortion after whole-genome amplification

    Science.gov (United States)

    Whole-genome amplification (WGA) has become an important tool to explore the genomic information of microorganisms in an environmental sample with limited biomass, however potential selective biases during the amplification processes are poorly understood. Here, we describe the e...

  7. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  8. Rumen microbial genomics

    International Nuclear Information System (INIS)

    Morrison, M.; Nelson, K.E.

    2005-01-01

    Improving microbial degradation of plant cell wall polysaccharides remains one of the highest priority goals for all livestock enterprises, including the cattle herds and draught animals of developing countries. The North American Consortium for Genomics of Fibrolytic Ruminal Bacteria was created to promote the sequencing and comparative analysis of rumen microbial genomes, offering the potential to fully assess the genetic potential in a functional and comparative fashion. It has been found that the Fibrobacter succinogenes genome encodes many more endoglucanases and cellodextrinases than previously isolated, and several new processive endoglucanases have been identified by genome and proteomic analysis of Ruminococcus albus, in addition to a variety of strategies for its adhesion to fibre. The ramifications of acquiring genome sequence data for rumen microorganisms are profound, including the potential to elucidate and overcome the biochemical, ecological or physiological processes that are rate limiting for ruminal fibre degradation. (author)

  9. Microbial Genomes Multiply

    Science.gov (United States)

    Doolittle, Russell F.

    2002-01-01

    The publication of the first complete sequence of a bacterial genome in 1995 was a signal event, underscored by the fact that the article has been cited more than 2,100 times during the intervening seven years. It was a marvelous technical achievement, made possible by automatic DNA-sequencing machines. The feat is the more impressive in that complete genome sequencing has now been adopted in many different laboratories around the world. Four years ago in these columns I examined the situation after a dozen microbial genomes had been completed. Now, with upwards of 60 microbial genome sequences determined and twice that many in progress, it seems reasonable to assess just what is being learned. Are new concepts emerging about how cells work? Have there been practical benefits in the fields of medicine and agriculture? Is it feasible to determine the genomic sequence of every bacterial species on Earth? The answers to these questions maybe Yes, Perhaps, and No, respectively.

  10. The genome editing revolution

    DEFF Research Database (Denmark)

    Stella, Stefano; Montoya, Guillermo

    2016-01-01

    -Cas system has become the main tool for genome editing in many laboratories. Currently the targeted genome editing technology has been used in many fields and may be a possible approach for human gene therapy. Furthermore, it can also be used to modifying the genomes of model organisms for studying human......In the last 10 years, we have witnessed a blooming of targeted genome editing systems and applications. The area was revolutionized by the discovery and characterization of the transcription activator-like effector proteins, which are easier to engineer to target new DNA sequences than...... sequence). This ribonucleoprotein complex protects bacteria from invading DNAs, and it was adapted to be used in genome editing. The CRISPR ribonucleic acid (RNA) molecule guides to the specific DNA site the Cas9 nuclease to cleave the DNA target. Two years and more than 1000 publications later, the CRISPR...

  11. The caregiver burden in lupus: findings from UNVEIL, a national online lupus survey in the United States.

    Science.gov (United States)

    Al Sawah, S; Daly, R P; Foster, S A; Naegeli, A N; Benjamin, K; Doll, H; Bond, G; Moshkovich, O; Alarcón, G S

    2017-01-01

    Lupus imposes a substantial burden on patients; however, little is known about its impact on those caring for patients with the disease. In this study, we examined the impact 'caring for patients with lupus' has on caregivers from their own perspective. UNVEIL was a one-time online national cross-sectional survey developed in partnership with the Lupus Foundation of America and fielded targeting the US Lupus Foundation of America constituents in 2014. Eligible caregivers were adults who self-identified as unpaid caregivers of patients with lupus. Eligible caregivers had to complete a series of sociodemographic questions as well as a series of well established outcome measures, such as the Short Form 12v2 Health Survey, the Work Productivity and Activity Index, the Caregiver Burden Inventory, and the Perceived Benefits of Caregiving Scale. A total of 253 caregivers completed the survey. The majority of caregivers (90.1%) were aged 60 years or younger, more than half (54.2%) were men, and more than half (59.7%) identified themselves as either a spouse or a partner to the patient with lupus they were caring for. Overall health-related quality of life was close to the norm mean of the general US population. Caregivers who were employed missed an average of 12.8% of paid work time due to caregiving responsibilities and reported a 33.5% reduction in on-the-job effectiveness. Nearly half of the caregivers surveyed (49.4%) indicated that their caregiving responsibilities impacted their ability to socialize with friends, and almost all caregivers (97.6%) reported experiencing increased anxiety and stress in relation to their caregiving role. Caregiving for patients with lupus has a substantial impact on the work productivity and the social and emotional functioning of caregivers. Healthcare professionals and policymakers should continually assess the impact of healthcare decisions on the well-being of those caring for patients with lupus. © The Author(s) 2016.

  12. The effect of post-mastectomy radiation therapy on breast implants: Unveiling biomaterial alterations with potential implications on capsular contracture

    Energy Technology Data Exchange (ETDEWEB)

    Ribuffo, Diego; Lo Torto, Federico [Department of Plastic Surgery, “Sapienza” University of Rome, Viale del Policlinico 155, 00166 Rome (Italy); Giannitelli, Sara M. [Tissue Engineering Unit, Department of Engineering, Università Campus Bio-Medico di Roma, Via Álvaro del Portillo 21, 00128 Rome (Italy); Urbini, Marco; Tortora, Luca [Surface Analysis Laboratory, Department of Mathematics and Physics, University “Roma Tre”, Via della Vasca Navale 84, 00146 Rome (Italy); INFN — National Institute of Nuclear Physics, Section of Roma Tre, Via della Vasca Navale 84, 00146 Rome (Italy); Mozetic, Pamela; Trombetta, Marcella [Tissue Engineering Unit, Department of Engineering, Università Campus Bio-Medico di Roma, Via Álvaro del Portillo 21, 00128 Rome (Italy); Basoli, Francesco; Licoccia, Silvia [Department of Chemical Science and Technologies, University of Rome “Tor Vergata”, Via della Ricerca Scientifica 1, 00173 Rome (Italy); Tombolini, Vincenzo [Department of Radiation Oncology, “Sapienza” University of Rome, Viale del Policlinico 155, 00166 Rome (Italy); Spencer-Lorillard Foundation, Viale Regina Elena 291, 00161 Rome (Italy); Cassese, Raffaele [Department of Radiation Oncology, “Sapienza” University of Rome, Viale del Policlinico 155, 00166 Rome (Italy); Scuderi, Nicolò [Department of Plastic Surgery, “Sapienza” University of Rome, Viale del Policlinico 155, 00166 Rome (Italy); and others

    2015-12-01

    Post-mastectomy breast reconstruction with expanders and implants is recognized as an integral part of breast cancer treatment. Its main complication is represented by capsular contracture, which leads to poor expansion, breast deformation, and pain, often requiring additional surgery. In such a scenario, the debate continues as to whether the second stage of breast reconstruction should be performed before or after post-mastectomy radiation therapy, in light of potential alterations induced by irradiation to silicone biomaterial. This work provides a novel, multi-technique approach to unveil the role of radiotherapy in biomaterial alterations, with potential involvement in capsular contracture. Following irradiation, implant shells underwent mechanical, chemical, and microstructural evaluation by means of tensile testing, Attenuated Total Reflectance Fourier Transform InfraRed spectroscopy (ATR/FTIR), Scanning Electron Microscopy (SEM), high resolution stylus profilometry, and Time of Flight Secondary Ion Mass Spectrometry (ToF-SIMS). Our findings are consistent with radiation-induced modifications of silicone that, although not detectable at the microscale, can be evidenced by more sophisticated nanoscale surface analyses. In light of these results, biomaterial irradiation cannot be ruled out as one of the possible co-factors underlying capsular contracture. - Highlights: • The debate continues whether to perform breast reconstruction before or after PMRT. • Radiation therapy may alter implant material, concurring to capsular contracture. • In this work, irradiated implants were investigated by a multi-technique approach. • Radiation-induced alterations could be evidenced by ATR/FTIR and ToF-SIMS. • Reported alteration might represent a co-factor underlying capsular contracture.

  13. Unveiling the Aggregation of Lycopene in Vitro and in Vivo: UV-Vis, Resonance Raman, and Raman Imaging Studies.

    Science.gov (United States)

    Ishigaki, Mika; Meksiarun, Phiranuphon; Kitahama, Yasutaka; Zhang, Leilei; Hashimoto, Hideki; Genkawa, Takuma; Ozaki, Yukihiro

    2017-08-31

    The present study investigates the structure of lycopene aggregates both in vitro and in vivo using ultraviolet-visible (UV-vis) and Raman spectroscopies. The electronic absorption bands of the J- and H-aggregates in vitro shift to lower and higher energies, respectively, compared to that of the lycopene monomer. Along with these results, the frequencies of the ν 1 Raman bands were shifted to lower and higher frequencies, respectively. By plotting the frequencies of the ν 1 Raman band against the S 0 → S 2 transition energy, a linear relationship between the data set with different aggregation conformations can be obtained. Therefore, the band positions depending on the different conformations can be explained based on the idea that the effective conjugated C═C chain lengths within lycopene molecules are different due to the environmental effect (site-shift effect) caused by the aggregation conformation. Applying this knowledge to the in vivo measurement of a tomato fruit sample, the relationship between the aggregation conformation of lycopene and the spectral patterns observed in the UV-vis as well as Raman spectra in different parts of tomato fruits was discussed in detail. The results showed that the concentration of lycopene (particularly that of the J-aggregate) specifically increased, whereas that of chlorophyll decreased, with ripening. Furthermore, Raman imaging indicated that lycopene with different aggregate conformations was distributed inhomogeneously, even within one sample. The layer formation in tomato tissues with high concentrations of J- and H-aggregates was successfully visualized. In this manner, the presence of lycopene distributions with different aggregate conformations was unveiled in vivo.

  14. The crystal structures of the tryparedoxin-tryparedoxin peroxidase couple unveil the structural determinants of Leishmania detoxification pathway.

    Directory of Open Access Journals (Sweden)

    Annarita Fiorillo

    Full Text Available Leishmaniasis is a neglected disease caused by Leishmania, an intracellular protozoan parasite which possesses a unique thiol metabolism based on trypanothione. Trypanothione is used as a source of electrons by the tryparedoxin/tryparedoxin peroxidase system (TXN/TXNPx to reduce the hydroperoxides produced by macrophages during infection. This detoxification pathway is not only unique to the parasite but is also essential for its survival; therefore, it constitutes a most attractive drug target. Several forms of TXNPx, with very high sequence identity to one another, have been found in Leishmania strains, one of which has been used as a component of a potential anti-leishmanial polyprotein vaccine. The structures of cytosolic TXN and TXNPx from L. major (LmTXN and LmTXNPx offer a unique opportunity to study peroxide reduction in Leishmania parasites at a molecular level, and may provide new tools for multienzyme inhibition-based drug discovery. Structural analyses bring out key structural features to elucidate LmTXN and LmTXNPx function. LmTXN displays an unusual N-terminal α-helix which allows the formation of a stable domain-swapped dimer. In LmTXNPx, crystallized in reducing condition, both the locally unfolded (LU and fully folded (FF conformations, typical of the oxidized and reduced protein respectively, are populated. The structural analysis presented here points to a high flexibility of the loop that includes the peroxidatic cysteine which facilitates Cys52 to form an inter-chain disulfide bond with the resolving cysteine (Cys173, thereby preventing over-oxidation which would inactivate the enzyme. Analysis of the electrostatic surface potentials of both LmTXN and LmTXNPx unveils the structural elements at the basis of functionally relevant interaction between the two proteins. Finally, the structural analysis of TXNPx allows us to identify the position of the epitopes that make the protein antigenic and therefore potentially suitable

  15. Freedom and Responsibility in Synthetic Genomics: The Synthetic Yeast Project

    OpenAIRE

    Sliva, Anna; Yang, Huanming; Boeke, Jef D.; Mathews, Debra J. H.

    2015-01-01

    First introduced in 2011, the Synthetic Yeast Genome (Sc2.0) Project is a large international synthetic genomics project that will culminate in the first eukaryotic cell (Saccharomyces cerevisiae) with a fully synthetic genome. With collaborators from across the globe and from a range of institutions spanning from do-it-yourself biology (DIYbio) to commercial enterprises, it is important that all scientists working on this project are cognizant of the ethical and policy issues associated with...

  16. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  17. Genomic sovereignty and the African promise: mining the African genome for the benefit of Africa.

    Science.gov (United States)

    de Vries, Jantina; Pepper, Michael

    2012-08-01

    Scientific interest in genomics in Africa is on the rise with a number of funding initiatives aimed specifically at supporting research in this area. Genomics research on material of African origin raises a number of important ethical issues. A prominent concern relates to sample export, which is increasingly seen by researchers and ethics committees across the continent as being problematic. The concept of genomic sovereignty proposes that unique patterns of genomic variation can be found in human populations, and that these are commercially, scientifically or symbolically valuable and in need of protection against exploitation. Although it is appealing as a response to increasing concerns regarding sample export, there are a number of important conceptual problems relating to the term. It is not clear, for instance, whether it is appropriate that ownership over human genomic samples should rest with national governments. Furthermore, ethnic groups in Africa are frequently spread across multiple nation states, and protection offered in one state may not prevent researchers from accessing the same group elsewhere. Lastly, scientific evidence suggests that the assumption that genomic data is unique for population groups is false. Although the frequency with which particular variants are found can differ between groups, such genes or variants per se are not unique to any population group. In this paper, the authors describe these concerns in detail and argue that the concept of genomic sovereignty alone may not be adequate to protect the genetic resources of people of African descent.

