WorldWideScience

Sample records for unit salinas pueblo

  1. Characterization of Near-Surface Geology and Possible Voids Using Resistivity and Electromagnetic Methods at the Gran Quivira Unit of Salinas Pueblo Missions National Monument, Central New Mexico, June 2005

    Science.gov (United States)

    Ball, Lyndsay B.; Lucius, Jeffrey E.; Land, Lewis A.; Teeple, Andrew P.

    2006-01-01

    At the Gran Quivira Unit of Salinas Pueblo Missions National Monument in central New Mexico, a partially excavated pueblo known as Mound 7 has recently become architecturally unstable. Historical National Park Service records indicate both natural caves and artificial tunnels may be present in the area. Knowledge of the local near-surface geology and possible locations of voids would aid in preservation of the ruins. Time-domain and frequency-domain electromagnetic as well as direct-current resistivity methods were used to characterize the electrical structure of the near-surface geology and to identify discrete electrical features that may be associated with voids. Time-domain electromagnetic soundings indicate three major electrical layers; however, correlation of these layers to geologic units was difficult because of the variability of lithologic data from existing test holes. Although resistivity forward modeling was unable to conclusively determine the presence or absence of voids in most cases, the high-resistivity values (greater than 5,000 ohm-meters) in the direct-current resistivity data indicate that voids may exist in the upper 50 meters. Underneath Mound 7, there is a possibility of large voids below a depth of 20 meters, but there is no indication of substantial voids in the upper 20 meters. Gridded lines and profiled inversions of frequency-domain electromagnetic data showed excellent correlation to resistivity features in the upper 5 meters of the direct-current resistivity data. This technique showed potential as a reconnaissance tool for detecting voids in the very near surface.

  2. Salinas :

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Walsh, Timothy; Bhardwaj, Manoj K.

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics nite element analysis, required for high delity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are speci c to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  3. de Salinas

    Directory of Open Access Journals (Sweden)

    Ma. Dolores París

    2003-01-01

    Full Text Available A diferencia de otros pueblos indígenas de Oaxaca como los mixtecos o los zapotecos que tienen una larga tradición migratoria en Estados Unidos, la migración de los triquis puede considerarse como un nuevo grupo migratorio. Por ejemplo, la mayoría de las familias asentadas en el Valle de Salinas, situado en la costa central de California, llegaron hace menos de cinco años. En otros lugares, como en los valles centrales o en las ciudades del sur (San Diego y Los Ángeles vivían unos pocos hombres triquis hacia los años ochenta. Algunos de esos contados pioneros lograron regularizar su situación migratoria a fines de esa misma década; muchos hombres y la enorme mayoría de las mujeres triquis que viven en California son indocumentados.

  4. Groundwater-quality data in the Monterey–Salinas shallow aquifer study unit, 2013: Results from the California GAMA Program

    Science.gov (United States)

    Goldrath, Dara A.; Kulongoski, Justin T.; Davis, Tracy A.

    2016-09-01

    Groundwater quality in the 3,016-square-mile Monterey–Salinas Shallow Aquifer study unit was investigated by the U.S. Geological Survey (USGS) from October 2012 to May 2013 as part of the California State Water Resources Control Board Groundwater Ambient Monitoring and Assessment (GAMA) Program’s Priority Basin Project. The GAMA Monterey–Salinas Shallow Aquifer study was designed to provide a spatially unbiased assessment of untreated-groundwater quality in the shallow-aquifer systems in parts of Monterey and San Luis Obispo Counties and to facilitate statistically consistent comparisons of untreated-groundwater quality throughout California. The shallow-aquifer system in the Monterey–Salinas Shallow Aquifer study unit was defined as those parts of the aquifer system shallower than the perforated depth intervals of public-supply wells, which generally corresponds to the part of the aquifer system used by domestic wells. Groundwater quality in the shallow aquifers can differ from the quality in the deeper water-bearing zones; shallow groundwater can be more vulnerable to surficial contamination.Samples were collected from 170 sites that were selected by using a spatially distributed, randomized grid-based method. The study unit was divided into 4 study areas, each study area was divided into grid cells, and 1 well was sampled in each of the 100 grid cells (grid wells). The grid wells were domestic wells or wells with screen depths similar to those in nearby domestic wells. A greater spatial density of data was achieved in 2 of the study areas by dividing grid cells in those study areas into subcells, and in 70 subcells, samples were collected from exterior faucets at sites where there were domestic wells or wells with screen depths similar to those in nearby domestic wells (shallow-well tap sites).Field water-quality indicators (dissolved oxygen, water temperature, pH, and specific conductance) were measured, and samples for analysis of inorganic

  5. Groundwater-quality data in the Monterey–Salinas shallow aquifer study unit, 2013: Results from the California GAMA Program

    Science.gov (United States)

    Goldrath, Dara A.; Kulongoski, Justin T.; Davis, Tracy A.

    2016-09-01

    Groundwater quality in the 3,016-square-mile Monterey–Salinas Shallow Aquifer study unit was investigated by the U.S. Geological Survey (USGS) from October 2012 to May 2013 as part of the California State Water Resources Control Board Groundwater Ambient Monitoring and Assessment (GAMA) Program’s Priority Basin Project. The GAMA Monterey–Salinas Shallow Aquifer study was designed to provide a spatially unbiased assessment of untreated-groundwater quality in the shallow-aquifer systems in parts of Monterey and San Luis Obispo Counties and to facilitate statistically consistent comparisons of untreated-groundwater quality throughout California. The shallow-aquifer system in the Monterey–Salinas Shallow Aquifer study unit was defined as those parts of the aquifer system shallower than the perforated depth intervals of public-supply wells, which generally corresponds to the part of the aquifer system used by domestic wells. Groundwater quality in the shallow aquifers can differ from the quality in the deeper water-bearing zones; shallow groundwater can be more vulnerable to surficial contamination.Samples were collected from 170 sites that were selected by using a spatially distributed, randomized grid-based method. The study unit was divided into 4 study areas, each study area was divided into grid cells, and 1 well was sampled in each of the 100 grid cells (grid wells). The grid wells were domestic wells or wells with screen depths similar to those in nearby domestic wells. A greater spatial density of data was achieved in 2 of the study areas by dividing grid cells in those study areas into subcells, and in 70 subcells, samples were collected from exterior faucets at sites where there were domestic wells or wells with screen depths similar to those in nearby domestic wells (shallow-well tap sites).Field water-quality indicators (dissolved oxygen, water temperature, pH, and specific conductance) were measured, and samples for analysis of inorganic

  6. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programer-notes manual, the user's notes and of course the material in the open literature.

  7. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2011-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas, we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  8. The Pueblo of Laguna.

    Science.gov (United States)

    Lockart, Barbetta L.

    Proximity to urban areas, a high employment rate, development of natural resources and high academic achievement are all serving to bring Laguna Pueblo to a period of rapid change on the reservation. While working to realize its potential in the areas of natural resources, commercialism and education, the Pueblo must also confront the problems of…

  9. Mi Pueblo Food Center

    Directory of Open Access Journals (Sweden)

    Alexis A. Babb

    2016-04-01

    Full Text Available This case describes a current growth opportunity for Mi Pueblo Food Center, a Hispanic grocery chain with locations throughout the Bay Area, California. The CEO of Mi Pueblo is contemplating opening a new store location in East Palo Alto, CA, which has been without a local, full-service grocery store for over 20 years. Case objectives are for students to develop an understanding of how the grocery industry operates, the risks and opportunities associated with opening a new grocery store location, and the impact on social, environmental, and economic sustainability. The SWOT (Strengths, Weaknesses, Opportunities, Threats framework is used to analyze whether or not it is feasible for Mi Pueblo to open a new location in East Palo Alto. This case may be used with students in graduate and advanced undergraduate courses.

  10. Salinas, Maximiliano, Tomás Cornejo y Catalina Saldaña, ¿Quiénes fueron los vencedores? Elite, pueblo y prensa humorística de la Guerra Civil de 1891. Santiago, CIDBA / LOM, Colección Ciencias Humanas, 2005, 238 p.

    Directory of Open Access Journals (Sweden)

    ELISABET PRUDANT S.

    2011-10-01

    Full Text Available ¿QUIÉNES FUERON LOS VENCEDORES? Elite, pueblo y prensa humorística de la Guerra Civil de 1891, es el nombre de la última publicación de EPA, Estudios Pililos Ahora, editada conjuntamente por el Centro de Investigaciones Diego Barros Arana y Lom el año 2005.  Se trata de un libro que nos sitúa desde el comienzo, con la interrogante misma que encabeza su título, en un campo abierto, desafiante, en el cual se revive el quiebre que experimentó tanto la élite política como la  sociedad en su conjunto, en torno al accionar de José Manuel Balmaceda.  La figura del mítico Presidente,  es revalorada por los autores a la luz de los punzantes juicios que  desde la trinchera oficialista, como de la opositora, se concentraron en  la  prensa satírica del periodo.

  11. Carotenoid fluorescence in Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Es, van M.A.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2010-01-01

    Dunaliella salina is a halotolerant green alga that is well known for its carotenoid producing capacity. The produced carotenoids are mainly stored in lipid globules. For various research purposes, such as production and extraction kinetics, we would like to determine and/or localise the carotenoid

  12. Solar energy system economic evaluation for Colt Pueblo, Pueblo, Colorado

    Science.gov (United States)

    1980-01-01

    The Solar Energy System is not economically beneficial under the assumed economic conditions at Pueblo, Colorado; Yosemite, California; Albuquerque, New Mexico; Fort Worth, Texas; and Washington, D.C. Economic benefits from this system depend on decreasing the initial investment and the continued increase in the cost of conventional energy. Decreasing the cost depends on favorable tax treatment and continuing development of solar energy technology. Fuel cost would have to increase drastically while the cost of the system would have to remain constant or decrease for the system to become economically feasible.

  13. Salinas. Theory Manual Version 2.8

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Walsh, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bhardwaj, Manoj K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  14. Longitudinal Analysis of Microbiota in Microalga Nannochloropsis salina Cultures.

    Science.gov (United States)

    Geng, Haifeng; Sale, Kenneth L; Tran-Gyamfi, Mary Bao; Lane, Todd W; Yu, Eizadora T

    2016-07-01

    Large-scale open microalgae cultivation has tremendous potential to make a significant contribution to replacing petroleum-based fuels with biofuels. Open algal cultures are unavoidably inhabited with a diversity of microbes that live on, influence, and shape the fate of these ecosystems. However, there is little understanding of the resilience and stability of the microbial communities in engineered semicontinuous algal systems. To evaluate the dynamics and resilience of the microbial communities in microalgae biofuel cultures, we conducted a longitudinal study on open systems to compare the temporal profiles of the microbiota from two multigenerational algal cohorts, which include one seeded with the microbiota from an in-house culture and the other exogenously seeded with a natural-occurring consortia of bacterial species harvested from the Pacific Ocean. From these month-long, semicontinuous open microalga Nannochloropsis salina cultures, we sequenced a time-series of 46 samples, yielding 8804 operational taxonomic units derived from 9,160,076 high-quality partial 16S rRNA sequences. We provide quantitative evidence that clearly illustrates the development of microbial community is associated with microbiota ancestry. In addition, N. salina growth phases were linked with distinct changes in microbial phylotypes. Alteromonadeles dominated the community in the N. salina exponential phase whereas Alphaproteobacteria and Flavobacteriia were more prevalent in the stationary phase. We also demonstrate that the N. salina-associated microbial community in open cultures is diverse, resilient, and dynamic in response to environmental perturbations. This knowledge has general implications for developing and testing design principles of cultivated algal systems.

  15. Salinas - User's Notes

    Energy Technology Data Exchange (ETDEWEB)

    ALVIN,KENNETH F.; BHARDWAJ,MANOJ K.; DRIESSEN,BRIAN; REESE,GARTH M.; SEGALMAN,DANIEL J.

    1999-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. This document provides a users guide to the input for Salinas. Details of input specifications for the different solution types, output options, element types and parameters are included. The appendices contain detailed examples, and instructions for running the software on parallel platforms.

  16. 78 FR 66982 - Santa Clara Pueblo Disaster #NM-00039

    Science.gov (United States)

    2013-11-07

    ... ADMINISTRATION Santa Clara Pueblo Disaster NM-00039 AGENCY: U.S. Small Business Administration. ACTION: Notice... for the Santa Clara Pueblo (FEMA- 4151-DR), dated 10/29/2013. Incident: Severe Storms and Flooding... disaster: Primary Areas: Santa Clara Pueblo. The Interest Rates are: Percent For Physical Damage:...

  17. Sobre el libro "Testimonio de un pueblo"

    Directory of Open Access Journals (Sweden)

    Manuel José Jaramillo

    1963-04-01

    Full Text Available Hasta hace poco no sabíamos casi nada acerca de los anteced entes que concurrieron a la fundación de Manizales. De las peripecias anejas a ese hecho se tiene hoy una noción clara, neta, por el libro de Otto Morales Benítez, Testimonio de un Pueblo.

  18. Chemical Stockpile Disposal Program: Review and comment on the Phase 1 environmental report for the Pueblo Depot Activity, Pueblo, Colorado

    Energy Technology Data Exchange (ETDEWEB)

    Olshansky, S.J.; Krummel, J.R.; Policastro, A.J.; McGinnis, L.D.

    1994-03-01

    As part of the Chemical Stockpile Disposal Program, an independent review is presented of the US Army Phase I environmental report for the disposal of chemical agents and munitions stored at the Pueblo Depot Activity (PUDA) in Pueblo, Colorado. The Phase I report addresses new and additional concerns not incorporated in the final programmatic environmental impact statement (FPEIS). These concerns are addressed by examining site-specific data for the PUDA. On the basis of our review of the Phase I report, we concluded that on-site meteorological data from December 1988 to June 1992 appear to be of insufficient quality to have been used instead of the off-site Pueblo airport data. No additional meteorological data have been collected since June 1992. The Phase I report briefly mentions problems with the air pollution control system. These problems will likely require the systems to be upgraded at the Johnston Atoll site and at each of the other depots in the continental United States. Without such improvements, the probability of accidents during start-up and shutdown would likely increase. The Army has a lessons-learned program to incorporate improvements into the design of future facilities. The Phase I report does not make any design change commitments. These issues need to be fully evaluated and resolved before any final conclusion concerning the adequacy of the decision in the FPEIS can be made with respect to the PUDA. With the exception of this issue, the inclusion of other more detailed site-specific data in the Phase I report does not change the decision reached in the FPEIS (which favored on-site disposal at the PUDA). We recommend that site-specific data on water, ecological, socioeconomic, and cultural resources and emergency planning and preparedness be considered explicitly in the site-specific EIS decision-making process.

  19. Solar Energy System Economic Evaluation final report for Colt Pueblo, Pueblo, Colorado

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-09-01

    The economic analysis of the solar energy system that was installed at Pueblo, Colorado is developed for this and five other sites typical of a wide range of environmental and economic conditions in the continental United States. This analysis is accomplished based on the technical and economic models in the f-chart design procedure with inputs based on the characteristics of the installed system and local conditions. The results are expressed in terms of the economic parameters of present worth of system cost over a projected twenty year life: life cycle savings, year of positive savings and year of payback for the optimized solar energy system at each of the analysis sites. The sensitivity of the economic evaluation to uncertainties in constituent system and economic variables is also investigated. Although budget constraints preclude an economic reevaluation of each of the sites, a similar site, Carlsbad, New Mexico, was done. When 1985 escalated values for fuel, costs, mass production, and improved design and installation techniques were applied, a significantly higher degree of savings was realized.

  20. Continuous production of carotenoids from Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    During the in situ extraction of ß-carotene from Dunaliella salina, the causal relationship between carotenoid extraction and cell death indicated that cell growth and cell death should be at equilibrium for a continuous in situ extraction process. In a flat-panel photobioreactor that was operated a

  1. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  2. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  3. The Selectivity of Milking of Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2010-01-01

    The process of the simultaneous production and extraction of carotenoids, milking, of Dunaliella salina was studied. We would like to know the selectivity of this process. Could all the carotenoids produced be extracted? And would it be possible to vary the profile of the produced carotenoids and,

  4. Continuous production of carotenoids from Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    During the in situ extraction of ß-carotene from Dunaliella salina, the causal relationship between carotenoid extraction and cell death indicated that cell growth and cell death should be at equilibrium for a continuous in situ extraction process. In a flat-panel photobioreactor that was operated

  5. Groundwater quality in the Monterey Bay and Salinas Valley groundwater basins, California

    Science.gov (United States)

    Kulongoski, Justin T.; Belitz, Kenneth

    2011-01-01

    The Monterey-Salinas study unit is nearly 1,000 square miles and consists of the Santa Cruz Purisima Formation Highlands, Felton Area, Scotts Valley, Soquel Valley, West Santa Cruz Terrace, Salinas Valley, Pajaro Valley, and Carmel Valley groundwater basins (California Department of Water Resources, 2003; Kulongski and Belitz, 2011). These basins were grouped into four study areas based primarily on geography. Groundwater basins in the north were grouped into the Santa Cruz study area, and those to the south were grouped into the Monterey Bay, the Salinas Valley, and the Paso Robles study areas (Kulongoski and others, 2007). The study unit has warm, dry summers and cool, moist winters. Average annual rainfall ranges from 31 inches in Santa Cruz in the north to 13 inches in Paso Robles in the south. The study areas are drained by several rivers and their principal tributaries: the Salinas, Pajaro, and Carmel Rivers, and San Lorenzo Creek. The Salinas Valley is a large intermontane valley that extends southeastward from Monterey Bay to Paso Robles. It has been filled, up to a thickness of 2,000 feet, with Tertiary and Quaternary marine and terrestrial sediments that overlie granitic basement. The Miocene-age Monterey Formation and Pliocene- to Pleistocene-age Paso Robles Formation, and Pleistocene to Holocene-age alluvium contain freshwater used for supply. The primary aquifers in the study unit are defined as those parts of the aquifers corresponding to the perforated intervals of wells listed in the California Department of Public Health database. Public-supply wells are typically drilled to depths of 200 to 650 feet, consist of solid casing from the land surface to depths of about 175 to 500 feet, and are perforated below the solid casing. Water quality in the primary aquifers may differ from that in the shallower and deeper parts of the aquifer system. Groundwater movement is generally from the southern part of the Salinas Valley north towards the Monterey Bay

  6. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina.

  7. Porting salinas to the windows platform.

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Wilson, Christopher Riley

    2006-06-01

    The ASC program has enabled significant development of high end engineering applications on massively parallel machines. There is a great benefit in providing these applications on the desktop of the analysts and designers, at least insofar as the small models may be run on these platforms, thus providing a tool set that spans the application needs. This effort documents the work of porting Salinas to the WINDOWS{trademark} platform. Selection of the tools required to compile, link, test and run Salinas in this environment is discussed. Significant problems encountered along the way are listed along with an estimation of the overall cost of the port. This report may serve as a baseline for streamlining further porting activities with other ASC codes.

  8. Pedro Salinas: la letra y la persona

    Directory of Open Access Journals (Sweden)

    Escartín Gual, Montserrat

    2002-12-01

    Full Text Available This article is a Pedro Salinas's homage in the fifty anniversary of his death. Here, we analise his attitude in front of life and his securities through his poems, personal letters and essais. The poet criticizes the materialistic american stil of life, where he should live during his exile until his death (1936-1951. Against the hurry, the profitable things, the technology, the money..., Salinas believes in his language, slowness, friendship, contemplation of countryside, art, spiritualism, optimism, etc. Son of the Institución Libre de Enseñanza's ideas, his personal ethics looked for the biggest perfection trought the will.Este artículo es un homenaje a Pedro Salinas al cumplirse el cincuentenario de su muerte. En él, se analiza su actitud ante la vida y sus valores a través de sus poesías, cartas personales y ensayos. El poeta critica el materialismo del modelo americano en el que se vio obligado a vivir desde que se exilió hasta su muerte (1936-1951. Frente a la prisa, lo rentable, la tecnología, el dinero...; Salinas cree en su idioma, la lentitud, la amistad, la contemplación del paisaje, el arte, lo espiritual, el optimismo, etc. Hijo de las ideas de la Institución Libre de Enseñanza, su ética personal buscó la mayor perfección a través de la voluntad.

  9. Pedro Salinas y el teatro desde dentro (Pedro Salinas and Theatre from Within

    Directory of Open Access Journals (Sweden)

    Benítez Vega, Yolanda

    2013-12-01

    Full Text Available Resumen: Pedro Salinas y el teatro, desde dentro es el título de este artículo cuya finalidad consiste en realizar un recorrido por la vocación teatral de Pedro Salinas desde sus primeros años hasta el final de sus días: su asistencia a representaciones teatrales, sus contactos con el teatro y sus proyectos como autor dramático tanto los que se realizaron como los que no llegaron a materializarse. El propósito es adentrarnos en el alma teatral del poeta: cómo, cuándo, por qué surge su vocación por el arte escénico, insistiendo en la necesidad de rescatar la faceta de dramaturgo de Pedro Salinas como una constante más en la labor del poeta, profesor y crítico. Abstract: "Pedro Salinas and the theatre, from inside " it is the title of this article which purpose consists of realizing a tour for Pedro Salinas's theatrical vocation from his first years until the end of his days: his assistance to theatrical representations, his contacts with the theatre and his projects like dramatic author so much those who were realized as those who did not manage to materialize. The intention is to enter the theatrical soul of the poet: how, when, why his vocation arises for the scenic art, insisting on the need to rescue the playwright's facet of Pedro Salinas as one more constant in the labor of the poet, teacher and critic.

  10. Pedro Salinas y el teatro desde dentro (Pedro Salinas and Theatre from Within

    Directory of Open Access Journals (Sweden)

    Yolanda Benítez Vega

    2013-12-01

    Full Text Available Resumen: Pedro Salinas y el teatro, desde dentro” es el título de este artículo cuya finalidad consiste en realizar un recorrido por la vocación teatral de Pedro Salinas desde sus primeros años hasta el final de sus días: su asistencia a representaciones teatrales, sus contactos con el teatro y sus proyectos como autor dramático tanto los que se realizaron como los que no llegaron a materializarse. El propósito es adentrarnos en el alma teatral del poeta: cómo, cuándo, por qué surge su vocación por el arte escénico, insistiendo en la necesidad de rescatar la faceta de dramaturgo de Pedro Salinas como una constante más en la labor del poeta, profesor y crítico.Abstract: "Pedro Salinas and the theatre, from inside " it is the title of this article which purpose consists of realizing a tour for Pedro Salinas's theatrical vocation from his first years until the end of his days: his assistance to theatrical representations, his contacts with the theatre and his projects like dramatic author so much those who were realized as those who did not manage to materialize. The intention is to enter the theatrical soul of the poet: how, when, why his vocation arises for the scenic art, insisting on the need to rescue the playwright's facet of Pedro Salinas as one more constant in the labor of the poet, teacher and critic.

  11. An evening at "La Clinica del Pueblo".

    Science.gov (United States)

    Shefsky, M L

    1986-01-01

    This article describes a typical evening at the Clinica del Pueblo in the Hispanic neighborhood of Adams-Morgan in Washington, D.c. The Clinical del Pueblo began operating in 1983 in response to the urgen medical needs of Central American refugees arriving in the Washington D.c. area. The refugees bring with them severe trauma, fear, and health problems caused by the civil was and exacerbated by inadequate or non-existant health services. Approximately 80,000 Salvadoran refugees live in the area. They do not receive adequate health care for 3 reasons. 1) Because the US goverment is unwilling to recognize them as true refugees, they live with the constant threat of deportatin back to the violence from which they have fled. 2) Refugees lack the ability to pay for private care. 3) Langauage and culture create frightening barriers to health care for the refugees. For those who do seek care, these barriers can lead to the inadequate or incomplete diagnoses and poor compliance and follow-up. Plenty International and the Central American Refugee Center responded to these problems by organizing a free clinic to provide not only medical care but also a training course for volunteers. The director of the clinic organizes the course, the classes are taught by a variety of people including the clinic's volunteer physicians, nurses, and public health educators as well as graduates of previus training courses and people from the wider community. The services of the clinic reach only a small portion of the population in need. However, the fact that free medical services are now available to some Central American refugees make the Clinica del Pueblo an important program.

  12. El Midwest Canto Al Pueblo: "otra vez, c/s"

    Science.gov (United States)

    Guernica, Antonio Jose; Saavedra, Pilar

    1977-01-01

    El Midwest Canto Al Pueblo was a successful effort to bring artists, poets, musicians, and cultural workers together in a setting conducive to a free and easy interchange of ideas and directions in order to reaffirm, share, and celebrate the identity of La Raza with el pueblo. The activities during the 10-day festival included poetry readings,…

  13. 77 FR 39726 - Land Acquisitions: Pueblo of Santa Clara

    Science.gov (United States)

    2012-07-05

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE INTERIOR Bureau of Indian Affairs Land Acquisitions: Pueblo of Santa Clara AGENCY: Bureau of Indian Affairs... into trust for the Pueblo of Santa Clara on January 27, 2012. FOR FURTHER INFORMATION CONTACT:...

  14. El Midwest Canto Al Pueblo: "otra vez, c/s"

    Science.gov (United States)

    Guernica, Antonio Jose; Saavedra, Pilar

    1977-01-01

    El Midwest Canto Al Pueblo was a successful effort to bring artists, poets, musicians, and cultural workers together in a setting conducive to a free and easy interchange of ideas and directions in order to reaffirm, share, and celebrate the identity of La Raza with el pueblo. The activities during the 10-day festival included poetry readings,…

  15. From Infancy to Adolescence: The Kansas University School of Medicine-Salina: A Rural Medical Campus Story.

    Science.gov (United States)

    Cathcart-Rake, William; Robinson, Michael; Paolo, Anthony

    2017-05-01

    The University of Kansas School of Medicine established a rural regional campus in Salina, Kansas, in 2011. The creation of a four-year medical campus of only 32 total students in a town of less than 50,000 inhabitants appeared to contradict all previous practices where medical schools have been situated in large metropolitan cities with student bodies frequently in the hundreds. The rationale to open the Salina campus was to attract medical students with a desire to train in a rural environment, hoping that many would eventually elect to practice primary care in rural Kansas. The authors evaluated the admission demographics, academic performance, campus satisfaction, and graduate medical education choices of students at Kansas University School of Medicine-Salina (KUSM-S) during its first four years of existence. To date, the Salina campus has succeeded in its mission to train students from rural communities in a rural environment to eventually become rural-based physicians. KUSM-S students have adjusted well to the rigors of medical school, have shown steady improvement in academic performance as measured by United States Medical Licensing Examination scores, and have been overwhelmingly positive about the Salina medical education program. The initial cohort of students has now successfully graduated and secured residency training positions, and most KUSM-S graduates are either continuing their training in primary care in Kansas or intend to return to Kansas to practice following residency training.

  16. From Infancy to Adolescence: The Kansas University School of Medicine–Salina: A Rural Medical Campus Story

    Science.gov (United States)

    Robinson, Michael; Paolo, Anthony

    2017-01-01

    The University of Kansas School of Medicine established a rural regional campus in Salina, Kansas, in 2011. The creation of a four-year medical campus of only 32 total students in a town of less than 50,000 inhabitants appeared to contradict all previous practices where medical schools have been situated in large metropolitan cities with student bodies frequently in the hundreds. The rationale to open the Salina campus was to attract medical students with a desire to train in a rural environment, hoping that many would eventually elect to practice primary care in rural Kansas. The authors evaluated the admission demographics, academic performance, campus satisfaction, and graduate medical education choices of students at Kansas University School of Medicine–Salina (KUSM-S) during its first four years of existence. To date, the Salina campus has succeeded in its mission to train students from rural communities in a rural environment to eventually become rural-based physicians. KUSM-S students have adjusted well to the rigors of medical school, have shown steady improvement in academic performance as measured by United States Medical Licensing Examination scores, and have been overwhelmingly positive about the Salina medical education program. The initial cohort of students has now successfully graduated and secured residency training positions, and most KUSM-S graduates are either continuing their training in primary care in Kansas or intend to return to Kansas to practice following residency training. PMID:27805948

  17. La Defensoría del Pueblo

    Directory of Open Access Journals (Sweden)

    Soraya Pérez Portillo

    2008-12-01

    Full Text Available La Defensoría del Pueblo es una institución que hace parte del Ministerio Público, con independencia administrativa y presupuestal. Tiene como función principal la promoción, el ejercicio y la divulgación de los derechos humanos, según lo estipulado en el capítulo ii, título x (“De los organismos de control del Estado” de la Constitución Política colombiana de 1991. Ley 24 de 1992 establece la organización y el funcionamiento de la Defensoría del Pueblo. Esta institución se presenta como mediadora entre los ciudadanos y el Estado. Desde esa función tramita solicitudes y quejas y opina sobre la problemática de los derechos humanos. Entre otras funciones, la entidad presenta informes anuales al Congreso de la República sobre su gestión; organiza y dirige la defensoría pública; interpone acciones en defensa de los derechos colectivos y fundamentales; divulga los derechos

  18. Nambe Pueblo Water Budget and Forecasting model.

    Energy Technology Data Exchange (ETDEWEB)

    Brainard, James Robert

    2009-10-01

    This report documents The Nambe Pueblo Water Budget and Water Forecasting model. The model has been constructed using Powersim Studio (PS), a software package designed to investigate complex systems where flows and accumulations are central to the system. Here PS has been used as a platform for modeling various aspects of Nambe Pueblo's current and future water use. The model contains three major components, the Water Forecast Component, Irrigation Scheduling Component, and the Reservoir Model Component. In each of the components, the user can change variables to investigate the impacts of water management scenarios on future water use. The Water Forecast Component includes forecasting for industrial, commercial, and livestock use. Domestic demand is also forecasted based on user specified current population, population growth rates, and per capita water consumption. Irrigation efficiencies are quantified in the Irrigated Agriculture component using critical information concerning diversion rates, acreages, ditch dimensions and seepage rates. Results from this section are used in the Water Demand Forecast, Irrigation Scheduling, and the Reservoir Model components. The Reservoir Component contains two sections, (1) Storage and Inflow Accumulations by Categories and (2) Release, Diversion and Shortages. Results from both sections are derived from the calibrated Nambe Reservoir model where historic, pre-dam or above dam USGS stream flow data is fed into the model and releases are calculated.

  19. Groundwater recharge on east side soils of the Salinas Valley

    Science.gov (United States)

    After four years of drought, groundwater levels in the Salinas Valley are at historically low levels which threaten to adversely affect farming in the Salinas Valley. Given the prospect of a strong El Niño this coming winter, it seems prudent to plan to capture as much of the rainfall as possible to...

  20. Réplica a Maximiliano Salinas

    OpenAIRE

    2011-01-01

    En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta h...

  1. Harvesting of Dunaliella salina by membrane filtration at pilot scale

    KAUST Repository

    Monte, Joana

    2017-09-02

    The microalgae Dunaliella salina is industrially produced due to its high content in carotenoids induced by low nitrogen and high salinity conditions. D. salina with low carotenoids content also produces other added value compounds, however its recovery have hardly been studied. This work aims to examine the potential of pre-concentrating D. salina by membrane processing prior to a final harvesting step by low-shear centrifugation. The aim is to minimize the overall energy expenditure and reduce capital costs, while assuring a minimal loss of cell integrity. This task is challenging, considering the sensitivity of D. salina to shear. Harvesting of D. salina by ultrafiltration allowed reaching a final concentration factor of 5.9, with an average permeate flux of 31 L/(m2 h). The Total Cost of Ownership and energy consumption for harvesting are respectively 52% and 45% lower when applying a two-step approach with pre-concentration (ultrafiltration) compared to only harvesting by centrifugation.

  2. Dinucleosidasetetraphosphatase in rat liver and Artemia salina.

    Science.gov (United States)

    Vallejo, C G; Lobaton, C D; Quintanilla, M; Sillero, A; Sillero, M A

    1976-06-07

    A comparative study of an enzymatic activity present in Artemia salina and rat liver which specifically splits dinucleoside tetraphosphates is presented. All the purine and pyrimidine dinucleoside tetraphosphates tested, i.e. diadenosine, diguanosine, dixanthosine and diuridine tetraphosphates, were substrates of both enzymes with similar maximum velocities and Km values, (around 10 muM). The inhibition by nucleotides of the enzyme from the two sources is also similar. Particularly relevant is the strong inhibition caused by nucleoside tetraphosphates which have Ki values in the nanomolar range. The Artemia enzyme has a slightly lower molecular weight (17 500) than the liver enzyme (21 000) and is more resistant to acidic pH. Based on previous findings, the enzyme from Artemia salina was named diguanosinetetraphosphatase (EC 3.6.1.17) by the Enzyme Commission. The results presented in this paper show that the liver and Artemia enzymes are similar, and we propose to name this enzyme as dinucleosidetetraphosphatase or dinucleoside-tetraphosphate nucleotidehydrolase.

  3. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina.

    Science.gov (United States)

    Hisem, Daniel; Hrouzek, Pavel; Tomek, Petr; Tomšíčková, Jana; Zapomělová, Eliška; Skácelová, Kateřina; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Heterocytous cyanobacteria from various habitats were screened for toxicity to brine shrimp Artemia salina and the murine lymphoblastic cell line Sp/2 in order to compare these two testing models for evaluation of risk posed by cyanobacteria to human health. Methanol extracts of biomass and cultivation media were tested for toxicity and selected extracts were fractionated to determine the active fraction. We found a significant toxic effect to A. salina and to Sp/2 cells in 5.2% and 31% of studied extracts, respectively. Only 8.6% of the tested strains were highly toxic to both A. salina and the Sp/2 cell line, and only two of the tested strains were toxic to A. salina and not to the murine cell line. Therefore, it is likely that the toxic effect of cyanobacterial secondary metabolites mostly targets basal metabolic pathways present in mammal cells and so is not manifested in A. salina. We conclude that it is insufficient to monitor cytotoxicity of cyanobacteria using only the brine shrimp bioassay as was usual in the past, since cytotoxicity is a more frequent feature in cyanobacteria in comparison with toxicity to A. salina. A. salina toxicity test should not be used when estimating the possible health risk for humans. We suggest that in vitro mammal cells be used for these purposes.

  4. Maras: pueblo en camino hacia el desarrollo turistico

    National Research Council Canada - National Science Library

    Marzal, Maria Virginia; Yang, Zoila Yi; Goluchowska, Katarzyna T

    2007-01-01

    ... antecesoras. Maras es un pueblo fundado en la epoca colonial en el camino entre Urubamba y Cusco. Hoy la poblacion se dedica a la agricultura, a la ganaderia, la produccion de sal y su comercializacion en la region...

  5. Proyecto y plan de marketing hacia salinas 2000

    OpenAIRE

    Merlo Veintimilla, Zenaida; Pastor, Bolivar

    2009-01-01

    El presente trabajo titulado “Proyecto y Plan de Marketing Hacia Salinas 2000”, es un plan de mercadotecnia turístico, que busca cultivar una cultura turística en el cantón Salinas, con miras a reactivar la actividad turística y comercial en el balneario. Salinas representa en la actualidad uno de los balnearios más visitados por turistas nacionales en la época de invierno, llegando incluso a su saturación total, provocando el colapso de los servicios básicos y a la degradación del medio ...

  6. The swimming mechanics of Artemia Salina

    Science.gov (United States)

    Ruiz-Angulo, A.; Ramos-Musalem, A. K.; Zenit, R.

    2013-11-01

    An experimental study to analyze the swimming strategy of a small crustacean (Artemia Salina) was conducted. This animal has a series of eleven pairs of paddle-like appendices in its thorax. These legs move in metachronal-wave fashion to achieve locomotion. To quantify the swimming performance, both high speed video recordings of the legs motion and time-resolved PIV measurements of the induced propulsive jet were conducted. Experiments were conducted for both tethered and freely swimming specimens. We found that despite their small size, the propulsion is achieved by an inertial mechanism. An analysis of the efficiency of the leg wave-like motion is presented and discussed. A brief discussion on the mixing capability of the induced flow is also presented.

  7. Réplica a Maximiliano Salinas

    Directory of Open Access Journals (Sweden)

    RENÉ MILLAR C.

    2011-10-01

    Full Text Available En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta hace algún tiempo.

  8. Smart SfM: Salinas Archaeological Museum

    Science.gov (United States)

    Inzerillo, L.

    2017-08-01

    In these last years, there has been an increasing use of the Structure from Motion (SfM) techniques applied to Cultural Heritage. The accessibility of SfM software can be especially advantageous to users in non-technical fields or to those with limited resources. Thanks to SfM using, everyone can make with a digital camera a 3D model applied to an object of both Cultural Heritage, and physically Environment, and work arts, etc. One very interesting and useful application can be envisioned into museum collection digitalization. In the last years, a social experiment has been conducted involving young generation to live a social museum using their own camera to take pictures and videos. Students of university of Catania and Palermo were involved into a national event #digitalinvasion (2015-2016 editions) offering their personal contribution: they realized 3D models of the museums collection through the SfM techniques. In particular at the National Archaeological Museum Salinas in Palermo, it has been conducted an organized survey to recognize the most important part of the archaeological collection. It was a success: in both #digitalinvasion National Event 2015 and 2016 the young students of Engineering classes carried out, with Photoscan Agisoft, more than one hundred 3D models some of which realized by phone camera and some other by reflex camera and some other with compact camera too. The director of the museum has been very impressed from these results and now we are going to collaborate at a National project to use the young generation crowdsourcing to realize a semi-automated monitoring system at Salinas Archaeological Museum.

  9. SMART SfM: SALINAS ARCHAEOLOGICAL MUSEUM

    Directory of Open Access Journals (Sweden)

    L. Inzerillo

    2017-08-01

    Full Text Available In these last years, there has been an increasing use of the Structure from Motion (SfM techniques applied to Cultural Heritage. The accessibility of SfM software can be especially advantageous to users in non-technical fields or to those with limited resources. Thanks to SfM using, everyone can make with a digital camera a 3D model applied to an object of both Cultural Heritage, and physically Environment, and work arts, etc. One very interesting and useful application can be envisioned into museum collection digitalization. In the last years, a social experiment has been conducted involving young generation to live a social museum using their own camera to take pictures and videos. Students of university of Catania and Palermo were involved into a national event #digitalinvasion (2015-2016 editions offering their personal contribution: they realized 3D models of the museums collection through the SfM techniques. In particular at the National Archaeological Museum Salinas in Palermo, it has been conducted an organized survey to recognize the most important part of the archaeological collection. It was a success: in both #digitalinvasion National Event 2015 and 2016 the young students of Engineering classes carried out, with Photoscan Agisoft, more than one hundred 3D models some of which realized by phone camera and some other by reflex camera and some other with compact camera too. The director of the museum has been very impressed from these results and now we are going to collaborate at a National project to use the young generation crowdsourcing to realize a semi-automated monitoring system at Salinas Archaeological Museum.

  10. Integrated assessment of the impacts of agricultural drainwater in the Salinas River (California, USA)

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, B.S.; Hunt, J.W.; Phillips, B.M.; Nicely, P.A.; Vlaming, V. de; Connor, V.; Richard, N.; Tjeerdema, R.S

    2003-08-01

    Invertebrate mortality was correlated with levels of water and sediment contaminatioin in the Salinas River. - The Salinas River is the largest of the three rivers that drain into the Monterey Bay National Marine Sanctuary in central California. Large areas of this watershed are cultivated year-round in row crops and previous laboratory studies have demonstrated that acute toxicity of agricultural drainwater to Ceriodaphnia dubia is caused by the organophosphate (OP) pesticides chlorpyrifos and diazinon. In the current study, we used a combination of ecotoxicologic tools to investigate incidence of chemical contamination and toxicity in waters and sediments in the river downstream of a previously uncharacterized agricultural drainage creek system. Water column toxicity was investigated using a cladoceran C. dubia while sediment toxicity was investigated using an amphipod Hyalella azteca. Ecological impacts of drainwater were investigated using bioassessments of macroinvertebrate community structure. The results indicated that Salinas River water downstream of the agricultural drain is acutely toxic to Ceriodaphnia, and toxicity to this species was highly correlated with combined toxic units (TUs) of chlorpyrifos and diazinon. Laboratory tests were used to demonstrate that sediments in this system were acutely toxic to H. azteca, which is a resident genus. Macroinvertebrate community structure was moderately impacted downstream of the agricultural drain input. While the lowest macroinvertebrate abundances were measured at the station demonstrating the greatest water column and sediment toxicity and the highest concentrations of pesticides, macroinvertebrate metrics were more significantly correlated with bank vegetation cover than any other variable. Results of this study suggest that pesticide pollution is the likely cause of laboratory-measured toxicity in the Salinas River samples and that this factor may interact with other factors to impact the

  11. The Trail Inventory of Salinas River NWR [Cycle 2

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Salinas River National Wildlife Refuge. Trails in this inventory are...

  12. Salinas River National Wildlife Refuge: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Salinas River NWR for the next 15 years. This plan outlines the Refuge vision and...

  13. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  14. Studies on experimental culture of a marine ciliate Fabrea salina

    Digital Repository Service at National Institute of Oceanography (India)

    Rattan, R.; Ansari, Z.A.; Chatterji, A.

    Studies were conducted on the culture of a marine ciliate, Fabrea salina in the laboratory condition. Three types of inert feed; commercial yeast, fermented wheat bran and fermented rise bran were tested to study their suitability as artificial feed...

  15. PUEBLO OF ZIA RENEWABLE ENERGY DEVELOPMENT FEASIBILITY STUDY

    Energy Technology Data Exchange (ETDEWEB)

    Pino, Peter M. [Tribal Administrator (Ret.), Pueblo of Zia; Lakshman, Jai [Project Manager (NDA) for Pueblo of Zia; Toole, G. Loren [Principal Investigator, Los Alamos National Laboratory - Energy Analysis Team/ CCS-3, D-4; Hand, Dan [P.E., Sustainable Enginerring; Witcher, James; Emerson, Michael A. [Senior V.P., ARES Corporation; Turner, Jeremy [Executive Director, NM Renewable Energy Transmission Authority; Sandidge, Wendy [Director of Operations, NM Community Capital

    2014-06-30

    The Pueblo of Zia will conduct a comprehensive feasibility study for best-use application(s) for development of renewable energy resources on its tribally held TRUST lands (i.e., Trust Lands of Zia Indian Reservation). The feasibility study is essential for determining the technical and economic viability of a future renewable project(s) on Zia tribal lands, including the potential economic and environmental benefits for the Tribe. Project Objectives: The feasibility study is essential for determining the technical and economic viability of future renewable project(s) on Zia tribal lands, including the potential economic and environmental benefits for the Tribe to: 1. Provide a balanced local renewable power supply for Zia Pueblo, its members, tribal offices, schools and buildings, and businesses on tribal lands 2. Provide a firm power supply for export and commercial market distribution 3. Provide economic development for the Tribe and its members, including job training and creation, each in accordance with the goals and objectives as conveyed by the Pueblo of Zia Tribal Council, Tribal Administration, and outlined in The Pueblo of Zia Comprehensive Plan and Pueblo of Zia — Zia Enterprise Zone Master Plan. A key goal of the study is to analyze the integrated development of solar, geothermal, and wind renewable energy resources at Zia Pueblo, with added potential to combine gas-fired generation to accomplish energy firming. Geothermal offers a base load source of energy, providing power continuously for end users. Wind and solar offer intermediate and peaking sources of energy, which can be harvested throughout the day, with periods of variable but predicable output. Variability will be managed in an integrated manner, using Zia Pueblo's combined renewable resources to generate high-quality power. Tasks are intended to collect, catalog, map, and analyze existing data on Zia Pueblo's renewable energy resource base and then match resource attributes with

  16. Rousseau y la soberanía del pueblo

    OpenAIRE

    Zarka, Yves Charles

    2006-01-01

    El artículo reflexiona sobre el nuevo concepto de soberanía del pueblo que se origina con el pensamiento de Rousseau, cuya obra representa un giro en la historia de la soberanía. Con él, la soberanía del pueblo pasa de ser virtual o potencial a ser en acto. Y.C. Zarka muestra cómo esto es posible gracias a las ambigüedades y las aporías. Precisamente por ello, para que la soberanía del pueblo llegue a ser el principio real de las democracias históricas, será preciso desprenderse de ella....

  17. CIUDADANOS Y PUEBLO SUJETOS DE LA ACCION POLITICA

    Directory of Open Access Journals (Sweden)

    Camilo Castellanos

    1998-01-01

    Full Text Available Se presentan aquí los conceptos de ciudadanía y pueblo desde la perspectiva de la acción política. En una primera parte, retoma de Hannah Arendt la dinámica de la esfera pública y desde ella deriva en las nociones de acción y ciudadan ía. En segundo término, siguiendo el trabajo de Antonio Negri, muestra la génesis del concepto de pueblo como poder constituyente y fundamento de la democracia en la reflexión de Maquiavelo. Por último, desde Pablo Neruda en su Canto General ilustra una comprensión latinoamericana del papel protagónico del pueblo en la historia de nuestro continente.

  18. Economic impacts of the Pueblo Smoke-Free Air Act.

    Science.gov (United States)

    Young, Walter F; Szychowski, Jeffery; Karp, Shelley; Liu, Lucia; Diedrich, Robert T

    2010-03-01

    On July 1, 2003, the city of Pueblo CO enacted a smokefree ordinance (Pueblo Smoke-Free Air Act [PSFAA]) that prohibited smoking in public places and workplaces, including taverns and restaurants. Opponents to this ordinance argued that it would have a negative impact on tavern and restaurant sales. The purpose of this study was to determine whether the PSFAA had a negative economic impact on tavern and restaurant sales tax revenues. With data gathered in 2007, this study implemented an interrupted time-series model in 2008, using 42 months of pre- and post-intervention sales tax revenue data for Pueblo to determine whether implementation of this ordinance had an effect on tavern and restaurant sales tax revenues. Ratios of tavern and restaurant openings to closings were also computed for the pre- and post-intervention periods. Pre-post sales tax revenue data showed slight losses in sales tax revenue for taverns, and gains for restaurants, which more than offset the tavern losses. After adjusting for the consumer price index, the city of Pueblo experienced a 20.3% gain in combined tavern and restaurant sales tax revenues from the pre-ordinance period to the post-ordinance period. The ratio of tavern openings to closings improved from 1:1 pre-period to 3.3:1 post-period and the restaurant ratio remained unchanged at approximately 1.78:1 from pre- to post-period. There is no evidence that the PSFAA had a negative economic impact on consumer price index-adjusted tavern and restaurant sales tax revenues. From a fiscal policy perspective, this ordinance may have contributed to a net increase in sales tax revenues for the city of Pueblo. The business openings/closings data suggest that the confidence Pueblo's business sector had in the local hospitality industry was not negatively influenced by the PSFAA. Copyright (c) 2010 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  19. "Pueblo" y "pueblos" en México, 1750- 1850: un ensayo de historia conceptual

    OpenAIRE

    Eugenia Roldán Vera

    2007-01-01

    El presente artículo es un análisis del concepto de pueblo en México entre 1750 y 1850, un período marcado por la doble revolución de la irrupción de la modernidad y la independencia política. Tras revisar la multiplicidad de significados que este concepto tenía en el siglo XVIII, el artículo se centra en el análisis de cómo estos significados se transformaron en las siguientes décadas, qué nuevos significados surgieron y cómo éstos fueron interactuando con los procesos polí...

  20. 78 FR 66756 - Santa Clara Pueblo; Amendment No. 1 to Notice of a Major Disaster Declaration

    Science.gov (United States)

    2013-11-06

    ... SECURITY Federal Emergency Management Agency Santa Clara Pueblo; Amendment No. 1 to Notice of a Major... amends the notice of a major disaster declaration for the Santa Clara Pueblo (FEMA-4147-DR), dated... disaster declaration for the Santa Clara Pueblo is hereby amended to include Public Assistance...

  1. 78 FR 64233 - Santa Clara Pueblo; Major Disaster and Related Determinations

    Science.gov (United States)

    2013-10-28

    ... SECURITY Federal Emergency Management Agency Santa Clara Pueblo; Major Disaster and Related Determinations... Presidential declaration of a major disaster for the Santa Clara Pueblo (FEMA-4147-DR), dated September 27... Santa Clara Pueblo resulting from severe storms and flooding during the period of July 19-21, 2013,...

  2. Pueblo of Jemez Geothermal Feasibility Study Fianl Report

    Energy Technology Data Exchange (ETDEWEB)

    S.A. Kelley; N. Rogers; S. Sandberg; J. Witcher; J. Whittier

    2005-03-31

    This project assessed the feasibility of developing geothermal energy on the Pueblo of Jemez, with particular attention to the Red Rocks area. Geologic mapping of the Red Rocks area was done at a scale of 1:6000 and geophysical surveys identified a potential drilling target at a depth of 420 feet. The most feasible business identified to use geothermal energy on the reservation was a greenhouse growing culinary and medicinal herbs. Space heating and a spa were identified as two other likely uses of geothermal energy at Jemez Pueblo. Further geophysical surveys are needed to identify the depth to the Madera Limestone, the most likely host for a major geothermal reservoir.

  3. Los pueblos nómadas indígenas

    OpenAIRE

    Sternberg, Troy; Chatty, Dawn

    2008-01-01

    En 2008, el tema del Foro Permanente de Naciones Unidas para las Cuestiones Indígenas (UNPFII, por sus siglas en inglés) era ‘Cambio climático, diversidad biocultural y medios de subsistencia: el papel directivo de los pueblos indígenas y los nuevos desafíos’.

  4. 78 FR 67210 - Santa Clara Pueblo Disaster #NM-00038

    Science.gov (United States)

    2013-11-08

    ... ADMINISTRATION Santa Clara Pueblo Disaster NM-00038 AGENCY: U.S. Small Business Administration. ACTION: Notice...: Submit completed loan applications to: U.S. Small Business Administration, Processing and Disbursement... of Disaster Assistance, U.S. Small Business Administration, 409 3rd Street, SW., Suite...

  5. Brine shrimp (Artemia salina Leach bioassay of extracts from Lychnophoriopsis candelabrum and different Lychnophora species

    Directory of Open Access Journals (Sweden)

    Z.S Ferraz Filha

    2012-01-01

    Full Text Available The present study aimed to evaluate on Artemia salina the citotoxicity of twenty-two extracts from five species of the genus Lychnophora and one species of the genus Lychnophoriopsis. The extracts solubilized in DMSO and prepared at the final concentrations of 100, 250, 375, 500 and 600 μg mL-1 were added to tubes containing Artemia salina nauplii (10 units each and filled to 5 mL total volume with artificial salt water. Lapachol and 5% DMSO were used as positive and negative controls, respectively. The samples were kept under light and dead larvae were counted after 24 hours of contact. LC50 was calculated by using Probit software. The crude ethanol extracts from five species showed low lethality in the following order: Lychnophora trichocarpha (LC50 = 672.38 μg mL-1 > Lychnophora pinaster (LC50 = 678.73 μg mL-1 > Lychnophora ericoides (LC50 = 738.09 μg mL-1 > Lychnophoriopsis candelabrum (LC50 = 812.57 μg mL-1 > Lychnophora passerina (LC50 = 921.78 μg mL-1. All tested extracts from L. candelabrum and chloroform extract from L. staavioides showed light toxicity on A. salina. Results indicated that there are substances with potential pharmacological activity in all tested species.O presente estudo teve como objetivo avaliar a citotoxicidade sobre Artemia salina de vinte e dois extratos de cinco espécies do gênero Lychnophora e de uma espécie de Lychnophoriopsis. Os extratos solubilizados em DMSO, preparados nas concentrações finais de 100, 250, 375, 500 e 600 μg mL-1, foram adicionados a recipientes contendo náuplios de Artemia salina (10 unidades cada e completou-se o volume para 5 mL com solução marinha. Lapachol e DMSO 5% foram usados como controles positivo e negativo, respectivamente. As amostras foram mantidas sob iluminação e as larvas mortas foram contadas após 24 horas de contato. O cálculo da LC50 foi feito utilizando-se o programa Probitos. Os extratos etanólicos brutos de cinco espécies apresentaram baixa

  6. Understanding Environmental Factors that Affect Violence in Salinas, California

    Science.gov (United States)

    2009-12-01

    Norteños are primarily second- or third-generation Mexican- American gangsters in northern California.9 The Nuestra Familia (NF) prison gang, which... Oriented Policing Service Youth Firearms Violence Initiative. Salinas used this grant to make their anti-gang task force a full-time effort and formed a

  7. Acute toxicity of organic solvents on Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Barahona-Gomariz, M.V.; Sanz-Barrera, F.; Sanchez-Fortun, S. (Complutense Univ. of Madrid (Spain))

    1994-05-01

    Organic solvents can make their way into the environment as industrial wastes and components of pesticide formulation. In laboratory bioassays, the use of organic formulations. In laboratory bioassays, the use of organic solvents is often unavoidable, since many pesticides and organic pollutants have low water solubility and must be dissolved in organic solvents prior to addition into experimental systems. In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species are of recent interest as test models due to the need for developing nonmammalian test systems. Toxic effects of organic solvents have been tested with a few aquatic species, but information on the comparative toxicity of solvents towards Artemia salina is not available. Artemia salina have, within recent years, gained popularity as test organisms for short-term toxicity testing. Because Artemia salina exhibit rapid development and growth within 48 hr after hatch, their potential as a model organism for toxicology screening has been considered. To do this, synchronous populations of Artemia salina at different development intervals must be available.

  8. Phase toxicity of dodecane on the microalga Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Es, van M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    In the so-called milking process of Dunaliella salina carotenoids are extracted and simultaneously produced by the culture, whilst the biomass concentration remains constant. Different theories exist about the extraction mechanisms although none have been proven yet. In this research, direct contact

  9. Anaerobic biodegradation of lipids of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Grossi, V.; Blokker, P.

    2001-01-01

    In order to determine the susceptibility to anaerobic biodegradation of the different lipid biomarkers present in a marine microalga containing algaenan, portions of one large batch of cultured Nannochloropsis salina (Eustigmatophyceae) were incubated in anoxic sediment slurries for various times. A

  10. Laboratory sulfurisation of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Gelin, F.; Kok, M.D.; Leeuw, J.W. de

    1998-01-01

    To understand more fully the mode of preservation of organic matter in marine sediments, laboratory sulfurisation of intact cells of the cultured microalga Nannochloropsis salina was performed using inorganic polysulfides in seawater at 50°C. Solvent extractable and non-extractable materials were an

  11. Hypoosmotic shock induces a stateⅠtransition of photosynthetic apparatus in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    LIU Xiande; SHEN Yungang

    2004-01-01

    The effects of hypoosmotic shock on statetransition in darkness in Dunaliella salina were studied.When the concentration of NaCl in culture medium wasdropped from 1.5 to 0.5 mol/L abruptly, the photosyntheticrate of D. salina declined, but the respiratory rate and in-tracellular ATP content increased in the dark. The FPSⅡ/FPSⅠratio at 77 K of D. salina cells exposed to hypoosmotic shockwas higher than that of control cells, indicating that moreexcitation energy was distributed to PSⅡ in stressedD. salina cells upon illumination. A decrease in LHCⅡ pho-sphorylation level was also observed when D. salina was exposed to hypoosmotic shock. Thus a stateⅠtransition ofphotosynthetic apparatus occurs when D. salina suffershypoosmotic shock in darkness, which is supposed to berelated to an enhancement of respiration and an increase inATP content in stressed D. salina cells.

  12. Pueblo mapuche. Estrategias discursivo-comunicativas para un nuevo orden

    Directory of Open Access Journals (Sweden)

    Sonia Betancour Sánchez

    2014-01-01

    Full Text Available Este trabajo sostiene que ante la episteme impuesta por Occidente a los pueblos originarios de América, el pueblo mapuche en Chile ha generado una estrategia contra-hegemónica de empoderamiento que instala y visibiliza un sistema de comunicación intercultural propio, lugar donde surgen heterogéneos discursos sobre un nuevo orden en las relaciones de contacto cultural, evidenciado en mecanismos y recursos discursivos transversales. Estos elementos forman parte de las estrategias de resistencia orientadas al “desprendimiento epistémico” (Mignolo, 2010 de la “matriz colonial de poder” (Quijano citado en Mignolo, 2010 , problemática que se estudia tanto en discursos artísticos como mediáticos que circulan en la esfera pública. Descriptores: Comunicación, Mapuches, oratoria, comunicación intercultural, descolonización.

  13. Otros pueblos: apuntes de una antropología televisual

    Directory of Open Access Journals (Sweden)

    Pancorbo, Luis

    1998-12-01

    Full Text Available The author, director of the TV series «Otros pueblos» («Other Peoples», produced by Spain's Public Broadcasting System (TVE since 1981, reflects upon 'tele-reality' and «televisual anthropology» on the basis of his experience in filming the 74 episodes broadcast to date of this popular serial.El autor, director de la serie «Otros pueblos» de TVE desde 1981, se cuestiona algunos aspectos de la tele-realidad como base de partida de sus «apuntes para una antropología televisual», basados sobre todo en el periodo formativo de los 74 capítulos ya emitidos de la citada serie.

  14. Ensayo sociológico sobre el pueblo santandereano

    Directory of Open Access Journals (Sweden)

    José Manuel Prada Sarmiento

    1967-09-01

    Full Text Available Los pueblos como las personas, para formarse y constituírse necesitan de pases sucesivos en los cuales se hacen patente los fenómenos evolutivos, que enmarcan en las segundas la personalidad y en los primeros la caractelogía, la tipología o el temperamento propiamente dicho del grupo que interviene en su constitución.

  15. The Salinas formation in the type-area, Northeastern Minas Gerais: a proposal to review the stratigraphy of the Aracuai belt on sedimentary, metamorphic and U-Pb SHRIMP evidences; A formacao Salinas na area-tipo, NE de Minas Gerais: uma proposta de revisao da estratigrafia da faixa Aracuai com base em evidencias sedimentares, metamorficas e idades U-Pb SHRIMP

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Sirlene A. de Abreu [Universidade Federal de Ouro Preto, MG (Brazil). Escola de Minas. Dept. de Geologia; Martins Neto, Marcelo A. [Universidade Federal de Ouro Preto, MG (Brazil). Escola de Minas. Nucleo de Geologia do Petroleo (NUPETRO)]. E-mail: mamneto@uai.com.br; Pedrosa Soares, Antonio C. [Minas Gerais Univ., Belo Horizonte (Brazil). Inst. de Geociencias. Centro de Pesquisa Manuel Teixeira da Costa]. E-mail: pedrosa@igc.ufmg.br; Cordani, Umberto G. [Universidade de Sao Paulo, SP (Brazil). Inst. de Geociencias; Nutman, Allen [Australian National Univ., Canberra (Australia). Research School of Earth Sciences

    2002-12-15

    The Salinas Formation has been considered to be a stratigraphic unit of the Macaubas Group. This group comprises the rift to passive margin sequences of the precursor basin of the Neo proterozoic Aracuai Orogeny, eastern Brazil. However, new road cuts show extensive and spectacular outcrops with very well-preserved sedimentary structures, allowing detailed studies in the type-locality of this formation, located in the Salinas town and surroundings, northeast Minas Gerais State. In its type-locality, the Salinas Formation consists of graywacke, pelite and clast-supported conglomerate, metamorphosed in the green schist facies. The sedimentary lithofacies are grouped into three facies association (shelf, slope and deep-sea), indicating sedimentation from shelf deposits to deep-water turbidites. The shelf sedimentation was influenced by storm-wave during deposition. The slump and deep-sea deposits were generated by gravitational flows and high- to low-concentration turbidity currents. Shelf sandstone, clast-supported conglomerate and proximal to distal turbidites outline a submarine fan system. U-Pb SHRIMP data from detrital zircons of graywacke samples indicate a maximum sedimentation age of ca. 568 Ma. Thus, the Salinas Formation is much younger than the Macaubas Group, and represents late orogenic deposits (ca. 568- 500 Ma). The distal, passive margin unit of the Macaubas Group is now called Ribeirao da Folha Formation (ca. 800 Ma). (author)

  16. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  17. Pueblos indígenas y la tolerancia occidental

    OpenAIRE

    Carmona Caldera, Cristóbal Gonzalo

    2014-01-01

    Ignorando la especificidad cultural de su origen y la vaguedad de sus fundamentos, los derechos humanos  han sido instituidos como marco en el que se deben desarrollar las relaciones entre los pueblos indígenas y las sociedades occidentales. Sin embargo, ello puede causar más problemas que beneficios en la construcción de un Estado que pretenda perseguir la justicia etnocultural. En el presente trabajo, se analizará de qué forma los derechos humanos se pueden convertir en un arma ideológica q...

  18. 78 FR 67382 - Santa Clara Pueblo; Major Disaster and Related Determinations

    Science.gov (United States)

    2013-11-12

    ... SECURITY Federal Emergency Management Agency Santa Clara Pueblo; Major Disaster and Related Determinations... Presidential declaration of a major disaster for the Santa Clara Pueblo (FEMA-4151-DR), dated October 24, 2013... Act''), as follows: I have determined that the damage to the lands associated with the Santa...

  19. Optimization of photosynthesis, growth, and biochemical composition of the microalga Rhodomonas salina

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Douëtte, Claire; Rayner, Thomas Allan

    2016-01-01

    The cryptophyte Rhodomonas salina is widely used as feed for copepod cultures. However, culturing conditions to obtain high-quality algae have not yet been efficiently optimized. Therefore, we aimed to develop a cultivation protocol for R. salina to optimize its nutritional value and provide tech...

  20. Crime Trend Prediction Using Regression Models for Salinas, California

    Science.gov (United States)

    2012-06-01

    Mafia (La Eme) and Nuestra Familia (NF)” (Sureños, 2005). The original members of the gang were associated with the urban Hispanic population...Morales et al., 2008, p. 8). The Norteños are associated with the Nuestra Familia gang. The Norteños, Spanish for “Our Family,” are rumored to have... Familia in Salinas. Monterey Herald. 55 San Francisco Citizen. (2010, 22 April). Jerry Brown Takes Down: “Operation Knockout” Arrests 94 Norteños

  1. Environmental analysis of Lower Pueblo/Lower Los Alamos Canyon, Los Alamos, New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ferenbaugh, R.W.; Buhl, T.E.; Stoker, A.K.; Becker, N.M.; Rodgers, J.C.; Hansen, W.R.

