WorldWideScience

Sample records for undertake longer term

  1. Investing wisely for longer-term gains.

    Science.gov (United States)

    Baillie, Jonathan

    2011-03-01

    At a time when, with less capital funding available for purchasing high value hospital equipment, NHS board-level and financial personnel may be tempted to sign off purchase of equipment that, while meeting minimum HTM and other standards, may offer compromised performance, especially over time, two key sales and product personnel at leading medical gas equipment supplier, BeaconMedaes, told HEJ editor Jonathan Baillie that "investing a little more" initially would reap considerable longer-term dividends, in payback, lifespan, and patient safety terms.

  2. Training staff to empower people with long-term conditions to undertake self care activities.

    Science.gov (United States)

    Bowler, Mandy

    Self care can help people with long-term conditions take control of their lives. However, their interest and ability to engage with it may fluctuate over the course of an illness and many need support to undertake self care activities. A team of community matrons in NHS South of Tyne and Wear helped to develop and pilot an e-learning tool for staff, to remind them of the importance of self care and give advice on ways to support patients. The tool has since been rolled out to all staff groups.

  3. Kenya; Ex Post Assessment of Longer-Term Program Engagement

    OpenAIRE

    International Monetary Fund

    2008-01-01

    This paper discusses key findings of the Ex Post Assessment (EPA) of Longer-Term Program Engagement paper for Kenya. This EPA focuses on 1993–2007, when Kenya was engaged in four successive IMF arrangements. Macroeconomic policy design was broadly appropriate, and implementation was generally sound. Growth slowed in the 1990s, but picked up after the 2002 elections, reflecting buoyant global conditions, structural reforms, and a surge of private capital inflows. Monetary policies were complic...

  4. Nuclear power plant life management and longer-term operation

    International Nuclear Information System (INIS)

    2006-01-01

    This book, prepared by NEA member country experts, contains data and analyses relevant to nuclear power plant life management and the plants' extended, longer-term operation (LTO). It addresses technical, economic and environmental aspects and provides insights into the benefits and challenges of plant life management and LTO. It will be of interest to policy makers and senior managers in the nuclear power sector and governmental bodies involved in nuclear power programme design and management. The data and information on current trends in nuclear power plant life management will be useful to researchers and analysts working in the field of nuclear energy system assessment. (authors)

  5. Shyness programme: longer term benefits, cost-effectiveness, and acceptability.

    Science.gov (United States)

    Titov, Nickolai; Andrews, Gavin; Johnston, Luke; Schwencke, Genevieve; Choi, Isabella

    2009-01-01

    In two randomized controlled trials Titov et al. demonstrated significant benefit from an Internet- and email-based treatment programme for social phobia: the Shyness programme. Data are presented about the longer term outcomes (6 months after treatment), cost-effectiveness relative to face-to-face treatment, and the acceptability of the programme to participants. Participants completed outcome and acceptability questionnaires at 6 months after treatment. Repeated measures analyses of variance were calculated using an intention-to-treat design. Cost-effectiveness in years lived with disability averted were calculated based on between-group effect sizes. A total of 59% of treatment group participants completed the 6 month follow-up questionnaires. Between post-treatment and 6 month follow up participants continued to make improvements in symptoms of social phobia, while maintaining improvements in mood, psychological distress, and disability. At 6 month follow up the mean within-group effect size (Cohen's d) for the two social phobia measures increased from 1.2 to 1.4. Cost-effectiveness in years lived with disability (YLD) averted was calculated as one-quarter that of face-to-face group treatment, or $AUD1495 for one YLD gained, compared to $AUD5686/YLD gained. Participants rated the Internet treatment to be as effective and helpful as face-to-face treatment. The present results confirm the reliability of the short-term findings reported in the first two Shyness programmes. The procedure appears to be very cost-effective, and acceptable to participants. These data provide further support for the development of Internet-based virtual clinics for common mental disorders.

  6. Psychodynamic Treatment of the Criminal Offender: Making the Case for Longer-Term Treatment in a Longer-Term Setting.

    Science.gov (United States)

    Mulay, Abby L; Kelly, Elspeth; Cain, Nicole M

    2017-01-01

    In recent years, prisons and jails have become de facto psychiatric hospitals, responsible for the care and treatment of individuals with serious mental illness. Historically, cognitive-behaviorally informed therapeutic approaches have been the treatment of choice among mental health practitioners in correctional settings. However, inmate-clients often present with complex diagnostic issues that are arguably better served by long-term treatment options, such as psychodynamic psychotherapy. We first review the nature of psychotherapy in the correctional setting, as well as treatment barriers and challenges faced by both mental health providers and inmate-clients. We then review treatment studies that examine the efficacy of various therapeutic techniques in correctional/forensic contexts. Finally, we argue that, due to the complex nature of psychopathology, average length of time incarcerated, and treatment issues that arise in this multifaceted and challenging setting, mental health treatment providers should consider providing psychodynamic treatment modalities when working with incarcerated individuals. We also argue that more research is needed to examine the efficacy of these treatment approaches with inmate-clients.

  7. Implications of longer term rest from grazing in the sagebrush steppe

    Science.gov (United States)

    K.W. Davies; M. Vavra; B. Schultz; N. Rimbey

    2014-01-01

    Longer term grazing rest has occurred or been proposed in large portions of the sagebrush steppe based on the assumption that it will improve ecosystem properties. However, information regarding the influence of longer term rest from grazing is limited and has not been summarized. We synthesized the scientific literature on long-term rest in the sagebrush steppe to...

  8. Longer-term effects of pine and eucalypt plantations on streamflow

    CSIR Research Space (South Africa)

    Scott, DF

    2008-10-01

    Full Text Available The longer-term effects of afforestation with Pinus radiata and Eucalyptus grandis on streamflows were analyzed using data from two paired-catchment experiments in South Africa. The experiments are rare in that they have been maintained over longer...

  9. The monitoring of longer term prescriptions of antidepressants: observational study in a primary care setting.

    Science.gov (United States)

    Sinclair, Jennifer E; Aucott, Lorna S; Lawton, Kenneth; Reid, Ian C; Cameron, Isobel M

    2014-08-01

    There is little evidence to guide the frequency of review for patients taking antidepressants in the longer term. To measure the frequency with which patients on longer term courses of antidepressants have their treatment monitored in primary care and to identify patient characteristics associated with the frequency of monitoring. A cohort of patients who were receiving antidepressants continuously for at least two years was identified from four general practices. Data were collected from patients' general medical records. The dates of all GP consultations and whether they included a documented review of antidepressant therapy were recorded, along with patient characteristics hypothesized to influence the frequency of monitoring. The frequency of antidepressant review consultations and proportion of participants being reviewed during a specific year of antidepressant therapy decreased with increasing year of antidepressant therapy. Individuals who receive antidepressants for an overt mental health reason; undergo more dose and drug changes; and who are referred to the community mental health team have their antidepressant therapy reviewed more often during the first five years of antidepressant therapy. As many patients on longer term courses of antidepressants are not being appropriately reviewed, a 'chronic disease management approach' to depression in primary care is advocated. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Pediatric Cancer Patients' Treatment-Related Distress and Longer-Term Anxiety: An Individual Differences Perspective.

    Science.gov (United States)

    Trentacosta, Christopher J; Harper, Felicity W K; Albrecht, Terrance L; Taub, Jeffrey W; Phipps, Sean; Penner, Louis A

    Although distress during treatment procedures and longer-term treatment-related anxiety are among the most common cancer-related stressors for children and their families, they are not invariant. This study examined whether individual differences in temperament and personality play a role in how children respond to treatment procedures. Attention control, a facet of the effortful control dimension of temperament, and the personality attribute ego-resilience were hypothesized to predict lower levels of distress during procedures. Moreover, ego-resilience and distress during procedures were hypothesized to account for indirect associations between attention control and longer-term treatment-related anxiety. Child gender was examined as a potential moderator of these relationships. Participants were 147 children undergoing treatment for pediatric cancer and their parents. At baseline, parents reported on children's effortful control and ego-resilience. Multiple raters assessed children's distress during multiple cancer-related procedures. Treatment-related anxiety was measured 3 and 9 months after the last assessed treatment procedure. Attention control was linked to ego-resilience and lower levels of distress, and these variables, in turn, accounted for indirect associations between attention control and treatment-related anxiety. Associations involving ego-resilience were stronger for boys than girls. Attention control plays an important role in children's immediate and longer-term responses to cancer-related medical procedures. Medical staff should consider individual differences in child temperament and personality when considering the nature and extent of support to provide to pediatric cancer patients and their families.

  11. Object naming induces reliance on orientation-independent representations during longer-term, but not short-term, visual remembering.

    Science.gov (United States)

    Walker, Peter; Kennedy, Helen; Berridge, Damon

    2011-11-01

    Naming novel objects with novel count nouns changes how the objects are drawn from memory, revealing that object categorisation induces reliance on orientation-independent visual representations during longer-term remembering, but not during short-term remembering. Serial position effects integrate this finding with a more established conceptualisation of short-term and longer-term visual remembering in which the former is identified as keeping an item in mind. Adults were shown a series of four novel objects in orientations in which they would not normally be drawn from memory. When not named ("Look at this object"), the objects were drawn in the orientations in which they had been seen. When named with a novel count noun (e.g., "Look at this dax"), the final object continued to be depicted in the orientation in which it had been seen, but all other objects were depicted in an unseen but preferred (canonical) orientation, even though participants could still remember the orientations in which they had been seen. Although orientation-dependent exemplar representations appear to be more accessible than orientation-independent generic representations during short-term remembering, the reverse is the case during longer-term remembering. How the theoretical framework emerging from these observations accommodates a broader body of evidence is discussed.

  12. Pediatric Cancer Patients’ Treatment-Related Distress and Longer-Term Anxiety: An Individual Differences Perspective

    Science.gov (United States)

    Trentacosta, Christopher J.; Harper, Felicity W. K.; Albrecht, Terrance L.; Taub, Jeffrey W.; Phipps, Sean; Penner, Louis

    2016-01-01

    Objective Although distress during treatment procedures and longer-term treatment-related anxiety are among the most common cancer-related stressors for children and their families, they are not invariant. This study examined whether individual differences in temperament and personality play a role in how children respond to treatment procedures. Attention control, a facet of the effortful control dimension of temperament, and the personality attribute ego-resilience were hypothesized to predict lower levels of distress during procedures. Moreover, ego-resilience and distress during procedures were hypothesized to account for indirect associations between attention control and longer-term treatment-related anxiety. Child gender was examined as a potential moderator of these relationships. Method Participants were 147 children undergoing treatment for pediatric cancer and their parents. At baseline, parents reported on children’s effortful control and ego-resilience. Multiple raters assessed children’s distress during multiple cancer-related procedures. Treatment-related anxiety was measured 3 months and 9 months after the last assessed treatment procedure. Results Attention control was linked to ego-resilience and lower levels of distress, and these variables, in turn, accounted for indirect associations between attention control and treatment-related anxiety. Associations involving ego-resilience were stronger for boys than girls. Conclusion Attention control plays an important role in children’s immediate and longer-term responses to cancer-related medical procedures. Medical staff should consider individual differences in child temperament and personality when considering the nature and extent of support to provide to pediatric cancer patients and their families. PMID:27802258

  13. Longer term outcomes of voluntarily admitted service users with high levels of perceived coercion.

    Science.gov (United States)

    O'Donoghue, Brian; Roche, Eric; Shannon, Stephen; Creed, Lisa; Lyne, John; Madigan, Kevin; Feeney, Larkin

    2015-09-30

    Voluntarily admitted service users can report levels of perceived coercion comparable to those admitted involuntarily, yet little is known of this groups longer term outcome. The 'coerced voluntary' had a score of 4 or above on the MacArthur perceived coercion scale and one year after discharge, they had a better therapeutic relationship compared to involuntarily admitted service users. There was no difference between the coerced voluntary, uncoerced voluntary and involuntary groups in engagement, satisfaction and functioning. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Women's experiences of victimizing sexualization, Part II: Community and longer term personal impacts.

    Science.gov (United States)

    Smith, S K

    1997-01-01

    This is the second of a two-part article describing the results of a qualitative study on women's experiences of victimizing sexualization. Ten adult women described their experiences of harmful learning about themselves as female and sexual. A four-part thematic description of women's experiences of victimizing sexualization was derived. This article reports on two of the major categories: community and cultural characteristics and longer term personal impacts. Findings of the study support the feminist position that the enactment of gender itself at social and cultural levels sometimes places women at risk for victimization.

  15. Intragenerational mobility and mortality in Russia: short and longer-term effects.

    Science.gov (United States)

    Billingsley, Sunnee

    2012-12-01

    This study uses the Russian Longitudinal Monitoring Survey to explore the relationship between mortality of men age 65 or younger and intragenerational mobility, measured objectively through household income and subjectively through social ranking. This relationship is considered in light of the social selection and social causation mechanisms developed in the literature as well as a proposed mechanism in which mobility itself is a consequential life event. The analysis spans the years 1994-2010, which covers the transitional period in Russia characterized by labor market restructuring and economic crisis as well as a later period of economic growth and recovery. Using Cox proportional hazard models, immediate and longer-term associations between mobility and mortality are estimated. Both subjective and objective downward mobility had an immediate positive association with mortality risk (increased by 44% and 24%, respectively). In contrast, upward mobility had a more pronounced effect over a longer-term horizon and lowered mortality risk by 17%. Controlling for destination status attenuated some associations, but findings were robust to the adjustment of selection-related factors such as alcohol consumption and health status in the year preceding mobility. Findings suggest that the negative relationship between upward mobility and mortality may be driven by social causation, whereas downward mobility may have an independent effect beyond selection or causation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Poststroke Trajectories: The Process of Recovery Over the Longer Term Following Stroke.

    Science.gov (United States)

    Hawkins, Rebecca J; Jowett, Adam; Godfrey, Mary; Mellish, Kirste; Young, John; Farrin, Amanda; Holloway, Ivana; Hewison, Jenny; Forster, Anne

    2017-01-01

    We adopted a grounded theory approach to explore the process of recovery experienced by stroke survivors over the longer term who were living in the community in the United Kingdom, and the interacting factors that are understood to have shaped their recovery trajectories. We used a combination of qualitative methods. From the accounts of 22 purposively sampled stroke survivors, four different recovery trajectories were evident: (a) meaningful recovery, (b) cycles of recovery and decline, (c) ongoing disruption, (d) gradual, ongoing decline. Building on the concept of the illness trajectory, our findings demonstrate how multiple, interacting factors shape the process and meaning of recovery over time. Such factors included conception of recovery and meanings given to the changing self, the meanings and consequences of health and illness experiences across the life course, loss, sense of agency, and enacting relationships. Awareness of the process of recovery will help professionals better support stroke survivors.

  17. Inpatient cognitive behaviour therapy for adolescents with anorexia nervosa: immediate and longer-term effects

    Directory of Open Access Journals (Sweden)

    Riccardo eDalle Grave

    2014-02-01

    Full Text Available Introduction: Inpatient treatment for anorexia nervosa is often successful in restoring body weight, but a high percentage of patients relapse following discharge. The aim of the present study was to establish the immediate and longer-term effects of a novel inpatient program for adolescents that was designed to produce enduring change. Method: Twenty-seven consecutive patients with severe anorexia nervosa were admitted to a 20-week inpatient treatment program based upon enhanced cognitive behaviour therapy (CBT-E. The patients were assessed before and after hospitalization, and six and 12 months later. Results: Twenty-six patients (96% completed the program. In these patients there was a substantial improvement in weight, eating disorder features and general psychopathology that was well maintained at 12-month follow-up. Conclusions: These findings suggest that inpatient CBT-E is a promising approach to the treatment of adolescents with severe anorexia nervosa.

  18. Longer-Term Mental and Behavioral Health Effects of the Deepwater Horizon Gulf Oil Spill

    Directory of Open Access Journals (Sweden)

    Tonya Cross Hansel

    2015-10-01

    Full Text Available Mental health issues are a significant concern after technological disasters such as the 2010 Gulf Oil Spill; however, there is limited knowledge about the long-term effects of oil spills. The study was part of a larger research effort to improve understanding of the mental and behavioral health effects of the Deepwater Horizon Gulf Oil Spill. Data were collected immediately following the spill and the same individuals were resampled again after the second anniversary (n = 314. The results show that mental health symptoms of depression, serious mental illness and posttraumatic stress have not statistically decreased, and anxiety symptoms were statistically equivalent to immediate symptoms. Results also showed that the greatest effect on anxiety is related to the extent of disruption to participants’ lives, work, family, and social engagement. This study supports lessons learned following the Exxon Valdez spill suggesting that mental health effects are long term and recovery is slow. Elevated symptoms indicate the continued need for mental health services, especially for individuals with high levels of disruption resulting in increased anxiety. Findings also suggest that the longer-term recovery trajectories following the Deepwater Horizon Gulf Oil Spill do not fall within traditional disaster recovery timelines.

  19. LONGER-TERM EFFECTIVENESS OF CBT IN TREATMENT OF COMORBID AUD/MDD ADOLESCENTS.

    Science.gov (United States)

    Cornelius, Jack R; Douaihy, Antoine B; Kirisci, Levent; Daley, Dennis C

    2013-01-01

    Cognitive Behavioral Therapy (CBT) is a commonly used therapy among persons with major depressive disorder (MDD) and also among those with alcohol use disorders (AUD). However, less is known regarding the efficacy of CBT for treating persons with co-occurring disorders involving both MDD and an AUD. Studies assessing the efficacy of CBT in adolescent populations with co-occurring disorders are particularly sparse, especially studies designed to assess the potential longer-term efficacy of an acute phase trial of CBT therapy in that youthful comorbid population. We recently conducted a first acute phase treatment study involving comorbid AUD/MDD adolescents, which involved the medication fluoxetine as well as manualized CBT therapy. The results of that acute phase study suggested efficacy for CBT therapy but not for fluoxetine for treating the depressive symptoms and the excessive alcohol use of study subjects (Cornelius et al., 2009). The current chapter provides an assessment of the long-term efficacy of CBT for treating comorbid AUD/MDD adolescents, based on results from our own long-term (four-year) follow-up study, which was conducted following the completion of our recent acute phase treatment study. The results of the study suggest long-term efficacy for acute phase CBT/MET therapy for treating both the depressive symptoms and the excessive alcohol use of comorbid AUD/MDD adolescents, but demonstrate no evidence of long-term efficacy for fluoxetine for treating either the depressive symptoms or the excessive alcohol use of that population.

  20. Aid alignment: a longer term lens on trends in development assistance for health in Uganda.

    Science.gov (United States)

    Stierman, Elizabeth; Ssengooba, Freddie; Bennett, Sara

    2013-02-20

    Over the past decade, development assistance for health (DAH) in Uganda has increased dramatically, surpassing the government's own expenditures on health. Yet primary health care and other priorities identified in Uganda's health sector strategic plan remain underfunded. Using data available from the Creditor Reporting System (CRS), National Health Accounts (NHA), and government financial reports, we examined trends in how donors channel DAH and the extent to which DAH is aligned with sector priorities. The study follows the flow of DAH from the donor to the implementing organization, specifying the modality used for disbursing funds and categorizing funds based on program area or support function. Despite efforts to improve alignment through the formation of a sector-wide approach (SWAp) for health in 1999 and the creation of a fund to pool resources for identified priorities, increasingly DAH is provided as short-term, project-based support for disease-specific initiatives, in particular HIV/AIDS. These findings highlight the need to better align external resources with country priorities and refocus attention on longer-term sector-wide objectives.

  1. Longer-Term Follow-Up of Kenyan Men Circumcised Using the ShangRing Device.

    Directory of Open Access Journals (Sweden)

    Paul J Feldblum

    Full Text Available To ascertain clinical sequelae, client satisfaction and sexual behavior 2+ years after male circumcision using the ShangRing device.We enrolled 199 men from the Kenya sites (Homa Bay district participating in a 2012 study of the ShangRing device used in routine male circumcision services (N = 552. We enrolled men who had had the ShangRing placed successfully, and over-sampled men who had had an adverse event and/or were HIV-positive during the field study. In the present study, each participant was examined and interviewed by a study clinician, and penile photographs were taken to document longer-term cosmetic results and any abnormal findings.194 men were included in the analysis. The mean and median times between circumcision and the longer-term follow-up visit in this study were 31.8 and 32 months, respectively. Four men (2.1% had signs/symptoms of a sexually transmitted infection (STI. Virtually all (99.5% of the men were very satisfied with the appearance of their circumcised penis, and all would recommend a ShangRing circumcision to friends or family members. The most prevalent reported advantage of the circumcision was the ease of bathing and enhanced cleanliness of the penis (75.8%. 94.3% of the men did not cite a single negative feature of their circumcision. 87.5% of men reported more sexual pleasure post-MC, the most common reason being more prolonged intercourse. The majority of men (52.6% reported one sexual partner post-MC, but more than a quarter of the men (28.1% reported an increased number of partners post-MC. Less than half of the men (44.3% reported using condoms half of the time or more, but the great majority of condom users stated that condom use was much easier post-MC, and 76.9% of users said they used condoms more after circumcision than before.This study supports the safety and acceptability of ShangRing male circumcision during 2-3 years of follow-up. It should allay worries that the ShangRing procedure could lead to

  2. How diking affects the longer-term structure and evolution of divergent plate boundaries

    KAUST Repository

    Trippanera, Daniele

    2015-04-01

    Recurrent diking episodes along divergent plate boundaries, as at Dabbahu (2005, Afar) or at Bardarbunga (2014, Iceland) , highlight the possibility to have m-wide opening in a short time (days to weeks). This suggests a prominent role of magma enhancing transient plate separations. However, the role of diking on a longer term (> 102 years) and its influence on the structure and the evolution of a divergent plate boundary is still poorly investigated. Here we use field surveys along the oceanic Icelandic and continental Ethiopian plate boundaries, along five eruptive fissures and four rift segments. Field observations have also been integrated with analogue and numerical models of dike emplacement to better understand the effect of dike emplacement at depth and at the surface. Our results show that the dike-fed eruptive fissures are systematically associated with graben structures formed by inward dipping normal faults having throws up to 10 m and commonly propagating downward. Moreover, rift segments (i.e. mature rift zones), despite any asymmetry and repetition, are characterized by the same features as the eruptive fissures, the only difference lying in the larger size (higher fault throws, up to 40 m, and wider deformation zones). Analogue and numerical models of dike intrusion confirm that all the structural features observed along the rift segments may be dike-induced; these features include downward propagating normal faults bordering graben structures, contraction at the base of the hanging walls of the faults and upward propagating faults. Simple calculations based on the deeper structure of the eroded rift segments in eastern and western Iceland also suggest that all the fault slip in the active rift segments may result from diking. These results suggest that the overall deformation pattern of eruptive fissures and rift segments may be explained only by dike emplacement. In a magmatic rift, the regional tectonic stress may rarely be high enough to be

  3. Longer-Term Postcure Measurement of Cuspal Deformation Induced by Dimensional Changes in Dental Materials

    Science.gov (United States)

    Falsafi, A.; Oxman, J. D.; Tse, P.-H.; Ton, T. T.

    2015-01-01

    Aim. This paper presents a simple, versatile in vitro methodology that enables indirect quantification of shrinkage and expansion stresses under clinically relevant conditions without the need for a dedicated instrument. Methods. For shrinkage effects, resulting cusp deformation of aluminum blocks with MOD type cavity, filled with novel filling compositions and commercial cements, has been measured using a bench-top micrometer and a Linear Variable Differential Transformer (LVDT, a displacement transducer) based instrument. Results. The results demonstrated the validity of the proposed simple methodology. The technique was successfully used in longer-term measurements of shrinkage and expansion stress for several dental compositions. Conclusions. In contrast to in situ techniques where a measuring instrument is dedicated to the sample and its data collection, the proposed simple methodology allows for transfer of the samples to the environment of choice for storage and conditioning. The presented technique can be reliably used to quantify stress development of curing materials under clinically relevant (oral) conditions. This enables direct examination and comparison of structural properties corresponding to the final stage of formed networks. The proposed methodology is directly applicable to the study of self-curing systems as they require mouth-type conditions (temperature and humidity) to achieve their designed kinetics and reactions. PMID:26257783

  4. Microbiological and abiotic processes in modelling longer-term marine corrosion of steel.

    Science.gov (United States)

    Melchers, Robert E

    2014-06-01

    Longer term exposure of mild steel in natural (biotic) waters progresses as a bimodal function of time, both for corrosion mass loss and for pit depth. Recent test results, however, found this also for immersion in clean fresh, almost pure and triply distilled waters. This shows chlorides or microbiological activity is not essential for the electrochemical processes producing bimodal behaviour. It is proposed that the first mode is aerobic corrosion that eventually produces a non-homogeneous corroded surface and rust coverage sufficient to allow formation of anoxic niches. Within these, aggressive autocatalytic reduction then occurs under anoxic abiotic conditions, caused by sulfide species originating from the MnS inclusions typical in steels. This is consistent with Wranglen's model for abiotic anoxic crevice and pitting corrosion without external aggressive ions. In biotic conditions, metabolites from anaerobic bacterial activity within and near the anoxic niches provides additional (sulfide) species to contribute to the severity of corrosion. Limited observational evidence that supports this hypothesis is given but further investigation is required to determine all contributor(s) to the cathodic current for the electrochemical reaction. The results are important for estimating the contribution of microbiological corrosion in infrastructure applications. © 2013.

  5. Stavudine toxicity in adult longer-term ART patients in Blantyre, Malawi.

    Science.gov (United States)

    van Oosterhout, Joep J; Mallewa, Jane; Kaunda, Symon; Chagoma, Newton; Njalale, Yassin; Kampira, Elizabeth; Mukaka, Mavuto; Heyderman, Robert S

    2012-01-01

    Stavudine is an effective and inexpensive antiretroviral drug, but no longer recommended by WHO for first-line antiretroviral regimens in resource-limited settings due to toxicity concerns. Because of the high cost of alternative drugs, it has not been feasible to replace stavudine in most adults in the Malawi ART programme. We aimed to provide policy makers with a detailed picture of stavudine toxicities in Malawians on longer-term ART, in order to facilitate prioritization of stavudine replacement among other measures to improve the quality of ART programmes. Prospective cohort of Malawian adults who had just completed one year of stavudine containing ART in an urban clinic, studying peripheral neuropathy, lipodystrophy, diabetes mellitus, high lactate syndromes, pancreatitis and dyslipidemia during 12 months follow up. Stavudine dosage was 30 mg irrespective of weight. Cox regression was used to determine associations with incident toxicities. 253 patients were enrolled, median age 36 years, 62.5% females. Prevalence rates (95%-confidence interval) of toxicities after one year on stavudine were: peripheral neuropathy 21.3% (16.5-26.9), lipodystrophy 14.7% (2.4-8.1), high lactate syndromes 0.0% (0-1.4), diabetes mellitus 0.8% (0-2.8), pancreatitis 0.0% (0-1.5). Incidence rates per 100 person-years (95%-confidence interval) during the second year on stavudine were: peripheral neuropathy 19.8 (14.3-26.6), lipodystrophy 11.4 (7.5-16.3), high lactate syndromes 2.1 (0.7-4.9), diabetes mellitus 0.4 (0.0-1.4), pancreatitis 0.0 (0.0-0.2). Prevalence of hypercholesterolemia and hypertriglyceridemia increased from 12.1% to 21.1% and from 29.5% to 37.6% respectively between 12 and 24 months. 5.5% stopped stavudine, 1.3% died and 4.0% defaulted during follow up. Higher age was an independent risk factor for incident peripheral neuropathy and lipodystrophy. Stavudine associated toxicities continued to accumulate during the second year of ART, especially peripheral neuropathy

  6. Effect of longer-term modest salt reduction on blood pressure.

    Science.gov (United States)

    He, Feng J; Li, Jiafu; Macgregor, Graham A

    2013-04-30

    A reduction in salt intake lowers blood pressure (BP) and, thereby, reduces cardiovascular risk. A recent meta-analysis by Graudal implied that salt reduction had adverse effects on hormones and lipids which might mitigate any benefit that occurs with BP reduction. However, Graudal's meta-analysis included a large number of very short-term trials with a large change in salt intake, and such studies are irrelevant to the public health recommendations for a longer-term modest reduction in salt intake. We have updated our Cochrane meta-analysis. To assess (1) the effect of a longer-term modest reduction in salt intake (i.e. of public health relevance) on BP and whether there was a dose-response relationship; (2) the effect on BP by sex and ethnic group; (3) the effect on plasma renin activity, aldosterone, noradrenaline, adrenaline, cholesterol, low-density lipoprotein (LDL), high-density lipoprotein (HDL) and triglycerides. We searched MEDLINE, EMBASE, Cochrane Hypertension Group Specialised Register, Cochrane Central Register of Controlled Trials, and reference list of relevant articles. We included randomised trials with a modest reduction in salt intake and duration of at least 4 weeks. Data were extracted independently by two reviewers. Random effects meta-analyses, subgroup analyses and meta-regression were performed. Thirty-four trials (3230 participants) were included. Meta-analysis showed that the mean change in urinary sodium (reduced salt vs usual salt) was -75 mmol/24-h (equivalent to a reduction of 4.4 g/d salt), the mean change in BP was -4.18 mmHg (95% CI: -5.18 to -3.18, I (2)=75%) for systolic and -2.06 mmHg (95% CI: -2.67 to -1.45, I (2)=68%) for diastolic BP. Meta-regression showed that age, ethnic group, BP status (hypertensive or normotensive) and the change in 24-h urinary sodium were all significantly associated with the fall in systolic BP, explaining 68% of the variance between studies. A 100 mmol reduction in 24 hour urinary sodium (6 g

  7. JET Joint Undertaking

    International Nuclear Information System (INIS)

    Keen, B.E.