  18. Ensembl Genomes 2013: scaling up access to genome-wide data.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Hughes, Daniel Seth Toney; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Langridge, Nicholas; McDowall, Mark D; Maheswari, Uma; Maslen, Gareth; Nuhn, Michael; Ong, Chuang Kee; Paulini, Michael; Pedro, Helder; Toneva, Iliana; Tuli, Mary Ann; Walts, Brandon; Williams, Gareth; Wilson, Derek; Youens-Clark, Ken; Monaco, Marcela K; Stein, Joshua; Wei, Xuehong; Ware, Doreen; Bolser, Daniel M; Howe, Kevin Lee; Kulesha, Eugene; Lawson, Daniel; Staines, Daniel Michael

    2014-01-01

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species. The project exploits and extends technologies for genome annotation, analysis and dissemination, developed in the context of the vertebrate-focused Ensembl project, and provides a complementary set of resources for non-vertebrate species through a consistent set of programmatic and interactive interfaces. These provide access to data including reference sequence, gene models, transcriptional data, polymorphisms and comparative analysis. This article provides an update to the previous publications about the resource, with a focus on recent developments. These include the addition of important new genomes (and related data sets) including crop plants, vectors of human disease and eukaryotic pathogens. In addition, the resource has scaled up its representation of bacterial genomes, and now includes the genomes of over 9000 bacteria. Specific extensions to the web and programmatic interfaces have been developed to support users in navigating these large data sets. Looking forward, analytic tools to allow targeted selection of data for visualization and download are likely to become increasingly important in future as the number of available genomes increases within all domains of life, and some of the challenges faced in representing bacterial data are likely to become commonplace for eukaryotes in future.

  19. GI-SVM: A sensitive method for predicting genomic islands based on unannotated sequence of a single genome.

    Science.gov (United States)

    Lu, Bingxin; Leong, Hon Wai

    2016-02-01

    Genomic islands (GIs) are clusters of functionally related genes acquired by lateral genetic transfer (LGT), and they are present in many bacterial genomes. GIs are extremely important for bacterial research, because they not only promote genome evolution but also contain genes that enhance adaption and enable antibiotic resistance. Many methods have been proposed to predict GI. But most of them rely on either annotations or comparisons with other closely related genomes. Hence these methods cannot be easily applied to new genomes. As the number of newly sequenced bacterial genomes rapidly increases, there is a need for methods to detect GI based solely on sequences of a single genome. In this paper, we propose a novel method, GI-SVM, to predict GIs given only the unannotated genome sequence. GI-SVM is based on one-class support vector machine (SVM), utilizing composition bias in terms of k-mer content. From our evaluations on three real genomes, GI-SVM can achieve higher recall compared with current methods, without much loss of precision. Besides, GI-SVM allows flexible parameter tuning to get optimal results for each genome. In short, GI-SVM provides a more sensitive method for researchers interested in a first-pass detection of GI in newly sequenced genomes.

  20. Phytozome Comparative Plant Genomics Portal

    Energy Technology Data Exchange (ETDEWEB)

    Goodstein, David; Batra, Sajeev; Carlson, Joseph; Hayes, Richard; Phillips, Jeremy; Shu, Shengqiang; Schmutz, Jeremy; Rokhsar, Daniel

    2014-09-09

    The Dept. of Energy Joint Genome Institute is a genomics user facility supporting DOE mission science in the areas of Bioenergy, Carbon Cycling, and Biogeochemistry. The Plant Program at the JGI applies genomic, analytical, computational and informatics platforms and methods to: 1. Understand and accelerate the improvement (domestication) of bioenergy crops 2. Characterize and moderate plant response to climate change 3. Use comparative genomics to identify constrained elements and infer gene function 4. Build high quality genomic resource platforms of JGI Plant Flagship genomes for functional and experimental work 5. Expand functional genomic resources for Plant Flagship genomes

  1. Signatures of the Galactic bar on stellar kinematics unveiled by APOGEE

    Science.gov (United States)

    Palicio, Pedro A.; Martinez-Valpuesta, Inma; Prieto, Carlos Allende; Vecchia, Claudio Dalla; Zamora, Olga; Zasowski, Gail; Fernandez-Trincado, J. G.; Masters, Karen L.; García-Hernández, D. A.; Roman-Lopes, Alexandre

    2018-05-01

    Bars are common galactic structures in the local universe that play an important role in the secular evolution of galaxies, including the Milky Way. In particular, the velocity distribution of individual stars in our galaxy is useful to shed light on stellar dynamics, and provides information complementary to that inferred from the integrated light of external galaxies. However, since a wide variety of models reproduce the distribution of velocity and the velocity dispersion observed in the Milky Way, we look for signatures of the bar on higher-order moments of the line-of-sight velocity (V_los) distribution. We make use of two different numerical simulations -one that has developed a bar and one that remains nearly axisymmetric- to compare them with observations in the latest APOGEE data release (SDSS DR14). This comparison reveals three interesting structures that support the notion that the Milky Way is a barred galaxy. A high skewness region found at positive longitudes constrains the orientation angle of the bar, and is incompatible with the orientation of the bar at ℓ = 0° proposed in previous studies. We also analyse the V_los distributions in three regions, and introduce the Hellinger distance to quantify the differences among them. Our results show a strong non-Gaussian distribution both in the data and in the barred model, confirming the qualitative conclusions drawn from the velocity maps. In contrast to earlier work, we conclude it is possible to infer the presence of the bar from the kurtosis distribution.

  2. Unveiling the transcriptional features associated with coccolithovirus infection of natural Emiliania huxleyi blooms.

    Science.gov (United States)

    Pagarete, António; Le Corguillé, Gildas; Tiwari, Bela; Ogata, Hiroyuki; de Vargas, Colomban; Wilson, William H; Allen, Michael J

    2011-12-01

    Lytic viruses have been implicated in the massive cellular lysis observed during algal blooms, through which they assume a prominent role in oceanic carbon and nutrient flows. Despite their impact on biogeochemical cycling, the transcriptional dynamics of these important oceanic events is still poorly understood. Here, we employ an oligonucleotide microarray to monitor host (Emiliania huxleyi) and virus (coccolithovirus) transcriptomic features during the course of E. huxleyi blooms induced in seawater-based mesocosm enclosures. Host bloom development and subsequent coccolithovirus infection was associated with a major shift in transcriptional profile. In addition to the expected metabolic requirements typically associated with viral infection (amino acid and nucleotide metabolism, as well as transcription- and replication-associated functions), the results strongly suggest that the manipulation of lipid metabolism plays a fundamental role during host-virus interaction. The results herein reveal the scale, so far massively underestimated, of the transcriptional domination that occurs during coccolithovirus infection in the natural environment. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Comparative analyses of glycerotoxin expression unveil a novel structural organization of the bloodworm venom system.

    Science.gov (United States)

    Richter, Sandy; Helm, Conrad; Meunier, Frederic A; Hering, Lars; Campbell, Lahcen I; Drukewitz, Stephan H; Undheim, Eivind A B; Jenner, Ronald A; Schiavo, Giampietro; Bleidorn, Christoph

    2017-03-04

    We present the first molecular characterization of glycerotoxin (GLTx), a potent neurotoxin found in the venom of the bloodworm Glycera tridactyla (Glyceridae, Annelida). Within the animal kingdom, GLTx shows a unique mode of action as it can specifically up-regulate the activity of Ca v 2.2 channels (N-type) in a reversible manner. The lack of sequence information has so far hampered a detailed understanding of its mode of action. Our analyses reveal three ~3.8 kb GLTx full-length transcripts, show that GLTx represents a multigene family, and suggest it functions as a dimer. An integrative approach using transcriptomics, quantitative real-time PCR, in situ hybridization, and immunocytochemistry shows that GLTx is highly expressed exclusively in four pharyngeal lobes, a previously unrecognized part of the venom apparatus. Our results overturn a century old textbook view on the glycerid venom system, suggesting that it is anatomically and functionally much more complex than previously thought. The herein presented GLTx sequence information constitutes an important step towards the establishment of GLTx as a versatile tool to understand the mechanism of synaptic function, as well as the mode of action of this novel neurotoxin.

  4. Synchronization unveils the organization of ecological networks with positive and negative interactions

    Science.gov (United States)

    Girón, Andrea; Saiz, Hugo; Bacelar, Flora S.; Andrade, Roberto F. S.; Gómez-Gardeñes, Jesús

    2016-06-01

    Network science has helped to understand the organization principles of the interactions among the constituents of large complex systems. However, recently, the high resolution of the data sets collected has allowed to capture the different types of interactions coexisting within the same system. A particularly important example is that of systems with positive and negative interactions, a usual feature appearing in social, neural, and ecological systems. The interplay of links of opposite sign presents natural difficulties for generalizing typical concepts and tools applied to unsigned networks and, moreover, poses some questions intrinsic to the signed nature of the network, such as how are negative interactions balanced by positive ones so to allow the coexistence and survival of competitors/foes within the same system? Here, we show that synchronization phenomenon is an ideal benchmark for uncovering such balance and, as a byproduct, to assess which nodes play a critical role in the overall organization of the system. We illustrate our findings with the analysis of synthetic and real ecological networks in which facilitation and competitive interactions coexist.

  5. ERP Response Unveils Effect of Second Language Manipulation on First Language Processing.

    Directory of Open Access Journals (Sweden)

    Elvira Khachatryan

    Full Text Available Lexical access in bilinguals has been considered either selective or non-selective and evidence exists in favor of both hypotheses. We conducted a linguistic experiment to assess whether a bilingual's language mode influences the processing of first language information. We recorded event related potentials during a semantic priming paradigm with a covert manipulation of the second language (L2 using two types of stimulus presentations (short and long. We observed a significant facilitation of word pairs related in L2 in the short version reflected by a decrease in N400 amplitude in response to target words related to the English meaning of an inter-lingual homograph (homograph-unrelated group. This was absent in the long version, as the N400 amplitude for this group was similar to the one for the control-unrelated group. We also interviewed the participants whether they were aware of the importance of L2 in the experiment. We conclude that subjects participating in the long and short versions were in different language modes: closer to monolingual mode for the long and closer to bilingual mode for the short version; and that awareness about covert manipulation of L2 can influence the language mode, which in its turn influences the processing of the first language.

  6. Synchronization unveils the organization of ecological networks with positive and negative interactions.

    Science.gov (United States)

    Girón, Andrea; Saiz, Hugo; Bacelar, Flora S; Andrade, Roberto F S; Gómez-Gardeñes, Jesús

    2016-06-01

    Network science has helped to understand the organization principles of the interactions among the constituents of large complex systems. However, recently, the high resolution of the data sets collected has allowed to capture the different types of interactions coexisting within the same system. A particularly important example is that of systems with positive and negative interactions, a usual feature appearing in social, neural, and ecological systems. The interplay of links of opposite sign presents natural difficulties for generalizing typical concepts and tools applied to unsigned networks and, moreover, poses some questions intrinsic to the signed nature of the network, such as how are negative interactions balanced by positive ones so to allow the coexistence and survival of competitors/foes within the same system? Here, we show that synchronization phenomenon is an ideal benchmark for uncovering such balance and, as a byproduct, to assess which nodes play a critical role in the overall organization of the system. We illustrate our findings with the analysis of synthetic and real ecological networks in which facilitation and competitive interactions coexist.

  7. Unveiling E-Bike Potential for Commuting Trips from GPS Traces

    Directory of Open Access Journals (Sweden)

    Angel J. Lopez

    2017-06-01

    Full Text Available Common goals of sustainable mobility approaches are to reduce the need for travel, to facilitate modal shifts, to decrease trip distances and to improve energy efficiency in the transportation systems. Among these issues, modal shift plays an important role for the adoption of vehicles with fewer or zero emissions. Nowadays, the electric bike (e-bike is becoming a valid alternative to cars in urban areas. However, to promote modal shift, a better understanding of the mobility behaviour of e-bike users is required. In this paper, we investigate the mobility habits of e-bikers using GPS data collected in Belgium from 2014 to 2015. By analysing more than 10,000 trips, we provide insights about e-bike trip features such as: distance, duration and speed. In addition, we offer a deep look into which routes are preferred by bike owners in terms of their physical characteristics and how weather influences e-bike usage. Results show that trips with higher travel distances are performed during working days and are correlated with higher average speeds. Usage patterns extracted from our data set also indicate that e-bikes are preferred for commuting (home-work and business (work related trips rather than for recreational trips.

  8. Qualitative ubiquitome unveils the potential significances of protein lysine ubiquitination in hyphal growth of Aspergillus nidulans.

    Science.gov (United States)

    Chu, Xin-Ling; Feng, Ming-Guang; Ying, Sheng-Hua

    2016-02-01

    Protein ubiquitination is an evolutionarily conserved post-translational modification process in eukaryotes, and it plays an important role in many biological processes. Aspergillus nidulans, a model filamentous fungus, contributes to our understanding of cellular physiology, metabolism and genetics, but its ubiquitination is not completely revealed. In this study, the ubiquitination sites in the proteome of A. nidulans were identified using a highly sensitive mass spectrometry combined with immuno-affinity enrichment of the ubiquitinated peptides. The 4816 ubiquitination sites were identified in 1913 ubiquitinated proteins, accounting for 18.1% of total proteins in A. nidulans. Bioinformatic analysis suggested that the ubiquitinated proteins associated with a number of biological functions and displayed various sub-cellular localisations. Meanwhile, seven motifs were revealed from the ubiquitinated peptides, and significantly over-presented in the different pathways. Comparison of the enriched functional catalogues indicated that the ubiquitination functions divergently during growth of A. nidulans and Saccharomyces cerevisiae. Additionally, the proteins in A. nidulans-specific sub-category (cell growth/morphogenesis) were subjected to the protein interaction analysis which demonstrated that ubiquitination is involved in the comprehensive protein interactions. This study presents a first proteomic view of ubiquitination in the filamentous fungus, and provides an initial framework for exploring the physiological roles of ubiquitination in A. nidulans.

  9. Unveiling the oxidative metabolism of Rhipicephalus microplus (Acari: Ixodidae) experimentally exposed to entomopathogenic fungi.