    1994-12-01

    The radiological survey of the former radioactive waste treatment plant site (TA-45), Acid Canyon, Pueblo Canyon, and Los Alamos Canyon found residual contamination at the site itself and in the channel and banks of Acid, Pueblo, and lower Los Alamos Canyons all the way to the Rio Grande. The largest reservoir of residual radioactivity is in lower Pueblo Canyon, which is on DOE property. However, residual radioactivity does not exceed proposed cleanup criteria in either lower Pueblo or lower Los Alamos Canyons. The three alternatives proposed are (1) to take no action, (2) to construct a sediment trap in lower Pueblo Canyon to prevent further transport of residual radioactivity onto San Ildefonso Indian Pueblo land, and (3) to clean the residual radioactivity from the canyon system. Alternative 2, to cleanup the canyon system, is rejected as a viable alternative. Thousands of truckloads of sediment would have to be removed and disposed of, and this effort is unwarranted by the low levels of contamination present. Residual radioactivity levels, under either present conditions or projected future conditions, will not result in significant radiation doses to persons exposed. Modeling efforts show that future transport activity will not result in any residual radioactivity concentrations higher than those already existing. Thus, although construction of a sediment trap in lower Pueblo Canyon is a viable alternative, this effort also is unwarranted, and the no-action alternative is the preferred alternative.

  2. Metabolic engineering of Dunaliella salina for production of ketocarotenoids.

    Science.gov (United States)

    Anila, N; Simon, Daris P; Chandrashekar, Arun; Ravishankar, G A; Sarada, R

    2016-03-01

    Dunaliella is a commercially important marine alga producing high amount of β-carotene. The use of Dunaliella as a potential transgenic system for the production of recombinant proteins has been recently recognized. The present study reports for the first time the metabolic engineering of carotenoid biosynthesis in Dunaliella salina for ketocarotenoid production. The pathway modification included the introduction of a bkt gene from H. pluvialis encoding β-carotene ketolase (4,4'β-oxygenase) along with chloroplast targeting for the production of ketocarotenoids. The bkt under the control of Dunaliella Rubisco smaller subunit promoter along with its transit peptide sequence was introduced into the alga through standardized Agrobacterium-mediated transformation procedure. The selected transformants were confirmed using GFP and GUS expression, PCR and southern blot analysis. A notable upregulation of the endogenous hydroxylase level of transformants was observed where the BKT expression was higher in nutrient-limiting conditions. Carotenoid analysis of the transformants through HPLC and MS analysis showed the presence of astaxanthin and canthaxanthin with maximum content of 3.5 and 1.9 µg/g DW, respectively. The present study reports the feasibility of using D. salina for the production of ketocarotenoids including astaxanthin.

  3. Effects of UV/Ag-TiO2/O3 advanced oxidation on unicellular green alga Dunaliella salina: Implications for removal of invasive species from ballast water

    Institute of Scientific and Technical Information of China (English)

    Donghai Wu; Hong You; Jiaxuan Du; Chuan Chen; Darui Jin

    2011-01-01

    The UV/Ag-TiO2/O3 process was investigated for ballast water treatment using Dunaliella salina as an indicator.Inactivation curves were obtained, and the toxicity of effluent was determined.Compared with individual unit processes using ozone or UV/Ag-TiO2, the inactivation efficiency of D.salina by the combined UV/Ag-TiO2/O3 process was enhanced.The presence of ozone caused an immediate decrease in chlorophyll a (chi-a) concentration.Inactivation efficiency and chl-a removal efficiency were positively correlated with ozone dose and ultraviolet intensity.The initial total residual oxidant (TRO) concentration of effluent increased with increasing ozone dose, and persistence of TRO resulted in an extended period of toxicity.The results suggest that UV/Ag-Ti02/03 has potential for ballast water treatment.

  4. Arsenic, cadmium, lead, and mercury in surface soils, Pueblo, Colorado: Implications for population health risk

    Science.gov (United States)

    Diawara, D.M.; Litt, J.S.; Unis, D.; Alfonso, N.; Martinez, L.A.; Crock, J.G.; Smith, D.B.; Carsella, J.

    2006-01-01

    Decades of intensive industrial and agricultural practices as well as rapid urbanization have left communities like Pueblo, Colorado facing potential health threats from pollution of its soils, air, water and food supply. To address such concerns about environmental contamination, we conducted an urban geochemical study of the city of Pueblo to offer insights into the potential chemical hazards in soil and inform priorities for future health studies and population interventions aimed at reducing exposures to inorganic substances. The current study characterizes the environmental landscape of Pueblo in terms of heavy metals, and relates this to population distributions. Soil was sampled within the city along transects and analyzed for arsenic (As), cadmium (Cd), mercury (Hg) and lead (Pb). We also profiled Pueblo's communities in terms of their socioeconomic status and demographics. ArcGIS 9.0 was used to perform exploratory spatial data analysis and generate community profiles and prediction maps. The topsoil in Pueblo contains more As, Cd, Hg and Pb than national soil averages, although average Hg content in Pueblo was within reported baseline ranges. The highest levels of As concentrations ranged between 56.6 and 66.5 ppm. Lead concentrations exceeded 300 ppm in several of Pueblo's residential communities. Elevated levels of lead are concentrated in low-income Hispanic and African-American communities. Areas of excessively high Cd concentration exist around Pueblo, including low income and minority communities, raising additional health and environmental justice concerns. Although the distribution patterns vary by element and may reflect both industrial and non-industrial sources, the study confirms that there is environmental contamination around Pueblo and underscores the need for a comprehensive public health approach to address environmental threats in urban communities. ?? Springer 2006.

  5. Sandals as Icons: Representations in Ancestral Pueblo Rock Art and Effigies in Stone and Wood

    OpenAIRE

    Polly Schaafsma

    2016-01-01

    Dating the late 1000s to the mid-1200s CE, petroglyphs of sandal images are among others that distinguish ancient Pueblo rock art in the San Juan and Little Colorado River drainages on the Colorado Plateau from Ancestral Pueblo rock art elsewhere across the Southwest. The sandal “track” also has counterparts  as effigies in stone and wood often found in ceremonial contexts in Pueblo sites. These representations reflect the sandal styles of the times, both plain in contour and the jog-toed var...

  6. pueblo antiguo de la ciudad de México

    Directory of Open Access Journals (Sweden)

    Teresa Losada

    2005-01-01

    Full Text Available En este artículo, la autora explora, a través de un trabajo de campo, la forma en que la memoria histórica se articula con la cosmovisión en Milpa Alta, un pueblo antiguo de la ciudad de México. La narración mítica que refiere al origen, se ubica en la historia de "larga duración", en el ensamblaje de la naturaleza con los ciclos de las fiestas religiosas y la relación con la tierra. La cosmovisión mesoamericana, incesantemente repetida, atraviesa el tiempo y le corresponde contar con siglos de duración, con profundidad, con una especie de semi-inmovilidad que hace que todo en Milpa Alta gravite en torno a ella.

  7. Artemia salina acute immobilization test: a possible tool for aquatic ecotoxicity assessment.

    Science.gov (United States)

    Kalčíková, Gabriela; Zagorc-Končan, Jana; Zgajnar Gotvajn, Andreja

    2012-01-01

    Despite the fact that the marine crustacean Artemia salina is extensively used in ecotoxicology, there is still a lack of information about its sensitivity to commonly used chemicals. In the presented study, acute toxicity of 18 commonly used chemicals - including organic solvents, industrial chemicals, metals and inorganic compounds - to A. salina was evaluated. A. salina showed a range of sensitivities to tested chemicals. Regarding all of the investigated organics, phenolic compounds expressed the highest toxicity to A. salina. Nitrite and mercury were the most toxic inorganic substances applied in the study. On the other hand, dimethyl sulfoxide, nitrate and ammonium were the least toxic. The possibility to use A. salina for interspecies correlation was assessed by comparison of sensitivities of different organisms (bacteria, fish, crustacean) to organic compounds. Correlation between various species was observed, especially between A. salina and fish. Due to the strong relation between toxicity and the logarithm of the octanol/water partition coefficient logP(OW,) lipophilicity was found to be the main factor influencing toxicity of the chosen organic compounds. No significant correlation between toxicity to A. salina and physico-chemical parameters of metals was observed.

  8. Antioxidant status of Penaeus monodon fed with Dunaliella salina supplemented diet and resistance against WSSV

    Directory of Open Access Journals (Sweden)

    M. MADHUMATHI

    2011-10-01

    Full Text Available The present study investigates the protection of shrimp Penaeus monodon against white spot syndrome virus (WSSV using Dunaliella salina algal cells which contains an antioxidant betacarotene for the shrimp nonspecific immunity. To determine the antioxidant activity, the shrimp were treated in vivo (orally with feed methods at the concentration of 0.5 %, 1.0 % and 2 % D. salina incorporated with pellet feed, respectively. In the present study, anti-WSSV activity of D. salina incorporated diet by in vivo methods showed strongantioxidant activity and the immunological parameters such as proPO, SOD,catalase were higher in the WSSVinfected shrimp treated with D. salina incorporated diet when compared to control groups. These results strongly indicate that in vivo of D. salina incorporated diet enhances immunity of the shrimp. Based on the present data and the advantages of harvesting D. salina at low price, we believe that oral administration of D. salina live cells along with the pellet feed is a potential prophylactic agent against WSSV infection of shrimp tosome extent.

  9. Salinas - An implicit finite element structural dynamics code developed for massively parallel platforms

    Energy Technology Data Exchange (ETDEWEB)

    BHARDWAJ, MANLJ K.; REESE,GARTH M.; DRIESSEN,BRIAN; ALVIN,KENNETH F.; DAY,DAVID M.

    2000-04-06

    As computational needs for structural finite element analysis increase, a robust implicit structural dynamics code is needed which can handle millions of degrees of freedom in the model and produce results with quick turn around time. A parallel code is needed to avoid limitations of serial platforms. Salinas is an implicit structural dynamics code specifically designed for massively parallel platforms. It computes the structural response of very large complex structures and provides solutions faster than any existing serial machine. This paper gives a current status of Salinas and uses demonstration problems to show Salinas' performance.

  10. Taos Smart Growth Implementation Assistance: Concepts for the Paseo del Pueblo Sur Corridor

    Science.gov (United States)

    This report describes a technical assistance project with Taos, NM, to help make development along State Highway 68, the Paseo del Pueblo Sur commercial corridor, economically stronger and more attractive.

  11. La reforma constitucional peruana: de la comunidad al pueblo indígena

    OpenAIRE

    Ballón, Francisco

    2002-01-01

    La propuesta de reforma constitucional que la Comisión Nacional de Pueblos Andinos y Amazónicos, ha presentado al Congreso de Perú el 13 de marzo de 2002, quiebra la tradición comunera y agrarista para acoderar en un nuevo sujeto de derechos: el Pueblo Indígena. Simultáneamente, visibiliza otro grupo hasta ahora sin derechos colectivos: los afroperuanos.

  12. Continuous flocculation-sedimentation for harvesting Nannochloropsis salina biomass.

    Science.gov (United States)

    Chatsungnoen, Tawan; Chisti, Yusuf

    2016-03-20

    A continuous flow process is developed for recovery of the biomass of the marine microalga Nannochloropsis salina. Flocculation-sedimentation is used to recover the biomass from an algal suspension with an initial dry biomass concentration of 0.5 g L(-1), as would be typical of a raceway-based biomass production system. More than 85% of the biomass initially in suspension could be settled by gravity in a flocculation-sedimentation device with a total residence time of ∼148 min. Aluminum sulfate was used as an inexpensive, readily available and safe flocculant. The optimal flocculant dosage (as Al2(SO4)3) was 229 mg L(-1). Relative to a highly effective 62-min batch flocculation-sedimentation process for the same alga and flocculant, the continuous flow operation took longer and required nearly double the flocculant dose. The design of the flocculation-sedimentation system is explained.

  13. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism.

  14. Cultivation of Nannochloropsis salina in municipal wastewater or digester centrate.

    Science.gov (United States)

    Dong, Bingfeng; Ho, Nam; Ogden, Kimberly L; Arnold, Robert G

    2014-05-01

    Meaningful use of biofuels for transportation depends on utilization of water from non-traditional, non-potable resources. Here it is hypothesized that (i) reclaimed wastewater or nutrient-rich side streams derived from municipal wastewater treatment are suitable for that purpose and (ii) use of those waters for algal growth can promote water quality through nutrient management. Experiments showed that metals levels in municipal wastewaters are unlikely to inhibit algal growth and lipid production, at least by metals tolerant microalgae like Nannochloropsis salina. Cells grew without inhibition in treated municipal wastewater or centrate derived from wastewater treatment at additions up to 75 percent v/v in their normal growth medium minus nitrogen and phosphorus. Although wastewater provides a suitable nutrient source for algal growth, not enough municipal wastewater is available to support a meaningful biofuels industry without efficient water recycling and nutrient recovery/reuse from spent algae. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Iron metallodrugs: stability, redox activity and toxicity against Artemia salina.

    Science.gov (United States)

    Vitorino, Hector Aguilar; Mantovanelli, Luca; Zanotto, Flavia Pinheiro; Espósito, Breno Pannia

    2015-01-01

    Iron metallodrugs comprise mineral supplements, anti-hypertensive agents and, more recently, magnetic nanomaterials, with both therapeutic and diagnostic roles. As biologically-active metal compounds, concern has been raised regarding the impact of these compounds when emitted to the environment and associated ecotoxicological effects for the fauna. In this work we assessed the relative stability of several iron compounds (supplements based on glucoheptonate, dextran or glycinate, as well as 3,5,5-trimethylhexanoyl (TMH) derivatives of ferrocene) against high affinity models of biological binding, calcein and aprotransferrin, via a fluorimetric method. Also, the redox-activity of each compound was determined in a physiologically relevant medium. Toxicity toward Artemia salina at different developmental stages was measured, as well as the amount of lipid peroxidation. Our results show that polymer-coated iron metallodrugs are stable, non-redox-active and non-toxic at the concentrations studied (up to 300 µM). However, TMH derivatives of ferrocene were less stable and more redox-active than the parent compound, and TMH-ferrocene displayed toxicity and lipid peroxidation to A. salina, unlike the other compounds. Our results indicate that iron metallodrugs based on polymer coating do not present direct toxicity at low levels of emission; however other iron species (eg. metallocenes), may be deleterious for aquatic organisms. We suggest that ecotoxicity depends more on metal speciation than on the total amount of metal present in the metallodrugs. Future studies with discarded metallodrugs should consider the chemical speciation of the metal present in the composition of the drug.

  16. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay

    National Research Council Canada - National Science Library

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50 < 100 µg/ml...

  17. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  18. Phototoxicity activity of Psoralea drupacea L. using Atremia salina bioassay system

    Directory of Open Access Journals (Sweden)

    Mohammad Ramezani

    2011-07-01

    Conclusion: The result showed that P. drupacea methanolic extract and chloroform fraction have phototoxicity in A. salina bioassay system and their toxic effect is related to phototoxic constituents such as psoralen.

  19. Ecology of a heterotrichous ciliate Fabrea salina from salterns of Bombay Coast, India

    Digital Repository Service at National Institute of Oceanography (India)

    Rattan, P.; Ansari, Z.A; Sreepada, R.A

    The abundance and population size structure of a heterotrichous ciliate @iFabrea salina@@, was studied in relation to hydrochemical and hydrobiological variables in three hypersaline ponds of Bombay, west coast of India There was a clear seasonal...

  20. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  1. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  2. Pengaruh Medium Tercemar Logam Pb dan Cu terhadap Pertumbuhan Nannochloropsis Salina

    OpenAIRE

    Abd.Wahid Wahab; Yusafir Hala; Fibiyanthy

    2013-01-01

    Penelitian ini dilakukan dengan tujuan memanfaatkan fitoplankton Nannochloropsis salina sebagai biosorben untuk ion logam Pb dan Cu di perairan. Pada penelitian ini pemaparan ion logam Pb dan Cu dengan variasi konsentrasi masing-masing 10, 30, dan 50 ppm dilakukan di awal masa pertumbuhan fitoplankton N. salina dalam Medium Conwy pada salinitas 30 ???, aerasi dan pencahayaan kontinyu, serta suhu ruangan 20 ??C. Konsentrasi ion logam ditentukan dengan menggunakan spektrofotometer serapan atom ...

  3. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  4. [Determination of Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus toxicity over Artemia salina].

    Science.gov (United States)

    Nieto R, Ivonne J; Salama, Ahmed M; Cataño P, Jorge E; Chegwin A, Carolina

    2008-09-30

    We report the toxicity of ethanolic extracts in Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus over that obtained in Artemia salina. P. involutus showed the highest toxicity (LC50 = 94.4 microg/ml), similar to that detected using potassium dichromate pattern. P. pulmonarius and P. ostreatus did not show toxicity over A. salina in concentrations lower than 1,000 microg/ml.

  5. 用卤虫(Artemia salina L.)评价杀虫活性%Evaluate Insecticidal Activity Using Artemia salina L.

    Institute of Scientific and Technical Information of China (English)

    王再强; 周红; 韩俊; 何月秋; 录丽平

    2011-01-01

    [Aims]Artemia salina L.is general used for preliminary assessment of pharmacological activity.However,it is necessary to evaluate the suitability of A.salina L.before it is used as a model material for screening insecticidal activity.Here, 14 insecticides with 10 different action mechanisms were selected to evaluate insecticidal activity against A.salina L.used as a model material.[Results]13 Insecticides significantly killed A.salina L., Moulting hormone agonist and compound stimulating GABA release were the most active.[Conclusions]A.salina L.is a suitable organism to evaluate insecticidal activity and the method is simple having good sensitivity to many insecticides with different action mechanisms.%[目的]以卤虫(Artemia salina L.)为模式生物对化合物的药理活性进行初步评价.对10种不同作用机制的14种杀虫剂进行了生物筛选试验.[结果]14种供试杀虫剂中有13种对卤虫有显著的毒杀效果,作用于以γ-氨基丁酸为神经递质传导系统的化合物及蜕皮激素类似物效果最为显著.[结论]用卤虫筛选杀虫剂活性的方法简便,对多种作用机制的杀虫剂灵敏.

  6. Interspecific competition and allelopathic interaction between Karenia mikimotoi and Dunaliella salina in laboratory culture

    Science.gov (United States)

    He, Dong; Liu, Jiao; Hao, Qiang; Ran, Lihua; Zhou, Bin; Tang, Xuexi

    2016-03-01

    Algal allelopathy is a manifold ecological/physiological phenomenon that is focused on chemical interactions and autotoxicity. We investigated the allelopathic interactions between Karenia mikimotoi and Dunaliella salina in laboratory cultures based on diff erent temperature (15°C, 20°C, and 25°C) and lighting (40, 80, and 160 μmol/(m2·s)) conditions. The growth of D. salina in bi-algae culture (1:1 size/density) was significantly restrained. The results of cell-free filtrate culture indicate that direct cell-tocell contact was not necessary in interspecific competition. Further experimental results demonstrated that allelochemicals released from K. mikimotoi were markedly influenced by both temperature ( P =0.013) and irradiance ( P =0.003), resulting in diff erent growth characteristics of D. salina in filtrate mediums. Compared with the plateau period, K. mikimotoi exudates in the exponential phase had a stronger short-term inhibition effect on D. salina in normal conditions. A clear concentration-dependent relationship was observed in the effect of allelochemicals released from K. mikimotoi with low-promoting and high-repressing effects on D. Salina in a short time-scale. In addition, allelopathic substances remain stable and effective under high temperature and pressure stress. Many flocculent sediments adhering with D. salina cells were observed in all filtrate mediums, while the quantity and color depended on the original culture conditions.

  7. Utility of the pat gene as a selectable marker gene in production of transgenic Dunaliella salina

    Directory of Open Access Journals (Sweden)

    Hyo Sun Jung

    2016-09-01

    Full Text Available Abstract Background The objective of this study was to develop an efficient selectable marker for transgenic Dunaliella salina. Results Tests of the sensitivity of D. salina to the antibiotic chloramphenicol and the herbicide Basta® showed that cells (1.0 × 106 cells/ml treated with 1000 or 1500 μg/ml chloramphenicol died in 8 or 6 days, respectively, whereas D. salina cells (1.0 × 106 cells/ml treated with 5, 10, 20, or 40 μg/ml Basta® died in 2 days. Therefore, D. salina is more sensitive to Basta® than to chloramphenicol. To examine the possibility of using the phosphinothricin N-acetyltransferase (pat gene as a selectable marker gene, we introduced the pat genes into D. salina with particle bombardment system under the condition of helium pressure of 900 psi from a distance of 3 cm. PCR analysis confirmed that the gene was stably inserted into the cells and that the cells survived in 5 μg/ml Basta®, the medium used to select the transformed cells. Conclusions The findings of this study suggest that the pat gene can be used as an efficient selectable marker when producing transgenic D. salina.

  8. Maracaibo: De pueblo de Agua a Ciudad, Puerto siglos XVIXVII

    Directory of Open Access Journals (Sweden)

    Ileana Parra Grazzina

    2006-01-01

    Full Text Available El pueblo de Maracaibo aborigen y sus términos antecedió a lo que fue la ciudad-puerto de Maracaibo en los siglos XVI y XVII inserta en la expansión capitalista europea. La ventajosa situación de Maracaibo en el intermedio del agua lacustre y marítimas, propició la alternativa de comunicación entre los centros productores andinos-lacustres con el Caribe y el Atlántico. Factor aprovechado por las poblaciones del norte del Lago de Maracaibo para el dominio de la navegación lacustre que derivó en rivalidades económicas y políticas, tanto en los tiempos aborígenes como en los tiempos de sometimiento hispánico. Se trata de interpretar el crecimiento del puerto y su competitividad con los otros puertos lacustres como Moporo, Tomoporo, Gibraltar y Zulia por el control comercial, de los cuales dependió paradójicamente para su abastecimiento en razón de la esterilidad de las tierras maracaiberas. Tal proceso se estudió en el marco de la política mercantilista de los Austrias, a través del análisis histórico de las fuentes documentales del Archivo General de Indias.

  9. The Pueblo Incident: A Follow-Up Survey Conducted Eight Years after the Release of the USS Pueblo Crew from North Korea

    Science.gov (United States)

    1978-10-01

    t .. • "..: , ; • • Introdijction This peper will report on the results of the health and adjustment of former USS Pueblo crew membars obtatned from...America’ "niform. The crew was flown to the Naval Regional Medical Centier, then called the U.A. Naval Hospital, San Diego, California for a Ail more

  10. CONFLICTOS POR TIERRAS EN LOS "PUEBLOS DE INDIOS" DE CÓRDOBA. EL PUEBLO DE SAN MARCOS ENTRE FINES DEL SIGLO XVII Y PRINCIPIOS DEL SIGLO XIX

    Directory of Open Access Journals (Sweden)

    Sonia Tell

    2012-01-01

    Full Text Available En este trabajo se abordan los conflictos por tierras de “pueblos de indios” de Córdoba en el siglo XVIII a partir de un estudio de caso: el del pueblo de San Marcos. En base a un pleito que se prolongó por cuatro décadas (entre 1769 y 1809, se reconstruyen las estrategias de la elite local para legalizar la usurpación de tierras de los pueblos de indios y las estrategias indígenas para recuperarlas, basándose en el título de la demarcación y asignación de tierras de reducción realizada en 1694 por orden del visitador Luján de Vargas y en el apoyo de los funcionarios de la Real Audiencia de Buenos Aires. Asimismo, se reconstruyen algunas características de la tenencia de la tierra, del sistema de autoridades y de la organización comunitaria de las actividades productivas, a fin de reevaluar los planteos realizados en estudios previos sobre la desestructuración avanzada de los pueblos de indios de la jurisdicción de Córdoba a fines de la colonia.

  11. Toxicity of four antifouling biocides and their mixtures on the brine shrimp Artemia salina.

    Science.gov (United States)

    Koutsaftis, A; Aoyama, I

    2007-11-15

    Zinc pyrithione (ZPT), Copper pyrihione (CPT), Chlorothalonil and Diuron are four of the most widely used as alternative to tributlytin (TBT) antifouling biocides in boat paints. As most previous laboratory bioassays for these biocides have been conducted solely based on acute tests with a single compound, information on the possible combined toxicity of these common biocides to marine organisms are limited. In this study, the toxicity of binary (in several proportions), ternary and quaternary mixtures were evaluated using the brine shrimp Artemia salina as test organism. Mixture toxicities were studied using the concentration addition model (isobolograms and toxic unit summation), and the mixture toxicity index (MTI). The ZPT-CPT combination had a strictly synergistic effect which requires attention because the coexistence of ZPT and CPT in the marine environment, due to transchelation of ZPT, may occur. The binary mixtures of Diuron with the metal pyrithiones exhibited various interactive effects (synergistic, antagonistic or additive) depending on concentration ratios, whereas all binary mixtures that contained Chlorothalonil exhibited antagonistic effects. The different types of combined effects subsequent to proportion variation of binary mixtures underline the importance of the combined toxicity characterization for various ratios of concentrations. The four ternary mixtures tested, also exhibited various interactive effects, and the quaternary mixture exhibited synergism. The models applied were in agreement in most cases. The observed synergistic interactions underline the requirement to review water quality guidelines, which are likely underestimating the adverse combined effects of these chemicals.

  12. Geology of the Delta, Escalante, Price, Richfield and Salina 1 deg x 2 deg NTMS quadrangles, Utah

    Science.gov (United States)

    Thayer, P. A.

    1981-11-01

    The National Uranium Resource Evaluation (NURE) program was established to evaluate domestic uranium resources in the continental United States and to identify areas favorable for uranium exploration. The Grand Junction Office of the Department of Energy is responsible for administering the program. The Savannah River Laboratory (SRL) is responsible for hydrogeochemical and stream-sediment reconnaissance (HSSR) of 3.9 million sq km (1,500,000 mi(2)) in 37 eastern and western states. This document provides geologic and mineral resources reports for the Delta, Escalante, Price, Richfield, and Salina 1 deg x 2 deg National Topographic Map Series quadrangles, Utah. The purpose of these reports is to provide background geologic and mineral resources information to aid in the interpretation of NURE geochemical reconnaissance data. Except for the Escalante Quadrangle, each report is accompanied by a geologic map and a mineral locality map (Plates 1-8, in pocket).

  13. La evanescencia del pueblo y los usos del romancero como factor de identidad política

    Directory of Open Access Journals (Sweden)

    Díaz Viana, Luis

    2011-10-01

    Full Text Available The compilation and study of the ballad tradition in general and the romancero in particular, have constituted, since they began to wake up the interest of the romantic folklorists, a specially propitious field to be used like factor of reconstruction of political identities. The fact that music and text they are in all ballad traditions united and combined fosters that potentiality. What this work discusses is why in the case of romancero the dominant tendency in research has been characterized until present times by the approach on a national or Hispanic scale, getting to even advise against the practice of the regional or provincial collections. And what methodological changes have been carried out by this position, which cannot be separated, on the other hand, from a theoretical concept of folk as national folk and which determines, in parallel, the evanescence and liquation of located and particular people, those who not only transmit, but also create culture, the true folk.

    La recopilación y el estudio de la balada en general, y del romancero en particular, ha constituido, desde que se empieza a despertar el interés de los folkloristas románticos, un campo especialmente propicio para ser utilizado como factor de reconstrucción de identidades políticas. El hecho de que música y texto estén en toda baladística inseparablemente unidos favorece esa potencialidad. Lo que este trabajo se plantea es por qué en el caso del romancero la tendencia dominante en su estudio se ha caracterizado hasta el presente por un enfoque a escala nacional o hispánico, llegando a desaconsejarse incluso la práctica de las colecciones regionales o provinciales. Y qué condicionamientos metodológicos ha acarreado esta postura, a la que no se puede desligar –de otro lado– de una determinada concepción teórica de pueblo, como pueblo-nación, la cual viene a determinar –paralelamente– la evanescencia y licuación de una gente o pueblo m

  14. de los pueblos amerindios, kogi y wayúu

    Directory of Open Access Journals (Sweden)

    María Amarís Macías

    2005-01-01

    Full Text Available Este artículo presenta la comprensión alcanzada acerca de los aspectos culturales de la familia de los pueblos amerindios Wayúu y Kogi, a partir de la realización de una investigación bibliográfica analítica sobre los mismos. Los resultados de esta investigación nos muestran que la “sangre” es un elemento esencial para los Wayúu (parentesco matrilineal materializado por el pago; en tanto que, para los Kogi, es fundamental la fecundidad, manifiesta en el acto de poporear, así como en la territorialidad. Uno y otro se relacionan con el aporte de sistema de reciprocidad de Lévi- Strauss. En ambas, el ciclo de la familia es continuo; sin embargo, los Kogi poseen un sistema cerrado con subsistemas desligamiento, mientras que, en los Wayúu, el sistema es abierto con subsistemas aglutinados. En los hallazgos se resalta la discrepancia en la caracterización de los Wayúu como sociedad de matriarcado; concluyéndose con la propuesta de Carranza (1997 en la existencia de matrilinealidad. En los Kogi, además, las magnitudes de las trasformaciones afectan a la familia, lo que hace a éstos vulnerables a cambios en su dinámica interna. En las dos culturas se establece el tema como unidad que determina el sentido de identidad étnica. Por eso la temática se extrapola en el concepto de la socialización, que en la población se realiza a través de los ritos de pubertad y el matrimonio. Por ello se reconoce que la familia es la encargada de generar en las personas un sentido de identidad (Campanini, A.; Luppi, F., 1996, (Minuchin, 1986.

  15. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-03

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae.

  16. Acute toxicity of TBT and IRGAROL in Artemia salina.

    Science.gov (United States)

    Panagoula, Bakoulia; Panayiota, Marcouli; Iliopoulou-Georgudaki, Joan

    2002-01-01

    A 24-hour LC(50) bioassay method was carried out to study acute toxicity of Tributyltin (TBT) and IRGAROL (C(11)H(19)N(5)S) in Artemia salina. Five graded levels of both biocides were tested. According to the range test, the doses of TBT were 11.6 ng x l(-1), 21.0 ng x l(-1), 37.3 ng x l(-1), 65.2 ng x l(-1), and 116.5 ng x l(-1), and for IRGAROL were 1.0 mg x l(-1), 1.8 mg x l(-1), 3.2 mg x l(-1), 5.6 mg x l(-1), and 10 mg x l(-1). The determined LC(50) values were 41.41 ng x l(-1) and 1.62 mg x l(-1) respectively. These results indicate that in this system TBT is acutely more toxic than IRGAROL; however, both are proven environmentally toxic substances.

  17. Turismo y agronegocios: alternativas para mejorar la calidad de vida en los pueblos originarios

    Directory of Open Access Journals (Sweden)

    Alejandra Giacosa

    2014-06-01

    Full Text Available En este artículo se analiza la incidencia de la cultura y el hábitat de los pueblos originarios en las actividades turísticas. No obstante, los beneficios derivados de esta industria no se ven reflejados en una mejor calidad de vida de aquéllos que contribuyen a su desarrollo. La desnutrición y las consecuencias sociales de estos nuevos escenarios ameritan realizar una propuesta de gestión que, mediante los ingresos obtenidos por el turismo se mejore la calidad de vida de estos pueblos. La originalidad de este trabajo reside en la propuesta de relacionar el turismo como fuente de ingresos, la situación nutricional de los pueblos originarios y el análisis de la tecnología apropiada en el marco de la agricultura.

  18. Ciudadanos y pueblo sujetos de la acción política

    Directory of Open Access Journals (Sweden)

    Camilo Castellanos

    1998-10-01

    Full Text Available Se presentan aquí los conceptos de ciudadanía y pueblo desde la perspectiva de la acción política. En una primera parte, retoma de Hannah Arendt la dinámica de la esfera pública y desde ella deriva en las nociones de acción y ciudadanía. En segundo término, siguiendo el trabajo de Antonio Negri, muestra la génesis del concepto de pueblo como poder constituyente y fundamento de la democracia en la reflexión de Maquiavelo. Por último, desde Pablo Neruda en su Canto General ilustra una comprensión latinoamericana del papel protagónico del pueblo en la historia de nuestro continente.

  19. Crescimento de mudas de mamoeiro em condições controladas com água salina

    Directory of Open Access Journals (Sweden)

    Debora Cristina Coelho

    2015-02-01

    Full Text Available Diante a importância socioeconômica e alimentar do mamoeiro para a região nordeste, onde naturalmente ocorrem águas com teores elevados de sais, objetivou-se avaliar o crescimento de mudas de mamoeiro em casa de vegetação sob irrigação com água salina. Neste sentido, foi realizado um experimento, em ambiente protegido da Universidade Federal de Campina Grande, UFCG, Campus de Pombal, PB onde foram estudados, cinco níveis de salinidade da água de irrigação em uma cultivar de mamoeiro (Tainung-1. O delineamento experimental foi inteiramente casualizado, sendo a unidade experimental composta por quatro plantas úteis; as mudas de mamoeiro foram formadas em sacolas plásticas de 500 ml de volume; avaliou-se o crescimento e a massa seca da parte aérea das plantas. Sendo as variáveis submetidas ao teste F, e realizando análise de regressão polinomial para o fator salinidade da água. Sendo assim; A salinidade reduz o crescimento das mudas de mamoeiro; A altura de planta e diâmetro de caule foi afetado com o incremento unitário da salinidade da água; A variável que melhor expressa o efeito da salinidade nas mudas de mamoeiro é massa seca da parte aérea, por haver maior redução com aumento unitário da salinidade.

  20. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    Directory of Open Access Journals (Sweden)

    Juan Manuel Pérez Agudelo

    2015-06-01

    Full Text Available Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20 y el grupo control fue expuesto a agua destilada (n=20 la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (Pearson para determinar la diferencia en mortalidad de los grupos.Resultados:El Grupo Control no presentó mortalidad, en tanto el Grupo Apitoxina presentó una mortalidad del 95%. Se demostró una asociación estadísticamente significativa con un p<0,05(IC: 95% entre la mortalidad de la Artemia salina y la administración de apitoxina.Conclusión:El extracto acuoso de apitoxina presenta toxicidad a una concentración de 0.35 en el modelo de Artemia salina. Palabras Clave: Apitoxina, Artemia salina, Toxicidad

  1. De ciudad-huerta a pueblo boutique: Turismo y transformaciones materiales en Purmamarca

    OpenAIRE

    Tommei,Constanza; Benedetti, Alejandro

    2014-01-01

    Con el inicio del siglo XXI se asistió a una profunda transformación del pueblo andino de Purmamarca (provincia de Jujuy, República Argentina). Hasta la década de 1980, el lugar tenía el carácter de una "ciudad-huerta" como fue definido en una ordenanza por el gobierno local. Diferentes acontecimientos acaecidos en la década de 1990 permitieron que el lugar se fuera transformando en un importante destino turístico de la Argentina. Así, aquel pequeño pueblo rural del interior jujeño fue cambia...

  2. La construcción política de los pueblos desde el posicionamiento moderno

    Directory of Open Access Journals (Sweden)

    Gerardo Lépore

    2017-02-01

    Full Text Available Kant y Rawls representan el pensamiento moderno erigido desde la racionalidad. Los pueblos y los ciudadanos de este mundo se construyen políticamente desde una serie de leyes que definen nuestra condición como sujetos. Esa arquitectura política está en crisis, puesta en tela de juicio por los relativismos actuales. La concepción liberal supone la paz de los pueblos como naturaleza propia. Sostener dicha posición implica el desafío utópico y realista que nos compromete como humanos.

  3. Pueblos ribereños de la Amazonía: haberes y habilidades

    OpenAIRE

    Chaves,Maria P. Socorro Rodrigues; Simonetti,Susy Rodrigues; Lima,Marly dos Santos

    2008-01-01

    Este artículo sobre los pueblos ribereños tradicionales y sus relaciones con la naturaleza es resultado de uno estudio realizado en las comunidades del Río Parauari, en el municipio de Maués, Provincia del Amazonas-Brasil. Aunque retrata la lucha de estos pueblos por la sobrevivencia sociocultural a partir de los haberes, técnicas y habilidades propias que se desenvuelven en contexto amazónico, con base en sus conocimientos que son pasadas por todos las generaciones.

  4. Artemia Salina L. (Anostraca): uma opção para a aquicultura do Nordeste do Brasil

    OpenAIRE

    1982-01-01

    Inoculations made with cysts of Artemia salina from San Francisco Bay (California, USA) in Macau, Rio Grande do Norte, Brazil, in 1977, have dispersed this crustacean in all neighboring salt work areas. Favourable environmental conditions which have successfully contributed to this inoculation, together with suggestions for a rational utilization of similar areas for Artemia salina cultivation, are analyzed and commented.

  5. Toxicity of cylindrospermopsin to the brine shrimp Artemia salina: comparisons with protein synthesis inhibitors and microcystins.

    Science.gov (United States)

    Metcalf, J S; Lindsay, J; Beattie, K A; Birmingham, S; Saker, M L; Törökné, A K; Codd, G A

    2002-08-01

    The Artemia salina bioassay was successfully applied to the analysis of the hepatotoxic cyanobacterial alkaloid and protein synthesis inhibitor, cylindrospermopsin. A dose-dependent response in mortality was observed for purified cylindrospermopsin and LC(50) values decreased with time from 8.1 to 0.71 microg/ml(-1), between 24 and 72 h, respectively. Cylindrospermopsin was slightly less potent than micro cystin-LR, with similar LC(50) values on a gravimetric basis, but was more toxic to A.salina than the protein synthesis inhibitors, cycloheximide, chloramphenicol and tetracycline. Cylindrospermopsin-containing strains of the cyanobacterium Cylindrospermopsis raciborskii were found to be toxic to A.salina and the LC(50) concentration for these strains over time was greater than the LC(50) for purified cylindrospermopsin, with the exception of C. raciborskii strain CR1.

  6. Hydrothermal liquefaction of Spirulina and Nannochloropsis Salina under subcritical and supercritical water conditions

    DEFF Research Database (Denmark)

    Toor, Saqib; Reddy, H.; Deng, S.

    2013-01-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220-375 °C, 20-255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid...... residue, and recycling process water for algae cultivation. GC-MS, elemental analyzer, FT-IR, calorimeter and nutrient analysis were used to analyze bio-crude, lipid-extracted algae and water samples produced in the hydrothermal liquefaction process. The highest bio-crude yield of 46% was obtained...... on Nannochloropsis salina at 350 °C and 175 bar. For Spirulina platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for Nannochloropsis salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae...

  7. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    CHAI Yurong; LU Yumin; WANG Tianyun; HOU Weihong; XUE Lexun

    2006-01-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficientpromoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase (CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics.Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  8. Stratigraphy, Structure, and Geologic and Coastal Hazards in the Peñuelas to Salinas Area, Southern Puerto Rico: A Compendium of Published Literature

    Science.gov (United States)

    Rodríguez-Martínez, Jesús

    2007-01-01

    The Puerto Rico Electrical Power Authority has proposed construction of a pipeline to convey natural gas from the municipio of Pe?uelas to the Aguirre thermoelectric power plant in the municipio of Salinas in southern Puerto Rico. To ensure that the geologic conditions along the possible routes do not represent a threat to the physical integrity of the natural gas pipeline, and thus comply with State and Federal regulations, the Puerto Rico Electrical Power Authority requested the U.S. Geological Survey to provide a synthesis of published literature of the geology of the coastal plain in the Pe?uelas to Salinas area. The study area is located in part of the Southern Coastal Plain of Puerto Rico. In the area that extends from the municipio of Pe?uelas eastward to the Laguna de las Salinas at Ponce, a distance of about 5 miles, the study area is underlain by middle Tertiary carbonate units. Eastward from the Laguna de las Salinas to the pipeline terminus at the Aguirre power plant in Salinas, a distance of about 30 miles, the terrain is underlain by fan-delta deposits of Quaternary age. The carbonate units and the fan-delta deposits are underlain by early Tertiary and older-age volcaniclastics with subordinate sedimentary rocks and lavas. The Great Southern Puerto Rico Fault Zone is the principal geologic structural feature in southern Puerto Rico. At present, the Great Southern Puerto Rico Fault Zone is considered largely quiescent, although it apparently is associated with minor earthquakes. There is no evidence of terrestrial, late Quaternary faulting within the Pe?uelas to Salinas area. Seismic activity in this area mostly originates from extension zones of more distal shallow sources such as Mona Canyon to the northwest and the Anegada Trough northeast of the island of Puerto Rico. The magnitude of completeness of earthquakes in the study area ranges from 2.0 to 2.5. The seismic density for the southern coast including the study area is about 0.128 earthquakes

  9. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina.

    Science.gov (United States)

    Beattie, Kenneth A; Ressler, Judith; Wiegand, Claudia; Krause, Eberhard; Codd, Geoffrey A; Steinberg, Christian E W; Pflugmacher, Stephan

    2003-02-12

    The toxicity and metabolism of the cyanobacterial toxins microcystin-LR (MCLR), Dhb-microcystin-HtyR and nodularin were investigated in the cysts, nauplii and adults of the brine shrimp Artemia salina. The presence of the phase II detoxication system glutathione S-transferase (sGST) in these stages was shown using different substrates. Exposure of adult A. salina to the toxins led to an elevation of GST activity in vivo. All three toxins were conjugated to glutathione via GST, which has been shown as an initial step of microcystin and nodularin detoxication.

  10. [Detection of fungal metabolites showing toxic activity through Artemia salina bioassay].

    Science.gov (United States)

    González, Ana María; Presa, Maximiliano; Latorre, María Gabriela; Lurá, María Cristina

    2007-03-01

    The aim of this study was to detect toxic metabolites from fungi contaminating food and medicinal herbs by applying the toxicity assay to Artemia salina. According to toxicity percentages, the extracts were classified as nontoxic (NT), slightly toxic (ST), toxic (T) and highly toxic (HT). Those classified as T and HT were assayed for mycotoxins. Only 6 out of 71 strains were found to be T (8.5%) for A. salina. Penicillium brevicompactum Dierckx, isolated from sausages, was found to be HT, mainly due to the presence of ochratoxin A and two other unidentified metabolites.

  11. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    OpenAIRE

    Juan Manuel Pérez Agudelo; Juan Felipe Salazar Espinosa; Jorge Hernán Hernández Guevara

    2015-01-01

    Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20) y el grupo control fue expuesto a agua destilada (n=20) la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (...

  12. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante)

    OpenAIRE

    2000-01-01

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante), datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado. Ce travail veut presenter la décoration damasquinée trouvée sur une lance de la nécropole ibérique du Puntal (Salinas, Alicant...

  13. Circuito turístico Guayaquil – salinas – puerto cayo

    OpenAIRE

    Vaca Viteri, Maria Soledad; Ortiz Franco, Samantha

    2009-01-01

    Bajo el concepto de Circuito de Turismo, este documento, busca integrar a la cosmopolita y moderna ciudad de Guayaquil con el conjunto de balnearios que se recorre en la ruta Salinas – Puerto Cayo. Tal Circuito resultaría de gran competitividad, a nivel nacional e internacional, frente a otros destinos similares. Dado esto, la ciudad de Guayaquil y la ruta Salinas – Puerto Cayo serian un solo atractivo turístico. Otorgando a la ciudad de Guayaquil una imagen renovada para...

  14. Comprehensive Education Bolivarian-Style: The Alternative School in Barrio Pueblo Nuevo, Venezuela

    Science.gov (United States)

    Cole, Mike

    2014-01-01

    In this article, the author traces revolutionary developments in an alternative school in Barrio Pueblo Nuevo, Mérida, in the Bolivarian Republic of Venezuela, a school that caters for students between 4 and 14. He begins by recounting some fieldwork done at the school on his behalf by Edward Ellis in 2010. He goes on to discuss a video made at…

  15. Formas de matrimonio entre los antiguos celtas y otros pueblos indo-europeos

    Directory of Open Access Journals (Sweden)

    Manuel ALBERRO

    2009-12-01

    Full Text Available RESUMEN: El trabajo consiste en una descripción y examen comparativo de las prácticas matrimoniales de los celtas y otros pueblos indo-europeos, tratando de detectar similitudes y diferencias.ABSTRACT: A description and comparative examination of Celtic and Indo-european practices in the field of marriage, intended to identify similarities and differences.

  16. La Música y la Solidaridad con los Pueblos

    Directory of Open Access Journals (Sweden)

    Real, José L.

    2000-05-01

    Full Text Available Las exigencias de la Logse nos llevan cada día más y más a estar sensibilizados ante un mundo que se sale de nuestras fronteras más inmediatas. Por otro lado, cuando hablamos de "diversidad", tenemos que tener en cuenta que muy cerca de nosotros existen personas, barrios, colectivos con muchas necesidades que muchas veces pasan desapercibidas por la falta justamente de sensibilidad.A nivel educativo, nuestros objetivos y contenidos deben estar marcados por un sentido de pluralidad, de respeto por otras culturas, de implicación en los proyectos y necesidades de los que están más allá de nuestro espacio cercano, e incluso, de los que estando muy cerca de nosotros padecen las consecuencias de problemáticas graves a nivel de trabajo, social, cultural...El espíritu de la LOGSE sobre estos temas de corte transversal concreto es muy explícito. Nosotros, los educadores, tenemos una responsabilidad muy grande como transformadores de la sociedad, llevando a la práctica y a la realidad dicho espíritu.El presente trabajo por tanto, tiene como objetivo posibilitar algunas pautas básicas para la creación y organización de Unidades Didácticas y/ó actividades musicales donde se contemplen estos aspectos de tipo transversal.Por otro lado, estas Unidades y/ó actividades, logran conseguir otros objetivos educativos importantes, globalizándose contenidos de Música, con otras áreas como Conocimiento del Medio, Plástica, etc...Nos interesará seleccionar primeramente un pueblo o un barrio con unas necesidades especiales concretas, con características socio-culturales muy peculiares y curiosas. Haremos un análisis (no demasiado profundo de sus dificultades, de sus señas de identidad,... Luego podremos contrastrar nuestra realidad con la de ellos.La Música se hace en sí misma un instrumento ideal para la socialización, y por lo tanto reúne todas las características básicas ideales para enseñanza de estos contenidos de una forma

  17. Pseudomonas salina sp. nov., isolated from a salt lake.

    Science.gov (United States)

    Zhong, Zhi-Ping; Liu, Ying; Hou, Ting-Ting; Liu, Hong-Can; Zhou, Yu-Guang; Wang, Fang; Liu, Zhi-Pei

    2015-09-01

    A Gram-staining-negative, facultatively aerobic bacterium, strain XCD-X85(T), was isolated from Xiaochaidan Lake, a salt lake (salinity 9.9%, w/v) in Qaidam basin, Qinghai province, China. Its taxonomic position was determined by using a polyphasic approach. Cells of strain XCD-X85(T) were non-endospore-forming rods, 0.4-0.6 μm wide and 1.0-1.6 μm long, and motile by means of a single polar flagellum. Strain XCD-X85(T) was catalase- and oxidase-positive. Growth was observed in the presence of 0-12.0% (w/v) NaCl (optimum, 1.0-2.0%) and at 4-35 °C (optimum, 25-30 °C) and pH 6.5-10.5 (optimum, pH 8.0-8.5). Strain XCD-X85(T) contained (>10%) summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c), C12 : 0, C16 : 0 and summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) as the predominant fatty acids. The major respiratory quinone was ubiquinone 9 (Q-9). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content was 57.4 mol%. Phylogenetic trees based on 16S rRNA gene sequences showed that strain XCD-X85(T) was associated with the genus Pseudomonas, and showed highest 16S rRNA gene sequence similarities to Pseudomonas pelagia CL-AP6(T) (99.0%) and Pseudomonas bauzanensis BZ93(T) (96.8%). DNA-DNA relatedness of strain XCD-X85T to P. pelagia JCM 15562(T) was 19 ± 1%. On the basis of the data presented above, it is concluded that strain XCD-X85(T) represents a novel species of the genus Pseudomonas, for which the name Pseudomonas salina sp. nov. is proposed. The type strain is XCD-X85(T) ( = CGMCC 1.12482(T) = JCM 19469(T)).

  18. Acute toxicity of several organophosphorous insecticides and protection by cholinergic antagonists and 2-PAM on Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Sanz, F; Barahona, M V

    1996-10-01

    The acute toxicity of chlorpyrifos, methylchlorpyrifos, parathion and methylparathion to three age classes of Artemia salina was determined. In general, A. salina 24-h old was less sensitive to these organophosphorous insecticides (OPI) than A. salina 48-h old and A. salina 48-h old was significantly more tolerant than A. salina 72-h old, in contrast, chlorpyrifos was equally toxic to A. salina 48- and 72-h old. There were some differences among the three age classes of A. salina in the relative order of toxicity of OPI tested. The rank order of toxicity to A. salina 48-h old was methylparathion salina 24- and 72-h old it was methylparathion = parathion Artemia salina 24-h old was investigated. The lethal action of OPI tested was completely prevented by pretreatment of Artemia salina 24-h old with 2-PAM (10(-5) M) and atropine (10(-4 )M). However no concentration of hexamethonium, pirenzepine or AF-DX 116 protected 100% of the animals poisoned by LC84 of the OPI selected, maximum protection obtained was 71 to 88%. In contrast, the maximum inhibition of mortality obtained with AF-DX 116 pretreatment was about 55% because this compound was used at concentrations which were non toxic to control Artemia salina. Atropine, hexamethonium, pirenzepine, AF-DX 116 and 2-PAM afforded 50 % protection (IC50) of Artemia salina against mortality by LC84 of the OPI selected at concentrations in the range of 6.62x10(-7)-1.6x10(-6) M, 2. 38x10(-4)-2.05x10(-3)M, 8.91x10(-7)-1.24x10(-6) M, 9.66x10(-8)-1. 34x10(-7 )M, and 1.95x10(-8)-2.73x10(-8 )M, respectively. Pretreatment of atropine plus 2-PAM to determine whether this combination afforded greater inhibition of the lethality induced by four OPI tested than pretreatment with either atropine or 2-PAM alone was investigated. Atropine (10(-5) M) in combination with 2-PAM (10(-7 )M) inhibited completely the acute toxicity of all OPI tested, while the pretreatment with atropine (10(-6) M) plus 2-PAM at the same concentration gave a

  19. MOVIMIENTOS Y ORGANIZACIONES POLITICAS Y SOCIALES DEL PUEBLO AYMARA: EL CASO DE ARICA- PARINACOTA Y TARAPACA, CHILE. TOMO I

    OpenAIRE

    POBLETE TAPIA, DANIEL HUMBERTO

    2010-01-01

    El aymara constituye uno de los pueblos indígenas de mayor población en el área de la Cordillera de los Andes que actualmente comparten las Repúblicas de Perú, Bolivia y Chile. En Chile es el segundo pueblo indígena en número de habitantes luego de mapuche, distribuyéndose mayoritariamente en !as regiones de! norte del pais, especialmente Arica- Parinacota y Tarapacá. A pesar de su presencia como sociedad y cultura en Chile, el pueblo indígena aymara no fue reconocido como tal por el Es...

  20. Neutral lipid production in Dunaliella salina during osmotic stress and adaptation

    DEFF Research Database (Denmark)

    Yao, Shuo; Lu, Jingquan; Sárossy, Zsuzsa

    2016-01-01

    The salt-tolerant green microalga Dunaliella salina can survive both hyper- and hypo-osmotic shock. Upon osmotic shock, the cells transiently and rapidly decreased or increased in size within minutes and slowly over hours acquired their original cell size and volume. Cell size distribution differs...

  1. Podosphaera xanthii but not Golovinomyces cichoracearum infects Cucurbits in a Greenhouse at Salinas, California

    Science.gov (United States)

    Two fungal species are the primary causes of cucurbit powdery mildew (CPM): Podosphaera xanthii and Golovinomyces cichoracearum. CPM on melon (Cucumis melo L.), cucumber (C. sativus L.) and summer squash (Cucurbita pepo L.) in a greenhouse at Salinas, California in winter 2011 was confirmed to be in...

  2. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity.

  3. Antioxidant activity of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana clone Tahiti

    Science.gov (United States)

    Widowati, Ita; Zainuri, Muhammad; Pancasakti Kusumaningrum, Hermien; Susilowati, Ragil; Hardivillier, Yann; Leignel, Vincent; Bourgougnon, Nathalie; Mouget, Jean-Luc

    2017-02-01

    Natural alternatives antioxidant source has become a trending topic in the past decades to replace synthetic antioxidant. Microalgae have been mentioned to show interesting bioactive properties and one of them is its antioxidant activity. This study aims to evaluate the potential of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbanaas new source of natural antioxidant. Proximate analysis and total phenolic content of D. salina, T. chuii and I. galbanas were determined. Antioxidant activity of methanolic extracts of these three species prepared in different concentration (50, 100, 250, 500, and 1000 ppm) was performed through DPPH assay. I. galbana clone Tahiti demonstrated a highest antioxidant potential with 61.64 of inhibition at 50 ppm followed by D. salina with 58.45 % of inhibition and T. chuii with 52.58 % of inhibition. I. galbana clone Tahiti was the best antioxidant with total phenol content of 17.798 mg GAE g-1 extract at 50 ppm; followed by T. chuii 16.868 mg GAE g-1 extract and the lowest was D. salina with 4.672 mg GAE g-1 extract. Results suggest that these microalgae posses antioxidant potential which could be considered for future applications in medicine, dietary supplements, cosmetics or food industries.

  4. Hepatoprotective and antioxidant activity of dunaliella salina in paracetamol-induced acute toxicity in rats

    Directory of Open Access Journals (Sweden)

    Fedekar F Madkour

    2013-01-01

    Full Text Available Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05 increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05 decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  5. Hepatoprotective and Antioxidant Activity of Dunaliella salina in Paracetamol-induced Acute Toxicity in Rats.

    Science.gov (United States)

    Madkour, Fedekar F; Abdel-Daim, M M

    2013-11-01

    Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05) increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05) decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  6. Evaluation of the photodynamic activity of xanthene dyes on Artemia salina described by chemometric approaches.

    Science.gov (United States)

    Pellosi, Diogo S; Batistela, Vagner R; Souza, Vagner R de; Scarminio, Ieda S; Caetano, Wilker; Hioka, Noboru

    2013-01-01

    The development of drugs for photodynamic therapy (PDT) is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y) with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i) photosensitizers concentration, (ii) the LED irradiation time and (iii) the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 2³ full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  7. Mass marking of Leuciscus idus larvae using Artemia salina as a vector of fluorescent dyes.

    Science.gov (United States)

    Stańczak, K; Krejszeff, S; Dębowska, M; Mierzejewska, K; Woźniak, M; Hliwa, P

    2015-09-01

    A method for the mass marking of ide Leuciscus idus larvae by feeding them Artemia salina nauplii that were immersed in different solutions of alizarin red S, tetracycline hydrochloride and calcein was tested. The best quality marks were obtained after feeding fish for 4 days with nauplii that had been immersed in 200 mg l(-1) alizarin red S.

  8. Construction of a System for the Stable Expression of Foreign Genes in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    GENGDe-Gui; HANYan; WANGYi-Qin; WANGPeng; ZHANGLi-Ming; LIWen-Bin; SUNYong-Ru

    2004-01-01

    A stable transformation system for the expression of foreign genes in the unicellular greenmarine alga (Dunaliella salina Teod.) was established. Using electroporation, the alga was transformed witha plasmid containing the hepatitis B surface antigen (HBsAg) gene and the chloramphenicol acetyltransferase(CAT) gene as a selectable gene. PCR and Southern blotting analysis indicated that the HBsAEgene wasintegrated into the D. salina genome. Northern dotting analysis showed that the HBsAg gene was expressedat the mRNA level. The stable expression of HBsAg protein in transformants was confirmed by HBsAgenzyme-linked immunosorbent assay (HBsAg EUSA) and Western blotting analysis. Also, PCR and Southernblotting analyses showed that the CA Tgene was integrated into the D, salina genome, and CAT EUSAindicated that CAT protein was stably expressed in the cells. The introduced HBsAg DNA and HBsAgprotein expression were stably maintained for at least 60 generations in media devoid of chloramphenicol.This is the first report of the stable expression of foreign genes in D. salina.

  9. First report of plant-parasitic nematode Meloidoderita salina in the Netherlands

    NARCIS (Netherlands)

    Ashrafi, S.; Helder, J.; Elsen, van den S.J.J.; Jansen, M.; Karssen, G.

    2014-01-01

    After the description of the root-parasitic nematode Meloidoderita salina from a tidal salt marsh in France (1), an additional sampling was carried out to search for the presence of this unusual nematode in a tidal salt marsh area close to Sint-Annaland, province Zeeland in the Netherlands. In Augus

  10. Dichotomosiphon salina sp. nov. - a new marine algal form from Goa estuary, India

    Digital Repository Service at National Institute of Oceanography (India)

    Untawale, A; Jagtap, T.G.; Dhargalkar, V.K.

    A new species Dichotomosiphon salina sp. of family Vaucheriaceae has been reported from brackish water areas of Goa. The high salinity tolerance of 40 ppt and the variation in size as well as shape of the reproductive organs are the main...

  11. Evaluation of the photodynamic activity of Xanthene Dyes on Artemia salina described by chemometric approaches

    Directory of Open Access Journals (Sweden)

    Diogo S. Pellosi

    2013-10-01

    Full Text Available The development of drugs for photodynamic therapy (PDT is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i photosensitizers concentration, (ii the LED irradiation time and (iii the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 23 full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  12. Spatial scale and the diversity of benthic cyanobacteria and diatoms in a salina

    DEFF Research Database (Denmark)

    Nübel, U.; Garcia-Pichel, F.; Kühl, Michael

    1999-01-01

    We characterized the richness of benthic cyanobacteria and diatoms in a salina system using traditional and molecular biological methods. After determining the different morphotypes and 16S rRNA genes present in various localities within this hypersaline system, an analysis of the increase...

  13. RIBONUCLEASE ACTIVITY OF DUNALIELLA SALINA (CHLOROPHYTA) UNDER HYPEROSMOTIC SHOCKS

    Institute of Scientific and Technical Information of China (English)

    LuShan; ZhangXiaoning; XiaZhonghao; LiuZhili

    1998-01-01

    The unicellular green alga Dunaliella salina Teod. can acclimate to and grow over a wide range of salinities ,from that less than seawater to saturated. The alga responds to osmotic shocks by the metabolisms of intracellular glycerol,and can change the cell volume

  14. Selective extraction of carotenoids from microalga Dunadiella salina with retention of viability

    NARCIS (Netherlands)

    Hejazi, M.A.; Lamarliere, de C.; Rocha, J.M.S.; Vermuë, M.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Simultaneous production and selective extraction of -carotene from living cells of Dunaliella salina in a two-phase system of aqueous and organic phases has been investigated. Solvents with values of log Poctanol, which denotes hydrophobicity of a compound, ranging from 3 to 9 were used as organic

  15. Exploring and exploiting carotenoid accumulation in Dunaliella salina for cell-factory applications

    NARCIS (Netherlands)

    Lamers, P.P.; Janssen, M.G.J.; Vos, de C.H.; Bino, R.J.; Wijffels, R.H.

    2008-01-01

    The unicellular alga Dunaliella salina is the most interesting cell factory for the commercial production of ß-carotene because this species accumulates carotenoids to high concentrations. Nevertheless, little is known about the underlying mechanisms of carotenoid accumulation. Here, we review the

  16. Selective extraction of carotenoids from microalga Dunadiella salina with retention of viability

    NARCIS (Netherlands)

    Hejazi, M.A.; Lamarliere, de C.; Rocha, J.M.S.; Vermuë, M.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Simultaneous production and selective extraction of -carotene from living cells of Dunaliella salina in a two-phase system of aqueous and organic phases has been investigated. Solvents with values of log Poctanol, which denotes hydrophobicity of a compound, ranging from 3 to 9 were used as organic p

  17. Milking microalga Dunaliella salina for Beta-carotene production in two-phase bioreactors

    NARCIS (Netherlands)

    Hejazi, M.; Holwerda, E.; Wijffels, R.H.

    2004-01-01

    A new method was developed for production of beta-carotene from Dunaliella salina. Cells were grown in low light intensity and then transferred to a production bioreactor illuminated at a higher light intensity. It was a two-phase bioreactor consisting of an aqueous and a biocompatible organic phase

  18. Carbon source utilization by the marine Dendryphiella species D. arenaria and D. salina.

    Science.gov (United States)

    dela Cruz, Thomas Edison E; Schulz, Barbara E; Kubicek, Christian P; Druzhinina, Irina S

    2006-12-01

    Carbon utilization by the marine Dendryphiella species, D. arenaria and D. salina, was investigated to detect differences in utilization and traits associated with their adaptation to the marine habitat. Fifty-four strains were isolated world-wide and tested for the utilization of various carbon sources using BIOLOG phenotype MicroArray (PM) and for the production of extracellular enzymes on solid culture media and on API ZYM assay strips. PM analysis showed that the fastest growth occurred on several monosaccharides and amino acids, 2-keto-d-gluconic acid, succinamide and turanose. Some polyols were poor carbon sources. However, the two species differed in their utilization rates of carbon sources, forming three major clusters: two separate clusters for D. arenaria and D. salina and a third cluster in which strains of the two species formed separate subclades that correlated with geographic origin. Several carbon sources were also found useful in differentiating the two speices. Dendryphiella salina did not utilize xylitol and quinic acid, whereas D. arenaria grew well on these substrates. The latter failed to grow on sorbitol and grew slowly on mannitol, both were good substrates for the former. There were also no qualitative differences between the extracellular enzymes produced, although laccase and peroxidase activities were confined only to some strains. The physiological similarities exhibited by the two species support the close relationship between D. arenaria and D. salina.

  19. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca).

    Science.gov (United States)

    Muñoz, Joaquín; Gómez, Africa; Green, Andy J; Figuerola, Jordi; Amat, Francisco; Rico, Ciro

    2008-07-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate an early Pleistocene expansion of A. salina in the Mediterranean Basin. Subsequent population isolation in a mosaic of Pleistocene refugia is suggested, with two or three refugia located in the Iberian Peninsula. Two instances of long-distance colonization were also observed. Surprisingly, given its strong phylogeographical structure, A. salina showed a signature of correlation between geographical and genetic distance. Owing to strong 'priority effects', extensive population differentiation is retained, despite dispersal via migrant birds and human management of saltpans. The foreseeable expansion of A. franciscana is likely to be followed by substantial loss of genetic diversity in Mediterranean A. salina. Large genetic divergences between Mediterranean and South African A. salina suggest that the latter deserves species status.