    1987-03-01

    The paper presents the progress report of the Joint European Torus (JET) Joint Undertaking, 1986. The report contains a survey of the scientific and technical achievements on JET during 1986; the more important articles referred to in this survey are reproduced as appendices to this Report. The last section discusses developments which might improve the overall performance of the machine. (U.K.)

  8. Quality of care and its determinants in longer term mental health facilities across Europe; a cross-sectional analysis

    NARCIS (Netherlands)

    Killaspy, Helen; Cardoso, Graca; White, Sarah; Wright, Christine; Caldas de Almeida, Jose Miguel; Turton, Penny; Taylor, Tatiana L.; Schuetzwohl, Matthias; Schuster, Mirjam; Cervilla, Jorge A.; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Adamowski, Tomasz; Ploumpidis, Dimitris; Gonidakis, Fragiskos; King, Michael

    2016-01-01

    Background: The Quality Indicator for Rehabilitative Care (QuIRC) is an international, standardised quality tool for the evaluation of mental health facilities that provide longer term care. Completed by the service manager, it comprises 145 items that assess seven domains of care: living

  9. Preterm infants have significantly longer telomeres than their term born counterparts.

    Directory of Open Access Journals (Sweden)

    Vimal Vasu

    Full Text Available There are well-established morbidities associated with preterm birth including respiratory, neurocognitive and developmental disorders. However several others have recently emerged that characterise an 'aged' phenotype in the preterm infant by term-equivalent age. These include hypertension, insulin resistance and altered body fat distribution. Evidence shows that these morbidities persist into adult life, posing a significant public health concern. In this study, we measured relative telomere length in leukocytes as an indicator of biological ageing in 25 preterm infants at term equivalent age. Comparing our measurements with those from 22 preterm infants sampled at birth and from 31 term-born infants, we tested the hypothesis that by term equivalent age, preterm infants have significantly shorter telomeres (thus suggesting that they are prematurely aged. Our results demonstrate that relative telomere length is highly variable in newborn infants and is significantly negatively correlated with gestational age and birth weight in preterm infants. Further, longitudinal assessment in preterm infants who had telomere length measurements available at both birth and term age (n = 5 suggests that telomere attrition rate is negatively correlated with increasing gestational age. Contrary to our initial hypothesis however, relative telomere length was significantly shortest in the term born control group compared to both preterm groups and longest in the preterm at birth group. In addition, telomere lengths were not significantly different between preterm infants sampled at birth and those sampled at term equivalent age. These results indicate that other, as yet undetermined, factors may influence telomere length in the preterm born infant and raise the intriguing hypothesis that as preterm gestation declines, telomere attrition rate increases.

  10. Public Undertakings and Imputability

    DEFF Research Database (Denmark)

    Ølykke, Grith Skovgaard

    2013-01-01

    exercised by the State, imputability to the State, and the State’s fulfilment of the Market Economy Investor Principle. Furthermore, it is examined whether, in the absence of imputability, public undertakings’ market behaviour is subject to the Market Economy Investor Principle, and it is concluded...... that this is not the case. Lastly, it is discussed whether other legal instruments, namely competition law, public procurement law, or the Transparency Directive, regulate public undertakings’ market behaviour. It is found that those rules are not sufficient to mend the gap created by the imputability requirement. Legal......In this article, the issue of impuability to the State of public undertakings’ decision-making is analysed and discussed in the context of the DSBFirst case. DSBFirst is owned by the independent public undertaking DSB and the private undertaking FirstGroup plc and won the contracts in the 2008...

  11. Making Decisions in a Time of Fiscal Stringency: The Longer-Term Implications.

    Science.gov (United States)

    Bowen, Frank M.

    The concept of traditional planning, programming, and budgeting systems (PPBS) is defined and compared with imperative planning, a term used to refer to whatever procedures higher education officials use to integrate program planning and budgeting. The University of Wisconsin system is described as an example of emerging budgetary practice in…

  12. Performance of Batteries for electric vehicles on shorter and longer term

    NARCIS (Netherlands)

    Gerssen-Gondelach, S.J.; Faaij, A.P.C.

    2012-01-01

    In this work, the prospects of available and new battery technologies for battery electric vehicles (BEVs) are examined. Five selected battery technologies are assessed on battery performance and cost in the short, medium and long term. Driving cycle simulations are carried out to assess the

  13. Performance of batteries for electric vehicles on short and longer term

    NARCIS (Netherlands)

    Gerssen - Gondelach, Sarah|info:eu-repo/dai/nl/355262436; Faaij, André P C|info:eu-repo/dai/nl/10685903X

    2012-01-01

    In this work, the prospects of available and new battery technologies for battery electric vehicles (BEVs) are examined. Five selected battery technologies are assessed on battery performance and cost in the short, medium and long term. Driving cycle simulations are carried out to assess the

  14. World food and agriculture: Outlook for the medium and longer term

    Science.gov (United States)

    Alexandratos, Nikos

    1999-01-01

    The world has been making progress in improving food security, as measured by the per person availability of food for direct human consumption. However, progress has been very uneven, and many developing countries have failed to participate in such progress. In some countries, the food security situation is today worse than 20 years ago. The persistence of food insecurity does not reflect so much a lack of capacity of the world as a whole to increase food production to whatever level would be required for everyone to have consumption levels assuring satisfactory nutrition. The world already produces sufficient food. The undernourished and the food-insecure persons are in these conditions because they are poor in terms of income with which to purchase food or in terms of access to agricultural resources, education, technology, infrastructure, credit, etc., to produce their own food. Economic development failures account for the persistence of poverty and food insecurity. In the majority of countries with severe food-security problems, the greatest part of the poor and food-insecure population depend greatly on local agriculture for a living. In such cases, development failures are often tantamount to failures of agricultural development. Development of agriculture is seen as the first crucial step toward broader development, reduction of poverty and food insecurity, and eventually freedom from excessive economic dependence on poor agricultural resources. Projections indicate that progress would continue, but at a pace and pattern that would be insufficient for the incidence of undernutrition to be reduced significantly in the medium-term future. As in the past, world agricultural production is likely to keep up with, and perhaps tend to exceed, the growth of the effective demand for food. The problem will continue to be one of persistence of poverty, leading to growth of the effective demand for food on the part of the poor that would fall short of that required for

  15. Quality of care and its determinants in longer term mental health facilities across Europe; a cross-sectional analysis.

    Science.gov (United States)

    Killaspy, Helen; Cardoso, Graça; White, Sarah; Wright, Christine; Caldas de Almeida, José Miguel; Turton, Penny; Taylor, Tatiana L; Schützwohl, Matthias; Schuster, Mirjam; Cervilla, Jorge A; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Adamowski, Tomasz; Ploumpidis, Dimitris; Gonidakis, Fragiskos; King, Michael

    2016-02-11

    The Quality Indicator for Rehabilitative Care (QuIRC) is an international, standardised quality tool for the evaluation of mental health facilities that provide longer term care. Completed by the service manager, it comprises 145 items that assess seven domains of care: living environment; treatments and interventions; therapeutic environment; self-management and autonomy; social interface; human rights; and recovery based practice. We used the QuIRC to investigate associations between characteristics of longer term mental health facilities across Europe and the quality of care they delivered to service patients. QuIRC assessments were completed for 213 longer term mental health units in ten countries that were at various stages of deinstitutionalisation of their mental health services. Associations between QuIRC domain scores and unit descriptive variables were explored using simple and multiple linear regression that took into account clustering at the unit and country level. We found wide variation in QuIRC domain scores between individual units, but across countries, fewer than a quarter scored below 50 % on any domains. The quality of care was higher in units that were smaller, of mixed sex, that had a defined expected maximum length of stay and in which not all patients were severely disabled. This is the first time longer term mental health units across a number of European countries have been compared using a standardised measure. Further use of the QuIRC will allow greater understanding of the quality of care in these units across Europe and provide an opportunity to monitor pan-European quality standards of care for this vulnerable patient group.

  16. Securing of supply in short and longer term of wood and straw

    International Nuclear Information System (INIS)

    Schultz, Gert

    2003-01-01

    In Denmark - as well as in the rest of Europe - the importance of biomass as energy source has developed during the last two decades. In the Nordic countries we have seen a rise in utilisation of wood, straw and biogas. Concurrently with this development the trade of biomass has grown and a market has been build up while prices for biofuels has declined by up to 40% in real term prices. The trade of biofuels is expected to increase in the future in order to meet the overall goal and fulfil the international agreements of climate change and reduction of CO 2 . Basically the object of securing supply of biomass for energy production is the same as for all types of fuel or other commodities: to make supply and demand meet at prices the market are able and willing to pay. Price and security of supply are of vital importance for users of biomass - such as Energi E2. Based on these criteria biomass would never have been a fuel for electricity production. The market and supply of biomass is small compared to fossil fuels and the price is 2-3 times the price of coal calculated on an energy basis. But legislation, financial support and tax on fossil fuels have made biomass a competitive fuel for production of electricity and heat. (au)

  17. Practitioner perspectives on strategies to promote longer-term benefits of acupuncture or counselling for depression: a qualitative study.

    Directory of Open Access Journals (Sweden)

    Hugh MacPherson

    Full Text Available Non-pharmacological interventions for depression may help patients manage their condition. Evidence from a recent large-scale trial (ACUDep suggests that acupuncture and counselling can provide longer-term benefits for many patients with depression. This paper describes the strategies practitioners reported using to promote longer-term benefits for their patients.A qualitative sub-study of practitioners (acupuncturists and counsellors embedded in a randomised controlled trial. Using topic guides, data was collected from telephone interviews and a focus group, altogether involving 19 counsellors and 17 acupuncturists. Data were audio recorded, transcribed verbatim and analysed using thematic content analysis.For longer-term impact, both acupuncturists and counsellors encouraged insight into root causes of depression on an individual basis and saw small incremental changes as precursors to sustained benefit. Acupuncturists stressed the importance of addressing concurrent physical symptoms, for example helping patients relax or sleep better in order to be more receptive to change, and highlighted the importance of Chinese medicine theory-based lifestyle change for lasting benefit. Counsellors more often highlighted the importance of the therapeutic relationship, emphasising the need for careful "pacing" such that the process and tools employed were tailored and timed for each individual, depending on the "readiness" to change. Our data is limited to acupuncture practitioners using the principles of traditional Chinese medicine, and counsellors using a humanistic, non-directive and person-centred approach.Long-term change appears to be an important focus within the practices of both acupuncturists and counsellors. To achieve this, practitioners stressed the need for an individualised approach with a focus on root causes.

  18. Costs and longer-term savings of parenting programmes for the prevention of persistent conduct disorder: a modelling study

    Directory of Open Access Journals (Sweden)

    Beecham Jennifer

    2011-10-01

    Full Text Available Abstract Background Conduct disorders are the most common psychiatric disorders in children and may persist into adulthood in about 50% of cases. The costs to society are high and impact many public sector agencies. Parenting programmes have been shown to positively affect child behaviour, but little is known about their potential long-term cost-effectiveness. We therefore estimate the costs of and longer-term savings from evidence-based parenting programmes for the prevention of persistent conduct disorder. Methods A decision-analytic Markov model compares two scenarios: 1 a 5-year old with clinical conduct disorder receives an evidence-based parenting programme; 2 the same 5-year old does not receive the programme. Cost-savings analysis is performed by comparing the probability that conduct disorder persists over time in each scenario, adopting both a public sector and a societal perspective. If the intervention is successful in reducing persistent conduct disorder, cost savings may arise from reduced use of health services, education support, social care, voluntary agencies and from crimes averted. Results Results strongly suggest that parenting programmes reduce the chance that conduct disorder persists into adulthood and are cost-saving to the public sector within 5-8 years under base case conditions. Total savings to society over 25 years are estimated at £16,435 per family, which compares with an intervention cost in the range of £952-£2,078 (2008/09 prices. Conclusions Effective implementation of evidence-based parenting programmes is likely to yield cost savings to the public sector and society. More research is needed to address evidence gaps regarding the current level of provision, longer-term effectiveness and questions of implementation, engagement and equity.

  19. The use of 137Cs to establish longer-term soil erosion rates on footpaths in the UK.

    Science.gov (United States)

    Rodway-Dyer, S J; Walling, D E

    2010-10-01

    There is increasing awareness of the damage caused to valuable and often unique sensitive habitats by people pressure as degradation causes a loss of plant species, disturbance to wildlife, on-site and off-site impacts of soil movement and loss, and visual destruction of pristine environments. This research developed a new perspective on the problem of recreational induced environmental degradation by assessing the physical aspects of soil erosion using the fallout radionuclide caesium-137 ((137)Cs). Temporal sampling problems have not successfully been overcome by traditional research methods monitoring footpath erosion and, to date, the (137)Cs technique has not been used to estimate longer-term soil erosion in regard to sensitive recreational habitats. The research was based on-sites within Dartmoor National Park (DNP) and the South West Coast Path (SWCP) in south-west England. (137)Cs inventories were reduced on the paths relative to the reference inventory (control), indicating loss of soil from the path areas. The Profile Distribution Model estimated longer-term erosion rates (ca. 40 years) based on the (137)Cs data and showed that the combined mean soil loss for all the sites on 'paths' was 1.41 kg m(-2) yr(-1) whereas the combined 'off path' soil loss was 0.79 kg m(-2) yr(-1), where natural (non-recreational) soil redistribution processes occur. Recreational pressure was shown to increase erosion in the long-term, as greater soil erosion occurred on the paths, especially where there was higher visitor pressure. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. Attention Deficit Hyperactivity Disorder (ADHD among longer-term prison inmates is a prevalent, persistent and disabling disorder

    Directory of Open Access Journals (Sweden)

    Hirvikoski Tatja

    2010-12-01

    Full Text Available Abstract Background ADHD is a common and disabling disorder, with an increased risk for coexisting disorders, substance abuse and delinquency. In the present study, we aimed at exploring ADHD and criminality. We estimated the prevalence of ADHD among longer-term prison inmates, described symptoms and cognitive functioning, and compared findings with ADHD among psychiatric outpatients and healthy controls. Methods At Norrtälje Prison, we approached 315 male inmates for screening of childhood ADHD by the Wender Utah Rating Scale (WURS-25 and for present ADHD by the Adult ADHD Self-Report Screener (ASRS-Screener. The response rate was 62%. Further, we assessed 34 inmates for ADHD and coexisting disorders. Finally, we compared findings with 20 adult males with ADHD, assessed at a psychiatric outpatient clinic and 18 healthy controls. Results The estimated prevalence of adult ADHD among longer-term inmates was 40%. Only 2 out of 30 prison inmates confirmed with ADHD had received a diagnosis of ADHD during childhood, despite most needed health services and educational support. All subjects reported lifetime substance use disorder (SUD where amphetamine was the most common drug. Mood and anxiety disorders were present among half of subjects; autism spectrum disorder (ASD among one fourth and psychopathy among one tenth. Personality disorders were common; almost all inmates presented conduct disorder (CD before antisocial personality disorder (APD. Prison inmates reported more ADHD symptoms during both childhood and adulthood, compared with ADHD psychiatric outpatients. Further, analysis of executive functions after controlling for IQ showed both ADHD groups performed poorer than controls on working memory tests. Besides, on a continuous performance test, the ADHD prison group displayed poorer results compared with both other groups. Conclusions This study suggested ADHD to be present among 40% of adult male longer-term prison inmates. Further, ADHD

  1. Risk factors for longer term psychological distress in well-functioning fibromyalgia patients: a prospective study into prognostic factors.

    Science.gov (United States)

    van Koulil, Saskia; van Lankveld, Wim; Kraaimaat, Floris W; van Riel, Piet L C M; Evers, Andrea W M

    2010-07-01

    Psychological distress is a key risk factor for long-term complaints in fibromyalgia (FM). Prognostic factors for psychological distress might facilitate an early identification of patients at risk to help prevent long-term dysfunction, especially for the relatively well-functioning patients showing little distress who are usually not considered for treatment. This study hence examines potential prognostic factors in this subgroup. Psychological distress, physical functioning, illness cognitions (helplessness, acceptance), pain-avoidance factors (passive pain-coping, fear of pain, hypervigilance), and social factors (social support, social reinforcement) was assessed in 78 low-distress FM patients at baseline and after a mean of 9 months (SD=3.3). Baseline physical functioning did not predict changes in psychological distress, whereas a higher level of hypervigilance, less acceptance, and less perceived social support predicted an increase in psychological distress at follow-up. Illness cognitions, pain-avoidance factors, and social support can be considered as prognostic factors predicting changes in psychological distress in FM. More research is needed to investigate additional factors that could also be implicated (e.g. personality factors, stressful events). Timely assessment of illness cognitions, pain-avoidance factors, and social support may help identify subgroups of relatively well-functioning FM patients at risk of longer term aggravated psychological distress. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  2. Longer-term effects of ADAS use on speed and headway control in drivers diagnosed with Parkinson's disease.

    Science.gov (United States)

    Dotzauer, Mandy; Caljouw, Simone R; De Waard, Dick; Brouwer, Wiebo H

    2015-01-01

    An advanced driver assistance system (ADAS) provided information about speed limits, speed, speeding, and following distance. Information was presented to the participants by means of a head-up display. Effects of the information on speed and headway control were studied in a longer-term driving simulator study including 12 repeated measures spread out over 4 weeks. Nine healthy older drivers between the ages of 65 and 82 years and 9 drivers between the ages of 68 and 82 years diagnosed with Parkinson's disease (PD) participated in the study. Within the 4 weeks, groups completed 12 consecutive sessions (10 with ADAS and 2 without ADAS) in a driving simulator. Results indicate an effect of ADAS use on performance. Removing ADAS after short-term exposure led to deterioration of performance in all speed measures in the group of drivers diagnosed with PD. These results suggest that provision of traffic information was utilized by drivers diagnosed with PD in order to control their speed.

  3. Massed versus spaced practice in vocology: effect of a short-term intensive voice training versus a longer-term traditional voice training.

    Science.gov (United States)

    Meerschman, Iris; Van Lierde, Kristiane; Van Puyvelde, Caro; Bostyn, Astrid; Claeys, Sofie; D'haeseleer, Evelien

    2018-03-01

    In contrast with most medical and pharmaceutical therapies, the optimal dosage for voice therapy or training is unknown. The aim of this study was to compare the effect of a short-term intensive voice training (IVT) with a longer-term traditional voice training (TVT) on the vocal quality and vocal capacities of vocally healthy non-professional voice users. A pre-/post-test randomized control group design with follow-up measurements was used. Twenty healthy female non-professional voice users with a mean age of 21.7 years (range = 20-24 years) were randomly assigned into a short-term IVT group (n = 10) or a longer-term TVT group (n = 10). Both groups received an identical 6-h lasting voice training. Only the distribution of practice varied between the groups: 2 h a day for 3 consecutive days for the IVT group versus two 30-min sessions a week for 6 weeks for the TVT group. In both groups, a voice assessment protocol consisting of subjective (questionnaire, participant's self-report, auditory-perceptual evaluation) and objective (maximum performance task, acoustic analysis, voice range profile, dysphonia severity index) measurements and determinations was used to evaluate the participants' voice pre- and post-training and at 6 weeks follow-up. Groups were compared over time using linear mixed models and generalized linear mixed models. Within-group effects of time were determined using post-hoc pairwise comparisons with Bonferroni corrections. No significant time-by-group interactions were found for any of the outcome measures, indicating no significant differences in evolution over time between the groups. Significant time effects were found for maximum phonation time, lowest intensity, lowest frequency, highest frequency and dysphonia severity index, all improving over time in both groups. More in-depth within-group analyses indicate a preference for the IVT group regarding the evolution of maximum phonation time, lowest frequency and dysphonia severity index, and

  4. The concept of abusive clauses/unfair terms in contracts concluded between the undertakings, on the one hand, and the consumers, on the other hand

    Directory of Open Access Journals (Sweden)

    Andreea-Teodora Stănescu

    2014-11-01

    Full Text Available Initially, the concept of unfair terms characterized only the contracts concluded between consumers and professionals. Currently, the concept is also incident in other types of contracts. This study only concerns the concept of unfair terms applicable to contracts concluded between consumers and professionals. Main regulations applicable are represented by Law no. 193/2000 on unfair terms in contracts concluded between professionals and consumers and Directive 93/13 / EEC on unfair terms in consumer contracts (interpreted by the ECJ. Scientific work is proposed to set up the concept of unfair terms. In order to do so, several steps are to be followed: 1. determining the scope (contracts on the sale of goods or services concluded between professionals and consumers 2. analysis of unfair terms defining features: (a the absence of negotiation between the contracting parties, (b the presence of a significant imbalance between the rights and obligations of the parties, to the detriment of consumers and (c the breach of good faith 3. the identification of the incident sanctions 4. the highlighting of some procedural features (especially in terms of the effects of court decisions finding the unfairness of a contractual term.

  5. Exploring the 'permanent forest' paradigm: might renewable commercial forest estates lead to greater net greenhouse abatement over the longer term?

    International Nuclear Information System (INIS)

    Anderson, Graeme

    2007-01-01

    Full text: Understanding permanence: A common perception exists which suggests that long term or 'permanent' tree plantings are considered a superior form of (post 1990) carbon sink, and commercial plantations (which allow for harvesting and replanting) are less useful for abatement. However, common to all forms of forest carbon sink is the issue of permanence. None of these are truly permanent stores of carbon because at any point either a fire, disease, harvest or major event can mean part of the carbon store is released. Why then the perceived bias against sink projects which allow for commercial harvesting and replanting? Let's not forget - things are getting hotter: Australian projections for climate change provide plenty of challenges for current and future forest managers. Over the next century many key forest species may have to endure conditions outside their'current growing range. This poses risks for the emergent offsets industry which needs to be actively managed. Simply planting local indigenous species alone may no longer be the only best practice. Think 'true fate of carbon': It is important that our thinking is not constrained by current rules, as these will continually be refined as our knowledge about carbon systems improves over the next century (between now and 2100 there will be 22 post-Kyoto negotiation periods). Our key focus should be in considering the 'true fate' of carbon, and the real contribution to greenhouse abatement. Policy makers need to keep this in mind, and ensure that the entire carbon life cycle is considered in their decision making. 'Standing forest' versus 'Net abatement effect': There are two effective means for forests to achieve genuine greenhouse abatement. One is the carbon sequestered and stored in the 'standing forest', the other is the greenhouse benefit (carbon flow or net abatement effect) of an ongoing and renewable supply of tree based products from the site (wood, fibre, biomass, biofuel), which replace

  6. Short- and longer-term health-care resource utilization and costs associated with acute ischemic stroke

    Directory of Open Access Journals (Sweden)

    Johnson BH

    2016-02-01

    .Conclusion: In addition to the substantial costs of the initial hospitalization of an AIS, these costs double within the year following this event. Given the high cost associated with AIS, new interventions reducing either the acute or longer-term burden of AIS are needed. Keywords: acute ischemic stroke, health-care resource utilization, health-care costs, readmissions

  7. Evaluation of alternatives to cautery disbudding of dairy goat kids using physiological measures of immediate and longer-term pain.

    Science.gov (United States)

    Hempstead, Melissa N; Waas, Joseph R; Stewart, Mairi; Cave, Vanessa M; Sutherland, Mhairi A

    2018-03-21

    We evaluated alternatives to cautery disbudding of goat kids using physiological measures of immediate and longer-term pain. Fifty Saanen doe kids were randomly assigned to 1 of 5 treatments (n = 10/treatment): (1) cautery disbudding (CAUT), (2) caustic paste disbudding (CASP), (3) liquid nitrogen disbudding (CRYO), (4) clove oil injected into the horn bud (CLOV), or (5) sham disbudding (SHAM). Serum cortisol and haptoglobin concentrations were measured from blood samples collected immediately before treatment (baseline) and at 15, 30, 60, and 120 min and then again at 6 and 24 h post-treatment. An infrared thermography camera was used to take images of the horn buds 24 h pre- and 24, 48, and 72 h post-treatment to measure skin temperature. Body weight was measured daily for 1 wk to assess weight change post-treatment. Images of the horn buds were taken at d 1, 2, and 7 and at 6 wk post-treatment to assess tissue damage and wound healing. Mean cortisol concentrations were elevated in CASP kids 1 h post-treatment relative to CAUT kids. Cortisol concentrations of CRYO kids were higher than those of CAUT kids 30 min post-treatment; concentrations for CLOV kids were similar to CAUT kids post-treatment. Mean haptoglobin concentrations were similar across treatments over time; however, CLOV kids had higher concentrations at 24 h post-treatment than all other treatments. Skin temperatures of CASP and CLOV kids were elevated relative to CAUT kids at all time points post-treatment, and all disbudded kids had skin temperatures above those of SHAM kids at 72 h post-treatment. Treatment did not influence weight gain. The CAUT kids had large, open wounds exposing bone; small scabs were still evident 6 wk post-treatment. The CASP kids had red and open, raw wounds that generated large eschars, apparent for up to 6 wk. The CRYO kids had closed, dry wounds initially, but over time lesions appeared that caused open wounds; small scabs were present 6 wk post-treatment. The CLOV kids

  8. Identifying attachment ruptures underlying severe music performance anxiety in a professional musician undertaking an assessment and trial therapy of Intensive Short-Term Dynamic Psychotherapy (ISTDP).

    Science.gov (United States)

    Kenny, Dianna T; Arthey, Stephen; Abbass, Allan

    2016-01-01

    Kenny has proposed that severe music performance anxiety that is unresponsive to usual treatments such as cognitive-behaviour therapy may be one manifestation of unresolved attachment ruptures in early life. Intensive Short-Term Dynamic Psychotherapy specifically targets early relationship trauma. Accordingly, a trial of Intensive Short-Term Dynamic Psychotherapy with severely anxious musicians was implemented to assess whether resolution of attachment ruptures resulted in clinically significant relief from music performance anxiety. Volunteer musicians participating in a nationally funded study were screened for MPA severity. Those meeting the critical cut-off score on the Kenny Music Performance Anxiety Inventory were offered a trial of Intensive Short-Term Dynamic Psychotherapy. In this paper, we present the theoretical foundations and rationale for the treatment approach, followed by sections of a verbatim transcript and process analysis of the assessment phase of treatment that comprised a 3-h trial therapy session. The 'case' was a professional orchestral musician (male, aged 55) who had suffered severe music performance anxiety over the course of his entire career, which spanned more than 30 years at the time he presented for treatment following his failure to secure a position at audition. The participant was able to access the pain, rage and grief associated with unresolved attachment ruptures with both parents that demonstrated the likely nexus between early attachment trauma and severe music performance anxiety. Intensive Short-Term Dynamic Psychotherapy is a potentially cost-effective treatment for severe music performance anxiety. Further research using designs with higher levels of evidence are required before clinical recommendations can be made for the use of this therapy with this population.