    Science.gov (United States)

    Tunholi-Alves, Vinícius Menezes; Tunholi Alves, Victor Menezes; da Silva, Jairo Pinheiro; Nora Castro, Rosane; Salgueiro, Fernanda Barbosa; Perinotto, Wendell Marcelo de Souza; Gôlo, Patrícia Silva; Camargo, Mariana Guedes; Angelo, Isabele da Costa; Bittencourt, Vânia Rita Elias Pinheiro

    2016-10-01

    Rhipicephalus microplus is an important tick in tropical regions due to the high economic losses caused by its parasitism. Metarhizium anisopliae and Beauveria bassiana are well-known entomopathogenic fungi that can afflict R. microplus ticks. The development of new targets and strategies to control this parasite can be driven by studies of this tick's physiology. Recently, it was reported that when exposed to adverse physiological conditions, ticks can activate fermentative pathways, indicating transition from aerobic to anaerobic metabolism. Nevertheless, the precise mechanism by which entomopathogenic fungi influence R. microplus metabolism has not been clarified, limiting understanding of the tick-fungus association. Thus, the present study aimed to evaluate the effect of infection of ticks by M. anisopliae and B. bassiana on the amount of selected carboxylic acids present in the hemolymph, enabling increased understanding of changes previously reported. The results showed preservation in the concentrations of oxalic, lactic, and pyruvic acids in the hemolymph 24 and 48 h after dropping from cattle; while there were variations in the concentration of these carboxylic acids after infection of female ticks to M. anisopliae and B. bassiana. Significant increases were observed in the concentration of oxalic and lactic acids and significant reduction of pyruvic acid for both observation times (24 and 48 h) after infection by entomopathogenic fungi. These results indicate that B. bassiana and M. anisopliae infection alters the basal metabolism of R. microplus females, resulting in the activation of fermentative pathways.

  10. Unveiling the Progenitors of Short-duration Gamma-ray Bursts

    Science.gov (United States)

    Fong, Wen-Fai

    2016-03-01

    Gamma-ray bursts (GRBs) are relativistic explosions which originate at cosmological distances, and are among the most luminous transients in the universe. Following the prompt gamma-ray emission, a fading synchrotron ``afterglow'' is detectable at lower energies. While long-duration GRBs (duration >2 sec) are linked to the deaths of massive stars, the progenitors of short-duration GRBs (duration black hole. Such merging systems are also important to understand because they are premier candidates for gravitational wave detections with current facilities and are likely sites of heavy element nucleosynthesis. The launch of NASA's Swift satellite in 2004, with its rapid multi-wavelength monitoring and localization capabilities, led to the first discoveries of short GRB afterglows and therefore robust associations to host galaxies. At a detection rate of roughly 10 events per year, the growing number of well-localized short GRBs has enabled comprehensive population studies of their afterglows and environments for the first time. In this talk, I describe my multi-wavelength observational campaign to address testable predictions for the progenitors of short GRBs. My work comprises several lines of independent evidence to demonstrate that short GRBs originate from the mergers of two compact objects, and also provides the first constraints on the explosion properties for a large sample of events. With the direct detection of gravitational waves from compact object mergers on the horizon, these studies provide necessary inputs to inform the next decade of joint electromagnetic-gravitational wave search strategies.

  11. Pharmacological induction of skin pigmentation unveils the neuroendocrine circuit regulated by light.

    Science.gov (United States)

    Bertolesi, Gabriel E; Vazhappilly, Sherene T; Hehr, Carrie L; McFarlane, Sarah

    2016-03-01

    Light-regulated skin colour change is an important physiological process in invertebrates and lower vertebrates, and includes daily circadian variation and camouflage (i.e. background adaptation). The photoactivation of melanopsin-expressing retinal ganglion cells (mRGCs) in the eye initiates an uncharacterized neuroendocrine circuit that regulates melanin dispersion/aggregation through the secretion of alpha-melanocyte-stimulating hormone (α-MSH). We developed experimental models of normal or enucleated Xenopus embryos, as well as in situ cultures of skin of isolated dorsal head and tails, to analyse pharmacological induction of skin pigmentation and α-MSH synthesis. Both processes are triggered by a melanopsin inhibitor, AA92593, as well as chloride channel modulators. The AA9253 effect is eye-dependent, while functional data in vivo point to GABAA receptors expressed on pituitary melanotrope cells as the chloride channel blocker target. Based on the pharmacological data, we suggest a neuroendocrine circuit linking mRGCs with α-MSH secretion, which is used normally during background adaptation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Glutamine synthetase in Medicago truncatula, unveiling new secrets of a very old enzyme

    Directory of Open Access Journals (Sweden)

    Ana Rita Seabra

    2015-07-01

    Full Text Available Glutamine Synthetase (GS catalyses the first step at which nitrogen is brought into cellular metabolism and is also involved in the reassimilation of ammonium released by a number of metabolic pathways. Due to its unique position in plant nitrogen metabolism, GS plays essential roles in all aspects of plant development, from germination to senescence, and is a key component of nitrogen use efficiency (NUE and plant yield. Understanding the mechanisms regulating GS activity is therefore of utmost importance and a great effort has been dedicated to understand how GS is regulated in different plant species. The present review summarizes exciting recent developments concerning the structure and regulation of glutamine synthetase isoenzymes, using the model legume Medicago truncatula. These include the understanding of the structural determinants of both the cytosolic and plastid located isoenzymes, the existence of a seed-specific GS gene unique to M. truncatula and closely related species and the discovery that GS isoenzymes are regulated by nitric oxide at the post-translational level. The data is discussed and integrated with the potential roles of the distinct GS isoenzymes within the whole plant context.

  13. Regulating genomics in the 21st century: from logos to pathos?

    Science.gov (United States)

    Gottweis, Herbert

    2005-03-01

    There is currently an important change in the governance of genomics. In the past, much of the regulatory discussion about genomics has focused on issues of risk. Today, a new discussion is evolving that emphasizes the uncertainties involved in the development and diffusion of genomics into society. The increasing importance of emotional language and the focus on trust in the discussion about genomics reflects the attempt to substitute for the shortcomings of logos with ethos and pathos.

  14. Unveiling the role and life strategies of viruses from the surface to the dark ocean

    KAUST Repository

    Lara, Elena; Vaqué , Dolors; Sà , Elisabet Laia; Boras, Julia A.; Gomes, Ana; Borrull, Encarna; Dí ez-Vives, Cristina; Teira, Eva; Pernice, Massimo C.; Garcia, Francisca C.; Forn, Irene; Castillo, Yaiza M.; Peiró , Aida; Salazar, Guillem; Moran, Xose Anxelu G.; Massana, Ramon; Catalá , Teresa S.; Luna, Gian Marco; Agusti, Susana; Estrada, Marta; Gasol, Josep M M; Duarte, Carlos M.

    2017-01-01

    Viruses are a key component of marine ecosystems, but the assessment of their global role in regulating microbial communities and the flux of carbon is precluded by a paucity of data, particularly in the deep ocean. We assessed patterns in viral abundance and production and the role of viral lysis as a driver of prokaryote mortality, from surface to bathypelagic layers, across the tropical and subtropical oceans. Viral abundance showed significant differences between oceans in the epipelagic and mesopelagic, but not in the bathypelagic, and decreased with depth, with an average power-law scaling exponent of −1.03 km−1 from an average of 7.76 × 106 viruses ml−1 in the epipelagic to 0.62 × 106 viruses ml−1 in the bathypelagic layer with an average integrated (0 to 4000 m) viral stock of about 0.004 to 0.044 g C m−2, half of which is found below 775 m. Lysogenic viral production was higher than lytic viral production in surface waters, whereas the opposite was found in the bathypelagic, where prokaryotic mortality due to viruses was estimated to be 60 times higher than grazing. Free viruses had turnover times of 0.1 days in the bathypelagic, revealing that viruses in the bathypelagic are highly dynamic. On the basis of the rates of lysed prokaryotic cells, we estimated that viruses release 145 Gt C year−1 in the global tropical and subtropical oceans. The active viral processes reported here demonstrate the importance of viruses in the production of dissolved organic carbon in the dark ocean, a major pathway in carbon cycling.

  15. Comparative fecal metagenomics unveils unique functional capacity of the swine gut

    Directory of Open Access Journals (Sweden)

    Martinson John

    2011-05-01

    Full Text Available Abstract Background Uncovering the taxonomic composition and functional capacity within the swine gut microbial consortia is of great importance to animal physiology and health as well as to food and water safety due to the presence of human pathogens in pig feces. Nonetheless, limited information on the functional diversity of the swine gut microbiome is available. Results Analysis of 637, 722 pyrosequencing reads (130 megabases generated from Yorkshire pig fecal DNA extracts was performed to help better understand the microbial diversity and largely unknown functional capacity of the swine gut microbiome. Swine fecal metagenomic sequences were annotated using both MG-RAST and JGI IMG/M-ER pipelines. Taxonomic analysis of metagenomic reads indicated that swine fecal microbiomes were dominated by Firmicutes and Bacteroidetes phyla. At a finer phylogenetic resolution, Prevotella spp. dominated the swine fecal metagenome, while some genes associated with Treponema and Anareovibrio species were found to be exclusively within the pig fecal metagenomic sequences analyzed. Functional analysis revealed that carbohydrate metabolism was the most abundant SEED subsystem, representing 13% of the swine metagenome. Genes associated with stress, virulence, cell wall and cell capsule were also abundant. Virulence factors associated with antibiotic resistance genes with highest sequence homology to genes in Bacteroidetes, Clostridia, and Methanosarcina were numerous within the gene families unique to the swine fecal metagenomes. Other abundant proteins unique to the distal swine gut shared high sequence homology to putative carbohydrate membrane transporters. Conclusions The results from this metagenomic survey demonstrated the presence of genes associated with resistance to antibiotics and carbohydrate metabolism suggesting that the swine gut microbiome may be shaped by husbandry practices.

  16. Unveiling the role and life strategies of viruses from the surface to the dark ocean

    KAUST Repository

    Lara, Elena

    2017-09-07

    Viruses are a key component of marine ecosystems, but the assessment of their global role in regulating microbial communities and the flux of carbon is precluded by a paucity of data, particularly in the deep ocean. We assessed patterns in viral abundance and production and the role of viral lysis as a driver of prokaryote mortality, from surface to bathypelagic layers, across the tropical and subtropical oceans. Viral abundance showed significant differences between oceans in the epipelagic and mesopelagic, but not in the bathypelagic, and decreased with depth, with an average power-law scaling exponent of −1.03 km−1 from an average of 7.76 × 106 viruses ml−1 in the epipelagic to 0.62 × 106 viruses ml−1 in the bathypelagic layer with an average integrated (0 to 4000 m) viral stock of about 0.004 to 0.044 g C m−2, half of which is found below 775 m. Lysogenic viral production was higher than lytic viral production in surface waters, whereas the opposite was found in the bathypelagic, where prokaryotic mortality due to viruses was estimated to be 60 times higher than grazing. Free viruses had turnover times of 0.1 days in the bathypelagic, revealing that viruses in the bathypelagic are highly dynamic. On the basis of the rates of lysed prokaryotic cells, we estimated that viruses release 145 Gt C year−1 in the global tropical and subtropical oceans. The active viral processes reported here demonstrate the importance of viruses in the production of dissolved organic carbon in the dark ocean, a major pathway in carbon cycling.

  17. Unveiling Singlet Fission Mediating States in TIPS-pentacene and its Aza Derivatives.

    Science.gov (United States)

    Herz, Julia; Buckup, Tiago; Paulus, Fabian; Engelhart, Jens U; Bunz, Uwe H F; Motzkus, Marcus

    2015-06-25

    Femtosecond pump-depletion-probe experiments were carried out in order to shed light on the ultrafast excited-state dynamics of triisopropylsilylethynyl (TIPS)-pentacene and two nitrogen-containing derivatives, namely, diaza-TIPS-pentacene and tetraaza-TIPS-pentacene. Measurements performed in the visible and near-infrared spectral range in combination with rate model simulations reveal that singlet fission proceeds via the extremely short-lived intermediate (1)TT state, which absorbs in the near-infrared spectral region only. The T1 → T3 transition probed in the visible region shows a rise time that comprises two components according to a consecutive reaction (S1 → (1)TT → T1). The incorporation of nitrogen atoms into the acene structure leads to shorter dynamics, but the overall triplet formation follows the same kinetic model. This is of particular importance, since experiments on tetraaza-TIPS-pentacene allow for investigation of the triplet state in the visible range without an overlapping singlet contribution. In addition, the pump-depletion-probe experiments show that the triplet absorption in the visible (T1 → T3) and near-infrared (T1 → T2) regions occurs from the same initial state, which was questioned in previous studies. Furthermore, an additional ultrafast transfer between the excited triplet states (T3 → T2) is identified, which is also in agreement with the rate model simulation. By applying depletion pulses, which are resonant with higher vibrational levels, we gain insight into internal vibrational energy redistribution processes within the triplet manifold. This additional information is of great relevance regarding the study of loss channels within these materials.

  18. Dynamic Evolution of the Chloroplast Genome in the Green Algal Classes Pedinophyceae and Trebouxiophyceae.

    Science.gov (United States)

    Turmel, Monique; Otis, Christian; Lemieux, Claude

    2015-07-01

    Previous studies of trebouxiophycean chloroplast genomes revealed little information regarding the evolutionary dynamics of this genome because taxon sampling was too sparse and the relationships between the sampled taxa were unknown. We recently sequenced the chloroplast genomes of 27 trebouxiophycean and 2 pedinophycean green algae to resolve the relationships among the main lineages recognized for the Trebouxiophyceae. These taxa and the previously sampled members of the Pedinophyceae and Trebouxiophyceae are included in the comparative chloroplast genome analysis we report here. The 38 genomes examined display considerable variability at all levels, except gene content. Our results highlight the high propensity of the rDNA-containing large inverted repeat (IR) to vary in size, gene content and gene order as well as the repeated losses it experienced during trebouxiophycean evolution. Of the seven predicted IR losses, one event demarcates a superclade of 11 taxa representing 5 late-diverging lineages. IR expansions/contractions account not only for changes in gene content in this region but also for changes in gene order and gene duplications. Inversions also led to gene rearrangements within the IR, including the reversal or disruption of the rDNA operon in some lineages. Most of the 20 IR-less genomes are more rearranged compared with their IR-containing homologs and tend to show an accelerated rate of sequence evolution. In the IR-less superclade, several ancestral operons were disrupted, a few genes were fragmented, and a subgroup of taxa features a G+C-biased nucleotide composition. Our analyses also unveiled putative cases of gene acquisitions through horizontal transfer. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Multiple models for Rosaceae genomics.