  20. Garcilaso de la Vega y Pedro Salinas: la voz a ti debida

    Directory of Open Access Journals (Sweden)

    Escarpín Gual, Montserrat

    2008-12-01

    Full Text Available This paper shows the relationship between two Spanish writers: Garcilaso de la Vega and Pedro Salinas; or better, the influence of the former over the latter. This influence may be noticed in different levels: the use of literary genres (eclogues, elegies or collections of verse, the conception of love, the use of myths and topics, the music of verse, etc. Some characteristics of Salinas’s style come clearly from Garcilaso (the intimacy, simplicity, orality, the dialogue, the use of the present tense and the first person, etc.. Our essay studies the influence of Garcilaso on the book Largo lamento, 1937?, written by Salinas at the same time as an essay about the renaissance poet —in addition of other unpublished works and his personal correspondence—, in order to show the presence of Garcilaso in his mind and all of his production.El artículo muestra la relación entre dos escritores españoles: Garcilaso de la Vega y Pedro Salinas; o mejor, la influencia del primero sobre el segundo. Esta puede observarse en diferentes niveles: el uso de géneros literarios (églogas, elegías o cancioneros, la concepción del amor, el uso de mitos y tópicos, la música del verso, etc. Algunas características del estilo de Salinas proceden claramente de Garcilaso (el intimismo, la sencillez, la oralidad, el empleo del diálogo, el presente verbal, la primera persona, etc.. Nuestro ensayo estudia la incidencia de Garcilaso en el libro Largo lamento, 1937?, que Salinas escribió en paralelo a un ensayo sobre el poeta renacentista —además de otros trabajos inéditos y su correspondencia personal—, para mostrar la presencia de Garcilaso en su pensamiento y en su producción.

  1. DINÁMICA SOCIODEMOGRÁFICA DE LOS PUEBLOS RURALES DE LA LINEA SUR RIONEGRINA.

    Directory of Open Access Journals (Sweden)

    Mónica Bendini

    2008-12-01

    Full Text Available Desde hace décadas, mucho se ha hablado acerca del despoblamiento del campo. Si bien los datos censales muestran que la población rural total y dispersa ha disminuido en el último período intercensal, la población rural agrupada, aumentó. Este proceso se traduce en pérdida absoluta y relativa de habitantes de algunos parajes y localidades, y en el crecimiento inusual de otros. En este sentido, pueden identificarse dinámicas diferenciales de pueblos rurales con desigual evolución demográfica de acuerdo a las características de los sistemas productivos y las posibilidades de trabajo no agrario. Surge así la necesidad de explorar qué ocurre con los pueblos y la población rural en un extenso territorio rionegrino, la Línea Sur. El significado social que adquieren estos pueblos y parajes rurales, permitió definir el foco de análisis de esta ponencia: comprender los cambios que están atravesando estas comunidades y la población rural, indagando tendencias diferenciales que den cuenta del crecimiento o del decrecimiento de pueblos y parajes rurales. Pensamos que la categoría pueblo rural representa una categoría suficientemente persistente como para hacer significativo su estudio. Esto nos lleva a intentar acercarnos al mundo sociodemográfico de los pueblos rurales de esa región rionegrina que, durante décadas, se caracterizó por la pérdida de población o por un bajo crecimiento demográfico ligado a las crisis de la principal actividad, la ganadería extensiva. Desde el punto de vista metodológico se trabaja con fuentes de datos secundarias -información censal, bibliografía y artículos periodísticos- y primarias - entrevistas a pobladores e informantes calificados.

  2. Reproductive structures of Rhamnaceae from the Cerro del Pueblo (Late Cretaceous, Coahuila) and Coatzingo (Oligocene, Puebla) Formations, Mexico

    National Research Council Canada - National Science Library

    Calvillo-Canadell, Laura; Cevallos-Ferriz, Sergio R. S

    2007-01-01

    .... Coyoacan, 04510 México D.F., Mexico Recently discovered fossil flowers from the Cretaceous Cerro del Pueblo and flowers and fruits from the Oligocene Coatzingo Formations are assigned to the Rhamnaceae...

  3. La columna, el circulo y sus variantes en la poesia primera de Pedro Salinas (The Vertical Line, the Circle, and other Geometric Varieties in the Early Poetry of Pedro Salinas)

    Science.gov (United States)

    De Armas, Jose R.

    1970-01-01

    Interprets Salinas' use of geometric figures for depicting concepts of time and infinity, and for portraying idealism and realism (the vertical line is idealism, perfection; the circle stands for reality and imperfection). (DS)

  4. La columna, el circulo y sus variantes en la poesia primera de Pedro Salinas (The Vertical Line, the Circle, and other Geometric Varieties in the Early Poetry of Pedro Salinas)

    Science.gov (United States)

    De Armas, Jose R.

    1970-01-01

    Interprets Salinas' use of geometric figures for depicting concepts of time and infinity, and for portraying idealism and realism (the vertical line is idealism, perfection; the circle stands for reality and imperfection). (DS)

  5. Pueblo Folklore, Landscape Phenomenology and the Visual Poetics of Fajada Butte

    Science.gov (United States)

    Carey, C.

    2009-08-01

    In the interest of reexamining the site of Fajada Butte in Chaco Canyon, this paper seeks to recontextualize discussions of its controversial spiral petroglyphs and astronomical phenomena (Sun Daggers) with reference to landscape phenomenology, visual and literary poetics, and the astronomical orientation of contemporary Pueblo ceremonial practices. The dearth of recent scholarship on Fajada Butte may have arisen from the many controversial arguments about its function from a variety of disciplinary locations including archaeology, anthropology, geology, and archeoastronomy. Via an emphasis on the physical landscape, storytelling, contemporary ceremonial practices and ancestral ties to Chaco Canyon, the Zuni and Hopi pueblos provide a context for re-examining the astronomical phenomena of Fajada Butte as a natural shrine of the of Chacoan culture and repository of an array of symbolic content.

  6. La religión de los pueblos de la Hispania Prerromana

    Directory of Open Access Journals (Sweden)

    J. M. BLÁZQUEZ

    2009-10-01

    Full Text Available La religión de los pueblos de la Hispania prerromana es mal conocida. Acerca de ella se ha recuperado abundante material arqueológico, más es difícil de interpretar por no disponer apenas de fuentes literarias. Tan sólo se conoce una mención referida a los pueblos del Norte, en Estrabón (3. 3. 7, que indica que a un dios, que el geógrafo griego, contemporáneo de Augusto, identifica con el Ares griego: «sacrifican machos cabríos, caballos y prisioneros. Suelen hacer hecatombes de cada especie de víctimas, al uso griego, y por decirlo así, al modo de Píndaro, inmolan todo un centenar».

  7. José Martí, Viajes y Apreciación del Pueblo Maya

    OpenAIRE

    Carlos Eduardo Bojórquez Urzaiz

    2015-01-01

    Este trabajo expone y examina los cambios de percepción que experimentó José Martí sobre el papel de los pueblos originarios de América, entre 1875 y 1878, años en los que vivió en México y Guatemala, con intensa escala en Yucatán, lugares donde conoció directamente la cultura y el pueblo maya. Martí resume una visión inicial de nuestra América en la figura lítica de Chacmool cuando después de ser expropiada por el gobierno yucateco, el Apóstol cubano la admira en la ciudad de Mérida y expres...

  8. La representación del pueblo en el segundo romanticismo mexicano

    Directory of Open Access Journals (Sweden)

    Carlos Illades

    2003-01-01

    Full Text Available Este artículo analiza las diferentes interpretaciones del término pueblo, un importante tema del pensamiento romántico mexicano y elemento constitutivo de la nación, mediante diversas obras representativas de esa corriente literaria, (de autores destacados como Guillermo Prieto, Nicolás Pizarro, Vicente Riva Palacio, Alberto G. Bianchi, Ignacio M. Altamirano, Manuel Payno y José Tomás de Cuéllar con el fin de conocer sus diferentes acepciones y el matiz social que el romanticismo le imprimió al significado político de pueblo, así como destacar la construcción de estereotipos sociales de la época, entre ellos el héroe popular y el artesano honrado.

  9. Presencia de un pueblo : reminiscencias de la ciudad de San Gil del doctor Rito Rueda Rueda

    Directory of Open Access Journals (Sweden)

    Victor Emilio Jara

    1968-04-01

    Full Text Available La muy noble y muy leal Villa de Santa Cruz y San Gil de la Nueva Baeza en el Reino de Granada aparece con su acta de fundación en el libro Presencia de un pueblo, del que es autor el historiador y abogado doctor Rito Rueda Rueda, quien presenta la fausta efemérides con la totalidad del documento de fundación del que transcribimos esta muestra...

  10. Presentación. Etnicidad y pueblos indígenas

    Directory of Open Access Journals (Sweden)

    AIBR. Consejo de Redacción

    2006-05-01

    Full Text Available Con este número, AIBR vuelve a poner en el centro de su publicación cuestiones ligadas con los pueblos indígenas y la etnicidad. Indiscutiblemente, la antropología no sería la ciencia que es hoy en día sin los estudios que se realizaron durante buena parte del siglo XX con comunidades indígenas. Los textos seleccionados para este número, no obstante, intentan mostrar formas más contemporáneas –e igualitarias- de estudiar temas ligados a los pueblos indígenas y a la etnicidad. En el proceso de preparación del número se intentó evitar los estudios culturalistas sobre pueblos indígenas, las generalizaciones del tipo “los xxx son” y, sobre todo, se ha buscado mostrar a los pueblos indígenas como agentes históricos, motores de cambio, heterogéneos y activos en su propia historia. Destacan especialmente los artículos escritos por académicos de universidades chilenas (un total de cuatro. El motivo que nos llevo a seleccionar tan amplia representación chilena fue mostrar que incluso en aquellos países de Latinoamérica donde la presencia indígena ha sido tradicionalmente discriminada y minoritaria, los antropólogos son también activos en su recuperación.

  11. Field Demonstration/Validation of Electrolytic Barriers for Energetic Compounds at Pueblo Chemical Depot

    Science.gov (United States)

    2010-01-01

    quantification limit PCD Pueblo Chemical Depot PID photoionization detector PI Principal Investigator PRB permeable reactive barrier PVC Polyvinyl...substrate (lactate) immediately downgradient of the former ponds • Injection of additional emulsified vegetable oil in a series of 10-20 transects...Sale (Wyoming PG-1954). Monitoring wells were constructed of 1-inch PVC pipe and 10-slot well screens. A 20-40 quartz filter sand was installed

  12. [Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, Salinas River National Wildlife Refuge: Annual Narrative Report: Calendar Year 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, and Salinas River National Wildlife Refuge outlines...

  13. Salt-induced redox-independent phosphorylation of light harvesting chlorophyll a/b proteins in Dunaliella salina thylakoid membranes.

    Science.gov (United States)

    Liu, Xian-De; Shen, Yun-Gang

    2005-02-17

    This study investigated the regulation of the major light harvesting chlorophyll a/b protein (LHCII) phosphorylation in Dunaliella salina thylakoid membranes. We found that both light and NaCl could induce LHCII phosphorylation in D. salina thylakoid membranes. Treatments with oxidants (ferredoxin and NADP) or photosynthetic electron flow inhibitors (DCMU, DBMIB, and stigmatellin) inhibited LHCII phosphorylation induced by light but not that induced by NaCl. Furthermore, neither addition of CuCl(2), an inhibitor of cytochrome b(6)f complex reduction, nor oxidizing treatment with ferricyanide inhibited light- or NaCl-induced LHCII phosphorylation, and both salts even induced LHCII phosphorylation in dark-adapted D. salina thylakoid membranes as other salts did. Together, these results indicate that the redox state of the cytochrome b(6)f complex is likely involved in light- but not salt-induced LHCII phosphorylation in D. salina thylakoid membranes.

  14. Arsenate toxicity and metabolism in the halotolerant microalga Dunaliella salina under various phosphate regimes.

    Science.gov (United States)

    Wang, Ya; Zheng, Yanheng; Liu, Cong; Xu, Pingping; Li, Hao; Lin, Qiaoyun; Zhang, Chunhua; Ge, Ying

    2016-06-15

    Microalgae play an important role in arsenic (As) biogeochemical cycles as they are capable of accumulating and metabolizing this metalloid efficiently. This study aimed to investigate the toxicity, accumulation and transformation of arsenate (As(v)) in Dunaliella salina, an exceptionally halotolerant microalga, under various phosphate (PO4(3-)) regimes. The results of the 72-h toxicity test showed that D. salina was tolerant to As(v). In addition, the toxicity of As(v) was mitigated by an increased PO4(3-) supply. D. salina resisted the adverse effects of As(v) through the suppression of As uptake, enhancement of As reduction, methylation in the cell and excretion from the cell. Our study revealed that D. salina reduced As(v) toxicity using different strategies, i.e., reduction of As uptake upon acute As stress (24 h) and increase of As efflux following chronic As exposure (9 day). Moreover, PO4(3-) strongly affected the adsorption, uptake and transformation of As(v) in D. salina. As(v) reduction, DMA production and As excretion were enhanced under P-limited conditions (0.112 mg L(-1)) or upon higher As(v) exposure (1120 μg L(-1)). Furthermore, PO4(3-) had a significant influence on the As removal ability of D. salina. A high As removal efficiency (>95.6%) was observed in the 5-day cultures at an initial As concentration of 11.2 μg L(-1) and PO4(3-) of 0.112 and 1.12 mg L(-1). However, only 10.9% of total As was removed under 11.2 mg L(-1) PO4(3-) after 9 days of incubation. The findings of this study illustrate the pivotal roles of extracellular PO4(3-) in As(v) toxicity and metabolism, and the results may be relevant for future research on the minimization of As contamination in algal products as well as on the enhancement of As removal from the environment.

  15. Imaging Faults with Reverse-Time Migration for Geothermal Exploration at Jemez Pueblo in New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Lianjie [Los Alamos National Laboratory; Albrecht, Michael [TBA Power; Kaufman, Greg [Jemez Purblo; Kelley, Shari [NM Bureau of Geology and Mineral Researces; Rehfeldt, Kenneth [Los Alamos National Laboratory; Zhang, Zhifu [EES-17 visitor

    2011-01-01

    The fault zones at Jemez Pueblo may dominate the flow paths of hot water, or confine the boundaries of the geothermal reservoir. Therefore, it is crucial to image the geometry of these fault zones for geothermal exploration in the area. We use reverse-time migration with a separation imaging condition to image the faults at Jemez Pueblo. A finite-difference full-wave equation method with a perfectly-matching-layer absorbing boundary condition is used for backward propagation of seismic reflection data from receivers and forward propagation of wavefields from sources. In the imaging region, the wavefields are separated into the upgoing and downgoing waves, and leftgoing and rightgoing waves. The upgoing and downgoing waves are used to obtain the downward-looking image, and the leftgoing and rightgoing waves are used to form the left-looking image and right-looking image from sources. The left-looking and right-looking images are normally weaker than the downward-looking image because the reflections from the fault zones are much weaker than those from sedimentary layers, but these migration results contain the images of the faults. We apply our reverse-time migration with a wavefield separation imaging condition to seismic data acquired at Jemez Pueblo, and our preliminary results reveal many faults in the area.

  16. Sandals as Icons: Representations in Ancestral Pueblo Rock Art and Effigies in Stone and Wood

    Directory of Open Access Journals (Sweden)

    Polly Schaafsma

    2016-10-01

    Full Text Available Dating the late 1000s to the mid-1200s CE, petroglyphs of sandal images are among others that distinguish ancient Pueblo rock art in the San Juan and Little Colorado River drainages on the Colorado Plateau from Ancestral Pueblo rock art elsewhere across the Southwest. The sandal “track” also has counterparts  as effigies in stone and wood often found in ceremonial contexts in Pueblo sites. These representations reflect the sandal styles of the times, both plain in contour and the jog-toed variety, the latter characterized by a projection where the little toe is positioned. These representations are both plain and patterned,  as are their material sandal counterparts. Their significance  as symbolic icons is their dominant aspect, and a ritual meaning is implicit.  As a component of a symbol system that was radically altered after 1300 CE, however, there is no ethnographic information that provides clues as to the sandal icon’s meaning. While there is no significant pattern of its associations with other symbolic content in the petroglyph panels, in some western San Juan sites cases a relationship to the hunt can be inferred. It is suggested that the track itself could refer to a deity, a mythological hero, or the carver ’s social identity. In conclusion, however, no clear meaning of the images themselves is forthcoming, and further research beckons.

  17. Radionuclide concentrations in soils and produce from Cochiti, Jemez, Taos, and San Ildefonso Pueblo Gardens

    Energy Technology Data Exchange (ETDEWEB)

    Fresquez, P.R.; Armstrong, D.R.; Salazar, J.G.

    1995-05-01

    Radionuclide ({sup 3}H, {sup 90}Sr, {sup 137}Cs, {sup 238}Pu, {sup 239}Pu, and total uranium) concentrations were determined in soils and produce collected from Cochiti, Jemez, Taos, and San Ildefonso Pueblo gardens. All radionuclides in soils from Pueblo areas were within or just above regional statistical (natural and/or worldwide fallout) reference levels. Similarily, the average levels of radionuclides in produce collected from Cochiti, Jemez, Taos, and San Ildefonso Pueblo gardens were not significantly different in produce collected from regional (background) locations. The effective (radiation) dose equivalent from consuming 352 lb of produce from Cochiti, Jemez, Taos, and San Ildefonso, after natural background has been subtracted, was 0.036 ({+-}0.016), 0.072 ({+-}0.051), 0.012 ({+-}0.027), and 0.110 ({+-}0.102) mrem/yr, respectively. The highest calculated dose, based on the mean + 2 std dev (95% confidence level), was 0.314 mrem/yr; this was <0.4% of the International Commission on Radiological Protection permissible dose limit for protecting members of the public.

  18. UN PRIVILEGIO PARA EL ESTADO DE MICHOACÁN: SUS PUEBLOS MÁGICOS

    Directory of Open Access Journals (Sweden)

    Horacio Mercado Vargas

    2013-06-01

    Full Text Available El Estado de Michoacán, que se ubica en la parte del extremo sur occidental de México, posee paisajes muy hermosos: de bosques, praderas y lagunas de gran belleza, montañas y volcanes que descienden hacia el mar. Es uno de los más ricos en recursos naturales. La Secretaría de Turismo, diversas entidades del gobierno federal y gobiernos estatales y municipales desarrollaron el Programa de Pueblos Mágicos, para darle un valor a ciertas poblaciones del país que tienen características culturales y que llaman la atención de los visitantes mexicanos y extranjeros. Michoacán es una entidad que por sus características culturales, se distingue del resto de las entidades, y por ello es el estado con mayor número de Pueblos Mágicos en todo el país. La belleza y cultura de Michoacán se puede constatar en sus Pueblos Mágicos, que siempre recordarán los visitantes. Sus formas, colores y tradiciones son expresiones de un pasado lleno de gloria que se manifiesta en el presente.

  19. Variation in fatty acid composition of Artemia salina nauplii enriched with microalgae and baker's yeast for use in larviculture.

    Science.gov (United States)

    Chakraborty, Rekha D; Chakraborty, Kajal; Radhakrishnan, E V

    2007-05-16

    The high content of the essential fatty acids in some microalgae and baker's yeast has made them excellent diets for boosting the fatty acid content of livefood Artemia. The influences of baker's yeast (Saccharomyces cerevisiae) and three microalgae, viz., Chlorella salina, Chaetoceros calcitrans, and Nannochloropsis salina, were tested as diet components in marine livefeed brine shrimp Artemia salina nauplii to improve the polyunsaturated fatty acid (PUFA) composition. Artemia nauplii submerged in these diets for four different enrichment intervals (3, 6, 8, and 24 h) were found to incorporate essential fatty acids, and the percentage composition of different fatty acids was measured in the enriched Artemia nauplii and enrichment diets. N. salina produced higher levels of arachidonic acid (AA, 20:4n6, 9.50%), eicosapentaenoic acid (EPA, 20:5n3, 25.80%), and docosahexaenoic acid (DHA, 22:6n3, 4.18%) as compared to other diets. The total PUFA content of the enriched Artemia by N. salina increased by 56.50% with enrichment periods up to 8 h, followed by a significant reduction in the final 24 h. N. salina yielded Artemia nauplii with considerable EPA (8.05%), AA (14.15%), and DHA (1.85%) after 8 h of enrichment, which are significantly higher levels than in nauplii fed with the other three diets (p = 0.05). The DHA/EPA values in Artemia enriched for 6 h by N. salina and C. calcitrans were found to be, respectively, 88.46 and 25% higher than freshly hatched Artemia. Artemia enriched by C. salina and baker's yeast exhibited a reduction in PUFA content even at 6 h of enrichment. Significant relative decreases in DHA, EPA, and total PUFA in Artemia enriched with all of the diets were apparent, with a corresponding increase in the total saturated fatty acid content (26.95 +/- 9.75%) in the final stages (24 h) of enrichment (p = 0.05).

  20. Can the halophilic ciliate Fabrea salina be used as a bio-control of microalgae blooms in solar salterns?

    Science.gov (United States)

    Hong, Hyun Pyo; Choi, Joong Ki

    2015-09-01

    The microlage Dunaliella salina, a major producer in salterns, is a serious problem for salt production. In this study we tried to assess if Fabrea salina can control D. salina. By parameterising numerical and functional response (growth and grazing vs prey abundance, respectively) at 90 psu and 30°C, where the ciliate is abundant and grows well, we developed a predator-prey model. The model is used to explore how change in microalga growth rate affect the dynamics, and the functional response is used in combination with field data to assess the potential impact of F. salina on D. salina. Over the 20 d simulation the ciliate controlled the prey population under all prey growth rates; although once D. salina were exhausted below the threshold level, F. salina died due to starvation, allowing the alga to increase in abundance, resulting in one or two predatorprey cycle, depending on prey growth rate. In general, the model predicted trends observed by others in the field, suggesting that it provided a good prediction of what may occur under the conditions we examined. Likewise we show that the ciliate can have a high impact on microalgal populations in the field. Finally, a literature review indicated that F. salina could be a good competitor with other protozoa and metazoan in salterns, depending on salinity and temperature, which requires further study and attention. In summary, we encourage continued studies on this unique ciliate on solar salterns and suggest that it may be useful in the bio-control of micoalgae.

  1. Una pequeña historia el cine: Sergio Salinas, promotor de la cultura cinematográfica en Chile

    OpenAIRE

    Hans Stange-Marcus; Claudio Salinas-Muñoz

    2013-01-01

    El crítico de cine Sergio Salinas afirmaba que no existen películas de arte sino "espacios" de arte, que propician una apreciación reflexiva y crítica de los filmes. El ensayo revisa tres de estos espacios desarrollados por el propio Salinas en Santiago de Chile: el cine club Nexo y las salas de cine arte Toesca y Normandie.

  2. Ocupation and movilization in Patagonia rural towns: An agrarian point of view Ocupaciones y movilidades en pueblos rurales de la Patagonia: Una mirada desde lo agrario

    Directory of Open Access Journals (Sweden)

    Mónica Bendini

    2011-01-01

    Full Text Available The study of occupations and mobilities in rural towns introduces us to the relationship between agriculture and rurality, and to "the" rural as non residual space in front of "the" modern and "the" urban. A related question has to do with the centering/des-centering of the agro, either by monoactivity or by the main occupation in case of multiple occupations, as well as the form taken by the relations between countryside (rural scattered and town (rural aglomerated. On the other hand, it relates to the nature of the rural world as social space, differentiated and built, a place of life and work. From a glance that makes visible the role of the agro in the rural, we show diverse occupational nets and displacements from case studies which exemplify the issues raised: two rural towns with variability in agro development and the social organization of agriculture. On the one hand, it is a rural town with high population growth located in an area of agricultural expansion, with company scale organization, predominance of wage relations of production and agricultural occupations, mostly important presence of seasonal migrant workers. On the other hand, a rural town located in a region historically marginal and slow down, sparsely populated, in an area of plateau dedicated to extensive livestock breeding where there coexist large farms and peasant units; recent population growth, traditional agro occupations and pluriactivity also traditional. The empirical research show the diverse spatial movements, the occupations and their forms of combination, the principality of the agro activity and related ones, and the consequent identity character of those towns. The findings lead us to raise the issue of the breakdown of the single occupation and of the complexity of the link countryside - town. The nowadays concern of the agro in the rural, and of the rural "living" towns, are matters that new rurality and globalization issues have been sometimes

  3. Building Chinese Cars in Mexico: The Grupo Salinas-FAW Alliance

    Directory of Open Access Journals (Sweden)

    Álvaro Cuervo-Cazurra

    2014-09-01

    Full Text Available Ricardo Salinas Pliego was the CEO of Grupo Salinas, one of the largest business groups in Mexico, and in 2009 he faced a challenge. Two years earlier, he had negotiated with the Chinese car company FAW to import Chinese cars into Mexico as an initial step towards their manufacturing. However, the global crisis of 2008 made him question the viability of the project and he had to decide whether to close the operation or continue in the hope of a quick recovery. This was a difficult decision because the group had sold several thousand cars and established a network of car dealers. Closing the operation would mean not only losing the investment in the network while having to continue servicing the cars, but would also result in a blow to the reputation of the group. He was pondering what the best option would be.

  4. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract.

  5. Facile sand enhanced electro-flocculation for cost-efficient harvesting of Dunaliella salina.

    Science.gov (United States)

    Xiong, Qiong; Pang, Qi; Pan, Xinwei; Chika, A Okonkwo; Wang, Liqing; Shi, Jia; Jia, Lishan; Chen, Changping; Gao, Yahui

    2015-01-01

    Energy consumption and water resource in the cultivation and harvesting steps still need to be minimized for the popularization of the microalgae-based products. An efficient electro-flocculation method for harvesting Dunaliella Salina integrated with local sand has been successfully applied. Sand was effective for speeding up the processes of flocculation and sedimentation of algal flocs and the electrolytic hydroxides was essential to bridge the sand and small flocs into large dense flocs. The maximal recovery effective improved from 95.13% in 6min to 98.09% in 4.5min and the optimal electrical energy consumption decreased 51.03% compared to conventional electro-flocculation in a laboratory ambient condition. Furthermore, reusing the flocculated medium in cultivation of the D. Salina with nitrogen supplemented performed no worse than using fresh medium. This sand enhanced electro-flocculation (SEF) technology provides a great potential for saving time and energy associated with improving microalgae harvesting.

  6. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  7. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Folgar, S. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Torres, E., E-mail: torres@udc.es [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Perez-Rama, M.; Cid, A.; Herrero, C.; Abalde, J. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain)

    2009-06-15

    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l{sup -1}) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l{sup -1} at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l{sup -1} at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  8. Neutron flow exposure as a test for survival of Artemia salina spores.

    Science.gov (United States)

    Matveeva, I S; Smirnov, A N; Vodennikov, B D; Popov, I M; Semenov, D S; Kolesnikov, M V; Syroeshkin, A V

    2004-11-01

    Live and heat-inactivated Artemia salina spores (samples with the same mass and filling density) were exposed to a flow of thermal neutrons from a (252)Cf radioactive source at an equivalent dose power of about 1 microSv/h. Irradiation led to a 4-fold acceleration of nauplius development and to modification of the element profiles of live spores. The difference between absorption/diffusion of thermal neutrons by live and dead spores was revealed.

  9. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante

    Directory of Open Access Journals (Sweden)

    Hernández Alcaraz, Laura

    2000-12-01

    Full Text Available Not Available

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante, datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado.

  10. Assessment of toxicity of Moringa oleifera flower extract to Biomphalaria glabrata, Schistosoma mansoni and Artemia salina.

    Science.gov (United States)

    Rocha-Filho, Cláudio A A; Albuquerque, Lidiane P; Silva, Luanna R S; Silva, Patrícia C B; Coelho, Luana C B B; Navarro, Daniela M A F; Albuquerque, Monica C P A; Melo, Ana Maria M A; Napoleão, Thiago H; Pontual, Emmanuel V; Paiva, Patrícia M G

    2015-08-01

    This study reports the effect of an aqueous extract from Moringa oleifera Lam. flowers on Biomphalaria glabrata embryos and adults and on Schistosoma mansoni adult worms. The extract contains tannins, saponins, flavones, flavonols, xanthones, and trypsin inhibitor activity. The toxicity of the extract on Artemia salina larvae was also investigated to determine the safety of its use for schistosomiasis control. After incubation for 24h, the flower extract significantly (p<0.05) delayed the development of B. glabrata embryos and promoted mortality of adult snails (LC50: 2.37±0.5mgmL(-1)). Furthermore, treatment with the extract disrupted the development of embryos generated by snails, with most of them remaining in the blastula stage while control embryos were already in the gastrula stage. Flower extract killed A. salina larvae with a LC50 value (0.2±0.015mgmL(-1)) lower than that determined for snails. A small reduction (17%) in molluscicidal activity was detected when flower extract (2.37mgmL(-1)) was exposed to tropical environmental conditions (UVI index ranging from 1 to 14, temperature from 25 to 30°C, and 65% relative humidity). Toxicity to A. salina was also reduced (LC50 value of 0.28±0.01mgmL(-1)). In conclusion, M. oleifera flower extract had deleterious effects on B. glabrata adults and embryos. However, unrestricted use to control schistosomiasis should be avoided due to the toxicity of this extract on A. salina.

  11. On the motility of living invertebrates The case of Artemia Salina

    Science.gov (United States)

    Huerta, R.; Hernández, A.; Alvarado-Gil, J. J.

    1998-08-01

    Using a laser beam deflection technique a non-destructive and non-invasive method is developed. This method is applied to monitor the motility of small invertebrates, in particular we study the important case of the crustacean Artemia Salina and the motion of its different parts. We find out that its dynamics can be explained as a superposition of several periodic motions with very well defined frequencies.

  12. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii.

    Science.gov (United States)

    Kokkali, Varvara; Katramados, Ioannis; Newman, Jeffrey D

    2011-03-28

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by a motion tracking algorithm that estimated their mobility. The results obtained by this system were compared to the mortality assay of the Artemia salina nauplii. Despite the small number of tested organisms, this system demonstrates great sensitivity in quantifying the mobility of the nauplii, which leads to significantly lower EC50 values than those of the mortality assay. Furthermore, concentrations of parts per trillion of toxic compounds could be detected for some of the metals. The main novelty of this instrument relies in the sub-pixel accuracy of the tracking algorithm that enables robust measurement of the deterioration of the mobility of Artemia salina even at very low concentrations of toxic metals.

  13. Chronic toxicity bioassay with populations of the crustacean Artemia salina exposed to the organophosphate diazinon.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Vargas, Alvaro

    2010-01-01

    A chronic toxicity bioassay was conducted with the microcrustacean Artemia salina as the testing organism for the toxic organophosphate diazinon in order to determine if the species is an appropriate indicator of pollution in aquatic environments. Tests of animal exposure to different concentrations of the toxicant were performed for 24, 48 and 72 hours after larvae hatching. Registered mortality data was used to obtain the lethal dose 50 (LD50) of the organophosphate for each exposure time, considering the immobilization of A. salina larvae as the mortality parameter. The lethal concentration (LD50) in the same exposure times was calculated by evaluating morphological changes on the three initial stages of larval development. Both doses were determined by using probit statistical analysis. Results indicate greater dose-response exactitude after 24 hours of exposure to the toxicant. High sensitivity of the organism to the toxicant was determined, thus indicating that A. salina is an appropriate ecotoxicological bioindicator of aquatic environments polluted with pesticides, with the special consideration that this species is a natural resident of saline water bodies, and thus could be used to control pollution in these environments as a result of the unrestrained usage of such toxic substances.

  14. Toxicity and characterization of cholinesterase-inhibition induced by diisopropyl fluorophosphate in Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, M V

    2009-03-01

    The acute toxicity of diisopropyl fluorophosphate (DFP) on three age classes of Artemia salina was evaluated. An increase in toxicity of this organophosphorous (OP) compound was found following longer development of A. salina larvae. The effects of pretreatment with the non-selective muscarinic antagonist atropine, the two reversible acetylcholinesterase inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on DFP-induced lethality in 24h Artemia were also investigated. The lethal action of DFP was not prevented by pretreatment of 24h Artemia with atropine, physostigmine, and pyridostigmine, while 2-PAM proved effective against intoxication with this OP compound. The inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM or physostigmine were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Pretreatment with 2-PAM (10(-6)M) plus physostigmine or pyridostigmine was ineffective. These results suggest that the combinations of atropine plus 2-PAM or physostigmine are effective in the prevention of the lethal effects induced by DFP in A. salina larvae.

  15. Hydrothermal liquefaction of Spirulina and Nannochloropsis salina under subcritical and supercritical water conditions.

    Science.gov (United States)

    Toor, Saqib S; Reddy, Harvind; Deng, Shuguang; Hoffmann, Jessica; Spangsmark, Dorte; Madsen, Linda B; Holm-Nielsen, Jens Bo; Rosendahl, Lasse A

    2013-03-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220–375 °C, 20–255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid residue, and recycling process water for algae cultivation. GC–MS, elemental analyzer, FT-IR, calorimeter and nutrient analysis were used to analyze bio-crude, lipid-extracted algae and water samples produced in the hydrothermal liquefaction process. The highest bio-crude yield of 46% was obtained on N. salina at 350 °C and 175 bar. For S. platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for N. salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae solid residue sample obtained in the hydrothermal liquefaction process contains a high level of proteins.

  16. Estimated natural streamflow in the Rio San Jose upstream from the pueblos of Acoma and Laguna, New Mexico

    Science.gov (United States)

    Risser, D.W.

    1982-01-01

    The development of surface and ground water, which began about 1870 in the upper Rio San Jose drainage basin, has decreased the flow of the Rio San Jose on the Pueblo of Acoma and the Pueblo of Laguna. The purpose of this study was to estimate the natural streamflow in the Rio San Jose that would have entered the pueblos if no upstream water development had taken place. Estimates of natural flow were based upon streamflow and precipitation records, historical accounts of streamflow, records of irrigated acreage, and empirically-derived estimates of the effects on streamflow of Bluewater Lake, groundwater withdrawals, and irrigation diversions. Natural streamflow in the Rio San Jose at the western boundary of the Pueblo of Acoma is estimated to be between 13,000 and 15,000 acre-feet per year, based on 55 years of recorded and reconstructed streamflow data from water years 1913 to 1972. Natural streamflow at the western boundary of the Pueblo of Laguna is estimated to be between 17 ,000 and 19,000 acre-feet per year for the same period. The error in these estimates of natural streamflow is difficult to assess accurately, but it probably is less than 25 percent. (USGS)

  17. Environmental analysis of Acid/middle Pueblo Canyon, Los Alamos, New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ferenbaugh, R.W.; Buhl, T.E.; Stoker, A.K.; Hansen, W.R.

    1982-08-01

    The radiological survey of the former radioactive waste treatment plant site (TA-45), Acid Canyon, and Pueblo Canyon found residual radioactivity at the site itself and in the channel and banks of Acid, Pueblo, and lower Los Alamos Canyons, all the way to the Rio Grande. The largest reservoir of radioactive material is in lower Pueblo Canyon, which is on DOE property. The only areas where residual radioactivity exceeds the proposed cleanup criteria are at the former vehicle decontamination facility, located between the former treatment plant site and Acid Canyon, around the former untreated waste outfall and for a short distance below, and in two small areas farther down in Acid Canyon. The three alternatives proposed are (1) to take no action, (2) to fence the areas where the residual radioactivity exceeds the proposed criteria (minimal action), and (3) to clean up the former vehicle decontamination facility and around the former untreated waste outfall. Calculations based on actual measurements indicate that the annual dose at the location having the greatest residual radioactivity would be about 12% of the applicable guideline. Most doses are much smaller than that. No environmental impacts are associated with either the no-action or minimal action alternatives. The impact associated with the cleanup alternative is very small. The preferred alternative is to clean up the areas around the former vehicle decontamination facility and the untreated waste outfall. This course of action is recommended not because of any real danger associated with the residual radioactivity, but rather because the cleanup operation is a minor effort and would conform with the ALARA (as low as reasonably achievable) philosophy.

  18. COMUNIDAD AGRARIA Y AUTONOMÍAS PARA EL PUEBLO MAPUCHE (1953-1972.

    Directory of Open Access Journals (Sweden)

    AUGUSTO SAMANIEGO MESÍAS

    2011-10-01

    Full Text Available Alejandro Lipschutz Friedman (1883-1980, medico y fisiólogo nacido en Letonia, adquirió la nacionalidad chilena luego de llegar al país contratado por la Universidad de Concepción (1926. Publicó su primer libro étno-histórico en 1935, sobre indoamericanismo. Fue reconocido internacionalmente como fisiólogo y el Estado de Chile le otorgó, por primera vez, el Premio Nacional de Ciencias. Participó en la fundación del Instituto Indigenista Inter-americano y su correspondiente en Chile. Desde los ’50 interpretó la comunidad indígena con el método marxista y expuso una visión concreta del reconocimiento étnico y del futuro de los pueblos originarios en el Estado nacional. Gran parte de sus estudios abordaron las políticas del indigenismo y fue impulsor del desarrollo del llamado indianismo. Hacia 1972, en el Chile de Allende, culminó su vida intelectual activa insistiendo en la propuesta de un «buen arreglo...con autonomía (para los pueblos amerindios...en el marco de la Nación chilena». Este artículo estudia su análisis sobre las comunidades agrario mapuche (1953.1972. En especial, su concepción marxista y adhesión a un proyecto de socialismo que se confrontó intelectualmente con la tradición y las políticas liberales. El tema central es la construcción de autonomías étnico-políticas en debate con la idea del progreso y de la integración del pueblo indígena, sostenido por la visión de la modernidad liberal.

  19. Proyecto vidas paralelas indígena: revelando los pueblos Macuxi y Wapixana de Roraima, Brasil

    Directory of Open Access Journals (Sweden)

    Giovana MANDULÃO

    2012-03-01

    Full Text Available Este relato de experiencia se refiere a los grupos étnicos Macuxi y Wapixana, que habitan la comunidad de Tabalascada, en el estado Saúde Indígena Tempus - Actas de Saúde Coletiva Revista Tempus Actas de Saúde Coletiva 64 brasileño de Roraima. La historia relata las migraciones que trajeron los Macuxi (pueblo de lengua Karib a la región de la Serra da Lua, en donde ya vivían los Wapixana (pueblo de lengua Aruak. Fueron no pasado enemigos. En Tabalascada 90,0% de los habitantes son Wapixana y los Macuxi son producto de matrimonios interétnicos. Pueblos indígenas de la región norte del Brasil (Macuxi y de Venezuela comparten la misma cosmovisión sobre el surgimiento del mundo. Se describe la organización jerárquica de la comunidad y sus líderes elegidos por una asamblea, así como la articulación con otras comunidades en el seno del Consejo Indígena de Roraima (CIR. Se describe el alto grado de articulación institucional de la educación indígena en el estado y el ingreso de estudiantes indígenas a universidades. La comunidad es atendida por un equipo multiprofesional que, además de enfermera, odontólogo y médico, tiene agente indígena de salud, agente de saneamiento básico y microscopista, estos últimos originarios de la comunidad.

  20. Derechos humanos de los pueblos indígenas: Panorama colombiano

    OpenAIRE

    Omar Huertas; Danilo Ortíz

    2009-01-01

    La crisis de los derechos humanos que sufre Latinoamérica se ve reflejada en la cantidad significativa de pueblos indígenas, que pertenecen a estos países, sometidos a procesos de discriminación, despojo, neoliberalismo económico y globalización. Estas circunstancias han condenado a estas comunidades al subdesarrollo y a una grave situación que pone en riesgo su existencia. En el presente artículo se hará unanálisis de la situación de los derechos de la población indígena en Colombia, teniend...

  1. Estrategias de las familias campesinas en Pueblo Nuevo, Acambay, Estado de México.

    OpenAIRE

    Magdaleno Hernández, Edgar

    2013-01-01

    Las familias campesinas trabajan buscando en primera instancia su autoabasto y complementan su ingreso con otras actividades. En este trabajo se analizan las estrategias; multi actividad y autoabasto a través de los resultados obtenidos mediante entrevistas y la aplicación de una encuesta a 35 jefes de familia de la comunidad de Pueblo Nuevo, ubicada en el municipio de Acambay en el estado de México. Se practica una agricultura tradicional, se fusiona el sistema de cultivo de maíz blanco (cri...

  2. UN PRIVILEGIO PARA EL ESTADO DE MICHOACÁN: SUS PUEBLOS MÁGICOS

    OpenAIRE

    Horacio Mercado Vargas; Edgar Allan Mercado Flores

    2013-01-01

    El Estado de Michoacán, que se ubica en la parte del extremo sur occidental de México, posee paisajes muy hermosos: de bosques, praderas y lagunas de gran belleza, montañas y volcanes que descienden hacia el mar. Es uno de los más ricos en recursos naturales. La Secretaría de Turismo, diversas entidades del gobierno federal y gobiernos estatales y municipales desarrollaron el Programa de Pueblos Mágicos, para darle un valor a ciertas poblaciones del país que tienen características culturales ...

  3. UN PRIVILEGIO PARA EL ESTADO DE MICHOACÁN: SUS PUEBLOS MÁGICOS

    OpenAIRE

    Horacio Mercado Vargas; Edgar Allan Mercado Flores

    2013-01-01

    El Estado de Michoacán, que se ubica en la parte del extremo sur occidental de México, posee paisajes muy hermosos: de bosques, praderas y lagunas de gran belleza, montañas y volcanes que descienden hacia el mar. Es uno de los más ricos en recursos naturales. La Secretaría de Turismo, diversas entidades del gobierno federal y gobiernos estatales y municipales desarrollaron el Programa de Pueblos Mágicos, para darle un valor a ciertas poblaciones del país que tienen características culturales ...

  4. HOMENAJE A MAGDALENA GÓMEZ: los pueblos indígenas y sus derechos.

    OpenAIRE

    Camacho, María Teresa Sierra

    2017-01-01

    Con este texto de apertura e inauguración del primer número de la “Revista Abya Yala sobre Acceso a la Justicia en América Latina” queremos hacer un homenaje a Magdalena Gómez, cuya obra académica y compromiso político e institucional ha marcado senderos fundamentales en el reconocimeinto y la defensa de los derechos de los pueblos indígenas en México y América Latina. 

  5. Estrategias de las familias campesinas en Pueblo Nuevo, Acambay, Estado de México.

    OpenAIRE

    Magdaleno Hernández, Edgar

    2013-01-01

    Las familias campesinas trabajan buscando en primera instancia su autoabasto y complementan su ingreso con otras actividades. En este trabajo se analizan las estrategias; multi actividad y autoabasto a través de los resultados obtenidos mediante entrevistas y la aplicación de una encuesta a 35 jefes de familia de la comunidad de Pueblo Nuevo, ubicada en el municipio de Acambay en el estado de México. Se practica una agricultura tradicional, se fusiona el sistema de cultivo de maíz blanco (cri...

  6. Bestiario y tarascas alegóricas y carnavalescas del pueblo de Poggio Rusco (Mantua)

    OpenAIRE

    Borsari, Elisa

    2006-01-01

    En el pequeño pueblo de Poggio Rusco (Mantua-Italia), los refranes, los cuentos y algunos pareados reflejan la fantasía de sus habitantes, que imaginaron un bestiario compuesto por animales fantásticos. El origen de estos animales y sus celebraciones carnavalescas se encuentra en otro temible monstruo: la Tarasca. A través de un breve recorrido acerca de la probable etimología de la palabra “Tarasca”, este ensayo dará una explicación de cómo se desarrollan estas festividades en Francia, Españ...

  7. El comunitarismo en los pueblos indígenas de México

    Directory of Open Access Journals (Sweden)

    Jiménez Ottalengo, Regina

    2000-04-01

    Full Text Available Not available

    Los pueblos indígenas mexicanos son culturas postergadas que sobreviven gracias a una organización comunal basada en un sistema de cargos cívico religiosos de carácter democrático y rotativo y que les imprime un sello corporativo. Su cohesión esta sustentada por los núcleos domésticos que se articulan entre s¿, por la vía de la solidaridad y la ayuda recíproca.

  8. Comparative analysis on the key enzymes of the glycerol cycle metabolic pathway in Dunaliella salina under osmotic stresses.

    Science.gov (United States)

    Chen, Hui; Lu, Yan; Jiang, Jian-Guo

    2012-01-01

    The glycerol metabolic pathway is a special cycle way; glycerol-3-phosphate dehydrogenase (G3pdh), glycerol-3-phosphate phosphatase (G3pp), dihydroxyacetone reductase (Dhar), and dihydroxyacetone kinase (Dhak) are the key enzymes around the pathway. Glycerol is an important osmolyte for Dunaliella salina to resist osmotic stress. In this study, comparative activities of the four enzymes in D. salina and their activity changes under various salt stresses were investigated, from which glycerol metabolic flow direction in the glycerol metabolic pathway was estimated. Results showed that the salinity changes had different effects on the enzymes activities. NaCl could stimulate the activities of all the four enzymes in various degrees when D. salina was grown under continuous salt stress. When treated by hyperosmotic or hypoosmotic shock, only the activity of G3pdh in D. salina was significantly stimulated. It was speculated that, under osmotic stresses, the emergency response of the cycle pathway in D. salina was driven by G3pdh via its response to the osmotic stress. Subsequently, with the changes of salinity, other three enzymes started to respond to osmotic stress. Dhar played a role of balancing the cycle metabolic pathway by its forward and backward reactions. Through synergy, the four enzymes worked together for the effective flow of the cycle metabolic pathways to maintain the glycerol requirements of cells in order to adapt to osmotic stress environments.

  9. Feasibility Study of Economics and Performance of Solar Photovoltaics at the Santo Domingo Pueblo in Sandoval County, New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Geiger, J.; Lisell, L.; Mosey, G.

    2013-07-01

    The U.S. Environmental Protection Agency (EPA), in accordance with the RE-Powering America's Land initiative, selected the Pueblo of Santo Domingo in Sandoval County, New Mexico, for a renewable energy production feasibility study. The National Renewable Energy Laboratory (NREL) provided technical assistance for this project. The purpose of this report is to assess specific areas on the Pueblo for potential installation of photovoltaic (PV) systems and to estimate the cost, performance, and site impacts of different PV options. The report also recommends financing options that could assist in the implementation of these PV systems.

  10. High temperatures and inverted metamorphism in the schist of Sierra de Salinas, California

    Science.gov (United States)

    Kidder, Steven; Ducea, Mihai N.

    2006-01-01

    New field and thermobarometric work in the Californian Salinian block clarifies current and pre-Tertiary relationships between the schist of Sierra de Salinas and Cretaceous arc-related granitic rocks. The contact is variably preserved as a brittle fault and high-temperature mylonite zone, the Salinas shear zone, which represents the contact between North America and sediments accreted above the Farallon slab between ˜ 76 Ma and ˜ 70 Ma. Near granulite facies, prograde replacement of hornblende with clinopyroxene is associated with deformation of plutonic rocks at the base of the upper plate. In the lower plate, the schist of Sierra de Salinas, garnet-biotite thermometry indicates decreasing temperatures down-section from at least 714 °C to ˜ 575 °C over an exposed thickness of ˜ 2.5 km, consistent with petrologic evidence of an inverted metamorphic gradient. The measured temperatures are significantly higher than observed at shallow levels above subducting slabs or predicted by 2D computational models assuming low shear stresses. Previous workers have called upon shear heating to explain similar observations in the correlative Pelona schist, an unlikely scenario given the results of recent rock deformation experiments which predict that feldspar-quartz-mica aggregates are far too weak to withstand stresses of ˜ 70 MPa required by the shear heating hypothesis. As an alternative, we propose that high temperatures resulted from conductive heating while the leading edge of the schist traveled ˜ 150 km beneath the recently active Salinian continental arc during the initiation of shallow subduction. Weakening of the schist due to high temperatures helped facilitate the collapse of the Salinian arc as the schist was emplaced. Schist emplacement coincided with loss of lower, mafic portions of the arc, and therefore evolution of the Southern California crust towards a more felsic composition.

  11. LIPID PRODUCTION BY DUNALIELLA SALINA IN BATCH CULTURE: EFFECTS OF NITROGEN LIMITATION AND LIGHT INTENSITY

    Energy Technology Data Exchange (ETDEWEB)

    Weldy, C.S.; Huesemann, M.

    2007-01-01

    Atmospheric carbon dioxide (CO2) concentrations are increasing and may cause unknown deleterious environmental effects if left unchecked. The Intergovernmental Panel on Climate Change (IPCC) has predicted in its latest report a 2°C to 4°C increase in global temperatures even with the strictest CO2 mitigation practices. Global warming can be attributed in large part to the burning of carbon-based fossil fuels, as the concentration of atmospheric CO2 is directly related to the burning of fossil fuels. Biofuels which do not add CO2 to the atmosphere are presently generated primarily from terrestrial plants, i.e., ethanol from corn grain and biodiesel from soybean oil. The production of biofuels from terrestrial plants is severely limited by the availability of fertile land. Lipid production from microalgae and its corresponding biodiesel production have been studied since the late 1970s but large scale production has remained economically infeasible due to the large costs of sterile growing conditions required for many algal species. This study focuses on the potential of the halophilic microalgae species Dunaliella salina as a source of lipids and subsequent biodiesel production. The lipid production rates under high light and low light as well as nitrogen suffi cient and nitrogen defi cient culture conditions were compared for D. salina cultured in replicate photobioreactors. The results show (a) cellular lipid content ranging from 16 to 44% (wt), (b) a maximum culture lipid concentration of 450mg lipid/L, and (c) a maximum integrated lipid production rate of 46mg lipid/L culture*day. The high amount of lipids produced suggests that D. salina, which can be mass-cultured in non-sterile outdoor ponds, has strong potential to be an economically valuable source for renewable oil and biodiesel production.

  12. Gestión de la Hilandería Intercomunal Salinas. Proyecto de cooperación al desarrollo en la comunidad andina de Salinas de Guaranda, Ecuador

    OpenAIRE

    Kimball Zurbano, Mark

    2012-01-01

    En este proyecto final de carrera hago una descripción de los diferentes puntos de actuación en los que trabajé en la Hilandería Intercomunal Salinas (Ecuador). Al final hago una reflexión del mundo de la cooperación según mi experiencia vivida. Las nueve partes en las que he dividido mi trabajo son Salinas: un ejemplo de economía solidaria, estudio de los procesos productivos, cálculo de costes de producción, fijación de precios, plan de producción, medio ambiente, materia prima, e...

  13. La representación románica del pueblo

    Directory of Open Access Journals (Sweden)

    Patrick Bouletreau

    2014-02-01

    Full Text Available ¿A partir de qué momento el pueblo tome conciencia de su papel en la historia y a la vez de la palabra para elaborar un discurso propio sobre su porvenir? A pesar de las censuras moralistas o de las técnicas literarias reductoras que tendrán a mostrar al pueblo coma un criminal en gestación, el siglo XIX asistió al despertar de los escritores políticos; estos llegan reactivando el recuerdo del antiguo régimen y justificando los abusos de la época del terror: revolución y novela no logran ponerse de acuerdo.Con Víctor Hugo se escucha el grito primordial de una muchedumbre en búsqueda de la palabra primitiva. Ahora bien, si la historia debe una serie de ciclos repetitivos, las épocas de crisis se revelan inevitables.¿Pesimismo?, ¿resignación? En efecto, la evolución no sería sino una serie de revoluciones, un proceso interminable y engañador: ya quo las situaciones son fortuitas, Los actores pueden rechazar La realidad y distorsionarla a su fantasía. El poder de la literatura radica en mostrarnos esas rupturas, ese combate sobre el discurso oficial. La palabra se niega desde luego a ser confiscada otra vez.

  14. Infraestructura y calidad educativa entre los pueblos indígenas originarios sonorenses

    Directory of Open Access Journals (Sweden)

    José Ángel Vera-Noriega

    2016-01-01

    Full Text Available El objetivo del artículo se centra en el análisis de la percepción entre los pueblos indígenas originarios de Sonora sobre la infraestructura y calidad educativa para la formación de sus descendientes. Participaron 1.329 personas con un promedio de 50 años de edad y desviación estándar de 16 años, 928 mujeres y 401 hombres. Los resultados indican la prevalencia de una percepción de falta de infraestructura para mejorar la calidad educativa de los niños y jóvenes indígenas. Además, se encontraron diferencias entre los siete pueblos indígenas con respecto a la problemática educativa. Los grupos que mejor están ubicados, en cuanto a acceso educativo, son aquellos que exhiben mayor desplazamiento de su lengua materna.

  15. Pueblo Indian water rights: who will get the water, New Mexico v. Aamodt

    Energy Technology Data Exchange (ETDEWEB)

    Maynez, A.P.

    1978-07-01

    Background information on court decisions over Pueblo Indian water rights is examined. The U.S. District Court for New Mexico determined in 1966 that the Pueblo water rights are not subject to the 1924 and 1933 state law of prior appropriation, but are not technically reserved rights. The history of this litigation requires documentation back to Mexican and Spanish jurisdiction over the area when land titles were given by treaty for both Indian and non-Indian rights. Several court decisions have defined the limits of these rights and have denied the state's efforts to manipulate the law. The court did not make a clear decision on whether the rights are reserved, however, because the case was not consistent with precedents. This leads to the conclusion that a land reservation is not required to have a reserved right as long as the land is held in trust by the Federal government with the intent to reserve waters that were not previously appropriated.

  16. Asentamientos y pueblos indios desaparecidos en Los Altos de Jalisco durante el virreinato

    Directory of Open Access Journals (Sweden)

    RAMÓN GOYAS MEJÍA

    2013-01-01

    Full Text Available En este trabajo se analiza la desaparición de pueblos indígenas duran- te el periodo colonial en la región de Los Altos de Jalisco. Diversos autores han analizado la catastrófica disminución de la población indí- gena a raíz de la llegada de los europeos al continente americano; sin embargo, al menos para el occidente de México no hay estudios deta- llados que describan la redistribución del espacio luego de dicha pér- dida de habitantes. Tal situación es aún más evidente para el caso de Los Altos de Jalisco, donde, a pesar de que se han llevado a cabo gran cantidad de estudios para entender la propiedad ranchera como forma típica de asentamiento local, los antiguos pueblos indios del área han pasado casi inadvertidos, de ahí la relevancia del presente análisis.

  17. Monitoramento dos extratos brutos de espécies de Polygala (Polygalaceae utilizando Artemia salina

    Directory of Open Access Journals (Sweden)

    A.B.P. Montanher

    2003-01-01

    Full Text Available Extratos de duas espécies de Polygala foram submetidos a um biomonitoramento utilizando o teste de toxicidade frente a Artemia salina, com a finalidade de detectar atividade citotóxica. Os resultados obtidos para o extrato bruto, frações hexânica e diclorometano de Polygala sabulosa Aw. Benn. mostraram-se promissores. No entanto, bioensaios mais específicos devem ser encorajados nos extratos vegetais que apresentam atividade diante deste bioensaio, a fim de confirmar estas conclusões.

  18. Atividade antibacteriana in vitro e toxicidade frente à Artemia salina Leach. de alguns compostos triazenos

    Directory of Open Access Journals (Sweden)

    Gustavo Luiz Paraginski

    2014-01-01

    Full Text Available Bacterial resistance to antibacterial agents is currently a major concern. We report the synthesis, in vitro antibacterial activity and toxicity toward Artemia salina of six diaryltriazene compounds bearing different substituent groups. Minimal Inhibitory Concentration (MIC and Minimal Bactericidal Concentration (MBC values against standard strains (ATCC and clinical isolates (including ESBL, MBL and AmpC strains were good to very good, in the range 8 to 128 mg mL-1. Results suggest that hydroxyl, 4-carboxyl and 4-phenyldiazenil groups attached to the diaryltriazenes provide enhanced activity. Toxicity results showed very low LC50 values for three compounds (10-fold lower than DTIC.

  19. IDENTIFIKASI DAN UJI TOKSISITAS EKSTRAK ETANOL SPONS Hyrtios erecta TERHADAP LARVA UDANG Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Rr. Anisa Hernindya

    2014-05-01

    Full Text Available ABSTRAK: Spons merupakan biota laut paling dominan dalam filum Porifera yang memiliki potensi biologis sebagai antikanker. Telah dilakukan identifikasi dan uji toksisitas pada ekstrak etanol Spons H. erecta menggunakan metode Brine Shrimp Lethality Test (BSLT dengan bioindikator larva udang Artemia salina Leach. Tujuan penelitian ini adalah untuk mengetahui tingkat toksisitas ekstrak etanol Spons H. erecta sebagai antikanker. Partisi dari 10,8 gram ekstrak etanol menggunakan n-heksan, kloroform, dan air kemudian diuapkan menghasilkan ekstrak n-heksan sebanyak 3,13 gram, ekstrak kloroform sebanyak 1,63 gram, dan ekstrak air sebanyak 9,25 gram. Hasil uji toksisitas menunjukkan ekstrak n-heksan memiliki toksisitas paling tinggi dengan nilai LC50 316,22 ppm. Selanjutnya  dilakukan pemisahan dan pemurnian dengan kromatografi  kolom menggunakan eluen n-heksan: kloroform (2:8 sehingga menghasilkan empat fraksi yaitu FA, FB, FC, dan FD. Uji toksisitas pada semua fraksi menunjukkan bahwa fraksi C (FC adalah yang paling toksik dengan LC50 50,11 ppm dan berdasarkan uji fitokimia diduga merupakan gabungan senyawa alkaloid, steroid dan polifeniol.   Kata  kunci:  Spons Hyrtios erecta, uji toksisitas, Artemia  salina  Leach.             ABSTRACT: Sponges are the most dominant marine life in the phylum Porifera which have biological activities as anticancer. Identification and the toxicity test of ethanol extract of H. erecta sponges using Brine Shrimp Lethality Test ( BSLT with bio-indicators of Artemia salina Leach has been conducted. The purpose of this study was to determine the level of toxicity of the ethanol extract of H. erecta sponges as anticancer. Partition of 10,8 grams of ethanol extract using n-hexane, chloroform, and water followed by evaporation leaved n-hexane extracts, chloroform extract, and water extract of 3,13 grams, 1,63 grams, and 9,25 grams, respectively. The results of toxicity tests showed that n-hexane extract has

  20. Effects of elevated pCO2 on physiological performance of marine microalgae Dunaliella salina (Chlorophyta, Chlorophyceae)

    Science.gov (United States)

    Hu, Shunxin; Wang, You; Wang, Ying; Zhao, Yan; Zhang, Xinxin; Zhang, Yongsheng; Jiang, Ming; Tang, Xuexi

    2017-06-01

    The present study was conducted to determine the effects of elevated pCO2 on growth, photosynthesis, dark respiration and inorganic carbon acquisition in the marine microalga Dunaliella salina. To accomplish this, D. salina was incubated in semi-continuous cultures under present-day CO2 levels (390 μatm, pHNBS: 8.10), predicted year 2100 CO2 levels (1 000 μatm, pHNBS: 7.78) and predicted year 2300 CO2 levels (2 000 μatm, pHNBS: 7.49). Elevated pCO2 significantly enhanced photosynthesis (in terms of gross photosynthetic O2 evolution, effective quantum yield (ΔF/F' m ), photosynthetic efficiency (α), maximum relative electron transport rate (rETRmax) and ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activity) and dark respiration of D. salina, but had insignificant effects on growth. The photosynthetic O2 evolution of D. salina was significantly inhibited by the inhibitors acetazolamide (AZ), ethoxyzolamide (EZ) and 4,4'-diisothiocyanostilbene-2,2'-disulfonate (DIDS), indicating that D. salina is capable of acquiring HCO3 - via extracellular carbonic anhydrase and anion-exchange proteins. Furthermore, the lower inhibition of the photosynthetic O2 evolution at high pCO2 levels by AZ, EZ and DIDS and the decreased carbonic anhydrase showed that carbon concentrating mechanisms were down-regulated at high pCO2. In conclusion, our results show that photosynthesis, dark respiration and CCMs will be affected by the increased pCO2/low pH conditions predicted for the future, but that the responses of D. salina to high pCO2/low pH might be modulated by other environmental factors such as light, nutrients and temperature. Therefore, further studies are needed to determine the interactive effects of pCO2, temperature, light and nutrients on marine microalgae.

  1. La teoría armónica después de Francisco de Salinas

    OpenAIRE

    2014-01-01

    [ES] Francisco de Salinas ha sido considerado siempre como uno de los grandes teóricos musicales de todos los tiempos, aunque su mayor fama se debe a la famosa «Oda a Salinas» de fray Luis de León. Como buen humanista, nuestro autor pretende abarcar todos los aspectos musicales conocidos de su época. Para ello le asiste, no solo su pericia como instrumentista sino su conocimiento del latín y el griego, que le permitía acceder a las fuentes clásicas, muchas de las cuales estaban ap...

  2. Selenium nanoparticle-enriched biomass of Yarrowia lipolytica enhances growth and survival of Artemia salina.

    Science.gov (United States)

    Hamza, Faseela; Vaidya, Amogh; Apte, Mugdha; Kumar, Ameeta Ravi; Zinjarde, Smita

    2017-11-01

    Controlling disease outbreaks is a major challenge in aquaculture farms and conventional methods are often ineffective. Nutritional supplementation and probiotic preparations help in reducing severity of such infections. The generally regarded as safe yeast (Yarrowia lipolytica) was used in the current study. A marine strain of Y. lipolytica exhibited tolerance towards sodium selenite and formed cell associated selenium nanoparticles (SeNPs). The synthesized nanoparticles were characterized by UV-vis spectroscopy, X-ray diffraction (XRD) and Field Emission Scanning Electron Microscope (FE-SEM) observations. Fourier transform infra-red (FTIR) spectroscopy indicated the role of carboxylic and amine groups in the synthesis of nanoparticles. This SeNP-enriched biomass was used as feed for the model aquaculture system, Artemia salina and compared with normal feed, baker's yeast (Saccharomyces cerevisiae). A. salina fed with SeNP-enriched biomass, showed increased survival rates (96.66%) as compared to those fed with S. cerevisiae (60.0%). The size of the larvae fed with SeNP-enriched biomass of Y. lipolytica was also found to be larger. Additionally, larval groups fed with SeNP-enriched biomass were better protected (70.0% survival) against V. harveyi infection when compared with groups fed with S. cerevisiae (24.44%). This combination of selenium in the nanoparticle form associated with the biomass of Y. lipolytica has potential application in improving health of aquaculture species in farms. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  4. Toxicity of organophosphates on morphology and locomotor behavior in brine shrimp, Artemia salina.