  9. Undertaking high impact strategies: The role of national efficiency measures in long-term energy and emission reduction in steel making

    International Nuclear Information System (INIS)

    Xu, Tengfang; Karali, Nihan; Sathaye, Jayant

    2014-01-01

    Highlights: • Evaluate long-term effects of national energy efficiency in steel making. • Use bottom-up optimization for projection in China, India and the U.S. • The effects include changes in steel production, energy use, emissions, and costs. • Three emission targets induce different structural changes and investments. • Projected energy and CO 2 intensity declines in each country from 2010 to 2050. - Abstract: In this paper, we applied bottom-up linear optimization modeling to analyze long-term national impacts of implementing energy efficiency measures on energy savings, CO 2 -emission reduction, production, and costs of steel making in China, India, and the U.S. We first established two base scenarios representing business-as-usual steel production for each country from 2010 to 2050; Base scenario (in which no efficiency measure is available) and Base-E scenario (in which efficiency measures are available), and model scenarios representing various emission-reduction targets that affects production, annual energy use and costs with the goal of cost minimization. A higher emission-reduction target generally induces larger structural changes and increased investments in nation-wide efficiency measures, in addition to autonomous improvement expected in the Base scenario. Given the same emission-reduction target compared to the base scenario, intensity of annual energy use and emissions exhibits declining trends in each country from year 2010 to 2050. While a higher emission-reduction target result in more energy reduction from the base scenario, such reduction can become more expensive to achieve. The results advance our understanding of long-term effects of national energy efficiency applications under different sets of emission-reduction targets for steel sectors in the three major economies, and provide useful implications for high impact strategies to manage production structures, production costs, energy use, and emission reduction in steel making

  10. Risk factors for longer term psychological distress in well-functioning fibromyalgia patients: a prospective study into prognostic factors.

    NARCIS (Netherlands)

    Koulil, S. van; Lankveld, W.G.J.M. van; Kraaimaat, F.W.; Riel, P.L.C.M. van; Evers, A.W.M.

    2010-01-01

    OBJECTIVE: Psychological distress is a key risk factor for long-term complaints in fibromyalgia (FM). Prognostic factors for psychological distress might facilitate an early identification of patients at risk to help prevent long-term dysfunction, especially for the relatively well-functioning

  11. 42 CFR 137.78 - May a Self-Governance Tribe negotiate a funding agreement for a term longer or shorter than one...

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false May a Self-Governance Tribe negotiate a funding agreement for a term longer or shorter than one year? 137.78 Section 137.78 Public Health PUBLIC HEALTH... SERVICES TRIBAL SELF-GOVERNANCE Funding General § 137.78 May a Self-Governance Tribe negotiate a funding...

  12. Quality of Longer Term Mental Health Facilities in Europe : Validation of the Quality Indicator for Rehabilitative Care against Service Users' Views

    NARCIS (Netherlands)

    Killaspy, Helen; White, Sarah; Wright, Christine; Taylor, Tatiana L.; Turton, Penny; Kallert, Thomas; Schuster, Mirjam; Cervilla, Jorge A.; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Piotrowski, Patryk; Ploumpidis, Dimitris; Gonidakis, Fragiskos; Caldas-de-Almeida, Jose Miguel; Cardoso, Graca; King, Michael

    2012-01-01

    Background: The Quality Indicator for Rehabilitative Care (QuIRC) is a staff rated, international toolkit that assesses care in longer term hospital and community based mental health facilities. The QuIRC was developed from review of the international literature, an international Delphi exercise

  13. Longer-term bosentan therapy improves functional capacity in Eisenmenger syndrome : Results of the BREATHE-5 open-label extension study

    NARCIS (Netherlands)

    Gatzoulis, Michael A.; Beghetti, Maurice; Galie, Nazzareno; Granton, John; Berger, Rolf M. F.; Lauer, Andrea; Chiossi, Eleonora; Landzberg, Michael

    2008-01-01

    BACKGROUND: Bosentan, an oral endothelin ET(A)/ET(B) receptor antagonist, improves hemodynamics and exercise capacity in patients with Eisenmenger syndrome but longer-term effects are unknown. This study investigated the efficacy and safety of bosentan up to 40 weeks in these patients. METHODS:

  14. A Mixed-Methods Evaluation of the Longer-Term Implementation and Utility of a Teacher Classroom Management Training Programme in Irish Primary Schools

    Science.gov (United States)

    Leckey, Yvonne; Hyland, Lynda; Hickey, Gráinne; Lodge, Anne; Kelly, Paul; Bywater, Tracey; Comiskey, Catherine; Donnelly, Michael; McGilloway, Sinéad

    2016-01-01

    Inappropriate, aggressive and disruptive behaviour in the classroom can be detrimental to child and teacher well-being. This study involved a longer-term evaluation of the "Incredible Years Teacher [Classroom Management]" programme (IYTP) undertaken mainly within disadvantaged schools in south-west Ireland. The IYTP is designed to…

  15. A longer-term perspective on human exploitation and management of peat wetlands: the Hula Valley, Israel

    Directory of Open Access Journals (Sweden)

    R.J. Payne

    2012-01-01

    Full Text Available The influence of non-recent human activities on the structure and functioning of wetlands is frequently overlooked. The Hula wetland in northern Israel was exploited for a variety of resources over thousands of years prior to near-total destruction by drainage in the 1950s. These pre-drainage human impacts created a mosaic of anthropogenic habitats which should be considered in attempting to re-create and rehabilitate the wetlands. Here we take an environmental history approach, using the documentary record to identify the numerous ways in which the ecosystem was shaped by human activity. The major traditional activities in the wetland included reed-harvesting, fishing, animal husbandry and limited arable agriculture. The corpus of material examined illustrates that drainage of the wetlands has a longer history than is frequently supposed. Activities such as papyrus harvesting, buffalo husbandry and fishing shaped the ecosystem and their replication may be desirable to re-create lost anthropogenic niches in contemporary conservation management.

  16. Jet Joint Undertaking. Vol. 2

    International Nuclear Information System (INIS)

    1989-06-01

    The scientific, technical, experimental and theoretical investigations related to JET tokamak are presented. The JET Joint Undertaking, Volume 2, includes papers presented at: the 15th European Conference on controlled fusion and plasma heating, the 15th Symposium on fusion technology, the 12th IAEA Conference on plasma physics and controlled nuclear fusion research, the 8th Topical Meeting on technology of fusion. Moreover, the following topics, concerning JET, are discussed: experience with wall materials, plasma performance, high power ion cyclotron resonance heating, plasma boundary, results and prospects for fusion, preparation for D-T operation, active gas handling system and remote handling equipment

  17. Longer-term needs of stroke survivors with communication difficulties living in the community: a systematic review and thematic synthesis of qualitative studies

    Science.gov (United States)

    Clarke, David

    2017-01-01

    Objective To review and synthesise qualitative literature relating to the longer-term needs of community dwelling stroke survivors with communication difficulties including aphasia, dysarthria and apraxia of speech. Design Systematic review and thematic synthesis. Method We included studies employing qualitative methodology which focused on the perceived or expressed needs, views or experiences of stroke survivors with communication difficulties in relation to the day-to-day management of their condition following hospital discharge. We searched MEDLINE, EMBASE, PsycINFO, CINAHL, The Cochrane Library, International Bibliography of the Social Sciences and AMED and undertook grey literature searches. Studies were assessed for methodological quality by two researchers independently and the findings were combined using thematic synthesis. Results Thirty-two studies were included in the thematic synthesis. The synthesis reveals the ongoing difficulties stroke survivors can experience in coming to terms with the loss of communication and in adapting to life with a communication difficulty. While some were able to adjust, others struggled to maintain their social networks and to participate in activities which were meaningful to them. The challenges experienced by stroke survivors with communication difficulties persisted for many years poststroke. Four themes relating to longer-term need were developed: managing communication outside of the home, creating a meaningful role, creating or maintaining a support network and taking control and actively moving forward with life. Conclusions Understanding the experiences of stroke survivors with communication difficulties is vital for ensuring that longer-term care is designed according to their needs. Wider psychosocial factors must be considered in the rehabilitation of people with poststroke communication difficulties. Self-management interventions may be appropriate to help this subgroup of stroke survivors manage their

  18. Assessing loss of coral cover on Australia's Great Barrier Reef over two decades, with implications for longer-term trends

    Science.gov (United States)

    Sweatman, H.; Delean, S.; Syms, C.

    2011-06-01

    While coral reefs in many parts of the world are in decline as a direct consequence of human pressures, Australia's Great Barrier Reef (GBR) is unusual in that direct human pressures are low and the entire system of ~2,900 reefs has been managed as a marine park since the 1980s. In spite of these advantages, standard annual surveys of a large number of reefs showed that from 1986 to 2004, average live coral cover across the GBR declined from 28 to 22%. This overall decline was mainly due to large losses in six (21%) of 29 subregions. Declines in live coral cover on reefs in two inshore subregions coincided with thermal bleaching in 1998, while declines in four mid-self subregions were due to outbreaks of predatory starfish. Otherwise, living coral cover increased in one subregion (3%) and 22 subregions (76%) showed no substantial change. Reefs in the great majority of subregions showed cycles of decline and recovery over the survey period, but with little synchrony among subregions. Two previous studies examined long-term changes in live coral cover on GBR reefs using meta-analyses including historical data from before the mid-1980s. Both found greater rates of loss of coral and recorded a marked decrease in living coral cover on the GBR in 1986, coinciding exactly with the start of large-scale monitoring. We argue that much of the apparent long-term decrease results from combining data from selective, sparse, small-scale studies before 1986 with data from both small-scale studies and large-scale monitoring surveys after that date. The GBR has clearly been changed by human activities and live coral cover has declined overall, but losses of coral in the past 40-50 years have probably been overestimated.

  19. Independent for longer

    NARCIS (Netherlands)

    Cretien van Campen; Jurjen Iedema; Marjolein Broese van Groenou; Dorly Deeg

    2017-01-01

    Original title: Langer zelfstandig. The Dutch government's reform of long-term care is intended to reinforce the trend whereby older persons continue to live independently for longer and the need for admission to a care institution is avoided or delayed. Many Dutch citizens aged 65 years and

  20. Longer term clinical and economic benefits of offering acupuncture care to patients with chronic low back pain.

    Science.gov (United States)

    Thomas, K J; MacPherson, H; Ratcliffe, J; Thorpe, L; Brazier, J; Campbell, M; Fitter, M; Roman, M; Walters, S; Nicholl, J P

    2005-08-01

    To test whether patients with persistent non-specific low back pain, when offered access to traditional acupuncture care alongside conventional primary care, gained more long-term relief from pain than those offered conventional care only, for equal or less cost. Safety and acceptability of acupuncture care to patients, and the heterogeneity of outcomes were also tested. A pragmatic, two parallel group, randomised controlled trial. Patients in the experimental arm were offered the option of referral to the acupuncture service comprising six acupuncturists. The control group received usual care from their general practitioner (GP). Eligible patients were randomised in a ratio of 2:1 to the offer of acupuncture to allow between-acupuncturist effects to be tested. Three non-NHS acupuncture clinics, with referrals from 39 GPs working in 16 practices in York, UK. Patients aged 18-65 years with non-specific low back pain of 4-52 weeks' duration, assessed as suitable for primary care management by their general practitioner. The trial protocol allowed up to ten individualised acupuncture treatments per patient. The acupuncturist determined the content and the number of treatments according to patient need. The Short Form 36 (SF-36) Bodily Pain dimension (range 0-100 points), assessed at baseline, and 3, 12 and 24 months. The study was powered to detect a 10-point difference between groups at 12 months post-randomisation. Cost--utility analysis was conducted at 24 months using the EuroQoL 5 Dimensions (EQ-5D) and a preference-based single index measure derived from the SF-36 (SF-6D). Secondary outcomes included the McGill Present Pain Index (PPI), Oswestry Pain Disability Index (ODI), all other SF-36 dimensions, medication use, pain-free months in the past year, worry about back pain, satisfaction with care received, and safety and acceptability of acupuncture care. A total of 159 patients were in the 'acupuncture offer' arm and 80 in the 'usual care' arm. All 159 patients

  1. Inadequacy of 3-month Oswestry Disability Index outcome for assessing individual longer-term patient experience after lumbar spine surgery.

    Science.gov (United States)

    Asher, Anthony L; Chotai, Silky; Devin, Clinton J; Speroff, Theodore; Harrell, Frank E; Nian, Hui; Dittus, Robert S; Mummaneni, Praveen V; Knightly, John J; Glassman, Steven D; Bydon, Mohamad; Archer, Kristin R; Foley, Kevin T; McGirt, Matthew J

    2016-08-01

    MCID at 3 and 12 months. The discordance rates of achieving or not achieving MCID for ODI were in the range of 19% to 27% for all diagnoses and treatments (decompression with and without fusion). The positive and negative predictive value of 3-months ODI to predict 12-month ODI was 86% and 60% for MCID and 82% and 67% for SCB. CONCLUSIONS Based on their findings, the authors conclude the following: 1) Predictive methods for functional outcome based on early patient experience (i.e., baseline and/or 3-month data) should be used to help evaluate the effectiveness of procedures in patient populations, rather than serving as a proxy for long-term individual patient experience. 2) Prospective longitudinal registries need to span at least 12 months to determine the effectiveness of spine care at the individual patient and practitioner level.

  2. Longer-term needs of stroke survivors with communication difficulties living in the community: a systematic review and thematic synthesis of qualitative studies.

    Science.gov (United States)

    Wray, Faye; Clarke, David

    2017-10-06

    To review and synthesise qualitative literature relating to the longer-term needs of community dwelling stroke survivors with communication difficulties including aphasia, dysarthria and apraxia of speech. Systematic review and thematic synthesis. We included studies employing qualitative methodology which focused on the perceived or expressed needs, views or experiences of stroke survivors with communication difficulties in relation to the day-to-day management of their condition following hospital discharge. We searched MEDLINE, EMBASE, PsycINFO, CINAHL, The Cochrane Library, International Bibliography of the Social Sciences and AMED and undertook grey literature searches. Studies were assessed for methodological quality by two researchers independently and the findings were combined using thematic synthesis. Thirty-two studies were included in the thematic synthesis. The synthesis reveals the ongoing difficulties stroke survivors can experience in coming to terms with the loss of communication and in adapting to life with a communication difficulty. While some were able to adjust, others struggled to maintain their social networks and to participate in activities which were meaningful to them. The challenges experienced by stroke survivors with communication difficulties persisted for many years poststroke. Four themes relating to longer-term need were developed: managing communication outside of the home, creating a meaningful role, creating or maintaining a support network and taking control and actively moving forward with life. Understanding the experiences of stroke survivors with communication difficulties is vital for ensuring that longer-term care is designed according to their needs. Wider psychosocial factors must be considered in the rehabilitation of people with poststroke communication difficulties. Self-management interventions may be appropriate to help this subgroup of stroke survivors manage their condition in the longer-term; however, such

  3. Quality of Longer Term Mental Health Facilities in Europe: Validation of the Quality Indicator for Rehabilitative Care against Service Users’ Views

    Science.gov (United States)

    Killaspy, Helen; White, Sarah; Wright, Christine; Taylor, Tatiana L.; Turton, Penny; Kallert, Thomas; Schuster, Mirjam; Cervilla, Jorge A.; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Piotrowski, Patryk; Ploumpidis, Dimitris; Gonidakis, Fragiskos; Caldas-de-Almeida, José Miguel; Cardoso, Graça; King, Michael

    2012-01-01

    Background The Quality Indicator for Rehabilitative Care (QuIRC) is a staff rated, international toolkit that assesses care in longer term hospital and community based mental health facilities. The QuIRC was developed from review of the international literature, an international Delphi exercise with over 400 service users, practitioners, carers and advocates from ten European countries at different stages of deinstitutionalisation, and review of the care standards in these countries. It can be completed in under an hour by the facility manager and has robust content validity, acceptability and inter-rater reliability. In this study, we investigated the internal validity of the QuIRC. Our aim was to identify the QuIRC domains of care that independently predicted better service user experiences of care. Method At least 20 units providing longer term care for adults with severe mental illness were recruited in each of ten European countries. Service users completed standardised measures of their experiences of care, quality of life, autonomy and the unit’s therapeutic milieu. Unit managers completed the QuIRC. Multilevel modelling allowed analysis of associations between service user ratings as dependent variables with unit QuIRC domain ratings as independent variables. Results 1750/2495 (70%) users and the managers of 213 units from across ten European countries participated. QuIRC ratings were positively associated with service users’ autonomy and experiences of care. Associations between QuIRC ratings and service users’ ratings of their quality of life and the unit’s therapeutic milieu were explained by service user characteristics (age, diagnosis and functioning). A hypothetical 10% increase in QuIRC rating resulted in a clinically meaningful improvement in autonomy. Conclusions Ratings of the quality of longer term mental health facilities made by service managers were positively associated with service users’ autonomy and experiences of care

  4. Quality of longer term mental health facilities in Europe: validation of the quality indicator for rehabilitative care against service users' views.

    Directory of Open Access Journals (Sweden)

    Helen Killaspy

    Full Text Available BACKGROUND: The Quality Indicator for Rehabilitative Care (QuIRC is a staff rated, international toolkit that assesses care in longer term hospital and community based mental health facilities. The QuIRC was developed from review of the international literature, an international Delphi exercise with over 400 service users, practitioners, carers and advocates from ten European countries at different stages of deinstitutionalisation, and review of the care standards in these countries. It can be completed in under an hour by the facility manager and has robust content validity, acceptability and inter-rater reliability. In this study, we investigated the internal validity of the QuIRC. Our aim was to identify the QuIRC domains of care that independently predicted better service user experiences of care. METHOD: At least 20 units providing longer term care for adults with severe mental illness were recruited in each of ten European countries. Service users completed standardised measures of their experiences of care, quality of life, autonomy and the unit's therapeutic milieu. Unit managers completed the QuIRC. Multilevel modelling allowed analysis of associations between service user ratings as dependent variables with unit QuIRC domain ratings as independent variables. RESULTS: 1750/2495 (70% users and the managers of 213 units from across ten European countries participated. QuIRC ratings were positively associated with service users' autonomy and experiences of care. Associations between QuIRC ratings and service users' ratings of their quality of life and the unit's therapeutic milieu were explained by service user characteristics (age, diagnosis and functioning. A hypothetical 10% increase in QuIRC rating resulted in a clinically meaningful improvement in autonomy. CONCLUSIONS: Ratings of the quality of longer term mental health facilities made by service managers were positively associated with service users' autonomy and experiences of care

  5. Quality of longer term mental health facilities in Europe: validation of the quality indicator for rehabilitative care against service users' views.

    Science.gov (United States)

    Killaspy, Helen; White, Sarah; Wright, Christine; Taylor, Tatiana L; Turton, Penny; Kallert, Thomas; Schuster, Mirjam; Cervilla, Jorge A; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Piotrowski, Patryk; Ploumpidis, Dimitris; Gonidakis, Fragiskos; Caldas-de-Almeida, José Miguel; Cardoso, Graça; King, Michael

    2012-01-01

    The Quality Indicator for Rehabilitative Care (QuIRC) is a staff rated, international toolkit that assesses care in longer term hospital and community based mental health facilities. The QuIRC was developed from review of the international literature, an international Delphi exercise with over 400 service users, practitioners, carers and advocates from ten European countries at different stages of deinstitutionalisation, and review of the care standards in these countries. It can be completed in under an hour by the facility manager and has robust content validity, acceptability and inter-rater reliability. In this study, we investigated the internal validity of the QuIRC. Our aim was to identify the QuIRC domains of care that independently predicted better service user experiences of care. At least 20 units providing longer term care for adults with severe mental illness were recruited in each of ten European countries. Service users completed standardised measures of their experiences of care, quality of life, autonomy and the unit's therapeutic milieu. Unit managers completed the QuIRC. Multilevel modelling allowed analysis of associations between service user ratings as dependent variables with unit QuIRC domain ratings as independent variables. 1750/2495 (70%) users and the managers of 213 units from across ten European countries participated. QuIRC ratings were positively associated with service users' autonomy and experiences of care. Associations between QuIRC ratings and service users' ratings of their quality of life and the unit's therapeutic milieu were explained by service user characteristics (age, diagnosis and functioning). A hypothetical 10% increase in QuIRC rating resulted in a clinically meaningful improvement in autonomy. Ratings of the quality of longer term mental health facilities made by service managers were positively associated with service users' autonomy and experiences of care. Interventions that improve quality of care in these

  6. A systematic review of the international published literature relating to quality of institutional care for people with longer term mental health problems

    Directory of Open Access Journals (Sweden)

    Visser Ellen

    2009-09-01

    Full Text Available Abstract Background A proportion of people with mental health problems require longer term care in a psychiatric or social care institution. However, there are no internationally agreed quality standards for institutional care and no method to assess common care standards across countries. We aimed to identify the key components of institutional care for people with longer term mental health problems and the effectiveness of these components. Methods We undertook a systematic review of the literature using comprehensive search terms in 11 electronic databases and identified 12,182 titles. We viewed 550 abstracts, reviewed 223 papers and included 110 of these. A "critical interpretative synthesis" of the evidence was used to identify domains of institutional care that are key to service users' recovery. Results We identified eight domains of institutional care that were key to service users' recovery: living conditions; interventions for schizophrenia; physical health; restraint and seclusion; staff training and support; therapeutic relationship; autonomy and service user involvement; and clinical governance. Evidence was strongest for specific interventions for the treatment of schizophrenia (family psychoeducation, cognitive behavioural therapy (CBT and vocational rehabilitation. Conclusion Institutions should, ideally, be community based, operate a flexible regime, maintain a low density of residents and maximise residents' privacy. For service users with a diagnosis of schizophrenia, specific interventions (CBT, family interventions involving psychoeducation, and supported employment should be provided through integrated programmes. Restraint and seclusion should be avoided wherever possible and staff should have adequate training in de-escalation techniques. Regular staff supervision should be provided and this should support service user involvement in decision making and positive therapeutic relationships between staff and service users

  7. Mediation of Short and Longer Term Effects of an Intervention Program to Enhance Resilience in Immigrants from Mainland China to Hong Kong.

    Science.gov (United States)

    Yu, Nancy X; Lam, T H; Liu, Iris K F; Stewart, Sunita M

    2015-01-01

    Few clinical trials report on the active intervention components that result in outcome changes, although this is relevant to further improving efficacy and adapting effective programs to other populations. This paper presents follow-up analyses of a randomized controlled trial to enhance adaptation by increasing knowledge and personal resilience in two separate brief interventions with immigrants from Mainland China to Hong Kong (Yu et al., 2014b). The present paper extends our previous one by reporting on the longer term effect of the interventions on personal resilience, and examining whether the Resilience intervention worked as designed to enhance personal resilience. The four-session intervention targeted at self-efficacy, positive thinking, altruism, and goal setting. In this randomized controlled trial, 220 immigrants were randomly allocated to three arms: Resilience, Information (an active control arm), and Control arms. Participants completed measures of the four active components (self-efficacy, positive thinking, altruism, and goal setting) at baseline and immediately after the intervention. Personal resilience was assessed at baseline, post-intervention, and 3- and 6-month follow-ups. The results showed that the Resilience arm had greater increases in the four active components post-intervention. Changes in each of the four active components at the post-intervention assessment mediated enhanced personal resilience at the 3-month follow-up in the Resilience arm. Changes in self-efficacy and goal setting showed the largest effect size, and altruism showed the smallest. The arm effects of the Resilience intervention on enhanced personal resilience at the 6-month follow-up were mediated by increases of personal resilience post-intervention (Resilience vs. Control) and at the 3-month follow-up (Resilience vs. Information). These findings showed that these four active components were all mediators in this Resilience intervention. Our results of the effects

  8. Longer term follow-up on effects of Tailored Physical Activity or Chronic Pain Self-Management Programme on return-to-work

    DEFF Research Database (Denmark)

    Andersen, Lotte Nygaard; Juul-Kristensen, Birgit; Sørensen, Thomas Lund

    2016-01-01

    OBJECTIVE: To evaluate the longer term efficacy of the interventions Tailored Physical Activity (TPA) and Chronic Pain Self-management Program (CPSMP) against a reference group on return-to-work for sick-listed subjects with pain in the back or upper body. DESIGN: A randomized controlled trial...... the reference group as regards return-to-work. Compared with the reference group no other benefits of TPA and CPSMP were evident regarding pain, work ability, kinesiophobia or physical capacity. CONCLUSION: After 11 months TPA, the reference group, and CPSMP show similar patterns of facilitating return-to-work...... to work and the co-primary end-point was the duration of the sickness absence period retrieved 11 months after the first day on sick leave. Secondary outcomes were pain level, body mass index, aerobic capacity, work ability and kinesiophobia. RESULTS: TPA and CPSMP were no more effective than...

  9. Relationship between national mental health expenditure and quality of care in longer-term psychiatric and social care facilities in Europe: cross-sectional study.

    Science.gov (United States)

    Salisbury, Tatiana Taylor; Killaspy, Helen; King, Michael

    2017-07-01

    Background It is not known whether increased mental health expenditure is associated with better outcomes. Aims To estimate the association between national mental health expenditure and (a) quality of longer-term mental healthcare, (b) service users' ratings of that care in eight European countries. Method National mental health expenditure (per cent of health budget spent on mental health) was calculated from international sources. Multilevel models were developed to assess associations with quality of care and service user experiences of care using ratings of 171 facility managers and 1429 service users. Results Significant positive associations were found between mental health spend and (a) six of seven quality of care domains; and (b) service user autonomy and experiences of care. Conclusions Greater national mental health expenditure was associated with higher quality of care and better service user experience. © The Royal College of Psychiatrists 2017.

  10. Predictors of current and longer-term patterns of abundance of American pikas (Ochotona princeps) across a leading-edge protected area

    Science.gov (United States)

    Moyer-Horner, Lucas; Beever, Erik A.; Johnson, Douglas H.; Beil, Mark; Belt, Jami

    2016-01-01

    American pikas (Ochotona princeps) have been heralded as indicators of montane-mammal response to contemporary climate change. Pikas no longer occupy the driest and lowest-elevation sites in numerous parts of their geographic range. Conversely, pikas have exhibited higher rates of occupancy and persistence in Rocky Mountain and Sierra Nevada montane ‘mainlands’. Research and monitoring efforts on pikas across the western USA have collectively shown the nuance and complexity with which climate will often act on species in diverse topographic and climatic contexts. However, to date no studies have investigated habitat, distribution, and abundance of pikas across hundreds of sites within a remote wilderness area. Additionally, relatively little is known about whether climate acts most strongly on pikas through direct or indirect (e.g., vegetation-mediated) mechanisms. During 2007–2009, we collectively hiked >16,000 km throughout the 410,077-ha Glacier National Park, Montana, USA, in an effort to identify topographic, microrefugial, and vegetative characteristics predictive of pika abundance. We identified 411 apparently pika-suitable habitat patches with binoculars (in situ), and surveyed 314 of them for pika signs. Ranking of alternative logistic-regression models based on AICc scores revealed that short-term pika abundances were positively associated with intermediate elevations, greater cover of mosses, and taller forbs, and decreased each year, for a total decline of 68% during the three-year study; whereas longer-term abundances were associated only with static variables (longitude, elevation, gradient) and were lower on north-facing slopes. Earlier Julian date and time of day of the survey (i.e., midday vs. not) were associated with lower observed pika abundance. We recommend that wildlife monitoring account for this seasonal and diel variation when surveying pikas. Broad-scale information on status and abundance determinants of montane mammals, especially

  11. Predictors of Current and Longer-Term Patterns of Abundance of American Pikas (Ochotona princeps across a Leading-Edge Protected Area.

    Directory of Open Access Journals (Sweden)

    Lucas Moyer-Horner

    Full Text Available American pikas (Ochotona princeps have been heralded as indicators of montane-mammal response to contemporary climate change. Pikas no longer occupy the driest and lowest-elevation sites in numerous parts of their geographic range. Conversely, pikas have exhibited higher rates of occupancy and persistence in Rocky Mountain and Sierra Nevada montane 'mainlands'. Research and monitoring efforts on pikas across the western USA have collectively shown the nuance and complexity with which climate will often act on species in diverse topographic and climatic contexts. However, to date no studies have investigated habitat, distribution, and abundance of pikas across hundreds of sites within a remote wilderness area. Additionally, relatively little is known about whether climate acts most strongly on pikas through direct or indirect (e.g., vegetation-mediated mechanisms. During 2007-2009, we collectively hiked >16,000 km throughout the 410,077-ha Glacier National Park, Montana, USA, in an effort to identify topographic, microrefugial, and vegetative characteristics predictive of pika abundance. We identified 411 apparently pika-suitable habitat patches with binoculars (in situ, and surveyed 314 of them for pika signs. Ranking of alternative logistic-regression models based on AICc scores revealed that short-term pika abundances were positively associated with intermediate elevations, greater cover of mosses, and taller forbs, and decreased each year, for a total decline of 68% during the three-year study; whereas longer-term abundances were associated only with static variables (longitude, elevation, gradient and were lower on north-facing slopes. Earlier Julian date and time of day of the survey (i.e., midday vs. not were associated with lower observed pika abundance. We recommend that wildlife monitoring account for this seasonal and diel variation when surveying pikas. Broad-scale information on status and abundance determinants of montane mammals

  12. Predictors of Current and Longer-Term Patterns of Abundance of American Pikas (Ochotona princeps) across a Leading-Edge Protected Area.