    Science.gov (United States)

    Shulaev, Vladimir; Korban, Schuyler S; Sosinski, Bryon; Abbott, Albert G; Aldwinckle, Herb S; Folta, Kevin M; Iezzoni, Amy; Main, Dorrie; Arús, Pere; Dandekar, Abhaya M; Lewers, Kim; Brown, Susan K; Davis, Thomas M; Gardiner, Susan E; Potter, Daniel; Veilleux, Richard E

    2008-07-01

    The plant family Rosaceae consists of over 100 genera and 3,000 species that include many important fruit, nut, ornamental, and wood crops. Members of this family provide high-value nutritional foods and contribute desirable aesthetic and industrial products. Most rosaceous crops have been enhanced by human intervention through sexual hybridization, asexual propagation, and genetic improvement since ancient times, 4,000 to 5,000 B.C. Modern breeding programs have contributed to the selection and release of numerous cultivars having significant economic impact on the U.S. and world markets. In recent years, the Rosaceae community, both in the United States and internationally, has benefited from newfound organization and collaboration that have hastened progress in developing genetic and genomic resources for representative crops such as apple (Malus spp.), peach (Prunus spp.), and strawberry (Fragaria spp.). These resources, including expressed sequence tags, bacterial artificial chromosome libraries, physical and genetic maps, and molecular markers, combined with genetic transformation protocols and bioinformatics tools, have rendered various rosaceous crops highly amenable to comparative and functional genomics studies. This report serves as a synopsis of the resources and initiatives of the Rosaceae community, recent developments in Rosaceae genomics, and plans to apply newly accumulated knowledge and resources toward breeding and crop improvement.

  20. Genome-derived vaccines.

    Science.gov (United States)

    De Groot, Anne S; Rappuoli, Rino

    2004-02-01

    Vaccine research entered a new era when the complete genome of a pathogenic bacterium was published in 1995. Since then, more than 97 bacterial pathogens have been sequenced and at least 110 additional projects are now in progress. Genome sequencing has also dramatically accelerated: high-throughput facilities can draft the sequence of an entire microbe (two to four megabases) in 1 to 2 days. Vaccine developers are using microarrays, immunoinformatics, proteomics and high-throughput immunology assays to reduce the truly unmanageable volume of information available in genome databases to a manageable size. Vaccines composed by novel antigens discovered from genome mining are already in clinical trials. Within 5 years we can expect to see a novel class of vaccines composed by genome-predicted, assembled and engineered T- and Bcell epitopes. This article addresses the convergence of three forces--microbial genome sequencing, computational immunology and new vaccine technologies--that are shifting genome mining for vaccines onto the forefront of immunology research.

  1. Integrated bioinformatic analysis unveils significant genes and pathways in the pathogenesis of supratentorial primitive neuroectodermal tumor

    Directory of Open Access Journals (Sweden)

    Wang G

    2018-04-01

    . Conclusion: Calcium signaling pathway and several genes (CDK1, CDC20, BUB1B, and BUB1 may play important roles in the pathogenesis of sPNET. Keywords: primitive neuroectodermal tumor, microarray analysis, protein-protein interaction, transcription factors

  2. ChloroMitoCU: Codon patterns across organelle genomes for functional genomics and evolutionary applications.

    Science.gov (United States)

    Sablok, Gaurav; Chen, Ting-Wen; Lee, Chi-Ching; Yang, Chi; Gan, Ruei-Chi; Wegrzyn, Jill L; Porta, Nicola L; Nayak, Kinshuk C; Huang, Po-Jung; Varotto, Claudio; Tang, Petrus

    2017-06-01

    Organelle genomes are widely thought to have arisen from reduction events involving cyanobacterial and archaeal genomes, in the case of chloroplasts, or α-proteobacterial genomes, in the case of mitochondria. Heterogeneity in base composition and codon preference has long been the subject of investigation of topics ranging from phylogenetic distortion to the design of overexpression cassettes for transgenic expression. From the overexpression point of view, it is critical to systematically analyze the codon usage patterns of the organelle genomes. In light of the importance of codon usage patterns in the development of hyper-expression organelle transgenics, we present ChloroMitoCU, the first-ever curated, web-based reference catalog of the codon usage patterns in organelle genomes. ChloroMitoCU contains the pre-compiled codon usage patterns of 328 chloroplast genomes (29,960 CDS) and 3,502 mitochondrial genomes (49,066 CDS), enabling genome-wide exploration and comparative analysis of codon usage patterns across species. ChloroMitoCU allows the phylogenetic comparison of codon usage patterns across organelle genomes, the prediction of codon usage patterns based on user-submitted transcripts or assembled organelle genes, and comparative analysis with the pre-compiled patterns across species of interest. ChloroMitoCU can increase our understanding of the biased patterns of codon usage in organelle genomes across multiple clades. ChloroMitoCU can be accessed at: http://chloromitocu.cgu.edu.tw/. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. The human genome as public: Justifications and implications.

    Science.gov (United States)

    Bayefsky, Michelle J

    2017-03-01

    Since the human genome was decoded, great emphasis has been placed on the unique, personal nature of the genome, along with the benefits that personalized medicine can bring to individuals and the importance of safeguarding genetic privacy. As a result, an equally important aspect of the human genome - its common nature - has been underappreciated and underrepresented in the ethics literature and policy dialogue surrounding genetics and genomics. This article will argue that, just as the personal nature of the genome has been used to reinforce individual rights and justify important privacy protections, so too the common nature of the genome can be employed to support protections of the genome at a population level and policies designed to promote the public's wellbeing. In order for public health officials to have the authority to develop genetics policies for the sake of the public good, the genome must have not only a common, but also a public, dimension. This article contends that DNA carries a public dimension through the use of two conceptual frameworks: the common heritage (CH) framework and the common resource (CR) framework. Both frameworks establish a public interest in the human genome, but the CH framework can be used to justify policies aimed at preserving and protecting the genome, while the CR framework can be employed to justify policies for utilizing the genome for the public benefit. A variety of possible policy implications are discussed, with special attention paid to the use of large-scale genomics databases for public health research. © Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  4. Bacillus subtilis genome diversity.

    Science.gov (United States)

    Earl, Ashlee M; Losick, Richard; Kolter, Roberto

    2007-02-01

    Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.

  5. Genomic taxonomy of vibrios

    Directory of Open Access Journals (Sweden)

    Iida Tetsuya

    2009-10-01

    Full Text Available Abstract Background Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera from 32 genome sequences of different vibrio species. We use a variety of tools to explore the taxonomic relationship between the sequenced genomes, including Multilocus Sequence Analysis (MLSA, supertrees, Average Amino Acid Identity (AAI, genomic signatures, and Genome BLAST atlases. Our aim is to analyse the usefulness of these tools for species identification in vibrios. Results We have generated four new genome sequences of three Vibrio species, i.e., V. alginolyticus 40B, V. harveyi-like 1DA3, and V. mimicus strains VM573 and VM603, and present a broad analyses of these genomes along with other sequenced Vibrio species. The genome atlas and pangenome plots provide a tantalizing image of the genomic differences that occur between closely related sister species, e.g. V. cholerae and V. mimicus. The vibrio pangenome contains around 26504 genes. The V. cholerae core genome and pangenome consist of 1520 and 6923 genes, respectively. Pangenomes might allow different strains of V. cholerae to occupy different niches. MLSA and supertree analyses resulted in a similar phylogenetic picture, with a clear distinction of four groups (Vibrio core group, V. cholerae-V. mimicus, Aliivibrio spp., and Photobacterium spp.. A Vibrio species is defined as a group of strains that share > 95% DNA identity in MLSA and supertree analysis, > 96% AAI, ≤ 10 genome signature dissimilarity, and > 61% proteome identity. Strains of the same species and species of the same genus will form monophyletic groups on the basis of MLSA and supertree. Conclusion The combination of different analytical and bioinformatics tools will enable the most accurate species identification through genomic computational analysis. This endeavour will culminate in

  6. Human Genome Project

    Energy Technology Data Exchange (ETDEWEB)

    Block, S. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Cornwall, J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dally, W. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dyson, F. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Fortson, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Joyce, G. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Kimble, H. J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Lewis, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Max, C. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Prince, T. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Schwitters, R. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Weinberger, P. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Woodin, W. H. [The MITRE Corporation, McLean, VA (US). JASON Program Office

    1998-01-04

    The study reviews Department of Energy supported aspects of the United States Human Genome Project, the joint National Institutes of Health/Department of Energy program to characterize all human genetic material, to discover the set of human genes, and to render them accessible for further biological study. The study concentrates on issues of technology, quality assurance/control, and informatics relevant to current effort on the genome project and needs beyond it. Recommendations are presented on areas of the genome program that are of particular interest to and supported by the Department of Energy.

  7. Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  8. Genomic signal processing

    CERN Document Server

    Shmulevich, Ilya

    2007-01-01

    Genomic signal processing (GSP) can be defined as the analysis, processing, and use of genomic signals to gain biological knowledge, and the translation of that knowledge into systems-based applications that can be used to diagnose and treat genetic diseases. Situated at the crossroads of engineering, biology, mathematics, statistics, and computer science, GSP requires the development of both nonlinear dynamical models that adequately represent genomic regulation, and diagnostic and therapeutic tools based on these models. This book facilitates these developments by providing rigorous mathema

  9. Unveiling the secrets of geology, from the Earth to your daily life

    Science.gov (United States)

    Delfini, Claudia

    2015-04-01

    How should we share geological information? How can we start involving the public at large in topics that apparently are so far away from them? What kind of information would be interesting to disseminate to attract the attention of the people? "Geology at the table - cooking without borders" and "Minerals in your life", edited by EuroGeoSurveys, the Geological Surveys of Europe, are two publications that have showed how it is possible to reach thousands of people around Europe only following a few simple rules. A good scientific communicator must first understand its audience, their knowledge and beliefs, in order to adopt an attractive approach to their communication strategy. A good communicator has to adopt a simplified blend of the crucial information without depleting the content of the main message. One must avoid the danger of losing the audience's interest by keeping with simple language and information that is easy to understand and accessible to all. When it comes to the field of geology, communication efforts would ideally engage the audience and develop their interest, showing how their daily life is linked and conditioned to the geological phenomena. "Geology at the table - cooking without borders" and "Minerals in your life" are two examples of how geology, a topic unknown to many people, is part of our life. Leafing through the pages of these books it is possible to understand how important geology is for the existence of our society and its crucial role in the complex world we live in. In "Geology at the table - cooking without borders" twenty-eight European Geological Surveys have shown how their own national dishes contain references to our past, to the present, and to the future, which can easily be analysed and explained through geology. This cookbook offers a little taste of geology through wonderful recipes from all around Europe. While "Minerals in your life" is an educational book that combines a hilarious comic strip storyline with an

  10. Signal Sensing and Transduction by Histidine Kinases as Unveiled through Studies on a Temperature Sensor.

    Science.gov (United States)

    Abriata, Luciano A; Albanesi, Daniela; Dal Peraro, Matteo; de Mendoza, Diego

    2017-06-20

    experiments and molecular simulations further showed that reversible formation of a two-helix coiled coil in the fifth TM segment and the N-terminus of the cytoplasmic domain is essential for the sensing and signal transduction mechanisms. Together with other structural and functional works, the emerging picture suggests that diverse HKs possess distinct sensing and transduction mechanisms but share as rather general features (i) a symmetric phosphatase state and an asymmetric kinase state and (ii) similar functional outputs on the conserved DHp and ABD domains, achieved through different mechanisms that depend on the nature of the initial signal. We here advance (iii) an important role for TM prolines in transducing the initial signals to the cytoplasmic coiled coils, based on simulations of DesK's TM helices and our previous work on a related HK, PhoQ. Lastly, evidence for DesK, PhoQ, BvgS, and DctB HKs shows that (iv) overall catalytic output is tuned by a delicate balance between hydration potentials, coiled coil stability, and exposure of hydrophobic surface patches at their cytoplasmic coiled coils and at the N-terminal and C-terminal sides of their TM helices. This balance is so delicate that small perturbations, either physiological signals or induced by mutations, lead to large remodeling of the underlying conformational landscape achieving clear-cut changes in catalytic output, mirroring the required response speed of these systems for proper biological function.

  11. Genomic analyses of the CAM plant pineapple.

    Science.gov (United States)

    Zhang, Jisen; Liu, Juan; Ming, Ray

    2014-07-01

    The innovation of crassulacean acid metabolism (CAM) photosynthesis in arid and/or low CO2 conditions is a remarkable case of adaptation in flowering plants. As the most important crop that utilizes CAM photosynthesis, the genetic and genomic resources of pineapple have been developed over many years. Genetic diversity studies using various types of DNA markers led to the reclassification of the two genera Ananas and Pseudananas and nine species into one genus Ananas and two species, A. comosus and A. macrodontes with five botanical varieties in A. comosus. Five genetic maps have been constructed using F1 or F2 populations, and high-density genetic maps generated by genotype sequencing are essential resources for sequencing and assembling the pineapple genome and for marker-assisted selection. There are abundant expression sequence tag resources but limited genomic sequences in pineapple. Genes involved in the CAM pathway has been analysed in several CAM plants but only a few of them are from pineapple. A reference genome of pineapple is being generated and will accelerate genetic and genomic research in this major CAM crop. This reference genome of pineapple provides the foundation for studying the origin and regulatory mechanism of CAM photosynthesis, and the opportunity to evaluate the classification of Ananas species and botanical cultivars. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. RNA-seq in grain unveils fate of neo- and paleopolyploidization events in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Pont, Caroline; Murat, Florent; Confolent, Carole; Balzergue, Sandrine; Salse, Jérôme

    2011-12-02

    Whole genome duplication is a common evolutionary event in plants. Bread wheat (Triticum aestivum L.) is a good model to investigate the impact of paleo- and neoduplications on the organization and function of modern plant genomes. We performed an RNA sequencing-based inference of the grain filling gene network in bread wheat and identified a set of 37,695 non-redundant sequence clusters, which is an unprecedented resolution corresponding to an estimated half of the wheat genome unigene repertoire. Using the Brachypodium distachyon genome as a reference for the Triticeae, we classified gene clusters into orthologous, paralogous, and homoeologous relationships. Based on this wheat gene evolutionary classification, older duplicated copies (dating back 50 to 70 million years) exhibit more than 80% gene loss and expression divergence while recent duplicates (dating back 1.5 to 3 million years) show only 54% gene loss and 36 to 49% expression divergence. We suggest that structural shuffling due to duplicated gene loss is a rapid process, whereas functional shuffling due to neo- and/or subfunctionalization of duplicates is a longer process, and that both shuffling mechanisms drive functional redundancy erosion. We conclude that, as a result of these mechanisms, half the gene duplicates in plants are structurally and functionally altered within 10 million years of evolution, and the diploidization process is completed after 45 to 50 million years following polyploidization.