    Science.gov (United States)

    Venkateswara Rao, J; Kavitha, P; Jakka, N M; Sridhar, V; Usman, P K

    2007-08-01

    The acute toxicity and hatching success of four organophosphorus insecticides--acephate (ACEP), chlorpyrifos (CPP), monocrotophos (MCP), and profenofos (PF)--was studied in a short-term bioassay using brine shrimp, Artemia salina. Fifty percent hatchability inhibition concentration and median lethal concentration (LC(50)) values were calculated after probit transformation of the resulting data. Among the insecticides tested, CPP is found to be the most toxic and also to inhibit hatching success of A. salina cysts in a concentration-dependent manner. In addition, the effect of these pesticides on locomotor behavior (swimming speed) and morphologic differences were studied in LC(50)-exposed nauplii after 24 hours. The in vivo effect of these insecticides on acetylcholinesterase (Enzyme commission number (EC 3.1.1.7) activity was also determined in LC(50)-exposed nauplii after 24 hours. Maximum percent decrease in their swimming speed and significant morphologic alterations were noticed in CPP-exposed brine shrimps. The order of toxicity was CPP > PF > MCP > ACEP in all the parameters studied.

  5. A bioassay using Artemia salina for detecting phototoxicity of plant coumarins.

    Science.gov (United States)

    Ojala, T; Vuorela, P; Kiviranta, J; Vuorela, H; Hiltunen, R

    1999-12-01

    Artemia salina (brine shrimp) has been successfully used for toxicity testing, and a screening test for phototoxicity has been developed based on this method. The ability of the method to test the phototoxic potential of seven known compounds was investigated. Athamantin (an angular furanocoumarin) and umbelliferone (a simple coumarin) showed no phototoxicity, while linear furanocoumarins exhibited phototoxic activity in the following order: psoralen > bergapten > peucedanin > xanthotoxin. The applicability of this method was also tested in screening the phototoxicity of plant material. Six plants from Apiaceae [Aegopodium podagraria L., Anethum graveolens L., Angelica archangelica L., Levisticum officinalis Koch, Petroselinum crispum (P. Mill) A. W. Hill., and Peucedanum palustre (L.) Moench] and one from Rutaceae (Ruta graveolens L.) were selected, all of them known to contain furanocoumarins. Extracts from leaves collected at different times during the growth period were used in the screening. Our results were in accordance with the furanocoumarin content of these plants and with the results of other phototoxicity tests. The Artemia salina method proved to be rapid, simple and inexpensive, and is therefore ideal in the initial biological screening of large numbers of samples for simultaneous detection of both toxicity and phototoxicity.

  6. ENHANCED VERTICAL EVACUATION APPLICATION WITH GEOMATIC TOOLS FOR TSUNAMIS IN SALINAS, ECUADOR

    Directory of Open Access Journals (Sweden)

    Andres Sebastian Matheus Medina

    2016-11-01

    Full Text Available Tsunami hazards are more than evident in the Pacific coast of Ecuador, but especially on its westernmost Peninsula called Salinas. As the potential impact time is relatively short for the public to reach natural high ground or at least leave the tsunami inundation area, a different approach to rescue lives has been applied with geomatic tools. The buildings inside the tsunami hazard zone have been first evaluated for their seismic resistance. Those buildings, which have been proven to withstand a seismic event, have been chosen to serve as elevated safe zones for a subsequent vertical tsunami evacuation. The used geographic tools allowed reducing time spans between initial evacuation points towards safe zones inside the tsunami inundation areas. The results of this study demonstrate the efficiency of vertical tsunami evacuation in a highly populated and visited touristic area in coastal Ecuador, as in Salinas appears a relatively high percentage of the population to far from shelters or elevated safe zones during a short-time impact of a tsunami.

  7. Toxicity of some glucose/mannose-binding lectins to Biomphalaria glabrata and Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir Feitosa; Cavada, Benildo Sousa; da Rocha, Bruno Anderson Matias; do Nascimento, Kyria Santiago; Sant'Ana, Antônio Euzébio Goulart

    2010-01-01

    Schistosomiasis or bilharzia, which affects millions of people living in Africa, Asia and Latin America, is closely associated with certain species of aquatic snails. One way of attacking the disease is to eradicate the host snails. Molluscicidal activities of natural compounds are especially important in the widespread control of this tropical disease. As part of our search for natural compounds with molluscicidal properties for the vector control of schistosomiasis, we are now evaluating for the first time the toxicity of the plant lectins from Canavalia brasiliensis (ConBr), Cratylia floribunda (CFL), Dioclea guianensis (Dgui), Dioclea grandiflora (DGL) and Dioclea virgata (Dvir) to Biomphalaria glabrata Say and Artemia salina Leach. Results indicate that all the samples were toxic to A. salina Leach, some of them with values of lethal concentration that kills 90% of the population (LC(90))<10 microg mL(-1). They are also active against B. glabrata Say, killing 100% of adult snails, at a concentration of 50 microg mL(-1). The lectins CFL and Dgui possess properties lethal to mollusks, with values of LC(90)=50.3 microg mL(-1) and LC(90)=41.0 microg mL(-1), respectively.

  8. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test.

    Science.gov (United States)

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-10-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v) for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC50 for the solvents were 8.5% (DMSO), 6.4% (methanol), 3.4% (ethanol) and 2.5% (Tween 20). The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  9. F. Salinas y la teoría musical de finales del Renacimiento

    Directory of Open Access Journals (Sweden)

    Goldáraz Gaínza, J. Javier

    1998-04-01

    Full Text Available Not available.Si F. Salinas (1513-1590 es justamente famoso en el mundo literario debido a Fray Luis de León, en este artículo se intenta contextualizar y así mostrar su contribución a la teoría armónica occidental. Tal contribución estriba nada menos que en ser el primer expositor del llamado temperamento igual, es decir, la división de la octava en doce partes, doce semitonos iguales. Hacerlo de forma matemática, dentro del contexto musical de finales del Renacimiento, no era tarea fácil. Se trata de dividir la razón 2/1 en doce partes igualmente proporcionales, lo que con medios puramente aritméticos es imposible. Salinas está al final de una cadena de teóricos renacentistas enredados en este objetivo que únicamente pudo llevarse a cabo dentro de la corriente humanista.

  10. Physiological responses of the eustigmatophycean Nannochloropsis salina to aqueous diesel fuel pollution

    Directory of Open Access Journals (Sweden)

    Rania Farag Mohammad

    2005-03-01

    Full Text Available The marine eustigmatophycean microalga Nannochloropsis(Monallantus salina Hibberd was cultivated in a batchculture in the presence of various concentrations (0, 25, 50, 75 and 100%of an aqueous extract of diesel fuel oil in order to assess the influenceof the pollutant on the growth and certain physiological responses of themicroalga. The growth data revealed a significant negative effect of thevarious pollutant concentrations on the algal cell number(p ≤ 0.05. However, at the mid-logarithmic growth phase (day 8,the algal cells were analysed for chlorophyll a, β-glucan,amino acid pool, C/N ratio and elemental composition. According to ourresults, N. salina was significantly affected by the pollution withregard to the different physiological parameters examined, and thissignificance may be negative, positive or variable. The effect of thepollutant on cellular β-glucan and the total amount of amino acidswas negative; however, the composition of the cellular amino acid poolremained unaffected. A positive effect of the pollutant on cellular chl aand the C/N ratio was observed. In addition, the pollutant showed variableeffects on the composition of different elements, as shown byenergy-dispersive X-ray microanalysis. Also, an existencecorrelation between different elements was statistically reported.

  11. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  12. Anaerobic co-digestion of the marine microalga Nannochloropsis salina with energy crops.

    Science.gov (United States)

    Schwede, Sebastian; Kowalczyk, Alexandra; Gerber, Mandy; Span, Roland

    2013-11-01

    Anaerobic co-digestion of corn silage with the marine microalga Nannochloropsis salina was investigated under batch and semi-continuous conditions. Under batch conditions process stability and biogas yields significantly increased by microalgae addition. During semi-continuous long-term experiments anaerobic digestion was stable in corn silage mono- and co-digestion with the algal biomass for more than 200 days. At higher organic loading rates (4.7 kg volatile solids m(-3)d(-1)) inhibition and finally process failure occurred in corn silage mono-digestion, whereas acid and methane formation remained balanced in co-digestion. The positive influences in co-digestion can be attributed to an adjusted carbon to nitrogen ratio, enhanced alkalinity, essential trace elements and a balanced nutrient composition. The results suggest that N. salina biomass is a suitable feedstock for anaerobic co-digestion of energy crops, especially for regions with manure scarcity. Enhanced process stability may result in higher organic loading rates or lower digester volumes.

  13. Los movimientos de protesta del Pueblo Mapuche en Chile, 2000-2012: Balance y perspectivas

    Directory of Open Access Journals (Sweden)

    Rita Cancino

    2014-09-01

    Full Text Available Aunque el Pueblo Mapuche de Chile es numéricamente reducido, sus reivindicaciones históricas y luchas actuales tienen el mismo contenido que las de otros pueblos originarios de América Latina con mayor población. Durante cuatro siglos los Mapuches no dejaron de combatir el colonialismo español. Desde 1830, el Estado chileno ha ejercido una colonización interior que les expropió sus tierras ancestrales, desconoció su lengua, cultura e identidad subsumiéndolos en la identidad chilena. Los movimientos mapuches actuales expresan la continuidad de una lucha de resistencia frente al Estado Nacional que nunca ha cesado. En 1979 la dictadura militar promulgó el Decreto de Ley 2.568 cuyo objetivo fue la disolución de las comunidades mapuches. Las movilizaciones mapuches fueron iniciadas en los 80 y formaban parte de los movimientos de protesta contra los procesos de globalización y modernización que han generado enormes impactos ambientales. En este artículo se discutirán las perspectivas de la lucha mapuche en un país donde los pueblos originarios constituyen una minoría y las posibilidades eventuales de estos de entablar alianza con otros sectores oprimidos para poder alcanzar los objetivos de su lucha. English: Although the Mapuche people of Chile is numerically a small group, its historical and current struggles have the same content as that of other peoples of Latin America with larger population. For four centuries the Mapuche people never stopped fighting against the Spanish colonialism. Since 1830, the Chilean government has exerted inner colonization by expropriating their ancestral lands, ignoring their language, culture and identity forcing them into the Chilean identity. The current Mapuche movements express the continuity of a resistance struggle against the Federal Government which has never ceased. In 1979, the military dictatorship enacted the Decree Law 2.568 aimed at the liquidation of the Mapuche communities. The

  14. Diseño del sistema de seguridad y salud ocupacional de dos empresas del "Grupo Salinas". Proyecto de cooperación al desarrollo en la comunidad andina de Salinas de Guaranda, Bolívar, Ecuador

    OpenAIRE

    Casado Pascal, Roberto Carlos

    2014-01-01

    Este proyecto fin de carrera consiste en el diseño y elaboración de un Sistema de Seguridad y Salud Ocupacional (SSSO) para dos empresas pertenecientes al Gruppo Salinas. Estos sistemas deben ajustarse a un estándar nacional, que en Ecuador han denominado SART (Sistema de Auditoría de Riesgos del Trabajo).

  15. Abelhas (Hymenoptera: apoidea visitantes das flores de goiaba em pomar comercial in Salinas, MG Bee diversity in a commercial guava orchard in Salinas, Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Rosemeire Alves Guimarães

    2009-01-01

    Full Text Available As abelhas são responsáveis por cerca de 80% a 100% da polinização de culturas agrícolas, especialmente aquelas relacionadas com a produção de sementes e frutos. A investigação da diversidade de abelhas em pomares de goiaba pode ser subsídio para estratégias de incremento da produtividade. Nesta perspectiva, o objetivo deste estudo foi identificar a diversidade de abelhas visitantes das flores de goiaba (Psidium guajava, em pomar comercial em Salinas (MG. O trabalho foi desenvolvido em maio de 2005 e foram coletadas as abelhas visitantes das flores nos horários entre 6h e 18h, totalizando-se 44 horas de coleta. Coletaram-se 705 abelhas de 17 espécies, sendo Trigona spinipes a mais freqüente e dominante na cultura da goiaba. Apis mellifera, Melipona quadrifasciata e Tetragonisca angustula foram consideradas acessórias. Aproximadamente 84% dos indivíduos foram coletados da manhã, de 6h às 10h.Pollination is an important factor in agricultural systems, especially in growing fruits and seed production, which depend greatly on bee visiting during blossom season; highly successful gains within these activities varies between 80 and nearly 100 per cent, owing to the bees. The assessment of bee diversity in commercial orchards of guava may contribute to a more desirable strategic design and consequent improvement of production. The aim of the study was identify the diversity of visiting bees to guava flowers (Psidium guajava in a commercial orchard in Salinas, State of Minas Gerais, Brazil. The work was carried during blossom season of May - 2005. Field works occurred between 6:00 am to 6:00 pm, counting with 44 hours of collection, when 705 bees were collected. The richness observed was of 17 species, the most frequent and dominant being Trigona spinipes. Among the collection there were some considered accessory species: Apis mellifera, Melipona quadrifasciata and Tetragonisca angustula. Most of individual bees have been captured

  16. Unravelling the effusive-explosive transitions and the construction of a volcanic cone from geological data: The example of Monte dei Porri, Salina Island (Italy)

    Science.gov (United States)

    Sulpizio, Roberto; Lucchi, Federico; Forni, Francesca; Massaro, Silvia; Tranne, Claudio

    2016-11-01

    The volcanic activity that built up the Monte dei Porri stratocone (Salina Island) was reconstructed using new stratigraphic data, which allowed seven eruption units to be distinguished. Alternating Strombolian/Vulcanian to sub-Plinian/Plinian explosive and effusive activity emplaced fall and pyroclastic density current deposits and lava flows that formed the volcanic cone. The minimum erupted bulk volumes were assessed at 100 × 106 m3 each for EU1, EU2, EU3 and EU6, while that of EU4 is ca. 200 × 106 m3. Rough estimation of EU7 volume yields values around 150 × 106 m3. The calculation of volume was not possible for the EU5 deposits. The magmas that fed the different eruption units of the Monte dei Porri succession range in composition from basalt to andesite, with the exception of dacites erupted in the initial phase of activity. SEM image analyses on coarse ash from the different pyroclastic units suggest that hydromagmatic fragmentation cannot be the cause of the large variations in explosivity observed throughout the stratigraphic succession. Based on the lithic component of pyroclastic deposits and xenolith contents of lava flows, the plumbing system that fed the different eruption units of Monte dei Porri was split into a deep magma storage level (15-20 km) and shallower magma batches (3-5 km). Our calculations indicate that the volumes of erupted material can account for magmatic triggering (injection of new magma) of eruptive units from the shallower feeding system, but they are not sufficient for suggesting magmatic initiation of the eruption units from the deeper feeding system. It is therefore assumed that the eruptions from the deep magma reservoir necessitate a favourable lithostatic stress, likely calling for a reduction of the local tectonic forces. A qualitative model explaining the eruptive style transitions among and within the different eruption units is presented, taking into account the relation between magmatic overpressure and lithostatic

  17. Afrontamiento intercultural para la coordinación jurisdiccional con pueblos indígenas colombianos

    Directory of Open Access Journals (Sweden)

    Carlos Vladimir Zambrano

    2008-05-01

    Full Text Available El artículo aborda la experiencia realizada en Colombia en los dos últimos años con grupos focales interculturales de 50 autoridades de 50 pueblos indígenas y 50 jueces y magistrados del sistema judicial nacional que intervinieron en procesos judiciales contra autoridades indígenas. Presenta la coordinación jurisdiccional con perspectiva intercultural, etnográfica y procesal, y asume que dicha institución es central en el trabajo social de lo intercultural cuando dos sistemas jurídicos se relacionan judicialmente. Los grupos focales permitieron vislumbrar las dificultades y posibilidades de la interculturalidad entre autoridades indígenas y jueces de la rama judicial, y fijar posiciones antropológicas, políticas y jurídicas de corte intercultural, las cuales se exponen en perspectiva latinoamericana.

  18. HEALTH IN THE LATE HORIZON: SHEPHERDS AND FARMERS OF PUEBLO VIEJO-PUCARA AND HUAMANMARCA (PERU

    Directory of Open Access Journals (Sweden)

    María Kolp-Godoy Allende

    2015-03-01

    Full Text Available Biological markers considered as nonspecific indicators of “stress” were used to evaluate the health and nutritional status of two Andean settlements of the Late Horizon (1430-1532 AD. from the coast and highland of Lima, Pueblo ViejoPucara and Huamanmarca respectively. A total of nine dental and health indicators were measured: enamel hypoplasia (LEH, carious lesions, tooth wear, dental calculus, criba orbitalia, porotic and trauma. The results indicate that in both the likelihood of a disease linked to one of the biological markers like periostitis, anaemia or infectious diseases, was low, enjoying many of the inhabitants a good health status. However, the difference in the percentage of cases affected in both varied markedly between one sector and another, showing a direct between the frequency of an indicator of nonspecific stress and (a the social status, (b the sector of origin, and (c the of an occupational activity of its inhabitants.

  19. DOCUMENTO: ORGANIZACIÓN Y PARTICIPACIÓN DESDE LAS PERSPECTIVAS DE LOS PUEBLOS AFRODESCENDIENTES

    Directory of Open Access Journals (Sweden)

    Rubén Hernández Cassiani

    2002-08-01

    Full Text Available En la mente de muchos colombianos prevalece la idea que los afrodescendientes están desorganizados y dispersos, que carecen de capacidad alguna para reivindicar sus derechos como grupo étnico o colectividad marginada históricamente por el Estado colombiano. Contrario a estas creencias, los pueblos afrodescendientes tienen múltiples formas organizativas que hunden sus raíces en las primeras sociedades africanas de las que heredaron una incalculable riqueza cultural que, en el ámbito organizacional, se constituye en medio generador y catalizador de conciencia étnica que en su accionar práctico se orienta a recuperar y fortalecer su identidad, sus territorios ancestrales y su autonomía como grupo al tiempo integrado y diferenciado del resto de la sociedad colombiana.

  20. Propuesta de Citymarketing para los Pueblos Mágicos del estado de Puebla

    Directory of Open Access Journals (Sweden)

    Adolfo Federico Herrera García

    2015-07-01

    Full Text Available Actualmente se buscan diferentes alternativas para incrementar la competitividad económica entre los países, estados y regiones con la intención de detonar su desarrollo. La creación de una propuesta de citymarketing puede ser considerada como una alternativa para alcanzar este objetivo. El presente trabajo presenta el modelo de diamante del turismo propuesto por Michael Porter, y es aplicado para los municipios de Chignahuapan, Zacatlán, Xicotepec de Juárez, Pahuatlán y Tlatlauqitepec con la finalidad de desarrollar una propuesta de citymarketing turístico de estos municipios considerados Pueblos Mágicos.

  1. Derechos humanos de los pueblos indígenas: Panorama colombiano

    Directory of Open Access Journals (Sweden)

    Omar Huertas

    2009-10-01

    Full Text Available La crisis de los derechos humanos que sufre Latinoamérica se ve reflejada en la cantidad significativa de pueblos indígenas, que pertenecen a estos países, sometidos a procesos de discriminación, despojo, neoliberalismo económico y globalización. Estas circunstancias han condenado a estas comunidades al subdesarrollo y a una grave situación que pone en riesgo su existencia. En el presente artículo se hará unanálisis de la situación de los derechos de la población indígena en Colombia, teniendo en cuenta el desarrollo normativo del derecho internacional de los derechos humanos que se ha dado a nivel universal e interamericano.

  2. Problemas en torno a los orígenes históricos del pueblo Vacceo

    Directory of Open Access Journals (Sweden)

    Adolfo Jerónimo DOMÍNGUEZ MONEDERO

    2009-10-01

    Full Text Available Es un hecho que los primeros datos históricos que poseemos acerca de los pueblos de la Meseta corresponden a una época tardía dentro del desarrollo de los mismos y que, por consiguiente, es hasta cierto punto arriesgado el intentar extraer de ellos más de lo que ellos mismos aportan. Por lo que se refiere al caso que aquí nos interesa, el caso vacceo, la principal característica que a ojos de un autor antiguo merecía la pena reseñar se refería a su organización económica, y concretamente a su conocido colectivismo agrario (Diodoro, V, 34, tantas veces comentado (Domínguez, 1988, con bibliografía anterior.

  3. Pueblos Turísticos”. El caso de Carlos Keen

    Directory of Open Access Journals (Sweden)

    Mariangel Cacciutto

    2015-01-01

    Full Text Available Este estudio pretende indagar acerca de las características de los procesos participativos en el marco de un programa publico provincial enfocado al desarrollo turístico. Para tal fin, y mediante un abordaje cualitativo, se propone analizar el alcance de la participación, los modos de comunicación y decisión y la extensión de la autoridad en la localidad de Carlos Keen (Buenos Aires, área de aplicación del programa provincial “Pueblos Turísticos”. Los resultados permiten establecer que si bien se trata de un programa con alto grado de exclusividad participativa, donde se han generado espacios de comunicación y deliberación conjunta, esta circunstancia se ve condicionada por la limitada participación de la comunidad.

  4. Sobre pueblos y armas. La revista de la disidencia montonera Columna José Sabino Navarro

    Directory of Open Access Journals (Sweden)

    Daniela Slipak

    2014-06-01

    Full Text Available Partiendo de la relevancia de las inscripciones simbólicas en la constitución de los espacios políticos, el presente artículo estudia la revista Puro Pueblo, editada en 1974 por una de las disidencias de la organización Montoneros, la Columna José Sabino Navarro. ¿Qué la diferenció de la prensa montonera? ¿Cómo reinventó la tradición peronista? ¿Cuáles fueron sus adversarios? Cuestionando la denominación supuestamente homogénea de una “izquierda peronista”, el análisis contribuye a exhibir y comprender las diferentes voces que en la década del setenta reivindicaron al peronismo y abogaron por una transformación cabal de la sociedad.

  5. La educación valoral desde la historia de los pueblos de habla inglesa

    Directory of Open Access Journals (Sweden)

    Yunier Pérez Sarduy

    2010-01-01

    Full Text Available Abordó el desarrollo de la educación valoral a través del estudio de la historia y la literatura de las culturas nativo americanas. Mediante la descripción de experiencias en la formación de profesores de inglés, los autores argumentaron cómo utilizar la literatura para llegar a valoraciones de elementos culturales a través de la disciplina Historia de las culturas de los pueblos de habla inglesa. A estos fines, se analizan las relaciones entre el trabajo con la literatura auténtica en lengua inglesa y sus contextos, la valoración de aspectos culturales y el análisis de hechos y procesos históricos en función de la educación valoral.

  6. Enhancement of carotenoid biosynthesis in the green microalga Dunaliella salina with light-emitting diodes and adaptive laboratory evolution.

    Science.gov (United States)

    Fu, Weiqi; Guðmundsson, Olafur; Paglia, Giuseppe; Herjólfsson, Gísli; Andrésson, Olafur S; Palsson, Bernhard O; Brynjólfsson, Sigurður

    2013-03-01

    There is a particularly high interest to derive carotenoids such as β-carotene and lutein from higher plants and algae for the global market. It is well known that β-carotene can be overproduced in the green microalga Dunaliella salina in response to stressful light conditions. However, little is known about the effects of light quality on carotenoid metabolism, e.g., narrow spectrum red light. In this study, we present UPLC-UV-MS data from D. salina consistent with the pathway proposed for carotenoid metabolism in the green microalga Chlamydomonas reinhardtii. We have studied the effect of red light-emitting diode (LED) lighting on growth rate and biomass yield and identified the optimal photon flux for D. salina growth. We found that the major carotenoids changed in parallel to the chlorophyll b content and that red light photon stress alone at high level was not capable of upregulating carotenoid accumulation presumably due to serious photodamage. We have found that combining red LED (75 %) with blue LED (25 %) allowed growth at a higher total photon flux. Additional blue light instead of red light led to increased β-carotene and lutein accumulation, and the application of long-term iterative stress (adaptive laboratory evolution) yielded strains of D. salina with increased accumulation of carotenoids under combined blue and red light.

  7. [Biological and biochemical quality of the Artemia (Anostraca: Artemiidae) population from Real de Salinas saltworks, Calkiní, Campeche, Mexico].

    Science.gov (United States)

    Rodríguez-Canché, Leticia G; Maldonado-Montiel, Teresita D N J; Carrillo Navarro, Luciano A

    2006-12-01

    Cysts of Artemia spp. collected from February 1997 to February 2000 in the Real de Salinas solar saltworks, Campeche, Mexico, were compared with Artemia franciscana (batch number 8,131 Microfeast Artemia Cysts, Texas, USA). The variables determined in these two populations were: number of cysts per gram, hatching percentage, hatching efficiency, hatching rate, hatching synchrony and hatching biomass, as well as diameter of the cysts and length of the nauplii (instar I). For Salinas, the average diameters of the encapsulated and decapsulated cysts were 230.5 +/- 4.14 and 221.8 +/- 3.39 microm, respectively. The thickness of the cyst shell was 4.35 +/- 0.68 microm and the length of the nauplii was 388.11 +/- 4.39 microm, this last value is among the smallest reported in the literature. For the commercial population of A. franciscana, the average diameters of the encapsulated and decapsulated cysts were 230.21 +/- 12.49 and 216.96 +/- 13.71, respectively. With respect to the corion thickness and length of the nauplii the values were 6.62 +/- 2.72 and 424.70 +/- 30.08, respectively. The protein value of the cysts (47.91 %) and nauplii (50.5 %) of Artemia population from Real de Salinas, are considered adequate to be used as food in aquaculture. The results indicate that the population from Real de Salinas presents positive features for its use in aquaculture in the region.

  8. ESPACIOS SALINEROS DE INTERIOR: LAS SALINAS DE SANGONERA LA SECA Y LIBRILLA EN LA REGIÓN DE MURCIA

    National Research Council Canada - National Science Library

    José Antonio Albaladejo-García; José María Gómez-Espín

    2016-01-01

    ... (afloramientos del Trías o del Messiniense), en los que coincide material salino y una pequeña corriente de agua que lo atraviesa, se genera un me dio de salmuera que tras su ordenación (salinas...

  9. Effect of mixing rate on Beta-carotene production and extraction by dunaliella salina in two-phase bioreactors

    NARCIS (Netherlands)

    Hejazi, M.; Andrysiewicz, E.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    beta-Carotene has many applications in the food, cosmetic, and pharmaceutical industries; Dunaliella salina is currently the main source for natural beta-carotene. We have investigated the effect of mixing rate and whether it leads to the facilitated release of beta-carotene from the cells of Dunali

  10. Improved synthesis of seven aromatic Baylis-Hillman adducts (BHA): evaluation against Artemia salina Leach. and Leishmania chagasi.

    Science.gov (United States)

    Barbosa, Ticiano P; Junior, Cláudio G L; Silva, Fábio P L; Lopes, Horacimone M; Figueiredo, Lucas R F; Sousa, Suervy C O; Batista, Guilherme N; da Silva, Thiago G; Silva, Tania M S; de Oliveira, Márcia R; Vasconcellos, Mário L A A

    2009-04-01

    We described a very efficient procedure to prepare seven aromatic compounds (1-7), a new class of antileishmanial substances, through Baylis-Hillman reaction (BHR). With one, all the Baylis-Hillman adducts were prepared in quantitative yields by reaction of the corresponding aromatic aldehydes in acrylonitrile at 0 degrees C in only 10-40min reaction time. We present our results about the toxicities of these compounds evaluated on the microcrustaceous Artemia salina Leach. and against promastigote Leishmania chagasi. All substances evaluated in this work have showed high bioactivity. The 3-hydroxy-2-methylene-3-(4-bromopheny)propanenitrile (4) (LC(50)=30.9 microg/mL on A. salina; IC(50)=25.2 microM on L. chagasi) was the most active compound evaluated on A. salina Leach. and on promastigote L. chagasi. The 2-[hydroxy(pyridin-4-yl)methyl]acrylonitrile (7) (LC(50)=30.9 microg/mL on A. salina Leach.; IC(50)=4.8 microg/mL on L. chagasi) was also a very active substance evaluated in this work on promastigote L. chagasi.

  11. The use of carbamates, atropine, and 2-pyridine aldoxime methoiodide in the protection of Artemia salina against poisoning by carbophenothion.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, V

    2001-09-01

    The acute toxicity of carbophenothion to three age classes of Artemia salina was evaluated. An increase in toxicity of carbophenothion was found following longer development of A. salina. The effect of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterase-inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methochloride (2-PAM) on carbophenothion-induced lethality in 24-h-old A. salina was also investigated. The lethal action of carbophenothion was completely prevented by pretreatment of A. salina with 2-PAM. Atropine and pyridostigmine afforded a maximal protection of approximately 87% and 72%, respectively, compared to control values. In contrast, physostigmine was ineffective. The inhibitory effects of combinations of 10(-5) M atropine with physostigmine, pyridostigmine, or 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 92.58%, 100%, and 100%, respectively. In the presence of 10(-7) M atropine, neither pyridostigmine nor 2-PAM provided additional inhibition of the lethality compared to that with either drug alone, whereas the protection afforded by 10(-7) M atropine plus physostigmine increased as the concentration of carbamate increased (up to 10(-3) M). Pretreatment with pyridostigmine or physostigmine plus 2-PAM (10(-6) M) slightly enhanced the maximal inhibition of carbophenothion lethality compared to that with either drug alone. It is suggested that the most active combined pretreatment studied here was physostigmine plus atropine.

  12. FRAKSINASI DAN IDENTIFIKASI SENYAWA ANTIKANKER EKSTRAK KULIT BATANG Rhizopora mucronata SERTA UJI TOKSISITASNYA TERHADAP LARVA UDANG (Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Hartiwi Diastuti

    2009-11-01

    Full Text Available Investigation the anticancer potency of R. mucronata has not been carried yet. This research were aimed to extract the bioactive compound of R. mucronata with various organic solvents, examine their toxicity againts A. salina Leach larv. and identify the toxic compounds from R. mucronata steam bark. The extraction of R. mucronata steam bark were peformed by maseration with n-hexane, chloroform, ethylacetate and methanol, repectively. The extracts were examined their toxicity againsts A. salina Leach larv. The highest activity extracts was fractionated performed by coloumn chromatography. The fractions respectively was examined their toxicity againts A. salina Leach larv. Identification of toxic compound was carry out using gas chromatography-mass spectrometry (GC-MS. The chloroform extracts of R. mucronata had toxic character. Toxicity test to A. salina Leach larv. The Result showed that the chloroform fraction 1 (C1 of R. mucronata steam bark had LC50 equal to 301.50 ppm. Phytochemical study showed that the active fractions contained terpenoid. Bioactive compound from R. mucronata steam bark were dioctyl phthalate and cyclopropyle azulene decahydro-1,1,7-trimethyl-4-methylene.

  13. 78 FR 1210 - Grand River Dam Authority; Notice of Telephone Meeting To Discuss the Salina Pumped Storage...

    Science.gov (United States)

    2013-01-08

    ... Energy Regulatory Commission Grand River Dam Authority; Notice of Telephone Meeting To Discuss the Salina... Grand River Dam Authority. (An RSVP is required. See paragraph f below.) c. FERC Contact: Stephen Bowler... Grand River Dam Authority (GRDA) is holding a technical meeting to discuss the results of the...

  14. NUEVA RURALIDAD Y SUSTENTABILIDAD SOCIAL EN EL PUEBLO MÁGICO DE CALVILLO, AGUASCALIENTES

    Directory of Open Access Journals (Sweden)

    Alejandro Palafox-Muñoz

    2016-06-01

    Full Text Available Con la finalidad de penetrar los espacios rurales para promover el modo de producción capitalista el Estado ha elaborado estrategias para la renovación del espacio rural, a ello se le denomina nueva ruralidad, la cual impulsa el turismo como actividad económica tanto en el campo como en áreas naturales protegidas. En este sentido, el Programa Pueblos Mágicos contribuye a establecer las acciones encaminadas a la apropiación, funcionalización y homogenización del territorio en espacios con precariedades marcadas por la pobreza. Calvillo, Aguascalientes, hoy en día reconocido por la Secretaría de Turismo como uno de los Pueblos Mágicos, es ejemplo vivo de la nueva ruralidad institucional, la cual se caracteriza por una intervención del Estado para el control de los recursos, así como para dirigir la actividad económica de acuerdo con los intereses del capital. Metodológicamente, se aplicaron una serie de entrevistas en profundidad, para que dicha información contribuya al análisis de los efectos de la nueva ruralidad institucional sobre la sustentabilidad social de la localidad, ya que la sociedad está perdiendo las actividades tradicionales que le caracterizaban y la participación de la comunidad se limita a la recepción de recursos e instrucciones para el desarrollo turístico de la comunidad.

  15. Los derechos de los pueblos indígenas en clave de derecho interno e internacional

    Directory of Open Access Journals (Sweden)

    Víctor Bazán

    2004-01-01

    Full Text Available El trabajo aborda diversas cuestiones sustanciales relativas a los derechos de los pueblos indígenas en la República Argentina desde las perspectivas constitucional, legal y jurisprudencial, advirtiendo sobre la mutación del paradigma que al respecto se ha verificado por conducto de la reforma constitucional de 1994, que diera cuerpo al precepto contenido en el art. 75, inc. 17, de la Ley Fundamental. Entre otros aspectos relevantes y conflictivos, el autor analiza la conexión entre el derecho penal estatal y el derecho consuetudinario indígena; las proyecciones de la normativa constitucional sobre el sistema jurídico-penal; la interacción cultura hegemónica - culturas minoritarias; la temática relativa a la vinculación política criminal y diversidad cultural; y el arduo asunto del constitucionalismo y el multiculturalismo. Asimismo, emprende un recorrido por el derecho comparado y las instancias iusinternacionales en materia de derechos humanos (Comisión y Corte Interamericanas y Comité de Derechos Económicos, Sociales y Culturales de Naciones Unidas en relación con la ‘cuestión indígena’, problemática que ve incrementada su importancia a partir de la creciente injerencia normativa y axiológica del derecho internacional de los derechos humanos y la potencial responsabilidad internacional en la que puede incurrir el Estado por violación (activa u omisiva de sus obligaciones en materia de protección de los derechos de los pueblos indígenas

  16. Proyecto vidas paralelas indígena: revelando el pueblo ATIKUM de Pernambuco, Brasil

    Directory of Open Access Journals (Sweden)

    Edneide Maria da SILVA

    2012-03-01

    Full Text Available El presente artículo se refiere a la comunidad indígena Atikum Umã, habitante del sertão central del Estado de Pernambuco, Brasil (municipios de Carnaubeira da Penha e Salgueiro. El pueblo Atikum se expresa en portugués, aunque algunas palabras de la lengua Cariri (del tronco linguístico Tupi estén preservadas. En la memoria histórica, se relata el reconocimiento oficial de este pueblo en la segunda mitad de la década de 1940, su lucha por una reserva frente a los abusos cometidos, y su alianza con los Tuxá (del Estado de Bahia. Se señala el hecho de la tierra indígena Atikum estar ubicada en el llamado “polígono de la marijuana”, lo cual ha causado graves conflictos y violencia contra los indígenas, incluyendo el asesinato de algunos de sus líderes en 1991. La organización jerárquica comprende el cacique (escogido en reuniones por indicación de la comunidad, y el Pajé. Hay una fuerte influencia de la política local-regional en el área indígena. Se apunta la existencia de instancias de participación, los concejos locales, la Comisión de los Profesores Indígenas Atikum - COPIA, y dos consejos indígenas de salud. Se anotan dificultades de conciliar los dos saberes que fundamentan la concepción de salud, el tradicional / popular y el científico. En lo que se refiere a la asistencia en salud, se describen los equipos multidisciplinarios de atención primaria, la insuficiencia para atender la demanda de la población y la demora en la realización de exámenes.

  17. Literatos sin pueblo: la aparición de los "intelectuales" en España

    Directory of Open Access Journals (Sweden)

    Santos JULIÁ

    2010-02-01

    Full Text Available RESUMEN: Analizar el origen, la presencia pública, las características y la representatividad social de los intelectuales en España es el objeto de este artículo. Desde la primera "intelligentsia" liberal y sus luchas contra el absolutismo, colocándose a la cabeza de las transformaciones políticas y sociales y contribuyendo de manera notable a la creación del mitologema populista de redención nacional, los intelectuales han mantenido una especial relación con "el pueblo" que iría cambiando con el paso del tiempo. Estudiar esa relación en el contexto del final de siglo y la irrupción de una nueva sociedad de masas, así como las consecuencias que arrastró para la posición asumida por el intelectual en la sociedad y frente a la política, constituye el núcleo de este trabajo. Palabras Clave: intelectuales, pueblo, sociedad de masas, liberalismo, crítica política. ABSTRACT: The object of this article is to analyze the origin, public presence, characteristics, and social significance of intellectuals in Spain. From the first liberal "intelligentsia" and their struggle against absolutism, when they placed themselves at the head of political and social transformations and contributed notably to the creation of the populist mythologem of national redemption, the intellectuals have maintained a special relationship with "the people" that would change over time. This paper focuses on the study of this relationship in the context of the end of the century and the irruption of a new society of masses as well as the consequences it entailed for the position assumed by the intellectuals in society and with regard to politics. Key words: Intellectuals, People, Society of Masses, Liberalism, Political Criticism.

  18. José Martí, Viajes y Apreciación del Pueblo Maya

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Bojórquez Urzaiz

    2015-09-01

    Full Text Available Este trabajo expone y examina los cambios de percepción que experimentó José Martí sobre el papel de los pueblos originarios de América, entre 1875 y 1878, años en los que vivió en México y Guatemala, con intensa escala en Yucatán, lugares donde conoció directamente la cultura y el pueblo maya. Martí resume una visión inicial de nuestra América en la figura lítica de Chacmool cuando después de ser expropiada por el gobierno yucateco, el Apóstol cubano la admira en la ciudad de Mérida y expresa que es la síntesis de las culturas americanas. Aspecto poco estudiado en la obra de Martí es este acercamiento etnográfico a la realidad maya de Yucatán y Guatemala.   This paper aims at presenting and examining the change of perception José Martí underwent in relation to the role of the native peoples of America between 1875 and 1878, the years he lived in Mexico and Guatemala, during which he spent a large amount of time in Yucatan, where he was able to get to know the Mayan culture and its people first hand. Martí summarized his initial vision of our America in the lithic figure of Chacmool, which he was able to admire in the city of Merida, after it had been expropriated by the government of Yucatan. The Cuban apostle described this as a synthesis of American cultures. This ethnographic insight into the Mayan reality in Yucatan and Guatemala represents a scarcely explored aspect of Martí's work.

  19. Análisis de subsidencia de la Cuenca de las Salinas, Sierras Pampeanas occidentales Subsidence analysis of the Las Salinas Basin, western Sierras Pampeanas

    Directory of Open Access Journals (Sweden)

    Edgardo A. Azeglio

    2008-06-01

    Full Text Available En el presente trabajo se ha evaluado la subsidencia total de la cuenca de Las Salinas mediante diagramas tiempo - profundidad, considerando la subsidencia inicial, por carga y termotectónica. También se calculó la velocidad de subsidencia interválica en función del tiempo geológico. El área en estudio se ubica aproximadamente entre los paralelos 31°17´S y 32°40´S y los meridianos 66°38´W y 67°48´W en las cercanías de la localidad de Marayes, en el sitio denominado cuenca de Las Salinas. Los diagramas tiempo - profundidad permitieron relacionar cambios en la velocidad de subsidencia de la cuenca durante el proceso distensivo del Mesozoico y el actualmente compresional a la cual esta sometida, obteniéndose valores concordantes con áreas circundantes. Como resultado del análisis se encontró que la velocidad de subsidencia inicial fue de 0,0017 mm/año en el Carbonífero, la que fue aumentando lentamente hasta alcanzar los 0,00875 mm/año en el Cretácico. Este incremento disminuye sensiblemente durante el Cretácico superior, para posteriormente incrementarse abruptamente en el Terciario (0,043 mm/año. Este régimen se mantiene durante el Plioceno a Mioceno, alcanzando valores promedios de 0,269 mm/año, culminando con valores de 0,0973 mm/año. De la comparación entre ambos diagramas de subsidencia se observan distintos ritmos de sedimentación entre el sector norte y sur de la cuenca que podría ser la consecuencia de un fallamiento en el basamento. La comparación de estos valores con los obtenidos en la cuenca de Beazley indican que si bien los valores de subsidencia inicial y ritmo de sedimentación fueron similares. El inicio de la subsidencia en la cuenca de Beazley, se produjo con posterioridad (en el Triásico. La componente termotectónica en ambas cuencas es similar a pesar que el gradiente térmico normal de la zona aumenta sensiblemente en dirección sur.In the present work the total subsidence of Las Salinas

  20. The ability of the branchiopod, Artemia salina, to graze upon harmful algal blooms caused by Alexandrium fundyense, Aureococcus anophagefferens, and Cochlodinium polykrikoides

    Science.gov (United States)

    Marcoval, M. Alejandra; Pan, Jerónimo; Tang, Yingzhong; Gobler, Christopher J.

    2013-10-01

    We present experiments that examined the grazing and survivorship of zooplankton native (Acartia tonsa) and non-native (Artemia salina) to NY (USA) estuaries when exposed to blooms and cultures of the three harmful algae native to NY, Alexandrium fundyense, Aureococcus anophagefferens (strains CCMP 1850 and CCMP 1984) and Cochlodinium polykrikoides. During experiments with cultures of A. anophagefferens, clearance rates (CR) of A. salina were significantly greater than those of A. tonsa for both algal strains examined. A. salina fed on cultures of C. polykrikoides at higher rates than all phytoplankton species examined, including the control diet (Rhodomonas salina), and faster than rates of A. tonsa fed C. polykrikoides. During experiments with A. fundyense, A. salina actively grazed all cell concentrations (250-1500 cells ml-1) while A. tonsa did not feed at any concentration. Percent mortality of A. salina and A. tonsa fed A. fundyense for 48 h were 43 ± 7.7% and 72 ± 7.8%, respectively, percentages significantly higher than those of individuals fed all other algal diets. During 25 field experiments using natural blooms of the three HAB species performed across six NY estuaries, A. salina significantly (p < 0.05) reduced cell densities of A. anophagefferens, C. polykrikoides, and A. fundyense relative to the control treatments in all but one experiment. The sum of these findings demonstrates that a failure to graze these HABs by the indigenous copepod, A. tonsa, may permit blooms to occur. In addition, the ability of A. salina to graze these HABs at densities that were inhibitory to A. tonsa suggests that A. salina could, in some circumstances, be considered as a part of mitigation strategy for these events.

  1. Characterisation of cholinesterases and evaluation of the inhibitory potential of chlorpyrifos and dichlorvos to Artemia salina and Artemia parthenogenetica.

    Science.gov (United States)

    Varó, I; Navarro, J C; Amat, F; Guilhermino, L

    2002-08-01

    In this study, the acute toxicity of the organophosphorous pesticides dichlorvos and chlorpyrifos to two different species of Artemia (A. salina and A. parthenogenetica) was evaluated. In addition, the in vivo effect of these two pesticides on cholinesterase (ChE) activity of both A. salina and A. parthenogenetica was also determined. The characterisation of the ChE, using different substrates and specific inhibitors, and the normal range of activity in non-exposed individuals were previously investigated for both species. The results obtained indicate that the ChE of A. salina is different from that of A. parthenogenetica and that both enzymes cannot be classified neither as acetylcholinesterase nor as butyrylcholinesterase since they show intermediary characteristics between the two vertebrate forms. The range of normal ChE activity was 2.65+/-0.15 U/mg protein for A. salina, and 3.69+/-0.17 U/mg protein for A. parthenogenetica. Significant in vivo effects of both pesticides on Artemia ChE activity were found, at concentrations between 5.38 and 9.30 mg/l for dichlorvos and between 1.85 and 3.19 mg/l for chlorpyrifos. Both Artemia species are resistant to these pesticides and they are able to survive with more than 80% ChE inhibition. However, A. parthenogenetica is more resistant than A. salina, with about a 95% reduction in its ChE activity respect to the control for nauplii exposed to the median lethal concentrations (LC50), without lethal effects after 24 h of exposure.

  2. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Hianna A.M.F.; Sa, Jose L.F.; Lima, Claudia S.A.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: hiannaamfs@gmail.com, E-mail: luismuma6@gmail.com, E-mail: claudia.salima@gmail.com, E-mail: amancioff@bol.com.br, E-mail: amdemelo@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Biofisica e Radiobiologia; Ribeiro, Luanna R.S.; Santos, Gustavo H.F.; Silva, Edvane B., E-mail: luannaribeiro_lua@hotmail.com, E-mail: santosghf@hotmail.com, E-mail: edvborges@yahoo.com.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear. Grupo de Estudos em Radioprotecao e Radioecologia

    2013-07-01

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  3. PIGRAU SOLÉ, Antoni (ed.), Pueblos indígenas, diversidad cultural y justicia ambiental. Un estudio de las nuevas constituciones de Ecuador y Bolivia

    OpenAIRE

    2014-01-01

    PIGRAU SOLÉ, Antoni (ed.), Pueblos indígenas, diversidad cultural y justicia ambiental. Un estudio de las nuevas constituciones de Ecuador y Bolivia, Tirant Lo Blanch, Estudios Latinoamericanos, Valencia, 2013, 76

  4. Salimyxins and enhygrolides: antibiotic, sponge-related metabolites from the obligate marine myxobacterium Enhygromyxa salina.

    Science.gov (United States)

    Felder, Stephan; Kehraus, Stefan; Neu, Edith; Bierbaum, Gabriele; Schäberle, Till F; König, Gabriele M

    2013-07-22

    Unlike their terrestrial counterparts, marine myxobacteria are hardly investigated for their secondary metabolites. This study describes three new compounds (1-3), named salimyxins and enhygrolides, obtained from the obligate marine myxobacterium Enhygromyxa salina. These are the first natural products obtained from Enhygromyxa species. Their structures were elucidated by spectroscopic analysis, including NMR and CD spectroscopy. Enhygrolides are closely related to the nostoclides, which were initially isolated from a cyanobacterium of the genus Nostoc. The salimyxins, representing structurally most unusual degraded sterols, are close to identical to demethylincisterol from the sponge Homaxinella sp. Salimyxin B and enhygrolide A inhibit the growth of the Gram-positive bacterium Arthrobacter cristallopoietes (MIC salimyxin B, 8 μg mL⁻¹; enhygrolide A, 4 μg mL⁻¹).

  5. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading...... to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa......) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate...

  6. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Danielly Albuquerque da; Matias, Wemerson Neves; Lima, Igara Oliveira; Xavier, Aline Lira; Costa, Vivian Bruna Machado; Diniz, Margareth de Fatima Formiga Melo; Agra, Maria de Fatima; Batista, Leonia Maria; Souza, Maria de Fatima Vanderlei de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica Prof. Delby Fernandes de Medeiros; Silva, Davi Antas e [Universidade Federal Rural de Pernambuco, Serra Talhada, PE (Brazil). Dept. de Quimica

    2009-07-01

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-{beta}-D-glucopyranoside, stigmasterol 3-O-{beta}-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides {beta}-sitosterol, kaempferol 3-O-{beta}-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-{alpha}-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, {sup 1}H and {sup 13}C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  7. First secondary metabolites from Herissantia crispa L (Brizicky and the toxicity activity against Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Danielly Albuquerque da Costa

    2009-01-01

    Full Text Available The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol, 3,5,7,3',4'-pentahydroxyflavone (quercetin, unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil (tiliroside glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin, described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, ¹H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out.

  8. Preliminary results of the Artemia salina experiments in biostack on LDEF

    Science.gov (United States)

    Graul, E. H.; Ruether, W.; Hiendl, C. O.

    1992-01-01

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions.

  9. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  10. Altered lipid accumulation in Nannochloropsis salina CCAP849/3 following EMS and UV induced mutagenesis

    Directory of Open Access Journals (Sweden)

    T.A. Beacham

    2015-09-01

    Full Text Available Microalgae have potential as a chemical feed stock in a range of industrial applications. Nannochloropsis salina was subject to EMS mutagenesis and the highest lipid containing cells selected using fluorescence-activated cell sorting. Assessment of growth, lipid content and fatty acid composition identified mutant strains displaying a range of altered traits including changes in the PUFA content and a total FAME increase of up to 156% that of the wild type strain. Combined with a reduction in growth this demonstrated a productivity increase of up to 76%. Following UV mutagenesis, lipid accumulation of the mutant cultures was elevated to more than 3 fold that of the wild type strain, however reduced growth rates resulted in a reduction in overall productivity. Changes observed are indicative of alterations to the regulation of the omega 6 Kennedy pathway. The importance of these variations in physiology for industrial applications such as biofuel production is discussed.

  11. Pastas de Rhodomonas salina (Cryptophyta como alimento para Brachionus plicatilis (Rotifera

    Directory of Open Access Journals (Sweden)

    Miguel Guevara

    2011-12-01

    Full Text Available Pastas de Rhodomonas salina, obtenidas mediante centrifugación y floculación con quitosano y preservadas con o sin vitamina C, a -20°C fueron evaluadas bioquímicamente y proporcionadas como alimento al rotífero Brachionus plicatilis. Las pastas microalgales: (1 centrifugada y con vitamina C (CV, (2 centrifugada y sin vitamina C (C, (3 floculada y con vitamina C (FV y (4 floculada y sin adición de vitamina C (F; mantuvieron sus contenidos de proteínas y lípidos totales similares al cultivo control, con valores de 40.0±2.32% y 12.0±1.45%, respectivamente. La relación feofitina a/clorofila a fue similar (0.09-0.11 entre las pastas centrifugadas y el cultivo control, pero mayor en las pastas floculadas (1.28-1.48. Las pastas centrifugadas presentaron porcentajes de PUFAs totales, EPA y DHA similares al cultivo control (PUFAs: 47%, EPA: 4% y DHA: 4.7% y superiores al de las pastas floculadas. Las pastas obtenidas por centrifugación indujeron un crecimiento del rotífero igual al obtenido con el alimento control (densidad máxima: 320rotíferos/mL; tasa instantánea de crecimiento: 0.23rotíferos/día, fecundidad: 1.49huevos/ hembra y productividad: 43x103rotíferos/L/día. Se concluye que la pasta de R. salina centrifugada y congelada a -20°C, durante cuatro semanas, sin adición de vitamina C, mantiene su calidad nutricional similar a la del alga fresca y puede ser usada como alimento de Brachionus plicatilis.

  12. Evaluation of toxicity of polluted marine sediments from Bahia Salina Cruz, Mexico.

    Science.gov (United States)

    Gonzalez-Lozano, Maria Cristina; Mendez-Rodriguez, Lia C; Maeda-Martinez, Alejandro M; Murugan, Gopal; Vazquez-Botello, Alfonso

    2010-01-01

    Bahia Salina Cruz, Oaxaca, Mexico is a major center of oil and refined product distribution on the Mexican Pacific coast. From the start of oil industry operations in 1979, negative effects from discharges of treated effluents in the bay have been a constant concern for local communities. We analyzed 28 surface sediment samples obtained in June, 2002 to evaluate the level of toxicity in the littoral zone, port-harbor, and La Ventosa estuary in Bahia Salina Cruz. The extractable organic matter concentration was high (1,213 to 7,505 micro g g(-1)) in 5 of 7 stations from the port and harbor, whereas it was low in 12 of 16 stations in the littoral zone (36 to 98 micro g g(-1)). The total aromatic hydrocarbon concentration was highest (57 to 142 micro g g(-1)) in the port and harbor compared to the La Ventosa estuary and the littoral zone. Among the heavy metals analyzed, cadmium exceeded the effects range-low values associated with adverse biological effects. The geo-accumulation index of sediments was moderate to strong contamination at 5 stations in the nonlittoral and 6 stations in the littoral zone. The enrichment of lead, zinc, and cadmium at 5 stations from the littoral, port, and harbor suggest that these metals are of anthropogenic origin. Bioassay tests of elutriates of sediments on nauplii of Artemia franciscana and Artemia sp. showed that the port and harbor were more toxic than the La Ventosa estuary and the coastal zone. The Microtox test (Vibrio fischeri) did not show a similar response with the solid phase of the sediments. The results of this study indicate that the high levels of organic content and metals in the sediments of port-harbor and the La Ventosa estuary are mainly caused by anthropogenic activities.

  13. El peritaje cultural como medio de prueba dentro del proceso penal, por el respeto de la identidad cultural de los pueblos indígenas

    OpenAIRE

    Soto Aguilar, Manuel Emilio; Pacheco Hernández, Daniel

    2014-01-01

    Analizamos varios insumos teóricos y casos a nivel nacional e internacional vinculados con el tema del acceso de la justicia para los pueblos indígenas, particularmente a través de la herramienta del peritaje cultural y el peritaje jurídico antropológico, como medios eficaces para garantizar una justicia pronta y cumplida que respete la identidad de los pueblos y personas indígenas.

  14. ¿Soberania del pueblo o de los pueblos? La doble cara de la soberanía durante la revolución de la independencia (1810-1820

    Directory of Open Access Journals (Sweden)

    Genevi\\u00E8ve Verdo

    2002-01-01

    Full Text Available La revolución de independencia como proceso político toma pleno sentido cuando se lo estudia en el marco de los vínculos que unían las ciudades del antiguo virreinato, y la manera en que evolucionan sus relaciones. En esta perspectiva, el problema de la representación y de la concepción del pueblo soberano son claves. Ellas se presentan bajo un doble aspecto: la concepción tradicional que consideraba a las ciudades como los sujetos de la soberanía, que es la que triunfa en la práctica, y una concepción más moderna del pueblo, la de los dirigentes revolucionarios, quienes consideraban al pueblo como una entidad única y abstracta, compuesta de individuos. La historia de la primera década de la revolución se presenta, en buena parte, como una serie de intentos por parte del poder central por conciliar estas dos tendencias, que tienen que ser vistas como las dos caras de un mismo proyecto. A lo largo del período estudiado, observamos que la búsqueda de la autonomía por parte de los pueblos no es contradictoria con la voluntad de permanecer unidos. Eso da lugar a una formulación híbrida, y por lo tanto muy original, del sujeto de la soberanía y de su delegación, cuyas formas más acabadas se formulan durante el Congreso de Tucumán y en la Constitución de 1819.

  15. Pastas de Rhodomonas salina (Cryptophyta como alimento para Brachionus plicatilis (Rotifera

    Directory of Open Access Journals (Sweden)

    Miguel Guevara

    2011-12-01

    Full Text Available Pastas de Rhodomonas salina, obtenidas mediante centrifugación y floculación con quitosano y preservadas con o sin vitamina C, a -20°C fueron evaluadas bioquímicamente y proporcionadas como alimento al rotífero Brachionus plicatilis. Las pastas microalgales: (1 centrifugada y con vitamina C (CV, (2 centrifugada y sin vitamina C (C, (3 floculada y con vitamina C (FV y (4 floculada y sin adición de vitamina C (F; mantuvieron sus contenidos de proteínas y lípidos totales similares al cultivo control, con valores de 40.0±2.32% y 12.0±1.45%, respectivamente. La relación feofitina a/clorofila a fue similar (0.09-0.11 entre las pastas centrifugadas y el cultivo control, pero mayor en las pastas floculadas (1.28-1.48. Las pastas centrifugadas presentaron porcentajes de PUFAs totales, EPA y DHA similares al cultivo control (PUFAs: 47%, EPA: 4% y DHA: 4.7% y superiores al de las pastas floculadas. Las pastas obtenidas por centrifugación indujeron un crecimiento del rotífero igual al obtenido con el alimento control (densidad máxima: 320rotíferos/mL; tasa instantánea de crecimiento: 0.23rotíferos/día, fecundidad: 1.49huevos/ hembra y productividad: 43x103rotíferos/L/día. Se concluye que la pasta de R. salina centrifugada y congelada a -20°C, durante cuatro semanas, sin adición de vitamina C, mantiene su calidad nutricional similar a la del alga fresca y puede ser usada como alimento de Brachionus plicatilis.Rhodomonas salina (Cryptophyta pastes as feed for Brachionus plicatilis (Rotifera. Rotifers are an important live feed for first feeding larvae of many fish species. The use of concentrated algae cells in the mass culture of the rotifer Brachionus plicatilis (Brachionidae has opened new horizons for research on this organism. Pastes of Rhodomonas salina (Pyrenomonadaceae obtained either by centrifugation or flocculation with chitosan were preserved, with or without vitamin C, at -20°C for four weeks and were evaluated

  16. Breve historia del pueblo de Israel, ayer y hoy, ¿puede haber una esperanza de paz en ese territorio?

    Directory of Open Access Journals (Sweden)

    María Hernández-Sampelayo

    2010-01-01

    Full Text Available La historia del pueblo de Israel, desde la Antigüedad, iniciaría, a partir de su asentamiento en el territorio de Palestina, uno los conflictos más prolongados del siglo XX, aún no resuelto. El objetivo de este artículo es hacer un recorrido por la historia del pueblo de Israel, y profundizar en el análisis del conflicto árabe-israelí, analizando la viabilidad de un proceso de paz hasta hoy no concretado._____________ABSTRACT:The history of the Israeli people, since the Antiquity, would start with their settlement in the territory of Palestine, one of the largest conflicts of the XX century, still in process. The aim of this article is to make a panoramic of the Israeli history and deeply analyze the Arabic-Israeli conflict, analyzing the effectiveness of a peace process not finished until today.

  17. Necrophilous beetles diversity (Coleoptera: Scarabaeidae, Silphidae, Staphylinidae and Trogidae) in a semiarid area of Zapotitlán de las Salinas Valley, Puebla, México

    National Research Council Canada - National Science Library

    Jiménez-Sánchez, Esteban; Quezada-García, Roberto; Padilla-Ramírez, Jorge

    2013-01-01

    ... in the Zapotitlán de las Salinas Valley in Puebla, Mexico. Over a one-year period, monthly samples were collected from five different vegetation systems that included the scrublands, a columnar cactus landscape, and altered vegetation...

  18. 26th National Congress of the Italian Association of Veterinary Food Hygienists | Isola di Salina (ME, 14-16 September 2016

    Directory of Open Access Journals (Sweden)

    Tiziana Civera

    2016-09-01

    Full Text Available This abstract book contains the abstracts presented at the 26th National Congress of the Italian Association of Veterinary Food Hygienists | Isola di Salina (ME, Italy, 14-16 September 2016.

  19. PUEBLOS INDÍGENAS VENEZOLANOS Y SU RELACIÓN CON EL AMBIENTE

    Directory of Open Access Journals (Sweden)

    Yénniffer Jiménez

    2012-05-01

    apreciadas a pesar de ser tan amplias como la cantidad de estos pueblos en Latinoamérica. El propósito del estudio fue realizar una investigación que permitiera mostrar la visión de algunos pueblos indígenas venezolanos sobre su relación con el ambiente natural, a fin de promover la reflexión sobre sus valores ambientales, y proponer un modelo para la promoción de una cultura ambiental sostenible, necesarios para la Educación Ambiental, para lo cual se proponen lineamientos orientadores, a fin de preservar la relación cultural y ambiental de los pueblos indígenas venezolanos. Para esto, se realizó una recolección exhaustiva en diferentes fuentes relacionadas con el tema, para finalizar con un bosquejo de seis comunidades indígenas venezolanas: Waraos, Pemones, Yanomami, Wayúu, Bari y Wóthüha, además de plantear algunos factores esenciales que podrían tener influencia positiva en la toma de decisiones ambientalistas y el uso responsable de los ecosistemas venezolanos.

  20. El problema de la inclusión de los Derechos Humanos en el Derecho de los Pueblos

    Directory of Open Access Journals (Sweden)

    Luciana Gabriela Soria

    2017-02-01

    Full Text Available Este trabajo presenta algunas de las nociones centrales del Derecho de los Pueblos de Rawls con el objetivo de analizar el contenido y el estatus que juegan los derechos humanos en dicha teoría. Al final, se concluye que los derechos humanos presentan ciertas ambigüedades que habilitan una lectura minimalista y al mismo tiempo maximalista de los derechos y de las normas.

  1. ¿La ‘soberanía de la tierra’ como alternativa? Hacia un contracercamiento de los pueblos

    NARCIS (Netherlands)

    S.M. Borras jr. (Saturnino); J.C. Franco (Jennifer)

    2012-01-01

    textabstract1. La soberanía de la tierra se refiere al derecho que tienen los pueblos trabajadores al acceso efectivo a la tierra, al uso de ella y a su control, así como a los beneficios de su uso y ocupación, entendiendo la tierra como un recurso, como territorio y como paisaje. 2. La soberanía de

  2. El derecho a la consulta previa de los pueblos indígenas en el Perú

    OpenAIRE

    Alva Arévalo, Amelia

    2010-01-01

    International audience; El presente estudio tiene por finalidad describir el tratamiento de la consulta previa en el Perú, como mecanismo de participación de los pueblos indígenas en las medidas legislativas y administrativas que les afecten directamente. Para ello nos hemos fijado los siguientes objetivos: i. Determinar el progreso del reconocimiento constitucional y legal, nacional e internacional, de este derecho; ii. Fijar los mecanismos institucionales creados para su ejercicio; y iii. E...