    Science.gov (United States)

    Moyer-Horner, Lucas; Beever, Erik A; Johnson, Douglas H; Biel, Mark; Belt, Jami

    2016-01-01

    American pikas (Ochotona princeps) have been heralded as indicators of montane-mammal response to contemporary climate change. Pikas no longer occupy the driest and lowest-elevation sites in numerous parts of their geographic range. Conversely, pikas have exhibited higher rates of occupancy and persistence in Rocky Mountain and Sierra Nevada montane 'mainlands'. Research and monitoring efforts on pikas across the western USA have collectively shown the nuance and complexity with which climate will often act on species in diverse topographic and climatic contexts. However, to date no studies have investigated habitat, distribution, and abundance of pikas across hundreds of sites within a remote wilderness area. Additionally, relatively little is known about whether climate acts most strongly on pikas through direct or indirect (e.g., vegetation-mediated) mechanisms. During 2007-2009, we collectively hiked >16,000 km throughout the 410,077-ha Glacier National Park, Montana, USA, in an effort to identify topographic, microrefugial, and vegetative characteristics predictive of pika abundance. We identified 411 apparently pika-suitable habitat patches with binoculars (in situ), and surveyed 314 of them for pika signs. Ranking of alternative logistic-regression models based on AICc scores revealed that short-term pika abundances were positively associated with intermediate elevations, greater cover of mosses, and taller forbs, and decreased each year, for a total decline of 68% during the three-year study; whereas longer-term abundances were associated only with static variables (longitude, elevation, gradient) and were lower on north-facing slopes. Earlier Julian date and time of day of the survey (i.e., midday vs. not) were associated with lower observed pika abundance. We recommend that wildlife monitoring account for this seasonal and diel variation when surveying pikas. Broad-scale information on status and abundance determinants of montane mammals, especially for

  13. Mediation of short and longer term effects of an intervention program to enhance resilience in immigrants from Mainland China to Hong Kong

    Directory of Open Access Journals (Sweden)

    Nancy Xiaonan eYu

    2015-11-01

    Full Text Available Few clinical trials report on the active intervention components that result in outcome changes, although this is relevant to further improving efficacy and adapting effective programs to other populations. This paper presents follow-up analyses of a randomized controlled trial to enhance adaptation by increasing knowledge and personal resilience in two separate brief interventions with immigrants from Mainland China to Hong Kong (Yu et al., 2014b. The present paper extends our previous one by reporting on the longer term effect of the interventions on personal resilience, and examining whether the Resilience intervention worked as designed to enhance personal resilience. The four-session intervention targeted at self-efficacy, positive thinking, altruism, and goal setting. In this randomized controlled trial, 220 immigrants were randomly allocated to three arms: Resilience, Information (an active control arm, and Control arms. Participants completed measures of the four active components (self-efficacy, positive thinking, altruism, and goal setting at baseline and immediately after the intervention. Personal resilience was assessed at baseline, post-intervention, and three- and six-month follow-ups. The results showed that the Resilience arm had greater increases in the four active components post-intervention. Changes in each of the four active components at the post-intervention assessment mediated enhanced personal resilience at the three-month follow-up in the Resilience arm. Changes in self-efficacy and goal setting showed the largest effect size, and altruism showed the smallest. The arm effects of the Resilience intervention on enhanced personal resilience at the six-month follow-up were mediated by increases of personal resilience post-intervention (Resilience versus Control and at the three-month follow-up (Resilience versus Information. These findings showed that these four active components were all mediators in this Resilience

  14. Dual layer hollow fiber PVDF ultra-filtration membranes containing Ag nano-particle loaded zeolite with longer term anti-bacterial capacity in salt water.

    Science.gov (United States)

    Shi, Huyan; Xue, Lixin; Gao, Ailin; Zhou, Qingbo

    2016-01-01

    Dual layer polyvinylidene fluoride (PVDF), antibacterial, hollow fiber, ultra-filtration composite membranes with antibacterial particles (silver (Ag) nano-particles loaded zeolite (Z-Ag)) in the outer layer were prepared with high water flux and desired pore sizes. The amounts of Ag(+) released from the composite membranes, freshly made and stored in water and salt solution, were measured. The result indicated that dual layer PVDF antibacterial hollow fiber containing Z-Ag (M-1-Ag) still possessed the ability of continuous release of Ag(+) even after exposure to water with high ionic content, showing a longer term resistance to bacterial adhesion and antibacterial activity than membrane doped with Z-Ag(+) (M-1). Results from an anti-adhesion and bacteria killing test with Escherichia coli supported that the antibacterial efficiency of dual hollow fiber PVDF membranes with Z-Ag was much higher than those with Z-Ag(+) after long time storage in water or exposure to phosphate buffered saline (PBS) solution. This novel hollow fiber membrane may find applications in constructing sea water pretreatment devices with long term antifouling capability for the desalination processes.

  15. The impact of longer term intervention on reforming physical science teachers' approaches to laboratory instruction: Seeking a more effective role for the laboratory in science instruction

    Science.gov (United States)

    Priestley, William Joseph

    This study is one of six companion studies investigating ways of improving the overall role of laboratory experiences in science instruction. The primary purpose of the study was to explore the extent to which longer term inservice experiences with modeled inquiry-based instruction caused immediate reform in the approach that inservice teachers of physical science use in pre- and post-laboratory instruction, as well as their ability to restructure their physical science courses to give greater emphasis to the inquiry approach. A secondary purpose was to compare the findings of this study with those of the companion study by H. Priestley (1996) which studied life science teachers (LSTs). A full semester graduate level science education course entitled Science Education 716, The Teaching of Chemistry, developed by two experienced Temple University professors, provided the necessary modeled inquiry-oriented pedagogical approach. Pre- and post-laboratory sessions were videotaped and analyzed using the Modified Revised Science Teacher Behavioral Inventory to determine the frequency of occurrence of the teaching behaviors used. Inservice teacher behavior profiles were compared to the profiles of traditional and model teaching. Eleven of the 14 PSTs presented post-laboratory sessions that used student laboratory data and/or observations to provide a foundation for the follow-up discussion. Eight of these 11, demonstrated, to a considerable degree, the model approach to instruction. Within this group of 8, four indicated that they utilized the modeled approach prior to the inservice treatment while the remaining 4 showed that they could restructure their courses and reform their teaching behaviors to approach the model profile. While the exploration reported herein did not reveal statistical significance in the teaching behaviors between the PST and LST groups of teachers, these teachers did show significant differences in the amount of time used in conducting post

  16. Longer-term effects of home-based exercise interventions on exercise capacity and physical activity in coronary artery disease patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Claes, Jomme; Buys, Roselien; Budts, Werner; Smart, Neil; Cornelissen, Véronique A

    2017-02-01

    Background Exercise-based cardiovascular rehabilitation (CR) improves exercise capacity (EC), lowers cardiovascular risk profile and increases physical functioning in the short term. However, uptake of and adherence to a physically active lifestyle in the long run remain problematic. Home-based (HB) exercise programmes have been introduced in an attempt to enhance long-term adherence to recommended levels of physical activity (PA). The current systematic review and meta-analysis aimed to compare the longer-term effects of HB exercise programmes with usual care (UC) or centre-based (CB) CR in patients referred for CR. Design Systematic review and meta-analysis. Methods Non-randomised controlled trials (RCTs) or randomised trials comparing the effects of HB exercise programmes with UC or CB rehabilitation on EC and/or PA, with a follow-up period of ≥12 months and performed in coronary artery disease patients, were searched in four databases (PubMed, EMBASE, the Cumulative Index to Nursing and Allied Health Literature (CINAHL) and the Cochrane Central Register of Controlled trials (CENTRAL)) from their inception until September 7, 2016. Standardised mean differences (SMDs) were calculated and pooled by means of random effects models. Risk of bias, publication bias and heterogeneity among trials were also assessed. Results Seven studies could be included in the meta-analysis on EC, but only two studies could be included in the meta-analysis on PA (total number of 1440 patients). The results showed no significant differences in EC between HB rehabilitation and UC (SMD 0.10, 95% confidence interval (CI) -0.13 to 0.33). There was a small but significant difference in EC in favour of HB compared to CB rehabilitation (SMD 0.25, 95% CI 0.02-0.48). No differences were found for PA (SMD 0.37, 95% CI -0.18 to 0.92). Conclusions HB exercise is slightly more effective than CB rehabilitation in terms of maintaining EC. The small number of studies warrants the need for more

  17. The development of the Quality Indicator for Rehabilitative Care (QuIRC): a measure of best practice for facilities for people with longer term mental health problems.

    Science.gov (United States)

    Killaspy, Helen; White, Sarah; Wright, Christine; Taylor, Tatiana L; Turton, Penny; Schützwohl, Matthias; Schuster, Mirjam; Cervilla, Jorge A; Brangier, Paulette; Raboch, Jiri; Kališová, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Adamowski, Tomasz; Ploumpidis, Dimitri; Gonidakis, Fragiskos; Caldas-de-Almeida, José; Cardoso, Graça; King, Michael B

    2011-03-01

    Despite the progress over recent decades in developing community mental health services internationally, many people still receive treatment and care in institutional settings. Those most likely to reside longest in these facilities have the most complex mental health problems and are at most risk of potential abuses of care and exploitation. This study aimed to develop an international, standardised toolkit to assess the quality of care in longer term hospital and community based mental health units, including the degree to which human rights, social inclusion and autonomy are promoted. The domains of care included in the toolkit were identified from a systematic literature review, international expert Delphi exercise, and review of care standards in ten European countries. The draft toolkit comprised 154 questions for unit managers. Inter-rater reliability was tested in 202 units across ten countries at different stages of deinstitutionalisation and development of community mental health services. Exploratory factor analysis was used to corroborate the allocation of items to domains. Feedback from those using the toolkit was collected about its usefulness and ease of completion. The toolkit had excellent inter-rater reliability and few items with narrow spread of response. Unit managers found the content highly relevant and were able to complete it in around 90 minutes. Minimal refinement was required and the final version comprised 145 questions assessing seven domains of care. Triangulation of qualitative and quantitative evidence directed the development of a robust and comprehensive international quality assessment toolkit for units in highly variable socioeconomic and political contexts.

  18. Upper-body morbidity following breast cancer treatment is common, may persist longer-term and adversely influences quality of life

    Directory of Open Access Journals (Sweden)

    Hayes Sandra C

    2010-08-01

    Full Text Available Abstract Background Impairments in upper-body function (UBF are common following breast cancer. However, the relationship between arm morbidity and quality of life (QoL remains unclear. This investigation uses longitudinal data to describe UBF in a population-based sample of women with breast cancer and examines its relationship with QoL. Methods Australian women (n = 287 with unilateral breast cancer were assessed at three-monthly intervals, from six- to 18-months post-surgery (PS. Strength, endurance and flexibility were used to assess objective UBF, while the Disability of the Arm, Shoulder and Hand questionnaire and the Functional Assessment of Cancer Therapy-Breast questionnaire were used to assess self-reported UBF and QoL, respectively. Results Although mean UBF improved over time, up to 41% of women revealed declines in UBF between six- and 18-months PS. Older age, lower socioeconomic position, treatment on the dominant side, mastectomy, more extensive lymph node removal and having lymphoedema each increased odds of declines in UBF by at least two-fold (p Conclusions Significant upper-body morbidity is experienced by many following breast cancer treatment, persisting longer term, and adversely influencing the QoL of breast cancer survivors.

  19. Investigating the Longer-Term Impact of the CREST Inquiry-Based Learning Programme on Student Self-regulated Processes and Related Motivations: Views of Students and Teachers

    Science.gov (United States)

    Moote, Julie

    2017-07-01

    This study investigates the impact of participation in the CREativity in Science and Technology (CREST) programme on student self-regulated processes and related motivations. The CREST scheme, a student-run science project managed by the British Science Association, is currently being implemented in schools across the UK to increase student engagement and motivation in science. Through implementing a rigorous quasi-experimental research design using two intervention conditions and one control group with immediate as well as 3-month delayed post-test data, the results documented both the immediate and longer-term positive impact of CREST participation on students' self-reported levels of self-regulation. The present study also investigates changes in teachers' perceptions of students' self-regulated learning through CREST programme participation. Group differences regarding changes in student self-reported self-regulation were not matched when looking at the teacher-reported self-regulated learning results at both immediate post-test and delayed post-test. These discrepancies are discussed in relation to analyses conducted on the other motivational constructs measured.

  20. Testing Mediators Hypothesized to Account for the Effects of a Dissonance Eating Disorder Prevention Program Over Longer-Term Follow-Up

    Science.gov (United States)

    Stice, Eric; Marti, C. Nathan; Rohde, Paul; Shaw, Heather

    2011-01-01

    Objective Test the hypothesis that reductions in thin-ideal internalization and body dissatisfaction mediate the effects of a dissonance-based eating disorder prevention program on reductions in eating disorder symptoms over 1-year follow-up. Method Data were drawn from a randomized effectiveness trial in which 306 female high school students (M age = 15.7 SD = 1.1) with body image concerns were randomized to the 4-session dissonance-based prevention program or an educational brochure control condition, wherein school counselors and nurses were responsible for participant recruitment and intervention delivery. Results Dissonance participants showed greater reductions in thin-ideal internalization, body dissatisfaction, and eating disorder symptoms; change in thin-ideal internalization predicted change in body dissatisfaction and symptoms; change in body dissatisfaction predicted change in symptoms; and all indirect effects were significant. Change in thin-ideal internalization fully mediated the effects of intervention condition on change in body dissatisfaction and partially mediated the effects on symptoms; change in body dissatisfaction partially mediated the effect of intervention condition on change in symptoms. Conclusions Findings provided support for the intervention theory of this eating disorder prevention program over longer-term follow-up, extending the evidence base for this effective intervention. PMID:21500884

  1. Community Unemployment and Disaster-Related Stressors Shape Risk for Posttraumatic Stress in the Longer-Term Aftermath of Hurricane Sandy.

    Science.gov (United States)

    Lowe, Sarah R; Sampson, Laura; Gruebner, Oliver; Galea, Sandro

    2016-10-01

    Persons living in communities with limited resources are at heightened risk of posttraumatic stress (PTS) after disasters, especially if they were highly exposed. The support deterrence desistence model and the conservation of resources theory suggest that this risk might increase in the longer-term aftermath of disasters. In the present study, we aimed to test this hypothesis. Two population-based samples of New York City residents in communities affected by Hurricane Sandy were surveyed at either 13-16 months (Time 1; n = 421) or 25-28 months (Time 2; n = 420) postdisaster. Participants reported on their exposure to disaster-related stressors and PTS. The percentage of residents who were unemployed in participants' census tracts was collected from the 2008-2012 American Community Survey. Multilevel models found that disaster-related stressors were more strongly associated with PTS for participants living in communities with high unemployment, but only at Time 2 (Est. = .58, SE = .21, p = .006). Mapping of community unemployment and disaster-related stressors suggested that communities in southern Brooklyn and Queens, and northeastern Staten Island were at particularly high risk for PTS at Time 2. The results suggest the need for ongoing support to economically disadvantaged communities in which residents have endured disaster-related stressors. Copyright © 2016 International Society for Traumatic Stress Studies.

  2. Beyond the crisis: building back better mental health care in 10 emergency-affected areas using a longer-term perspective.

    Science.gov (United States)

    Epping-Jordan, JoAnne E; van Ommeren, Mark; Ashour, Hazem Nayef; Maramis, Albert; Marini, Anita; Mohanraj, Andrew; Noori, Aqila; Rizwan, Humayun; Saeed, Khalid; Silove, Derrick; Suveendran, T; Urbina, Liliana; Ventevogel, Peter; Saxena, Shekhar

    2015-01-01

    Major gaps remain - especially in low- and middle-income countries - in the realization of comprehensive, community-based mental health care. One potentially important yet overlooked opportunity for accelerating mental health reform lies within emergency situations, such as armed conflicts or natural disasters. Despite their adverse impacts on affected populations' mental health and well being, emergencies also draw attention and resources to these issues and provide openings for mental health service development. Cases were considered if they represented a low- or middle-income country or territory affected by an emergency, were initiated between 2000 and 2010, succeeded in making changes to the mental health system, and were able to be documented by an expert involved directly with the case. Based on these criteria, 10 case examples from diverse emergency-affected settings were included: Afghanistan, Burundi, Indonesia (Aceh Province), Iraq, Jordan, Kosovo, occupied Palestinian territory, Somalia, Sri Lanka, and Timor-Leste. These cases demonstrate generally that emergency contexts can be tapped to make substantial and sustainable improvements in mental health systems. From these experiences, 10 common lessons learnt were identified on how to make this happen. These lessons include the importance of adopting a longer-term perspective for mental health reform from the outset, and focusing on system-wide reform that addresses both new-onset and pre-existing mental disorders. Global progress in mental health care would happen more quickly if, in every crisis, strategic efforts were made to convert short-term interest in mental health problems into momentum for mental health reform.

  3. Fasting and meal-stimulated residual beta cell function is positively associated with serum concentrations of proinflammatory cytokines and negatively associated with anti-inflammatory and regulatory cytokines in patients with longer term type 1 diabetes

    DEFF Research Database (Denmark)

    Pham, Minh-Long; Kolb, H; Battelino, T

    2013-01-01

    Cytokines may promote or inhibit disease progression in type 1 diabetes. We investigated whether systemic proinflammatory, anti-inflammatory and regulatory cytokines associated differently with fasting and meal-stimulated beta cell function in patients with longer term type 1 diabetes.......Cytokines may promote or inhibit disease progression in type 1 diabetes. We investigated whether systemic proinflammatory, anti-inflammatory and regulatory cytokines associated differently with fasting and meal-stimulated beta cell function in patients with longer term type 1 diabetes....

  4. Delayed hippocampal neuronal death in young gerbil following transient global cerebral ischemia is related to higher and longer-term expression of p63 in the ischemic hippocampus

    Directory of Open Access Journals (Sweden)

    Eun Joo Bae

    2015-01-01

    Full Text Available The tumor suppressor p63 is one of p53 family members and plays a vital role as a regulator of neuronal apoptosis in the development of the nervous system. However, the role of p63 in mature neuronal death has not been addressed yet. In this study, we first compared ischemia-induced effects on p63 expression in the hippocampal regions (CA1- 3 between the young and adult gerbils subjected to 5 minutes of transient global cerebral ischemia. Neuronal death in the hippocampal CA1 region of young gerbils was significantly slow compared with that in the adult gerbils after transient global cerebral ischemia. p63 immunoreactivity in the hippocampal CA1 pyramidal neurons in the sham-operated young group was significantly low compared with that in the sham-operated adult group. p63 immunoreactivity was apparently changed in ischemic hippocampal CA1 pyramidal neurons in both ischemia-operated young and adult groups. In the ischemia-operated adult groups, p63 immunoreactivity in the hippocampal CA1 pyramidal neurons was significantly decreased at 4 days post-ischemia; however, p63 immunoreactivity in the ischemia-operated young group was significantly higher than that in the ischemia-operated adult group. At 7 days post-ischemia, p63 immunoreactivity was decreased in the hippocampal CA1 pyramidal neurons in both ischemia-operated young and adult groups. Change patterns of p63 level in the hippocampal CA1 region of adult and young gerbils after ischemic damage were similar to those observed in the immunohistochemical results. These findings indicate that higher and longer-term expression of p63 in the hippocampal CA1 region of the young gerbils after ischemia/reperfusion may be related to more delayed neuronal death compared to that in the adults.

  5. The development of the Quality Indicator for Rehabilitative Care (QuIRC: a measure of best practice for facilities for people with longer term mental health problems

    Directory of Open Access Journals (Sweden)

    Visser Ellen

    2011-03-01

    Full Text Available Abstract Background Despite the progress over recent decades in developing community mental health services internationally, many people still receive treatment and care in institutional settings. Those most likely to reside longest in these facilities have the most complex mental health problems and are at most risk of potential abuses of care and exploitation. This study aimed to develop an international, standardised toolkit to assess the quality of care in longer term hospital and community based mental health units, including the degree to which human rights, social inclusion and autonomy are promoted. Method The domains of care included in the toolkit were identified from a systematic literature review, international expert Delphi exercise, and review of care standards in ten European countries. The draft toolkit comprised 154 questions for unit managers. Inter-rater reliability was tested in 202 units across ten countries at different stages of deinstitutionalisation and development of community mental health services. Exploratory factor analysis was used to corroborate the allocation of items to domains. Feedback from those using the toolkit was collected about its usefulness and ease of completion. Results The toolkit had excellent inter-rater reliability and few items with narrow spread of response. Unit managers found the content highly relevant and were able to complete it in around 90 minutes. Minimal refinement was required and the final version comprised 145 questions assessing seven domains of care. Conclusions Triangulation of qualitative and quantitative evidence directed the development of a robust and comprehensive international quality assessment toolkit for units in highly variable socioeconomic and political contexts.

  6. Acute and longer-term safety results from a pooled analysis of duloxetine studies for the treatment of children and adolescents with major depressive disorder.

    Science.gov (United States)

    Emslie, Graham J; Wells, Thomas G; Prakash, Apurva; Zhang, Qi; Pangallo, Beth A; Bangs, Mark E; March, John S

    2015-05-01

    To assess acute and longer-term safety of duloxetine in the treatment of children and adolescents with major depressive disorder (MDD), a pooled analysis of data from two completed randomized, double-blind, multicenter, phase 3, placebo- and active-controlled trials was undertaken. In these studies, neither duloxetine (investigational drug) nor fluoxetine (active control) demonstrated a statistically significant improvement compared with placebo on the primary efficacy measure. Patients ages 7-17 years with MDD as defined by the Diagnostic and Statistical Manual of Mental Disorders, 4th ed., Text Revision (DSM-IV-TR) received duloxetine (n=341), fluoxetine (n=234), or placebo (n=225) for 10 week acute and 26 week extended (duloxetine or fluoxetine only) treatments. Safety measures included treatment-emergent adverse events (TEAEs), the Columbia-Suicide Severity Rating Scale, vital signs, electrocardiograms, laboratory samples, and growth (height and weight) assessments. Significantly more patients discontinued because of adverse events during duloxetine (8.2%) treatment than during placebo (3.1%) treatment (p≤0.05). TEAEs in >10% of duloxetine-treated patients were headache and nausea. No completed suicides or deaths occurred. During acute treatment, 6.6% of duloxetine-, 8.0% of fluoxetine-, and 8.2% of placebo-treated patients had worsening suicidal ideation from baseline. Among patients initially randomized to duloxetine or fluoxetine who had suicidal ideation at study baseline, 81% of duloxetine- and 77% of fluoxetine-treated patients had improvements in suicidal ideation at end-point in the 36-week studies. Suicidal behavior occurred in two fluoxetine-treated patients and one placebo-treated patient during acute treatment, and in seven duloxetine-treated patients and one fluoxetine-treated patient during extended treatment. Duloxetine-treated patients had a mean pulse increase of ∼3 beats per minute, and mean blood pressure (both systolic and diastolic

  7. Accounting Systems for New Public Sector Undertakings ...

    African Journals Online (AJOL)

    Accounting Systems for New Public Sector Undertakings Management: A Case Study. ... African Journal of Finance and Management ... It concludes that the current accounting systems such as financial accounting, cost accounting and reporting systems are not suitable for the effective and efficient management.

  8. Working Longer in Good Health

    NARCIS (Netherlands)

    F.R.M. Leijten (Fenna)

    2015-01-01

    markdownabstractAbstract Due to an ageing society, an increasing retirement age, and high prevalence of chronic health problems among older persons, it is important to understand how older employees [with health problems] can work for longer and productively, often this is termed ‘sustainable

  9. JET joint undertaking. Annual report 1978

    International Nuclear Information System (INIS)

    1979-02-01

    This document is intended for information only and should not be used as a technical reference. After an introductive part on the controlled nuclear fusion research and an historical survey of the JET project, are presented: the JET joint undertaking (members of council and committee...) with its administration (finance, personnel, external relations), and the scientific and technical department with its divisions for systems (experimental, magnet, plasma, assembly, power supplies, control and data acquisition, and site and building). In appendix is described the Euratom fusion research programme

  10. Longer term impact of the mass media campaign to promote the Get Healthy Information and Coaching Service®: increasing the saliency of a new public health program.

    Science.gov (United States)

    O'Hara, Blythe J; Phongsavan, Philayrath; Gebel, Klaus; Banovic, Debbie; Buffett, Kym M; Bauman, Adrian E

    2014-11-01

    The Get Healthy Information and Coaching Service® (GHS) was introduced in New South Wales in February 2009. It used mass reach media advertising and direct mail and/or proactive marketing to recruit participants. This article reports on the long-term impact of the campaign on GHS participation from July 2011 to June 2012. A stand-alone population survey collected awareness, knowledge, and behavioral variables before the first advertising phase, (n = 1,544, August-September 2010), during the advertising period (n = 1,500, February-March 2011; n = 1,500, June-July 2011; n = 1,500, February 2012), and after the advertising period (n = 1,500, June-July 2012). GHS usage data (n = 6,095) were collated during July 2011-June 2012. Unprompted and prompted awareness of GHS mass media significantly increased (0% to 8.0%, p mass media as their referral source were significantly more likely to enroll in the intensive coaching program. Mass media campaigns remain an effective method of promoting a telephone-based statewide lifestyle program. © 2014 Society for Public Health Education.

  11. Short- and longer-term effects of feeding increased metabolizable protein with or without an altered amino acid profile to dairy cows immediately postpartum.

    Science.gov (United States)

    Carder, E G; Weiss, W P

    2017-06-01

    fed MPAA had the greatest plasma concentrations of Met and the lowest concentrations of isoleucine, but lysine was not affected by treatment. Feeding additional MP (HMP or MPAA) reduced the concentrations of 3-methylhistidine in plasma, indicating reduced muscle breakdown. Diet effects on milk composition continued after cows were changed to a common diet in that cows fed MPAA the first 3 wk of lactation had greater concentration of milk protein for the entire experiment than cows fed HMP, and cows fed additional MP (HMP and MPAA) during phase 1 had greater concentrations of milk fat for the entire experiment. Increasing dietary protein and AA supply in early lactation had short-term effects on yield of energy-corrected milk and long-term effects on milk composition. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. A Pragmatic Randomised, Controlled Trial of Intensive Care follow up programmes in improving Longer-term outcomes from critical illness. The PRACTICAL study

    Directory of Open Access Journals (Sweden)

    Ramsey Craig

    2007-07-01

    Full Text Available Abstract Background A number of intensive care (ICU patients experience significant problems with physical, psychological, and social functioning for some time after discharge from ICU. These problems have implications not just for patients, but impose a continuing financial burden for the National Health Service. To support recovery, a number of hospitals across the UK have developed Intensive Care follow-up clinics. However, there is a lack of evidence base to support these, and this study aims to test the hypothesis that intensive care follow up programmes are effective and cost-effective at improving physical and psychological quality of life in the year after intensive care discharge. Methods/Design This is a multi-centre, pragmatic, randomised controlled trial. Patients (n = 270 will be recruited prior to hospital discharge from three intensive care units in the UK, and randomised to one of two groups. The control group will receive standard in-hospital follow-up and the intervention group will participate in an ICU follow-up programme with clinic appointments 2–3 and 9 months after ICU discharge. The primary outcome measure is Health-related Quality of Life (HRQoL 12 months after ICU discharge as measured by the Short Form-36. Secondary measures include: HRQoL at six months; Quality-adjusted life years using EQ-5D; posttraumatic psychopathology as measured by Davidson Trauma Scale; and anxiety and depression using the Hospital Anxiety and Depression Scale at both six and twelve months after ICU discharge. Contacts with health services in the twelve months after ICU discharge will be measured as part of the economic analysis. Discussion The provision of intensive care follow-up clinics within the UK has developed in an ad hoc manner, is inconsistent in both the number of hospitals offering such a service or in the type of service offered. This study provides the opportunity to evaluate such services both in terms of patient benefit and

  13. Immediate and longer term impact of the varicella shortage on children 18 and 24 months of age in a community population

    Directory of Open Access Journals (Sweden)

    Zimmerman Rick

    2006-08-01

    rebounded quickly to above pre-shortage rates. In this community the only long term impact of the varicella vaccine shortage may be on the small number of children who still had not received catch-up varicella immunizations by 36 months of age.