  13. Annotating functional RNAs in genomes using Infernal.

    Science.gov (United States)

    Nawrocki, Eric P

    2014-01-01

    Many different types of functional non-coding RNAs participate in a wide range of important cellular functions but the large majority of these RNAs are not routinely annotated in published genomes. Several programs have been developed for identifying RNAs, including specific tools tailored to a particular RNA family as well as more general ones designed to work for any family. Many of these tools utilize covariance models (CMs), statistical models of the conserved sequence, and structure of an RNA family. In this chapter, as an illustrative example, the Infernal software package and CMs from the Rfam database are used to identify RNAs in the genome of the archaeon Methanobrevibacter ruminantium, uncovering some additional RNAs not present in the genome's initial annotation. Analysis of the results and comparison with family-specific methods demonstrate some important strengths and weaknesses of this general approach.

  14. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  15. Pipeline to upgrade the genome annotations

    Directory of Open Access Journals (Sweden)

    Lijin K. Gopi

    2017-12-01

    Full Text Available Current era of functional genomics is enriched with good quality draft genomes and annotations for many thousands of species and varieties with the support of the advancements in the next generation sequencing technologies (NGS. Around 25,250 genomes, of the organisms from various kingdoms, are submitted in the NCBI genome resource till date. Each of these genomes was annotated using various tools and knowledge-bases that were available during the period of the annotation. It is obvious that these annotations will be improved if the same genome is annotated using improved tools and knowledge-bases. Here we present a new genome annotation pipeline, strengthened with various tools and knowledge-bases that are capable of producing better quality annotations from the consensus of the predictions from different tools. This resource also perform various additional annotations, apart from the usual gene predictions and functional annotations, which involve SSRs, novel repeats, paralogs, proteins with transmembrane helices, signal peptides etc. This new annotation resource is trained to evaluate and integrate all the predictions together to resolve the overlaps and ambiguities of the boundaries. One of the important highlights of this resource is the capability of predicting the phylogenetic relations of the repeats using the evolutionary trace analysis and orthologous gene clusters. We also present a case study, of the pipeline, in which we upgrade the genome annotation of Nelumbo nucifera (sacred lotus. It is demonstrated that this resource is capable of producing an improved annotation for a better understanding of the biology of various organisms.

  16. Genomic diversity within the haloalkaliphilic genus Thioalkalivibrio.

    Science.gov (United States)

    Ahn, Anne-Catherine; Meier-Kolthoff, Jan P; Overmars, Lex; Richter, Michael; Woyke, Tanja; Sorokin, Dimitry Y; Muyzer, Gerard

    2017-01-01

    Thioalkalivibrio is a genus of obligate chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria. Their habitat are soda lakes which are dual extreme environments with a pH range from 9.5 to 11 and salt concentrations up to saturation. More than 100 strains of this genus have been isolated from various soda lakes all over the world, but only ten species have been effectively described yet. Therefore, the assignment of the remaining strains to either existing or novel species is important and will further elucidate their genomic diversity as well as give a better general understanding of this genus. Recently, the genomes of 76 Thioalkalivibrio strains were sequenced. On these, we applied different methods including (i) 16S rRNA gene sequence analysis, (ii) Multilocus Sequence Analysis (MLSA) based on eight housekeeping genes, (iii) Average Nucleotide Identity based on BLAST (ANIb) and MUMmer (ANIm), (iv) Tetranucleotide frequency correlation coefficients (TETRA), (v) digital DNA:DNA hybridization (dDDH) as well as (vi) nucleotide- and amino acid-based Genome BLAST Distance Phylogeny (GBDP) analyses. We detected a high genomic diversity by revealing 15 new "genomic" species and 16 new "genomic" subspecies in addition to the ten already described species. Phylogenetic and phylogenomic analyses showed that the genus is not monophyletic, because four strains were clearly separated from the other Thioalkalivibrio by type strains from other genera. Therefore, it is recommended to classify the latter group as a novel genus. The biogeographic distribution of Thioalkalivibrio suggested that the different "genomic" species can be classified as candidate disjunct or candidate endemic species. This study is a detailed genome-based classification and identification of members within the genus Thioalkalivibrio. However, future phenotypical and chemotaxonomical studies will be needed for a full species description of this genus.

  17. Prospects: the tomato genome as a cornerstone for gene discovery

    Science.gov (United States)

    Those involved in the international tomato genome sequencing effort contributed to not only the development of an important genome sequence relevant to a major economic and nutritional crop, but also to the tomato experimental system as a model for plant biology. Without question, prior seminal work...

  18. Community standards for genomic resources, genetic conservation, and data integration

    Science.gov (United States)

    Jill Wegrzyn; Meg Staton; Emily Grau; Richard Cronn; C. Dana Nelson

    2017-01-01

    Genetics and genomics are increasingly important in forestry management and conservation. Next generation sequencing can increase analytical power, but still relies on building on the structure of previously acquired data. Data standards and data sharing allow the community to maximize the analytical power of high throughput genomics data. The landscape of incomplete...

  19. Genome sequence of Chinese porcine parvovirus strain PPV2010.

    Science.gov (United States)

    Cui, Jin; Wang, Xin; Ren, Yudong; Cui, Shangjin; Li, Guangxing; Ren, Xiaofeng

    2012-02-01

    Porcine parvovirus (PPV) isolate PPV2010 has recently emerged in China. Herein, we analyze the complete genome sequence of PPV2010. Our results indicate that the genome of PPV2010 bears mixed characteristics of virulent PPV and vaccine strains. Importantly, PPV2010 has the potential to be a naturally attenuated candidate vaccine strain.

  20. Genome Sequence of Chinese Porcine Parvovirus Strain PPV2010

    OpenAIRE

    Cui, Jin; Wang, Xin; Ren, Yudong; Cui, Shangjin; Li, Guangxing; Ren, Xiaofeng

    2012-01-01

    Porcine parvovirus (PPV) isolate PPV2010 has recently emerged in China. Herein, we analyze the complete genome sequence of PPV2010. Our results indicate that the genome of PPV2010 bears mixed characteristics of virulent PPV and vaccine strains. Importantly, PPV2010 has the potential to be a naturally attenuated candidate vaccine strain.

  1. ESO unveils an amazing, interactive, 360-degree panoramic view of the entire night sky

    Science.gov (United States)

    2009-09-01

    , on 21 September 2009. Notes [1] During his quest, Brunier used a Nikon D3 digital camera. The apparent motion of the sky caused by Earth's rotation was corrected for using a small, precise equatorial mount moving in the opposite direction, which made a whole circle in 23 hours 56 minutes around the Earth's axis of rotation. Each photo required a six-minute exposure, for a total exposure time of more than 120 hours. [2] The data processing, using software called Autopano Pro Giga, took great care in respecting the colours and "texture" of the Milky Way. Frédéric Tapissier needed about 340 computing hours on a powerful PC to complete the task. More information As part of the IYA2009, ESO is participating in several remarkable outreach activities, in line with its world-leading rank in the field of astronomy. ESO is hosting the IYA2009 Secretariat for the International Astronomical Union, which coordinates the Year globally. ESO is one of the Organisational Associates of IYA2009, and was also closely involved in the resolution submitted to the United Nations (UN) by Italy, which led to the UN's 62nd General Assembly proclaiming 2009 the International Year of Astronomy. In addition to a wide array of activities planned both at the local and international level, ESO is leading three of the twelve global Cornerstone Projects. ESO, the European Southern Observatory, is the foremost intergovernmental astronomy organisation in Europe and the world's most productive astronomical observatory. It is supported by 14 countries: Austria, Belgium, the Czech Republic, Denmark, France, Finland, Germany, Italy, the Netherlands, Portugal, Spain, Sweden, Switzerland and the United Kingdom. ESO carries out an ambitious programme focused on the design, construction and operation of powerful ground-based observing facilities enabling astronomers to make important scientific discoveries. ESO also plays a leading role in promoting and organising cooperation in astronomical research. ESO

  2. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  3. Insights into bilaterian evolution from three spiralian genomes

    Energy Technology Data Exchange (ETDEWEB)

    Simakov, Oleg; Marletaz, Ferdinand; Cho, Sung-Jin; Edsinger-Gonzales, Eric; Havlak, Paul; Hellsten, Uffe; Kuo, Dian-Han; Larsson, Tomas; Lv, Jie; Arendt, Detlev; Savage, Robert; Osoegawa, Kazutoyo; de Jong, Pieter; Grimwood, Jane; Chapman, Jarrod A.; Shapiro, Harris; Otillar, Robert P.; Terry, Astrid Y.; Boore, Jeffrey L.; Grigoriev, Igor V.; Lindberg, David R.; Seaver, Elaine C.; Weisblat, David A.; Putnam, Nicholas H.; Rokhsar, Daniel S.; Aerts, Andrea

    2012-01-07

    Current genomic perspectives on animal diversity neglect two prominent phyla, the molluscs and annelids, that together account for nearly one-third of known marine species and are important both ecologically and as experimental systems in classical embryology1, 2, 3. Here we describe the draft genomes of the owl limpet (Lottia gigantea), a marine polychaete (Capitella teleta) and a freshwater leech (Helobdella robusta), and compare them with other animal genomes to investigate the origin and diversification of bilaterians from a genomic perspective. We find that the genome organization, gene structure and functional content of these species are more similar to those of some invertebrate deuterostome genomes (for example, amphioxus and sea urchin) than those of other protostomes that have been sequenced to date (flies, nematodes and flatworms). The conservation of these genomic features enables us to expand the inventory of genes present in the last common bilaterian ancestor, establish the tripartite diversification of bilaterians using multiple genomic characteristics and identify ancient conserved long- and short-range genetic linkages across metazoans. Superimposed on this broadly conserved pan-bilaterian background we find examples of lineage-specific genome evolution, including varying rates of rearrangement, intron gain and loss, expansions and contractions of gene families, and the evolution of clade-specific genes that produce the unique content of each genome.

  4. Lophotrochozoan mitochondrial genomes

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Yvonne; Boore, Jeffrey L.

    2005-10-01

    Progress in both molecular techniques and phylogeneticmethods has challenged many of the interpretations of traditionaltaxonomy. One example is in the recognition of the animal superphylumLophotrochozoa (annelids, mollusks, echiurans, platyhelminthes,brachiopods, and other phyla), although the relationships within thisgroup and the inclusion of some phyla remain uncertain. While much ofthis progress in phylogenetic reconstruction has been based on comparingsingle gene sequences, we are beginning to see the potential of comparinglarge-scale features of genomes, such as the relative order of genes.Even though tremendous progress is being made on the sequencedetermination of whole nuclear genomes, the dataset of choice forgenome-level characters for many animals across a broad taxonomic rangeremains mitochondrial genomes. We review here what is known aboutmitochondrial genomes of the lophotrochozoans and discuss the promisethat this dataset will enable insight into theirrelationships.

  5. Mouse Genome Informatics (MGI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — MGI is the international database resource for the laboratory mouse, providing integrated genetic, genomic, and biological data to facilitate the study of human...

  6. Genomic definition of species

    Energy Technology Data Exchange (ETDEWEB)

    Crkvenjakov, R.; Drmanac, R.

    1991-07-01

    The subject of this paper is the definition of species based on the assumption that genome is the fundamental level for the origin and maintenance of biological diversity. For this view to be logically consistent it is necessary to assume the existence and operation of the new law which we call genome law. For this reason the genome law is included in the explanation of species phenomenon presented here even if its precise formulation and elaboration are left for the future. The intellectual underpinnings of this definition can be traced to Goldschmidt. We wish to explore some philosophical aspects of the definition of species in terms of the genome. The point of proposing the definition on these grounds is that any real advance in evolutionary theory has to be correct in both its philosophy and its science.

  7. Structural genomics in endocrinology

    NARCIS (Netherlands)

    Smit, J. W.; Romijn, J. A.

    2001-01-01

    Traditionally, endocrine research evolved from the phenotypical characterisation of endocrine disorders to the identification of underlying molecular pathophysiology. This approach has been, and still is, extremely successful. The introduction of genomics and proteomics has resulted in a reversal of

  8. Epidemiology & Genomics Research Program

    Science.gov (United States)

    The Epidemiology and Genomics Research Program, in the National Cancer Institute's Division of Cancer Control and Population Sciences, funds research in human populations to understand the determinants of cancer occurrence and outcomes.

  9. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  10. Genetical Genomics for Evolutionary Studies

    NARCIS (Netherlands)

    Prins, J.C.P.; Smant, G.; Jansen, R.C.