  3. ¿La ‘soberanía de la tierra’ como alternativa? Hacia un contracercamiento de los pueblos

    NARCIS (Netherlands)

    S.M. Borras jr. (Saturnino); J.C. Franco (Jennifer)

    2012-01-01

    textabstract1. La soberanía de la tierra se refiere al derecho que tienen los pueblos trabajadores al acceso efectivo a la tierra, al uso de ella y a su control, así como a los beneficios de su uso y ocupación, entendiendo la tierra como un recurso, como territorio y como paisaje. 2. La soberanía de

  4. The Carotenogenesis Pathway via the Isoprenoid-β-carotene Interference Approach in a New Strain of Dunaliella salina Isolated from Baja California Mexico

    Directory of Open Access Journals (Sweden)

    Luis Enrique Gutierrez-Millan

    2009-02-01

    Full Text Available D. salina is one of the recognized natural sources to produce β-carotene, and an useful model for studying the role of inhibitors and enhancers of carotenogenesis. However there is little information in D. salina regarding whether the isoprenoid substrate can be influenced by stress factors (carotenogenic or selective inhibitors which in turn may further contribute to elucidate the early steps of carotenogenesis and biosynthesis of β-carotene. In this study,Dunaliella salina (BC02 isolated from La Salina BC Mexico, was subjected to the method of isoprenoids-β-carotene interference in order to promote the interruption or accumulation of the programmed biosynthesis of carotenoids. When Carotenogenic and non-carotenogenic cells of D. salina BC02 were grown under photoautotrophicgrowth conditions in the presence of 200 µM fosmidomycin, carotenogenesis and the synthesis of β-carotene were interrupted after two days in cultured D. salina cells. This result is an indirect consequence of the inhibition of the synthesis of isoprenoids and activity of the recombinant DXR enzyme thereby preventing the conversionof 1-deoxy-D-xylulose 5-phosphate (DXP to 2-C-methyl-D-erythritol (MEP and consequently interrupts the early steps of carotenogenesis in D. salina. The effect at the level of proteins and RNA was not evident. Mevinolin treated D. salina cells exhibited carotenogenesis and β-carotene levels very similar to those of control cell cultures indicating that mevinolin not pursued any indirect action in the biosynthesis of isoprenoids and had no effect at the level of the HMG-CoA reductase, the key enzyme of the Ac/MVA pathway.

  5. Proyecto Vidas Paralelas Indígena: revelando el pueblo guaraní de Espírito Santo, Brasil

    Directory of Open Access Journals (Sweden)

    Vilma Benedito de OLIVEIRA

    2012-03-01

    Full Text Available Este relato de experiencia se refiere al pueblo Guarani de la aldea Boa Esperança (Tekoa Porã, localizada en el municipio de Aracruz (Estado de Espíritu Santo. Ese pueblo, perteneciente al grupo Mbya, migró en la década de 1940, partiendo de Rio Grande do Sul hasta llegar a su ubicación actual. Se destaca el conflicto con la multinacional Aracruz Celulose, la lucha por la posesión de la tierra y la reciente regularización de las tierras de los pueblos Guarani y Tupinikim. En lo que se refiere a su cultura, se detaca su espiritualidad y el uso de un local sagrado no habiendo, sin embargo, un pajé que atienda otras necesidades. Con Saúde Indígena Tempus - Actas de Saúde Coletiva Revista Tempus Actas de Saúde Coletiva 50 respecto a la atención a la salud de la población, hay necesidad de ampliación de cobertura y de mejor infraestructura. Destacase también la necesidad de formación de un número mayor de estudiantes indígenas en universidades.

  6. SANTIAGO DEL ESTERO Y SUS PUEBLOS DE INDIOS. DE LAS ORDENANZAS DE ALFARO (1612 A LAS GUERRAS DE INDEPENDENCIA

    Directory of Open Access Journals (Sweden)

    Judith Farberman

    2008-01-01

    Full Text Available A partir de las ordenanzas de Francisco de Alfaro, las aldeas indígenas bajo el régimen de encomienda se institucionalizaron como pueblos de indios. Como es sabido, la reducción, el mantenimiento de las tierras de comunidad, el respeto por las autoridades indígenas tradicionales y la designación de alcaldes, además del reemplazo del servicio personal por un tributo, fueron las principales medidas que se procuró implementar. En Santiago del Estero, zona no alterada por la política de desnaturalizaciones posterior a las rebeliones calchaquíes, las disposiciones alfarianas no tuvieron un carácter meramente formal. Configurando un cuadro bastante excepcional en el escenario tucumano (salvando quizás la jurisdicción de Jujuy, los pueblos de indios y su estructura institucional sobrevivieron hasta poco después de las revoluciones de independencia. Nuestra hipótesis es que la perduración de los pueblos de indios santiagueños se vinculó a la puesta en marcha de una serie de estrategias. El matrimonio preferencial, la migración temporaria, la integración a los mercados de bienes y mano de obra y los cambios en los sistemas de autoridad son algunas de las variables que serán analizadas en la ponencia.

  7. Uranium mobility and accumulation along the Rio Paguate, Jackpile Mine in Laguna Pueblo, NM.

    Science.gov (United States)

    Blake, Johanna M; De Vore, Cherie L; Avasarala, Sumant; Ali, Abdul-Mehdi; Roldan, Claudia; Bowers, Fenton; Spilde, Michael N; Artyushkova, Kateryna; Kirk, Matthew F; Peterson, Eric; Rodriguez-Freire, Lucia; Cerrato, José M

    2017-04-19

    The mobility and accumulation of uranium (U) along the Rio Paguate, adjacent to the Jackpile Mine, in Laguna Pueblo, New Mexico was investigated using aqueous chemistry, electron microprobe, X-ray diffraction and spectroscopy analyses. Given that it is not common to identify elevated concentrations of U in surface water sources, the Rio Paguate is a unique site that concerns the Laguna Pueblo community. This study aims to better understand the solid chemistry of abandoned mine waste sediments from the Jackpile Mine and identify key hydrogeological and geochemical processes that affect the fate of U along the Rio Paguate. Solid analyses using X-ray fluorescence determined that sediments located in the Jackpile Mine contain ranges of 320 to 9200 mg kg(-1) U. The presence of coffinite, a U(iv)-bearing mineral, was identified by X-ray diffraction analyses in abandoned mine waste solids exposed to several decades of weathering and oxidation. The dissolution of these U-bearing minerals from abandoned mine wastes could contribute to U mobility during rain events. The U concentration in surface waters sampled closest to mine wastes are highest during the southwestern monsoon season. Samples collected from September 2014 to August 2016 showed higher U concentrations in surface water adjacent to the Jackpile Mine (35.3 to 772 μg L(-1)) compared with those at a wetland 4.5 kilometers downstream of the mine (5.77 to 110 μg L(-1)). Sediments co-located in the stream bed and bank along the reach between the mine and wetland had low U concentrations (range 1-5 mg kg(-1)) compared to concentrations in wetland sediments with higher organic matter (14-15%) and U concentrations (2-21 mg kg(-1)). Approximately 10% of the total U in wetland sediments was amenable to complexation with 1 mM sodium bicarbonate in batch experiments; a decrease of U concentration in solution was observed over time in these experiments likely due to re-association with sediments in the reactor. The

  8. Sobre el principio de autodeterminación de los pueblos indios

    Directory of Open Access Journals (Sweden)

    Angélica PORRAS

    2009-11-01

    Full Text Available RESUMEN: El principio de autodeterminación de los pueblos ha sido criticado principalmente desde dos posiciones teóricas. Una que encuentra contradicción entre los conceptos de derechos individuales y derechos colectivos, categoría en la que suele situarse a la autodeterminación. Otra, se refiere a sus supuestas consecuencias negativas, la indeterminación, la inestabilidad y la superposición a otras nacionalidades. Este artículo sostiene que las nociones de derechos individuales y derechos colectivos no se contraponen sino más bien se complementan, tanto es así, que se puede afirmar que los derechos colectivos nacen de los derechos individuales y estos les sirven a los primeros como límite, especialmente a través de los derechos de libertad, democracia y justicia social. Por otra parte, los fundamentos de la indeterminación del sujeto, inestabilidad y superposición a otras nacionalidades atribuídas a la autodeterminación pueden superarse después de un cuidadoso análisis. La indeterminación del sujeto se resuelve si el concepto "pueblo" es pensado en términos de sentimientos de pertenencia o identificación con un grupo. La inestabilidad y superposición a otras nacionalidades se superaría con la introducciónde procesos de negociación.ABSTRACT: The principle of the self-determination of the people has been criticized from two theoretic positions. The first argues that there exist a contradiction between individual rights and collective rights -people self determination is a collective right. The second argues that indeterminacy, instability and overlapping nationalities are its consecuences. This paper argues that the concepts of individual rights and collective rights aren't contradictory but complementary. The collective rights are the offspring of individual rights. The individual rights especially liberty, democracy and social justice will limit the exercise of the collective rights. Furthermore shows that the motives

  9. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  10. Laboratory scale photobioreactor for high production of microalgae Rhodomonas salina used as food for intensive copepod cultures

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Jepsen, Per Meyer; Hansen, Benni Winding

    Introduction Microalgae are essential feeds for many cultured molluscs, larvae of marine fishes, crustaceans as well as other important live feeds including rotifers, Artemia and copepods (Muller-Feuga, 2000). Microalgae are grown either in open culture systems (ponds) or closed systems...... (photobioreactor - PBR). There is an increasing interest in using closed PBRs for algae cultivation since this culture system provides a better control of cultivation conditions and enables higher algae productivity. Among the marine microalgae, the cryptophyte Rhodomonas salina is one of the optimal feed...... for copepods (Støttrup and Jensen, 1990; Zhang et al., 2013). Despite the benefit of using R. salina in cultivation of copepods, to our knowledge, there is no report on the production of this microalga at industrial scale to supply sufficient food for mass production of copepods. We intend to conduct the basic...

  11. Toxicity of tannins towards the free-living nematode Caenorhabditis elegans and the brine shrimp Artemia salina.

    Science.gov (United States)

    Yamasaki, Toru; Sato, Masashi; Mori, Tomoaki; Mohamed, Ahmed S A; Fujii, Kyoko; Tsukioka, Junko

    2002-08-01

    Toxicities of gallo- and condensed tannins towards the free-living nematode Caenorhabditis elegans is dependent on the tannins' molecular sizes. In the present paper we investigate the toxicity of ellagitannins to C elegans and the toxicity of ellagi-, gallo-, and condensed tannins to the brine shrimpArtemia salina. Ellagitannins 1 and 2 were isolated from Euphorbia supina and identified as tellimagrandin I and rugosin A methyl ester, respectively. An ellagitannin preparation from Cornus officinalis was chromatographically fractionated into ellagitannins A through H, having different molecular weights and specific rotations. Three of the ten ellagitannins, 2, G, and H produced significant toxicity towards C. elegans, showing the presence of an activity-structure relationship, as opposed to the results from tests of gallo- and condensed tannins. Ellagi-, gallo-, and condensed tannins also produced toxicity in A. salina.

  12. Biotechnological potential of Synechocystis salina co-cultures with selected microalgae and cyanobacteria: Nutrients removal, biomass and lipid production.

    Science.gov (United States)

    Gonçalves, Ana L; Pires, José C M; Simões, Manuel

    2016-01-01

    Cultivation of microalgae and cyanobacteria has been the focus of several research studies worldwide, due to the huge biotechnological potential of these photosynthetic microorganisms. However, production of these microorganisms is still not economically viable. One possible alternative to improve the economic feasibility of the process is the use of consortia between microalgae and/or cyanobacteria. In this study, Chlorella vulgaris, Pseudokirchneriella subcapitata and Microcystis aeruginosa were co-cultivated with Synechocystis salina to evaluate how dual-species cultures can influence biomass and lipid production and nutrients removal. Results have shown that the three studied consortia achieved higher biomass productivities than the individual cultures. Additionally, nitrogen and phosphorus consumption rates by the consortia provided final concentrations below the values established by European Union legislation for these nutrients. In the case of lipid productivities, higher values were determined when S. salina was co-cultivated with P. subcapitata and M. aeruginosa.

  13. Effect of specific light supply rate on photosynthetic efficiency of Nannochloropsis salina in a continuous flat plate photobioreactor.

    Science.gov (United States)

    Sforza, Eleonora; Calvaruso, Claudio; Meneghesso, Andrea; Morosinotto, Tomas; Bertucco, Alberto

    2015-10-01

    In this work, Nannochloropsis salina was cultivated in a continuous-flow flat-plate photobioreactor, working at different residence times and irradiations to study the effect of the specific light supply rate on biomass productivity and photosynthetic efficiency. Changes in residence times lead to different steady-state cell concentrations and specific growth rates. We observed that cultures at steady concentration were exposed to different values of light intensity per cell. This specific light supply rate was shown to affect the photosynthetic status of the cells, monitored by fluorescence measurements. High specific light supply rate can lead to saturation and photoinhibition phenomena if the biomass concentration is not optimized for the selected operating conditions. Energy balances were applied to quantify the biomass growth yield and maintenance requirements in N. salina cells.

  14. Biodiesel Fuel Production from Marine Microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and Measurement of its Viscosity and Density

    Directory of Open Access Journals (Sweden)

    T. Sujin Jeba Kumar

    2013-01-01

    Full Text Available Biodiesel is a fuel derives from transesterification of fats and oils. It is renewable and non-toxic ecofriendly fuel with less CO2 and NO2 emissions. Microalgae are known to contain more lipid content than macroalgae and most other oil crops. In this study, we extracted biodiesel from three microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and also measured the density and viscosity of biofuel obtained from these microalgae. Pavlova lutheri yielded more oil than the other two algae with biomass left over Dunaliella salina was more. The density of biodiesel obtained from these microalgae was between 0.86 g/cm3 and 0.90 g/cm3 with viscosity in the range 3.92 mm2/sec to 4.5 mm2/sec showing high density than the other oils.

  15. Cloning and sequence analysis of the gene encoding 19-kD subunit of Complex I from Dunaliella salina.

    Science.gov (United States)

    Liu, Yi; Qiao, Dai Rong; Zheng, Hong Bo; Dai, Xu Lan; Bai, Lin Han; Zeng, Jing; Cao, Yi

    2008-09-01

    NADH:ubiquinone oxidoreductase (complex I ) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone coupled to proton translocation across the membrane. The cDNA sequence of Dunaliella salina mitochondrial NADH: ubiquinone oxidoreductase 19-kD subunit contains a 682-bp ORF encoding a protein with an apparent molecular mass of 19 kD. The sequence has been submitted to the GenBank database under Accession No. EF566890 (cDNA sequences) and EF566891 (genomic sequence). The deduced amino-acid sequence is 74% identical to Chlamydomonas reinhardtii mitochondrial NADH:ubiquinone oxidoreductase 18-kD subunit. The 19-kD subunit mRNA expression was observed in oxygen deficiency, salt treatment, and rotenone treatment with lower levels. It demonstrate that the 19-kD subunit of Complex I from Dunaliella salina is regulated by these stresses.

  16. Pueblos indígenas de Sonora: el agua, ¿es de todos?

    Directory of Open Access Journals (Sweden)

    Diana Luque

    2012-01-01

    Full Text Available La diversidad cultural y la problemática ambiental del agua en el estado de Sonora convergen en el presente trabajo, abordadas desde la perspectiva de la ecología política y la diversidad biocultural mediante un análisis transdisciplinario. Se distingue entre el acceso al agua para la subsistencia tradicional del agua para el desarrollo. Se advierten tendencias generalizadas de despojo de los territorios indígenas y sus recursos naturales, en las que los conflictos por el agua para la subsistencia son cada vez más graves, que exacerban la vulnerabilidad de las comunidades y la desorganización del complejo biocultural. El servicio del agua potable no tiene las condiciones para impulsar el desarrollo comunitario sustentable. Estas tendencias no son homogéneas, y se observan posibilidades de reconfiguración. Se requiere precisar el análisis para aportar al desarrollo de los pueblos indígenas, desde una plataforma biocultural contemporánea, en pleno respeto de sus derechos humanos individuales y colectivos.

  17. PROCESOS ÉTNICOS Y CULTURA EN LOS PUEBLOS INDÍGENAS DE CHILE

    Directory of Open Access Journals (Sweden)

    Hans Gundermann K.

    2013-07-01

    Full Text Available Durante las últimas dos décadas las culturas de los pueblos originarios del país quedan inscritas en el corazón de las movilizaciones étnicas y de la política indígena de los recientes gobiernos democráticos y, con ello, experimentan una nueva dinámica e importantes transformaciones. La cultura es a la vez el fundamento y objeto estratégico de acción en la emergencia indígena desarrollada en el periodo. Su conformación como sujetos colectivos se establece desde el recurso a la cultura propia, que les otorga especificidad. También se constituye en objeto de una política cultural y de diversos cursos de acción. Participan de ello agentes culturales indígenas, agencias públicas especializadas y grupos e instituciones de la sociedad civil. De su concurrencia se gesta un proceso nuevo de construcción social de lo cultural indígena, cuya estructuración toma la forma de un dominio o campo de lo cultural indígena en Chile.

  18. Alteridad latinoamericana y sujeto-pueblo en la obra temprana de Enrique Dussel

    Directory of Open Access Journals (Sweden)

    Guillermo Barón del Pópolo

    2012-10-01

    Full Text Available The following article intends an overview on Enrique Dussel’s early work and the examination of the development process of political and philosophical categories such as the ones of “Latin-American identity / otherness”; “Latin-American thought” and political and historical subjects. The corpus covered in this study includes the author’s anthropological-philosophical research on the origins and fundamentals of the western culture (Christianity as they appear in the trilogy: El humanismo semita, El humanismo helénico and El dualismo en la antropología de la Cristiandad; the first development of otherness and analectic and the proposition of a new political subject (pueblo in Método para una filosofía de la liberación and Para una ética de la liberación latinoamericana. A review of the first author’s historiographical experiences is included as well by the study of his book: Hipótesis para una historia de la Iglesia en América Latina.

  19. Pueblos indígenas, Estado y Territorio en tiempos interculturales en la provincia de Salta

    Directory of Open Access Journals (Sweden)

    Mariana Andrea Schmidt

    2011-12-01

    Full Text Available La configuración del Estado argentino hacia fines del siglo XIX y principios del XX tuvo como uno de sus móviles principales la eliminación, asimilación e invisibilización de los pueblos indígenas. En las últimas décadas del siglo XX, se ha pasado de una política de invisibilización y homogeneización a otra de visibilización y reconocimiento de la diversidad cultural, promoviéndose la diversidad territorial, cultural y lingüística acallada durante décadas. El objetivo del presente artículo es indagar en las características asumidas por estos procesos en la provincia de Salta. Partiendo de considerar al Chaco salteño como territorio históricamente imaginado como indígena, interesa pensar cómo juegan estos imaginarios territoriales a la hora de diseñar e implementar políticas públicas para este territorio y su población.

  20. TUTELA CONSTITUCIONAL DE LOS DERECHOS DE NUESTROS PUEBLOS INDÍGENAS

    Directory of Open Access Journals (Sweden)

    Federico Justiniano Robledo

    2002-01-01

    Full Text Available En este artículo se plantea y analiza el tema de los derechos de los pueblos originarios en América latina, considerando una perspectiva de antecedentes históricos y jurisprudenciales, además de documentos de la Iglesia Católica, hasta llegar a nuestra realidad contemporánea. En esta última perspectiva se analiza el régimen jurídico de protección de los derechos indígenas en la Constitución Política y el derecho público vigente en Argentina.In this article, the topic of the rights of the native people in Latin America is stated and analyzed, considering an outlook of legal and historical backgrounds and Roman Catholic Church documents until arriving at out contemporary reality. In this final outlook, the judicial regime of protection of the indigenous rights in the Political Constitution and the current public law in Argentina are analyzed.

  1. La encomienda entre los pueblos de la provincia paez en el siglo XVII

    Directory of Open Access Journals (Sweden)

    Marcela Quiroga Zuluaga

    2010-01-01

    Full Text Available Este artículo observa el establecimiento de la encomienda entre los pueblos paecesen la gobernación de Popayán. Es necesario señalar que, comparado con otros procesos de implantación de esta forma de control de la población indígena en el suelo americano, el caso de las encomiendas entre los paeces presenta ciertas particularidades. En primer lugar, de orden temporal, pues ella sólo tomó forma efectiva hasta el siglo XVII. En segundo lugar, en lo concerniente a su configuración y su desarrollo. Estas particularidades fueron la consecuencia de la resistencia india, así como una realidad indígena móvil y sociopolíticamente dispersa. De esta manera, la encomienda asociada al proceso de sometimiento de los paeces no fue ni formal ni temporal ni espacialmente uniforme. Para su consolidación, ella solicita la acción conjunta de múltiples estrategias y actores del poder colonial.

  2. La territorialidad de los pueblos originarios: una historia de despojos y violaciones en el Abya Yala

    Directory of Open Access Journals (Sweden)

    Jenny Gonzáles-Muños

    2012-10-01

    PALABRAS-CHAVE: Pueblos indígenas de América Latina, territorialidad, despojo. RÉSUMÉ: Le territoire pour les populations autochtones implique une relation d'identité et de l'auto-construction et la reconnaissance de soi l'espace communautaire qui synthétise les éléments impliqués dans un passé commun, c'est à dire historique, c’est la vision du monde comme l'endroit où il fait toutes les relations sociales essentielles enregistré pour la continuité culturelle dans un large éventail de droits et des devoirs collectifs. Pour les peuples indigènes d'Amérique latine, la territorialité a à voir avec l'héritage ancestral, et pas seulement un morceau de terre capitalisés, sa valeur est sacrée et communautaire, et non économique. Depuis le XVe siècle, ces peuples ont souffert le viol et la dépossession de leurs terres ancestrales, une situation que même dans le XXIe siècle reste bien réel.   MOTS-CLÉS: Peuples indigènes d'Amérique latine, territorialité, dépossession.

  3. Water resources on the Pueblo of Laguna, west-central New Mexico

    Science.gov (United States)

    Risser, D.W.; Lyford, F.P.

    1983-01-01

    This study evaluates the quality and quantity of water available on the Pueblo of Laguna, New Mexico. Groundwater for public supply occurs in the valley fill along the Rio San Jose, in the Paguate and Encinal areas, and possibly in the northern part of the Sedillo Grant. The valley fill in the Rio San Jose will supply 50 to 450 gallons per minute of potable water to properly constructed wells. In the alluvium along Rio Paguate, additional development of as much as 250 gallons per minute is possible. Groundwater for irrigation is restricted by available yields and quality to the valley fill along the Rio San Jose and possibly the western part of the Major 's Ranch area. In the Rio San Jose valley yields of 50 to 450 gallons per minute of water containing 500 to 3,000 milligrams per liter are possible. Digital-model simulations of the valley-fill aquifer west of the Village of Laguna show a potential salvage of as much as 900 acre-feet per year of evapotranspiration losses if water levels are lowered. Model studies also indicate that the winter flow of the Rio San Jose could be used to recharge groundwater stored in the valley. (USGS)

  4. Biodiesel Fuel Production from Marine Microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and Measurement of its Viscosity and Density

    OpenAIRE

    T. Sujin Jeba Kumar; C.K. Balavigneswaran; K.P. Srinivasakumar

    2013-01-01

    Biodiesel is a fuel derives from transesterification of fats and oils. It is renewable and non-toxic ecofriendly fuel with less CO2 and NO2 emissions. Microalgae are known to contain more lipid content than macroalgae and most other oil crops. In this study, we extracted biodiesel from three microalgae Isochrysis galbana, Pavlova lutheri, Dunaliella salina and also measured the density and viscosity of biofuel obtained from these microalgae. Pavlova lutheri yielded more oil than the other two...

  5. Desenvolvimento de mudas de pinhão-manso irrigadas com água salina

    Directory of Open Access Journals (Sweden)

    Fábio Santos Matos

    2013-08-01

    Full Text Available O uso de água salina na irrigação torna-se importante alternativa diante daescassez de água de boa qualidade em todo o mundo. O pinhão-manso (Jatropha curcas L. possui baixa exigência hídrica, sobrevive e apresenta produção satisfatória em solos de baixa fertilidade. No entanto, a sua produção é maior em cultivos irrigados, o que reforça a necessidade de desenvolvimento de pesquisas para uso de água salina. Este trabalho objetivou avaliar o efeito de diferentes níveis de salinidade da água de irrigação nas características morfofisiológicas de mudas de pinhão-manso. Para isso, foi conduzido experimento em casa de vegetação com interceptação de 50 % da radiação solar, localizada na Universidade Estadual de Goiás, Ipameri, Goiás. O experimento foi conduzido em vasos com capacidade de 4 L de solo, utilizando-se o delineamento inteiramente casualizado, com quatro tratamentos e cinco repetições. As plantas foram irrigadas diariamente com 150 mL de água não salina, durante os 30 primeiros dias após a germinação das sementes. Do 31º ao 50º dia, as plantas foram submetidas a quatro tratamentos: plantas diariamente irrigadas com água de condutividade elétrica igual a 0,5; 8; 16 e 24 dS m-1. Aos 50 dias após a germinação, analisaram-se as seguintes características nas mudas de pinhão-manso: número de folhas; altura de planta; diâmetro de ramo; teor relativo de água; área foliar; clorofila total; razões de massa radicular, massa caulinar, massa foliar e parte aérea/sistema radicular; e biomassa total. Os resultados evidenciaram que as mudas de pinhão-manso irrigadas com água de condutividade elétrica 8 dS m-1 não apresentaram redução do crescimento vegetativo. Todavia, a água de irrigação com condutividade elétrica 16 dS m-1 causou redução no crescimento vegetativo e elevou a senescência e abscisão foliar. Água com condutividade elétrica elétrica de pinhão-manso na fase de mudas.

  6. Identifying primary stressors impacting macroinvertebrates in the Salinas River (California, USA): Relative effects of pesticides and suspended particles

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, B.S. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)]. E-mail: anderson@ucdavis.edu; Phillips, B.M. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Hunt, J.W. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States); Connor, V. [Division of Water Quality, State Water Resources Control Board, 1001 I. Street, Sacramento, CA 95814 (United States); Richard, N. [Division of Water Quality, State Water Resources Control Board, 1001 I. Street, Sacramento, CA 95814 (United States); Tjeerdema, R.S. [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)

    2006-06-15

    Laboratory dose-response experiments with organophosphate and pyrethroid pesticides, and dose-response experiments with increasing particle loads were used to determine which of these stressors were likely responsible for the toxicity and macroinvertebrate impacts previously observed in the Salinas River. Experiments were conducted with the amphipod Hyalella azteca, the baetid mayfly Procloeon sp., and the midge Chironomus dilutus (Shobanov, formerly Chironomus tentans). The results indicate the primary stressor impacting H. azteca was pesticides, including chlorpyrifos and permethrin. The mayfly Procloeon sp. was sensitive to chlorpyrifos and permethrin within the range of concentrations of these pesticides measured in the river. Chironomus dilutus were sensitive to chlorpyrifos within the ranges of concentrations measured in the river. None of the species tested were affected by turbidity as high as 1000 NTUs. The current study shows that pesticides are more important acute stressors of macroinvertebrates than suspended sediments in the Salinas River. - Pesticides are the primary stressor impacting macroinvertebrates in sections of the lower Salinas River.

  7. Primary Screening of the Bioactivity of Brackishwater Cyanobacteria: Toxicity of Crude Extracts to Artemia salina Larvae and Paracentrotus lividus Embryos

    Directory of Open Access Journals (Sweden)

    Viviana R. Lopes

    2010-03-01

    Full Text Available Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  8. Multicriteria analysis as a tool to investigate compatibility between conservation and development on Salina Island, Aeolian Archipelago, Italy

    Science.gov (United States)

    Bodini, Antonio; Giavelli, Giovanni

    1992-09-01

    Several multicriteria evaluation techniques have been developed since the 1970s. The need to compare different territorial policies has justified their introduction into environmental research. These methods are based on the numerical manipulation of heterogeneous information, which varies in terms of reference scale and type of measure (continuous, ordinal, qualitative, binary, etc.). During recent years, diverse investigations have focused on general conditions on Salina, the “green island” of the Aeolian archipelago. Such studies, within an interdisciplinary project, aimed to explore the possibility of implementing conservation strategies that are compatible with human needs, landscape preservation, and sustainable economic development. Three different evaluation techniques are applied, namely multicriteria weighted concordance and discordance analysis and a qualitative procedure. They are used to compare four alternative plans for the socioeconomic development of Salina Island. These plans lie between extreme alternatives: total protection of natural resources and maximizing economic development based on tourism. The plans are compared to each other on the basis of 14 criteria that reflect the socioenvironmental perception of Salina's inhabitants. The approach used in this research seems particularly fruitful because of its flexibility: it offers decision makers the chance to manage heterogeneous data and information that is not easily quantifiable. Such “soft” information helps to evaluate environmental conditions more precisely, and to make a less damaging choice among alternative development plans.

  9. Primary screening of the bioactivity of brackishwater cyanobacteria: toxicity of crude extracts to Artemia salina larvae and Paracentrotus lividus embryos.

    Science.gov (United States)

    Lopes, Viviana R; Fernández, Nuria; Martins, Rosário F; Vasconcelos, Vitor

    2010-03-05

    Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  10. Protective effect induced by atropine, carbamates, and 2-pyridine aldoxime methoiodide Artemia salina larvae exposed to fonofos and phosphamidon.

    Science.gov (United States)

    Victoria Barahona, M; Sánchez-Fortún, Sebastián

    2007-01-01

    The acute toxicity of fonofos and phosphamidon on three age classes of Artemia salina was evaluated. An increase in toxicity of these organophosphorous (OP) insecticides was found following longer development of A. salina. The effects of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterease inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on OP-induced lethality in 24 h Artemia were also investigated. The lethal action of both OP insecticides was prevented by pretreatment of 24 h Artemia with atropine and 2-PAM, while physostigmine proved ineffective against intoxication with both OP insecticides and pyridostigmine exhibited a low synergic effect. In both cases, the inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Combined pretreatment of atropine (10(-5)M) plus physostigmine practically abolished the lethal effects induced by both insecticides. Pretreatment with 2-PAM (10(-6)M) plus physostigmine afforded maximal protection of 100% and 76% on the lethality induced by fonofos and phosphamidon, respectively. The data obtained suggest that the combination of atropine plus 2-PAM or physostigmine and the combined pretreatment of 2-PAM plus physostigmine are effective in the prevention of the lethal effects induced by fonofos and phosphamidon in A. salina larvae.

  11. Toxicity assessment of metabolites of fungal biocontrol agents using two different (Artemia salina and Daphnia magna) invertebrate bioassays.

    Science.gov (United States)

    Favilla, M; Macchia, L; Gallo, A; Altomare, C

    2006-11-01

    Fungal biocontrol agents (BCAs) have been marketed for control of crop pests, weeds, and diseases. However, BCAs may produce toxic metabolites, whose presence in the formulated products, in the crops and in the environment should be considered along with the associated risk. Two invertebrate models, viz. Artemia salina and Daphnia magna were used to assess the acute toxicity of seven BCA metabolites, characterized by different chemical nature and mode of action, namely alamethicin (ALA), paracelsin (PCS), antiamoebin (AAM), gliotoxin (GTX), destruxin A (DA), oosporein (OOS), and elsinochrome A (EA). The two invertebrates were very sensitive to all the metabolites examined, except OOS. The LC50s after 24 and 36 h exposures showed the following toxicity ranks: A. salina, DA > ALA > EA > GTX > AAM > PCS (LC50s ranging from 9.78 to 40.84 microg/ml at 24 h and from 2.92 to 18.56 microg/ml at 36 h); D. magna, DA > GTX = EA > ALA > PCS > AAM (LC50s ranging from 0.20 to 24.41 microg/ml at 24h and from 0.16 to 11.98 microg/ml at 36 h). LC50 of OOS to D. magna increased dramatically in 36 h exposure, compared to 24 h exposures (5.84 and 68.40 microg/ml, respectively). A. salina and D. magna proved to be suitable models for rapid and inexpensive screening of toxicity of BCAs at an early stage of product development.

  12. Colorimetric Evaluation of the Viability of the Microalga Dunaliella Salina as a Test Tool for Nanomaterial Toxicity.

    Science.gov (United States)

    Golubev, Alexander A; Prilepskii, Artur Y; Dykman, Lev A; Khlebtsov, Nikolai G; Bogatyrev, Vladimir A

    2016-05-01

    A diagnostic test system was developed to determine the toxicity of nanomaterials to the saltwater microalga Dunaliella salina through evaluation of cell death and changes in the culture growth rate at various toxicant concentrations, providing LC50 and other toxicological metrics. The viability of cells was shown to decrease with decreasing chlorophyll absorption of red light by damaged cells. This correlation was confirmed by independent fluorescence microscopic measurements of live and dead cells in the population. Two standard colorless pollutants, hydrogen peroxide and formaldehyde, were used to validate the colorimetric method. The method's performance is exemplified with three Ag-containing preparations (Ag nitrate, Ag proteinate, and 20-nm Ag nanoparticles) and with cetyltrimethylammonium bromide (CTAB) mixed with colloidal 15-nm Au and 20-nm Ag nanoparticles. The toxicity of the Ag-containing preparations to D. salina decreased in the order Ag nitrate ≥ Ag proteinate ≫ colloidal Ag. The toxicity of colloidal Au-CTAB mixtures was found to depend mostly on the content of free CTAB. The toxicity of colloidal Ag increased substantially in the presence of CTAB. The results suggest that our D. salina-based colorimetric test system can be used for simple and rapid preliminary screening of the toxicity of different nanomaterials.

  13. [Immunocytochemical studies on the phase of differentiation of hatching gland cells in brine shrimp, Artemia salina].

    Science.gov (United States)

    Li, Ling; Fan, Ting Jun; Wang, Xiao Feng; Cong, Ri Shan; Yu, Qiu Tao; Zhong, Qi Wang

    2004-04-01

    Hatching enzyme (HE), synthesized in hatching gland cells (HGCs), plays vital roles in animal hatching. Immunocytochemical techniques employing anti-GST-UVS.2 antiserum, prepared from Xenopus HE and with specificity to brine shrimp HE, were first used to investigate the differentiation and variability of hatching gland cells (HGCs) in the hatching process of embryos of brine shrimp, Artemia salina, in this study. HGCs with immunoreactivity to anti-GST-UVS.2 antiserum were identified, for the first time, in brine shrimp embryos during hatching process. Immunocytochemical staining results showed that, (1) HE-positive immunoreactivity is really specific to Artemia HE, and its appearance and disappearance are closely correlated with the hatching process of Artemia salina. (2) Artemia HGCs, first appeared in embryos 5 hours before hatching and disappeared 4 hours after hatching, were also a transient type of cells, with an existence period of 9 hours. (3) The head portion of Artemia embryo is probably the initial position of HE secretion, and likely to be the main position of HE secretion as well. The detailed process and mechanism need to be studied. (4) The appearance of HGCs is in a synchronous mode from places all over the embryos, and their disappearance is also in a synchronous mode. (5) The number of HGCs increased gradually along with embryo development process and reached a maximum number at hatching. Contrarily, the number of HGCs decreased gradually after hatching, and HGCs disappeared 5 hours after hatching. However, the intensity of HE-positive reaction was almost at the same level at the period of HGCs'presence. (6) Artemia HGCs were distributed throughout the body of embryos at all time during their presence. Therefore, it can concluded that Artemia HGCs, as a transient type of cells, first appeared in embryos 4 hours before hatching and disappeared in embryos 5 hours after hatching, and with distinguished patterns of appearance, disappearance and

  14. Análisis de subsidencia de la Cuenca de las Salinas, Sierras Pampeanas occidentales

    Directory of Open Access Journals (Sweden)

    Edgardo A. Azeglio

    2008-06-01

    Full Text Available En el presente trabajo se ha evaluado la subsidencia total de la cuenca de Las Salinas mediante diagramas tiempo - profundidad, considerando la subsidencia inicial, por carga y termotectónica. También se calculó la velocidad de subsidencia interválica en función del tiempo geológico. El área en estudio se ubica aproximadamente entre los paralelos 31°17´S y 32°40´S y los meridianos 66°38´W y 67°48´W en las cercanías de la localidad de Marayes, en el sitio denominado cuenca de Las Salinas. Los diagramas tiempo - profundidad permitieron relacionar cambios en la velocidad de subsidencia de la cuenca durante el proceso distensivo del Mesozoico y el actualmente compresional a la cual esta sometida, obteniéndose valores concordantes con áreas circundantes. Como resultado del análisis se encontró que la velocidad de subsidencia inicial fue de 0,0017 mm/año en el Carbonífero, la que fue aumentando lentamente hasta alcanzar los 0,00875 mm/año en el Cretácico. Este incremento disminuye sensiblemente durante el Cretácico superior, para posteriormente incrementarse abruptamente en el Terciario (0,043 mm/año. Este régimen se mantiene durante el Plioceno a Mioceno, alcanzando valores promedios de 0,269 mm/año, culminando con valores de 0,0973 mm/año. De la comparación entre ambos diagramas de subsidencia se observan distintos ritmos de sedimentación entre el sector norte y sur de la cuenca que podría ser la consecuencia de un fallamiento en el basamento. La comparación de estos valores con los obtenidos en la cuenca de Beazley indican que si bien los valores de subsidencia inicial y ritmo de sedimentación fueron similares. El inicio de la subsidencia en la cuenca de Beazley, se produjo con posterioridad (en el Triásico. La componente termotectónica en ambas cuencas es similar a pesar que el gradiente térmico normal de la zona aumenta sensiblemente en dirección sur.

  15. Effect of salinity on metal mobility in Sečovlje salina sediment (northern Adriatic, Slovenia)

    Science.gov (United States)

    Kovač, N.; Ramšak, T.; Glavaš, N.; Dolenec, M.; Rogan Šmuc, N.

    2016-12-01

    Saline sediment (saline healing mud or "fango") from the Sečovlje Salina (northern Adriatic, Slovenia) is traditionally used in the coastal health resorts as a virgin material for medical treatment, wellness and relax purposes. Therapeutic qualities of the healing mud depend on its mineralogical composition and physical, mineralogical, geochemical and biological properties. Their microbial and potentially toxic elements contamination are the most important features affecting user safety. However, the degree of metal toxicity (and its regulation) for natural healing mud is still under discussion. Therefore, the influence of the overlying water salinity on the mobility of heavy metals (and some other geochemical characteristic) was studied for saline sediments of the Sečovlje Salina. Experiments takes place in tanks under defined conditions i.e. at day (21 °C): night (16 °C) cycle for three months. Sediment was covered with water of different salinities (36, 155, 323 g NaCl L-1 and distillate water) and mixed/stirred every week during the experimental period. At the same time, the evaporated water was replaced with distilled water. The mud samples were analyzed, at the beginning and at the end of experiment, for mineral (XRD), elemental composition (ICP-MS) and organic content (% TOC, % TN). Geochemical analysis of the aqueous phase (content of cations and anions) have also been carried out in an accredited Canadian laboratory Actlabs (Activation Laboratories, Canada). Salinity and maturation of sediment does not significantly affect its mineral composition. The samples taken at the end of the experiment have higher percent of water but lower organic carbon concentration. Concentrations of investigated elements are comparable to that in surface sediments from Central Adriatic Sea. In the water phase, concentrations of most elements (As, Ba, Cu, Mo, Mn, Ni, Sr, Sb) rise from the beginning to the end of the experiment, whereas the metal (potentially toxic elements

  16. TOXIC ACTIVITIES OF HEXANE EXTRACT AND COLUMN CHROMATOGRAPHY FRACTIONS OF RODENT TUBER PLANT (Typhonium flagelliforme Lodd. ON Artemia salina

    Directory of Open Access Journals (Sweden)

    Nesti F. Sianipar

    2013-04-01

    Full Text Available Rodent tuber (Typhonium flagelliforme Lodd. is a medicinal plant  particularly found in Java. The plant is used as an ingredient for  conventional cancer treatment. The aim of this study was to determine the toxic activities of crude extracts and column chromatography fractions of  rodent tuber on Artemia salina larvae. Rodent tuber plant was obtained  from the Indonesian Spice and Medicinal Crops Research Institute in  Bogor, West Java. The experiment was conducted in the Biology  Laboratory of Universitas Pelita Harapan, Tangerang, Banten. Leaves and petioles of the plant were macerated with acetone and the filtrates were evaporated (40°C to obtain crude extracts. The crude extracts were partitioned with ethyl acetate, followed with hexane, chloroform and  butanol. Toxicity test of the extracts was performed using the Brine Shrimp Lethality Test (BSLT method on A. salina larvae. Extract showing the most toxic was fractioned using column chromatography and then tested on the larvae. The experiment was designed in a completely randomized  factorial, four replicates for crude extracts and two replicates for the fractions. Treatments were different types of extracts (hexane, chloroform and butanol at various concentrations (500, 1,000 and 1,500 μg ml-1 of 5% Tween solution. Fractions of the column chromatography used were taken from the column number 1, 3 and 10, and tested their toxicities at 200, 400, 600, 800 and 1,000 μg ml-1 of 5% Tween solution. Parameters observed were the death of A. salina expressed as LC50. The study  showed that hexane extract of the petioles had the most toxic to A. salina (LC50 = 762.08 μg ml-1. Fraction number 10 showed the highest toxic (LC50 = 381.07 μg ml-1, whereas the lowest was fraction number 3 (LC50 = 653.13 μg ml-1. The study indicates that rodent tuber plant from Bogor is toxic to A. salina and further test for its cytotoxic activity is justified.

  17. Purification and characterization of hatching enzyme from brine shrimp Artemia salina.

    Science.gov (United States)

    Fan, Tingjun; Wang, Jing; Yuan, Wenpeng; Zhong, Qiwang; Shi, Ying; Cong, Rishan

    2010-02-01

    By using Artemia chorion as a specific substrate, the hatching enzyme from Artemia salina (AHE) was purified by gel-filtration and ion-exchange chromatography, and characterized biochemically and enzymatically in this study. It was found that the AHE had a molecular weight of 82.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and often contained 73.3 kDa molecules in preparation. The AHE had obvious choriolytic activity, which was optimal at pH 7.0 and a temperature of 408C. The Km value of the AHE for dimethyl casein was 8.20 mg/ml. The AHE activity was almost completely inhibited by soybean trypsin inhibitor and p-amidinophenyl methane sulfonyl fluoride hydrochloride, greatly inhibited by N-tosyl-L-lysyl chloromethyl ketone, phenylmethanesulfonyl fluoride, and lima bean trypsin inhibitor, slightly inhibited by pepstatin, N-tosyl-L-phenylalanyl chloromethyl ketone, leupeptin, N-ethylmaleimide, and iodoacetamide, and not inhibited by chymostatin and bestatin. All these results imply that AHE is most probably a trypsin-type serine protease. Besides of these, AHE was also sensitive to EDTA and Zn21. Combined with the results that the EDTA-pre-treated HE activity could be perfectly recovered by Zn21, it is indicated that AHE might be also a kind of Zn-metalloprotease.

  18. Tolerance to cadmium and cadmium-binding ligands in Great Salt Lake brine shrimp (Artemia salina)

    Energy Technology Data Exchange (ETDEWEB)

    Jayasekara, S.; Drown, D.B.; Sharma, R.P.

    1986-02-01

    Information on the accumulation of cadmium in cytosolic proteins of Great Lake brine shrimp (Artemia salina) was obtained from animals collected directly from the lake and also from animal hatched and maintained in three sublethal concentrations of cadmium (0.5, 2.0, 5.0 ppm) in saltwater aquaria. Brine shrimp growth under these conditions was monitored by measuring body lengths during a 7-day exposure period. Heat-stable, cadmium-binding ligands were isolated and identified by Sephadex G-75 chromatography and atomic absorption spectrophotometry. Cadmium was found to be equally distributed between high and low molecular weight proteins in animals collected from the lake and the 0.5 ppm cadmium group. There was also a slight growth stimulation noted in the 0.5-pm group. Higher cadmium incorporation was noted in low molecular weight fractions with increasing cadmium concentration in the exposure media. Low molecular weight fractions were also found to have high uv absorption characteristics at 250 nm and low absorption at 280 nm. Molecular weight of the cadmium-binding ligands was found to be 11,000 as estimated by the gel filtration method. De novo synthesis of this protein was increased as a function of cadmium concentration in the media. However, slow accumulation of cadmium in other protein fractions was also noticed in higher cadmium exposure groups, suggesting the existence of possible tolerance mechanisms in brine shrimp exposed to suspected acute cadmium concentrations.

  19. Un carnaval para el yo lésbico: Los cuentos de Gilda Salinas

    Directory of Open Access Journals (Sweden)

    Elena Madrigal

    2011-01-01

    Full Text Available Gilda Salinas rompe las unidades cuentísticas tradicionales al hacer de cada texto de Del destete al desempance. Cuentos lésbicos y un colado un episodio en la vida de una lesbiana que, con “voz propia”, narra sus peripecias nocturnas por la ciudad de México, de los años setenta a la actualidad. Al ubicar las acciones en sitios de diversión lésbica que no existen más, la voz, cual cronista, rescata un ámbito de la vida homosexual a la vez que fija bromas y códigos lingüísticos que por su origen oral hubieran corrido el riesgo de perderse con las generaciones que los animaron. Sus estrategias carnavalizan el tema lésbico a la vez que legitiman la validez de las búsquedas expresivas y de comportamiento del ser lesbiana en un tiempo y en un lugar. Su aportación en los planos del género literario y de la formación de constantes en la narrativa homosexual mexicana indudablemente enriquece los medios expresivos, la visibilidad, la diversidad, las vidas y las historias de la y las lesbianas.

  20. Analyzing the movement of the Nauplius 'Artemia salina' by optical tracking of plasmonic nanoparticles.

    Science.gov (United States)

    Kirchner, Silke R; Fedoruk, Michael; Lohmüller, Theobald; Feldmann, Jochen

    2014-07-15

    We demonstrate how optical tweezers may provide a sensitive tool to analyze the fluidic vibrations generated by the movement of small aquatic organisms. A single gold nanoparticle held by an optical tweezer is used as a sensor to quantify the rhythmic motion of a Nauplius larva (Artemia salina) in a water sample. This is achieved by monitoring the time dependent displacement of the trapped nanoparticle as a consequence of the Nauplius activity. A Fourier analysis of the nanoparticle's position then yields a frequency spectrum that is characteristic to the motion of the observed species. This experiment demonstrates the capability of this method to measure and characterize the activity of small aquatic larvae without the requirement to observe them directly and to gain information about the position of the larvae with respect to the trapped particle. Overall, this approach could give an insight on the vitality of certain species found in an aquatic ecosystem and could expand the range of conventional methods for analyzing water samples.

  1. Comparative evaluation of short-term toxicity of inorganic arsenic compounds on Artemia salina.

    Science.gov (United States)

    GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Purdel, Nicoleta Carmen; Ilie, Mihaela; NeamŢu, Marius Cristian; Dănciulescu Miulescu, Rucsandra; Avramescu, Elena Taina; Margină, Denisa Marilena

    2015-01-01

    The study aimed to assess the short-term effects exerted by two inorganic arsenic species (arsenite and arsenate) on Artemia salina after 24, 48 and 72 h. The dose-lethality curves obtained indicate that the lethality induced by arsenite was higher than by arsenate. The lowest observed effect concentration for arsenite (0.5 μg/mL) is similar with the no observed effect concentration for arsenate, thus indicating that the toxicity of arsenite is higher compared with arsenate. Also, the lethal concentration 50 values confirm that arsenite induced about 1.24-fold higher toxicity than arsenate at 24 h and about three-fold higher toxicity at 48 h and 72 h of exposure. Both LC50 (lethal concentration 50) values are indicating negligible effects exhibited by arsenic at this trophic level after short-term exposure. The predicted no effect concentration in the surface aquatic compartment corresponds to 10.38 μg/L, similar to the limit imposed by Directive 98/83/EC.

  2. Toxicity assessment of fumonisins using the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Hartl, M; Humpf, H U

    2000-12-01

    The Fusarium mycotoxins fumonisin B(1) (FB(1)) (1) and B(2) (FB(2)) (2), their hydrolysed analogues HFB(1) (3) and HFB(2) (4) and the recently discovered fumonisin derivatives N-palmitoyl-HFB(1) (5) and N-carboxymethyl-FB(1) (6) were compared for their toxicity in a short term bioassay using brine shrimp (Artemia salina). The brine shrimp were hatched in artificial sea water and exposed to the fumonisins in microwell plates with a mortality endpoint after 48 hours. LC(50) values were calculated after Probit transformation of the resulting data. Of the substances tested, fumonisin B(1) emerged to be the most toxic whereas its N-carboxymethyl analogue was 100-fold less effective. The hydrolysed fumonisins showed a four- to sixfold reduced toxicity compared to FB(1). N-Palmitoyl-HFB(1) had a higher LC(50) value than its precursor HFB(1). The brine shrimp assay proved to be a convenient and rapid system for toxicity assessment of this group of mycotoxins.

  3. Artemia salina as test organism for assessment of acute toxicity of leachate water from landfills.

    Science.gov (United States)

    Svensson, B M; Mathiasson, L; Mårtensson, L; Bergström, S

    2005-03-01

    Artemia salina has, for the first time, been used as test organism for acute toxicity of leachate water from three landfills (the municipal landfills at Kristianstad, Sweden and Siauliai, Lithuania, and an industrial landfill at Stena fragmenting AB, Halmstad, as well as for leachate from Kristianstad treated in different ways in a pilot plan). Artemia can tolerate the high concentrations of chloride ions found in such waters. Large differences in toxicities were found, the leachate from Siauliai being the most toxic one. To increase the selectivity in the measurements, a fractionation was done by using ion exchange to separate ammonium/ammonia and metal ions from the leachate, and activated carbon adsorbents for organic pollutants. The influence of some metals and phenol compounds on the toxicity was investigated separately. It was found that most of the toxicity emanated from the ammonium/ammonia components in the leachate. However, there was also a significant contribution n from organic pollutants, other than phenol compounds, since separate experiments had in this latter case indicated negligible impact. The concentrations of metals were at a level, shown by separate experiments, where only small contribution to the toxicity could be expected.

  4. Effects of Light and Temperature on Fatty Acid Production in Nannochloropsis Salina

    Directory of Open Access Journals (Sweden)

    Braden Crowe

    2012-03-01

    Full Text Available Accurate prediction of algal biofuel yield will require empirical determination of physiological responses to the environment, particularly light and temperature. One strain of interest, Nannochloropsis salina, was subjected to ranges of light intensity (5–850 μmol m−2 s−1 and temperature (13–40 °C and its exponential growth rate, total fatty acids (TFA and fatty acid composition were measured. The maximum acclimated growth rate was 1.3 day−1 at 23 °C and 250 μmol m−2 s−1. Fatty acids were detected by gas chromatography with flame ionization detection (GC-FID after transesterification to corresponding fatty acid methyl esters (FAMEs. A sharp increase in TFA containing elevated palmitic acid (C16:0 and palmitoleic acid (C16:1 during exponential growth at high light was observed, indicating likely triacylglycerol accumulation due to photo-oxidative stress. Lower light resulted in increases in the relative abundance of unsaturated fatty acids; in thin cultures, increases were observed in palmitoleic and eicosapentaenoic acids (C20:5ω3. As cultures aged and the effective light intensity per cell converged to very low levels, fatty acid profiles became more similar and there was a notable increase of oleic acid (C18:1ω9. The amount of unsaturated fatty acids was inversely proportional to temperature, demonstrating physiological adaptations to increase membrane fluidity. These data will improve prediction of fatty acid characteristics and yields relevant to biofuel production.

  5. The Rhodomonas salina mitochondrial genome: bacteria-like operons, compact gene arrangement and complex repeat region.

    Science.gov (United States)

    Hauth, Amy M; Maier, Uwe G; Lang, B Franz; Burger, Gertraud

    2005-01-01

    To gain insight into the mitochondrial genome structure and gene content of a putatively ancestral group of eukaryotes, the cryptophytes, we sequenced the complete mitochondrial DNA of Rhodomonas salina. The 48 063 bp circular-mapping molecule codes for 2 rRNAs, 27 tRNAs and 40 proteins including 23 components of oxidative phosphorylation, 15 ribosomal proteins and two subunits of tat translocase. One potential protein (ORF161) is without assigned function. Only two introns occur in the genome; both are present within cox1 belong to group II and contain RT open reading frames. Primitive genome features include bacteria-like rRNAs and tRNAs, ribosomal protein genes organized in large clusters resembling bacterial operons and the presence of the otherwise rare genes such as rps1 and tatA. The highly compact gene organization contrasts with the presence of a 4.7 kb long, repeat-containing intergenic region. Repeat motifs approximately 40-700 bp long occur up to 31 times, forming a complex repeat structure. Tandem repeats are the major arrangement but the region also includes a large, approximately 3 kb, inverted repeat and several potentially stable approximately 40-80 bp long hairpin structures. We provide evidence that the large repeat region is involved in replication and transcription initiation, predict a promoter motif that occurs in three locations and discuss two likely scenarios of how this highly structured repeat region might have evolved.

  6. Synthesis and coating of nanosilver by vanillic acid and its effects on Dunaliella salina Teod.

    Directory of Open Access Journals (Sweden)

    Hajar Zamani

    2013-09-01

    Full Text Available Plant phenolics have high reducing capacity which can be exploited in the synthesis of nanomaterials. In the present study, phytoreductant vanillic acid is used to produce and coat silver nanoparticles. The effects of Ag nanoparticles on the unicellular green algae D. Salina were then investigated. Under optimum pH and temperature, silver ions were reduced to silver metal by vanillic acid. The absorption spectra of the silver nanoparticles showed a maximum band of 410 nm, which is characteristic of the surface plasmon resonance of silver nanoparticles. Dynamic light scattering (DLS showed a narrow distribution size with an average of 52 nm. High concentrations of Ag nanoparticles reduced growth, total carotenoids, chlorophyll content, phenolics and antioxidant activity of the algae. Based on these results, phytoreductant vanillic acid can be used for synthesis and coating of nanosilver. Due to the projected increase in quantities and types of nanomaterials which leads to their elevated release into the environment and also because of the toxicity of nanomaterials, an urgent need to evaluate the impacts of nano-sized particles on the environment and living organisms is felt.

  7. Characterization of the fatty acid composition of Nannochloropsis salina as a determinant of biodiesel properties

    Energy Technology Data Exchange (ETDEWEB)

    Mohammady, Nagwa Gamal-EIDin [Alexandria Univ, Alexandria (Egypt). Dept. of Botany and Microbiology

    2011-07-15

    Nannochloropsis salina was cultured batch-wise to evaluate the potential of the alga to produce biodiesel. The cells were harvested at the end of the exponential growth phase when the concentration was 18 . 10{sup 6} cells/mL culture. The growth estimated as dry weight from this cell number was (3.8 {+-} 0.7) mg/L. The lipid and triglyceride contents were 40% and 12% on a dry weight basis, respectively. The amount of the ratio triglycerides/total lipids was approximately 0.3. The composition of triglyceride fatty acid methyl esters (biodiesel) was analysed by gasliquid chromatography and identified as: C14:0, C16:0, C16:1, C18:0, C18:1, C18:2, C18:3, C20:1, and C20:5. The ratio of unsaturated to saturated fatty acid contents was approximately 4.4. Additionally, the characterization of each individual fatty acid ester was discussed with regard to the fuel properties of biodiesel produced by the alga.

  8. Effects of Light and Temperature on Fatty Acid Production in Nannochloropsis Salina

    Energy Technology Data Exchange (ETDEWEB)

    Van Wagenen, Jonathan M.; Miller, Tyler W.; Hobbs, Samuel J.; Hook, Paul W.; Crowe, Braden J.; Huesemann, Michael H.

    2012-03-12

    Accurate prediction of algal biofuel yield will require empirical determination of physiological responses to the climate, particularly light and temperature. One strain of interest, Nannochloropsis salina, was subjected to ranges of light intensity (5-850 {mu}mol m{sup -2} s{sup -1}) and temperature (13-40 C); exponential growth rate, total fatty acids (TFA) and fatty acid composition were measured. The maximum acclimated growth rate was 1.3 day{sup -1} at 23 C and 250 {mu}mol m{sup -2} s{sup -1}. Fatty acids were detected by gas chromatography with flame ionization detection (GC-FID) after transesterification to corresponding fatty acid methyl esters (FAME). A sharp increase in TFA containing elevated palmitic acid (C16:0) and palmitoleic acid (C16:1) during exponential growth at high light was observed, indicating likely triacylglycerol accumulation due to photo-oxidative stress. Lower light resulted in increases in the relative abundance of unsaturated fatty acids; in thin cultures, increases were observed in palmitoleic and eicosapentaenoeic acids (C20:5{omega}3). As cultures aged and the effective light intensity per cell converged to very low levels, fatty acid profiles became more similar and there was a notable increase of oleic acid (C18:1{omega}9). The amount of unsaturated fatty acids was inversely proportional to temperature, demonstrating physiological adaptations to increase membrane fluidity. This data will improve prediction of fatty acid characteristics and yields relevant to biofuel production.

  9. Growth and pigment development of Dunaliella salina Teod. in response to ammonium nitrate nutrition

    Directory of Open Access Journals (Sweden)

    Keramatollah Nikookar

    2013-09-01

    Full Text Available The microalgae, Dunaliella salina was isolated from Maharlu Salt Lake, south east of Shiraz, Iran. The isolated strain was identified by both morphological and physiological markers. The complete ITS region (ITS1 + ITS2 including the 5.8S rDNA gene used as molecular marker confirmed our identification. Growth and cell proliferation, total chlorophyll and carotenoid contents were determined in the presence of 0.125, 0.25, 0.50, 1.0 and 2.0 mM ammonium nitrate. After five weeks, a maximum cell density of about (4.4 ±0.21×106 mL-1 was observed in the growth medium containing 1mM NH4NO3. Increasing NH4NO3 concentrations up to 1mM, resulted in an increase in the cells total chlorophyll contents. The highest amount of cell carotenoid contents was produced in media containing the least amount of NH4NO3 (0.125 mM. Manipulating the type and amount of external nitrogen sources to induce the synthesis of the highest amounts of carotenoid compounds in this microalgae strain can be of great commercial values to food industries.

  10. Obtención de glicerol a partir de la Microalga Dunaliella Salina

    Directory of Open Access Journals (Sweden)

    Lisethy Hernández Nazario

    2000-08-01

    Full Text Available En el campo de la tecnología farmacéutica, el glicerol es un disolvente ampliamente utilizado en virtud de sus propiedades físico-químicas en la formulación de diferentes formas farmacéuticas. Se investigaron las posibilidades de obtención de glicerol como un subproducto del proceso de extracción de ß-carotenos a partir de cultivos de Dunaliella salina, desarrollados bajo régimen autotrófico en el Centro de Investigaciones de Energía Solar. El flujo tecnológico propuesto comprende el tratamiento de la biomasa con hidróxido de calcio, la filtración del producto resultante, la extracción del ß-carotenos con un solvente insoluble en agua y, por último, la separación del glicerol neutralizando convenientemente del filtrado con ácido. El rendimiento de glicerol fue del 4-5 %, valor susceptible de ser incrementado mediante la inducción metabólica de los cultivos.

  11. Research on the Pueblo culture settlement system from the North American Southwest: Results of the Sand Canyon-Castle Rock Community Archaeological Project

    Directory of Open Access Journals (Sweden)

    Radosław Palonka

    2015-02-01

    Full Text Available Investigating ancient Pueblo culture from the North American Southwest is challenging task involving cooperationof scientists from different disciplines, mainly archaeology, history, anthropology, and linguistics. There isalso a large body of information in native oral tradition that has enormous potential for enriching our knowledgeof the past and our understanding of how Pueblo societies functioned. The paper focuses on one of the mostintriguing periods of Pueblo Indians culture, the thirteenth century A.D., in the central Mesa Verde region onpresent Utah-Colorado border. It was the time of great development of Pueblo societies and close to the centuryfall of the settlement system and total migration from the area to what is present-day Arizona and New Mexico.One of the projects in the area is Sand Canyon-Castle Rock Community Archaeological Project. The projectfocuses on analysis and reconstruction of the settlement structure and socio-cultural changes that took placein Pueblo culture during the thirteenth century A.D. in Sand Canyon, Rock Creek Canyon and several othersmall canyons located in one subarea within the Mesa Verde region, Colorado.

  12. Historia de ideas e historia de lenguajes políticas: acerca del debate en torno a los usos de los términos "pueblo" y "pueblos" History of ideas and history of political languages: on the discussion about the "pueblo" and "pueblos" concepts

    Directory of Open Access Journals (Sweden)

    Elías J. Palti

    2005-07-01

    Full Text Available Los últimos veinte años han sido testigos de una transformación crucial en nuestros modos de concebir el proceso que llevaría a la quiebra del vínculo colonial con España. La visión dicotómica clásica que oponía el liberalismo latinoamericano al proverbial tradicionalismo y despotismo peninsular se habría tornado ya insostenible. Según han demostrado autores como François-Xavier Guerra, la crisis que conduciría a la independencia se trató de un proceso único, que comprendía de conjunto al Imperio, y que tenía, precisamente, su centro en la península, que será la más directamente afectada por la acefalía que entonces se produjo. Tal perspectiva nos abrirá una visión mucho más rica y compleja del proceso revolucionario hispanoamericano. Sin embargo, la quiebra de la oposición clásica liberalismo latinoamericano - tradicionalismo hispano se terminará resolviendo en una dicotomía inversa que opondrá ahora el liberalismo hispano al tradicionalismo latinoamericano. La persistencia de patrones sociales organicistas heredados de la Colonia, que harían de los "pueblos" (en plural, una vez caído el régimen monárquico, el depositario natural de la soberanía, impedirían aquí la emergencia de un concepto "moderno" de la nacionalidad como una entidad abstracta, homogénea y unificada. Como se intenta demostrar en el presente ensayo, esta visión deber ía, a su vez, revisarse a fin de desplegar las potencialidades implícitas para la escritura histórica en la profunda renovación teórico-metodológica que estos mismos autores produjeron en el campo.The last twenty years witnessed a radical transformation in our ways of conceiving of the process leading to the break of the colonial tie with Spain. Classical dichotomous perspectives that opposed Latin American liberalism to Spanish despotism have proven untenable. As many authors, following François-Xavier Guerra, have showed, the crisis that resulted in independence was

  13. HACIA UN MODELO DE DESARROLLO TURÍSTICO ALTERNATIVO EN LOS PUEBLOS BALNEARIOS DEL SUDESTE BONAERENSE

    Directory of Open Access Journals (Sweden)

    Facundo Martín Hernández

    2008-12-01

    Full Text Available El modelo de desarrollo turístico en las urbanizaciones del litoral marítimo bonaerense ha generado, desde fines del siglo XIX, una serie de problemáticas sociales, económicas y ambientales. El análisis de estas nos lleva a pensar al turismo en forma crítica, ya que al indagar los cuatro elementos constitutivos del mismo – paisaje, tierras, inversión (capital y trabajo- nos da como resultado un ineficiente manejo del recurso paisajístico, una intensa especulación inmobiliaria, inversiones sin un adecuado marco normativo, concentración de las riquezas generadas por la actividad y explotación laboral. La existencia de sectores que no se encuentran bajo este modelo de desarrollo turístico, –o con menor intensidad- en el litoral marítimo, están conformados por los llamados pueblos balnearios (Reta, Orense, Marisol, San Cayetano. Estos a diferencia de las ciudades balnearias (Mar del Plata, Villa Gesell, Pinamar, predominantemente masivas, y las villas balnearias, de carácter exclusivista (Mar Azul, Mar de las Pampas, Cariló, tienen el paisaje natural costero conservado, la venta de tierras en el frente costero limitado, desarrollo de PYMES turísticas, trabajo familiar y una mayor distribución de las ganancias. Sin embargo al investigar los proyectos de urbanización privada –countries y barrios privados- se puede observar un proceso que hemos definido como “avance de la frontera urbana” que tiene dos connotaciones socioterritoriales: eliminar los relictos de paisaje natural costero bonaerense y privatizar espacios de belleza escénica. Se partió de la siguiente hipótesis de trabajo: el paisaje natural y el tipo de sociabilidad es la base del desarrollo turístico en los pueblos balnearios, el avance del modelo urbano-turístico, opuesto a estas características, representa un riesgo para la economía local. Para prevenir el avance de un modelo agresivo con el ambiente natural, con la comunidad local y la turística se

  14. Educación, Identidad y Derechos como estrategias de desarrollo de los Pueblos Indígenas. II Decenio de los Pueblos Indígenas 2005-2015.