  14. An undertaking planning game for the electricity supply industry

    International Nuclear Information System (INIS)

    Troescher, H.

    1977-01-01

    Planning games have been found satisfactory in many field in political and economic life. In particular the more convenient access to electronic calculators has made a contrinution to their wider use. It is therefore surprising that the first planning game which has become known for the electricity supply industry was first published in the year 1975. This is the planning game for the Bernischen Kraftwerke AG, which is based on a simplified model of a small electricity supply undertaking (EVU). This planning game was adapted in the RWE to the conditions in larger EVU and a few additional model components were added. Besides the general points of view on planning games for EVU the author deals with the extended planning game which is termed in the article PEW. (orig.) [de

  15. Does undertaking an intercalated BSc influence first clinical year exam results at a London medical school?

    Science.gov (United States)

    Howman, Mary; Jones, Melvyn

    2011-02-03

    Intercalated BScs (iBScs) are an optional part of the medical school curriculum in many Universities. Does undertaking an iBSc influence subsequent student performance? Previous studies addressing this question have been flawed by iBSc students being highly selected. This study looks at data from medical students where there is a compulsory iBSc for non-graduates. Our aim was to see whether there was any difference in performance between students who took an iBSc before or after their third year (first clinical year) exams. A multivariable analysis was performed to compare the third year results of students at one London medical school who had or had not completed their iBSc by the start of this year (n = 276). A general linear model was applied to adjust for differences between the two groups in terms of potential confounders (age, sex, nationality and baseline performance). The results of third year summative exams for 276 students were analysed (184 students with an iBSc and 92 without). Unadjusted analysis showed students who took an iBSc before their third year achieved significantly higher end of year marks than those who did not with a mean score difference of 4.4 (0.9 to 7.9 95% CI, p = 0.01). (overall mean score 238.4 "completed iBSc" students versus 234.0 "not completed", range 145.2 - 272.3 out of 300). There was however a significant difference between the two groups in their prior second year exam marks with those choosing to intercalate before their third year having higher marks. Adjusting for this, the difference in overall exam scores was no longer significant with a mean score difference of 1.4 (-4.9 to +7.7 95% CI, p = 0.66). (overall mean score 238.0 " completed iBSc" students versus 236.5 "not completed"). Once possible confounders are controlled for (age, sex, previous academic performance) undertaking an iBSc does not influence third year exam results. One explanation for this confounding in unadjusted results is that students who do better

  16. Jet Joint Undertaking. Annual report 1990

    International Nuclear Information System (INIS)

    1991-05-01

    The Joint European Torus is the largest project in the coordinated fusion programme of the European Atomic Energy Community (EURATOM). A brief general introduction provides an overview of the planning of the Report. This is followed by a description of JET and the Euratom and International Fusion Programmes, which summarize the main features of the JET apparatus and its experimental programme and explains the position of the Project in the overall Euratom programme. In addition, this relates and compares JET to other large fusion devices throughout the world. The following section reports on the technical status of the machine including: technical changes and achievements during 1989; details of the operational organization of experiments and pulse statistics; and progress on enhancements in machine systems for future operation. This is followed by the results of JET operations in 1990 under various operating conditions, including ohmic heating, radio-frequency (RF) heating, neutral beam (NB) heating and various combined scenarios in different magnetic field configurations; the overall global and local behaviour observed; and the progress towards reactor conditions. In particular, the comparative performance between JET and other tokamaks, in terms of the triple fusion product, shows the substantial achievements made by JET since the start of operations in 1983. The second part of the Report explains the organization and management of the Project and describes the administration of JET. In particular, it sets out the budget situation; contractual arrangements during 1990; and details of the staffing arrangements and complement

  17. Students Collaborating to Undertake Tracking Efforts for Sturgeon(SCUTES)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Students Collaborating to Undertake Tracking Efforts for Sturgeon (SCUTES) is a collaboration between NOAA Fisheries, sturgeon researchers, and teachers/educators in...

  18. Non-financial reporting, CSR frameworks and groups of undertakings

    DEFF Research Database (Denmark)

    Szabó, Dániel Gergely; Sørensen, Karsten Engsig

    2017-01-01

    The recently adopted Directive on non-financial reporting (Directive 2014/95/EU) and several CSR frameworks are based on the assumption that groups of undertakings adopt, report and implement one group policy. This is a very important but also rather unique approach to groups. This article first...

  19. Using an undertaker's data to assess changing patterns of mortality ...

    African Journals Online (AJOL)

    Key informant interviews were done to support the undertaker's data and determine how families bear the burden of burying deceased relatives. Despite a disproportionate increase in deaths in certain age categories and evidence of worsening poverty, funerals remain large and elaborate affairs. Keywords: AIDS, burial ...

  20. Original article Personality determinants of motivation to undertake vocational training

    Directory of Open Access Journals (Sweden)

    Dorota Godlewska-Werner

    2014-05-01

    Full Text Available Background Recently, at a time of frequent changes in the economic and socio-economic circumstances, knowledge acquired in the course of formal education is insufficient. Especially, the education system is still criticized for a lack of flexibility and strong resistance to change. Therefore, regular participation in various forms of training is required. Employee education and training are becoming an optimal answer to complex business challenges. The aim of this study was to determine which personality traits are responsible for the strength of motivation to undertake vocational training and other educational forms. Participants and procedure The study included 104 staff members of Polish companies (60 women and 44 men. The study used Cattell’s 16 PF Questionnaire and the scales of readiness to undertake training and further education as a measure of the strength of motivation (Kawecka, Łaguna & Tabor, 2010. Results The study showed that openness to change and tension (primary traits had the greatest impact on the intention and planning to take vocational training. Additionally, the intention and planning to take vocational training were found to be associated with mindedness, independence, self-control, and anxiety (secondary traits. Such traits as rule-consciousness [G], social-boldness [H], abstractedness [M], and apprehension [O] (primary traits, were important in some aspects, which could constitute a background for further research and discussion of the results. Conclusions The obtained results lead to the conclusion that some of the individual differences in personality determine the motivation to undertake vocational training.

  1. Changes in the functions of undertakings in electricity supply

    International Nuclear Information System (INIS)

    Oberlack, H.W.

    1976-01-01

    For the electricity supply industry also it is necessary, by means of more intensive publicity work, to achieve the general realisation that neither new laws nor intervention of the state are required for dealing in the interests of the consumer with the problems arising, from great changes in all fields of business enterprise. It is more important for the electricity supply undertakings (EVU), by means of executive power and the administration of justice, to be put a position to carry out in the most efficient manner the functions entrusted to them by the Federal Government under the Power Supply Law and the energy programme. (orig.) [de

  2. No Longer Have to Choose

    Science.gov (United States)

    Brown, H.; Ritchey, N. A.

    2017-12-01

    NOAA National Centers for Environmental Information (NCEI) once was three separate data centers (NGDC, NODC, and NCDC). In 2015 the three centers merged into NCEI. NCEI has refined the art of long term preservation and stewardship practices throughout the life-cycle of various types of data. NCEI can help you navigate and make the complicated world of preserving your data user-friendly. Using tools at NCEI, data providers can request data to be archived, submit data for archival and create complete International Organization for Standardization (ISO) metadata records with ease. To ensure traceability, Digital Object Identifiers (DOIs) are minted for published data sets. The services offered at NCEI follow standards and NOAA directives such as the Open Archival Information System (OAIS) - Reference Model (ISO 14721) to ensure consistent long-term preservation for the Nation's resource of global environmental data for a broad spectrum of users. The implementation of these standards supports the data to be accessible, independently understandable and reproducible in an easy to understand format for all types of users. Insights from combined knowledge of 100+years of various domain and data management and preservation and the tools supporting these functions will be shared.

  3. The exclusion of 'public undertakings' from the re-use of public sector information regime

    OpenAIRE

    Ricolfi, M.; Drexl, J.; van Eechoud, M.; Salmeron, M.; Sappa, C.; Tziavos, P.; Valero, J.; Pavoni, F.; Patrito, P.

    2011-01-01

    Should public undertakings be covered by the PSI Directive? The definitions of public sector bodies and bodies governed by public law, to which the PSI Directive applies, are currently taken from the public procurement Directives and public undertakings are not covered by these definitions. Should public undertakings be considered as public sector bodies in the meaning of the Directive? Are there public undertakings holding "interesting" PSI? Are there different definitions of national legisl...

  4. 42 CFR 137.165 - Are Self-Governance Tribes required to undertake annual audits?

    Science.gov (United States)

    2010-10-01

    ... Operational Provisions Audits and Cost Principles § 137.165 Are Self-Governance Tribes required to undertake...-Governance Tribes must undertake annual audits pursuant to the Single Audit Act, 31 U.S.C. 7501 et seq. ... 42 Public Health 1 2010-10-01 2010-10-01 false Are Self-Governance Tribes required to undertake...

  5. The capabilities and scope-of-practice requirements of advanced life support practitioners undertaking critical care transfers: A Delphi study

    Directory of Open Access Journals (Sweden)

    Monique Venter

    2016-11-01

    Full Text Available Background. Critical care transfers (CCT refer to the high level of care given during transport (via ambulance, helicopter or fixed-wing aircraft of patients who are of high acuity. In South Africa (SA, advanced life support (ALS paramedics undertake CCTs. The scope of ALS in SA has no extended protocol regarding procedures or medications in terms of dealing with these CCTs. Aim. The aim of this study was to obtain the opinions of several experts in fields pertaining to critical care and transport and to gain consensus on the skills and scope-of-practice requirements of paramedics undertaking CCTs in the SA setting. Methods. A modified Delphi study consisting of three rounds was undertaken using an online survey platform. A heterogeneous sample (n=7, consisting of specialists in the fields of anaesthesiology, emergency medicine, internal medicine, critical care, critical care transport and paediatrics, was asked to indicate whether, in their opinion, selected procedures and medications were needed within the scope of practice of paramedics undertaking CCTs. Results. After three rounds, consensus was obtained in 70% (57/81 of procedures and medications. Many of these items are not currently within the scope of paramedics’ training. The panel felt that paramedics undertaking these transfers should have additional postgraduate training that is specific to critical care. Conclusion. Major discrepancies exist between the current scope of paramedic practice and the suggested required scope of practice for CCTs. An extended scope of practice and additional training should be considered for these practitioners.

  6. Longer-term impact of cardiology e-consults.

    Science.gov (United States)

    Wasfy, Jason H; Rao, Sandhya K; Kalwani, Neil; Chittle, Melissa D; Richardson, Calvin A; Gallen, Kathleen M; Isselbacher, Eric M; Kimball, Alexandra B; Ferris, Timothy G

    2016-03-01

    Cardiac e-consults may be an effective way to deliver value-oriented outpatient cardiology care in an accountable care organization. Initial results of cardiac e-consults have demonstrated high satisfaction among both patients and referring providers, no known adverse events, and low rates of diagnostic testing. Nevertheless, differences between e-consults and traditional consults, effects of e-consults on traditional consult volume, and whether patients seek traditional consults after e-consults are unknown. We established a cardiac e-consult program on January 13, 2014. We then conducted detailed medical record reviews of all patients with e-consults to detect any adverse clinical events and detect subsequent traditional visits to cardiologists. We also performed 2 comparisons. First, we compared age, gender, and referral reason for e-consults vs traditional consults. Second, we compared changes in volume of referrals to cardiology vs other medical specialties that did not have e-consults. From January 13 to December 31, 2014, 1,642 traditional referrals and 165 e-consults were requested. The proportion of e-consults of all evaluations requested over that period was 9.1%. Gender balance was similar among traditional consults and e-consults (44.8% male for e-consults vs 45.0% for traditional consults, P = .981). E-consult patients were younger than traditional consult patients (55.3 vs 60.4 years, P cardiology visit during the follow-up period. E-consults are an effective and safe mechanism to enhance value in outpatient cardiology care, with low rates of bounceback to traditional consults. E-consults can account for nearly one-tenth of total outpatient consultation volume at 1 year within an accountable care organization and are associated with a reduction in traditional referrals to cardiologists. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Minimum Wage Effects in the Longer Run

    Science.gov (United States)

    Neumark, David; Nizalova, Olena

    2007-01-01

    Exposure to minimum wages at young ages could lead to adverse longer-run effects via decreased labor market experience and tenure, and diminished education and training, while beneficial longer-run effects could arise if minimum wages increase skill acquisition. Evidence suggests that as individuals reach their late 20s, they earn less the longer…

  8. Do benefits accrue from longer rotations for students in Rural Clinical Schools?

    Science.gov (United States)

    Denz-Penhey, Harriet; Shannon, Susan; Murdoch, Campbell J; Newbury, Jonathon W

    2005-01-01

    areas of need. Clinical benefits: contributions to the clinical team: students in their clinical years want to feel useful and to be allowed to become contributors to the medical care, even as they are learning. A longer rotation allows them to become known to their teachers who are then able to easily assess the type of contribution that is appropriate for their students to undertake. Students then become full participating members of the healthcare team, rather than observing learners. Social benefits: all students with a home base actively participated in a wide range of community activities outside their role as medical students. Those students undertaking short rotations without a home base seldom connected in the same way to any rural community. Evaluation from these two RCS has shown that short rotations are likely to be less optimal than longer rotations for meeting the broader goals of the RCS to build future workforce capacity. Our results suggest that one opportunity to acculturate students into the rural lifestyle is lost when students' placements are insufficiently long for them to put down roots in their community, and to understand how to 'live' there more broadly. Good rural experiences and teaching and learning opportunities are not sufficient in themselves. Students' emotional attachment to rural living comes from experience related to time and the connection to local people that comes as a result of time spent in the community. Students on short rotations do not make that local connection.

  9. Working longer in good health [Langer doorwerken in goede gezondheid

    NARCIS (Netherlands)

    Leijten, F.R.M

    2015-01-01

    Due to an ageing society, an increasing retirement age, and high prevalence of chronic health problems among older persons, it is important to understand how older employees [with health problems] can work for longer and productively, often this is termed ‘sustainable employability’. This context

  10. 12 CFR 980.2 - Limitation on Bank authority to undertake new business activities.

    Science.gov (United States)

    2010-01-01

    ... business activities. 980.2 Section 980.2 Banks and Banking FEDERAL HOUSING FINANCE BOARD NEW FEDERAL HOME LOAN BANK ACTIVITIES NEW BUSINESS ACTIVITIES § 980.2 Limitation on Bank authority to undertake new business activities. No Bank shall undertake any new business activity except in accordance with the...

  11. The exclusion of 'public undertakings' from the re-use of public sector information regime

    NARCIS (Netherlands)

    Ricolfi, M.; Drexl, J.; van Eechoud, M.; Salmeron, M.; Sappa, C.; Tziavos, P.; Valero, J.; Pavoni, F.; Patrito, P.

    2011-01-01

    Should public undertakings be covered by the PSI Directive? The definitions of public sector bodies and bodies governed by public law, to which the PSI Directive applies, are currently taken from the public procurement Directives and public undertakings are not covered by these definitions. Should

  12. Children’s Brain Development Benefits from Longer Gestation

    Directory of Open Access Journals (Sweden)

    Elysia Poggi Davis

    2011-02-01

    Full Text Available Disruptions to brain development associated with shortened gestation place individuals at risk for the development of behavioral and psychological dysfunction throughout the lifespan. The purpose of the present study was to determine if the benefit for brain development conferred by increased gestational length exists on a continuum across the gestational age spectrum among healthy children with a stable neonatal course. Neurodevelopment was evaluated with structural magnetic resonance imaging (MRI in 100 healthy right-handed six to ten year old children born between 28 and 41 gestational weeks with a stable neonatal course. Data indicate that a longer gestational period confers an advantage for neurodevelopment. Longer duration of gestation was associated with region-specific increases in grey matter density. Further, the benefit of longer gestation for brain development was present even when only full term infants were considered. These findings demonstrate that even modest decreases in the duration of gestation can exert profound and lasting effects on neurodevelopment for both term and preterm infants and may contribute to long-term risk for health and disease.

  13. An approach for longer lifetime MCFCs

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Masaru; Tatsumi, Masahiko; Hayano, Takuro [MCFC Research Association, Tokyo (Japan)] [and others

    1996-12-31

    For entering into commercialization of MCFC power plants in the beginning of the 21st century, we will devote to research for increasing lifetime as long as 40,000 hours with cell performance decay rate of 0.25 %/1000hrs as the target in FY 1999. This paper will discuss on our approach for longer lifetime MCFCs through electrolyte-loss management and NiO precipitation management as well as micro-structural control of electrodes and matrix plates. Cell voltage decay rate will be estimated by simulation through series of experiments on accelerated conditions.

  14. Atomic weights: no longer constants of nature

    Science.gov (United States)

    Coplen, Tyler B.; Holden, Norman E.

    2011-01-01

    Many of us were taught that the standard atomic weights we found in the back of our chemistry textbooks or on the Periodic Table of the Chemical Elements hanging on the wall of our chemistry classroom are constants of nature. This was common knowledge for more than a century and a half, but not anymore. The following text explains how advances in chemical instrumentation and isotopic analysis have changed the way we view atomic weights and why they are no longer constants of nature

  15. CONSIDERATIONS ON THE RULES ON COMPETITION GOVERNING UNDERTAKINGS IN THE EUROPEAN UNION

    Directory of Open Access Journals (Sweden)

    Vlad – Teodor Florea

    2014-11-01

    Full Text Available This study concerns the general rules on competition between undertakings in the EU. The author paid attention primarly to matters on the prohibition of agreements that aim to distort or impair competition on the internal market. Moreover, he examined in detail the matter concerning the regulation and interdiction of the abuse of a dominant position. The work also reviews doctrinal opinions, as well as the jurisprudential solutions in the area. The author’s concern to summarize and develop the conditions for the implementation of each of the two legal mechanisms is worth noting: the prohibition of agreements between undertakings and the abuse of a dominant position. The essential considerations taken into account by the Court of Justice of the European Union in settling a case whose subject consisted of assessing the manner in which an undertaking reflected on competition on the internal market were selected at the end of the work.

  16. Live Longer, Work Longer: Making It Happen in the Labor Market

    Directory of Open Access Journals (Sweden)

    Milan Vodopivec

    2008-03-01

    Full Text Available An aging population and the corresponding shrinkage of the labor force will create a significant drag on economic growth and may jeopardize the economic well-being of some of the elderly. Thus working longer is an imperative – but extending working lives has proven difficult, both because workers do not want to work longer and because employers are lukewarm about employing older workers. As measures that can be taken to motivate workers to work longer, the paper proposes providing retirement incentives and attractive, flexible working arrangements. To induce employers to hire old workers, it suggests removing the obstacles imposed by restrictive labor market institutions, an increase in the human capital of workers via life-long learning, and addressing age-discrimination. Chances for extending working lives will also increase as the health of elderly workers is improved.

  17. Therapeutic manuka honey: no longer so alternative

    Directory of Open Access Journals (Sweden)

    Dee A Carter

    2016-04-01

    Full Text Available Medicinal honey research is undergoing a substantial renaissance. From a folklore remedy largely dismissed by mainstream medicine as alternative, we now see increased interest by scientists, clinical practitioners and the general public in the therapeutic uses of honey. There are a number of drivers of this interest: first, the rise in antibiotic resistance by many bacterial pathogens has prompted interest in developing and using novel antibacterials; second, an increasing number of reliable studies and case reports have demonstrated that certain honeys are very effective wound treatments; third, therapeutic honey commands a premium price, and the honey industry is actively promoting studies that will allow it to capitalize on this; and finally, the very complex and rather unpredictable nature of honey provides an attractive challenge for laboratory scientists. In this paper we review manuka honey research, from observational studies on its antimicrobial effects through to current experimental and mechanistic work that aims to take honey into mainstream medicine. We outline current gaps and remaining controversies in our knowledge of how honey acts, and suggest new studies that could make honey a no longer alternative alternative.

  18. Therapeutic Manuka Honey: No Longer So Alternative

    Science.gov (United States)

    Carter, Dee A.; Blair, Shona E.; Cokcetin, Nural N.; Bouzo, Daniel; Brooks, Peter; Schothauer, Ralf; Harry, Elizabeth J.

    2016-01-01

    Medicinal honey research is undergoing a substantial renaissance. From a folklore remedy largely dismissed by mainstream medicine as “alternative”, we now see increased interest by scientists, clinical practitioners and the general public in the therapeutic uses of honey. There are a number of drivers of this interest: first, the rise in antibiotic resistance by many bacterial pathogens has prompted interest in developing and using novel antibacterials; second, an increasing number of reliable studies and case reports have demonstrated that certain honeys are very effective wound treatments; third, therapeutic honey commands a premium price, and the honey industry is actively promoting studies that will allow it to capitalize on this; and finally, the very complex and rather unpredictable nature of honey provides an attractive challenge for laboratory scientists. In this paper we review manuka honey research, from observational studies on its antimicrobial effects through to current experimental and mechanistic work that aims to take honey into mainstream medicine. We outline current gaps and remaining controversies in our knowledge of how honey acts, and suggest new studies that could make honey a no longer “alternative” alternative. PMID:27148246

  19. Who Assists the Faculty? The Need for Mentorship Programs for Faculty Undertaking Global Education Initiatives

    Science.gov (United States)

    Dean, Yasmin; London, Chad; Carston, Cathy; Salyers, Vincent

    2015-01-01

    This study explored the expectations, motivations, and experiences of Canadian faculty members undertaking development and implementation of global education initiatives (GEI) for students in the form of exchange and study abroad programs, supervised practical coursework, and experiential learning in international settings. Findings revealed that…

  20. The Complexities of Supporting Asian International Pre-Service Teachers as They Undertake Practicum

    Science.gov (United States)

    Spooner-Lane, Rebecca; Tangen, Donna; Campbell, Marilyn

    2009-01-01

    Increasing numbers of Asian international students are choosing to undertake their tertiary studies in English-speaking countries. For universities, international students are an important source of revenue. However, Asian international students face multiple challenges in adapting to a foreign culture, understanding the expectations of their…

  1. 31 CFR 248.5 - Exception to requirement of undertaking of indemnity Form 2244.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Exception to requirement of... POSSESSIONS Action to Be Taken by Claimants § 248.5 Exception to requirement of undertaking of indemnity Form... and agents, of and from any and all liability, loss, expense, claim, and demand whatsoever, arising in...

  2. Assisted reproductive technologies in Ghana : Transnational undertakings, local practices and ‘more affordable’ IVF

    NARCIS (Netherlands)

    Gerrits, T.

    The article sketches the origins and development of IVF in Ghana as a highly transnational undertaking. Movements are from and to Africa, involving human beings (providers and users), and also refer to other entities such as technologies, skills and knowledge. None of these movements are paid for

  3. Best practice in undertaking and reporting health technology assessments : Working Group 4 report

    OpenAIRE

    Busse, R.; Orvain, J.; Velasco, M.; Perleth, M.; Drummond, M.; Gurtner, F.; Jorgensen, T.; Jovell, A.; Malone, J.; Ruther, A; Wild, C.

    2002-01-01

    [Executive Summary] The aim of Working Group 4 has been to develop and disseminate best practice in undertaking and reporting assessments, and to identify needs for methodologic development. Health technology assessment (HTA) is a multidisciplinary activity that systematically examines the technical performance, safety, clinical efficacy, and effectiveness, cost, costeffectiveness, organizational implications, social consequences, legal, and ethical considerations of the application of a heal...

  4. Be my guest! Challenges and practical solutions of undertaking interviews with children in the home setting.

    Science.gov (United States)

    Coad, Jane; Gibson, Faith; Horstman, Maire; Milnes, Linda; Randall, Duncan; Carter, Bernie

    2015-12-01

    This article aims to share critical debate on undertaking interviews with children in the home setting and draws on the authors' extensive research fieldwork. The article focuses on three key processes: planning entry to the child's home, conducting the interviews and exiting the field. In planning entry, we include children's engagement and issues of researcher gender. In conducting the interviews, we consider issues such as the balance of power, the importance of building a rapport, the voluntary nature of consent and the need for a flexible interview structure. Finally, we address exiting from the child's home with sensitivity at the end of the interview and/or research study. Undertaking research in the child's home provides a known and familiar territory for the child, but it means that the researcher faces a number of challenges that require solutions whilst they are a guest in a child's home. © The Author(s) 2014.

  5. [Environmental licensing of major undertakings: possible connection between health and environment].

    Science.gov (United States)

    Silveira, Missifany; Araújo Neto, Mário Diniz de

    2014-09-01

    The prospect of multidisciplinary assessment that considers the environmental impacts on the health of the population during the implementation of potentially polluting projects is incipient in Brazil. Considering the scenario of major undertakings in the country, broadening the outlook on the health and environment relationship based on social and economic development processes striving for environmentally sustainable projects is a key strategy. This article examines the debate on the relationship between the current development model, the risks, the environment and health and discusses the importance of the participation of the health sector in the environmental licensing procedures, which is the instrument of the Environmental Impact Assessment (EIA). Seeking to create more environmentally and socially sustainable territories, the health sector has been looking for opportunities to participate in the licensing processes of major undertakings from the EIA standpoint. Results of research conducted by the Ministry of Health have demonstrated the form of participation in these processes, highlighting the strengths and weaknesses that favor or hinder the increase of preventive actions in public health in the implementation of major undertakings in Brazil.

  6. Researcher or nurse? Difficulties of undertaking semi-structured interviews on sensitive topics.

    Science.gov (United States)

    Ashton, Susan

    2014-09-01

    To reflect on the author's personal and professional journey when undertaking semi-structured interviews on sensitive topics with potentially vulnerable people. When discussing care at the end of life, researchers must accept that some participants may become distressed or emotional, depending on their previous experiences. Interviews that involve sensitive topics require careful planning. The semi-structured interviews were conducted as part of the author's PhD study examining the experiences of advance care planning among family caregivers of people with advanced dementia. A reflection on my personal and professional journey when undertaking semi-structured interviews on sensitive topics with potentially vulnerable people. The frustration and tragedy of dementia, as experienced by the family caregivers, were powerful and required the author to exert self-control to avoid being overly sympathetic and offering words of reassurance, agreement and comfort. This blurring of roles between researcher and nurse has implications for all nurse researchers who undertake qualitative interviews, particularly when an intense emotional response is likely. Nurse researchers should plan and prepare for potential blurring of roles during emotional interviews and should never automatically assume that they are sufficiently prepared as a result of their previous experience and nurse training.

  7. Exploring the role of social interactions and supports in overcoming accessibility barriers while undertaking health tours in India.

    Science.gov (United States)

    Jana, Arnab; Harata, Noboru; Kiyoshi, Takami; Ohmori, Nobuaki

    2014-01-01

    This article explores the phenomenon of companionship as an adaptation strategy to counter the existing barriers to health care access in developing nations. Companionship is argued to be an outcome of "inter" and "intra" household collaboration to offer diverse supports in addition to altruism. The analysis of the household survey conducted in West Bengal, India, exhibited different patterns of health care tours and the associated dependencies. In addition to support in terms of mobility while traveling and companionship while waiting for the opportunity, support in terms of refuge is also found to be essential, especially for the poor while they undertake regional tours. Causal models focusing on aggregated general health tours and specific regional tours were estimated separately to comprehend the implicit social interactions and their effects on the patient as well as the companions. The research demonstrated that accessibility barriers affect not only the ill, but also those associated with them and at times adversely. Segregation of regional tours illustrated the gaps, which instigated such tours and also might aid in health infrastructure planning as a whole.