    2012-01-01

    Genetical genomics combines acquired high-throughput genomic data with genetic analysis. In this chapter, we discuss the application of genetical genomics for evolutionary studies, where new high-throughput molecular technologies are combined with mapping quantitative trait loci (QTL) on the genome

  11. Genomics of pear and other Rosaceae fruit trees.

    Science.gov (United States)

    Yamamoto, Toshiya; Terakami, Shingo

    2016-01-01

    The family Rosaceae includes many economically important fruit trees, such as pear, apple, peach, cherry, quince, apricot, plum, raspberry, and loquat. Over the past few years, whole-genome sequences have been released for Chinese pear, European pear, apple, peach, Japanese apricot, and strawberry. These sequences help us to conduct functional and comparative genomics studies and to develop new cultivars with desirable traits by marker-assisted selection in breeding programs. These genomics resources also allow identification of evolutionary relationships in Rosaceae, development of genome-wide SNP and SSR markers, and construction of reference genetic linkage maps, which are available through the Genome Database for the Rosaceae website. Here, we review the recent advances in genomics studies and their practical applications for Rosaceae fruit trees, particularly pear, apple, peach, and cherry.

  12. Using nanopore sequencing to get complete genomes from complex samples

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Nielsen, Per Halkjær

    The advantages of “next generation sequencing” has come at the cost of genome finishing. The dominant sequencing technology provides short reads of 150-300 bp, which has made genome assembly very difficult as the reads do not span important repeat regions. Genomes have thus been added...... to the databases as fragmented assemblies and not as finished contigs that resemble the chromosomes in which the DNA is organised within the cells. This is especially troublesome for genomes derived from complex metagenome sequencing. Databases with incomplete genomes can lead to false conclusions about...... the absence of genes and functional predictions of the organisms. Furthermore, it is common that repetitive elements and marker genes such as the 16S rRNA gene are missing completely from these genome bins. Using nanopore long reads, we demonstrate that it is possible to span these regions and make complete...

  13. G-InforBIO: integrated system for microbial genomics

    Directory of Open Access Journals (Sweden)

    Abe Takashi

    2006-08-01

    Full Text Available Abstract Background Genome databases contain diverse kinds of information, including gene annotations and nucleotide and amino acid sequences. It is not easy to integrate such information for genomic study. There are few tools for integrated analyses of genomic data, therefore, we developed software that enables users to handle, manipulate, and analyze genome data with a variety of sequence analysis programs. Results The G-InforBIO system is a novel tool for genome data management and sequence analysis. The system can import genome data encoded as eXtensible Markup Language documents as formatted text documents, including annotations and sequences, from DNA Data Bank of Japan and GenBank encoded as flat files. The genome database is constructed automatically after importing, and the database can be exported as documents formatted with eXtensible Markup Language or tab-deliminated text. Users can retrieve data from the database by keyword searches, edit annotation data of genes, and process data with G-InforBIO. In addition, information in the G-InforBIO database can be analyzed seamlessly with nine different software programs, including programs for clustering and homology analyses. Conclusion The G-InforBIO system simplifies genome analyses by integrating several available software programs to allow efficient handling and manipulation of genome data. G-InforBIO is freely available from the download site.

  14. [Personal genomics: are we debating the right Issues?].

    Science.gov (United States)

    Vayena, E; Mauch, F

    2012-07-25

    The debate about personal genomics and their role in personalized medicine has been, to some extent, hijacked by the controversy about commercially available genomic tests sold directly to consumers. The clinical validity and utility of such tests are currently limited and most medical associations recommend that consumers refrain from testing. Conversely, DTC genomics proponents and particularly the DTC industry argue that there is personal utility in acquiring genomic information. While it is necessary to debate risks and benefits of DTC genomics, we should not lose sight of the increasingly important role that genomics will play in medical practice and public health. Therefore, and in anticipation of this shift we also need to focus on important implications from the use of genomics information such as genetic discrimination, privacy protection and equitable access to health care. Undoubtedly, personal genomics will challenge our social norms maybe more than our medicine. Sticking to the polarization of «to have or not to have DTC genomics» risks to takes us away from the critical issues we need to be debating.

  15. Decoding the human genome

    CERN Multimedia

    CERN. Geneva. Audiovisual Unit; Antonerakis, S E

    2002-01-01

    Decoding the Human genome is a very up-to-date topic, raising several questions besides purely scientific, in view of the two competing teams (public and private), the ethics of using the results, and the fact that the project went apparently faster and easier than expected. The lecture series will address the following chapters: Scientific basis and challenges. Ethical and social aspects of genomics.

  16. Molluscan Evolutionary Genomics

    Energy Technology Data Exchange (ETDEWEB)

    Simison, W. Brian; Boore, Jeffrey L.

    2005-12-01

    In the last 20 years there have been dramatic advances in techniques of high-throughput DNA sequencing, most recently accelerated by the Human Genome Project, a program that has determined the three billion base pair code on which we are based. Now this tremendous capability is being directed at other genome targets that are being sampled across the broad range of life. This opens up opportunities as never before for evolutionary and organismal biologists to address questions of both processes and patterns of organismal change. We stand at the dawn of a new 'modern synthesis' period, paralleling that of the early 20th century when the fledgling field of genetics first identified the underlying basis for Darwin's theory. We must now unite the efforts of systematists, paleontologists, mathematicians, computer programmers, molecular biologists, developmental biologists, and others in the pursuit of discovering what genomics can teach us about the diversity of life. Genome-level sampling for mollusks to date has mostly been limited to mitochondrial genomes and it is likely that these will continue to provide the best targets for broad phylogenetic sampling in the near future. However, we are just beginning to see an inroad into complete nuclear genome sequencing, with several mollusks and other eutrochozoans having been selected for work about to begin. Here, we provide an overview of the state of molluscan mitochondrial genomics, highlight a few of the discoveries from this research, outline the promise of broadening this dataset, describe upcoming projects to sequence whole mollusk nuclear genomes, and challenge the community to prepare for making the best use of these data.

  17. Human Germline Genome Editing

    OpenAIRE

    Ormond, Kelly E.; Mortlock, Douglas P.; Scholes, Derek T.; Bombard, Yvonne; Brody, Lawrence C.; Faucett, W. Andrew; Garrison, Nanibaa’ A.; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E.

    2017-01-01

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Gen...

  18. Genome Variation Map: a data repository of genome variations in BIG Data Center.

    Science.gov (United States)

    Song, Shuhui; Tian, Dongmei; Li, Cuiping; Tang, Bixia; Dong, Lili; Xiao, Jingfa; Bao, Yiming; Zhao, Wenming; He, Hang; Zhang, Zhang

    2018-01-04

    The Genome Variation Map (GVM; http://bigd.big.ac.cn/gvm/) is a public data repository of genome variations. As a core resource in the BIG Data Center, Beijing Institute of Genomics, Chinese Academy of Sciences, GVM dedicates to collect, integrate and visualize genome variations for a wide range of species, accepts submissions of different types of genome variations from all over the world and provides free open access to all publicly available data in support of worldwide research activities. Unlike existing related databases, GVM features integration of a large number of genome variations for a broad diversity of species including human, cultivated plants and domesticated animals. Specifically, the current implementation of GVM not only houses a total of ∼4.9 billion variants for 19 species including chicken, dog, goat, human, poplar, rice and tomato, but also incorporates 8669 individual genotypes and 13 262 manually curated high-quality genotype-to-phenotype associations for non-human species. In addition, GVM provides friendly intuitive web interfaces for data submission, browse, search and visualization. Collectively, GVM serves as an important resource for archiving genomic variation data, helpful for better understanding population genetic diversity and deciphering complex mechanisms associated with different phenotypes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family.

    Science.gov (United States)

    Illa, Eudald; Sargent, Daniel J; Lopez Girona, Elena; Bushakra, Jill; Cestaro, Alessandro; Crowhurst, Ross; Pindo, Massimo; Cabrera, Antonio; van der Knaap, Esther; Iezzoni, Amy; Gardiner, Susan; Velasco, Riccardo; Arús, Pere; Chagné, David; Troggio, Michela

    2011-01-12

    Comparative genome mapping studies in Rosaceae have been conducted until now by aligning genetic maps within the same genus, or closely related genera and using a limited number of common markers. The growing body of genomics resources and sequence data for both Prunus and Fragaria permits detailed comparisons between these genera and the recently released Malus × domestica genome sequence. We generated a comparative analysis using 806 molecular markers that are anchored genetically to the Prunus and/or Fragaria reference maps, and physically to the Malus genome sequence. Markers in common for Malus and Prunus, and Malus and Fragaria, respectively were 784 and 148. The correspondence between marker positions was high and conserved syntenic blocks were identified among the three genera in the Rosaceae. We reconstructed a proposed ancestral genome for the Rosaceae. A genome containing nine chromosomes is the most likely candidate for the ancestral Rosaceae progenitor. The number of chromosomal translocations observed between the three genera investigated was low. However, the number of inversions identified among Malus and Prunus was much higher than any reported genome comparisons in plants, suggesting that small inversions have played an important role in the evolution of these two genera or of the Rosaceae.

  20. Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2011-01-01

    Full Text Available Abstract Background Comparative genome mapping studies in Rosaceae have been conducted until now by aligning genetic maps within the same genus, or closely related genera and using a limited number of common markers. The growing body of genomics resources and sequence data for both Prunus and Fragaria permits detailed comparisons between these genera and the recently released Malus × domestica genome sequence. Results We generated a comparative analysis using 806 molecular markers that are anchored genetically to the Prunus and/or Fragaria reference maps, and physically to the Malus genome sequence. Markers in common for Malus and Prunus, and Malus and Fragaria, respectively were 784 and 148. The correspondence between marker positions was high and conserved syntenic blocks were identified among the three genera in the Rosaceae. We reconstructed a proposed ancestral genome for the Rosaceae. Conclusions A genome containing nine chromosomes is the most likely candidate for the ancestral Rosaceae progenitor. The number of chromosomal translocations observed between the three genera investigated was low. However, the number of inversions identified among Malus and Prunus was much higher than any reported genome comparisons in plants, suggesting that small inversions have played an important role in the evolution of these two genera or of the Rosaceae.

  1. The Complete Chloroplast Genome of Catha edulis: A Comparative Analysis of Genome Features with Related Species

    Directory of Open Access Journals (Sweden)

    Cuihua Gu

    2018-02-01

    Full Text Available Qat (Catha edulis, Celastraceae is a woody evergreen species with great economic and cultural importance. It is cultivated for its stimulant alkaloids cathine and cathinone in East Africa and southwest Arabia. However, genome information, especially DNA sequence resources, for C. edulis are limited, hindering studies regarding interspecific and intraspecific relationships. Herein, the complete chloroplast (cp genome of Catha edulis is reported. This genome is 157,960 bp in length with 37% GC content and is structurally arranged into two 26,577 bp inverted repeats and two single-copy areas. The size of the small single-copy and the large single-copy regions were 18,491 bp and 86,315 bp, respectively. The C. edulis cp genome consists of 129 coding genes including 37 transfer RNA (tRNA genes, 8 ribosomal RNA (rRNA genes, and 84 protein coding genes. For those genes, 112 are single copy genes and 17 genes are duplicated in two inverted regions with seven tRNAs, four rRNAs, and six protein coding genes. The phylogenetic relationships resolved from the cp genome of qat and 32 other species confirms the monophyly of Celastraceae. The cp genomes of C. edulis, Euonymus japonicus and seven Celastraceae species lack the rps16 intron, which indicates an intron loss took place among an ancestor of this family. The cp genome of C. edulis provides a highly valuable genetic resource for further phylogenomic research, barcoding and cp transformation in Celastraceae.

  2. The Complete Chloroplast Genome of Catha edulis: A Comparative Analysis of Genome Features with Related Species

    Science.gov (United States)

    Tembrock, Luke R.; Zheng, Shaoyu; Wu, Zhiqiang

    2018-01-01

    Qat (Catha edulis, Celastraceae) is a woody evergreen species with great economic and cultural importance. It is cultivated for its stimulant alkaloids cathine and cathinone in East Africa and southwest Arabia. However, genome information, especially DNA sequence resources, for C. edulis are limited, hindering studies regarding interspecific and intraspecific relationships. Herein, the complete chloroplast (cp) genome of Catha edulis is reported. This genome is 157,960 bp in length with 37% GC content and is structurally arranged into two 26,577 bp inverted repeats and two single-copy areas. The size of the small single-copy and the large single-copy regions were 18,491 bp and 86,315 bp, respectively. The C. edulis cp genome consists of 129 coding genes including 37 transfer RNA (tRNA) genes, 8 ribosomal RNA (rRNA) genes, and 84 protein coding genes. For those genes, 112 are single copy genes and 17 genes are duplicated in two inverted regions with seven tRNAs, four rRNAs, and six protein coding genes. The phylogenetic relationships resolved from the cp genome of qat and 32 other species confirms the monophyly of Celastraceae. The cp genomes of C. edulis, Euonymus japonicus and seven Celastraceae species lack the rps16 intron, which indicates an intron loss took place among an ancestor of this family. The cp genome of C. edulis provides a highly valuable genetic resource for further phylogenomic research, barcoding and cp transformation in Celastraceae. PMID:29425128

  3. Genome Variation Map: a data repository of genome variations in BIG Data Center

    Science.gov (United States)

    Tian, Dongmei; Li, Cuiping; Tang, Bixia; Dong, Lili; Xiao, Jingfa; Bao, Yiming; Zhao, Wenming; He, Hang

    2018-01-01

    Abstract The Genome Variation Map (GVM; http://bigd.big.ac.cn/gvm/) is a public data repository of genome variations. As a core resource in the BIG Data Center, Beijing Institute of Genomics, Chinese Academy of Sciences, GVM dedicates to collect, integrate and visualize genome variations for a wide range of species, accepts submissions of different types of genome variations from all over the world and provides free open access to all publicly available data in support of worldwide research activities. Unlike existing related databases, GVM features integration of a large number of genome variations for a broad diversity of species including human, cultivated plants and domesticated animals. Specifically, the current implementation of GVM not only houses a total of ∼4.9 billion variants for 19 species including chicken, dog, goat, human, poplar, rice and tomato, but also incorporates 8669 individual genotypes and 13 262 manually curated high-quality genotype-to-phenotype associations for non-human species. In addition, GVM provides friendly intuitive web interfaces for data submission, browse, search and visualization. Collectively, GVM serves as an important resource for archiving genomic variation data, helpful for better understanding population genetic diversity and deciphering complex mechanisms associated with different phenotypes. PMID:29069473

  4. A high-quality carrot genome assembly provides new insights into carotenoid accumulation and asterid genome evolution

    Science.gov (United States)

    We report a chromosome-scale assembly and analysis of the Daucus carota genome, an important source of provitamin A in the human diet and the first sequenced genome among members of the Euasterid II clade. We characterized two new polyploidization events, both occurring after the divergence of carro...