    OpenAIRE

    Gehrig, Rainer; Muñoz Sánchez, Práxedes

    2015-01-01

    A continuación presentamos en resumen los contenidos del libro en sus 15 capítulos divididos en tres partes temáticas. Estas deben entenderse como círculos concéntricos con sus solapamientos. Son como tres grandes hilos conductores de los capítulos desarrollados en esta publicación que abarca diferentes perspectivas: 1. Educación y cooperación como reto de Desarrollo comunitario en contextos indígenas; 2. Identidad cultural y Derechos de los Pueblos indígenas y 3. Interculturalidad, Evangeliz...

  15. Educación, Identidad y Derechos como estrategias de desarrollo de los Pueblos Indígenas. II Decenio de los Pueblos Indígenas 2005-2015.

    OpenAIRE

    Gehrig, Rainer; Muñoz Sánchez, Práxedes

    2015-01-01

    A continuación presentamos en resumen los contenidos del libro en sus 15 capítulos divididos en tres partes temáticas. Estas deben entenderse como círculos concéntricos con sus solapamientos. Son como tres grandes hilos conductores de los capítulos desarrollados en esta publicación que abarca diferentes perspectivas: 1. Educación y cooperación como reto de Desarrollo comunitario en contextos indígenas; 2. Identidad cultural y Derechos de los Pueblos indígenas y 3. Interculturalidad, Evangeliz...

  16. Understandings of reproductive tract infections in a peri-urban pueblo joven in Lima, Peru

    Directory of Open Access Journals (Sweden)

    Parker Kea

    2006-05-01

    Full Text Available Abstract Background Control programs for Reproductive Tract Infections (RTIs typically focus on increasing awareness of risks associated with different forms of sexual contact, and pay little attention to how or why people may link RTIs to other features of their physical or social environments. This paper describes how women in a peri-urban pueblo joven located in the coastal desert surrounding Lima, Peru conceptualize the links between RTIs, sexual behaviour, personal hygiene, and the adverse environment in which they live. Methods We combined qualitative interviews and a participatory voting exercise to examine social and physical environmental influences on RTIs and gynaecologic symptom interpretation. Results Knowledge of RTIs in general was limited, although knowledge of AIDS was higher. Perceived causes of RTIs fell into three categories: sexual contact with infected persons, personal hygiene and exposure to the contaminated physical environment, with AIDS clearly related to sexual contact. The adverse environment is thought to be a major contributor to vaginal discharge, "inflamed ovaries" and urinary tract infection. The more remote parts of this periurban squatter settlement, characterized by blowing sand and dust and limited access to clean water, are thought to exhibit higher rates of RTIs as a direct result of the adverse environment found there. Stigma associated with RTIs often keeps women from seeking care or obtaining information about gynaecologic symptoms, and favours explanations that avoid mention of sexual practices. Conclusion The discrepancy between demonstrated disease risk factors and personal explanations influenced by local environmental conditions and RTI-related stigma poses a challenge for prevention programs. Effective interventions need to take local understandings of RTIs into account as they engage in dialogue with communities about prevention and treatment of RTIs.

  17. Proyecto Vidas Paralelas Indígena: revelando el pueblo Pataxó de Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Cristina SANTOS

    2012-03-01

    Full Text Available Este relato de experiencia se refiere al grupo étnico Pataxó, que habita la Costa del Descubrimiento, en el sur del Estado de Bahia, Brasil, y en algunos lugares de Minas Gerais. Más especificamente se refiere a las aldeas de Barra Velha (Aldeia Madre y Coroa Vermelha, con 6.695 y 5.200 habitantes, Saúde Indígena Tempus - Actas de Saúde Coletiva Revista Tempus Actas de Saúde Coletiva 72 respectivamente. Este pueblo fue uno de los primeros a tener contacto con los portugueses y le fue prohibido hablar su lengua ancestral, que pertenece a la familia Maxacali, del tronco Macro-Jê, y que se encuentra en proceso de rescate. Se relata la historia reciente de conflictos, en 1951 y en 1990. Se describe la organización jerárquica de la comunidad y sus líderes elegidos por una asamblea, así como las instancias de representación y control social. Se relatan costumbres de alimentación y autocuidado, la influencia creciente de productos industrializados en los hábitos alimentarios, así como las enfermedades y dolencias más fecuentes. Hay varios estudiantes indígenas en universidades públicas. La atención a la salud es realizada por un equipo multiprofesional que se desplaza a la comunidad cada 15 días. Se destacan problemas de transporte.

  18. Del discurso a los hechos: el Estado mexicano y los pueblos indígenas de México

    OpenAIRE

    Edwards, Andrea Aguillar

    2015-01-01

    En este trabajo se presenta un análisis de contenido del Programa Especial para los Pueblos Indígenas 2014-2018, del gobierno mexicano, a partir del modelo para la Mediación Dialéctica de la Comunicación Social (Piñuel, 2002), que permite trascender la simple identifi cación de datos de carácter intra-textual, hacia la descripción de las situaciones y el contexto implicados en la producción de dicho texto, como elementos determinantes de su contenido, con el objeto de formular un sistema conc...

  19. Un enfoque diferente para la protección de los conocimientos tradicionales de los pueblos indígenas

    Directory of Open Access Journals (Sweden)

    Natalia Tobón-Franco

    2010-03-01

    vale a limitar. Por lo anterior, la autora sostiene que solo tendrá efectividad la propuesta de protec­ción que, luego de recolectar y analizar la información sobre leyes y prácticas con­suetudinarias de estos pueblos, acepte la naturaleza sagrada y no racional de estos conocimientos, reconozca la propiedad colectiva de los descubrimientos, entienda que las invenciones pueden tener carácter intergeneracional (sin perder novedad para su protección, no exija registros y sea ilimitada en el tiempo.

  20. Programa pueblos mágicos y desarrollo local: actores, dimensiones y perspectivas en El Oro, México

    OpenAIRE

    Carlos Alberto Pérez-Ramírez

    2016-01-01

    Este trabajo realiza un análisis de la imple- mentación del programa pueblos mágicos en El Oro, Estado de México, con la finalidad de conocer los alcances y limitaciones para el desarrollo local. La propuesta metodológica se fundamenta en los planteamientos de Arocena (2002), que delinea las bases para el estudio del desarrollo local con base en las variables: modo de desarrollo, sistema de actores e identidad local. Se concluye que es preciso posi...

  1. Programa pueblos mágicos y desarrollo local: actores, dimensiones y perspectivas en El Oro, México

    OpenAIRE

    Carlos Alberto Pérez-Ramírez; Diana Itzel Antolín-Espinosa

    2016-01-01

    Este trabajo realiza un análisis de la imple- mentación del programa pueblos mágicos en El Oro, Estado de México, con la finalidad de conocer los alcances y limitaciones para el desarrollo local. La propuesta metodológica se fundamenta en los planteamientos de Arocena (2002), que delinea las bases para el estudio del desarrollo local con base en las variables: modo de desarrollo, sistema de actores e identidad local. Se concluye que es preciso posi...

  2. Diferentes pero Iguales: los Pueblos Indígenas en México y el Acceso a la Justicia

    OpenAIRE

    Hernández, Rosalva Aída; Ortiz, Héctor Elizondo

    2003-01-01

    En este artículo discutiremos algunos retos para la construcción de un Estado multicultural en México y los avances alcanzados hasta la fecha en cuanto a las reformas del aparato legal que son necesarias para el pleno reconocimiento de los derechos de los pueblos indígenas. En una primera parte presentaremos el panorama general de pluralismo jurídico existente desde la época colonial y reconocido en 1992 por la Constitución mexicana (en el párrafo primero del artículo 4º constitucional). Des...

  3. El papel de la fauna en la cultura y la cosmovisión del pueblo Tarahumara, en el noroeste de México

    OpenAIRE

    Saucedo Sánchez de Tagle, Eduardo Rubén

    2015-01-01

    [ES] La tesis intenta determinar, a través del análisis antropológico, el lugar que ocupa actualmente la fauna en la cosmovisión tarahumara, el pueblo indígena más numeroso del norte de México. Pero además, enmarcado bajo ese objetivo general, el trabajo tiene también como trasfondo el tema de las relaciones culturales que han existido y existen entre los pueblos indígenas del norte de México, y los pueblos que históricamente han habitado el área cultural conocida como Mesoamérica, ubicada al...

  4. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  5. Antropología jurídica y superposición de sistemas normativos Estado/nación - pueblos indígenas: el caso actual del pueblo Mapuche.

    Directory of Open Access Journals (Sweden)

    Andrea Aravena Reyes

    2016-09-01

    Full Text Available La realidad de los pueblos indígenas tiene características muy variadas y complejas, que han sido abordadas desde distintas áreas del conocimiento, entre ellas la Antropología política y la Antropología jurídica, disciplinas que prestan especial atención a las dinámicas de poder. En el caso de esta investigación , dichas dinámicas se expresan en la relación jurídico-política que regula la interacción o interfaz entre el pueblo mapuche y el Estado de Chile en materia judicial. El presente artículo aborda el marco jurídico nacional chileno y el sistema consuetudinario mapuche, como expresiones culturales en diálogo y como fenómenos en interacción asimétrica y en conflicto. Para tales efectos, se analiza la perspectiva de los diferentes actores que participan en el proceso de interfaz jurídica, particularmente, en el contexto establecido por la Ley Indígena 19.253 (1993 y el Convenio 169 de la OIT. El interés por indagar en la materia corresponde a la necesidad de comprender las dinámicas que se despliegan en el encuentro e interacción de cuerpos o sistemas jurídicos y sociales culturalmente diferenciados.

  6. DERECHOS FUNDAMENTALES DE LOS PUEBLOS INDÍGENAS. EL CASO DEL PUEBLO EMBERA KATÍO Y LA REPRESA DE URRÁ: UN ANÁLISIS DESDE LA CORTE CONSTITUCIONAL COLOMBIANA

    Directory of Open Access Journals (Sweden)

    Gerardo A. Durango Álvarez

    2008-11-01

    Full Text Available En Colombia existen, a partir de la Constitución de 1991, unas garantías jurídicas y unas políticas de reconocimiento de los derechos de los pueblos indígenas, logradas mediante la positivización en el ordenamiento jurídico de sus derechos. Pero es precisamente en este reconocimiento cultural, donde emergen tensiones entre la interculturalidad y los valores liberales universales impuestos de facto por la cultura dominante. Ahora bien, dar nueva dimensión dichas tensiones y paradojas ayuda a entender la complejidad de la problemática entre lo universal y los derechos contextualizados de los pueblos indígenas. De esta manera, la interculturalidad se funda en la necesidad de construir espacios dialógicos entre grupos, en leer de forma diferente lo universal, en percibir lógicas y conocimientos distintos, en confrontar y transformar las relaciones del poder –incluyendo las estructuras e instituciones de la sociedad– que han naturalizado las asimetrías sociales.

  7. Efeito do meio Erd Schreiber no cultivo das microalgas Dunaliella salina, Tetraselmis chuii e Isochrysis galbana = Erd Schreiber medium effect in culture of microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana

    Directory of Open Access Journals (Sweden)

    Vera Lucia Mota Klein

    2006-04-01

    Full Text Available As microalgas são utilizadas como fonte de alimento em aqüicultura. Neste trabalho cultivaram-se D. salina, T. chuii e I. galbana. O objetivo do trabalho consistiu em determinar o efeito do meio Erd Schreiber sobre o seu crescimento. Iniciou-se o cultivo com a mistura de 200 mg de Na2HPO4,7H2O, 100 mg de NaNO3 e 50 mL de extrato de solo. No monitoramento, manteve-se a temperatura entre 24 - 28 oC, a salinidade a 34 ppt, à iluminação constante, a densidade celular com uma câmara de Neubauer e um microscópio binocular modelo ZEISS. Como resultado, I. galbana, D. salina e T. chuii atingiram 969 104 cel/mL, 457 x 104 cel/mL e 258,66 x 104 cel/mL, respectivamente, e oscoeficientes angulares b foram 3,76 x 104 cel./mL/dia, 6,84 x 104 cel./mL/dia e 2,08 x 104 cel./mL/dia respectivamente, indicando bom desempenho de todas as microalgas no meio Erd Shreiber.The microalgae is used as food source in aqüicultura. In this work they had cultivated D. salina , T. chuii and I. galbana . The objective of the work is to determine the effect of Erd Schreiber´s culture medium on the microalgae growth. The culture initiated mixting 200mg of Na2HPO4,7H2O, 100 mg of NaNO3 and 50 mL of soil extract. During the culture the temperature had varied between 24 and 28oC, the salinity was fixed on 34 %o, and the illumination was maintained constant. The assessment of the culture was made by a chamber of Neubauer and a binocular microscope ZEISS model. As result I. galbana D. salina and T.chuii reached 969 104 cel/mL, 457 x 104cel/mL and 258,66 x 104 cel/mL respectively and as angular coefficient 3,76 x 104 cel/mL/dia, 6,84 x 104 cel/mL/dia and 2,08 104 x cel/mL/dia respectively, showing good answer of the microalgae to the effect of Erd Schreiber´ s medium.

  8. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina Chemometric studies of pheo formulated in pluronics®: photodynamic action against Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  9. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    OpenAIRE

    LIMA, J.M. de; SILVA, C. A.; Rosa, M. B.; J.B. Santos; OLIVEIRA, T. G. de; Silva,M.B.

    2009-01-01

    A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qual...

  10. Las márgenes de los pueblos de indios. Agregados, arrendatarios y soldados en el Tucumán colonial. Siglos XVIII y XIX.

    OpenAIRE

    Farberman, Judith

    2009-01-01

    Desde mediados del siglo XVIII, la documentación sobre los pueblos de indios del Tucumán incluye escuetas referencias sobre “agregados” y “soldados”, la móvil población que va creciendo en sus márgenes y que podía incluso superar en número a las familias tributarias. Normalmente, los agregados se vinculaban a los pueblos pagando un arriendo al cacique. Por ello, pudieron contribuir a la perduración de algunas reducciones y a la consolidación de su sistema de autoridades. Sin embargo, el mismo...

  11. Los montes y su desamortización en los pueblos del sur del valle de Toluca (México), 1880-1917

    OpenAIRE

    Cesar Fernando Escudero Martínez; Gloria Camacho Pichardo

    2015-01-01

    Este artículo pretende aproximarse al estudio de la desamortización de los montes en los pueblos del sur del valle de Toluca (1880-1917). Llama la atención al análisis de la explotación de la madera en beneficio de la industria, para establecer las diversas respuestas y medidas que adoptaron tanto los pueblos en cuestión, sus ayuntamientos y el gobierno estatal frente al fraccionamiento de la propiedad comunal de los montes, en el contexto de modernización económica e industrial que vivió el ...

  12. Pueblos indígenas, fronteras y estados nacionales. reflexiones histórico-antropológicas desde las fronteras brasil-colombia-perú y brasil-

    OpenAIRE

    López Garcés,Claudia Leonor

    2011-01-01

    Este artículo analiza, a partir de datos historiográficos y etnográficos, las contradicciones discursivas y las tensiones prácticas en las relaciones entre los pueblos indígenas y los estados nacionales en las fronteras Brasil-Colombia-Perú y Brasil-Francia (departamento ultramarino de Guayana francesa). El análisis se enfoca en los procesos de nacionalización y el impacto de las diferentes políticas indigenistas en los estilos de vida de los pueblos indígenas que habitan esas regiones fronte...

  13. Fundamentos y práctica internacional del derecho a la consulta previa, libre e informada a pueblos indígenas

    Directory of Open Access Journals (Sweden)

    Luz Ángela Patiño Palacios

    2014-04-01

    Full Text Available Este artículo describe y analiza las prácticas en derecho internacional sobre la consulta previa, libre e informada a pueblos indígenas. En primer lugar, expone los fundamentos en diferentes instrumentos internacionales en la materia, así como los criterios para una adecuada consulta. En segundo lugar, se realizan consideraciones sobre la diferencia entre el derecho a la consulta previa y el consentimiento vinculante de los pueblos indígenas. Por último, el artículo realiza una breve conclusión.

  14. ILUSTRACIÓN, JUSTICIA Y TÍTULOS DE TIERRAS. EL CASO DEL PUEBLO DE LA ASUNCIÓN MALACATEPEC EN EL SIGLO XVIII

    OpenAIRE

    René García Castro

    2003-01-01

    Este artículo tiene como objetivo analizar el uso de los títulos falsificados en la defensa jurídica de las tierras corporativas de los pueblos de indios del centro de México en el siglo XVIII. Se examina el proceso judicial seguido en la Audiencia de México y el rol jugado por los abogados y magistrados ilustrados para determinar como prueba legítima la presentación de los títulos apócrifos del pueblo de La Asunción Malacatepec, así como las consecuencias de ello.

  15. ILUSTRACIÓN, JUSTICIA Y TÍTULOS DE TIERRAS. EL CASO DEL PUEBLO DE LA ASUNCIÓN MALACATEPEC EN EL SIGLO XVIII

    OpenAIRE

    René García Castro; Jesús Arzate Becerrril

    2003-01-01

    Este artículo tiene como objetivo analizar el uso de los títulos falsificados en la defensa jurídica de las tierras corporativas de los pueblos de indios del centro de México en el siglo XVIII. Se examina el proceso judicial seguido en la Audiencia de México y el rol jugado por los abogados y magistrados ilustrados para determinar como prueba legítima la presentación de los títulos apócrifos del pueblo de La Asunción Malacatepec, así como las consecuencias de ello.

  16. Oxidative stress is a mediator for increased lipid accumulation in a newly isolated Dunaliella salina strain.

    Science.gov (United States)

    Yilancioglu, Kaan; Cokol, Murat; Pastirmaci, Inanc; Erman, Batu; Cetiner, Selim

    2014-01-01

    Green algae offer sustainable, clean and eco-friendly energy resource. However, production efficiency needs to be improved. Increasing cellular lipid levels by nitrogen depletion is one of the most studied strategies. Despite this, the underlying physiological and biochemical mechanisms of this response have not been well defined. Algae species adapted to hypersaline conditions can be cultivated in salty waters which are not useful for agriculture or consumption. Due to their inherent extreme cultivation conditions, use of hypersaline algae species is better suited for avoiding culture contamination issues. In this study, we identified a new halophilic Dunaliella salina strain by using 18S ribosomal RNA gene sequencing. We found that growth and biomass productivities of this strain were directly related to nitrogen levels, as the highest biomass concentration under 0.05 mM or 5 mM nitrogen regimes were 495 mg/l and 1409 mg/l, respectively. We also confirmed that nitrogen limitation increased cellular lipid content up to 35% under 0.05 mM nitrogen concentration. In order to gain insight into the mechanisms of this phenomenon, we applied fluorometric, flow cytometric and spectrophotometric methods to measure oxidative stress and enzymatic defence mechanisms. Under nitrogen depleted cultivation conditions, we observed increased lipid peroxidation by measuring an important oxidative stress marker, malondialdehyde and enhanced activation of catalase, ascorbate peroxidase and superoxide dismutase antioxidant enzymes. These observations indicated that oxidative stress is accompanied by increased lipid content in the green alga. In addition, we also showed that at optimum cultivation conditions, inducing oxidative stress by application of exogenous H2O2 leads to increased cellular lipid content up to 44% when compared with non-treated control groups. Our results support that oxidative stress and lipid overproduction are linked. Importantly, these results also suggest that

  17. Effect of osmotic shock on the redox system in plasma membrane of Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    CHENSIXUE; CHICHIONGYEN; 等

    1996-01-01

    The unicellular halotolerant alga Dunaliella salina had the ability to oxidize NADH and reduce Fe(CN)63-.The redox reactions were to some extent stimulated by slight hyperosmotic shock (2.0mol/L→2.6mol/L NaCl),but markably inhibited by abrupt hyperosmotic shock (2.0mol/L→3.5mol/L NaCl) and hypoosmotic shock (2.0mol/L→1.0mol/L NaCl;2.0mol/L→0.67mol/L NaCl).With the adaptation of algal cells to osmotic shock by accumulating or degraging intracellular grycerol,the plasmalemma redox activities were also restored.The O2 uptake stimulated by NADH could be promoted by FA and SHAM.Hypoosmotic shock increases the basal respiration rate of alga cells,but weakened the stimulating effects of NADH,FA and SHAM on O2 uptake.On the other hand,hyperosmotic shock reduced the basal respiration rate,but relatively enhanced the above effects of NADH,FA and SHAM.H+ extrusion of alga cells was inhibited by NADH and stimulated by Fe(CN)63-.Vanadate and DES could inhibit H+ efflux,but had little effect in the presence of NADH and Fe(CN)63-.Both hyperand hypoosmotic shock stimulated H+ extrusion.This effect could be totally inhibited by vanadate and DES,but almost unaffected by 8-hydroxyquinoline.It was suggested that H+-ATPase probably played a more important role in H+ extrusion and osmoregulation under the conditions of osmotic shock.

  18. Oxidative stress is a mediator for increased lipid accumulation in a newly isolated Dunaliella salina strain.

    Directory of Open Access Journals (Sweden)

    Kaan Yilancioglu

    Full Text Available Green algae offer sustainable, clean and eco-friendly energy resource. However, production efficiency needs to be improved. Increasing cellular lipid levels by nitrogen depletion is one of the most studied strategies. Despite this, the underlying physiological and biochemical mechanisms of this response have not been well defined. Algae species adapted to hypersaline conditions can be cultivated in salty waters which are not useful for agriculture or consumption. Due to their inherent extreme cultivation conditions, use of hypersaline algae species is better suited for avoiding culture contamination issues. In this study, we identified a new halophilic Dunaliella salina strain by using 18S ribosomal RNA gene sequencing. We found that growth and biomass productivities of this strain were directly related to nitrogen levels, as the highest biomass concentration under 0.05 mM or 5 mM nitrogen regimes were 495 mg/l and 1409 mg/l, respectively. We also confirmed that nitrogen limitation increased cellular lipid content up to 35% under 0.05 mM nitrogen concentration. In order to gain insight into the mechanisms of this phenomenon, we applied fluorometric, flow cytometric and spectrophotometric methods to measure oxidative stress and enzymatic defence mechanisms. Under nitrogen depleted cultivation conditions, we observed increased lipid peroxidation by measuring an important oxidative stress marker, malondialdehyde and enhanced activation of catalase, ascorbate peroxidase and superoxide dismutase antioxidant enzymes. These observations indicated that oxidative stress is accompanied by increased lipid content in the green alga. In addition, we also showed that at optimum cultivation conditions, inducing oxidative stress by application of exogenous H2O2 leads to increased cellular lipid content up to 44% when compared with non-treated control groups. Our results support that oxidative stress and lipid overproduction are linked. Importantly, these

  19. Toxicоlogical evaluation of the plant products using Brine Shrimp (Artemia salina L. model

    Directory of Open Access Journals (Sweden)

    Меntor R. Hamidi

    2014-04-01

    Full Text Available Many natural products could serve as the starting point in the development of modern medicines because of their numerous biological and pharmacological activities. However, some of them are known to carry toxicological properties as well. In order to achieve a safe treatment with plant products, numerous research studies have recently been focused on both pharmacology and toxicity of medicinal plants. Moreover, these studies employed efforts for alternative biological assays. Brine Shrimp Lethality Assay is the most convenient system for monitoring biological activities of various plant species. This method is very useful for preliminary assessment of toxicity of the plant extracts. Rapidness, simplicity and low requirements are several advantages of this assay. However, several conditions need to be completed, especially in the means of standardized experimental conditions (temperature, pH of the medium, salinity, aeration and light. The toxicity of herbal extracts using this assay has been determined in a concentration range of 10, 100 and 1000 µg/ml of the examined herbal extract. Most toxicity studies which use the Brine Shrimp Lethality Assay determine the toxicity after 24 hours of exposure to the tested sample. The median lethal concentration (LC50 of the test samples is obtained by a plot of percentage of the dead shrimps against the logarithm of the sample concentration. LC50 values are estimated using a probit regression analysis and compared with either Meyer’s or Clarkson’s toxicity criteria. Furthermore, the positive correlation between Meyer’s toxicity scale for Artemia salina and Gosselin, Smith and Hodge’s toxicity scale for higher animal models confirmed that the Brine Shrimp Lethality Assay is an excellent predictive tool for the toxic potential of plant extracts in humans.

  20. Evaluation of alpha and gamma aluminum oxide nanoparticle accumulation, toxicity, and depuration in Artemia salina larvae.

    Science.gov (United States)

    Ates, Mehmet; Demir, Veysel; Arslan, Zikri; Daniels, James; Farah, Ibrahim O; Bogatu, Corneliu

    2015-01-01

    In this study, Artemia salina (crustacean filter feeders) larvae were used as a test model to investigate the toxicity of aluminum oxide nanoparticles (Al2O3 NPs) on marine microorganisms. The uptake, toxicity, and elimination of α-Al2O3 (50 nm and 3.5 μm) and γ-Al2O3 (5 nm and 0.4 μm) NPs were studied. Twenty-four and ninety-six hour exposures of different concentrations of Al2O3 NPs to Artemia larvae were conducted in a seawater medium. When suspended in water, Al2O3 NPs aggregated substantially with the sizes ranging from 6.3 nm to >0.3 µm for spherical NPs and from 250 to 756 nm for rod-shaped NPs. The phase contrast microscope images showed that NPs deposited inside the guts as aggregates. Inductively coupled plasma mass spectrometry analysis showed that large particles (3.5 μm α-Al2O3) were not taken up by Artemia, whereas fine NPs (0.4 μm γ-Al2O3) and ultra-fine NPs (5 nm γ-Al2O3 and 50 nm α-Al2O3) accumulated substantially. Differences in toxicity were detected as changing with NP size and morphology. The malondialdehyde levels indicated that smaller γ-Al2O3 (5 nm) NPs were more toxic than larger γ-Al2O3 (0.4 µm) particulates in 96 h. The highest mortality was measured as 34% in 96 h for γ-Al2O3 NPs (5 nm) at 100 mg/L (LC50 > 100 mg/L). γ-Al2O3 NPs were more toxic than α-Al2O3 NPs at all conditions.

  1. Toxic effects of Microgramma vacciniifolia rhizome lectin on Artemia salina, human cells, and the schistosomiasis vector Biomphalaria glabrata.

    Science.gov (United States)

    de Albuquerque, Lidiane Pereira; Pontual, Emmanuel Viana; Santana, Giselly Maria de Sá; Silva, Luanna Ribeiro Santos; Aguiar, Jaciana dos Santos; Coelho, Luana Cassandra Breitenbach Barroso; Rêgo, Moacyr Jesus Barreto de Melo; Pitta, Maira Galdino da Rocha; da Silva, Teresinha Gonçalves; Melo, Ana Maria Mendonça de Albuquerque; Napoleão, Thiago Henrique; Paiva, Patrícia Maria Guedes

    2014-10-01

    The present study evaluated the toxicity of Microgramma vacciniifolia rhizome lectin (MvRL) to Artemia salina, human tumour cell lines (larynx epidermoid carcinoma Hep-2, NCI-H292 lung mucoepidermoid carcinoma, and chronic myelocytic leukaemia K562), and normal peripheral blood mononuclear cells (PBMCs), as well as to Biomphalaria glabrata embryos and adults. MvRL was toxic to A. salina (LC50=159.9 μg/mL), and exerted cytotoxic effects on NCI-H292 cells (IC50=25.23 μg/mL). The lectin (1-100 μg/mL) did not affect the viability of K562 and Hep-2 tumour cells, as well as of PBMCs. MvRL concentration of 1, 10, and 100 μg/mL promoted malformations (mainly exogastrulation) in 7.8%, 22.5%, and 27.7% of embryos, respectively, as well as delayed embryo development in 42.0%, 69.5%, and 54.7% of embryos, respectively. MvRL at a concentration of 100 μg/mL killed B. glabrata embryos (17.7%) and adults (25%). Further, MvRL damaged B. glabrata reproductive processes, which was evidenced by observations that snails exposed to the lectin (100 μg/mL) deposited fewer eggs than those in the control group, and approximately 40% of the deposited eggs exhibited malformations. Comparison of these results with that from A. salina assay indicates that MvRL is adulticidal at the concentration range which is toxic to environment. In conclusion, the cytotoxicity of MvRL on tumour cell and absence of toxicity to normal cell indicate its potential as chemotherapeutic drug. Also, the study revealed that the lectin is able to promote deleterious effects on B. glabrata embryos at environmentally safe concentrations.

  2. Estudio multiescalar de la formación de costras salinas sobre sedimentos amorfos silíceos lacustres.

    OpenAIRE

    Camargo Hernández, Aidé

    2010-01-01

    Sobre los suelos/sedimentos (lacustres, eólicos y fluviales) del antiguo Lago de Texcoco se desarrollan costras salinas con diferentes morfologías. La mayor diversidad de costras se presenta sobre los sedimentos amorfos silíceos lacustres. Las costras e interfase costra-sedimento fueron analizadas mediante métodos físicos y químicos, difracción de rayos-X (DRX), microscopía petrográfica (MP) y microscopía electrónica de barrido (MEB/EDS). Se encontró que la morfología está relacionada princ...

  3. Crecimiento y distribución iónica en nueve accesiones de aguacate regadas con agua salina.

    OpenAIRE

    2011-01-01

    El presente estudio se realizó para conocer la respuesta en crecimiento y distribución iónica de nueve accesiones de aguacate, al estrés provocado por el riego con agua salina. Plantas originadas de semilla de las accesiones: Tochimilco S2, Criollo 38, Tepetl, Aquila S1, 257 PTB todas ellas de la raza Mexicana (var. drymifolia), Navideño y un Segregante de Hunucma de la raza Antillana (var. americana), Fuerte negro (Guatemalteco x Mexicano) y Persea nubigena 1/7 (Persea nubigena Will.), fuer...

  4. Actividad de la falla la salina a partir de instrumentación sismológica

    Directory of Open Access Journals (Sweden)

    Gómez Ernesto

    2003-08-01

    Full Text Available

    The "La Salina" Fault, located in a region of high seismicity was studied in an area of 294 km2 in the Santander Department, it's defined as an inverse fault. In general it doesn't present clear morphological or actual activity evidences. In the area of the Hydroelectrical Project of the Sogamoso River by ISAGEN SA., a six stations seismic network was installed in an area near to the fault. During 124 days, 2.367 seismic events were evaluated; from these, 339 acceptable quality events were chosen for doing maps and profiles. Most of the seismicity is related to the "Bucaramanga Nest", other 131 seismic events ware related to the mapped faults. Only two events were related to the "La Salina" Fault, defining a indicating low activity.

    La falla La Salina se ubica en el departamento de Santander, en una región de alta sismicidad y es definida como de tipo inversa. En general, no presenta claras evidencias morfológicas ni de actividad reciente, por lo cual en el presente trabajo se investiga un área de 294 km2 de la misma.

    Dentro del Proyecto hidroeléctrico del rio Sogamoso, desarrollado por ISAGEN S.A, se estableció una red sismológica de seis estaciones en un área cercana a la falla. Durante 124 días se evaluaron 2.367 sismos, de los cuales se seleccionaron 339 de calidad aceptable para la elaboración de mapas y perfiles. De estos sismos, la mayor parte están asociados al "Nido de Bucaramanga" y 131 eventos están relacionados a fallas cartografiadas en la región; y de ellos

  5. Cultural heritage and food identity: The pre-Hispanic salt of Zapotitlán Salinas, Mexico

    OpenAIRE

    Renard, Marie-Christine; Thomé Ortiz, Humberto

    2016-01-01

    Salt production in Zapotitlán de las Salinas (Puebla, Mexico) dates back to pre-Hispanic times when the Popolocas inhabiting the Tehuacán Valley paid it as tribute to the Aztecs. The technique to obtain salt has changed little over the past 500 years and know-how continues to be transmitted from generation to generation of salters (salineros). It is a resource that is deeply anchored in the identity of the inhabitants of Zapotitlán and regional cuisine. Salt has endured over the centuries as ...

  6. Antropología y formación de colecciones: las producciones artesanales del pueblo Chané

    Directory of Open Access Journals (Sweden)

    Cecilia Mariana Benedetti

    2006-12-01

    Full Text Available Los antropólogos desempeñaron un importante papel en la formación de colecciones de artesanías indígenas en la primera mitad del siglo XX. El objetivo de este trabajo es abordar este proceso, centrándonos en el caso del pueblo chané. En esta dirección, consideraremos la dinámica de relaciones interétnicas que se desarrollaron en el contexto de consolidación del estado nación argentino, y su articulación con las teorías y las practicas de dos antropólogos —Alfred Métraux y Enrique Palavecino— quienes ademas de realizar estudios sobre este grupo, crearon importantes colecciones con sus producciones artesanales. Así, comprenderemos a la preservación como un espacio generado a partir de las relaciones entre el Estado Nacional y los pueblos originarios, entre la antropología la "otredad".

  7. Etnogénesis como práctica. Arqueología y turismo en el pueblo manta (Ecuador

    Directory of Open Access Journals (Sweden)

    Macarena Hernández-Ramírez

    2011-05-01

    Full Text Available El pueblo manta (Manabí, Ecuador se ha constituido como tal a principios del siglo XXI. Su devenir, desde que los indios de la costa ecuatoriana fueran reportados por primera vez en el siglo XVI, nos sitúa ante un proceso de etnogénesis muy particular que invita a reflexionar sobre las emergencias étnicas en el mundo globalizado. La literatura presenta los fenómenos de etnogénesis como procesos multidimensionales afectados por intereses territoriales, movimientos reivindicativos, políticas públicas, u organismos internacionales. El caso manteño muestra que es conveniente ampliar esas dimensiones apuntadas hasta ahora, incorporando las percepciones territoriales, la participación en el mercado o la organización socio-política interna. El análisis de la arqueologización y del desarrollo del turismo comunitario en el pueblo manta nos invita a ampliar sustancialmente esa multidimensionalidad de la etnogénesis. Desde esta perspectiva, la etnogénesis debería ser entendida como práctica adaptativa, de resistencia y creatividad a un tiempo, que afecta a la organización social y a la inserción en el entorno del grupo que la protagoniza.

  8. High-EPA Biomass from Nannochloropsis salina Cultivated in a Flat-Panel Photo-Bioreactor on a Process Water-Enriched Growth Medium

    Directory of Open Access Journals (Sweden)

    Hamed Safafar

    2016-07-01

    Full Text Available Nannochloropsis salina was grown on a mixture of standard growth media and pre-gasified industrial process water representing effluent from a local biogas plant. The study aimed to investigate the effects of enriched growth media and cultivation time on nutritional composition of Nannochloropsis salina biomass, with a focus on eicosapentaenoic acid (EPA. Variations in fatty acid composition, lipids, protein, amino acids, tocopherols and pigments were studied and results compared to algae cultivated on F/2 media as reference. Mixed growth media and process water enhanced the nutritional quality of Nannochloropsis salina in laboratory scale when compared to algae cultivated in standard F/2 medium. Data from laboratory scale translated to the large scale using a 4000 L flat panel photo-bioreactor system. The algae growth rate in winter conditions in Denmark was slow, but results revealed that large-scale cultivation of Nannochloropsis salina at these conditions could improve the nutritional properties such as EPA, tocopherol, protein and carotenoids compared to laboratory-scale cultivated microalgae. EPA reached 44.2% ± 2.30% of total fatty acids, and α-tocopherol reached 431 ± 28 µg/g of biomass dry weight after 21 days of cultivation. Variations in chemical compositions of Nannochloropsis salina were studied during the course of cultivation. Nannochloropsis salina can be presented as a good candidate for winter time cultivation in Denmark. The resulting biomass is a rich source of EPA and also a good source of protein (amino acids, tocopherols and carotenoids for potential use in aquaculture feed industry.

  9. High-EPA Biomass from Nannochloropsis salina Cultivated in a Flat-Panel Photo-Bioreactor on a Process Water-Enriched Growth Medium

    DEFF Research Database (Denmark)

    Safafar, Hamed; Hass, Michael Z.; Møller, Per

    2016-01-01

    Nannochloropsis salina was grown on a mixture of standard growth media and pre-gasified industrial process water representing effluent from a local biogas plant. The study aimed to investigate the effects of enriched growth media and cultivation time on nutritional composition of Nannochloropsis...... salina biomass, with a focus on eicosapentaenoic acid (EPA). Variations in fatty acid composition, lipids, protein, amino acids, tocopherols and pigments were studied and results compared to algae cultivated on F/2 media as reference. Mixed growth media and process water enhanced the nutritional quality...

  10. Protection against the toxicity of microcystin-LR and cylindrospermopsin in Artemia salina and Daphnia spp. by pre-treatment with cyanobacterial lipopolysaccharide (LPS).

    Science.gov (United States)

    Lindsay, J; Metcalf, J S; Codd, G A

    2006-12-15

    Purified cyanobacterial lipopolysaccharide (LPS) was not acutely toxic to three aquatic invertebrates (Artemia salina, Daphnia magna and Daphnia galeata) in immersion trials. However, pre-exposure (24 h) to 2 ngmL(-1) LPS increased the LC(50) of microcystin-LR significantly in all 3 species. Similar results were observed with A. salina pre-treated with the same concentration of cyanobacterial LPS and subsequently exposed to cylindrospermopsin, increasing the LC(50) by 8. The findings indicate the need to include exposures to defined combinations of cyanotoxins, and in defined sequences, to understand the contributions of individual cyanotoxins in accounting for cyanobacterial toxicity to invertebrates in natural aquatic environments.

  11. Status and understanding of groundwater quality in the Monterey Bay and Salinas Valley Basins, 2005-California GAMA Priority Basin Project

    Science.gov (United States)

    Kulongoski, Justin T.; Belitz, Kenneth

    2011-01-01

    Groundwater quality in the approximately 1,000 square mile (2,590 km2) Monterey Bay and Salinas Valley Basins (MS) study unit was investigated as part of the Priority Basin Project of the Groundwater Ambient Monitoring and Assessment (GAMA) Program. The study unit is located in central California in Monterey, Santa Cruz, and San Luis Obispo Counties. The GAMA Priority Basin Project is being conducted by the California State Water Resources Control Board in collaboration with the U.S. Geological Survey (USGS) and the Lawrence Livermore National Laboratory. The GAMA MS study was designed to provide a spatially unbiased assessment of the quality of untreated (raw) groundwater in the primary aquifer systems (hereinafter referred to as primary aquifers). The assessment is based on water-quality and ancillary data collected in 2005 by the USGS from 97 wells and on water-quality data from the California Department of Public Health (CDPH) database. The primary aquifers were defined by the depth intervals of the wells listed in the CDPH database for the MS study unit. The quality of groundwater in the primary aquifers may be different from that in the shallower or deeper water-bearing zones; shallow groundwater may be more vulnerable to surficial contamination. The first component of this study, the status of the current quality of the groundwater resource, was assessed by using data from samples analyzed for volatile organic compounds (VOC), pesticides, and naturally occurring inorganic constituents, such as major ions and trace elements. This status assessment is intended to characterize the quality of groundwater resources in the primary aquifers of the MS study unit, not the treated drinking water delivered to consumers by water purveyors. Relative-concentrations (sample concentration divided by the health- or aesthetic-based benchmark concentration) were used for evaluating groundwater quality for those constituents that have Federal and (or) California regulatory or

  12. Introducción al proyecto de declaración de las Naciones Unidas sobre los derechos de los pueblos indígenas

    Directory of Open Access Journals (Sweden)

    Marta Méndez Díaz

    2006-05-01

    Full Text Available Este artículo analiza pormenorizadamente el articulado del Proyecto de Declaración sobre los Derechos de los Pueblos Indígenas, su proceso de elaboración y el contexto internacional en el que se enmarca.

  13. Los pueblos indígenas y sus derechos de cara al conflicto armado: ¿Retórica o realidad latente y manifiesta?

    Directory of Open Access Journals (Sweden)

    Angie Catherine Pardo Ayala

    2005-01-01

    Full Text Available La expansión del conflicto armado, lo mismo que su intensidad y degradación, representa para los pueblos indígenas el principal factor causal de la violación de sus derechos. Aunque se registran importantes desarrollos normativos y constitucionales en la

  14. Haciendo desigualdad de la diferencia: Meritocracia y derecho a la identidad cultural. A propósito de la posición del pueblo gitano

    National Research Council Canada - National Science Library

    Jesús García Cívico

    2010-01-01

    ... la cuestión del derecho a la identidad cultural y su incidencia en ámbitos como los de educación y empleo. Este trabajo analiza la incidencia de la diferencia cultural, en el caso concreto del pueblo gitano, en la desigualdad legitimada...

  15. Non-photochemical quenching in cryptophyte alga Rhodomonas salina is located in chlorophyll a/c antennae.

    Science.gov (United States)

    Kaňa, Radek; Kotabová, Eva; Sobotka, Roman; Prášil, Ondřej

    2012-01-01

    Photosynthesis uses light as a source of energy but its excess can result in production of harmful oxygen radicals. To avoid any resulting damage, phototrophic organisms can employ a process known as non-photochemical quenching (NPQ), where excess light energy is safely dissipated as heat. The mechanism(s) of NPQ vary among different phototrophs. Here, we describe a new type of NPQ in the organism Rhodomonas salina, an alga belonging to the cryptophytes, part of the chromalveolate supergroup. Cryptophytes are exceptional among photosynthetic chromalveolates as they use both chlorophyll a/c proteins and phycobiliproteins for light harvesting. All our data demonstrates that NPQ in cryptophytes differs significantly from other chromalveolates - e.g. diatoms and it is also unique in comparison to NPQ in green algae and in higher plants: (1) there is no light induced xanthophyll cycle; (2) NPQ resembles the fast and flexible energetic quenching (qE) of higher plants, including its fast recovery; (3) a direct antennae protonation is involved in NPQ, similar to that found in higher plants. Further, fluorescence spectroscopy and biochemical characterization of isolated photosynthetic complexes suggest that NPQ in R. salina occurs in the chlorophyll a/c antennae but not in phycobiliproteins. All these results demonstrate that NPQ in cryptophytes represents a novel class of effective and flexible non-photochemical quenching.

  16. Salinity-Induced Palmella Formation Mechanism in Halotolerant Algae Dunaliella salina Revealed by Quantitative Proteomics and Phosphoproteomics

    Directory of Open Access Journals (Sweden)

    Sijia Wei

    2017-05-01

    Full Text Available Palmella stage is critical for some unicellular algae to survive in extreme environments. The halotolerant algae Dunaliella salina is a good single-cell model for studying plant adaptation to high salinity. To investigate the molecular adaptation mechanism in salinity shock-induced palmella formation, we performed a comprehensive physiological, proteomics and phosphoproteomics study upon palmella formation of D. salina using dimethyl labeling and Ti4+-immobilized metal ion affinity chromatography (IMAC proteomic approaches. We found that 151 salinity-responsive proteins and 35 salinity-responsive phosphoproteins were involved in multiple signaling and metabolic pathways upon palmella formation. Taken together with photosynthetic parameters and enzyme activity analyses, the patterns of protein accumulation and phosphorylation level exhibited the mechanisms upon palmella formation, including dynamics of cytoskeleton and cell membrane curvature, accumulation and transport of exopolysaccharides, photosynthesis and energy supplying (i.e., photosystem II stability and activity, cyclic electron transport, and C4 pathway, nuclear/chloroplastic gene expression regulation and protein processing, reactive oxygen species homeostasis, and salt signaling transduction. The salinity-responsive protein–protein interaction (PPI networks implied that signaling and protein synthesis and fate are crucial for modulation of these processes. Importantly, the 3D structure of phosphoprotein clearly indicated that the phosphorylation sites of eight proteins were localized in the region of function domain.

  17. Influencia del medio ambiente en los materiales de construcción III. Dinámica salina

    Directory of Open Access Journals (Sweden)

    Fernández Paris, José Manuel

    1978-06-01

    Full Text Available Las sales y la humedad son los dos factores que condicionan las alteraciones de los materiales de construcción. Los citados materiales, bien de por sí —piedras y ladrillos—, bien una vez endurecidos —morteros y hormigones—, están estructurados por partículas sólidas granulares, separadas por un sistema poroso, que constituye el medio -dinámico para el transporte de las disoluciones salinas procedentes del medio ambiente. La motilidad de las sales a través de la red de poros es función de tres variables físicoclimáticas: temperatura, humedad y condiciones de aireación. La dinámica salina se efectúa mediante procesos de difusión, unas veces de naturaleza química: difusión iónica, otras de naturaleza física: difusión capilar.

  18. Algunas notas sobre la proyección literaria en el epistolario de Pedro Salinas a Katherine Whitmore

    Directory of Open Access Journals (Sweden)

    Peragón López, Clara Eugenia

    2004-12-01

    Full Text Available Pedro Salinas' lover with no name that appears in his trilogy in loving poetry (La voz a ti debida. Razón de amor, Largo lament is presented with her own name in the group of letters sent by the poet to Katherine Whitmore. Through the analysis of these fascinating texts we will be able to establish tight relationship between his real world and his poetic world. Their content will reveal us a double documental and literary aspect of one of the best poems of love of the XX century.La amada innombrada en la trilogía de poesía amorosa de Pedro Salinas (La voz a ti debida. Razón de amor, Largo lamento se presenta con nombre propio en el conjunto de cartas enviadas por el poeta a Katherine Whitmore. A través del análisis de este fascinante epistolario podremos establecer una estrecha relación entre el mundo real y el mundo poético saliniano. Su contenido nos revelará un doble aspecto documental y literario y nos acercará a uno de los mejores poemarios de temática amorosa del siglo XX.

  19. Ethanol fermentation with Kluyveromyces marxianus from Jerusalem artichoke grown in salina and irrigated with a mixture of seawater and freshwater.

    Science.gov (United States)

    Yuan, W J; Zhao, X Q; Ge, X M; Bai, F W

    2008-12-01

    To study fuel ethanol fermentation with Kluyveromyces marxianus ATCC8554 from Jerusalem artichoke (Helianthus tuberosus) grown in salina and irrigated with a mixture of seawater and freshwater. The growth and ethanol fermentation of K. marxianus ATCC8554 were studied using inulin as substrate. The activity of inulinase, which attributes to the hydrolysis of inulin, the main carbohydrate in Jerusalem artichoke, was monitored. The optimum temperatures were 38 degrees C for growth and inulinase production, and 35 degrees C for ethanol fermentation. Aeration was not necessary for ethanol fermentation with the K. marxianus from inulin. Then, the fresh Jerusalem artichoke tubers grown in salina and irrigated with 25% and 50% seawater were further examined for ethanol fermentation with the K. marxianus, and a higher ethanol yield was achieved for the Jerusalem artichoke tuber irrigated with 25% seawater. Furthermore, the dry meal of the Jerusalem artichoke tubers irrigated with 25% seawater was examined for ethanol fermentation at three solid concentrations of 200, 225 and 250 g l(-1), and the highest ethanol yield of 0.467, or 91.5% of the theoretical value of 0.511, was achieved for the slurry with a solid concentration of 200 g l(-1). Halophilic Jerusalem artichoke can be used for fuel ethanol production. Halophilic Jerusalem artichoke, not competing with grain crops for arable land, is a sustainable feedstock for fuel ethanol production.

  20. The use of a brine shrimp (Artemia salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

    Science.gov (United States)

    Caldwell, Gary S; Bentley, Matthew G; Olive, Peter J W

    2003-09-01

    Water soluble algal extracts, the aldehydes 2E,4E-decadienal, decanal, undecanal and the fatty acid eicosapentaenoic acid (EPA) were assayed for toxicity to hatching success and larval mortality of the brine shrimp Artemia salina. Both crude cellular extracts of the diatoms Skeletonema costatum and Nitzschia commutata and the diatom-derived short chain aldehyde decadienal were found to inhibit hatching success of A. salina cysts in a dose-dependent manner. Decadienal also significantly affected larval mortality rates in 24 and 72 h exposure incubations. The Artemia hatching success assay was the least sensitive of the three (EC50=3.94 microg ml(-1)). A greater sensitivity was observed for the 72 h compared with the 24 h exposure trials (EC50 for 24h=2.14, 72 h=0.023 microg ml(-1)). Decanal did not significantly affect survival or hatching success at the concentrations tested. Undecanal and EPA showed a limited toxic effect in naupliar mortality trials. We suggest that 72 h Artemia exposure trials represent an acceptable bioassay for diatom toxicity where alternative bioassays are unavailable.

  1. Evaluation of Culture Conditions to Obtain Fatty Acids from Saline Microalgae Species: Dunaliella salina, Sinecosyfis sp., and Chroomonas sp.

    Science.gov (United States)

    Castilla Casadiego, D. A.; Albis Arrieta, A. R.; Angulo Mercado, E. R.; Cervera Cahuana, S. J.; Baquero Noriega, K. S.; Suárez Escobar, A. F.; Morales Avendaño, E. D.

    2016-01-01

    The use of the saline microalgae, Dunaliella salina, Sinecosyfis sp., and Chroomonas sp., was explored as an alternative source for the production of fatty acids using fertilizer and glycerol as culture media. The nutrient medium used contained “Nutrifoliar,” a commercial fertilizer, and/or glycerol, in natural sea water. The microalgae were placed in cultures with different conditions. The parameters that favored the largest production of fatty acids were 24 hours of agitation and illumination, 1620 L/day of air supply, 2.25 L of air/min, and a temperature of 32°C using “Nutrifoliar” as the culture media. Results indicated that, from 3 g of microalgae in wet base of Chroomonas sp., 54.43 mg of oil was produced. The chromatographic characterization of oil obtained revealed the presence of essential fatty acids such as 9,12,15-octadecatrienoic acid (omega-3) and 4,7,10-hexadecatrienoic acid (omega-6) from the species Dunaliella salina. On the other hand, 9,12-octadecadienoic acid (omega-6) and cis-11-eicosenoic acid (omega-9) were identified from the species Chroomonas sp. The temperature variations played an important role in the velocity of growth or the production of the algae biomass, the amount of oil, and the ability to produce fatty acids. PMID:27376085

  2. Non-photochemical quenching in cryptophyte alga Rhodomonas salina is located in chlorophyll a/c antennae.

    Directory of Open Access Journals (Sweden)

    Radek Kaňa

    Full Text Available Photosynthesis uses light as a source of energy but its excess can result in production of harmful oxygen radicals. To avoid any resulting damage, phototrophic organisms can employ a process known as non-photochemical quenching (NPQ, where excess light energy is safely dissipated as heat. The mechanism(s of NPQ vary among different phototrophs. Here, we describe a new type of NPQ in the organism Rhodomonas salina, an alga belonging to the cryptophytes, part of the chromalveolate supergroup. Cryptophytes are exceptional among photosynthetic chromalveolates as they use both chlorophyll a/c proteins and phycobiliproteins for light harvesting. All our data demonstrates that NPQ in cryptophytes differs significantly from other chromalveolates - e.g. diatoms and it is also unique in comparison to NPQ in green algae and in higher plants: (1 there is no light induced xanthophyll cycle; (2 NPQ resembles the fast and flexible energetic quenching (qE of higher plants, including its fast recovery; (3 a direct antennae protonation is involved in NPQ, similar to that found in higher plants. Further, fluorescence spectroscopy and biochemical characterization of isolated photosynthetic complexes suggest that NPQ in R. salina occurs in the chlorophyll a/c antennae but not in phycobiliproteins. All these results demonstrate that NPQ in cryptophytes represents a novel class of effective and flexible non-photochemical quenching.

  3. Evaluation of Culture Conditions to Obtain Fatty Acids from Saline Microalgae Species: Dunaliella salina, Sinecosyfis sp., and Chroomonas sp.

    Directory of Open Access Journals (Sweden)

    D. A. Castilla Casadiego

    2016-01-01

    Full Text Available The use of the saline microalgae, Dunaliella salina, Sinecosyfis sp., and Chroomonas sp., was explored as an alternative source for the production of fatty acids using fertilizer and glycerol as culture media. The nutrient medium used contained “Nutrifoliar,” a commercial fertilizer, and/or glycerol, in natural sea water. The microalgae were placed in cultures with different conditions. The parameters that favored the largest production of fatty acids were 24 hours of agitation and illumination, 1620 L/day of air supply, 2.25 L of air/min, and a temperature of 32°C using “Nutrifoliar” as the culture media. Results indicated that, from 3 g of microalgae in wet base of Chroomonas sp., 54.43 mg of oil was produced. The chromatographic characterization of oil obtained revealed the presence of essential fatty acids such as 9,12,15-octadecatrienoic acid (omega-3 and 4,7,10-hexadecatrienoic acid (omega-6 from the species Dunaliella salina. On the other hand, 9,12-octadecadienoic acid (omega-6 and cis-11-eicosenoic acid (omega-9 were identified from the species Chroomonas sp. The temperature variations played an important role in the velocity of growth or the production of the algae biomass, the amount of oil, and the ability to produce fatty acids.

  4. Accumulation of mercury by Artemia populations of different salinas of Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The total mercury content in samples of the brine shrimp Artemia, sediments, water, suspended matter and, when available, algae, from nine salines of Portugal, was evaluated, to find out how mercury present in its natural habitat accumulates in Artemia. This study, carried out between 1990 and 1993, was part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms, including in Portugal. The following sampling sites were chosen: some salinas of the lagoon of Aveiro, situated in the northern region of Portugal and partially contaminated with mercury-, the salt-mines of Rio Maior, in the interior of the central region of the country, where there are no sediments (the floor is cemented); and salt-marshes in the Algarve, in the south of Portugal. Mercury was determined by cold vapor absorption espectrofotometry after digestion of samples with sulfuric acid and potassium permanganate, and reference materials have been used to control the analytical performance. The concentrations of total Hg varied from 0.014 to 0.36 mg/Kg in the sediments, 0 to 0.30 {micro}g/g in the Artemia, 0.17 to 0.84 {micro}g/l in the suspended matter and 0.09 to 0.56 {micro}g/l in the water. The content of mercury in the artemias was strongly related to the concentration in the sediments, except when the algae were present, because they also accumulate a significantly percentage of the mercury. No relationships could be established with the Hg in water or in suspended matter (in mass of Hg/volume of filtered water), because their, content in Hg varied a lot with time and weather conditions, such as the wind strength. The presence of Hg in the sediments was due either to significant containing Hg discharges or to the composition of the sediments, being more important in the case of clays.

  5. Plutonium and Uranium Atom Ratios and Activity Levels in Cochiti Lake Bottom Sediments Provided by Pueblo de Cochiti

    Energy Technology Data Exchange (ETDEWEB)

    Gallaher, B.M.; Efurd, D.W.; Rokop, D.J.; Benjamin, T.M.

    1999-05-01

    Historical operations at the Los Alamos National Laboratory have contaminated stream sediments with plutonium and other radionuclides. A small portion of these contaminated sediments has been carried by floods into the Rio Grande drainage system, eventually to be trapped by Cochiti Lake located on Pueblo de Cochiti lands approximately 8 km downstream of the Laboratory. In this study, lake bottom sediment samples provided by the Pueblo de Cochiti were analyzed by thermal ionization mass spectrometry to determine plutonium and uranium activity levels and isotopic atom ratios. This specialized analytical method allows us to take isotopic fingerprints of radionuclides found in the sediment and to determine how much plutonium and uranium came from the Laboratory and how much was deposited by worldwide fallout or is natural. Two distinct types of samples were processed: segments of a continuous vertical core of the entire accumulated sediment sequence and other samples from across the lake bottom at the water/sediment interface. Based on measurement of the {sup 240}Pu/{sup 239}Pu atom ratio, Laboratory-derived plutonium is present in eight of nine samples at the core site. On a depth-weighted basis, approximately one-half of the {sup 239}Pu and {sup 240}Pu came from early operations at the Laboratory; the remaining plutonium came from fallout dispersed by above-ground nuclear tests. In contrast to the core site, the samples from the other locations showed little or no evidence of Laboratory-derived plutonium, with more than 90 percent of the plutonium attributable to fallout. The overall amount of plutonium in all the samples is of the same magnitude as other reservoirs in the region. The net increase in plutonium over upstream reservoirs unaffected by Laboratory activities is a maximum of 0.014 pCi/g or 3.5 times. All of the samples reflect natural uranium compositions. Laboratory-derived uranium is not identifiable, presumably because the sediment contains abundant

  6. Autoatención en Salud Oral en el Pueblo Yanacona de los Andes del Sur de Colombia

    Directory of Open Access Journals (Sweden)

    Edson Jair Ospina Lozano

    2011-10-01

    Full Text Available Antecedentes. El pueblo indígena Yanacona tiene sus propias estrategias de entender y atender su proceso salud/enfermedad, referido particularmente a la cavidad oral. En estas actividades no se involucran terapeutas de la medicina tradicional ni de la medicina occidental, las realizan las mismas personas. Objetivo: identificar y analizar las prácticas de autoatención en salud oral de la población Yanacona de los resguardos de Caquiona y Pancitará. Materiales y métodos. Se utilizó el método etnográfico. Las técnicas fueron la entrevista semi-estructurada y la observación participante. La información se consignó en el diario de campo. El universo de trabajo fueron las familias de los resguardos de Pancitará y Caquiona. Las unidades de análisis las conformaron cinco familias que cumplían los criterios de inclusión: auto adscripción indígena, los ingresos económicos, la tenencia de dos o más hijos y la escolaridad de la madre.  Resultados: Para los integrantes de este pueblo indígena la boca es necesaria para comer y comunicarse. Las personas reconocen las enfermedades y otras dolencias en su cavidad oral y disponen de conocimientos y destrezas para enfrentarlas, principalmente plantas medicinales y medicamentos farmacéuticos. La caries dental es reconocida como la única enfermedad que afecta a la boca. Se reconoce un origen mágico de las aftas bucales. Los cuidados de la boca implican el uso de cepillo y crema dental y la masticación de una planta -chulco-. Conclusiones. La autoatención en salud oral es una estrategia que le permite a este pueblo indígena solucionar parcialmente los inconvenientes relacionados con su salud/enfermedad oral.

  7. Ground-Water Quality Data in the Monterey Bay and Salinas Valley Basins, California, 2005 - Results from the California GAMA Program

    Science.gov (United States)

    Kulongoski, Justin T.; Belitz, Kenneth

    2007-01-01

    Ground-water quality in the approximately 1,000-square-mile Monterey Bay and Salinas Valley study unit was investigated from July through October 2005 as part of the California Ground-Water Ambient Monitoring and Assessment (GAMA) program. The study was designed to provide a spatially unbiased assessment of raw ground-water quality, as well as a statistically consistent basis for comparing water quality throughout California. Samples were collected from 94 public-supply wells and 3 monitoring wells in Monterey, Santa Cruz, and San Luis Obispo Counties. Ninety-one of the public-supply wells sampled were selected to provide a spatially distributed, randomized monitoring network for statistical representation of the study area. Six wells were sampled to evaluate changes in water chemistry: three wells along a ground-water flow path were sampled to evaluate lateral changes, and three wells at discrete depths from land surface were sampled to evaluate changes in water chemistry with depth from land surface. The ground-water samples were analyzed for volatile organic compounds (VOCs), pesticides, pesticide degradates, nutrients, major and minor ions, trace elements, radioactivity, microbial indicators, and dissolved noble gases (the last in collaboration with Lawrence Livermore National Laboratory). Naturally occurring isotopes (tritium, carbon-14, helium-4, and the isotopic composition of oxygen and hydrogen) also were measured to help identify the source and age of the sampled ground water. In total, 270 constituents and water-quality indicators were investigated for this study. This study did not attempt to evaluate the quality of water delivered to consumers; after withdrawal from the ground, water typically is treated, disinfected, and (or) blended with other waters to maintain water quality. In addition, regulatory thresholds apply to treated water that is served to the consumer, not to raw ground water. In this study, only six constituents, alpha radioactivity, N

  8. Investigation of environmental factors on the prevalence of free bacteriophages against Shiga toxin-producing Escherichia coli strains in produce pre-harvest environment in Salinas, California

    Science.gov (United States)

    Investigation of environmental factors on the prevalence of free bacteriophages against Shiga toxin-producing Escherichia coli strains in produce pre-harvest environment in Salinas, California Yen-Te Liaoa, Irwin Quintelab, Kimberly Nguyena, Alexandra Salvadora, Michael Cooleya, and Vivian C.H. Wu*a...

  9. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y.I.; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  10. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  11. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    Energy Technology Data Exchange (ETDEWEB)

    Mesarič, Tina, E-mail: tina.mesaric84@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Gambardella, Chiara, E-mail: chiara.gambardella@ge.ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Milivojević, Tamara, E-mail: milivojevictamara@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Faimali, Marco, E-mail: marco.faimali@ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Drobne, Damjana, E-mail: damjana.drobne@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Centre of Excellence in Nanoscience and Nanotechnology (CO Nanocentre), Ljubljana (Slovenia); Centre of Excellence in Advanced Materials and Technologies for the Future (CO NAMASTE), Ljubljana (Slovenia); Falugi, Carla, E-mail: carlafalugi@hotmail.it [Department of Earth, Environment and Life Sciences, University of Genova, Genova (Italy); Makovec, Darko, E-mail: darko.makovec@ijs.si [Jožef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia); Jemec, Anita, E-mail: anita.jemec@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Sepčić, Kristina, E-mail: kristina.sepcic@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia)

    2015-06-15

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  12. EL MESTIZAJE EN UNA FRONTERA DEL CARIBE: EL CASO DEL PUEBLO DE BORONATA EN LA GUAJIRA, 1696-1776

    Directory of Open Access Journals (Sweden)

    José Trinidad Polo Acuña

    2014-12-01

    Full Text Available La historia del mestizaje refleja más que el aspecto biológico asociado a la mezcla de razas que genera un prototipo humano, y se sitúa también en las variadas dinámicas históricas que posibilitan a las sociedades relacionarse en diferentes niveles y construir, desde esas relaciones, complejos procesos identitarios. En ese sentido, este artículo analiza el proceso de mestizaje en el pueblo de Boronata, ubicado en el sur de la península de la Guajira durante el período 1696-1776, donde los elementos culturales nativos jugaron un papel central en las relaciones que se dieron entre las sociedades criolla y aborigen. Para ello se analizan e interpretan una variedad de fuentes de la época consistentes en censos de poblaciones e informes de militares y misioneros que se desempeñaron en la Guajira.