  8. Who should be undertaking population-based surveys in humanitarian emergencies?

    Directory of Open Access Journals (Sweden)

    Spiegel Paul B

    2007-06-01

    Full Text Available Abstract Background Timely and accurate data are necessary to prioritise and effectively respond to humanitarian emergencies. 30-by-30 cluster surveys are commonly used in humanitarian emergencies because of their purported simplicity and reasonable validity and precision. Agencies have increasingly used 30-by-30 cluster surveys to undertake measurements beyond immunisation coverage and nutritional status. Methodological errors in cluster surveys have likely occurred for decades in humanitarian emergencies, often with unknown or unevaluated consequences. Discussion Most surveys in humanitarian emergencies are done by non-governmental organisations (NGOs. Some undertake good quality surveys while others have an already overburdened staff with limited epidemiological skills. Manuals explaining cluster survey methodology are available and in use. However, it is debatable as to whether using standardised, 'cookbook' survey methodologies are appropriate. Coordination of surveys is often lacking. If a coordinating body is established, as recommended, it is questionable whether it should have sole authority to release surveys due to insufficient independence. Donors should provide sufficient funding for personnel, training, and survey implementation, and not solely for direct programme implementation. Summary A dedicated corps of trained epidemiologists needs to be identified and made available to undertake surveys in humanitarian emergencies. NGOs in the field may need to form an alliance with certain specialised agencies or pool technically capable personnel. If NGOs continue to do surveys by themselves, a simple training manual with sample survey questionnaires, methodology, standardised files for data entry and analysis, and manual for interpretation should be developed and modified locally for each situation. At the beginning of an emergency, a central coordinating body should be established that has sufficient authority to set survey standards

  9. Fusion for Energy: The European joint undertaking for ITER and the development of fusion energy

    International Nuclear Information System (INIS)

    Diegele, E.

    2009-01-01

    Materials development in nuclear fusion for in-vessel components, i.e. for breeder blankets and divertors, has a history of more than two decades. It is the specific in-service and loading conditions and the consequentially required properties in combination with safety standards and social-economic demands that create a unique set of specifications. Objectives of Fusion for Energy (F4E) include: 1) To provide Europe's contribution to the ITER international fusion energy project; 2) To implement the Broader Approach agreement between Euratom and Japan; 3) To prepare for the construction and demonstration of fusion reactors (DEMO). Consequently, activities in F4E focus on structural materials for the first generations of breeder blankets, i.e. ITER Test Blanket Modules (TBM) and DEMO, whereas a Fusion Materials Topical Group implemented under EFDA coordinates R and D on physically based modelling of irradiation effects and R and D in the longer term (new and /or higher risk materials). The paper focuses on martensitic-ferritic steels and (i) reviews briefly the challenges and the rationales for the decisions taken in the past, (ii) analyses the status of the main activities of development and qualification, (iii) indicates unresolved issues, and (iv) outlines future strategies and needs and their implications. Due to the exposure to intense high energy neutron flux, the main issue for breeder materials is high radiation resistance. The First Wall of a breeder blanket should survive 3-5 full power years or, respectively in terms of irradiation damage, typically 50-70 dpa for DEMO and double figures for a power plant. Even though the objective is to have the materials and key fabrication technologies needed for DEMO fully developed and qualified within the next two decades, a major part of the task has to be completed much earlier. Tritium breeding test blanket modules will be installed in ITER with the objective to test DEMO relevant technologies in fusion

  10. Undertaking and writing research that is important, targeted, and the best you can do.

    Science.gov (United States)

    McLeod, Sharynne

    2014-04-01

    Conducting and writing research is a privilege. It is a privilege because researchers can change lives through their findings and can influence public knowledge and debate. It is also a privilege because researchers are reliant on the time and goodwill of participants (and colleagues), and research is often underpinned by funding raised by the public, either through taxes or philanthropic donations. This privilege comes with responsibility. Researchers have a responsibility to undertake research that is important, targeted, and of high quality. This editorial aims to inspire, challenge, and bolster the research efforts of individuals and teams.

  11. Benefits and barriers for registered nurses undertaking post-graduate diplomas in paediatric nursing.

    Science.gov (United States)

    Johnson, Anne; Copnell, Beverley

    2002-02-01

    This paper presents one aspect of a larger study identifying key influences on curriculum redesign and development of a post-graduate diploma in advanced clinical nursing. The focus is on paediatric intensive care and general paediatric streams. Data presented here relate to registered nurses' perceptions of benefits and barriers when undertaking this post-graduate diploma. As well as interviews and focus group discussions with a number of nurses, data were collected through a self-administered questionnaire, A total of 885 surveys were distributed to nurses working in paediatric areas in five hospitals in Victoria, Australia. Of these, 391 were completed (response rate 44%). One hundred and thirty (33%) had post-registration or post-graduate paediatric qualifications. Perceived benefits of undertaking the post-graduate diploma mainly related to an increase in knowledge and experience and improvement of employment opportunities. Perceived barriers mainly related to financial and professional issues such as cost of the course, loss of salary, the lack of direct remuneration on completion of the course and a lack of promotional opportunities. It was of concern that several nurses expressed a belief that paediatric qualifications were unnecessary and that many believed their employers did not value the qualification. Several recommendations are suggested to address the main barriers. These include more flexibility in the provision of such courses and opportunities for financial assistance. Copyright 2002, Elsevier Science Ltd. All rights reserved.

  12. Nurses on the move: evaluation of a program to assist international students undertaking an accelerated Bachelor of Nursing program.

    Science.gov (United States)

    Seibold, Carmel; Rolls, Colleen; Campbell, Michelle

    2007-01-01

    This paper reports on an evaluation of a Teaching and Learning Enhancement Scheme (TALES) program designed to meet the unique need of the 2005 cohort of international nursing students undertaking an accelerated Bachelor of Nursing (BN) program at the Victorian campus of Australian Catholic University (ACU) National. The program involved a team approach with three academic mentors and the international students working together to produce satisfactory learning outcomes through fortnightly meetings and provision of additional assistance including compiling a portfolio, reflective writing, English, including colloquial English and pronunciation, as well as familiarisation with handover and abbreviations common in the clinical field, general communication, assistance with preparing a resume and participation in simulated interviews. This relatively small group of international students (20) confirmed the findings of other studies from other countries of international nursing students' in terms of concerns in regard to studying in a foreign country, namely English proficiency, communication difficulties, cultural differences and unfamiliarity with the health care environment. The assistance provided by the program was identified by the completing students as invaluable in helping them settle into study and successfully complete the theoretical and clinical components of the course.

  13. Undertaking cause-specific mortality measurement in an unregistered population: an example from Tigray Region, Ethiopia.

    Science.gov (United States)

    Godefay, Hagos; Abrha, Atakelti; Kinsman, John; Myléus, Anna; Byass, Peter

    2014-01-01

    The lack of adequate documentation of deaths, and particularly their cause, is often noted in African and Asian settings, but practical solutions for addressing the problem are not always clear. Verbal autopsy methods (interviewing witnesses after a death) have developed rapidly, but there remains a lack of clarity as to how these methods can be effectively applied to large unregistered populations. This paper sets out practical details for undertaking a representative survey of cause-specific mortality in a population of several million, taking Tigray Region in Ethiopia as a prototype. Sampling was designed around an expected level of maternal mortality ratio of 400 per 100,000 live births, which needed measuring within a 95% confidence interval of approximately ±100. Taking a stratified cluster sample within the region at the district level for logistic reasons, and allowing for a design effect of 2, this required a population of around 900,000 people, equating to six typical districts. Since the region is administered in six geographic zones, one district per zone was randomly selected. The survey was implemented as a two-stage process: first, to trace deaths that occurred in the sampled districts within the preceding year, and second to follow them up with verbal autopsy interviews. The field work for both stages was undertaken by health extension workers, working in their normally assigned areas. Most of the work was associated with tracing the deaths, rather than undertaking the verbal autopsy interviews. This approach to measuring cause-specific mortality in an unregistered Ethiopian population proved to be feasible and effective. Although it falls short of the ideal situation of continuous civil registration and vital statistics, a survey-based strategy of this kind may prove to be a useful intermediate step on the road towards full civil registration and vital statistics implementation.

  14. Undertaking cause-specific mortality measurement in an unregistered population: an example from Tigray Region, Ethiopia

    Directory of Open Access Journals (Sweden)

    Hagos Godefay

    2014-09-01

    Full Text Available Background: The lack of adequate documentation of deaths, and particularly their cause, is often noted in African and Asian settings, but practical solutions for addressing the problem are not always clear. Verbal autopsy methods (interviewing witnesses after a death have developed rapidly, but there remains a lack of clarity as to how these methods can be effectively applied to large unregistered populations. This paper sets out practical details for undertaking a representative survey of cause-specific mortality in a population of several million, taking Tigray Region in Ethiopia as a prototype. Sampling: Sampling was designed around an expected level of maternal mortality ratio of 400 per 100,000 live births, which needed measuring within a 95% confidence interval of approximately ±100. Taking a stratified cluster sample within the region at the district level for logistic reasons, and allowing for a design effect of 2, this required a population of around 900,000 people, equating to six typical districts. Since the region is administered in six geographic zones, one district per zone was randomly selected. Implementation: The survey was implemented as a two-stage process: first, to trace deaths that occurred in the sampled districts within the preceding year, and second to follow them up with verbal autopsy interviews. The field work for both stages was undertaken by health extension workers, working in their normally assigned areas. Most of the work was associated with tracing the deaths, rather than undertaking the verbal autopsy interviews. Discussion: This approach to measuring cause-specific mortality in an unregistered Ethiopian population proved to be feasible and effective. Although it falls short of the ideal situation of continuous civil registration and vital statistics, a survey-based strategy of this kind may prove to be a useful intermediate step on the road towards full civil registration and vital statistics implementation.

  15. Big mice die young but large animals live longer

    Science.gov (United States)

    Blagosklonny, Mikhail V.

    2013-01-01

    It has been known for millennia that large animals live longer, inspiring numerous theories of aging. For example, elephants and humans live longer than mice, which in turn live longer than worms and flies. The correlation is not perfect, with many explainable exceptions, but it is still obvious. In contrast, within each species (e.g., mice and some other mammals) small body size is associated with longevity and slow aging. The concept that aging (and age-related diseases) is an aimless continuation of developmental growth, a hyperfunction driven by the same nutrient-sensing and growth-promoting pathways such as MTOR, may explain this longstanding paradox. PMID:23603822

  16. Education and Training: Is There Any Longer a Useful Distinction?

    Science.gov (United States)

    Hager, Paul; Laurent, John

    1990-01-01

    Although education and training were distinct concepts when Taylorism dominated the workplace, it is no longer appropriate to separate them. Today's highly competitive environment requires the education of a flexible, multiskilled workforce, not training for narrowly defined employment tasks. (SK)

  17. The economic efficiency of allowing longer combination vehicles in Texas.

    Science.gov (United States)

    2011-08-01

    This paper shows the economic efficiency of allowing longer combination vehicles in Texas. First, an : overview of the truck size and weight policies is explained, with an emphasis on those that affect : Texas. Next, LCV operations in other countries...

  18. An investigation in to the impact of acquisition location on error type and rate when undertaking panoramic radiography.

    Science.gov (United States)

    Loughlin, A; Drage, N; Greenall, C; Farnell, D J J

    2017-11-01

    Panoramic radiography is a common radiographic examination carried out in the UK. This study was carried out to determine if acquisition site has an impact on image quality. An image quality audit was carried out in South Wales across a number of dental and general radiology settings. The image quality was assessed retrospectively against national standards. A total of 174 radiographs were assessed from general radiology departments and 141 from dental radiology units. Chi-squared analysis was used to investigate whether there were differences in the grading between dental radiology units and general radiology departments. Differences between the two settings in terms of the number of errors in the radiographs was analysed using the Mann-Whitney test. Chi-squared analysis was used to see if there were differences between the types of errors in the two clinical settings. There was a significant association (p = 0.021) between the quality of the radiograph grading and type of radiology department. However when excellent and diagnostically acceptable radiographs were grouped together there was no significant difference between the two clinical settings. Although the vast majority of radiographs were diagnostic (89% for general radiology and 92% for dental radiology units), neither reached the required standards. The most common errors were patient positioning errors (54.6% radiographs affected) and preparation/instructional errors (47.9% radiographs affected). Errors in panoramic radiography are relatively high and further instruction to staff undertaking these procedures is required to ensure the targets are reached. Copyright © 2017 The College of Radiographers. Published by Elsevier Ltd. All rights reserved.

  19. Resumption of menstruation and pituitary response to gonadotropin-releasing hormone in functional hypothalamic amenorrhea subjects undertaking estrogen replacement therapy.

    Science.gov (United States)

    Shen, Z Q; Xu, J J; Lin, J F

    2013-11-01

    Functional hypothalamic amenorrhea (FHA) refers to a functional menstrual disorder with various causes and presentations. Recovery of menstrual cyclicity is common in long-term follow-up but the affecting factors remain unknown. To explore factors affecting the menstrual resumption and to evaluate the pituitary response to gonadotropin-releasing hormone (GnRH) in FHA. Thirty cases with FHA were recruited. All subjects were put on continuous 1 mg/day estradiol valerate orally and followed up monthly. Recovery was defined as the occurrence of at least three consecutive regular cycles. Responder referred to those who recovered within two years of therapy. Gonadotropin response to the 50 μg GnRH challenge was tested every three months. Nineteen (63.3%) subjects recovered with a mean time to recovery of 26.8 months. Time to recovery was negatively correlated with body mass index (BMI) before and by amenorrhea. Twentyone cases had undertaken therapy for more than two years and 10 of them recovered. BMI before and by amenorrhea were negatively correlated with the recovery. Significant increase of serum luteinizing hormone (LH) and LH response to GnRH were noted after recovery. Menstrual resumption was common in FHA undertaking estrogen replacement therapy (ERT). The likelihood of recovery was affected by their BMI before and by amenorrhea but not by the weight gain during therapy. Low serum LH and attenuated LH response to GnRH were the main features of pituitary deficiency in FHA. The menstrual resumption in FHA was accompanied by the recovery of serum LH and the LH response to GnRH.

  20. Vivências maternas associadas ao aleitamento materno exclusivo mais duradouro: um estudo etnográfico Vivencias de madres asociadas a la lactancia materna exclusiva más duradera: un estudio etnográfico Maternal experiences associated with longer term exclusive breastfeeding: an ethnographic study

    Directory of Open Access Journals (Sweden)

    Carolina Guizardi Polido

    2011-01-01

    . RESULTADOS: El amamantamiento se presentó como evento particular en los diferentes contextos de su ocurrencia, sin embargo fue posible identificar que la lactancia exclusiva estuvo ligado a la determinación materna, a pesar de las dificultades vividas. La lactancia materna exclusiva más duradera se relacionó a las madres que se mostraron motivadas con la práctica, concientes de sus beneficios y apoyadas por la familia, aun frente a la interferencia contraria de su medio cultural. CONCLUSIÓN: La ausencia de determinación materna para amamantar exclusivamente debe ser investigada y, cuando presente, recibir abordaje especial de los profesionales de salud.OBJECTIVE: To describe the experiences of breastfeeding mothers using the Unified Health System who were seeking to obtain knowledge, expectations, perceptions and feelings involved with identifying aspects relevant for more prolonged, exclusive breastfeeding. METHODS: A qualitative ethnographic study conducted with eight primiparas and family references, through observation and household interviews during the first semester of the infants' lives. The data were summarized in three categories: starting breastfeeding; experiencing the process of early weaning; maintaining exclusive breastfeeding. RESULTS: Breastfeeding appeared as a particular event in different contexts of occurrence, however, it was possible to identify that exclusive breastfeeding was linked to maternal determination, despite the difficulties experienced. Longer lasting exclusive breastfeeding was related to the mothers who were highly motivated to practice, those who were aware of its benefits and were supported by their family, even in the face of interference contrary to their culture. CONCLUSION: The lack of determination for exclusive maternal breastfeeding should be investigated and, when present, receive special consideration by health professionals.

  1. Technology transfer in the hydropower industry: An analysis of Chinese dam developers’ undertakings in Europe and Latin America

    NARCIS (Netherlands)

    Kirchherr, Julian; Matthews, Nathanial

    2018-01-01

    Technology transfer is essential for transitioning to a low carbon economy which can include hydropower. Chinese dam developers allegedly dominate the global hydropower industry. Studies have been carried out on technology transfer in their undertakings in Africa and Asia. However, such work is

  2. Revisiting Academic Capitalism in Canada: No Longer the Exception

    Science.gov (United States)

    Metcalfe, Amy Scott

    2010-01-01

    In "Academic Capitalism: Politics, Policies, and the Entrepreneurial University" (1997), Slaughter and Leslie found that Canada showed signs of resisting academic capitalism. Changes in postsecondary education funding policies and the emergence of new commercialization initiatives are evidence that Canada is certainly no longer, and…

  3. Subsurface ice structure analysis with longer wavelength sar tomography

    DEFF Research Database (Denmark)

    Banda, Francesco; Dall, Jørgen; Tebaldini, Stefano

    2013-01-01

    of longer wavelength SAR to retrieve information about ice flow and structure. In the present paper first results from processing of tomographic data for subsurface ice structure mapping are presented. The extent of signal penetration has been found to be of about 20-60 m, conditional on the different...

  4. Longer rest periods for intensive rotational grazing limit diet quality ...

    African Journals Online (AJOL)

    Longer rest periods for intensive rotational grazing limit diet quality of sheep without enhancing environmental benefits. ... This experiment was established to compare three intensive rotational grazing strategies (fast rotation [FR], average 57-day rest; slow rotation [SR], average 114-day rest; and flexible grazing [FX], based ...

  5. Non proliferation regimes undertakings: Benefits and limits of synergies in verification technologies and procedures

    International Nuclear Information System (INIS)

    Richard, M.

    2001-01-01

    Full text: Thirty years ago the NPT was entering into force. Therewith, when a State became party to the NPT, it had, in accordance with article III.1 of the Treaty, an undertaking to conclude a Comprehensive Safeguards agreement with the IAEA and accept safeguards verification on source or special fissionable material in all peaceful nuclear activities within its territories in order to verify that such material is not diverted. This multilateral instrument was the foundation stone of the non-proliferation regime and marked the actual birth of internationally accepted measures to verily compliance with politically stringent agreements. Since that time several important multilateral or bilateral instruments on non-proliferation and disarmament have been negotiated and adopted to curb the development and the acquisition of Weapons of Mass Destruction (WMD) most of them since the middle of the eighties and the collapse of the Soviet Union. Amongst the multilateral instruments are the Convention on the Prohibition of Bacteriological Weapon and Toxin Weapons (1972), the Convention on the Prohibition of Chemical Weapons (1993), the Comprehensive Test Ban Treaty (1996), the Strengthening of the IAEA Safeguards and the Additional Protocol (1997), with some still in negotiation like the Protocol of the Convention on the Prohibition of Bacteriological and Toxin Weapons, and some on which negotiation is still a wish like the Fissile Material Cut-off Treaty. Bilateral disarmament agreements between the United States of America and the Russian Federation such as the INF Treaty, START I and II, the agreements on the elimination of excess defence nuclear material as well as the Trilateral Initiative with the IAEA pave the way to nuclear disarmament with the reduction of both the number of nuclear weapons arsenal and the fissile material inventories. The politically stringent undertakings of States that have become parties to those agreements would not be possible without the

  6. Telomere length is longer in women with late maternal age

    DEFF Research Database (Denmark)

    Fagan, Erin; Sun, Fangui; Bae, Harold

    2017-01-01

    OBJECTIVE:: Maternal age at birth of last child has been associated with maternal longevity. The aim of this study was to determine whether older women with a history of late maternal age at last childbirth had a longer leukocyte telomere length than those with maternal age at last childbirth of 29...... years or less. METHODS:: A nested case control study was conducted using data from the Long Life Family Study. Three hundred eighty-seven women who gave birth to at least one child and lived to the top fifth percentile of their birth cohort, or died before the top fifth percentile of their birth cohort...... in the first tertile. CONCLUSIONS:: These findings show an association between longer leukocyte telomere length and a later maternal age at birth of last child, suggesting that extended maternal age at last childbirth may be a marker for longevity....

  7. Verifying compliance with nuclear non-proliferation undertakings: IAEA safeguards agreements and additional protocols

    International Nuclear Information System (INIS)

    2008-06-01

    This report provides background information on safeguards and explains procedures for States to conclude Additional Protocols to comprehensive Safeguards Agreements with the IAEA. Since the IAEA was founded in 1957, its safeguards system has been an indispensable component of the nuclear non-proliferation regime and has facilitated peaceful nuclear cooperation. In recognition of this, the Treaty on the Non-Proliferation of Nuclear Weapons (NPT) makes it mandatory for all non-nuclear-weapon States (NNWS) party to the Treaty to conclude comprehensive safeguards agreements with the IAEA, and thus allow for the application of safeguards to all their nuclear material. Under Article III of the NPT, all NNWS undertake to accept safeguards, as set forth in agreements to be negotiated and concluded with the IAEA, for the exclusive purpose of verification of the fulfilment of the States' obligations under the NPT. In May 1997, the IAEA Board of Governors approved the Model Additional Protocol to Safeguards Agreements (reproduced in INFCIRC/540(Corr.)) which provided for an additional legal authority. In States that have both a comprehensive safeguards agreement and an additional protocol in force, the IAEA is able to optimize the implementation of all safeguards measures available. In order to simplify certain procedures under comprehensive safeguards agreements for States with little or no nuclear material and no nuclear material in a facility, the IAEA began making available, in 1971, a 'small quantities protocol' (SQP), which held in abeyance the implementation of most of the detailed provisions of comprehensive safeguards agreements for so long as the State concerned satisfied these criteria. The safeguards system aims at detecting and deterring the diversion of nuclear material. Such material includes enriched uranium, plutonium and uranium-233, which could be used directly in nuclear weapons. It also includes natural uranium and depleted uranium, the latter of which is

  8. Strategy and issues for the LHC upgrades and fair, including longer-term prospects

    CERN Document Server

    Zimmermann, F

    2013-01-01

    This report discusses the time line, goals and key ingredients for the next ten years of LHC operation, including injector upgrade, for the following High Luminosity LHC (HL-LHC), and for the FAIR project. Results from pertinent EuCARD-WP4 workshops on optics, space charge, crab cavities, crystal collimation, and electron cloud are summarized in this context. A Large Hadron electron Collider, LHeC, would be an additional upgrade, further expanding the physics scope of the LHC, to eventually include both ep and γγ Higgs factories (LHeC-HF and SAPPHiRE). Results from relevant topical WP4 workshops are highlighted. The development of magnet and cable technology based on Nb3Sn, and HTS, for the HL-LHC prepares the ground for a future higher-energy hadron collider, either in the LHC tunnel, “HELHC” (33 TeV c.m.), or in a new 80- or 100-km tunnel, “VHE-LHC” (100 TeV c.m.). A large new tunnel could also host an ultimate highest-precision e+e- Higgs factory collider, “TLEP,” exhibiting many synergies an...

  9. Bio-energy trade. Possibilities and constraints on short and longer term

    International Nuclear Information System (INIS)

    Agterberg, A.E.; Faaij, A.P.C.

    1998-12-01

    In order to get more in-depth insight in matters concerning trading biomass, the so called Biotrade project was initiated in 1996 when the Netherlands began to consider biomass import as a serious CO2 mitigation option after initial and relatively promising studies had been carried out. Sweden on the other side, with a well developed infrastructure for both biomass supply and utilisation, showed interest to supply biomass to the Dutch energy system. This resulted into a Dutch-Swedish project team financed by the ALTENER programme of DG-12 of the European Commission and co-financed by Novem (Netherlands Organisation for Energy and Environment) and NUTEK (Swedish National board for Industrial and Technical Development). The main objectives of the Biotrade project were: (a) to provide insight m the various possibilities for trade in bio-energy by evaluation of the (micro- and macro) economics and energy balances of various options by a standardised methodology; (b) working out bio-energy trade between Sweden and The Netherlands and for comparison export from the Baltic region and one of the FACE countries (FACE is the foundation of the Dutch electric power generation board Sep, involved in forestation projects for CO2 mitigation); (c) Comparison of the bio-energy trade options to domestic use of the biomass in the exporting country and to afforestation; and (d) Provide policy recommendations. Countries considered for export of energy from biomass to the Netherlands are Sweden, Estonia, and Ecuador. The following import options were considered: (a) Import of woody biomass and conversion to electricity of this biomass in the Netherlands; (b) Conversion to electricity of biomass in the exporting country and import of this electricity by the Netherlands; and (c) Use of the biomass as feedstock for methanol production in the exporting country and import of this methanol by the Netherlands. The following aspects are included in the analysis: (1) Costs of electricity or methanol from foreign biomass in the Netherlands (in ECUct/kWh or in ECU/GJ MeOH); (2) Energy balances and CO2 emissions; (3) CO2 emission avoidance costs (in ECU/tonne avoided CO2 emission); (4) Macro-economic effects (employment and value added). The import options are compared to afforestation in Ecuador and use of the biomass in the exporting countries itself as CO2 mitigation options. 67 refs

  10. Knowledge of oral cancer, distress and screening intentions: longer term effects of a patient information leaflet.

    Science.gov (United States)

    Boundouki, George; Humphris, Gerry; Field, Anne

    2004-04-01

    Study aim was to determine the influence of a patient information leaflet (PIL) on mouth cancer to improve knowledge, reduce distress and increase intention to accept a mouth screen over a 2-month period. The design was a randomised controlled trial. Two dental practices in the northwest of England participated. Standardised multi-item scales of the three outcome measures were employed. The PIL was given to a randomised intervention group of patients in waiting room. Single sheet questionnaire was completed by both groups of patients at baseline in waiting room (immediately following leaflet administration in intervention arm of study). Repeat questionnaire completion at 8 weeks by all patients through postal system. Mann-Whitney U-tests comparing outcome variables between patients with and without access to the leaflet at baseline and 8 weeks were performed. Multiple logistic regression was used to predict re-reading of the leaflet at home. Useable replies were received from 317 patients (60% response rate). All measures showed some benefit of immediate exposure to the leaflet at follow up. Older patients, less initial knowledge, and self-reported smoking positively predicted the re-reading of the leaflet. The introduction of a mouth cancer PIL into dental practice may help to inform patients about oral cancer, moderate distress and encourage acceptance of an oral health screen.

  11. International Forum for Reactor Aging Management (IFRAM): Progress in cooperation to promote longer term operations (LTO)

    International Nuclear Information System (INIS)

    Shoji, T.; Bond, L.J.; Brenchley, D.L.; Carpenter, C.E.; Hwang, I.S.; Martin, O.; Reister, R.; Tilley, R.

    2012-01-01

    The vision and goals for the International Forum for Reactor Aging Management (IFRAM) are an organization that will complement existing networks and provide the framework to facilitate the appropriate exchange of information among those parties and organizations around the world that are presently addressing, or are planning to address, issues of nuclear power plant systems, structures and components aging management. This paper will provide a status report on IFRAM and a summary of the inaugural meeting, and discuss activities and plans for the path forward. (author)

  12. The longer-term effects of Roux-en-Y gastric bypass surgery on sodium excretion

    NARCIS (Netherlands)

    Celik, Funda; Ahdi, Mohamed; Meesters, Eelco W.; van de Laar, Arnold; Brandjes, Dees P. M.; Gerdes, Victor E. A.

    2013-01-01

    Obesity is an independent risk factor for hypertension and chronic kidney disease. During the first months after bariatric surgery, an improvement of sodium excretion has been described. The aim of this work was to study the influence of bariatric surgery on sodium excretion at more than a year

  13. Longer-term Baerveldt to Trabectome glaucoma surgery comparison using propensity score matching.

    Science.gov (United States)

    Kostanyan, Tigran; Shazly, Tarek; Kaplowitz, Kevin B; Wang, Steven Z; Kola, Sushma; Brown, Eric N; Loewen, Nils A

    2017-12-01

    To apply propensity score matching to compare Baerveldt glaucoma drainage implant (BGI) to Trabectome-mediated ab interno trabeculectomy (AIT). Recent data suggests that AIT can produce results similar to BGI which is traditionally reserved for more severe glaucoma. BGI and AIT patients with at least 1 year of follow-up were included. The primary outcome measures were intraocular pressure (IOP), number of glaucoma medications, and a Glaucoma Index (GI) score. GI reflected glaucoma severity based on visual field, the number of preoperative medications, and preoperative IOP. Score matching used a genetic algorithm consisting of age, gender, type of glaucoma, concurrent phacoemulsification, baseline number of medications, and baseline IOP. Patients with neovascular glaucoma, with prior glaucoma surgery, or without a close match were excluded. Of 353 patients, 30 AIT patients were matched to 29 BGI patients. Baseline characteristics including, IOP, the number of glaucoma medications, type of glaucoma, the degree of VF loss and GI were not significantly different between AIT and BGI. BGI had a preoperative IOP of 21.6 ± 6.3 mmHg compared to 21.5 ± 7.4 for AIT on 2.8 ± 1.1 medications and 2.5 ± 2.3 respectively. At 30 months, the mean IOP was 15.0 ± 3.9 mmHg for AIT versus 15.0 ± 5.7 mmHg for BGI (p > 0.05), while the number of drops was 1.5 ± 1.3 for AIT (change: p = 0.001) versus 2.4 ± 1.2 for BGI (change: p = 0.17; AIT vs BGI: 0.007). Success, defined as IOP  0.05) and 50% versus 52% at 2.5 years. A propensity score matched comparison of AIT and BGI demonstrated a similar IOP reduction through 1 year. AIT required fewer medications.