  5. Eyeball Pressure Stimulation Unveils Subtle Autonomic Cardiovascular Dysfunction in Persons with a History of Mild Traumatic Brain Injury.

    Science.gov (United States)

    Hilz, Max J; Aurnhammer, Felix; Flanagan, Steven R; Intravooth, Tassanai; Wang, Ruihao; Hösl, Katharina M; Pauli, Elisabeth; Koehn, Julia

    2015-11-15

    After mild traumatic brain injury (mTBI), patients have increased long-term mortality rates, persisting even beyond 13 years. Pathophysiology is unclear. Yet, central autonomic network dysfunction may contribute to cardiovascular dysregulation and increased mortality. Purely parasympathetic cardiovascular challenge by eyeball pressure stimulation (EP), might unveil subtle autonomic dysfunction in post-mTBI patients. We investigated whether mild EP shows autonomic cardiovascular dysregulation in post-mTBI patients. In 24 patients (34 ± 12 years; 5-86 months post-injury) and 27 controls (30 ± 11 years), we monitored respiration, electrocardiographic RR intervals (RRI), systolic and diastolic blood pressure (BPsys, BPdia) before and during 2 min of 30 mm Hg EP, applied by an ophthalmologic ocular pressure device (Okulopressor(®)). We calculated spectral powers of RRI in the mainly sympathetic low frequency (LF; 0.04-0.15 Hz) and parasympathetic high frequency (HF; 0.15-0.5 Hz) ranges, and of BP in the sympathetic LF range, the RRI-LF/HF ratio as index of the sympathetic-parasympathetic balance, normalized (nu) RRI-LF- and HF-powers, and LF- and HF-powers after natural logarithmic transformation (ln). Parameters before and during EP in post-mTBI patients and controls were compared by repeated measurement analysis of variance with post hoc analysis (p < 0.05). During EP, BPsys and BPdia increased in post-mTBI patients. Only in controls but not in post-mTBI patients, EP increased RRI-HFnu-powers and decreased RRI-LF-powers, RRI-LFnu-powers, BPsys-LF-powers, BPsys-lnLF-powers and BPdia-lnLF-powers. RRI-LF/HF ratios slightly increased in post-mTBI patients but slightly decreased in controls upon EP. Even with only mild EP, our controls showed normal EP responses and shifted sympathetic-parasympathetic balance towards parasympathetic predominance. In contrast, our post-mTBI patients could not increase parasympathetic heart rate modulation but

  6. Uncertainty analysis in Titan ionospheric simulated ion mass spectra: unveiling a set of issues for models accuracy improvement

    Science.gov (United States)

    Hébrard, Eric; Carrasco, Nathalie; Dobrijevic, Michel; Pernot, Pascal

    present semi-coupled model of Titan's ionosphere. We will eventually unveil a set of different issues limiting the current accuracy and, as one can expect, the predictivity of Titan photochemical models.

  7. RadGenomics project

    Energy Technology Data Exchange (ETDEWEB)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu [National Inst. of Radiological Sciences, Chiba (Japan). Frontier Research Center] [and others

    2002-06-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  8. Human social genomics.

    Directory of Open Access Journals (Sweden)

    Steven W Cole

    2014-08-01

    Full Text Available A growing literature in human social genomics has begun to analyze how everyday life circumstances influence human gene expression. Social-environmental conditions such as urbanity, low socioeconomic status, social isolation, social threat, and low or unstable social status have been found to associate with differential expression of hundreds of gene transcripts in leukocytes and diseased tissues such as metastatic cancers. In leukocytes, diverse types of social adversity evoke a common conserved transcriptional response to adversity (CTRA characterized by increased expression of proinflammatory genes and decreased expression of genes involved in innate antiviral responses and antibody synthesis. Mechanistic analyses have mapped the neural "social signal transduction" pathways that stimulate CTRA gene expression in response to social threat and may contribute to social gradients in health. Research has also begun to analyze the functional genomics of optimal health and thriving. Two emerging opportunities now stand to revolutionize our understanding of the everyday life of the human genome: network genomics analyses examining how systems-level capabilities emerge from groups of individual socially sensitive genomes and near-real-time transcriptional biofeedback to empirically optimize individual well-being in the context of the unique genetic, geographic, historical, developmental, and social contexts that jointly shape the transcriptional realization of our innate human genomic potential for thriving.

  9. RadGenomics project

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu

    2002-01-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  10. GenPlay Multi-Genome, a tool to compare and analyze multiple human genomes in a graphical interface.

    Science.gov (United States)

    Lajugie, Julien; Fourel, Nicolas; Bouhassira, Eric E

    2015-01-01

    Parallel visualization of multiple individual human genomes is a complex endeavor that is rapidly gaining importance with the increasing number of personal, phased and cancer genomes that are being generated. It requires the display of variants such as SNPs, indels and structural variants that are unique to specific genomes and the introduction of multiple overlapping gaps in the reference sequence. Here, we describe GenPlay Multi-Genome, an application specifically written to visualize and analyze multiple human genomes in parallel. GenPlay Multi-Genome is ideally suited for the comparison of allele-specific expression and functional genomic data obtained from multiple phased genomes in a graphical interface with access to multiple-track operation. It also allows the analysis of data that have been aligned to custom genomes rather than to a standard reference and can be used as a variant calling format file browser and as a tool to compare different genome assembly, such as hg19 and hg38. GenPlay is available under the GNU public license (GPL-3) from http://genplay.einstein.yu.edu. The source code is available at https://github.com/JulienLajugie/GenPlay. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Survey sequencing and comparative analysis of the elephant shark (Callorhinchus milii genome.

    Directory of Open Access Journals (Sweden)

    Byrappa Venkatesh

    2007-04-01

    Full Text Available Owing to their phylogenetic position, cartilaginous fishes (sharks, rays, skates, and chimaeras provide a critical reference for our understanding of vertebrate genome evolution. The relatively small genome of the elephant shark, Callorhinchus milii, a chimaera, makes it an attractive model cartilaginous fish genome for whole-genome sequencing and comparative analysis. Here, the authors describe survey sequencing (1.4x coverage and comparative analysis of the elephant shark genome, one of the first cartilaginous fish genomes to be sequenced to this depth. Repetitive sequences, represented mainly by a novel family of short interspersed element-like and long interspersed element-like sequences, account for about 28% of the elephant shark genome. Fragments of approximately 15,000 elephant shark genes reveal specific examples of genes that have been lost differentially during the evolution of tetrapod and teleost fish lineages. Interestingly, the degree of conserved synteny and conserved sequences between the human and elephant shark genomes are higher than that between human and teleost fish genomes. Elephant shark contains putative four Hox clusters indicating that, unlike teleost fish genomes, the elephant shark genome has not experienced an additional whole-genome duplication. These findings underscore the importance of the elephant shark as a critical reference vertebrate genome for comparative analysis of the human and other vertebrate genomes. This study also demonstrates that a survey-sequencing approach can be applied productively for comparative analysis of distantly related vertebrate genomes.

  12. [Mycoviruses and importance in mycology].

    Science.gov (United States)

    Keçeli, Sema Aşkın

    2017-10-01

    Opportunistic fungal infections like invasive candidiasis and aspergillozis have high mortality rate particularly in immunosupressive patients. The rate of therapy success with antifungal agents is usually low. Although immunotherapy methods have been developed to increase the host response against antifungals, there has been a need for new antifungal therapeutic agents in the treatment of invasive aspergillozis and other opportunistic fungal infections. Mycoviruses are the viruses that specifically infect fungi. The use of mycoviruses in the treatment of invasive fungal infections has not been suggested yet. However, as mentioned in this review, the researches about the use of mycoviruses as a therapeutic agent have been still carried on. Mycoviruses have no infectivity as free particules. Many of them have RNA genome. They are classified as: Fungi containing "double stranded (ds) RNA, ds DNA or single stranded RNA". Although most of them are found in plant pathogenic fungi, they are also found in human pathogenic fungi. In most of the mycoviruses identified up to now, dsRNA genome are present. Mycoviruses that can be pathogenic for human and carrying dsRNA genome have been classified as Partitiviridae, Totiviridae, Chrysoviridae, Reoviridae and Hypoviridae. A part of mycoviruses may not cause any sign of infection in fungal host. The other part of mycoviruses causes hypovirulence or lethal effect. When hypovirulence occured in fungi, the observed effects are the decrease in pigmentation, mycelium formation, asexual sporulation, growing rate and the loss of fertility. The transfer of mycovirus to fungi may occur by intracellular or extracellular way. The transfer of genetic content to fungi occurs in two way: transformation and transfection. In both ways, there is a need for a spheroblast that has no cell wall. There are various scenarios about mycoviruses for the their use in the treatment. In the first scenario, the transfer of selective mycovirus is ensured by

  13. Historical genomics of North American maize

    NARCIS (Netherlands)

    Heerwaarden, van J.; Hufford, M.B.; Ross-Ibarra, J.

    2012-01-01

    Since the advent of modern plant breeding in the 1930s, North American maize has undergone a dramatic adaptation to high-input agriculture. Despite the importance of genetic contributions to historical yield increases, little is known about the underlying genomic changes. Here we use high-density

  14. The Human Genome Project and Biology Education.

    Science.gov (United States)

    McInerney, Joseph D.

    1996-01-01

    Highlights the importance of the Human Genome Project in educating the public about genetics. Discusses four challenges that science educators must address: teaching for conceptual understanding, the nature of science, the personal and social impact of science and technology, and the principles of technology. Contains 45 references. (JRH)

  15. Applied bioinformatics: Genome annotation and transcriptome analysis

    DEFF Research Database (Denmark)

    Gupta, Vikas

    agricultural and biological importance. Its capacity to form symbiotic relationships with rhizobia and microrrhizal fungi has fascinated researchers for years. Lotus has a small genome of approximately 470 Mb and a short life cycle of 2 to 3 months, which has made Lotus a model legume plant for many molecular...

  16. Translating Genomic Discoveries to Cure Ultrahypermutant ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Translating Genomic Discoveries to Cure Ultrahypermutant Mismatch Repair Deficient Brain Tumours. Malignant brain tumours are the most common cause of death among children with cancer, but there is no known cure. This project will advance research in this important field. Inherited mutations and childhood cancer.

  17. Cellular Factors Shape 3D Genome Landscape

    Science.gov (United States)

    Researchers, using novel large-scale imaging technology, have mapped the spatial location of individual genes in the nucleus of human cells and identified 50 cellular factors required for the proper 3D positioning of genes. These spatial locations play important roles in gene expression, DNA repair, genome stability, and other cellular activities.

  18. Unveiling the Gap

    DEFF Research Database (Denmark)

    Jensson, Pall; Rokkjær, Ole; Nørgaard, Bente

    by the EU Leonardo da Vinci Partnership program. The project had two objectives. The first objective was to use the European Qualification Framework (EQF) as a benchmark against the National Qualification Framework (NQF) of the partner countries and the IE educations offered by the partner institutions...

  19. LHCb unveils new particles

    CERN Multimedia

    Stefania Pandolfi

    2016-01-01

    The LHCb collaboration announces the observation of four “exotic” particles from its analysis of the LHC data.   The LHCb experimental cavern. On 28 June, the LHCb collaboration reported the observation of three new "exotic" particles and confirmation of the existence of a fourth one in data from the LHC. These particles each appear to be formed by four quarks (the fundamental constituents of the matter inside all the atoms of the universe): two quarks and two antiquarks (that is, a tetraquark). Due to their non-standard quark content, the newly observed particles have been included in the broad category of so-called exotic particles, although their exact theoretical interpretation is still under study.            The quark model, proposed by Murray Gell-Mann and George Zweig in 1964, is considered to be the most valid scheme for the classification of hadrons (all the composite particles) that has been fou...

  20. Genomics using the Assembly of the Mink Genome

    DEFF Research Database (Denmark)

    Guldbrandtsen, Bernt; Cai, Zexi; Sahana, Goutam

    2018-01-01

    The American Mink’s (Neovison vison) genome has recently been sequenced. This opens numerous avenues of research both for studying the basic genetics and physiology of the mink as well as genetic improvement in mink. Using genotyping-by-sequencing (GBS) generated marker data for 2,352 Danish farm...... mink runs of homozygosity (ROH) were detect in mink genomes. Detectable ROH made up on average 1.7% of the genome indicating the presence of at most a moderate level of genomic inbreeding. The fraction of genome regions found in ROH varied. Ten percent of the included regions were never found in ROH....... The ability to detect ROH in the mink genome also demonstrates the general reliability of the new mink genome assembly. Keywords: american mink, run of homozygosity, genome, selection, genomic inbreeding...

  1. Karyotype diversity and genome size variation in Neotropical Maxillariinae orchids.

    Science.gov (United States)

    Moraes, A P; Koehler, S; Cabral, J S; Gomes, S S L; Viccini, L F; Barros, F; Felix, L P; Guerra, M; Forni-Martins, E R

    2017-03-01

    Orchidaceae is a widely distributed plant family with very diverse vegetative and floral morphology, and such variability is also reflected in their karyotypes. However, since only a low proportion of Orchidaceae has been analysed for chromosome data, greater diversity may await to be unveiled. Here we analyse both genome size (GS) and karyotype in two subtribes recently included in the broadened Maxillariinea to detect how much chromosome and GS variation there is in these groups and to evaluate which genome rearrangements are involved in the species evolution. To do so, the GS (14 species), the karyotype - based on chromosome number, heterochromatic banding and 5S and 45S rDNA localisation (18 species) - was characterised and analysed along with published data using phylogenetic approaches. The GS presented a high phylogenetic correlation and it was related to morphological groups in Bifrenaria (larger plants - higher GS). The two largest GS found among genera were caused by different mechanisms: polyploidy in Bifrenaria tyrianthina and accumulation of repetitive DNA in Scuticaria hadwenii. The chromosome number variability was caused mainly through descending dysploidy, and x=20 was estimated as the base chromosome number. Combining GS and karyotype data with molecular phylogeny, our data provide a more complete scenario of the karyotype evolution in Maxillariinae orchids, allowing us to suggest, besides dysploidy, that inversions and transposable elements as two mechanisms involved in the karyotype evolution. Such karyotype modifications could be associated with niche changes that occurred during species evolution. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. The cacao Criollo genome v2.0: an improved version of the genome for genetic and functional genomic studies.