  13. De pueblo a sociedad civil: el discurso político después del sismo de 1985

    OpenAIRE

    2014-01-01

    Este artículo examina el surgimien- to de la idea de sociedad civil en la esfera pú- blica mexicana después de los sismos de 1985, así como su popularización y los cambios de sus significados en las siguientes décadas. Median- te el análisis de textos periodísticos producidos en torno a los sismos, el texto argumenta que la sociedad civil sustituyó al pueblo como la co- lectividad nacional legítima en el contexto de la transición al neoliberalismo. De ser el sím- bolo de la colectividad nacio...

  14. ANÁLISIS DE DEMANDA DE TURISMO RURAL EN LOS PUEBLOS DE LA ARQUITECTURA NEGRA DE GUADALAJARA

    Directory of Open Access Journals (Sweden)

    Elima Benito Romera

    2011-01-01

    Full Text Available Se plantea un estudio de demanda del turista de los Pueblos Negros y se mide su grado de satisfacción con el destino. Nos encontramos ante un exceso de oferta, un nivel general de baja calidad y ausencia de datos, no se conoce el perfil del turista que visita la zona y se han creado servicios e infraestructuras que no se ajustan a las necesidades de una demanda cada vez más exigente. Los resultados sugieren un grado de satisfacción en general elevado y proporcionan información a tener en cuenta desde la perspectiva de la política turística a desarrollar en el territorio objeto de estudio.

  15. Estudio preliminar de contaminación bacteriológica en la laguna Pueblo Viejo, Veracruz, México

    OpenAIRE

    Guadalupe Barrera Escorcia; Irma Wong Chang; Alma S Sobrino Figueroa; Xóchitl Guzmán García; Fabiola Hernández Galindo; Fernando Saavedra Villeda

    1998-01-01

    La contaminación bacteriológica de la laguna de Pueblo Viejo fue evaluada en agua, sedimento y ostión, a través de las concentraciones de bacterias coliformes y estreptococos fecales (en dos épocas del año). Los conteos se realizaron utilizando la técnica de tubos múltiples de fermentación y se determinaron parámetros fisicoquímicos simultáneamente. Los resultados indican que el agua de la laguna fue inadecuada tanto para el cultivo de ostión, como para la recreación con contacto primario y p...

  16. Proyecto socioeducativo 'del dimoni i les pedres'. Herramientas TIC para trabajar la memoria colectiva de nuestro pueblo

    OpenAIRE

    Valdivia, Paloma

    2014-01-01

    Este proyecto nace de la inquietud de los voluntarios, de más de 60 años de edad, del telecentro de Palau-solità i Plegamans. Lo que ellos pretenden es recopilar y digitalizar la información histórica que existe en el pueblo y compartirla a través de una página Web, para ponerla a disposición de la población. Y así mismo, transformar esta información de la Web, en códigos QR ubicados en diversos espacios históricos o de interés colectivo. En diciembre del 2013, se creó el proyecto socioeducat...

  17. Homes for the migrants: the pueblos jovenes of Lima--a study of socioeconomic determinants of child malnutrition.

    Science.gov (United States)

    Herold, P; Sanjur, D

    1986-12-01

    The family ecology of 68 preschool children attending a health care center in a pueblo joven (low-income peripheral settlement) of Lima, Perú, was investigated to determine its bearing on their nutritional status. Some of the variables studied included family income, income available to mothers, household composition, migratory history of mothers, child feeding practices and housing conditions. Nutritional status of the children was assessed through anthropometric and dietary means. Results indicated that chronic malnutrition was widespread. Breast-feeding was common, but the weaning diets had little diversity and low-caloric value. The family diet relied heavily on soups and starchy foodstuffs, and children participated fully in the family meals by the age of two. Child growth was negatively correlated with the number of preschool children and birth order, and positively correlated with income spent on water. In its turn, the children's diet was positively correlated with the income available to the mothers and the income spent on food.

  18. Violencia de género hacia mujeres del Frente de Pueblos en Defensa de la Tierra

    Directory of Open Access Journals (Sweden)

    Blanca Estela Carrillo Franco

    2009-01-01

    Full Text Available En este artículo se aborda la represión que sufrieron por parte del Estado las mujeres integrantes del Frente de Pueblos en Defensa de la Tierra (FPDT, cuando se movilizaron para defender sus tierras. Mediante reconstrucción y análisis de las memorias que ellas guardan del suceso, se propone reflexionar cómo el Estado utiliza la violencia de género como estrategia para frenar la participación de las mujeres. Se parte de información testimonial y observación participante en espacios organizativos del FPDT para explicar cómo la intervención en este movimiento las ha llevado a sufrir violencia de género y tortura sexualizada. Asimismo, se expone cómo pudieron superar la experiencia que implicó la persecución política hacia el movimiento.

  19. Reproducción identitaria y social en las redes translocales de migrantes de dos pueblos andinos

    Directory of Open Access Journals (Sweden)

    Jacques Malengreau

    2008-12-01

    Full Text Available Se analizan de manera comparativa —según su destino y según su origen— las estrategias adoptadas por los migrantes de dos comunidades andinas de distintas regiones del Perú en su manejo de recursos sociales, culturales y materiales de su entorno extendido en el cuadro de su experiencia translocal. Estas estrategias están fundadas en una forma paralela. Por una parte, sobre una extensión de los lazos domésticos del pueblo originario, sobre todo a través de una continuidad transgeneracional basada en la descendenciacolateral tío(a – sobrino (a entre el pueblo originario y el lugar de inmigración, lo que implica un debilitamiento de las identidades colectivas supradomésticas originarias. Y, por otra parte, sobre la construcción de lazos vecindarios nuevos interétnicos, lo cual reinventa un modelo de solidaridad social en el lugar de inmigración. Estas estrategias —que combinan la jerarquización, el clientelismo, así como la reciprocidad y la redistribución— implican una reinterpretaciónde las normas vehiculadas por el modelo empresarial «liberal»,productivista, competitivo y consumista acondicionado a partir de un mundo extranjero que se manifiesta en una forma transnacional y transregional. En consecuencia, se pueden ver de modo comparativo las estrategias seguidas por los migrantes de ambos pueblos originarios como un desarrollo, tanto de rasgos comunes, como de particularidades que son ligadas, no solamente a las experiencias sociohistóricas y a las herencias culturales propias de cada uno de los pueblos, sino también al tipo de destino escogido por ellos; porejemplo, Lima metropolitana, los centros urbanos regionales y los valles tropicales del oriente. -- This article contrasts strategies adopted by migrants from two Andeancommunities located in different regions in Peru, in their useof social, cultural, and material networks, taking into consideration the place they settle in and where they come from, their

  20. Programa pueblos mágicos y desarrollo local: actores, dimensiones y perspectivas en El Oro, México

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Pérez-Ramírez

    2016-01-01

    Full Text Available Este trabajo realiza un análisis de la imple- mentación del programa pueblos mágicos en El Oro, Estado de México, con la finalidad de conocer los alcances y limitaciones para el desarrollo local. La propuesta metodológica se fundamenta en los planteamientos de Arocena (2002, que delinea las bases para el estudio del desarrollo local con base en las variables: modo de desarrollo, sistema de actores e identidad local. Se concluye que es preciso posicionar a la población local como actores protagónicos en la construcción del desarrollo local, con la finalidad de favorecer la búsqueda de soluciones a problemáticas comunes y la distribución compartida de los beneficios generados.

  1. Vallecas, identidades compartidas, identidades enfrentadas: La ciudad, el pueblo y el campo, el suburbio y el barrio

    Directory of Open Access Journals (Sweden)

    Fernández Montes, Matilde

    2007-06-01

    Full Text Available The diverse symbolic representations of the identities of Vallecas, currently as well as in the past (part of the countryside of Madrid in the Muslim period, a village near the state capital in the Early Modern period, the workers’ slum by the Bridge of Vallecas that emerged in the mid 1800s, the relationships that accrued since then between this new community and the village, which after 1950 became two separate districts within the municipality of Madrid, etc. are herein analyzed by the author, who focuses on the continuity, accumulation and transformation of these identities through time. In addition, she calls attention to the ways in which each of them has brought about reactions of differentiation, assimilation or conflict vis-à-vis other identities as well as the social universe outside, especially other neighborhood in Madrid.

    Las diversas representaciones simbólicas de las identidades vallecanas, históricas y actuales (el campo de Madrid en época islámica, el pueblo abastecedor de la cercana capital en la Edad Moderna, el surgimiento del suburbio obrero en el Puente a partir del siglo XIX y sus relaciones con el pueblo, la pérdida de la autonomía municipal, el lugar de asentamiento de los inmigrantes, nacionales durante el franquismo y en la actualidad de origen internacional, etc. son analizadas incidiendo en su pervivencia, acumulación y transformación temporal. También se estudia cómo cada una de estas identidades provoca movimientos de diferenciación, asimilación o confrontación, tanto entre ellas mismas, como en su imagen exterior, sobre todo desde otros barrios de Madrid.

  2. Selvas yermas. Los pueblos de indios desaparecidos en la costa sur de la Nueva Galicia durante el periodo colonial

    Directory of Open Access Journals (Sweden)

    Ramón Goyas Mejía

    2017-01-01

    Full Text Available El presente análisis se centra en la desaparición de los pueblos de indios en la alcaldía mayor de la Purificación perteneciente a la Nueva Galicia durante el virreinato. Para la realización de este trabajo se abordó primero la caracterización físico natural de la región, para posteriormente hacer relevante la relación histórica hombre-naturaleza desde la época precolombina, ello con la finalidad de destacar la importancia de la pérdida de población durante el periodo colonial, como tema central de investigación. Más que un estudio de demografía histórica, este trabajo aborda las consecuencias de la desaparición de dichas entidades en el espacio geográfico en que estuvieron ubicadas, por tanto, es un análisis de la relación de los pueblos como entidades geoespaciales y su entorno. Partiendo de la premisa teórica de los llamados “nudos” y “redes” para la construcción de un territorio, en este ensayo se plantea que a medida que las poblaciones indígenas fueron desapareciendo, dejaron de cumplir su papel como articuladoras sociales del territorio surgiendo espacios que en teoría pasaron a ser realengos pero que en realidad fueron “zonas de nadie”, áreas no controladas por las localidades sobrevivientes ni por los nuevos colonizadores que demoraron siglos en consolidarse en la región de estudio.

  3. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations

    Directory of Open Access Journals (Sweden)

    Stella Redón

    2015-07-01

    Full Text Available The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain, in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults and Flamingolepis flamingo (in juveniles. The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides and colour change (for six cestode species were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  4. Comparative study on toxicity of ZnO and TiO2 nanoparticles on Artemia salina: effect of pre-UV-A and visible light irradiation.

    Science.gov (United States)

    Bhuvaneshwari, M; Sagar, Bhawana; Doshi, Siddharth; Chandrasekaran, N; Mukherjee, Amitava

    2017-02-01

    This study evaluated the toxicity potential of ZnO and TiO2 nanoparticles under pre-UV-A irradiation and visible light condition on Artemia salina. The nanoparticle suspension was prepared in seawater medium and exposed under pre-UV-A (0.23 mW/cm(2)) and visible light (0.18 mW/cm(2)) conditions. The aggregation profiles of both nanoparticles (NPs) and dissolution of ZnO NPs under both irradiation conditions at various kinetic intervals (1, 24, 48 h) were studied. The 48-h LC50 values were found to be 27.62 and 71.63 mg/L for ZnO NPs and 117 and 120.9 mg/L for TiO2 NPs under pre-UV-A and visible light conditions. ZnO NPs were found to be more toxic to A. salina as compared to TiO2 NPs. The enhanced toxicity was observed under pre-UV-A-irradiated ZnO NPs, signifying its phototoxicity. Accumulation of ZnO and TiO2 NPs into A. salina depends on the concentration of particles and type irradiations. Elimination of accumulated nanoparticles was also evident under both irradiation conditions. Other than ZnO NPs, the dissolved Zn(2+) also had a significant effect on toxicity and accumulation in A. salina. Increased catalase (CAT) activity in A. salina indicates the generation of oxidative stress due to NP interaction. Thus, this study provides an understanding of the toxicity of photoreactive ZnO and TiO2 NPs as related to the effects of pre-UV-A and visible light irradiation.

  5. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations.

    Science.gov (United States)

    Redón, Stella; Amat, Francisco; Sánchez, Marta I; Green, Andy J

    2015-01-01

    The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica) from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain), in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides) was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults) and Flamingolepis flamingo (in juveniles). The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides) and colour change (for six cestode species) were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  6. Influence of PbS nanoparticle polymer coating on their aggregation behavior and toxicity to the green algae Dunaliella salina

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hajar [Department of Biology, Faculty of Sciences, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of); Moradshahi, Ali, E-mail: moradshahi@susc.ac.ir [Department of Biology, Faculty of Sciences, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of); Jahromi, Hamed Dehdashti; Sheikhi, Mohammad Hosein [Nanotechnology Research Institute, Shiraz University, Shiraz 71454 (Iran, Islamic Republic of)

    2014-09-15

    Highlights: • Lead sulfide nanoparticles (PbS NPs) are toxic to D. salina. • Gum-Arabic coating alters the toxicity of PbS NPs. • Cell-NPs agglomerates and lipid peroxidation could explain the toxicity of PbS NPs. • Shading effect and dissolution do not seem to contribute to the toxicity of PbS NPs. • Particle–particle interaction was reduced by coating; therefore, PbS NPs were stabilized in the culture media. - Abstract: The potential hazards of nanoparticles (NPs) to the environment and to living organisms need to be considered for a safe development of nanotechnology. In the present study, the potential toxic effects of uncoated and gum Arabic-coated lead sulfide nanoparticles (GA-coated PbS NPs) on the growth, lipid peroxidation, reducing capacity and total carotenoid content of the hypersaline unicellular green algae Dunaliella salina were investigated. Coatings of PbS NPs with GA, as confirmed by Fourier transform infrared spectroscopy, reduced the toxicity of PbS NPs. Uncoated PbS NP toxicity to D. salina was attributed to higher algal cell-NP agglomerate formation, higher lipid peroxidation, lower content of total reducing substances and lower total carotenoid content. Low levels of Pb{sup 2+} in the growth culture media indicate that PbS NP dissolution does not occur in the culture. Also, the addition of 100 μM Pb{sup 2+} to the culture media had no significant (P > 0.05) effect on algal growth. The shading of light (shading effect) by PbS NPs, when simulated using activated charcoal, did not contribute to the overall toxic effect of PbS NPs which was evident by insignificant (P > 0.05) reduction in the growth and antioxidant capacity of the algae. When PbS NP aggregation in culture media (without algal cells) was followed for 60 min, uncoated form aggregated rapidly reaching aggregate sizes with hydrodynamic diameter of over 2500 nm within 60 min. Effective particle–particle interaction was reduced in the GA-coated NPs. Aggregates of about

  7. Nutritional Composition, in vitro Antioxidant Activity and Artemia salina L. Lethality of Pulp and Seed of Tamarindus indica L. Extracts.

    Science.gov (United States)

    Khairunnuur, F A; Zulkhairi, A; Azrina, A; Moklas, Ma M; Khairullizam, S; Zamree, M S; Shahidan, M A

    2009-03-01

    This study was designed to examine the nutritional composition, antioxidant activity and medium lethal concentration (LC50 value) of Tamarindus indica L. pulp and seed extracts in vitro. The extraction was set at 40◦C, 60◦C and 100◦C for 12 hours, 6 hours and 15 minutes respectively to determine the optimum extraction parameter whereas the anti-oxidant activity of the extracts was measured using iron (III) reduction (FRAP) assay. Total phenolic content (TPC) of the extracts was estimated as gallic acid equivalent by Folin-Ciocalteau method. Toxicity potential of the extract was assessed in vitro by Artemia salina lethality test both in seed and pulp samples. The results showed that tamarind seed contained a higher percentage of carbohydrate, protein, fat and energy (15%, 82%, 95% and 33.13% respectively) than the pulp. On the other hand, the pulp demonstrated a high moisture (51.1%) and ash (34.84%) content than the seed. For the mineral analysis, tamarind seed contained higher Ca and C (1.0% and 50.73% respectively) than the pulp (0.27% and 40.40% respectively). No heavy metals were detected in both samples. Seed extracted at 60◦C/6 hours and 100◦C/15 minutes showed the highest TPC value and were significantly different (pseed extracted at 40◦C/12 hours. Anti-oxidant activity is positively correlated to the TPC value of the extracts (R=0.991). The pulp and seed extracted at 100◦C/15 minutes showed the highest FRAP value among its groups (216.17 ± 14.06 μmol (Fe)/g and 659.74 ± 16.40 μmol (Fe)/g respectively). This study indicates that tamarind pulp and seed extracts possess beneficial antioxidant properties and the optimum extraction parameter is 100◦C for 15 minutes. In Artemia salina lethality test, tamarind pulp caused significant mortality of the crustacean larvae with LC50 in the range of 26-28 μL/mL. Tamarind seed were not toxic to Artemia salina since the LC50 of the extracts was higher than 1000 μL/mL.

  8. Fatty acid profile of "bottled butter fat" produced in the region of Salinas, Minas Gerais Perfil dos ácidos graxos de "manteigas de garrafa" produzidas na região de Salinas - Minas Gerais

    Directory of Open Access Journals (Sweden)

    Maria das Graças Clemente

    2009-12-01

    Full Text Available The economic history of Salinas, Minas Gerais is largely based on cattle-breeding. The discoverers found in the city's region a large potential for the progress of their activities, either in agriculture or in cattle-breeding (OLIVEIRA, 2000. Even today, milk production plays an important role in family farming activities, which besides raw milk, provides curdal cheese, cottage cheese, and "bottled butter fat", which is manufactured with fat extracted from whey. Therefore, this study was conducted to analyze the fatty acid profile of "bottled butter fat" produced in Salinas, in the northern region of Minas Gerais , and also to analyze the ratio of saturated to unsaturated fatty acid of these butters. The fatty acid profile of the "bottled butter fat" was determined by chromatographic analysis, according to methodology advanced by Luddy et al. (1960, and later modified by Abreu (1993. Analysis of variance was applied for comparison of the averages by the Tukey test at 5% probability. The fatty acid profiles of all the "bottled butter fat" were found to be similar. The concentration of saturated fatty acids was higher than that of the unsaturated, with averages of 60,36% and 39,64%, respectively.A história econômica de Salinas apóia-se em grande parte na pecuária. Os desbravadores encontraram na região do município, um grande potencial para o desenvolvimento de suas atividades, seja na lavoura de mantimentos, seja na pecuária (OLIVEIRA, 2000. Até hoje, a produção de leite ocupa certo destaque nas atividades da agricultura familiar que, além do leite "in natura", fornece também o queijo de coalho, o requeijão e, dos soros obtidos desses produtos elabora-se a manteiga de garrafa. Assim, esse estudo foi realizado com o objetivo de analisar o perfil dos ácidos graxos de manteigas de garrafa produzidas em Salinas, norte de Minas Gerais e análise da relação de ácidos graxos saturados: ácidos graxos insaturados dessas manteigas. O

  9. Evaluation of metabolic responses of Artemia salina to oil and oil dispersant as a potential indicator of toxicant stress

    Energy Technology Data Exchange (ETDEWEB)

    Verriopoulos, G.; Moraitou-Apostolopoulou, M.; Xatzispirou, A.

    1986-03-01

    Oil represents an obvious hazard for the coastal environment and studies on its impact on marine organisms are necessary. Solvent based oil dispersants constitute one of the most important means for removing oil from shores. Although recently new dispersants have been developed, which are much less toxic than the first ones, dispersants still remain toxic substances. Since in the case of oil pollution treatment, oils and detergents are acting in combination, a realistic approach of laboratory studies must also include the combined action of these substances on marine organisms. Although acute toxicity studies are very useful for the determination of the range of animal tolerance, other effects causing physiological alterations may be detrimental to a population's survival. This paper concerns research on the effects of an oil, an oil dispersant and of the mixture of oil and dispersant on a physiological process, the respiration of the brine shrimp Artemia salina.

  10. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina larvae

    Directory of Open Access Journals (Sweden)

    Lejla Duraković

    2011-06-01

    Full Text Available Temperature-dose relationships with aflatoxin M1 (AFM1 were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg AFM1 x L-1 and above. The test can be conducted during 30-60 hours.

  11. Dunaliella salina (Dunal Teodoresco (Chlorophyceae Büyümesi Üzerine Tuz Derişimlerinin Etkileri.

    Directory of Open Access Journals (Sweden)

    Yaşar Durmaz

    2015-12-01

    Full Text Available Dunaliella salina, yüksek tuzluluk, yüksek ışık şiddeti ve azot eksikliği gibi bazı stres koşulları altında kültüre edildiğinde hücre içinde β-karoten biriktirebilen Chlorophyceae sınıfına ait bir alg türüdür. Yüksek tuzlulukları tolere edebilen D. salina gibi türler belli bir bölgeye ve çevre koşullarına adapte olmuş halde yaşar. Bu araştırma kapsamında Konya Tuz Gölü’nde yapılan incelemelerde, tuz parsellerinde kırmızılıklar şeklinde görülen alanlardan alınan örneklerdeki alg hücrelerinin mikroskopta tür tanımı yapıldıktan sonra D. salina olarak tanımlanan hücreler seyreltme yöntemi ile izole edilerek kültüre alınmıştır. Laboratuvarda NaCl ilave edilerek, 0.62M, 0.85M, 1.28M ve 1.71M tuz derişimleri hazırlanmış, 500 ml’lik erlenlerde, AS100 ortamında, 100 µmol foton m-2s-1 ışık şiddetinde sürekli aydınlatma ile 20±1°C sıcaklıkta kültürleri yapıldı. D. salina’nın yüksek tuzluluk konsantrasyonlarında gelişimini sürdürebildikleri gözlendi. En yüksek hücre konsantrasyonu 1.71 M NaCl’de 5.87x106 hücre ml-1 ulaştı. 1.71M NaCl konsantrasyonında yapılan kültürlerden alınan örneklerde toplam karoten 9.80±0.25 mg g-1 kuru ağırlık tespit edildi. Bu araştırmada Tuz Gölünden izole edilen D.salina türünün yüksek tuzluluk konsantrasyonlarına dayanıklı olduğu ve hatta gelişimini sürdürebilği tespit edildi

  12. Toxicity of lapachol and isolapachol and their potassium salts against Biomphalaria glabrata, Schistosoma mansoni cercariae, Artemia salina and Tilapia nilotica.

    Science.gov (United States)

    Lima, Nadja Maria Fernandes; dos Santos, Aldenir Feitosa; Porfírio, Zenaldo; Goulart, Marília O F; Sant'Ana, Antônio Euzébio G

    2002-07-01

    The toxicity of soluble derivatives (potassium salt) of lapachol and isolapachol in different stages of the life cycle of Schistosoma mansoni is evaluated. The potassium salts of isolapachol and lapachol showed significant molluscicidal activity against the adult snail (LC90Artemia salina Leach) indicated very high toxicity for the potassium salt of isolapachol (LC90=1.54 ppm), differently from the potassium salt of lapachol that can be considered non toxic (LC90=176.3 ppm). The same tendency is observed with piscicidal activity, for which the isolapachol salt has showed higher toxicity. The obtained selectivity ratios concerning LC50 and LC90 for lapachol, in relation to Tilapia nilotica lethality assay are 2.33 and 1.26, respectively. Despite the piscicidal toxicity, the use of the salt of lapachol can be recommended for field tests in Schistosomiasis, with caution.

  13. A butyrylcholinesterase in the early development of the brine shrimp (Artemia salina) larvae: a target for phthalate ester embryotoxicity?

    Science.gov (United States)

    Acey, Roger A; Bailey, Stacie; Healy, Patricia; Jo, Chang; Unger, Thomas F; Hudson, Richard A

    2002-12-13

    The phthalate ester insensitive blue-green algae (Synechococcus lividus) were used as a food source to extend the survival of synchronously hatched brine shrimp (Artemia salina) larvae allowing measurement of a reduced toxic response to phthalate esters at late post-hatching stages of development. The maximum acute toxicity due to di-n-butyl phthalate (DNBP) correlated with the expression of a phthalate ester-hydrolyzing enzyme. The purified enzyme was identified as a butyrylcholinesterase due to its rapid inactivation by low concentrations (10(-7)M) of diisopropyl fluorophosphate and inhibition by physostigmine (IC(50)=6 x 10(-7)M) and tetraisopropylpyrophosphoramide (I-OMPA, IC(50)=x 10(-6)M) but not by BW284c5. Apparently competition of the phthalates with the endogenous substrates of the enzyme led to development-dependent toxicity.

  14. The lethality of Euphorbia conspicua to adults of Biomphalaria glabrata, cercaria of Schistosoma mansoni and larvae of Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir F; de Azevedo, Denise P L; dos Santos Mata, Rosalina da C; de Mendonça, Dina I M Dinis; Sant'Ana, Antônio E Goulart

    2007-01-01

    Leaf extracts of Euphorbia conspicua (Euphorbiaceae), together with the latex and fractions derived therefrom, were evaluated for their molluscicidal and cercaricidal activities and their toxicities to brine shrimps. Whilst the leaf extracts were inactive against Biomphalaria glabrata, the latex, its triterpenic fraction and irritant fractions I and II exhibited high activities against adult snails with LC90 values of 4.87, 10.55, 0.64 and 0.10 microg/mL, respectively. The latex and its derived fractions were considered lethal to the cercaria of Schistosoma mansoni at concentrations of 100 microg/mL. The toxicities of the latex and the irritant fractions, but not of the triterpenic fraction, against Artemia salina were high with LC50 values < 10 microg/mL. The possible application of the latex of E. conspicua as an alternative natural molluscicide is considered.

  15. Avaliação ambiental do município de Salinas da Margarida, Bahia, Brasil

    OpenAIRE

    Nazar Ramos, María Loreto

    2013-01-01

    [Resumo] linas da Margarida é um município localizado na parte sul da Bahia de Todos os Santos, caracteriza-se por ser um município netamente costeiro que abarca uma área continental de 65 Km2, e é constituído por seis comunidades, sendo elas Encarnação, Dendê, Salinas Sede, Conceição, Cairu, e Barra do Paraguaçu. Poucos são os estudos que integram dados químicos, biológicos e sociais visando melhorar as políticas de desenvolvimento pesqueiro. A pesca no município é basicamente de subsistênci...

  16. The influence of photoperiod and light intensity on the growth and photosynthesis of Dunaliella salina (chlorophyta) CCAP 19/30.

    Science.gov (United States)

    Xu, Yanan; Ibrahim, Iskander M; Harvey, Patricia J

    2016-09-01

    The green microalga Dunaliella salina survives in a wide range of salinities via mechanisms involving glycerol synthesis and degradation and is exploited for large amounts of nutraceutical carotenoids produced under stressed conditions. In this study, D. salina CCAP 19/30 was cultured in varying photoperiods and light intensities to study the relationship of light with different growth measurement parameters, with cellular contents of glycerol, starch and carotenoids, and with photosynthesis and respiration. Results show CCAP 19/30 regulated cell volume when growing under light/dark cycles: cell volume increased in the light and decreased in the dark, and these changes corresponded to changes in cellular glycerol content. The decrease in cell volume in the dark was independent of cell division and biological clock and was regulated by the photoperiod of the light/dark cycle. When the light intensity was increased to above 1000 μmol photons m(-2) s(-1), cells displayed evidence of photodamage. However, these cells also maintained the maximum level of photosynthesis efficiency and respiration possible, and the growth rate increased as light intensity increased. Significantly, the intracellular glycerol content also increased, >2-fold compared to the content in light intensity of 500 μmol photons m(-2) s(-1), but there was no commensurate increase in the pool size of carotenoids. These data suggest that in CCAP 19/30 glycerol stabilized the photosynthetic apparatus for maximum performance in high light intensities, a role normally attributed to carotenoids.

  17. El derecho a la autodeterminación de los pueblos indígenas: límites y alcances de la declaración de Naciones Unidas 2007

    Directory of Open Access Journals (Sweden)

    Diana Ximena Machuca Pérez

    2016-01-01

    Full Text Available El objetivo de este artículo es exponer algunos hitos claves que han configurado la forma y contenido del derecho a la autodeterminación de los pueblos indígenas en el marco del derecho internacional, tratando de exponer algunas problemáticas que la declaración del 2007 sobre los derechos de los pueblos indígenas ha generado en los últimos años.

  18. 盐藻的诱变育种及光合反应器培养的初步研究%PRELIMINARY STUDIES ON THE MUTAGEN BREEDING OF Dunaliella salina AND ITS CULTIVATION IN SIMPLE AXIS PHOTOBIOREACTOR

    Institute of Scientific and Technical Information of China (English)

    姜建国; 周世水; 姚汝华

    2001-01-01

    A optimum started strain collected from 3 strains of Dunaliella salina was mutagenized by UV light. A new strain with content of β  carotene 5% higher than that of original strain was obtained. The strain was cultivated with a simple phorobioreactor in the optimum condition of cell growth. The result showed that the biomass of D. salina cultivated in the bioreactor over the triangular flask had a marked increase and the growth period shortened greatly.

  19. The San Marcos Pueblo Archaeological Site: A Review and Update of Ongoing Work by the Summer of Applied Geophysical Experience (SAGE)

    Science.gov (United States)

    Poje, M. S. L.; Berry, K.; Brandt, T. W.; Irwin, T. C.; Creighton, A.; MacLennan, K. J.; Ferguson, J. F.; Pellerin, L.

    2014-12-01

    The San Marcos Pueblo, one of the largest and most important cities of the pre-European Southwest, has long been a place of curiosity for archaeologists and geophysicists alike. Despite numerous archaeological investigations, primarily test excavations and surface surveys carried out at San Marcos from the early 1900s to the present, the site retains pottery sherds scattered along the surface from when it was first occupied in the thirteenth century to its abandonment during the Pueblo Revolt of 1680. Geophysical investigations have identified locations of kivas (ceremonial pits), middens (trash heaps), room blocks and possible metallurgy activity in the area. The site is located south of Santa Fe, NM and to the east of the Cerrillos Hills, a source for lead ore and turquoise. The students of SAGE have studied the San Marcos Pueblo for the past 11 years, and produced a map of the northeastern portion of the Pueblo colloquially called 'El Mapa Grande.' Ground penetrating radar (GPR), magnetics, and electromagnetic (EM) data were acquired on 30mx30m grids and seismic refraction data on various profiles throughout El Mapa Grande. During the 2014 field season new GPR data were acquired on two grids, magnetics data on one, and multiple grids were resurveyed with magnetics and EM to enhance resolution. The most recent GPR data extend coverage of two large anomalies that are part of linear EW-trending structures previously identified and consistent with a possible block wall or midden. Low GPR scatter and circular magnetic lows define several kivas. A target area in the NE of El Mapa Grande was thought to be related to metallurgic activity. Analysis of previous seismic data did not resolve any subsurface features corresponding to a metallurgy operation, but detected the magnetically-chaotic Ancha formation. Comparison with magnetic profile data support the interpretation that this anomaly is caused by a sub-crop of the Ancha Formation.

  20. Use of frequency analysis and the extended streamflow prediction procedure to estimate evacuation dates for the joint-use pool of Pueblo Reservoir, Colorado

    Science.gov (United States)

    Kuhn, Gerhard; Nickless, R.C.

    1994-01-01

    Part of the storage space of Pueblo Reservoir consists of a 65,950 acre-foot joint-use pool (JUP) that can be used to provide additional conservation capacity from November 1 to April 14; however, the JUP must be evacuated by April 15 and used only for flood-control capacity until November 1. A study was completed to determine if the JUP possibly could be used for conservation storage for any number of days from April 15 through May 14 under certain hydrologic conditions. The methods of the study were: (1) Frequency analysis of recorded daily mean discharge data for streamflow-gaging stations upstream and downstream from Pueblo Reservoir, and (2) Implementation of the extended streamflow prediction (ESP) procedure for the Arkansas River basin upstream from the reservoir. The frequency analyses enabled estimation of daily discharges at selected exceedance probabilities (EP's), including the 0.01 EP that was used in design of the flood- storage capacity of Pueblo Reservoir. The ESP procedure enabled probabilistic forecasts of inflow volume to the reservoir for April 15 through May 14. Daily discharges derived from the frequency analyses were routed through Pueblo Reservoir to estimate evacuation dates of the JUP for different reservoir inflow volumes; the estimates indicated a relation between the inflow volume and the JUP evacuation date. To apply the study results, only a ESP forecast of the April 15-May 14 reservoir inflow volume is needed. Study results indicate the JUP possibly could be used as late as May 5 depending on the forecast inflow volume.

  1. LA VIOLENCIA COMUNAL EN EL PUEBLO INDÍGENA SAN JUAN EVANGELISTA DE TOBOSI: JUICIO CRIMINAL POR "FILICIDIO" CONTRA CATALINA PEREZ, 1781

    OpenAIRE

    Quirós Vargas, Claudia

    2013-01-01

    Con el presente estudio intentamos evidenciar que durante elsiglo XVIII costarricense, y al interno de los pueblos indios,éstos protagonizaron entre otros, un tipo diferente de violencia,obviamente configurada durante dicho siglo por factores internos yexternos, la cual hemos conceptualizado como violencia comunal.De lo anterior deducimos que la violencia no es un problemaexclusivo de las sociedades contemporáneas, aunque si es necesariodestacar que el estudio de la violencia como problema so...

  2. El papel del antropólogo en la protección de los derechos humanos de los pueblos indígenas

    Directory of Open Access Journals (Sweden)

    David Martín-Castro

    2006-05-01

    Full Text Available El texto es una reflexión sobre el papel que el autor considera deben jugar los antropólogos en su relación con los pueblos indígenas. El autor recoge la percepción y critica de algunos representantes indígenas hacia los antropólogos e intenta responder a los motivos que les llevan a dicha crítica.

  3. Reflexiones sobre un posible código de ética del trabajo de las universidades en los territorios y pueblos indígenas

    OpenAIRE

    González Dobles, Jaime

    2011-01-01

    Un posible “Código de ética del trabajo de las universidades en los territorios y pueblos indígenas” supone, por una parte, diferencias significativas entre las universidades y las comunidades indígenas y, por la otra, que dicho código pretende regular la conducta de las instancias y personas de las primeras, con respecto a las características y modalidades de las segundas.

  4. Los pueblos indígenas de la Amazonia Peruana y el uso político de los medios de comunicación

    Directory of Open Access Journals (Sweden)

    Oscar ESPINOSA

    2009-11-01

    Full Text Available RESUMEN: Este artículo trata sobre el uso político de los medios de comunicación (radio, televisión e Internet por parte de los pueblos indígenas de la Amazonia Peruana. En particular, analiza la utilización que el pueblo Shipibo ha hecho de la radio en el proceso de construcción de su identidad étnica y en la creación de sus organizaciones políticas representativas; el tipo de vinculación de los pueblos Ashaninka y Aguaruna, el estado y la televisión sobre todo en la redefinición del concepto de identidad nacional en el contexto de diferentes conflictos armados, y finalmente, se presenta el uso de Internet por el pueblo Ashaninka.El objetivo principal del articulo es mostrar como el empleo de los medios de comunicación permite a las comunidades indígenas hacerse más visibles y actuar políticamente en distintos espacios públicos.ABSTRACT: This article deals with the political use of the means of communication (radio, tv, Internet by the indigenous peoples of the Peruvian Amazonas. In particular, it analyzes the use made by the Shipibo people of the radio in the construction of their ethnic identity and the creation of representative political organization; the links among the Ashaninka and Aguaruna peoples, the state and the tv in the redefinition of the national identity in the context of armed conflicts, and finally, it presents the use of Internet by Ashaninka people.This article aims at showing that the use of mass media allows indigenous groups to become more visible and to act in different political scenarios.

  5. Derechos políticos de los pueblos y comunidades indígenas en la República Bolivariana de Venezuela

    Directory of Open Access Journals (Sweden)

    Loiralith Margarita Chirinos Portillo

    2012-01-01

    Full Text Available La investigación tiene como objetivo analizar los derechos políticos de los indígenas en la Constitución de la República Bolivariana de Venezuela de 1999. Este objetivo es abordado conforme a la estrategia de investigación documental, sustentada en el método analítico. Las fuentes para la recolección de información atienden a tres ámbitos: constitucional, legal y doctrinal. Los integrantes de los pueblos y comunidades indígenas gozan de derechos políticos, pues se garantiza tanto el derecho a la participación directa en la vida política, económica y social del país, como la representación indígena por ante la Asamblea Nacional y demás instancias deliberantes de las entidades federales y locales. La organización política y social propia de los pueblos y comunidades indígenas deriva del derecho a la autodeterminación de tales pueblos y comunidades e implica el establecimiento de estructuras organizativas y funcionales, de diversa naturaleza, orientadas al desarrollo socio político de los pueblos y comunidades indígenas, sobre la base de sus tradiciones, usos y costumbres. El municipio indígena constituye el espacio geográfico, local y democrático, representado por una agrupación humana con características particulares, con personalidad jurídica y autonomía en cuanto a la elección de sus autoridades, la gestión de las materias de su competencia, y, la administración de sus ingresos

  6. ¿Qué hacemos con los indios? Pueblos indígenas y desarrollo: entre las políticas gubernamentales y el “buen vivir”

    Directory of Open Access Journals (Sweden)

    Francisco LÓPEZ-BÁRCENAS

    2013-01-01

    Full Text Available ¿Por qué los pueblos indígenas siguen en la pobreza social? Aquí se postula que los pueblos indígenas no son pobres, como desde el discurso oficial se establece. En México, durante las cuatro últimas décadas se ha fomentado una política extractivista que en los hechos despoja a los pueblos indígenas de sus territorios y sus recursos naturales, subordinando su vida a la lógica del capital y en muchos casos desplazándolos de sus espacios histórico-culturales. Los mixtecos, quienes se autonombran como Nuúsavi o Nasavi son un ejemplo de grupo social que, partiendo de sus propias estructuras, normas y formas de organización, ofrece otro tipo de opciones para acceder al bienestar, diferentes a los planes y programas diseñados desde el aparato estatal y su caso arroja elementos para pensar que los programas de desarrollo que se impulsan desde el go - bierno no fracasan únicamente porque no cuentan con los recursos necesarios para salir adelante, sino fundamentalmente porque al planearlos no se toma en cuenta la situación específica de los destinatarios.

  7. Procesos de integración del colectivo rumano a través de las historias de vida familiares en un pueblo onubense

    Directory of Open Access Journals (Sweden)

    Antonia María Diaz Reales

    2015-07-01

    Full Text Available La integración de inmigrantes rumanos en Lucena del Puerto (Huelva-España, a través de las historias de vida de dos familias de origen rumano se presenta en este estudio que analiza sus vivencias en este pueblo, por motivos laborales, debido a las campañas de recogida del cultivo de la fresa. Observaremos las diferencias en la visión de la integración así como también la existencia de problemas de convivencia e integración en el colectivo rumano como con otros colectivos como el marroquí. En este sentido, nos centramos en los procesos de integración de la población rumana en este pueblo andaluz. Los protagonistas principales son estas dos familias de origen rumano residentes en el pueblo. En suma, se pretende reflejar las inquietudes y recursos integradores para fomentar una convivencia armónica con el fenómeno migratorio que nos rodea. 

  8. Capitalismo turístico: conflictividades y tensiones de los pueblos originarios latinoamericanos en el contexto de la globalización

    Directory of Open Access Journals (Sweden)

    William Ortiz Jiménez

    2012-11-01

    Full Text Available El turismo presenta elevados índices de crecimiento a partir del proceso de globalización. Una de las regiones con mayor desarrollo turístico desde la década de 1990 es América Latina, donde en diferentes países el porcentaje de participación en el PBI del turismo es superior al 10%. Los pueblos originarios no han sido ajenos a este contexto, ya que sus creencias, expresiones artísticas, sus formas de sociabilidad han sido valoradas por la economía del turismo como productos o recursos exóticos. El llamado capitalismo turístico representa un modelo de desarticulación de las relaciones socioculturales de los pueblos originarios, introduciendo la cultura de mercado. El presente trabajo tiene por objetivo analizar los procesos de turistificación de los territorios de los pueblos originarios, en el actual contexto de globalización, las formas de desarticulación socioeconómica y aculturización asociadas, así como identificar los actores que intervienen en el proceso.

  9. Reconocimiento sin implementación. Un balance sobre los derechos de los pueblos indígenas en América Latina

    Directory of Open Access Journals (Sweden)

    Manuel Ignacio Martínez Espinoza

    2015-01-01

    Full Text Available El artículo analiza el estatus de los derechos de los pueblos indígenas en América Latina dando cuenta de la existencia de la “brecha de implementación” según la cual puede discernirse entre el reconocimiento formal del marco jurí-dico normativo internacional de derechos y la ausencia en las prácticas administrativas y políticas por parte de los Estados latinoamericanos. La participación en la adopción de decisiones ha sido, junto con las reivindicaciones de tierras, territorios y recursos naturales, una de las demandas que los pueblos indígenas han esgrimido recientemente con mayor vehemencia en la región. Las respuestas de los gobiernos se han caracterizado por la intimidación, la represiónel encarcelamiento y el asesinato de los indíge-nas. Tal esquema de conflictos y violación de derechos se ejemplifica con el caso de las movilizaciones de los pueblos indígenas contra la minería en Guatemala.

  10. "Qué pertenece a quién": Procesos de patrimonialización y Pueblos Originarios en Patagonia

    Directory of Open Access Journals (Sweden)

    Carolina Crespo

    2005-07-01

    Full Text Available Mientras en el pasado, el relato histórico y la identidad nacional/provincial se configuró en base a la negación y/o rechazo de la diferencia y se camufló la desigualdad bajo la apelación a una unidad cultural, particular y homogénea como lo fue el criollismo; hoy los restos arqueológicos del pasado indígena son re-categorizados en la legislación de la provincia de Río Negro como patrimonio cultural de la misma. Frente a la complejidad que reviste tal situación, me propongo analizar las ambigüedades y contradicciones que se desprenden de esta clasificación en el ámbito legislativo provincial y los conflictos que se tejen en torno a esta activación patrimonial entre los agentes estatales y el pueblo mapuche. Intento demostrar que estas contradicciones son producto de -y moldean- la dinámica que ha adquirido en años recientes la relación entre el pueblo mapuche y los agentes estatales, a la vez que de ciertas directrices internacionales.In the past, the national/provincial&'s history and identity was shaped by refusing and/or rejecting differences, while inequity was hidden by claiming for a particular and homogeneous cultural unity: &"the criollismo&". Nowadays, the archaeological rests of indigenous past are re-categorized in Rio Negro`s legislation as a province`s cultural heritage. Considering the complexity of these circumstances, the purpose of this article is (to analyse the contradictions and ambiguousness released by this classification at the legislative context and the conflicts that this heritage activation weaves between the state`s agents and mapuche`s people. I will try to demonstrate that this contradictions are the product of -and also provide- the relationship between mapuche`s people, state`s agents and certain international directrices in recent years.

  11. Síntese de 1,3,5-triazinas substituídas e avaliação da toxicidade frente a Artemia Salina leach Synthesis of substituted 1,3,5-triazines and toxicity evaluation against Artemia Salina leach

    Directory of Open Access Journals (Sweden)

    Márcia Ferreira Cavalcante

    2000-02-01

    Full Text Available The synthesis of ten symmetrically and unsymmetrically substituted 1,3,5-triazines by Phase Transfer Catalysis (PTC method is described. Their toxicities were determined against Artemia salina Leach. The LD50 values have also been obtained for these compounds.

  12. The efficiency of a new hydrodynamic cavitation pilot system on Artemia salina cysts and natural population of copepods and bacteria under controlled mesocosm conditions.

    Science.gov (United States)

    Cvetković, Martina; Grego, Mateja; Turk, Valentina

    2016-04-15

    A study of the efficiency of hydrodynamic cavitation and separation was carried out to evaluate an innovative, environmentally safe and acceptable system for ballast water treatment for reducing the risk of introducing non-native species worldwide. Mesocosm experiments were performed to assess the morphological changes and viability of zooplankton (copepods), Artemia salina cysts, and the growth potential of marine bacteria after the hydrodynamic cavitation treatment with a different number of cycles. Our preliminary results confirmed the significant efficiency of the treatment since more than 98% of the copepods and A. salina cysts were damaged, in comparison with the initial population. The efficiency increased with the number of the hydrodynamic cavitation cycles, or in combination with a separation technique for cysts. There was also a significant decrease in bacterial abundance and growth rate, compared to the initial number and growth potential.

  13. Characterization and alternative splicing of the complex I 19-kD subunit in Dunaliella salina: expression and mutual correlation of splice variants under diverse stresses.

    Science.gov (United States)

    Cao, Yu; Jin, Nan; Xu, Hui; Liu, Yi; Zhu, Wei Hua; Li, Xin Ran; Qiao, Dai Rong; Cao, Yi

    2010-01-01

    Complex I is the first enzyme in the mitochondrial respiratory chain. It extracts energy from NADH, which is produced by the oxidation of sugars and fats, and traps the energy by virtue of a potential difference or voltage across the mitochondrial inner membrane. Herein, the genomic sequence and four splice variants encoding the complex I 19-kD subunit were isolated from Dunaliella salina. There were four transcripts coding for the complex I 19-kD subunit due to alternative splicing in algae, and the four transcripts were translated to two protein isoforms with varying C-terminals. We report the splicing pattern in the 3'-region of the D. salina 19-kD subunit, in which three of the exons (5, 6, and 7) could be alternatively spliced. Moreover, we found that four alternatively spliced variants were subject to coordinated transcription in response to different stresses by real-time quantitative PCR.

  14. A Formação Salinas, Orógeno Araçuaí (MG): história deformacional e significado tectônico

    OpenAIRE

    Santos, Reginato Fernandes dos; Alkmim, Fernando Flecha de; Soares, Antônio Carlos Pedrosa

    2009-01-01

    A Formação Salinas, constituída de meta-arenitos, metapelitos e metaconglomerados, tem como principal área de ocorrência as vizinhanças da cidade homônima (norte de MG), onde jaz em discordância sobre rochas do Grupo Macaúbas, a oeste, e é intrudida por corpos graníticos neoproterózicos e cambrianos, a leste. Quatro gerações de estruturas deformacionais foram caracterizadas nessa região e três delas afetam as rochas da Formação Salinas. Os elementos da fase mais antiga, DD, correspondem a dob...

  15. Efeito alelopático e toxicidade frente à Artemia salina Leach dos extatos do fruto de Euterpe edulis Martius Allelopathic effects and toxicity against Artemia salina Leach of extracts of the fruit of Euterpe edulis Martius

    Directory of Open Access Journals (Sweden)

    Cristina Peitz de Lima

    2011-06-01

    Full Text Available Alelopatia é um processo envolvendo metabólitos secundários produzidos por plantas que infl uenciam o crescimento e desenvolvimento de sistemas agrícolas. Devido à toxicidade dos herbicidas sintéticos para o meio ambiente e para a saúde humana tem-se aumentado o interesse na exploração da alelopatia como uma alternativa para o controle de plantas daninhas. O presente trabalho avaliou efeito dos extratos dos frutos de Euterpe edulis Martius sobre o desenvolvimento de cipselas e plântulas de Lactuca sativa Linné, foram determinados o índice de velocidade de germinação, o crescimento da radícula e do hipocótilo. Para a avaliação da toxicidade dos extratos foi realizado o ensaio de toxicidade frente ao microcrustáceo Artemia salina Leach determinando-se a CL50 e percentual de mortalidade. A fração remanescente demonstrou efeito alelopático, pois todas as concentrações alteraram os valores do índice de velocidade de germinação e as concentrações de 0,2 e 0,4 mg inibiram tanto o crescimento da radícula quanto o crescimento do hipocótilo. No ensaio de toxicidade todos os extratos apresentaram CL50 superior a 1000 ppm e 0% de mortalidade das artemias, indicando a não toxicidade dos extratos.Allelopathy is a process involving secondary metabolites produced by plants that influence growth and development of agricultural systems. Because of the toxicity of synthetic herbicides to the environment and human health, there has been increased interest in exploiting allelopathy as an alternative for weed control. This study evaluated the eff ect of extracts of Euterpe edulis Martius fruits on the development of cypselae and seedlings of Lactuca sativa Linné; the germination speed index, radicle and hypocotyl growth were determined. To evaluate the toxicity of the extracts the toxicity test against Artemia salina Leach was used, where the LC50 and mortality rate were determined. Th e remaining fraction showed allelopathic effect

  16. Creación de un manual que permita medir la presión en centros turísticos de playa en el Ecuador: caso salinas

    OpenAIRE

    Delgado Moscoso, Ana Patricia; López Loyola, Jairo Israel; Ricaurte Quijano, Carla Valeria

    2009-01-01

    This paper presents a proposal based on indicators to measure the pressure brought by tourism on the economy and the environment in beach resorts in Ecuador in order to support decision making to minimize the negative impacts of the activity. The first chapter sets the framework for research and presents the general context of Salinas as a study area characterized by seasonal tourism and overcrowding. It defines the basic concepts that direct research to analyze their interacti...

  17. Creación de un manual que permita medir la presión en centros turísticos de playa en el Ecuador: caso salinas

    OpenAIRE

    Delgado Moscoso, Ana Patricia; López Loyola, Jairo Israel; Ricaurte Quijano, Carla Valeria

    2009-01-01

    This paper presents a proposal based on indicators to measure the pressure brought by tourism on the economy and the environment in beach resorts in Ecuador in order to support decision making to minimize the negative impacts of the activity. The first chapter sets the framework for research and presents the general context of Salinas as a study area characterized by seasonal tourism and overcrowding. It defines the basic concepts that direct research to analyze their interacti...

  18. La reforma del Estado y el acceso de los pueblos indios a los medios de comunicación

    Directory of Open Access Journals (Sweden)

    Javier Esteinou Madrid

    2002-01-01

    Full Text Available El levantamiento del Ejército Zapatista de Liberación Nacional el 1 de enero de 1994 ha planteado en los últimos siete años que las comunidades indígenas, además de demandar justicia, paz, dignidad y reivindicación de sus derechos básicos, también exigieran acceso a los medios colectivos de comunicación. Es por ello que el punto 9 de los Acuerdos de San András Larráinzar y la Iniciativa de Ley de Reforma de Cultura y Derechos Indígenas, en su inciso 7, formularon oficialmente que el Estado mexicano reconocía que "los pueblos indígenas tienen el derecho a la libre determinación y a la autonomía, como parte del Estado mexicano [...] para adquirir, operar y administrar sus propios medios de comunicación". No obstante estos reconocimientos políticos, los acuerdos pactados en ambas iniciativas de Ley enviadas al Poder Legislativo fueron engañosos e insuficientes para lograr un cambio sustancial en esta materia, y en consecuencia, todo permaneció igual.

  19. Las flores del desierto. Opciones de vida en pueblos de la región central de Sonora

    Directory of Open Access Journals (Sweden)

    Ma. Amalia Gracia

    2014-01-01

    Full Text Available Aunque la búsqueda de las localidades rurales por generar opciones de vida se observa en el esfuerzo de algunos pobladores, en México la política pública se restringe a ofrecer garantías sociales; le deja al mercado la creación de alternativas económicas, que no alcanzan para producir desarrollo local y regional. El presente artículo reflexiona sobre esto, a partir de una iniciativa de trabajo asociativo surgida hace más de seis años en pueblos de la región central del norte de Sonora, y muestra cómo se resuelven temporal y dinámicamente las tensiones entre prácticas de cooperación y reciprocidad y las de intercambio con el mercado utilizando postulados teóricos de distintas disciplinas, retomadas por las propuestas de economía solidaria. El caso ilustra las dificultades, riqueza y potencialidad de iniciativas como ésta, y la importancia del apoyo gubernamental en localidades a las que la baja capacidad económica y la generalización del narcotráfico las vuelve frágiles para contrarrestar procesos profundos de despoblamiento.

  20. Los espacios del pueblo de indios tras el proceso de Congregación, 1550-1625

    Directory of Open Access Journals (Sweden)

    Federico Fernández Christlieb

    2006-01-01

    Full Text Available Consumada la conquista del altiplano mesoamericano, los españoles se encontraron ante la dificultad de evangelizar y controlar políticamente a una parte de la población indígena que vivía en parajes montañosos de difícil acceso y bajo un patrón de asentamientos disperso. Para concentrar a los indios diseminados, la Corona Española tomó la decisión de construir pueblos trazados ortogonalmente sobre planicies cercanas a los viejos asentamientos. Con ello cambió no sólo la relación urbanística entre las comunidades indígenas sino también el paisaje que habían seleccionado originalmente. Estos dos aspectos: la distribución espacial y la relación entre sociedad y paisaje, son dos temas que inquietan a la Geografía. Desde el enfoque propio de esta disciplina se propone un modelo que sirva de síntesis a varias escalas sobre los cambios y continuidades espaciales que se verificaron en el tránsito de la época prehispánica a la colonial.

  1. Reproductive structures of Rhamnaceae from the Cerro del Pueblo (Late Cretaceous, Coahuila) and Coatzingo (Oligocene, Puebla) Formations, Mexico.

    Science.gov (United States)

    Calvillo-Canadell, Laura; Cevallos-Ferriz, Sergio R S

    2007-10-01

    Recently discovered fossil flowers from the Cretaceous Cerro del Pueblo and flowers and fruits from the Oligocene Coatzingo Formations are assigned to the Rhamnaceae. The Cretaceous flower, Coahuilanthus belindae Calvillo-Canadell and Cevallos-Ferriz, gen. et sp. nov., is actinomorphic with fused perianth parts forming a slightly campanulate to cupulate floral cup, with sepals slightly keeled and spatulate clawed petals. The Oligocene fossils include Nahinda axamilpensis Calvillo-Canadell and Cevallos-Ferriz, gen. et sp. nov. (characterized by its campanulate bisexual flower with stamens opposite, adnate to and enfolded by petals; and with the ovary ripening into a drupe), and a winged fruit assigned to Ventilago engoto Calvillo-Canadell and Cevallos-Ferriz, sp. nov. The flowers and drupe features indicate closer affinity to Zizipheae and/or Rhamneae, while the single samaroid fruit suggests the presence of Ventilagineae. However, the unique character combination in the fossil flowers precludes placing them in extant genera. Nevertheless, the history of the family is long and can be traced back to the Campanian. A detailed phylogenetic revision of the group that uses morphological characters from both extant and fossil plants is needed to better understand the significance of these records as well as other important fossils of the family.

  2. Memorias íntimas y espacio social: el pueblo de Peyruis (Francia a mediados del siglo XX

    Directory of Open Access Journals (Sweden)

    Alain Musset

    2014-01-01

    Full Text Available Los lugares destacados juegan un papel fundamental en la organización simbólica del territorio y en su puesta en conformidad con la historia oficial. Son la expresión de una identidad colectiva que se expresa a diferentes niveles tanto sociológicos como políticos, desde la nación hasta la familia (escala de análisis hasta entonces poco estudiada. Con el propósito de ver cómo el espacio-tiempo de los individuos se articula con el espacio-tiempo de la sociedad, he emprendi- do una investigación cuyo tema y objeto es mi propia familia y su cuna lugareña, Peyruis (Francia, antiguo departamento de los Alpes Bajos. Al reconstruir la geografía íntima de tres hermanas y su hermano en este pueblo provenzal de los años 1940, pasamos de los lugares institucionales de la memoria a una memoria de los lugares comunes y corrientes, lugares de la trivialidad no relacionados con el culto periódico de los recuerdos oficiales sino con las practicas diarias de la sociedad. De hecho, esos pequeños lugares destacados se ubican en un espacio social más amplio y expresan la apropiación virtual (y limitada en el tiempo de un territorio público por una memoria privada.

  3. Capitalismo y pueblos indígenas en el Chaco argentino: formas y determinaciones de una subjetividad productiva

    Directory of Open Access Journals (Sweden)

    Juan Iñigo Carrera

    2017-06-01

    Full Text Available Los pueblos indígenas del Chaco argentino constituyen una población trabajadora desplazada de la producción rural, al encontrarse cada vez más en exceso relativo para los requerimientos del capital. Este trabajo se propone abordar el proceso de progresiva mutilación de sus atributos productivos, a partir de desplegar sus determinaciones generales hasta alcanzar las formas concretas específicas con que estas se realizan en el caso considerado. Para ello partimos de desarrollar las determinaciones materiales del trabajo como condición inherente a la vida humana, avanzando luego sobre la determinación de la subjetividad productiva humana propia del modo de producción capitalista. Nos enfrentamos así a la privación, impuesta sobre porciones significativas de la población trabajadora, del ejercicio de su capacidad para participar activamente en el proceso de producción y consumo social. Seguidamente desplegamos las expresiones que encuentra la mutilación de los atributos de los indígenas como sujetos del proceso de trabajo: la limitación en su participación -como productores independientes y trabajadores estacionales- en los distintos cultivos, la caída del salario, la venta de los productos del trabajo doméstico por debajo de su valor, su constitución generalizada en beneficiarios de programas sociales de asistencia

  4. Cultural heritage and food identity: The pre-Hispanic salt of Zapotitlán Salinas, Mexico

    Directory of Open Access Journals (Sweden)

    Renard, Marie-Christine

    2016-06-01

    Full Text Available Salt production in Zapotitlán de las Salinas (Puebla, Mexico dates back to pre-Hispanic times when the Popolocas inhabiting the Tehuacán Valley paid it as tribute to the Aztecs. The technique to obtain salt has changed little over the past 500 years and know-how continues to be transmitted from generation to generation of salters (salineros. It is a resource that is deeply anchored in the identity of the inhabitants of Zapotitlán and regional cuisine. Salt has endured over the centuries as a perennial resource and constitutes a source of income for its owners. However, despite these historical and cultural factors of territorial anchorage, salters have not attained the level of organization necessary to obtain a fair value in the market. Failure to appreciate this product has led to the abandonment of a large percentage of the saltworks that once existed. This essay will analyze the socio-economic and cultural constraints that have prevented this community from attaining the level of territorial governance necessary to enhance the market value of Zapotitlán salt on the market but how, with the depletion of other economic options, its people are returning to the salt, with new strategies. Lastly, the paper will conclude with a consideration of its future potential.La producción de sal de Zapotitlán de las Salinas (Puebla, México se remonta a épocas prehispánicas cuando los popolocas, moradores del valle de Tehuacán, lo tributaban a los aztecas. La técnica para la obtención de la sal ha cambiado poco desde hace 500 años y el saber-hacer se sigue transmitiendo entre las generaciones de salineros. Es un recurso profundamente anclado en la identidad de los habitantes de Zapotitlán y en la gastronomía regional. Su existencia ha perdurado en el transcurso de los siglos por ser un recurso perenne y constituir una renta para sus dueños. Sin embargo, a pesar de los factores históricos y culturales de anclaje territorial, los salineros no

  5. Electrochemical Corrosion Behavior of Are Sprayed Zn and Zn(1)5Al Coatings in Simulated Salina Soil and Neutral Meadow Soil Solutions

    Institute of Scientific and Technical Information of China (English)

    LIN Bilan; LU Xinying; LI Long

    2011-01-01

    Arc sprayed Zn and Zn(1)5Al coatings were chosen to protect the metal ends of prestressed high-strength concrete (PHC) pipe piles against corrosion of salina soil in northern china and neutral meadow soil in northeast China.The corrosion behavior of the coated Q235 steel samples in two simulated soil solutions were investigated by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) methods.The experimental results show that the corrosion of the matrix Q235 steel in both simulated solutions is remarkably inhibited by Zn and Znl5A1 coatings.The corrosion products on Zn and Zn(1)5Al are thick,compact,firm and protective.The corrosion current density icorr of both Zn and Zn(1)5Al-coated samples is decreased evidently with corrosion time,and the charge transfer resistance Rct is increased greatly.The corrosion resistance indexes of Zn and Zn(1)5Al in simulated neutral meadow soil solution are more outstanding than those in salina soil.The corrosion resistance of Zn(1)5Al in salina soil is slightly superior to that of Zn.When the sprayed coatings are sealed with epoxy resin,the corrosion resistance of the coatings is further enhanced markedly.

  6. U-Pb zircon geochronology of rocks in the Salinas Valley region of California: A reevaluation of the crustal structure and origin of the Salinian block

    Science.gov (United States)

    Barth, A.P.; Wooden, J.L.; Grove, M.; Jacobson, C.E.; Pedrick, J.N.

    2003-01-01

    The Salinian block in the Salinas Valley region of central California consists of arc granitic and metasedimentary rocks (schist of Sierra de Salinas) sandwiched between coeval high-pressure, low-temperature me??lange belts. U-Pb zircon ages of three granitic plutons from this region range from 88 to 82 Ma, and coexisting biotite yielded 40Ar/39Ar cooling ages of 76-75 Ma. The U-Pb ages from detrital zircons indicate derivation of the protolith of the schist from a 117-81 Ma igneous provenance. Muscovite and biotite 40Ar/ 39Ar cooling ages of 72-68 Ma from the nearby schist are distinctly younger than those from the granitic plutons. These data indicate that deposition and metamorphism of the schist occurred after emplacement of adjacent granitic rocks, contradicting the prevailing view that the schist comprises the local framework for the Salinian arc. We propose that the schist of Sierra de Salinas was thrust beneath the Salinian magmatic arc along a Campanian thrust fault that has not been recognized. This hypothesis implies that the Salinian arc originated as a klippe of basement rocks derived from the vicinity of the western Mojave Desert. Thrusting initiated southeastward-migrating Laramide tectonism of a style similar to that which formed the Vincent thrust and the latest Cretaceous and Paleocene Pelona and Orocopia Schists of southern California and southwestern Arizona.