  14. Longer Term Impact of Cigarette Package Warnings in Australia Compared with the United Kingdom and Canada

    Science.gov (United States)

    Li, Lin; Borland, Ron; Yong, Hua; Cummings, Kenneth M.; Thrasher, James F.; Hitchman, Sara C.; Fong, Geoffrey T.; Hammond, David; Bansal-Travers, Maansi

    2015-01-01

    This study examines the effects of different cigarette package warnings in Australia, Canada and the United Kingdom up to 5 years post-implementation. The data came from the International Tobacco Control Surveys. Measures included salience of warnings, cognitive responses, forgoing cigarettes and avoiding warnings. Although salience of the UK…

  15. Results of a Longer Term NDACC Measurements Comparison Campaign at Mauna Loa Observatory

    Directory of Open Access Journals (Sweden)

    McGee Thomas J.

    2016-01-01

    Full Text Available Between November, 2015 and January, 2015, the Goddard Space Flight Center operated a pair of lidar instruments at the NOAA facility at Mauna Loa on the Big Island of Hawaii (Lat. 19.5N, Lon. 155.5 W, Altitude 3.397 km. Measurements were made during six different four week periods during this time period by both the NASA GSFC Stratospheric Ozone Lidar (STROZ and the Aerosol and Temperature (ATL lidar. Also making measurements were the JPL Stratospheric Ozone Lidar and the NOAA Aerosol and Water Vapor Lidar. All instruments participate and archive data with the Network for the Detection of Atmospheric Composition Change. Measurement comparisons were made among various instruments in accordance with the standard intercomparison protocols of the NDACC.

  16. No Longer "Catholic, White and Gaelic": Schools in Ireland Coming to Terms with Cultural Diversity

    Science.gov (United States)

    Parker-Jenkins, Marie; Masterson, Mary

    2013-01-01

    Irish society has experienced unprecedented demographic change since the turn of the twenty-first century, and increasingly, educators are facing the prospect of having to respond to the changing nature of cultural diversity in their classrooms. Traditionally characterised as"Catholic, white and Gaelic", Irish schools are said to be…

  17. Behavioural Climate Change Mitigation Options and Their Appropriate Inclusion in Quantitative Longer Term Policy Scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Faber, J.; Schroten, A.; Bles, M.; Sevenster, M.; Markowska, A.; Smit, M. [CE Delft, Delft (Netherlands); Rohde, C.; Duetschke, E.; Koehler, J.; Gigli, M. [Fraunhofer Institute for Systems and Innovation Research ISI, Karlsruhe (Germany); Zimmermann, K.; Soboh, R.; Van ' t Riet, J. [Landbouw Economisch Instituut LEI, Wageningen (Netherlands)

    2012-01-15

    Changes in consumer behaviour can lead to major reductions in greenhouse gas emissions in the European Union, particularly in the areas of transport, housing and food. Behavioural changes can complement technological changes and can allow emission reduction targets to be achieved more cost-effectively overall. The study identifies 36 options for behavioural change that would cut greenhouse gas emissions. Of these, 11 particularly relevant options have been studied in detail. They include shifting to a more healthy and balanced diet, eating less meat and dairy products, buying and using a smaller car or an electric car, teleworking, adjusting room temperature and optimising ventilation. For each of the behavioural changes studied in depth, emission reduction potentials have been quantified for 2020, 2030 and 2050. The study identifies barriers to implementing the changes, and quantifies the likely effects of policy packages which could overcome these barriers. The results show that the behavioural changes that could take place simultaneously have the potential to save emissions totalling up to about 600 million tonnes of CO2-equivalent a year in 2020. This is about one-quarter of the projected annual emissions from sectors not covered by the EU emissions trading system. The savings potential is particularly high in the area of food.

  18. Farmers Prone to Drought Risk: Why Some Farmers Undertake Farm-Level Risk-Reduction Measures While Others Not?

    Science.gov (United States)

    Gebrehiwot, Tagel; van der Veen, Anne

    2015-03-01

    This research investigates farmers' cognitive perceptions of risk and the behavioral intentions to undertake farm-level risk-reduction measures. It has been observed that people who are susceptible to natural hazards often fail to act, or do very little, to protect their assets or lives. To answer the question of why some people show adaptive behavior while others do not, a socio-psychological model of precautionary adaptation based on protection motivation theory and trans-theoretical stage model has been applied for the first time to areas of drought risk in the developing countries cultural context. The applicability of the integrated model is explored by means of a representative sample survey of smallholder farmers in northern Ethiopia. The result of the study showed that there is a statistically significant association between farmer's behavioral intention to undertake farm-level risk-reduction measures and the main important protection motivation model variables. High perceived vulnerability, severity of consequences, self-efficacy, and response efficacy lead to higher levels of behavioral intentions to undertake farm-level risk-reduction measures. For farmers in the action stage, self-efficacy and response efficacy were the main motivators of behavioral intention. For farmers in the contemplative stage, self-efficacy and cost appear to be the main motivators for them to act upon risk reduction, while perceived severity of consequences and cost of response actions were found to be important for farmers in the pre-contemplative stage.

  19. Sexual intimacy in couples is associated with longer telomere length.

    Science.gov (United States)

    Cabeza de Baca, Tomás; Epel, Elissa S; Robles, Theodore F; Coccia, Michael; Gilbert, Amanda; Puterman, Eli; Prather, Aric A

    2017-07-01

    High-quality relationships have been shown to be beneficial for physical and mental health. This study examined overall relationship satisfaction and perceived stress as well as daily reports of partner support, partner conflict, and physical intimacy obtained over the course of one week in a sample of 129 high and low stress mothers. Telomere length was examined in whole blood, as well as the two cell subpopulations: peripheral blood mononuclear cells (PBMCs) and granulocytes. Telomerase activity was measured in PBMCs. Analyses revealed no statistically significant associations of telomere length with current relationship satisfaction, daily support or conflict, or perceived stress. In contrast, women who reported any sexual intimacy during the course of the week had significantly longer telomeres measured in whole blood and PBMCs, but not in granulocytes. These relationships held covarying for age, body mass index, perceived stress, the relationship indices, and caregiver status. Sexual intimacy was not significantly related to PBMC telomerase activity. These data provide preliminary data that sexual intimacy is associated with longer telomere length. Future studies investigating these associations are warranted. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Narratives of Choice amongst white Australians who undertake Surrogacy Arrangements in India.

    Science.gov (United States)

    Riggs, Damien W

    2016-09-01

    This paper reports on a rhetorical analysis of interviews with fifteen white Australian citizens who had undertaken offshore commercial surrogacy in India. Extending previous research, the findings suggest that genetic relatedness was valorized, and surrogacy constructed as a less tenuous route to family formation. The paper concludes with a discussion of the need for further research on 1) how the contentious nature of offshore commercial surrogacy may prevent full consideration of its ethical implications, 2) the differing belief systems between India and Australia in terms of children as alienable objects, and 3) ongoing consideration of how and when genetic-relatedness is made to matter.

  1. Trend changes in global greening and browning: Contribution of short-term trends to longer-term change

    NARCIS (Netherlands)

    Jong, de R.; Verbesselt, J.; Schaepman, M.E.; Bruin, de S.

    2012-01-01

    Field observations and time series of vegetation greenness data from satellites provide evidence of changes in terrestrial vegetation activity over the past decades for several regions in the world. Changes in vegetation greenness over time may consist of an alternating sequence of greening and/or

  2. Identifying potential academic leaders: Predictors of willingness to undertake leadership roles in an academic department of family medicine.

    Science.gov (United States)

    White, David; Krueger, Paul; Meaney, Christopher; Antao, Viola; Kim, Florence; Kwong, Jeffrey C

    2016-02-01

    To identify variables associated with willingness to undertake leadership roles among academic family medicine faculty. Web-based survey. Bivariate and multivariable analyses (logistic regression) were used to identify variables associated with willingness to undertake leadership roles. Department of Family and Community Medicine at the University of Toronto in Ontario. A total of 687 faculty members. Variables related to respondents' willingness to take on various academic leadership roles. Of all 1029 faculty members invited to participate in the survey, 687 (66.8%) members responded. Of the respondents, 596 (86.8%) indicated their level of willingness to take on various academic leadership roles. Multivariable analysis revealed that the predictors associated with willingness to take on leadership roles were as follows: pursuit of professional development opportunities (odds ratio [OR] 3.79, 95% CI 2.29 to 6.27); currently holding at least 1 leadership role (OR 5.37, 95% CI 3.38 to 8.53); a history of leadership training (OR 1.86, 95% CI 1.25 to 2.78); the perception that mentorship is important for one's current role (OR 2.25, 95% CI 1.40 to 3.60); and younger age (OR 0.97, 95% CI 0.95 to 0.99). Willingness to undertake new or additional leadership roles was associated with 2 variables related to leadership experiences, 2 variables related to perceptions of mentorship and professional development, and 1 demographic variable (younger age). Interventions that support opportunities in these areas might expand the pool and strengthen the academic leadership potential of faculty members.

  3. Decree No. 67/77 of 6 May establishing a National Uranium Undertaking as a public body

    International Nuclear Information System (INIS)

    1977-01-01

    This Decree, promulgated on 29 March 1977, sets up a National Uranium Undertaking (ENU). The ENU Statute which is attached to the Decree lays down that its main purpose is to prospect for and inventory uranium deposits, to explore known deposits, to set up facilities for recovery and treatment of uranium ores, and finally, to market the products obtained. The ENU has taken over the work which, until now, had been carried out in that field by the Junta de Energia Nuclear and it is placed under the authority of the Minister of Industry and Technology. (NEA) [fr

  4. Avalanching Systems with Longer Range Connectivity: Occurrence of a Crossover Phenomenon and Multifractal Finite Size Scaling

    Directory of Open Access Journals (Sweden)

    Simone Benella

    2017-07-01

    Full Text Available Many out-of-equilibrium systems respond to external driving with nonlinear and self-similar dynamics. This near scale-invariant behavior of relaxation events has been modeled through sand pile cellular automata. However, a common feature of these models is the assumption of a local connectivity, while in many real systems, we have evidence for longer range connectivity and a complex topology of the interacting structures. Here, we investigate the role that longer range connectivity might play in near scale-invariant systems, by analyzing the results of a sand pile cellular automaton model on a Newman–Watts network. The analysis clearly indicates the occurrence of a crossover phenomenon in the statistics of the relaxation events as a function of the percentage of longer range links and the breaking of the simple Finite Size Scaling (FSS. The more complex nature of the dynamics in the presence of long-range connectivity is investigated in terms of multi-scaling features and analyzed by the Rank-Ordered Multifractal Analysis (ROMA.

  5. Living Longer in Mexico: Income Security and Health.

    Science.gov (United States)

    Aguila, Emma; Diaz, Claudia; Fu, Mary Manqing; Kapteyn, Arie; Pierson, Ashley

    2012-01-01

    This analysis of aging and income security in Mexico establishes that the older population in Mexico is increasing quickly and that this population is especially vulnerable to poverty. Mexican citizens are living longer and overall have experienced an improvement in the quality of life compared to that of prior generations. However, this study demonstrates that social improvements are not affecting the daily lives of all persons equally. The authors attempt to uncover and highlight those differences. One of the primary challenges facing Mexico is a growing older population. The demographic transition in Mexico combined with the lack of formal sources of income in retirement place many older persons in a state of financial insecurity. The information contained in this study and the proposed policy research areas are intended to enlarge the portfolio of options for older Mexicans. The authors analyze wealth and sources of income during retirement, the relationship between health and wealth, urban and rural disparities, and the impact of migration spells to the United States on wealth accumulation and health insurance in Mexico.

  6. Larger Stimuli Require Longer Processing Time for Perception.

    Science.gov (United States)

    Kanai, Ryota; Dalmaijer, Edwin S; Sherman, Maxine T; Kawakita, Genji; Paffen, Chris L E

    2017-05-01

    The time it takes for a stimulus to reach awareness is often assessed by measuring reaction times (RTs) or by a temporal order judgement (TOJ) task in which perceived timing is compared against a reference stimulus. Dissociations of RT and TOJ have been reported earlier in which increases in stimulus intensity such as luminance intensity results in a decrease of RT, whereas perceived perceptual latency in a TOJ task is affected to a lesser degree. Here, we report that a simple manipulation of stimulus size has stronger effects on perceptual latency measured by TOJ than on motor latency measured by RT tasks. When participants were asked to respond to the appearance of a simple stimulus such as a luminance blob, the perceptual latency measured against a standard reference stimulus was up to 40 ms longer for a larger stimulus. In other words, the smaller stimulus was perceived to occur earlier than the larger one. RT on the other hand was hardly affected by size. The TOJ results were further replicated in a simultaneity judgement task, suggesting that the effects of size are not due to TOJ-specific response biases but more likely reflect an effect on perceived timing.

  7. [Diabetic neuropathy: therapeutic nihilism is no longer acceptable].

    Science.gov (United States)

    Haslbeck, Manfred

    2007-05-21

    The repeatedly expressed doubts about the value of an effective therapy for diabetic neuropathies are no longer acceptable. Today a number of excellent longitudinal and cross-sectional studies, i.e. DCCT, Steno 2, DCCT/EDIC, European Diabetes Prospective Complications Study, are available. The attending physician should make every effort to diagnose diabetic neuropathies as soon as possible with all their multivarious manifestations. Treatment must be promptly, aggressively and multifactorially as described in evidence-based guidelines. In principle, the same risk factors apply to neuropathy in type 1 and type 2 diabetes as for macro-angiopathy and microangiopathy. Therapy focuses on establishing near-normal diabetes and blood pressure control, lipid management, intensive patient education, avoidance of exogenous noxae such as alcohol and nicotine and if necessary, an effective therapy of neuropathic pain. The objective of all diagnostic and preventive efforts must be always to avoid the development of the diabetic neuropathic foot syndrome, which is the most important end stage of somatic and autonomic diabetic neuropathy.

  8. Taking a Longer View: Processes of Curriculum Development in the ...

    African Journals Online (AJOL)

    http://dx.doi.org/10.14426/cristal.v1i1.6 · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL · News. OTHER RESOURCES... for Researchers · for Journals · for Authors · for Policy Makers ...

  9. Achieving more frequent and longer dialysis for the majority: wearable dialysis and implantable artificial kidney devices.

    Science.gov (United States)

    Fissell, William H; Roy, Shuvo; Davenport, Andrew

    2013-08-01

    The long-term survival for many chronic kidney failure patients who remain treated by dialysis in economically advanced countries remains similar to that of those with solid-organ malignancy, despite a disproportionate amount of health-care expenditure. As such, the current paradigm of three times weekly in-center hemodialysis for 4 h or shorter sessions needs to change to improve patient outcomes. Although more frequent and longer dialysis sessions have been reported to improve cardiovascular risk surrogates and short-term outcomes, these options are only practically available to a very small fraction of the total dialysis population. As such, radically new approaches are required to improve patient outcomes and quality of life for the majority of dialysis patients. Currently, two different approaches are being developed, wearable devices based on current dialysis techniques and more futuristic implantable devices modeled on the natural nephron.

  10. What factors influence community-dwelling older people’s intent to undertake multifactorial fall prevention programs?

    Directory of Open Access Journals (Sweden)

    Hill KD

    2014-11-01

    Full Text Available Keith D Hill,1,2 Lesley Day,3 Terry P Haines4,5 1School of Physiotherapy and Exercise Science, Faculty of Health Sciences, Curtin University, Perth, WA, Australia; 2National Ageing Research Institute, Royal Melbourne Hospital, Parkville, VIC, Australia; 3Falls Prevention Research Unit, Monash Injury Research Institute, Monash University, VIC, Australia; 4Allied Health Research Unit, Southern Health, Cheltenham, VIC, Australia; 5Physiotherapy Department, Faculty of Medicine, Nursing, and Health Sciences, Monash University, VIC, Australia Purpose: To investigate previous, current, or planned participation in, and perceptions toward, multifactorial fall prevention programs such as those delivered through a falls clinic in the community setting, and to identify factors influencing older people’s intent to undertake these interventions.Design and methods: Community-dwelling people aged >70 years completed a telephone survey. Participants were randomly selected from an electronic residential telephone listing, but purposeful sampling was used to include equal numbers with and without common chronic health conditions associated with fall-related hospitalization. The survey included scenarios for fall prevention interventions, including assessment/multifactorial interventions, such as those delivered through a falls clinic. Participants were asked about previous exposure to, or intent to participate in, the interventions. A path model analysis was used to identify factors associated with intent to participate in assessment/multifactorial interventions.Results: Thirty of 376 participants (8.0% reported exposure to a multifactorial falls clinic-type intervention in the past 5 years, and 16.0% expressed intention to undertake this intervention. Of the 132 participants who reported one or more falls in the past 12 months, over one-third were undecided or disagreed that a falls clinic type of intervention would be of benefit to them. Four elements

  11. Chronic Idiopathic Urticaria (CIU) is no longer idiopathic

    DEFF Research Database (Denmark)

    Maurer, M; Bindslev-Jensen, C; Gimenez-Arnau, A

    2013-01-01

    During recent years our knowledge of the aetiology and pathogenesis of urticaria has advanced considerably allowing us to better characterize urticaria subtypes. However, although the classification of urticaria has undergone some revisions during this time (1), authors still use different names...... for the same type of urticaria, which has implications for comparing study outcomes and drug licensing. Consequently, there is an urgent need for a harmonized and universally accepted nomenclature and classification of urticaria and to avoid the routine use of the outdated aetiological term, chronic idiopathic...... urticaria (CIU)....

  12. Do longer consultations improve the management of psychological problems in general practice? A systematic literature review

    Directory of Open Access Journals (Sweden)

    Hutton Catherine

    2007-05-01

    Full Text Available Abstract Background Psychological problems present a huge burden of illness in our community and GPs are the main providers of care. There is evidence that longer consultations in general practice are associated with improved quality of care; but this needs to be balanced against the fact that doctor time is a limited resource and longer consultations may lead to reduced access to health care. The aim of this research was to conduct a systematic literature review to determine whether management of psychological problems in general practice is associated with an increased consultation length and to explore whether longer consultations are associated with better health outcomes for patients with psychological problems. Methods A search was conducted on Medline (Ovid databases up to7 June 2006. The following search terms, were used: general practice or primary health care (free text or family practice (MeSH AND consultation length or duration (free text or time factors (MeSH AND depression or psychological problems or depressed (free text. A similar search was done in Web of Science, Pubmed, Google Scholar, and Cochrane Library and no other papers were found. Studies were included if they contained data comparing consultation length and management or detection of psychological problems in a general practice or primary health care setting. The studies were read and categories developed to enable systematic data extraction and synthesis. Results 29 papers met the inclusion criteria. Consultations with a recorded diagnosis of a psychological problem were reported to be longer than those with no recorded psychological diagnosis. It is not clear if this is related to the extra time or the consultation style. GPs reported that time pressure is a major barrier to treating depression. There was some evidence that increased consultation length is associated with more accurate diagnosis of psychological problems. Conclusion Further research is needed to

  13. Identification of Preferred Sources of Information for Undertaking Studies in the Faculty of Engineering Management at Poznan University of Technology

    Directory of Open Access Journals (Sweden)

    Magdalena Wyrwicka

    2015-06-01

    Full Text Available Since 2010 a survey has been conducted among first-year students about sources of information which influence the decision of undertaking field studies in Safety Engineering, Management Engineering and Logistics in the Faculty of Engineering Management at Poznan University of Technology. The goal of these analyses is both to assess the effectiveness of promotion and also show trends in the use of diverse channels of information transfer of studies. The results of the investigation show that internet promotion via university and faculty website plays the dominant role but also direct promotion, such as opinion of older friends, is crucial. Furthermore, from year to year the analyses indicate the significant increase of official media and reveal that the prospective students rely on a few sources of information simultaneously.

  14. Look at longer lives as a good thing, not a burden

    DEFF Research Database (Denmark)

    Vaupel, James W.; Schwentker, Björn

    2011-01-01

    People in most countries are living longer and longer. Indeed, the rise in life expectancy is seen as a major looming social and economic problem. But is it?......People in most countries are living longer and longer. Indeed, the rise in life expectancy is seen as a major looming social and economic problem. But is it?...

  15. JET Joint Undertaking

    International Nuclear Information System (INIS)

    Keen, B.E.; Kupschus, P.

    1984-09-01

    The report is in sections, as follows. (1) Introduction and summary. (2) A brief description of the origins of the JET Project within the EURATOM fusion programme and the objectives and aims of the device. The basic JET design and the overall philosophy of operation are explained and the first six months of operation of the machine are summarised. The Project Team Structure adopted for the Operation Phase is set out. Finally, in order to set JET's progress in context, other large tokamaks throughout the world and their achievements are briefly described. (3) The activities and progress within the Operation and Development Department are set out; particularly relating to its responsibilities for the operation and maintenance of the tokamak and for developing the necessary engineering equipment to enhance the machine to full performance. (4) The activities and progress within the Scientific Department are described; particularly relating to the specification, procurement and operation of diagnostic equipment; definition and execution of the programme; and the interpretation of experimental results. (5) JET's programme plans for the immediate future and a broad outline of the JET Development Plan to 1990 are given. (author)

  16. JET Joint Undertaking

    International Nuclear Information System (INIS)

    Keen, B.E.

    1988-03-01

    The paper is a JET progress report 1987, and covers the fourth full year of JET's operation. The report contains an overview summary of the scientific and technical advances during the year, and is supplemented by appendices of detailed contributions of the more important JET articles published during 1987. The document is aimed at specialists and experts engaged in nuclear fusion and plasma physics, as well as the general scientific community. (U.K.)

  17. JET Joint Undertaking

    International Nuclear Information System (INIS)

    Keen, B.E.

    1986-03-01

    This is an overview summary of the scientific and technical advances at JET during the year 1985, supplemented by appendices of detailed contributions (in preprint form) of eight of the more important JET articles produced during that year. It is aimed not only at specialists and experts but also at a more general scientific community. Thus there is a brief summary of the background to the project, a description of the basic objectives of JET and the principle design features of the machine. The new structure of the Project Team is also explained. Developments and future plans are included. Improvements considered are those which are designed to overcome certain limitations encountered generally on Tokamaks, particularly those concerned with density limits, with plasma MHD behaviour, with impurities and with plasma transport. There is also a complete list of articles, reports and conference papers published in 1985 - there are 167 such items listed. (UK)

  18. JET joint undertaking

    International Nuclear Information System (INIS)

    1984-06-01

    JET began operations on 25 June 1983. This annual report contains administrative information and a general review of scientific and technical developments. Among them are vacuum systems, toroidal and poloidal field systems, power supplies, neutral beam heating, radiofrequency heating, remote handling, tritium handling, control and data acquisition systems and diagnostic systems

  19. Introducing Polyautoimmunity: Secondary Autoimmune Diseases No Longer Exist

    Science.gov (United States)

    Rojas-Villarraga, Adriana; Amaya-Amaya, Jenny; Rodriguez-Rodriguez, Alberto; Mantilla, Rubén D.; Anaya, Juan-Manuel

    2012-01-01

    Similar pathophysiological mechanisms within autoimmune diseases have stimulated searches for common genetic roots. Polyautoimmunity is defined as the presence of more than one autoimmune disease in a single patient. When three or more autoimmune diseases coexist, this condition is called multiple autoimmune syndrome (MAS). We analyzed the presence of polyautoimmunity in 1,083 patients belonging to four autoimmune disease cohorts. Polyautoimmunity was observed in 373 patients (34.4%). Autoimmune thyroid disease (AITD) and Sjögren's syndrome (SS) were the most frequent diseases encountered. Factors significantly associated with polyautoimmunity were female gender and familial autoimmunity. Through a systematic literature review, an updated search was done for all MAS cases (January 2006–September 2011). There were 142 articles retrieved corresponding to 226 cases. Next, we performed a clustering analysis in which AITD followed by systemic lupus erythematosus and SS were the most hierarchical diseases encountered. Our results indicate that coexistence of autoimmune diseases is not uncommon and follows a grouping pattern. Polyautoimmunity is the term proposed for this association of disorders, which encompasses the concept of a common origin for these diseases. PMID:22454759

  20. Coalbed methane and tight gas no longer unconventional resources

    International Nuclear Information System (INIS)

    Gatens, M.

    2006-01-01

    Unconventional gas refers to natural gas contained in difficult-to-produce formations that require special drilling and completion techniques to achieve commercial production. It includes tight gas, coal seams, organic shales, and gas hydrates. Canada's vast unconventional gas resource is becoming an increasingly important part of the country's gas supply. The emergence of unconventional gas production in Canada over the past several years has made the unconventional increasingly conventional in terms of industry activity. It was suggested that in order to realize the potential for unconventional gas in Canada, all stakeholders should engage to ensure the development is environmentally responsible. Unconventional gas accounts for nearly one third of U.S. gas production. It also accounts for nearly 5 Bcf per day and growing. The impetus to this sudden growth has been the gradual and increasing contribution of tight sands and limes to Canadian production, which accounts for more than 4 Bcf per day. Coalbed methane (CBM) is at 0.5 Bcf per day and growing. In response to expectations that CBM will reach 2 to 3 Bcf per day over the next 2 decades, Canadian producers are placing more emphasis on unconventional resource plays, including organic shales and gas hydrates. As such, significant growth of unconventional gas is anticipated. This growth will be facilitated by the adoption of U.S..-developed technologies and new Canadian technologies. It was suggested that research and development will be key to unlocking the unconventional gas potential. It was also suggested that the already existing, strong regulatory structure should continue in order to accommodate this growth in a sustainable manner. figs

  1. Hydroxychloroquine Use in Lupus Patients during Pregnancy Is Associated with Longer Pregnancy Duration in Preterm Births

    Directory of Open Access Journals (Sweden)

    S. J. Kroese

    2017-01-01

    Full Text Available Objective. To investigate the effect of hydroxychloroquine (HCQ in pregnant women with systemic lupus erythematosus (SLE. Methods. In SLE pregnancies of a single Dutch center (2000–2015, lupus activity and flares before and during pregnancy and postpartum were assessed using the SLE Disease Activity Index (SLEDAI/SLEPDAI (SLEDAI adjusted for pregnancy. The association between HCQ use and pregnancy outcomes (early spontaneous abortion, fetal death, and preterm and term live birth was analyzed using generalized estimating equations (GEE accounting for the occurrence of multiple pregnancies per patient. Analyses were adjusted for antiphospholipid antibody (aPL status. Results. 110 pregnancies (63 mostly Caucasian patients were included, of which, in 30, HCQ was used; overall occurrence of flares was low (non-HCQ group: 5 mild (6.4% and 2 severe (2.6%; HCQ group: 2 mild (6.7% and no severe flares. The HCQ group showed a trend towards lower dosage of prednisone (OR 0.2 (95% CI 0.0–1.4; p=0.10. Pregnancy outcomes were comparable between groups. Among preterm live births, pregnancy duration was significantly longer in HCQ users (2.4 weeks (95% CI 1.0–3.8; p≤0.001. Conclusion. HCQ use was associated with longer pregnancy duration in the vulnerable preterm birth population, underscoring the beneficial effect of HCQ use during pregnancy.

  2. Do Cervical Cancer Patients Diagnosed with Opportunistic Screening Live Longer? An Arkhangelsk Cancer Registry Study

    Science.gov (United States)

    Roik, Elena E.; Nieboer, Evert; Kharkova, Olga A.; Grjibovski, Andrej M.; Odland, Jon Ø.