    Science.gov (United States)

    Argout, X; Martin, G; Droc, G; Fouet, O; Labadie, K; Rivals, E; Aury, J M; Lanaud, C

    2017-09-15

    Theobroma cacao L., native to the Amazonian basin of South America, is an economically important fruit tree crop for tropical countries as a source of chocolate. The first draft genome of the species, from a Criollo cultivar, was published in 2011. Although a useful resource, some improvements are possible, including identifying misassemblies, reducing the number of scaffolds and gaps, and anchoring un-anchored sequences to the 10 chromosomes. We used a NGS-based approach to significantly improve the assembly of the Belizian Criollo B97-61/B2 genome. We combined four Illumina large insert size mate paired libraries with 52x of Pacific Biosciences long reads to correct misassembled regions and reduced the number of scaffolds. We then used genotyping by sequencing (GBS) methods to increase the proportion of the assembly anchored to chromosomes. The scaffold number decreased from 4,792 in assembly V1 to 554 in V2 while the scaffold N50 size has increased from 0.47 Mb in V1 to 6.5 Mb in V2. A total of 96.7% of the assembly was anchored to the 10 chromosomes compared to 66.8% in the previous version. Unknown sites (Ns) were reduced from 10.8% to 5.7%. In addition, we updated the functional annotations and performed a new RefSeq structural annotation based on RNAseq evidence. Theobroma cacao Criollo genome version 2 will be a valuable resource for the investigation of complex traits at the genomic level and for future comparative genomics and genetics studies in cacao tree. New functional tools and annotations are available on the Cocoa Genome Hub ( http://cocoa-genome-hub.southgreen.fr ).

  3. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    Science.gov (United States)

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  4. Genome Editing Redefines Precision Medicine in the Cardiovascular Field

    Directory of Open Access Journals (Sweden)

    Elda Dzilic

    2018-01-01

    Full Text Available Genome editing is a powerful tool to study the function of specific genes and proteins important for development or disease. Recent technologies, especially CRISPR/Cas9 which is characterized by convenient handling and high precision, revolutionized the field of genome editing. Such tools have enormous potential for basic science as well as for regenerative medicine. Nevertheless, there are still several hurdles that have to be overcome, but patient-tailored therapies, termed precision medicine, seem to be within reach. In this review, we focus on the achievements and limitations of genome editing in the cardiovascular field. We explore different areas of cardiac research and highlight the most important developments: (1 the potential of genome editing in human pluripotent stem cells in basic research for disease modelling, drug screening, or reprogramming approaches and (2 the potential and remaining challenges of genome editing for regenerative therapies. Finally, we discuss social and ethical implications of these new technologies.

  5. The genome and transcriptome of perennial ryegrass mitochondria

    DEFF Research Database (Denmark)

    Islam, Md. Shofiqul; Studer, Bruno; Byrne, Stephen

    2013-01-01

    Background: Perennial ryegrass (Lolium perenne L.) is one of the most important forage and turf grass species of temperate regions worldwide. Its mitochondrial genome is inherited maternally and contains genes that can influence traits of agricultural importance. Moreover, the DNA sequence...... and annotation of the complete mitochondrial genome from perennial ryegrass. Results: Intact mitochondria from perennial ryegrass leaves were isolated and used for mtDNA extraction. The mitochondrial genome was sequenced to a 167-fold coverage using the Roche 454 GS-FLX Titanium platform, and assembled...... of mitochondrial genomes has been established and compared for a large number of species in order to characterize evolutionary relationships.Therefore, it is crucial to understand the organization of the mitochondrial genome and how it varies between and within species. Here, we report the first de novo assembly...

  6. Complete genome sequence of Ikoma lyssavirus.

    Science.gov (United States)

    Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

    2012-09-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

  7. Genome scale metabolic modeling of cancer

    DEFF Research Database (Denmark)

    Nilsson, Avlant; Nielsen, Jens

    2017-01-01

    of metabolism which allows simulation and hypotheses testing of metabolic strategies. It has successfully been applied to many microorganisms and is now used to study cancer metabolism. Generic models of human metabolism have been reconstructed based on the existence of metabolic genes in the human genome......Cancer cells reprogram metabolism to support rapid proliferation and survival. Energy metabolism is particularly important for growth and genes encoding enzymes involved in energy metabolism are frequently altered in cancer cells. A genome scale metabolic model (GEM) is a mathematical formalization...

  8. Visualization of genome signatures of eukaryote genomes by batch-learning self-organizing map with a special emphasis on Drosophila genomes.

    Science.gov (United States)

    Abe, Takashi; Hamano, Yuta; Ikemura, Toshimichi

    2014-01-01

    A strategy of evolutionary studies that can compare vast numbers of genome sequences is becoming increasingly important with the remarkable progress of high-throughput DNA sequencing methods. We previously established a sequence alignment-free clustering method "BLSOM" for di-, tri-, and tetranucleotide compositions in genome sequences, which can characterize sequence characteristics (genome signatures) of a wide range of species. In the present study, we generated BLSOMs for tetra- and pentanucleotide compositions in approximately one million sequence fragments derived from 101 eukaryotes, for which almost complete genome sequences were available. BLSOM recognized phylotype-specific characteristics (e.g., key combinations of oligonucleotide frequencies) in the genome sequences, permitting phylotype-specific clustering of the sequences without any information regarding the species. In our detailed examination of 12 Drosophila species, the correlation between their phylogenetic classification and the classification on the BLSOMs was observed to visualize oligonucleotides diagnostic for species-specific clustering.

  9. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  10. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  11. Coordination of Programs on Domestic Animal Genomics: A Federal Framework

    National Research Council Canada - National Science Library

    2003-01-01

    The Interagency Working Group (IWG) on Domestic Animal Genomics was chartered in March 2002 to enhance communication and awareness of the importance of domesticated animals, both livestock and companion, as a critical part...

  12. Genome position specific priors for genomic prediction

    DEFF Research Database (Denmark)

    Brøndum, Rasmus Froberg; Su, Guosheng; Lund, Mogens Sandø

    2012-01-01

    casual mutation is different between the populations but affects the same gene. Proportions of a four-distribution mixture for SNP effects in segments of fixed size along the genome are derived from one population and set as location specific prior proportions of distributions of SNP effects...... for the target population. The model was tested using dairy cattle populations of different breeds: 540 Australian Jersey bulls, 2297 Australian Holstein bulls and 5214 Nordic Holstein bulls. The traits studied were protein-, fat- and milk yield. Genotypic data was Illumina 777K SNPs, real or imputed Results...

  13. Attitudes towards personal genomics among older Swiss adults: An exploratory study

    Directory of Open Access Journals (Sweden)

    Laura Mählmann

    2016-03-01

    Conclusion: This study indicates a relatively positive overall attitude towards personal genomic testing among older Swiss adults, a group not typically represented in surveys about personal genomics. Genomic data of older adults can be highly relevant to late life health and maintenance of quality of life. In addition they can be an invaluable source for better understanding of longevity, health and disease. Understanding the attitudes of this population towards genomic analyses, although important, remains under-examined.

  14. The role of zinc in genomic stability

    International Nuclear Information System (INIS)

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Fenech, Michael

    2012-01-01

    Zinc (Zn) is an essential trace element required for maintaining both optimal human health and genomic stability. Zn plays a critical role in the regulation of DNA repair mechanisms, cell proliferation, differentiation and apoptosis involving the action of various transcriptional factors and DNA or RNA polymerases. Zn is an essential cofactor or structural component for important antioxidant defence proteins and DNA repair enzymes such as Cu/Zn SOD, OGG1, APE and PARP and may also affect activities of enzymes such as BHMT and MTR involved in methylation reactions in the folate-methionine cycle. This review focuses on the role of Zn in the maintenance of genome integrity and the effects of deficiency or excess on genomic stability events and cell death.

  15. Genomic Diversity in the Genus of Aspergillus

    DEFF Research Database (Denmark)

    Rasmussen, Jane Lind Nybo

    , sections and genus of Aspergillus. The work uncovers a large genomic diversity across all studied groups of species. The genomic diversity was especially evident on the section level, where the proteins shared by all species only represents ⇠55% of the proteome. This number decreases even further, to 38......, sections Nigri, Usti and Cavericolus, clade Tubingensis, and species A. niger. It lastly uses these results to predict genetic traits that take part in fungal speciation. Within a few years the Aspergillus whole-genus sequencing project will have published all currently-accepted Aspergillus genomes......Aspergillus is a highly important genus of saprotrophic filamentous fungi. It is a very diverse genus that is inextricably intertwined with human a↵airs on a daily basis, holding species relevant to plant and human pathology, enzyme and bulk chemistry production, food and beverage biotechnology...

  16. Interpretation of Genomic Data Questions and Answers

    Science.gov (United States)

    Simon, Richard

    2008-01-01

    Using a question and answer format we describe important aspects of using genomic technologies in cancer research. The main challenges are not managing the mass of data, but rather the design, analysis and accurate reporting of studies that result in increased biological knowledge and medical utility. Many analysis issues address the use of expression microarrays but are also applicable to other whole genome assays. Microarray based clinical investigations have generated both unrealistic hyperbole and excessive skepticism. Genomic technologies are tremendously powerful and will play instrumental roles in elucidating the mechanisms of oncogenesis and in devlopingan era of predictive medicine in which treatments are tailored to individual tumors. Achieving these goals involves challenges in re-thinking many paradigms for the conduct of basic and clinical cancer research and for the organization of interdisciplinary collaboration. PMID:18582627

  17. Salmonella Typhi genomics: envisaging the future of typhoid eradication.

    Science.gov (United States)

    Yap, Kien-Pong; Thong, Kwai Lin

    2017-08-01

    Next-generation whole-genome sequencing has revolutionised the study of infectious diseases in recent years. The availability of genome sequences and its understanding have transformed the field of molecular microbiology, epidemiology, infection treatments and vaccine developments. We review the key findings of the publicly accessible genomes of Salmonella enterica serovar Typhi since the first complete genome to the most recent release of thousands of Salmonella Typhi genomes, which remarkably shape the genomic research of S. Typhi and other pathogens. Important new insights acquired from the genome sequencing of S. Typhi, pertaining to genomic variations, evolution, population structure, antibiotic resistance, virulence, pathogenesis, disease surveillance/investigation and disease control are discussed. As the numbers of sequenced genomes are increasing at an unprecedented rate, fine variations in the gene pool of S. Typhi are captured in high resolution, allowing deeper understanding of the pathogen's evolutionary trends and its pathogenesis, paving the way to bringing us closer to eradication of typhoid through effective vaccine/treatment development. © 2017 John Wiley & Sons Ltd.

  18. GDC 2: Compression of large collections of genomes.

    Science.gov (United States)

    Deorowicz, Sebastian; Danek, Agnieszka; Niemiec, Marcin

    2015-06-25

    The fall of prices of the high-throughput genome sequencing changes the landscape of modern genomics. A number of large scale projects aimed at sequencing many human genomes are in progress. Genome sequencing also becomes an important aid in the personalized medicine. One of the significant side effects of this change is a necessity of storage and transfer of huge amounts of genomic data. In this paper we deal with the problem of compression of large collections of complete genomic sequences. We propose an algorithm that is able to compress the collection of 1092 human diploid genomes about 9,500 times. This result is about 4 times better than what is offered by the other existing compressors. Moreover, our algorithm is very fast as it processes the data with speed 200 MB/s on a modern workstation. In a consequence the proposed algorithm allows storing the complete genomic collections at low cost, e.g., the examined collection of 1092 human genomes needs only about 700 MB when compressed, what can be compared to about 6.7 TB of uncompressed FASTA files. The source code is available at http://sun.aei.polsl.pl/REFRESH/index.php?page=projects&project=gdc&subpage=about.

  19. Genomics of Volvocine Algae

    Science.gov (United States)

    Umen, James G.; Olson, Bradley J.S.C.

    2015-01-01

    Volvocine algae are a group of chlorophytes that together comprise a unique model for evolutionary and developmental biology. The species Chlamydomonas reinhardtii and Volvox carteri represent extremes in morphological diversity within the Volvocine clade. Chlamydomonas is unicellular and reflects the ancestral state of the group, while Volvox is multicellular and has evolved numerous innovations including germ-soma differentiation, sexual dimorphism, and complex morphogenetic patterning. The Chlamydomonas genome sequence has shed light on several areas of eukaryotic cell biology, metabolism and evolution, while the Volvox genome sequence has enabled a comparison with Chlamydomonas that reveals some of the underlying changes that enabled its transition to multicellularity, but also underscores the subtlety of this transition. Many of the tools and resources are in place to further develop Volvocine algae as a model for evolutionary genomics. PMID:25883411

  20. Genomics of Salmonella Species

    Science.gov (United States)

    Canals, Rocio; McClelland, Michael; Santiviago, Carlos A.; Andrews-Polymenis, Helene

    Progress in the study of Salmonella survival, colonization, and virulence has increased rapidly with the advent of complete genome sequencing and higher capacity assays for transcriptomic and proteomic analysis. Although many of these techniques have yet to be used to directly assay Salmonella growth on foods, these assays are currently in use to determine Salmonella factors necessary for growth in animal models including livestock animals and in in vitro conditions that mimic many different environments. As sequencing of the Salmonella genome and microarray analysis have revolutionized genomics and transcriptomics of salmonellae over the last decade, so are new high-throughput sequencing technologies currently accelerating the pace of our studies and allowing us to approach complex problems that were not previously experimentally tractable.