  7. The laboratory environmental algae pond simulator (LEAPS) photobioreactor: Validation using outdoor pond cultures of Chlorella sorokiniana and Nannochloropsis salina

    Energy Technology Data Exchange (ETDEWEB)

    Huesemann, M.; Williams, P.; Edmundson, S.; Chen, P.; Kruk, R.; Cullinan, V.; Crowe, B.; Lundquist, T.

    2017-09-01

    A bench-scale photobioreactor system, termed Laboratory Environmental Algae Pond Simulator (LEAPS), was designed and constructed to simulate outdoor pond cultivation for a wide range of geographical locations and seasons. The LEAPS consists of six well-mixed glass column photobioreactors sparged with CO2-enriched air to maintain a set-point pH, illuminated from above by a programmable multicolor LED lighting (0 to 2,500 µmol/m2-sec), and submerged in a temperature controlled water-bath (-2 °C to >60 °C). Measured incident light intensities and water temperatures deviated from the respective light and temperature set-points on average only 2.3% and 0.9%, demonstrating accurate simulation of light and temperature conditions measured in outdoor ponds. In order to determine whether microalgae strains cultured in the LEAPS exhibit the same linear phase biomass productivity as in outdoor ponds, Chlorella sorokiniana and Nannochloropsis salina were cultured in the LEAPS bioreactors using light and temperature scripts measured previously in the respective outdoor pond studies. For Chlorella sorokiniana, the summer season biomass productivity in the LEAPS was 6.6% and 11.3% lower than in the respective outdoor ponds in Rimrock, Arizona, and Delhi, California; however, these differences were not statistically significant. For Nannochloropsis salina, the winter season biomass productivity in the LEAPS was statistically significantly higher (15.2%) during the 27 day experimental period than in the respective outdoor ponds in Tucson, Arizona. However, when considering only the first 14 days, the LEAPS biomass productivity was only 9.2% higher than in the outdoor ponds, a difference shown to be not statistically significant. Potential reasons for the positive or negative divergence in LEAPS performance, relative to outdoor ponds, are discussed. To demonstrate the utility of the LEAPS in predicting productivity, two other strains – Scenedesmus obliquus and Stichococcus minor

  8. Bulk rock composition and geochemistry of olivine-hosted melt inclusions in the Grey Porri Tuff and selected lavas of the Monte dei Porri volcano, Salina, Aeolian Islands, southern Italy

    Science.gov (United States)

    Doherty, Angela L.; Bodnar, Robert J.; De Vivo, Benedetto; Bohrson, Wendy A.; Belkin, Harvey E.; Messina, Antonia; Tracy, Robert J.

    2012-01-01

    The Aeolian Islands are an arcuate chain of submarine seamounts and volcanic islands, lying just north of Sicily in southern Italy. The second largest of the islands, Salina, exhibits a wide range of compositional variation in its erupted products, from basaltic lavas to rhyolitic pumice. The Monte dei Porri eruptions occurred between 60 ka and 30 ka, following a period of approximately 60,000 years of repose. The bulk rock composition of the Monte dei Porri products range from basaltic-andesite scoria to andesitic pumice in the Grey Porri Tuff (GPT), with the Monte dei Porri lavas having basaltic-andesite compositions. The typical mineral assemblage of the GPT is calcic plagioclase, clinopyroxene (augite), olivine (Fo72−84) and orthopyroxene (enstatite) ± amphibole and Ti-Fe oxides. The lava units show a similar mineral assemblage, but contain lower Fo olivines (Fo57−78). The lava units also contain numerous glomerocrysts, including an unusual variety that contains quartz, K-feldspar and mica. Melt inclusions (MI) are ubiquitous in all mineral phases from all units of the Monte dei Porri eruptions; however, only data from olivine-hosted MI in the GPT are reported here. Compositions of MI in the GPT are typically basaltic (average SiO2 of 49.8 wt %) in the pumices and basaltic-andesite (average SiO2 of 55.6 wt %) in the scoriae and show a bimodal distribution in most compositional discrimination plots. The compositions of most of the MI in the scoriae overlap with bulk rock compositions of the lavas. Petrological and geochemical evidence suggest that mixing of one or more magmas and/or crustal assimilation played a role in the evolution of the Monte dei Porri magmatic system, especially the GPT. Analyses of the more evolved mineral phases are required to better constrain the evolution of the magma.

  9. The effects of enriched CO2 and enhanced UV-B radiation on ultra structure of Dunaliella salina, singly and in combination

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The effects of ambient CO2/ambient UV-B, enriched CO2/ambient UV-B, ambient CO2/enhanced UV-B, and enriched CO2/enhanced UV-B on the ultrastructure of Dunaliella salina were investigated. (1) The ultrastructure of D.salina cell in the control experiment showed that the arrangement of thylakoid lamellae was regular, and there were many large starch grains among the thylakoid lamellae.A prominent well-developed pyrenoid was found in the middle of the chloroplast. Nucleus envelope and nucleolus were clearly observed. The Golgi apparatus accompanied by numerous vesicles with a compact arrangement of cisternae and the peripheral tips of the cisternae were swollen to a size comparable to that of some of the associated vesicles. (2) The ultrastructure of D. salina cell in enriched CO2 showed that the arrangement ofthylakoid was regular and the lamellae were vivid. Developed pyrenoids were found in the low-CO2-grown cells, but not in the high-CO2-grown cells. The mitochondria cristae were vivid. The arrangement of Golgi apparatus was compact. (3) The ultrastructure of D. salina cell in enhanced UV-B showed that the thylakoid was dissolved and the cells had a less developed pyrenoid or no detectable pyrenoid. Part of the nucleus envelope was dissolved. The number ofmitochondria was increased and some mitochondria cristae were disintegrated. The starch grains were broken apart into many small starch grains. The Golgi apparatus with a loose arrangement of cisternae and the peripheral tips of the Golgi cisternae were not especially swollen, with several large associated vesicles. (4) The ultrastructure of D. salina cell in the enriched CO2/enhanced UV-B showed that part of the thylakoid and nucleus envelopes of some cells were dissolved. The pyrenoid was larger than that of the enhanced UV-B. There were many mitochondria between stroma and chloroplast membrane, but mitochondria cristae were partly dissolved. Many small starch grains were accumulated in cells. The starch sheath

  10. Chemical investigation of saponins from twelve annual Medicago species and their bioassay with the brine shrimp Artemia salina.

    Science.gov (United States)

    Tava, Aldo; Pecetti, Luciano

    2012-07-01

    The saponin and sapogenin composition of the aerial growth of 12 annual Medicago species sampled at full senescence were investigated. Saponins were extracted from the plant material and obtained in a highly pure grade by reverse-phase chromatography, with a yield ranging from 0.38 +/- 0.04% to 1.35 +/- 0.08% dry matter, depending on the species. Sapogenins were then obtained after acid hydrolysis of saponins, and evaluated by GC/FID and GC/MS methods. Different compositions of the aglycone moieties were observed in the 12 Medicago species. Medicagenic acid was the dominant aglycone in M. x blancheana, M. doliata, M. littoralis, M. rotata, M. rugosa, M. scutellata, M. tornata and M. truncatula, bayogenin and hederagenin in M. arabica and M. rigidula, echinocystic acid in M. polymorpha, and soyasapogenol B in M. aculeata. The purified saponin mixtures, characterized by different chemical compositions, were then used in a toxicity test using the brine shrimp Artemia salina. The most active compounds were the saponins from M. arabica and M. rigidula with LD50 values of 10.1 and 4.6 microg/mL, respectively. A structure-activity relationship for the tested saponin mixtures was observed.

  11. Growth of mono- and mixed cultures of Nannochloropsis salina and Phaeodactylum tricornutum on struvite as a nutrient source

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Ryan W. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Siccardi, Anthony J. [Texas AgriLife Research Mariculture Lab., Corpus Christi, TX (United States); Huysman, Nathan D. [Texas AgriLife Research Mariculture Lab., Corpus Christi, TX (United States); Wyatt, Nicholas B. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Hewson, John C. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lane, Todd W. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2015-09-26

    In this paper, the suitability of crude and purified struvite (MgNH4PO4), a major precipitate in wastewater streams, was investigated for renewable replacement of conventional nitrogen and phosphate resources for cultivation of microalgae. Bovine effluent wastewater stone, the source of crude struvite, was characterized for soluble N/P, trace metals, and biochemical components and compared to the purified mineral. Cultivation trials using struvite as a major nutrient source were conducted using two microalgae production strains, Nannochloropsis salina and Phaeodactylum tricornutum, in both lab and outdoor pilot-scale raceways in a variety of seasonal conditions. Both crude and purified struvite-based media were found to result in biomass productivities at least as high as established media formulations (maximum outdoor co-culture yield ~20 ± 4 g AFDW/m2/day). Finally, analysis of nutrient uptake by the alga suggest that struvite provides increased nutrient utilization efficiency, and that crude struvite satisfies the trace metals requirement and results in increased pigment productivity for both microalgae strains.

  12. Preliminary evaluation of the toxicity of some synthetic furan derivatives in two cell lines and Artemia salina.

    Science.gov (United States)

    Amaro, María I; Monasterios, Melina; Avendaño, Milagros; Charris, Jaime

    2009-01-01

    This study describes the preliminary toxicity evaluation of five new furan derivatives, 2-[2-acetylamino-2-[(benzothiazolyl-substituted)aminocarbonyl]vinyl]-5-nitro furane (compounds A, B, D and E) and 2-[2-phenylamino-2-[benzothiazolylaminocarbonyl]vinyl]furane (compound C). Cytotoxicity was determined using the MTT (tetrazolium salt) method over BHK21 (Syrian baby hamster kidney) and Hep-2 (human larynx carcinoma) cells, which had previously been used to evaluate the cytotoxicity of the 5-nitrofuran derivatives. The lethal concentration 50 (LC(50)) was determined using brine shrimp (Artemia salina) bioassay. Nitrofurantoin was used as reference compound. The results demonstrate that BHK21 cells are more sensitive than Hep-2 cells. This structurally related serial of compounds shows a differential toxicity, which is an indication that the toxicity naturally arising from the nitro group can be modulated by the substituents over the furan ring. Additionally, compound C, the only derivative with no nitro group, was least toxic to Hep-2, but exhibits toxicity to BHK21 cells and brine shrimp. The LC(50 )brine shrimp test (BST) bioassay results were as follows: A, 654.2 microg ml(-1); B, 50.0 microg ml(-1); C, 533.4 microg ml(-1); D, 172.1 microg ml(-1); E, 76.4 microg ml(-1), and NF, >1000 microg ml(-1).

  13. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    Energy Technology Data Exchange (ETDEWEB)

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.

    1987-08-01

    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO/sub 4//polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO/sub 4/ gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO/sub 4//polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1)/sub 2/ and (P2)/sub 2/ dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits.

  14. Ribosomal S6 kinase is activated as an early event in preemergence development of encysted embryos of Artemia salina.

    Science.gov (United States)

    Malarkey, K; Coker, K J; Sturgill, T W

    1998-01-15

    Dormant Artemia salina cysts contain desiccated gastrulae that are metabolically inactive, and physiologically arrested. Following rehydration, embryos resume development via alterations in protein expression, in the complete absence of cell division. In mammals, activation of p70 ribosomal S6 kinase (p70S6k) has been implicated in translational control, in particular the selective up-regulation of translation of mRNAs with polypyrimidine tracts at their 5' start sites. We therefore investigated ribosomal S6 kinase activity in preemergence development. We demonstrate that an S6 kinase activity is rapidly stimulated (within Artemia S6 kinase was inactivated by treatment with protein phosphatase 2A. Activation of S6 kinase activity was shown to be due to an enzymatic step(s), and not simply rehydration of stored, active enzyme. The temporal profile of activation of S6 kinase activity is compatible with a regulatory function for p70S6k in early preemergence development of encysted Artemia. These studies identify activated Artemia cysts as a system for biochemical studies of p70S6k regulation.

  15. Effects of selected metal oxide nanoparticles on Artemia salina larvae: evaluation of mortality and behavioural and biochemical responses.

    Science.gov (United States)

    Gambardella, Chiara; Mesarič, Tina; Milivojević, Tamara; Sepčić, Kristina; Gallus, Lorenzo; Carbone, Serena; Ferrando, Sara; Faimali, Marco

    2014-07-01

    The aim was to investigate the toxicity of selected metal oxide nanoparticles (MO-NPs) on the brine shrimp Artemia salina, by evaluating mortality and behavioural and biochemical responses. Larvae were exposed to tin(IV) oxide (stannic oxide (SnO2)), cerium(IV) oxide (CeO2) and iron(II, III) oxide (Fe3O4) NPs for 48 h in seawater, with MO-NP suspensions from 0.01 to 1.0 mg/mL. Mortality and behavioural responses (swimming speed alteration) and enzymatic activities of cholinesterase, glutathione-S-transferase and catalase were evaluated. Although the MO-NPs did not induce any mortality of the larvae, they caused changes in behavioural and biochemical responses. Swimming speed significantly decreased in larvae exposed to CeO2 NPs. Cholinesterase and glutathione-S-transferase activities were significantly inhibited in larvae exposed to SnO2 NPs, whereas cholinesterase activity significantly increased after CeO2 NP and Fe3O4 NP exposure. Catalase activity significantly increased in larvae exposed to Fe3O4 NPs. In conclusion, swimming alteration and cholinesterase activity represent valid endpoints for MO-NP exposure, while glutathione-S-transferase and catalase activities appear to be NP-specific.

  16. Synthesis Organonitrogen Compounds from Patchouli Alcohol Through Ritter Reaction with Acetonitrile and Its Toxicity to Artemia salina Leach.

    Directory of Open Access Journals (Sweden)

    Khoirun Nisyak

    2013-03-01

    Full Text Available Patchouli oil contains a compound with biological activities to human body called the patchouli alcohol that can be further developed in medical field. This research aimed to synthesize organonitrogen compound from patchouli alcohol through Ritter reaction with acetonitrile and discover its toxicity towards Artemia salina Leach. The isolation of patchouli alcohol from patchouli oil using fractional distillation under reduced pressure method. The synthesis of organonitrogen compound is done at room temperature with the mol ratio of patchouli alcohol: acetonitrile: sulfuric acid is 1:1,5:4 for 24 hours. The result showed that the amount of patchouli alcohol produced from fractional distillation is 65,25%. The main product yielded from the synthesis between patchouli alcohol and acetonitrile through Ritter reaction is 36,93 % of N-(4,8a,9,9-tetramethyl decahydro-1,6-methanonaphtalene-1-yl acetamide. Starting material used have LC50 of 77,39 ppm. The product of synthesis have higher toxicity level than starting material, which have LC50 value is 10,39 ppm with the potential as medical compounds.

  17. Las expediciones a salinas: caravanas en la pampa colonial. El abastecimiento de sal a Buenos Aires (Siglos XVII y XVIII

    Directory of Open Access Journals (Sweden)

    Gabriel Darío Taruselli

    2005-01-01

    Full Text Available El abastecimiento de sal en cantidades sufi cientes fue una de las principales preocupaciones del Cabildo de Buenos Aires. Fue este un producto de importancia vital no sólo por su aplicación en las comidas cotidianas, sino también por su aplicación en la conservación de las carnes y los cueros. Las características de su uso y su obtención, aumentaron su valor, no sólo comercial sino también estratégico. El hallazgo de yacimientos locales permitió a los habitantes de Buenos Aires abastecerse mediante la práctica de expediciones periódicas que fueron promovidas por las autoridades capitulares, lo que les permitió ejercer un mayor control sobre dicha producción. Como la actividad requería una importante capacidad de transporte y de mano de obra, era una práctica aprovechada por muchos para emplearse en ella y para obtener benefi cios con el comercio que se generaba en la oportunidad. Esto convertía a las expediciones a salinas, organizadas por las autoridades de la ciudad, en grandes caravanas que se internaban en pleno territorio indí-gena, involucrando un amplio conjunto de actores sociales tanto de la ciudad como de la campaña y el mundo indígena

  18. Copper(II) complexes with 2-pyridineformamide-derived thiosemicarbazones: Spectral studies and toxicity against Artemia salina

    Science.gov (United States)

    Ferraz, Karina O.; Wardell, Solange M. S. V.; Wardell, James L.; Louro, Sonia R. W.; Beraldo, Heloisa

    2009-07-01

    The copper(II) complexes [Cu(H2Am4DH)Cl 2] ( 1), [Cu(H2Am4Me)Cl 2] ( 2), [Cu(H2Am4Et)Cl 2] ( 3) and [Cu(2Am4Ph)Cl] ( 4) with 2-pyridineformamide thiosemicarbazone (H2Am4DH) and its N(4)-methyl (H2Am4Me), N(4)-ethyl (H2Am4Et) and N(4)-phenyl (H2Am4Ph) derivatives were studied by means of infrared and EPR spectral techniques. The crystal structure of 4 was determined. The studied compounds proved to be toxic to Artemia salina, suggesting that they could present cytotoxic activity against solid tumors. Among the free thiosemicarbazones H2Am4Ph presented higher toxicity than all other compounds, which showed comparable effects. In the case of complexes 2 and 3 toxicity is probably attributable to the complex as an entity or to a synergistic effect involving the thiosemicarbazone and copper. H2Am4Ph and complexes 2 and 3 revealed to be the most promising compounds as potential antineoplasic agents.

  19. Directed Evolution of Dunaliella salina Ds-26-16 and Salt-Tolerant Response in Escherichia coli.

    Science.gov (United States)

    Guo, Yuan; Dong, Yanping; Hong, Xiao; Pang, Xiaonan; Chen, Defu; Chen, Xiwen

    2016-10-29

    Identification and evolution of salt tolerant genes are crucial steps in developing salt tolerant crops or microorganisms using biotechnology. Ds-26-16, a salt tolerant gene that was isolated from Dunaliella salina, encodes a transcription factor that can confer salt tolerance to a number of organisms including Escherichia coli (E. coli), Haematococcus pluvialis and tobacco. To further improve its salt tolerance, a random mutagenesis library was constructed using deoxyinosine triphosphate-mediated error-prone PCR technology, and then screened using an E. coli expression system that is based on its broad-spectrum salt tolerance. Seven variants with enhanced salt tolerance were obtained. Variant EP-5 that contained mutation S32P showed the most improvement with the E. coli transformant enduring salt concentrations up to 1.54 M, in comparison with 1.03 M for the wild type gene. Besides, Ds-26-16 and EP-5 also conferred E. coli transformant tolerance to freezing, cold, heat, Cu(2+) and alkaline. Homology modeling revealed that mutation S32P in EP-5 caused the conformational change of N- and C-terminal α-helixes. Expression of Ds-26-16 and EP-5 maintained normal cellular morphology, increased the intracellular antioxidant enzymatic activity, reduced malondialdehyde content, and stimulated Nitric Oxide synthesis, thus enhancing salt tolerance to E. coli transformants.

  20. Production of ectoine through a combined process that uses both growing and resting cells of Halomonas salina DSM 5928T.

    Science.gov (United States)

    Lang, Ya-jun; Bai, Lin; Ren, Ya-nan; Zhang, Ling-hua; Nagata, Shinichi

    2011-03-01

    Using ectoine-excreting strain Halomonas salina DSM 5928(T), we developed a new process for high-efficiency production of ectoine, which involved a combined process of batch fermentation by growing cells and production by resting cells. In the first stage, batch fermentation was carried out using growing cells under optimal fermentation conditions. The second stage was the production phase, in which ectoine was synthesized and excreted by phosphate-limited resting cells. Optimal conditions for synthesis and excretion of ectoine during batch fermentation in a 10 l fermentor were 0.5 mol l(-1) NaCl and an initial monosodium glutamate concentration of 80 g l(-1) respectively. The pH was adjusted to 7.0 and the temperature was maintained at 33°C. In phosphate-limited resting cells medium, monosodium glutamate and NaCl concentration was 200 g l(-1) and 0.5 mol l(-1), respectively, as well as pH was 7.0. The total concentration of ectoine produced was 14.86 g l(-1), the productivity and yield of ectoine was 7.75 g l(-1) day(-1) and 0.14 g g(-1), respectively, and the percentage of ectoine excreted was 79%. These levels of ectoine production and excretion are the highest reported to date.

  1. Ocupantes espontáneos y derechos por la tierra en la formación de “pueblos de españoles” (Rincón de San Pedro, Buenos Aires, 1740-1860

    Directory of Open Access Journals (Sweden)

    Mariana Canedo

    2015-01-01

    Full Text Available Durante el siglo XVIII, se multiplicó la presencia de “pueblos de espa-ñoles” y villas en la frontera sur hispanoamericana. El protagonismo de ocupantes rurales en la formación de “pueblos de españoles” fue más frecuente en la campaña de Buenos Aires que en otras jurisdicciones, aunque poco se conoce sobre su proceder. El objetivo del artículo fue analizar las características de los ocupantes rurales y el rango de acción que tuvieron para solicitar el reconocimiento legal de terrenos para la formación de un pueblo en la campaña de Buenos Aires durante el siglo XVIII y parte del XIX. El análisis del caso del pueblo de San Pedro nos permitió profundizar la situación de los “ocupantes” y abrir varios inte-rrogantes sobre la regulación de los derechos por la tierra, particularmen-te sobre los pueblos y villas, en un período que suele estar vinculado a transformaciones en los derechos y en las relaciones de poder ejercidas en su puesta en práctica.

  2. Proyecto Vidas Paralelas Indígena: revelando el pueblo Tupinikim de Espírito Santo, Brasil.

    Directory of Open Access Journals (Sweden)

    Vilma Benedito de OLIVEIRA

    2012-03-01

    Full Text Available Este relato de experincia se refiere al grupo étnico Tupinikim, habitante de un territorio localizado en el município de Aracruz (Estado de Espírito Santo, que representa uno de los sectores sociales más antiguos del área, Saúde Indígena Tempus - Actas de Saúde Coletiva Revista Tempus Actas de Saúde Coletiva 100 perteneciente al tronco lingüístico Tupi de la familia tupi-guaraní. Además de los datos históricos que datan de la colonización portuguesa y de la reducción jesuítica, se resalta la situación creada por el gobierno del estado que dió por resultado la compra y posesión por parte de una multinacional (Aracruz Celulose de tierras indígenas, su invasión por campesinos y la lucha de los pueblos indígenas por su recuperación. Finalmente fue reconocida la demarcación de 18.100 hectáreas de las “Terras Indígenas Comboios e Tupinikim”, recién en 2009. Se describen las asociaciones indígenas que unen a los tupinikim y guaraní. Se detalla la incipiente presencia de estudiantes indígenas en universidades públicas y la pérdida gradual de conocimientos y prácticas tradicionales. El Distrito Sanitario Especial Indígena de Minas Gerais / Espírito Santo (DESEI es responsable por la atención a la salud de los indígenas de los dos estados y tiene su sede en Governador Valadares (MG, muy distante de Aracruz, lo cual plantea dificultades administrativas.

  3. Cirugía y pueblos Amerindios: un reto intercultural Surgery and Amerindian peoples: an intercultural challenge

    Directory of Open Access Journals (Sweden)

    Gerardo Fernández-Juárez

    2010-03-01

    Full Text Available El corte o escisión de la anatomía humana se ha producido en diversas culturas bajo contextos que consideramos como mágicos o religiosos; sin embargo, la intención de brindar recuperación a las personas en sus dolencias, progresivamente hizo de estos cortes procedimientos dirigidos a la extracción de las causantes, conocida como cirugía. Sin embargo, aquello no supuso un reemplazo sino una forma distinta de ver la forma de brindar salud, por tanto aún existen brechas entre aquella ‘cirugía simbólica’ y la que en occidente se practica. En la siguiente revisión se ofrece una descripción sobre la visión de diversos pueblos respecto a la cirugía, y algunas anécdotas de cómo ha influido, modificado o sido rechazada la aplicación de la cirugía moderna.Many cultures have performed the cutting and excision of the human anatomy under contexts that we consider magical or religious; nevertheless, the will to offer recovery to people in their diseases, progressively transformed these cuttings into procedures aimed at the extraction of their causes, known as surgery. However, that didn’t imply a replacement but a different sight of how to provide health, that is why there are still gaps between that "symbolic surgery" and the one practiced in occident. In this review we offer a description of the vision of diverse communities regarding surgery, and some anecdotes of how it has influenced, modified or rejected the application of modern surgery.

  4. Efeito da solução salina 0,9% e tampão fosfato salina em diferentes temperaturas e tempos de incubação sobre a morfologia de folículos pré-antrais caprinos

    Directory of Open Access Journals (Sweden)

    Regiane Rodrigues dos Santos

    2002-01-01

    Full Text Available O presente trabalho investigou a eficiência da solução salina 0,9% e tampão fosfato salina (PBS na conservação de folículos pré-antrais caprinos in situ a diferentes temperaturas e tempos de incubação. O par ovariano de cada animal foi dividido em 19 fragmentos. Um fragmento foi escolhido aleatoriamente e fixado (controle. Os outros 18 fragmentos foram distribuídos aleatoriamente em tubos contendo solução salina 0,9% ou PBS a 4, 20 ou 39 °C por 4, 12 ou 24 h. Um total de 5.921 folículos pré-antrais foram analisados. A qualidade dos folículos pré-antrais foi avaliada através de histologia clássica. A incubação de fragmentos ovarianos em solução salina 0,9% ou PBS a 4 ºC não reduziu significativamente a percentagem de folículos morfologicamente normais quando comparados com o controle, exceto após a conservação em solução salina 0,9% por 24 h. A incubação de fragmentos ovarianos a 20 ou 39°C reduziu a percentagem de folículos pré-antrais normais quando comparados com o controle, exceto após conservação em PBS a 20°C por 4 h. Em conclusão, este estudo mostrou pela primeira vez que folículos pré-antrais caprinos podem ser conservados in situ com sucesso a 4 ºC em solução salina 0,9% por 12 h e em PBS por 24 h, e a 20 ºC em PBS por 4 h.

  5. Imágenes y sonidos del Wall Mapu. El proyecto de descolonización del universo visual y sonoro del Pueblo Mapuche

    Directory of Open Access Journals (Sweden)

    Elisa García Mingo

    2016-01-01

    Full Text Available La historia del vídeo indígena y de las radios indígenas en el Abya Yala (América Latina es una historia de descolonización de la palabra y la imagen. La propuesta de descolonización mediática que han elevado los pueblos indígenas del Abya Yala, basada en la producción de textos verbo-audio-visuales desde su propia cosmovisión y proponiendo nuevos lenguajes visuales, nos permiten (repensar sobre las nuevas (y antiguas formas de ver y las identidades visuales divergentes. A su vez, las radios indígenas han permitido a las comunidades crear un espacio para elevar la voz colectiva y proyectarla en el radioespectro creando paisajes sonoros descolonizados mediante nuevos (y antiguos lenguajes sonoros que se adecuan a una formas de escuchar propias de su cosmovisión y que permiten revisar la matriz epistémica que ha conformado la mirada y el oído occidental, que en muchas ocasiones han constituido una mirada colonial y colonizadora sobre los Pueblos Indígenas. En las dos últimas décadas, el Pueblo Mapuche ha creado proyectos mediáticos que han producido una interferencia en un “mediasfera” (Appadurai, 1995 colonizado que estaba monopolizado por los estados criollos que han construido la memoria de los nuevos estados sobre una identidad no indígena. Este artículo contempla la dimensión política de estos proyectos, ya que la producción audiovisual tiene demostrada capacidad para empoderar a los sujetos subalternizados y permitirles desafiar la violencia de la representación que han experimentado.

  6. Los mejores médicos de la Tierra. El “pueblo de Israel” en el Examen de ingenios de Juan Huarte (1575

    Directory of Open Access Journals (Sweden)

    Rafael Mandressi

    2016-07-01

    Full Text Available El Examen de ingenios del médico navarro Juan Huarte de San Juan, que conoció una amplísima difusión desde la publicación de su primera edición en Baeza (1575 hasta comienzos del siglo xviii, expone una teoría de las aptitudes basada en el saber médico y en la filosofía natural de raíz aristotélico-galénica. Se trata, así mismo, de un libro político, desde que en función de esa teoría, Huarte propone una clasificación de los individuos según el “ingenio” del que estén naturalmente dotados para el estudio y/o el ejercicio de alguna disciplina en particular. En el capítulo dedicado a la medicina, una extensa argumentación apunta a demostrar la superioridad de los judíos (el “pueblo de Israel” en lo que respecta a la medicina práctica. Del análisis de ese largo pasaje surge una asociación estrecha no solo entre un “ingenio” natural y una ciencia, como en el resto de los capítulos correspondientes a la parte aplicada del libro, sino además de ambas cosas con un pueblo, definido por ende en virtud de rasgos naturales específicos, inscriptos en el cuerpo, y, por añadidura, transmisibles por vía hereditaria. El modo según el cual Huarte fundamenta la especial aptitud del pueblo judío para la medicina práctica constituye, en el contexto en el que se expresa, un gesto político significativo y robusto.

  7. Los mejores médicos de la Tierra. El “pueblo de Israel” en el Examen de ingenios de Juan Huarte (1575

    Directory of Open Access Journals (Sweden)

    Rafael Mandressi

    2016-07-01

    Full Text Available El Examen de ingenios del médico navarro Juan Huarte de San Juan, que conoció una amplísima difusión desde la publicación de su primera edición en Baeza (1575 hasta comienzos del siglo xviii, expone una teoría de las aptitudes basada en el saber médico y en la filosofía natural de raíz aristotélico-galénica. Se trata, así mismo, de un libro político, desde que en función de esa teoría, Huarte propone una clasificación de los individuos según el “ingenio” del que estén naturalmente dotados para el estudio y/o el ejercicio de alguna disciplina en particular. En el capítulo dedicado a la medicina, una extensa argumentación apunta a demostrar la superioridad de los judíos (el “pueblo de Israel” en lo que respecta a la medicina práctica. Del análisis de ese largo pasaje surge una asociación estrecha no solo entre un “ingenio” natural y una ciencia, como en el resto de los capítulos correspondientes a la parte aplicada del libro, sino además de ambas cosas con un pueblo, definido por ende en virtud de rasgos naturales específicos, inscriptos en el cuerpo, y, por añadidura, transmisibles por vía hereditaria. El modo según el cual Huarte fundamenta la especial aptitud del pueblo judío para la medicina práctica constituye, en el contexto en el que se expresa, un gesto político significativo y robusto.

  8. Influencia de organizaciones en el desarrollo rural: caso de Salinas, San Luis Potosí Influence of organizations for the rural development: the case of Salinas, San Luis Potosí

    Directory of Open Access Journals (Sweden)

    Luz María Pérez-Hernández

    2011-08-01

    Full Text Available La organización es considerada como elemento estratégico en el desarrollo de una localidad rural, ya que a través de ésta se obtienen mayores beneficios, permite a las personas desarrollar sus capacidades y son impulsoras de proyectos dentro de las comunidades. Sin embargo, es común que los territorios rurales cuenten con un tejido asociativo desarticulado que limita esas posibilidades. Por lo anterior se planteo conocer las causas de la escasa participación de la sociedad en grupos organizados y la problemática que enfrentan las organizaciones asentadas en un territorio, a través de un estudio de caso en el municipio de Salinas, San Luis Potosí, México, en 2009. El objetivo de este trabajo es identificar las causas que están originando que la organización no tenga impacto en el municipio, lo que permitirá formular una estrategia para lograr que ésta sea un motor de desarrollo en el territorio. Los resultados indican que la mayoría de las personas no participan en ningún tipo de organización aún cuando les gusta trabajar en grupo. En general, las organizaciones se enfrentan a dificultades para tomar acuerdos y cumplir los compromisos adquiridos. Las organizaciones formales en el municipio incluyen organizaciones económicas y de representación. Ambas presentan problemas internos relacionados con la falta de recursos económicos, la escasa capacitación y la falta de compromiso del grupo; elementos que no han permitido su consolidación y su participación en el desarrollo del territorio.The organization is considered as a strategic element in the development of a rural locality, because through it higher benefits are obtained, it allows people to develop their skills and promotes projects within the communities. However, it is common that rural areas have a dismantled association network that limits those possibilities. For that reason, the causes of low society's participation in organized groups and the problems faced by

  9. Observações preliminares sobre a toxicidade do ϒBHC e do cloreto de mercúrio à Artemia salina Preliminary observations on the toxicity of ϒBHC and mercuric cloride on Artemia salina

    Directory of Open Access Journals (Sweden)

    Salvador Airton Gaeta

    1983-01-01

    Full Text Available São apresentados os resultados de bioensaios com larvas de Artemia salinacolocadas em misturas de γBHC e HgCl2, a fim de se compararem os efeitos das mesmas com aqueles obtidos quando essas duas substancias atuam isoladamente. A CL50 para o yBHC foi quase que o dobro do valor para o HgCl2. O efeito da primeira dose foi observado para aproximadamente 16% da população (CL16, enquanto que, para o γBHC, o foi em 2,3% da população (CL2,3. Assim, as doses subseqüentes foram mais efetivas para o HgCl2 que para o γBHC. A dose efetiva 50% (ED50 ê mais ou menos igual para o γBHC e para o γBHC + HgCl2, mas em doses altas o YBHC seria mais efetivo, enquanto que em doses baixas a mistura e que o seria.Results of bio-assays using Artemia salina larvae in γBHC-HgCl2 mixture are presented. The results obtained are compared with those obtained using the two chemicals separately. The LC50 for γBHC was almost double that for HgCl2. The effect due to the primary dose of HgCl2 was observed for approximately 16% of the population (LC2.3 while for γBHC the population percentage was 2.3 (LC2.3. As a consequence, subsequent doses were more effective for HgCl2 than for γBHC. The effective dose 50% (ED50 is about the same for γBHC and for γBHC + HgCl2 mixture, though in higher doses BHC would be more effective, while in smaller doses the mixture would predominate.

  10. Ética intercultural y reconocimiento dialógico. Una mirada a la dignidad del otro: conflicto entre el Estado de Chile - Pueblo Mapuche

    Directory of Open Access Journals (Sweden)

    Jorge Araya Anabalón

    2010-07-01

    Full Text Available El presente trabajo configura una búsqueda de soluciones posibles al conflictointerétnico vigente entre el pueblo Mapuche y el Estado de Chile desde unaperspectiva del reconocimiento y de relaciones dialógicas que conduzcan a unconsenso intercultural, cuyo objetivo es desarrollar los fundamentos teóricos yprácticos necesarios para delinear una mirada ética del conflicto, que puedaplasmar una comunidad humana sin humillación, degradación, no reconocimiento,evitando el daño y la crueldad.

  11. Democracia formal y derechos indígenas. Una aproximación a la relación actual entre el estado chileno y el pueblo mapuche

    Directory of Open Access Journals (Sweden)

    Tito Tricot

    2009-12-01

    Full Text Available No es posible entender la relación entre el pueblo mapuche, el Estado chileno y la democracia, sin entender el tipo de vínculo histórico que se ha verificado entre el Estado y el mapuche a partir de la génesis de Chile como país. Por lo mismo, el objetivo general del presente trabajo es explorar el tipo de vínculo que existe entre el Estado de Chile y el pueblo mapuche y, el objetivo específico, analizar la situación de los derechos indígenas en el marco del sistema democrático formal actualmente vigente en nuestro país. Para lograr dichos objetivos realizaremos una breve contextualización histórica de la relación Estado-Pueblo mapuche; se analizará el modelo económico, principalmente en lo concerniente a la inversión forestal y la ejecución de megaproyectos en territorio mapuche; la Ley indígena en general y el concepto de pueblo indígena en particular; el denominado conflicto mapuche y la Ley anti-terrorista. Todo ellos, esperamos, servirán de elementos de juicio y antecedentes importantes para aproximarnos al problema de la relación entre la democracia formal y los derechos indígenas._______________________ABSTRACT:It is not possible to understand the relation between the Mapuche Nation, the Chilean State and the democracy, without understanding the type of historical bond that has occurred between the State and the Mapuche nation from the onset of Chile as a Country. For the same reason, the general purpose of the present work is to explore the type of connections existing between the State of Chile and the Mapuche Nation and the specific aim is to analyze the situation of the indigenous rights in the democratic system context that is actually in force in our country. In order to obtain these aims we will make a brief historical contextualización of the relation State-Mapuche Nation; the economic model will be analyzed, mainly as for the forest investment and the implementation of superproyects in the Mapuche land

  12. Niños en extrema pobreza... ¿socialización deficitaria?Resultado de un estudio empírico en un pueblo joven de Lima

    Directory of Open Access Journals (Sweden)

    Schade Burkhard

    1989-12-01

    Full Text Available Los autores estudian las características de socialización de niños en extrema pobreza provenientes de un pueblo joven de Lima. Utilizando un cuestionario entrevistaron a 30 familias, con un promedio de seis a diez miembros cada una. Los resultados muestran que los niños no tienen un status propio, sino que panicipan y se adaptan a la vida de los adultos. La dimensión emocional no juega un rol significativo, así como las diferencias interindividuales, salvo las de género. Los resultados son discutidos y comparados a los de sociedades industrializadas.

  13. Consulta previa a pueblos indígenas y tribales: análisis y propuesta de legislación

    OpenAIRE

    Vega Rodríguez, Alejandra

    2012-01-01

    Este trabajo se constituye en un análisis de convenciones, tratados y principios y sentencias tanto nacionales como internacionales sobre el derecho a la consulta previa para pueblos indígenas y tribales; así como el análisis de un caso colombiano que ha sido tratado a nivel internacional y nacional. Esta es una investigación de tipo cualitativo y dogmática que quiere proponer los elementos que permitan diseñar un proyecto de normatividad para la consulta previa que adecué la legislación colo...

  14. Percepciones de reconocimiento de su cultura en los estudiantes afrodescendientes de la Institución Educativa Pueblo Nuevo Ciprés El Tambo Cauca

    OpenAIRE

    Montero Muñoz, Olga Lucía; Urrea Rebolledo, Arcenio

    2011-01-01

    Tesis (Maestría en Educación desde la Diversidad).Universidad de Manizales. Facultad de Ciencias Sociales y Humanas, 2011 El presente trabajo está inscrito en la línea de investigación alternativas pedagógicas del grupo de investigación de pedagogía de la Universidad de Manizales. El objetivo es comprender las percepciones de reconocimiento que de su cultura tienen los estudiantes afrodescendientes de la Institución Educativa Pueblo Nuevo Ciprés El Tambo Cauca, como un aporte a la consolid...

  15. Territorio sin Estado. El caso de los pueblos palafíticos en la Ciénaga Grande de Santa Marta

    OpenAIRE

    Juan Pablo Sarmiento E.

    2015-01-01

    Este estudio argumenta que en Colombia, donde el Estado no tiene pre sencia, las comunidades crean y recrean formas paraestatales de gobierno que les permiten organizarse pacífica, política y jurídicamente. A través de un estudio de caso (los pueblos palafíticos de la Ciénaga Grande de Santa Marta) se expondrá la manera como una sociedad sin una singularidad cul tural determinada, pero en la que el Estado ha sido incipiente, ha generado formas de gobierno local, diferenciadas y paralela...

  16. Los pueblos indígenas y la consulta previa: ¿normatización o emancipación? Una mirada desde Guatemala

    Directory of Open Access Journals (Sweden)

    Guillermo Alberto Padilla Rubiano

    2016-01-01

    Full Text Available El presente artículo trata sobre la incidencia de los cambios que han estado ocurriendo en las últimas décadas en el campo de las relaciones entre pueblos indígenas y Estados en América Latina, en particular a partir de la introducción de un cuerpo de derechos de origen internacional que en teoría modifican sustancialmente las dinámicas entre estos pueblos y otras minorías étnicas con los Estados. La forma como esta influencia se produce frente al Estado tiene un espectro muy amplio. Para evidenciar este fenómeno, se contrasta lo que ha ocurrido en la región, en particular el caso colombiano y el de Guatemala. En el primero, la incidencia indígena alcanza a modificar la narrativa y práctica institucionales, mientras que en el segundo, el Estado se ha caracterizado por estar ausente y ser reticente en el ejercicio y la implementación de derechos de los pueblos indígenas. Para analizar este aspecto, en el presente artículo se analiza la construcción de una hidroeléctrica en la región Ixil de Guatemala, donde el efecto de la presencia del Estado ha sido una fuerte represión a la población indígena a la que se le han usurpado sus tierras ancestrales, al punto que el 75 % de ellas están en manos de dos propietarios de origen extranjero. Sobre la base de la responsabilidad demostrada del Ejército de Guatemala —que a comienzos de la década de 1980 ejecutó varias masacres contra el pueblo Ixil—, el dictador y general Efraín Ríos Montt fue condenado por genocidio en el 2014, pero su sentencia fue anulada unos días más tarde por supuestos vicios en el procedimiento.

  17. Sistemas defensoriales de protección de los Derechos de los pueblos indígenas. La experiencia de México

    OpenAIRE

    2008-01-01

    El respeto y reconocimiento de los Derechos de los Pueblos Indígenas, se ha configurado como uno de los temas centrales para la labor de los Ombudsman en la mayoría de los países del mundo, dado que, la identidad indígena y la especificidad de su cultura, han puesto a prueba la noción «moderna» de los derechos humanos y, por tanto, su efectiva salvaguarda. Algunas de sus causas las encontramos en la noción de «Estado» surgida en el siglo XIX, la cual se basaba en concepciones de unidad e igua...

  18. A Zuni Artist looks at Frank Hamilton Cushing: Cartoons by Phil Hughte, Pueblo of Zuni Arts and Crafts, Zuni, New Mexico

    Directory of Open Access Journals (Sweden)

    Douglas R. Givens

    1996-05-01

    Full Text Available This book is a very unique look into the legacy of Frank Hamilton Cushing at Zuni and his influence on the Zuni people by the Zuni cartoonist Phil Hughte. This volume of Hughte's cartoons depicts Cushing at various periods and important moments of his career at Zuni. Although Hughte's cartoons selected Cushing moments at Zuni require no words to express Cushing's influence on the pueblo, Hughte provides captions to each of his cartoons designed to explain what Cushing was doing to the reader who is not intimately knowledgeable about Cushing's work.

  19. La reinvención de la nación en la argentina actual: estado, relato nacional y pueblos indígenas

    Directory of Open Access Journals (Sweden)

    Sofía Soria

    2011-04-01

    Full Text Available El artículo se propone analizar la articulación del relato nacional que el Estado puso en juego en el contexto del debate y posterior aprobación de la Ley de Educación Nacional en Argentina durante 2006. Partiendo del análisis de documentos publicados a propósito de ese debate, el objetivo es problematizar las narrativas en las cuales la nación se reinventa y cobra nuevos perfiles en su relación con “otros”: los pueblos indígenas.

  20. Reseña de "Pueblos indígenas para el mundo del mañana", de Stephen Corry

    OpenAIRE

    Dangla Gea, Borja

    2016-01-01

    Obra ressenyada: Stephen CORRY, Pueblos indígenas para el mundo del mañana. El modo de vida occidental es una construcción sociocultural particular de un espacio y un tiempo histórico concreto. Su noción de "progreso" nace con el colonialismo y la revolución industrial y, por tanto, tampoco es universal; de hecho, Corry afirma que no es ni el deseo de toda la humanidad ni el “objetivo” (si es que se puede decir que una sociedad tiene un objetivo) de todas las sociedades del planeta. El lib...

  1. Consideraciones ambientales y viabilidad socioeconómica del sistema productivo del cacao el caso de los agricultores de Pueblo Bello, Departamento del César

    OpenAIRE

    Ramos Pérez, Danilo Fernando

    2014-01-01

    Pueblo Bello es uno de los 25 municipios colombianos que integran el Departamento del Cesar. Se encuentra sobre la Sierra Nevada de Santa Marta a una altitud de 1200 m s.n.m. y su temperatura media es de 21,8°C. Es un importante centro para servicios de salud y abasto para la población indígena de la Sierra y un atractivo sitio turístico, no solo para los habitantes del Cesar, sino también para otras regiones de Colombia por tener en su jurisdicción la capital de la Cultura Arhuaca Nabusímake...

  2. Los movimientos sociales desde la perspectiva de las mujeres y pueblos indígenas. Un análisis desde la jurisprudencia de la Corte Constitucional colombiana

    Directory of Open Access Journals (Sweden)

    Gerardo A. Durango Álvarez

    2012-01-01

    Full Text Available Las luchas de los pueblos indígenas de América Latina por sus derechos ancestrales, así como las reivindicaciones emprendidas por las mujeres sobre la equidad e igualdad material entre hombres y mujeres, han incidido de manera notoria en temas cruciales como la participación política en la toma de decisiones que les afectan, en exigir una mayor inclusión en las políticas sociales, en la lucha por el reconocimiento y garantía de sus derechos fundamentales y en los debates sobre la perspectiva de género, etc.

  3. Conflictos, denominación de pueblo mágico y el papel amate en Pahuatlán de Valle, Puebla

    OpenAIRE

    González García, Carolina Paola

    2015-01-01

    El turismo por su contribución a la economía se convierte en una prioridad nacional. Dada su importancia como factor de desarrollo y motor de crecimiento se incluye en el Plan Nacional de Desarrollo. Como una de las estrategias de desarrollo turístico se inscribe el programa de Pueblos Mágicos, definido como “una localidad que tiene atributos simbólicos, leyendas, historia, hechos trascendentes, cotidianidad, en fin MAGIA que emana en cada una de sus manifestaciones socio - cul...

  4. La vigencia de la tradición cultural mesoamericana en Milpa Alta, pueblo antiguo de la ciudad de México

    OpenAIRE

    Teresa Losada

    2005-01-01

    En este artículo, la autora explora, a través de un trabajo de campo, la forma en que la memoria histórica se articula con la cosmovisión en Milpa Alta, un pueblo antiguo de la ciudad de México. La narración mítica que refiere al origen, se ubica en la historia de "larga duración", en el ensamblaje de la naturaleza con los ciclos de las fiestas religiosas y la relación con la tierra. La cosmovisión mesoamericana, incesantemente repetida, atraviesa el tiempo y le corresponde con...

  5. Los derechos al conocimiento tradicional de los pueblos indígenas canadienses en materia de biotecnología. Compromisos internacionales

    OpenAIRE

    2011-01-01

    En Canadá los derechos de los pueblos indígenas sobre el conocimiento tradicional se encuentran limitados por cuatro causas, la primera se vincula a las formas de concebir a los indígenas desde el momento en que empezó a delimitarse y a construirse el Estado canadiense, la segunda a la tradición jurídica basada en el common law, la tercera a los intereses del Estado por la biotecnología, y la cuarta a los compromisos internacionales suscritos. Con base en estas cuatro causas, el artículo expo...

  6. JUSTICIA CONSTITUCIONAL EN BOLIVIA. DESAFÍOS Y OPORTUNIDADES PARA LA TUTELA DE LOS DERECHOS DE LOS PUEBLOS INDÍGENAS EN CONFLICTOS SOCIO-AMBIENTALES

    OpenAIRE

    2013-01-01

    Las organizaciones indígenas del país han optado regularmente en las últimas décadas por las acciones directas, de hecho, a fin de lograr el reconocimiento e implementación de sus derechos; ello, frente a una débil institucionalidad estatal en Bolivia. La Justicia Constitucional (JC) en su primera etapa de funcionamiento (1999-2011), en general no otorgó una tutela efectiva a los derechos de los pueblos indígenas vinculados aconflictos socio-ambientales. En este trabajo, se realiza un ...

  7. Legislación de pesca y obstáculos para el reconocimiento de derechos al uso preferencial de recursos naturales del pueblo Cucapá

    OpenAIRE

    Navarro, Alejandra; Bravo Espinoza, Yacotzin; López Sagástegui, Catalina

    2013-01-01

    Aquí se describen los conflictos que surgieron entre pescadores cucapás y autoridades al aplicar el tope de captura para la curvina golfina, en 2012. Ésta es la medida legal más reciente que limita el volumen de pesca permitido por temporada en el Alto Golfo de California. Con registros etnográficos pensamos las relaciones entre leyes, manejo sustentable de los recursos pesqueros y el derecho al uso preferencial de recursos naturales que tienen los pueblos indígenas en México. De fondo, se re...

  8. Representaciones sociales en torno al “conflicto” estado chileno - pueblo mapuche en jóvenes universitarios chilenos: un estudio con redes semánticas naturales

    OpenAIRE

    Marianela Denegri Coria; David Chávez Herting; Francisca Silva Layera; Carlos Del Valle Rojas

    2015-01-01

    Esta investigación tuvo como propósito realizar una primera aproxi - mación a las representaciones sociales sobre el “conflicto estado-nación y pueblo mapuche”, en estudiantes universitarios del área de Ciencias Sociales de una universidad estatal del sur de Chile. Se trabajó con la técnica de redes semánticas naturales, utilizando cuatro frases- estímulo. Los resultados indican que existe una percepción de la circunstancia en la que se resalta la situación de conflicto, con una mirada m...

  9. Conflictos, denominación de pueblo mágico y el papel amate en Pahuatlán de Valle, Puebla

    OpenAIRE

    2015-01-01

    El turismo por su contribución a la economía se convierte en una prioridad nacional. Dada su importancia como factor de desarrollo y motor de crecimiento se incluye en el Plan Nacional de Desarrollo. Como una de las estrategias de desarrollo turístico se inscribe el programa de Pueblos Mágicos, definido como “una localidad que tiene atributos simbólicos, leyendas, historia, hechos trascendentes, cotidianidad, en fin MAGIA que emana en cada una de sus manifestaciones socio - cul...

  10. Imagen y representación de los territorios de montaña: pueblos y valles de la Sierra de Ancares (León y Lugo)

    OpenAIRE

    Fernández Fernández, Vanessa

    2014-01-01

    [ES] La presente Tesis Doctoral parte de la siguiente hipótesis: del reconocimiento social, científico, medioambiental y jurídico del los pueblos y valles de la sierra de Ancares se desprende una valoración simbólica que perpetúa elementos secundarios y parciales de su realidad que no responden a las necesidades y demandas internas de su población ni garantizan su futuro. El territorio de estudio comprende los municipios leoneses de Candín, Peranzanes, Vega de Espinareda y Villafranca del Bie...

  11. Modelo dinámico-probabilístico sobre el comportamiento de los pueblos indígenas en aislamiento de la Amazonia Ecuatoriana.

    OpenAIRE

    Heredia Rengifo, Marco G.; Hernández Díaz-Ambrona, Carlos Gregorio

    2013-01-01

    La supervivencia de los pueblos en aislamiento (PIAs), Tagaeri? Taromenane en la Amazonia ecuatoriana, está influida por agentes externos y características culturales. El área definida como Zona Intangible para el desplazamiento de los PIAs presenta cierta debilidad geográfica, lo que alterna el funcionamiento de estas comunidades. El objetivo de este trabajo es conocer el comportamiento de las comunidades aisladas en relación con las fronteras de contactos. Se ha utilizado el software libre ...

  12. La dualidad andina del pueblo Pasto, principio filosófico ancestral inmerso en el tejido en guanga y la espiritualidad

    OpenAIRE

    Chirán Caipe, Rosa Alba; Burbano Hernández, Marleny

    2013-01-01

    Artículo (Maestría en Educación desde la Diversidad).Universidad de Manizales.Facultad de Ciencias Sociales y Humanas, 2013 El pensamiento indígena del pueblo pasto gira en torno a un plan para preservar la vida, de todo ser, el territorio es un lugar de respeto, un espacio mítico y espiritual donde se forjan sus saberes propios vivir en unidad en medio de lo diverso, reconstruir con nuevas formas de vida no escritas en libros, sino en la memoria de la comunidad, en la historia oral de los...

  13. IRRIGAÇÃO COM ÁGUA SALINA NA CULTURA DO AMENDOIM EM SOLO COM BIOFERTILIZANTE BOVINO

    Directory of Open Access Journals (Sweden)

    Geocleber Gomes de Sousa

    2014-06-01

    Full Text Available O experimento foi conduzido na área experimental da Estação Agrometereológica, UFC, em Fortaleza/Ceará, no período de setembro a novembro de 2012, com o objetivo de avaliar o efeito da salinidade da água de irrigação nas características agronômicas do amendoinzeiro, cultivar BRS 1 em solo com e sem biofertilizante bovino. Os tratamentos foram distribuídos em delineamento inteiramente casualizado, em esquema fatorial 5 x 2, com cinco repetições, referente aos valores de condutividade elétrica da água de irrigação:0,8; 1,5; 3,0; 4,5 e 6,0 dS m-1, em solo sem e com biofertilizante bovino, aplicado de uma única vez, ao nível de 10% do volume do substrato, três dias antes da semeadura. As variáveis analisadas foram: número de folhas, altura de plantas, diâmetro do caule, área foliar, comprimento de raiz, matéria seca da parte aérea, da raiz e total. O aumento da concentração salina da água de irrigação reduziu a área foliar, matéria seca da parte aérea, matéria seca total e comprimento da raiz do amendoinzeiro, porém com menor intensidade no solo com o biofertilizante bovino. A elevação da salinidade do solo decorrente da irrigação com água salina provoca redução na altura da planta, diâmetro do caule e matéria seca da raiz. Palavra-chave: estresse salino, índices fisiológicos, insumo orgânico. PEANUT CULTURE IRRIGATED WITH SALINE WATER IN SOIL WITH BOVINE BIOFERTILIZER ABSTRACT This experiment was conducted at the agrometeorological experimental station, at the UFC, Fortaleza-CE (BR, in the period from September 2012 to November 2012, aiming to evaluate the effects of irrigation water salinity on the agronomic characteristics of BRS 1 peanut plant, in bio fertilized and non-bio fertilized soil. Treatments were arranged in a completely randomized design in a 5 x 2 factorial scheme, with five repetitions. Five different saline solutions (or irrigation water, identified by their respective electrical

  14. Hydrologic, water-quality, and biological assessment of Laguna de las Salinas, Ponce, Puerto Rico, January 2003-September 2004

    Science.gov (United States)

    Soler-López, Luis R.; Gómez-Gómez, Fernando; Rodríguez-Martínez, Jesús

    2005-01-01

    The Laguna de Las Salinas is a shallow, 35-hectare, hypersaline lagoon (depth less than 1 meter) in the municipio of Ponce, located on the southern coastal plain of Puerto Rico. Hydrologic, water-quality, and biological data in the lagoon were collected between January 2003 and September 2004 to establish baseline conditions. During the study period, rainfall was about 1,130 millimeters, with much of the rain recorded during three distinct intense events. The lagoon is connected to the sea by a shallow, narrow channel. Subtle tidal changes, combined with low rainfall and high evaporation rates, kept the lagoon at salinities above that of the sea throughout most of the study. Water-quality properties measured on-site (temperature, pH, dissolved oxygen, specific conductance, and Secchi disk transparency) exhibited temporal rather than spatial variations and distribution. Although all physical parameters were in compliance with current regulatory standards for Puerto Rico, hyperthermic and hypoxic conditions were recorded during isolated occasions. Nutrient concentrations were relatively low and in compliance with current regulatory standards (less than 5.0 and 1.0 milligrams per liter for total nitrogen and total phosphorus, respectively). The average total nitrogen concentration was 1.9 milligrams per liter and the average total phosphorus concentration was 0.4 milligram per liter. Total organic carbon concentrations ranged from 12.0 to 19.0 milligrams per liter. Chlorophyll a was the predominant form of photosynthetic pigment in the water. The average chlorophyll a concentration was 13.4 micrograms per liter. Chlorophyll b was detected (detection limits 0.10 microgram per liter) only twice during the study. About 90 percent of the primary productivity in the Laguna de Las Salinas was generated by periphyton such as algal mats and macrophytes such as seagrasses. Of the average net productivity of 13.6 grams of oxygen per cubic meter per day derived from the diel

  15. Effects of aqueous suspensions of titanium dioxide nanoparticles on Artemia salina: assessment of nanoparticle aggregation, accumulation, and toxicity.

    Science.gov (United States)

    Ates, Mehmet; Daniels, James; Arslan, Zikri; Farah, Ibrahim O

    2013-04-01

    Aquatic stability and impact of titanium dioxide nanoparticles (TiO2 NPs, 10-30 nm) were investigated using Artemia salina. Acute exposure was conducted on nauplii (larvae) and adults in seawater in a concentration range from 10 to 100 mg/L TiO2 NPs for 24 and 96 h. Rapid aggregation occurred in all suspensions of TiO2 NPs to form micrometer size particles. Yet, both nauplii and adults accumulated the aggregates significantly. Average TiO2 content in nauplii ranged from 0.47 to 3.19 and from 1.29 to 4.43 mg/g in 24 and 96 h, respectively. Accumulation in adults was higher ranging from 2.30 to 4.19 and from 4.38 to 6.20 mg/g in 24 and 96 h, respectively. Phase contrast microscopy images revealed that Artemia were unable to excrete the particles. Thus, the TiO2 aggregates filled inside the guts. No significant mortality or toxicity occurred within 24 h at any dose. Lipid peroxidation levels characterized with malondialdehyde concentrations were not statistically different from those of the controls (p > 0.05). These results suggested that suspensions of the TiO2 NPs were nontoxic to Artemia, most likely due to the formation of benign TiO2 aggregates in water. In contrast, both mortality and lipid peroxidation increased in extended exposure to 96 h. Highest mortality occurred in 100 mg/L TiO2 NP suspensions; 18 % for nauplii and 14 % for adults (LC50 > 100 mg/L). These effects were attributed to the particle loading inside the guts leading to oxidative stress as a result of impaired food uptake for a long period of time.

  16. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Yanlong Wang

    Full Text Available We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli, Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology and KEGG (Kyoto encyclopedia of genes and genomes enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species scavenging, membrane proteins and ABC (ATP binding cassette transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli.

  17. Clorofila e carotenoides em maracujazeiro-amarelo irrigado com águas salinas no solo com biofertilizante bovino

    Directory of Open Access Journals (Sweden)

    Lourival Ferreira Cavalcante

    2011-10-01

    Full Text Available Os efeitos deletérios provocados pelo estresse salino resultam em modificações nos mecanismos bioquímicos e fisiológicos das plantas, alterando, dentre outros, os teores foliares de clorofila e carotenoides, comprometendo a atividade fotossintética e, consequentemente, o crescimento, o desenvolvimento, a produção e a adaptabilidade aos ambientes adversos. O objetivo do trabalho foi avaliar os efeitos de diferentes condutividades elétricas da água de irrigação (CEai, associadas às épocas de aplicação de biofertilizante, sobre os teores de pigmentos fotossintéticos para a determinação dos pigmentos cloroplastídicos (clorofila a, b, total e carotenoides do maracujazeiro-amarelo. Os tratamentos foram distribuídos em arranjo fatorial 5 x 4, referentes aos valores de CEai: 0,5; 1,5; 2,5; 3,5 e 4,5 dS m-1, em quatro épocas de aplicação do biofertilizante: sem biofertilizante (SB; aplicação uma semana antes do transplantio (1SAT; a cada 90 dias, a partir do transplantio (90DAT; uma semana antes e a cada 90 dias, após o transplantio (1SAT+90DAT. O aumento da concentração salina da água de irrigação reduziu a eficiência fotossintética nas folhas do maracujazeiro-amarelo, sendo mais drástico na condutividade superior a 2,5 dS m-1. As frequências de aplicação do biofertilizante não influenciaram nas concentrações dos pigmentos fotossintéticos.

  18. Partial purification and characterization of a Ca(2+)-dependent protein kinase from the green alga, Dunaliella salina

    Science.gov (United States)

    Roux, S. J.

    1990-01-01

    A calcium-dependent protein kinase was partially purified and characterized from the green alga Dunaliella salina. The enzyme was activated at free Ca2+ concentrations above 10(-7) molar. and half-maximal activation was at about 3 x 10(-7) molar. The optimum pH for its Ca(2+)-dependent activity was 7.5. The addition of various phospholipids and diolein had no effects on enzyme activity and did not alter the sensitivity of the enzyme toward Ca2+. The enzyme was inhibited by calmodulin antagonists, N-(6-aminohexyl)-1-naphthalene sulfonamide and N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide in a dose-dependent manner while the protein kinase C inhibitor, sphingosine, had little effect on enzyme activity up to 800 micromolar. Immunoassay showed some calmodulin was present in the kinase preparations. However, it is unlikely the kinase was calmodulin regulated, since it still showed stimulation by Ca2+ in gel assays after being electrophoretically separated from calmodulin by two different methods. This gel method of detection of the enzyme indicated that a protein band with an apparent molecular weight of 40,000 showed protein kinase activity at each one of the several steps in the purification procedure. Gel assay analysis also showed that after native gel isoelectric focusing the partially purified kinase preparations had two bands with calcium-dependent activity, at isoelectric points 6.7 and 7.1. By molecular weight, by isoelectric point, and by a comparative immunoassay, the Dunaliella kinase appears to differ from at least some of the calcium-dependent, but calmodulin and phospholipid independent kinases described from higher plants.

  19. Un modelo del gasto con factores sociodemográficos y de hábitos de viaje en Pueblos Mágicos del Estado de Guanajuato, México

    OpenAIRE

    Treviño Aguilar, Erick; Heald, Jeremy; Guerrero Rodríguez, Rafael

    2015-01-01

    En este trabajo se presenta un panorama de la industria turística mexicana que incluye un análisis de las tendencias y la competitividad del sector en el contexto de la aplicación del Programa Nacional de Pueblos Mágicos. Se desarrolla un modelo econométrico con el fin de analizar el comportamiento del gasto de los visitantes a los Pueblos Mágicos del Estado de Guanajuato. Los coeficientes del modelo son estimados con una base de datos de la Secretaría de Turismo del Estado de Guanajuato. La ...

  20. Ser nación en la nación : movimientos de los pueblos indígenas en el Valle del Cauca, dinámicas organizativas y reivindicación de derechos

    OpenAIRE

    Donado Escobar, Maritza

    2015-01-01

    Los estudios sobre los pueblos indígenas, habitantes de territorios de origen u ocupados por los desplazamientos acaecidos desde la invasión española hasta la actualidad, se centran en las regiones donde su presencia es masiva y los movimientos sociales que generan trascienden el ámbito regional, incluso el nacional. Quizá por ello, los pueblos indígenas que habitan en el Valle del Cauca no han sido específicamente objeto de estudios relacionados con sus movimientos y sus proce...