    2017-01-01

    The aim of the current study was to compare cervical cancer (СС) patients diagnosed with and without screening in terms of: (i) sociodemographic and clinical characteristics; (ii) factors associated with survival; and (iii), and levels of risk. A registry-based study was conducted using data from the Arkhangelsk Cancer Registry. It included women with newly diagnosed malignant neoplasm of the uterine cervix during the period of 1 January 2005 to 11 November 2016 (N = 1548). The Kaplan-Meier method, the log-rank test, and Cox regression were applied. Most participants who were diagnosed by screening were at stage I and died less frequently from CC than those diagnosed without screening. The latter group was also diagnosed with СС at a younger age and died younger. Younger individuals and urban residents diagnosed with stage I and II, squamous cell carcinoma had longer survival times. Cox regression modeling indicated that the hazard ratio for death among women with CC diagnosed without screening was 1.61 (unadjusted) and 1.37 (adjusted). CC diagnosed by screening, cancer stage, patient residence, histological tumor type, and age at diagnosis were independent prognostic variables of longer survival time with CC. Diagnosis of CC made within a screening program improved survival. PMID:29186874

  3. Do Cervical Cancer Patients Diagnosed with Opportunistic Screening Live Longer? An Arkhangelsk Cancer Registry Study

    Directory of Open Access Journals (Sweden)

    Elena E. Roik

    2017-11-01

    Full Text Available The aim of the current study was to compare cervical cancer (СС patients diagnosed with and without screening in terms of: (i sociodemographic and clinical characteristics; (ii factors associated with survival; and (iii, and levels of risk. A registry-based study was conducted using data from the Arkhangelsk Cancer Registry. It included women with newly diagnosed malignant neoplasm of the uterine cervix during the period of 1 January 2005 to 11 November 2016 (N = 1548. The Kaplan-Meier method, the log-rank test, and Cox regression were applied. Most participants who were diagnosed by screening were at stage I and died less frequently from CC than those diagnosed without screening. The latter group was also diagnosed with СС at a younger age and died younger. Younger individuals and urban residents diagnosed with stage I and II, squamous cell carcinoma had longer survival times. Cox regression modeling indicated that the hazard ratio for death among women with CC diagnosed without screening was 1.61 (unadjusted and 1.37 (adjusted. CC diagnosed by screening, cancer stage, patient residence, histological tumor type, and age at diagnosis were independent prognostic variables of longer survival time with CC. Diagnosis of CC made within a screening program improved survival.

  4. Working (longer than) 9 to 5: are there cardiometabolic health risks for young Australian workers who report longer than 38-h working weeks?

    Science.gov (United States)

    Reynolds, Amy C; Bucks, Romola S; Paterson, Jessica L; Ferguson, Sally A; Mori, Trevor A; McArdle, Nigel; Straker, Leon; Beilin, Lawrence J; Eastwood, Peter R

    2018-05-01

    The average Australian working week in middle-aged and older workers exceeds government recommendations. Long working weeks are associated with poor health outcomes; however, the relationship between long working weeks and health in young Australian workers is unknown. Data were drawn from the 22-year follow-up of the Western Australian Pregnancy Cohort (Raine) Study in Perth, Western Australia. Information was available from 873 young adults about working hours per week, shift work and sleep duration. Blood samples provided measures of cardiometabolic risk (CMR) factors. Almost one-third (32.8%) of young workers reported > 38 h working weeks. This was commonly reported in mining and construction industries for males; health and social assistance, mining and retail trade industries for females. CMR factors including increased waist circumference, higher fasting plasma glucose and reduced HDL cholesterol were associated with > 38 h working weeks. These relationships were not moderated by gender or by BMI for glucose and HDL cholesterol. Total sleep time was significantly lower in both male and female workers reporting > 38 h working weeks, but did not mediate the relationships seen with CMR factors. These findings point to early associations between > 38 h working weeks and CMR risk, and highlight the potential benefit of making young employees aware of the health associations with working arrangements to reduce the longer-term relationships seen with working hours and poor cardiometabolic health in population studies.

  5. The protective effect of longer duration of breastfeeding against pregnancy-associated triple negative breast cancer.

    Science.gov (United States)

    ElShamy, Wael M

    2016-08-16

    Parity associated breast cancer (PABC) often diagnosed within the 2-5 years after a full term pregnancy. PABC is usually present with more advanced, poorly differentiated, high-grade cancers that show shorter time to progression and often of the triple negative breast cancer (TNBC) subtype. Data from around the world show that pregnancy-associated TNBC is independently associated with poor survival, underscoring the impact of the pregnant breast microenvironment on the biology and consequently the prognosis of these tumors. Although it is not yet clear, a link between pregnancy-associated TNBCs and lack or shorter duration of breastfeeding (not pregnancy per se) has been proposed. Here, we present epidemiological and experimental evidence for the protective effect of longer duration of lactation against pregnancy-associated TNBCs, and propose a putative molecular mechanism for this protective effect and its effect in eliminating any potential TNBC precursors from the breast by the end of the natural breast involution.

  6. Changing Zaire to Congo: the fate of no-longer relevant mnemonic information.

    Science.gov (United States)

    Eriksson, Johan; Stiernstedt, Mikael; Öhlund, Maria; Nyberg, Lars

    2014-11-01

    In an ever-changing world there is constant pressure on revising long-term memory, such when people or countries change name. What happens to the old, pre-existing information? One possibility is that old associations gradually are weakened and eventually lost. Alternatively, old and no longer relevant information may still be an integral part of memory traces. To test the hypothesis that old mnemonic information still becomes activated when people correctly retrieve new, currently relevant information, brain activity was measured with fMRI while participants performed a cued-retrieval task. Paired associates (symbol-sound and symbol-face pairs) were first learned during two days. Half of the associations were then updated during the next two days, followed by fMRI scanning on day 5 and also 18 months later. As expected, retrieval reactivated sensory cortex related to the most recently learned association (visual cortex for symbol-face pairs, auditory cortex for symbol-sound pairs). Critically, retrieval also reactivated sensory cortex related to the no-longer relevant associate. Eighteen months later, only non-updated symbol-face associations were intact. Intriguingly, a subset of the updated associations was now treated as though the original association had taken over, in that memory performance was significantly worse than chance and that activity in sensory cortex for the original but not the updated associate correlated (negatively) with performance. Moreover, the degree of "residual" reactivation during day 5 inversely predicted memory performance 18 months later. Thus, updating of long-term memory involves adding new information to already existing networks, in which old information can stay resilient for a long time. Copyright © 2014. Published by Elsevier Inc.

  7. The Level of Anxiety and Depression in Dialysis Patients Undertaking Regular Physical Exercise Training--a Preliminary Study.

    Science.gov (United States)

    Dziubek, Wioletta; Kowalska, Joanna; Kusztal, Mariusz; Rogowski, Łukasz; Gołębiowski, Tomasz; Nikifur, Małgorzata; Szczepańska-Gieracha, Joanna; Zembroń-Łacny, Agnieszka; Klinger, Marian; Woźniewski, Marek

    2016-01-01

    The aim of the study was to evaluate the effects of a six-month physical training undertaken by haemodialysis (HD) patients, on the depression and anxiety. Patients with end stage renal disease (ESRD) were recruited from the dialysis station at the Department of Nephrology and Transplantation Medicine in Wroclaw. Physical training took place at the beginning of the first 4-hours of dialysis, three times a week for six months. A personal questionnaire, Beck Depression Inventory (BDI) and State-Trait Anxiety Inventory (STAI) were used in the study. A total of 28 patients completed the study: 20 were randomised to endurance training and 8 were randomised to resistance training. Statistical analysis of depression and anxiety at the initial (t1) and final examination (t2) indicated a significant reduction in depression and anxiety, particularly anxiety as a trait (X2) in the whole study group. The change in anxiety as a state correlated with the disease duration, duration of dialysis and the initial level of anxiety as a state (t1X1). The change in anxiety as a trait significantly correlated with age and the initial level of anxiety (t1X2). Undertaking physical training during dialysis by patients with ESRD is beneficial in reducing their levels of anxiety and depression. Both resistance and endurance training improves mood, but only endurance training additionally results in anxiety reduction. © 2016 S. Karger AG, Basel.

  8. Effects of Periodic Task-Specific Test Feedback on Physical Performance in Older Adults Undertaking Band-Based Resistance Exercise

    Directory of Open Access Journals (Sweden)

    Ryuichi Hasegawa

    2014-01-01

    Full Text Available The purpose of this study was to determine the effects of periodic task-specific test feedback on performance improvement in older adults undertaking community- and home-based resistance exercises (CHBRE. Fifty-two older adults (65–83 years were assigned to a muscular perfsormance feedback group (MPG, n=32 or a functional mobility feedback group (FMG, n=20. Both groups received exactly the same 9-week CHBRE program comprising one community-based and two home-based sessions per week. Muscle performance included arm curls and chair stands in 30 seconds, while functional mobility was determined by the timed up and go (TUG test. MPG received fortnightly test feedback only on muscle performance and FMG received feedback only on the TUG. Following training, there was a significant (P<0.05 interaction for all performance tests with MPG improving more for the arm curls (MPG 31.4%, FMG 15.9% and chair stands (MPG 33.7%, FMG 24.9% while FMG improved more for the TUG (MPG-3.5%, FMG-9.7%. Results from this nonrandomized study suggest that periodic test feedback during resistance training may enhance task-specific physical performance in older persons, thereby augmenting reserve capacity or potentially reducing the time required to recover functional abilities.

  9. Bio-based Industries Joint Undertaking: The catalyst for sustainable bio-based economic growth in Europe.

    Science.gov (United States)

    Mengal, Philippe; Wubbolts, Marcel; Zika, Eleni; Ruiz, Ana; Brigitta, Dieter; Pieniadz, Agata; Black, Sarah

    2018-01-25

    This article discusses the preparation, structure and objectives of the Bio-based Industries Joint Undertaking (BBI JU). BBI JU is a public-private partnership (PPP) between the European Commission (EC) and the Bio-based Industries Consortium (BIC), the industry-led private not-for-profit organisation representing the private sectors across the bio-based industries. The model of the public-private partnership has been successful as a new approach to supporting research and innovation and de-risking investment in Europe. The BBI JU became a reality in 2014 and represents the largest industrial and economic cooperation endeavour financially ever undertaken in Europe in the area of industrial biotechnologies. It is considered to be one of the most forward-looking initiatives under Horizon 2020 and demonstrates the circular economy in action. The BBI JU will be the catalyst for this strategy to mobilise actors across Europe including large industry, small and medium-sized enterprises (SMEs), all types of research organisations, networks and universities. It will support regions and in doing so, the European Union Member States and associated countries in the implementation of their bioeconomy strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. DETERMINATION OF THE URGENCY OF UNDERTAKING LAND CONSOLIDATION WORKS IN THE VILLAGES OF THE SŁAWNO MUNICIPALITY

    Directory of Open Access Journals (Sweden)

    Przemysław Leń

    2016-09-01

    Full Text Available The object of the paper is to analyze the spatial structure of land and identification of the needs of consolidation works and exchange of land in the villages of the Sławno municipality, lying in the district of Opoczno, in the Łódzkie Voivodship. The authors use the method of zero unitarisation for the purposes of determining the order of undertaking consolidation works and exchange of land in the area of research. The basis for calculation is the database of 19 factors (x1–x19 characteristic for the listed five groups of issues, describing each of the following villages. The obtained results, in a form of synthetic meter for each village, allowed creating the hierarchy of the urgency of carrying out consolidation works. The problem of excessive fragmentation of farms, constituting the collections of a certain number of parcels, in a broader sense, is one of the elements that prevent the acceleration of reforms by conversion of the Land and Buildings Register (EGiB in a full valuable real estate cadastre in Poland. The importance of the problem is highlighted by the fact that there are ecological grounds in the study area, significant from the point of view of environmental protection.

  11. Chinese Anti-Cancer Association as a non-governmental organization undertakes systematic cancer prevention work in China

    Science.gov (United States)

    2015-01-01

    Cancer has become the first leading cause of death in the world, particularly in low- and middle-income countries. Facing the increasing trend of cancer incidence and mortality, China issued and implemented “three-early (early prevention, early diagnosis and early treatment)” national cancer prevention plan. As the main body and dependence of social governance, non-governmental organizations (NGOs) take over the role of government in the field of cancer prevention and treatment. American Cancer Society (ACS) made a research on cancer NGOs and civil society in cancer control and found that cancer NGOs in developing countries mobilize civil society to work together and advocate governments in their countries to develop policies to address the growing cancer burden. Union for International Cancer Control (UICC), Cancer Council Australia (CCA), and Malaysian cancer NGOs are the representatives of cancer NGOs in promoting cancer control. Selecting Chinese Anti-Cancer Association (CACA) as an example in China, this article is to investigate how NGOs undertake systematic cancer prevention work in China. By conducting real case study, we found that, as a NGO, CACA plays a significant role in intensifying the leading role of government in cancer control, optimizing cancer outcomes, decreasing cancer incidence and mortality rates and improving public health. PMID:26361412

  12. A systematic scoping review of the evidence for consumer involvement in organisations undertaking systematic reviews: focus on Cochrane.

    Science.gov (United States)

    Morley, Richard F; Norman, Gill; Golder, Su; Griffith, Polly

    2016-01-01

    Cochrane is the largest international producer of systematic reviews of clinical trial evidence. We looked for published evidence that reports where consumers (patients and the public) have been involved in Cochrane systematic reviews, and also in reviews published by other organisations.We found 36 studies that reported about consumer involvement either in individual systematic reviews, or in other organisations. The studies showed that consumers were involved in reviews in a range of different ways: coordinating and producing reviews, making reviews more accessible, and spreading the results of reviews ("knowledge transfer"). The most common role was commenting on reviews ("peer reviewing"). Consumers also had other general roles, for example in educating people about evidence or helping other consumers. There were some interesting examples of new ways of involving consumers. The studies showed that most consumers came from rich and English speaking countries. There was little evidence about how consumer involvement had changed the reviews ("impact"). The studies found that consumer involvement needed to be properly supported.In future we believe that more research should be done to understand what kind of consumer involvement has the best impact; that more review authors should report how consumers have been involved; and that consumers who help with reviews should come from more varied backgrounds. Background Cochrane is the largest international producer of systematic reviews, and is committed to consumer involvement in the production and dissemination of its reviews. The review aims to systematically scope the evidence base for consumer involvement in organisations which commission, undertake or support systematic reviews; with an emphasis on Cochrane. Methods In June 2015 we searched six databases and other sources for studies of consumer involvement in organisations which commission, undertake or support systematic reviews, or in individual systematic

  13. Building capacity to use and undertake research in health organisations: a survey of training needs and priorities among staff.

    Science.gov (United States)

    Barratt, Helen; Fulop, Naomi J

    2016-12-07

    Efforts to improve healthcare and population health depend partly on the ability of health organisations to use research knowledge and participate in its production. We report the findings of a survey conducted to prioritise training needs among healthcare and public health staff, in relation to the production and implementation of research, across an applied health research collaboration. A questionnaire survey using a validated tool, the Hennessy-Hicks Training Needs Assessment Questionnaire. Participants rated 25 tasks on a five-point scale with regard to both their confidence in performing the task, and its importance to their role. A questionnaire weblink was distributed to a convenience sample of 35 healthcare and public health organisations in London and South East England, with a request that they cascade the information to relevant staff. 203 individuals responded, from 20 healthcare and public health organisations. None. Training needs were identified by comparing median importance and performance scores for each task. Individuals were also invited to describe up to three priority areas in which they require training. Across the study sample, evaluation; teaching; making do with limited resources; coping with change and managing competing demands were identified as key tasks. Assessing the relevance of research and learning about new developments were the most relevant research-related tasks. Participants' training priorities included evaluation; finding, appraising and applying research evidence; and data analysis. Key barriers to involvement included time and resources, as well as a lack of institutional support for undertaking research. We identify areas in which healthcare and public health professionals may benefit from support to facilitate their involvement in and use of applied health research. We also describe barriers to participation and differing perceptions of research between professional groups. Published by the BMJ Publishing Group Limited

  14. Longer Life and Higher Fertility in an OLG Economy with Production

    Directory of Open Access Journals (Sweden)

    Luciano Fanti

    2013-01-01

    Full Text Available This paper investigates the effect of a change in life expectancy (i.e., longevity on fertility in a standard OLG economy. The main result is that, in contrast with other papers, an increase in the longevity rate may increase the fertility rate as well. It is shown that such a result holds when the cost of rearing children in terms of goods and services (rather than in terms of forgone wages matters. In particular, such a result depends on the relative “strength” of the capital in the technology as compared with the “strength” of the parsimony. Moreover it is shown, again in contrast with other papers, that with an unfunded social security system it is more likely that a longer life may increase the fertility. The latter result is even more likely in the presence of child subsidy policies, which are widespread in developed countries. In conclusion, we argue that in countries having a population with a high longevity, a high capital share, a large unfunded social security, and child subsidy policies (such as Italy, a further increase of longevity may increase fertility in the long run and thus partially alleviate the peril of the so-called “demographic bomb.”

  15. Longer hypoxia-ischemia periods to neonatal rats causes motor impairments and muscular changes.

    Science.gov (United States)

    Durán-Carabali, L E; Sanches, E F; Marques, M R; Aristimunha, D; Pagnussat, A; Netto, C A

    2017-01-06

    Prematurity and hypoxia-ischemia (HI) can lead to movement disorders in infants. Considering that mild-moderate HI induced at postnatal day (PND) 3 has failed to produce motor disabilities similar to those seen in pre-term newborns, the main goal of the present study was to verify whether longer hypoxia periods would mimic motor function impairment, brain and muscle morphological alterations. Forty-nine Wistar rat pups of both sexes were randomly assigned to surgical control (CG) and HI groups. HI animals were submitted to the Levine-Rice model at PND 3, and exposed to 120 (HI-120'), 180 (HI-180') or 210 (HI-210') minutes of hypoxia (FiO 2 : 0.08). Sensorimotor function was assessed as from PND 35-45, by means of grasping strength, adhesive removal, cylinder and ladder walking tests. Histological staining was used to quantify the striatal volume and the cross-sectional area (CSA) of skeletal muscles. Cylinder and adhesive removal test evidenced that HI-180' and HI-210' groups had asymmetrical use of the forepaws when compared to controls. HI animals showed a decrease in the step placement quality and an increase in step errors when compared to CG (P⩽0.05). Reduction in striatal volume correlates with behavioral assessment, HI-180' and HI-210' groups presented lower biceps brachii and tibialis anterior CSA. These results show that rats exposed to longer hypoxic periods at PND3 have encephalic and sensorimotor impairments that mimic those observed in preterm infants. Morphological changes in muscle tissue evidence a new pathophysiological characteristic of the HI model that might be of relevance for the study of sensorimotor deficits. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. Ministerial Decree of 15 February 1974 establishing the inventory of qualified experts and physicians authorized to undertake the health physics and medical supervision of protection against ionizing radiations

    International Nuclear Information System (INIS)

    1974-01-01

    This Decree was made in implementation of DPR No. 185 of 13 February 1964 and provides for the legal and administrative acknowledgment of experts and physicians who are required to undertake supervision of protection against the hazards of ionizing radiations. (NEA) [fr

  17. Sexual conflict over the duration of copulation in Drosophila montana: why is longer better?

    Directory of Open Access Journals (Sweden)

    Hoikkala Anneli

    2009-06-01

    Full Text Available Abstract Background Conflicts of interest between the sexes are increasingly recognized as an engine driving the (co-evolution of reproductive traits. The reproductive behaviour of Drosophila montana suggests the occurrence of sexual conflict over the duration of copulation. During the last stages of copulation, females vigorously attempt to dislodge the mounting male, while males struggle to maintain genital contact and often successfully extend copulations far beyond the females' preferred duration. Results By preventing female resistance, we show that females make a substantial contribution towards shortening copulations. We staged matings under different sex ratio conditions, and provide evidence that copulation duration is a form of male reproductive investment that responds to the perceived intensity of sperm competition as predicted by game theoretical models. Further, we investigated potential benefits to persistent males, and costs to females coerced into longer matings. While males did not benefit in terms of increased progeny production by protracting copulation, female remating was delayed after long first copulations. Conclusion Copulation time is a trait subject to sexual conflict. Mating durations exceeding female optima serve males as a form of 'extended mate guarding': by inducing mating refractoriness in the female, a male extends the time over which its sperm is exclusively used to sire progeny and reduces the likelihood of the female being reinseminated by a competitor.

  18. Sexual conflict over the duration of copulation in Drosophila montana: why is longer better?

    Science.gov (United States)

    Mazzi, Dominique; Kesäniemi, Jenni; Hoikkala, Anneli; Klappert, Kirsten

    2009-06-12

    Conflicts of interest between the sexes are increasingly recognized as an engine driving the (co-)evolution of reproductive traits. The reproductive behaviour of Drosophila montana suggests the occurrence of sexual conflict over the duration of copulation. During the last stages of copulation, females vigorously attempt to dislodge the mounting male, while males struggle to maintain genital contact and often successfully extend copulations far beyond the females' preferred duration. By preventing female resistance, we show that females make a substantial contribution towards shortening copulations. We staged matings under different sex ratio conditions, and provide evidence that copulation duration is a form of male reproductive investment that responds to the perceived intensity of sperm competition as predicted by game theoretical models. Further, we investigated potential benefits to persistent males, and costs to females coerced into longer matings. While males did not benefit in terms of increased progeny production by protracting copulation, female remating was delayed after long first copulations. Copulation time is a trait subject to sexual conflict. Mating durations exceeding female optima serve males as a form of 'extended mate guarding': by inducing mating refractoriness in the female, a male extends the time over which its sperm is exclusively used to sire progeny and reduces the likelihood of the female being reinseminated by a competitor.

  19. 124Iodine: A Longer-Life Positron Emitter Isotope—New Opportunities in Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Giuseppe Lucio Cascini

    2014-01-01

    Full Text Available 124Iodine (124I with its 4.2 d half-life is particularly attractive for in vivo detection and quantification of longer-term biological and physiological processes; the long half-life of 124I is especially suited for prolonged time in vivo studies of high molecular weight compounds uptake. Numerous small molecules and larger compounds like proteins and antibodies have been successfully labeled with 124I. Advances in radionuclide production allow the effective availability of sufficient quantities of 124I on small biomedical cyclotrons for molecular imaging purposes. Radioiodination chemistry with 124I relies on well-established radioiodine labeling methods, which consists mainly in nucleophilic and electrophilic substitution reactions. The physical characteristics of 124I permit taking advantages of the higher PET image quality. The availability of new molecules that may be targeted with 124I represents one of the more interesting reasons for the attention in nuclear medicine. We aim to discuss all iodine radioisotopes application focusing on 124I, which seems to be the most promising for its half-life, radiation emissions, and stability, allowing several applications in oncological and nononcological fields.

  20. Karyotypic changes through dysploidy persist longer over evolutionary time than polyploid changes.

    Directory of Open Access Journals (Sweden)

    Marcial Escudero

    Full Text Available Chromosome evolution has been demonstrated to have profound effects on diversification rates and speciation in angiosperms. While polyploidy has predated some major radiations in plants, it has also been related to decreased diversification rates. There has been comparatively little attention to the evolutionary role of gains and losses of single chromosomes, which may or not entail changes in the DNA content (then called aneuploidy or dysploidy, respectively. In this study we investigate the role of chromosome number transitions and of possible associated genome size changes in angiosperm evolution. We model the tempo and mode of chromosome number evolution and its possible correlation with patterns of cladogenesis in 15 angiosperm clades. Inferred polyploid transitions are distributed more frequently towards recent times than single chromosome gains and losses. This is likely because the latter events do not entail changes in DNA content and are probably due to fission or fusion events (dysploidy, as revealed by an analysis of the relationship between genome size and chromosome number. Our results support the general pattern that recently originated polyploids fail to persist, and suggest that dysploidy may have comparatively longer-term persistence than polyploidy. Changes in chromosome number associated with dysploidy were typically observed across the phylogenies based on a chi-square analysis, consistent with these changes being neutral with respect to diversification.

  1. Cancer patients undertaking bone scans in a department of Nuclear Medicine have significant stress related to the examination

    International Nuclear Information System (INIS)

    Sioka, C.; Manetou, M.; Dimakopoulos, N.; Christidi, S.; Kouraklis, G.

    2005-01-01

    Bone scanning is a standard screening procedure for evaluation of metastases in cancer patient. In addition to the staging procedures, bone scan is a valuable test for deciding palliative therapeutic options in selected patients. The aim of this study was to investigate if patients with cancer who were undertaking routine bone scans had any stress related to the test. We asked 83 consecutive patients with various types of cancer if they had anxiety just prior to undergoing the test. Overall, we found that 53 (64%) patients had increased anxiety related to the examination and 30 (36%) patients did not. Among the 53 patients who were anxious about the bone scan, 32 were concerned about the results of the examination, 13 worried about the effects of the radiation, 4 were anxious for both results/radiation, and 4 patients had stress but could not specify the reason. Among the 32 patients who were concerned about the results of the examination, 15 were having their first bone scans, while 17 had already undergone the procedure before. Among the 13 patients who were mainly concerned about the risks of the radiation exposure during the test, 9 were having bone scans for the first time. Out of the 4 patients who feared both the results and radiation, 3 were having bone scans for the first time and 1 had it for several times. Finally, out of the 4 patients who had anxiety about the test but could not identify the reason, 3 were having bone scans for the first time and one had the test before but was claustrophobic. Our findings indicate that most patients (64%) with cancer who underwent a routine bone scan to check for metastatic disease had intense stress related either to the results or the side effects of the examination. However, there were more patients who were concerned about the results of the test rather than the effects of radiation. Among the patients who feared the effects of radioactivity most were having the test for the first time. A previous study in a

  2. Ministerial Decree of 12 May 1980 authorising Agip Nucleare S.p.a. in Rome to undertake health physics and medical supervision of protection against ionizing radiation

    International Nuclear Information System (INIS)

    1980-01-01

    Section 83 of Decree No. 185 of 13 February 1964 on protection against ionizing radiation provides that institutions previously authorised by the Minister of Labour and Social Security may, on condition that they are adequately equipped for such services, be authorised to undertake health physics and medical supervision of personnel. This Decree accordingly authorises the Agip Nucleare Company to carry out this work. (NEA) [fr

  3. Preschool Affects Longer Term Literacy and Numeracy: Results from a General Population Longitudinal Study in Northern Ireland

    Science.gov (United States)

    Melhuish, Edward; Quinn, Louise; Sylva, Kathy; Sammons, Pam; Siraj-Blatchford, Iram; Taggart, Brenda

    2013-01-01

    The Effective Pre-school Provision in Northern Ireland (EPPNI) project is a longitudinal study of child development from 3 to 11 years. It is one of the first large-scale UK projects to investigate the effects of different kinds of preschool provision, and to relate experience in preschool to child development. In EPPNI, 683 children were randomly…

  4. Longer-term domestic supply problems for nonrenewable materials with special emphasis on energy-related applications

    International Nuclear Information System (INIS)

    Goeller, H.E.

    1980-01-01

    An examination is made on how materials are used in present and future energy production and use. Problem areas which are discussed include by-products production, import limitations, substitution and recycle, accelerated use, synthesis, and the adequacy of the data bases availability

  5. Longer-term changes in streamflow following logging and mixed species eucalypt forest regeneration: The Karuah experiment

    Science.gov (United States)

    Webb, Ashley A.; Kathuria, Amrit; Turner, Lisa

    2012-09-01

    SummaryThe Karuah replicated paired catchment experiment was initiated in the 1970s to examine the hydrological effects of eucalypt-to-eucalypt forest succession in New South Wales, Australia. Treatments were conducted on 25.4-78.8% of the area of six small catchments in 1983. Five of the treated catchments experienced a significant increase in streamflow following forest disturbance, equivalent to annual water yield changes ranging from 120 mm to 319.6 mm which varied in proportion to the percentage of each catchment logged. This initial increase lasted for greater than 5 years in the logged and unburnt Bollygum (L-) catchment, but had returned to pre-treatment levels within 2.5 years in the logged and burnt (L+) Corkwood and Jackwood catchments, and within 2 years in the Kokata and Coachwood plantation catchments (P). A significant reduction in streamflow then occurred in three catchments - Corkwood (113.5 mm a-1), Bollygum (72.7 mm a-1) and Kokata (68.9 mm a-1) - but had returned to the pre-treatment level within 7 years post-harvest in the Corkwood catchment. A continuing suppression of streamflow after 27 years is evident in two of the catchments, Bollygum and Kokata, with Kokata experiencing a further decline from 2005 onwards to a mean annual reduction of 172.4 mm. By contrast a significant increase in streamflow relative to the pre-treatment level has been recorded in the Jackwood catchment after 23 years (157.6 mm a-1). Relative changes in streamflow measured in this experiment can be explained largely by changes in forest species composition, basal area and stocking rates. The eucalypt stands have variously self-thinned and in some cases forest growth appears to have been slowed by insect attack and bell miner associated dieback. Contrary to earlier published findings, while this study confirms that Mountain ash type water yield reductions can occur in other forest types, this response appears to be the exception rather than the rule. These findings have implications for the modelling and management of water yield impacts of mixed species eucalypt forest disturbance.

  6. Longer-term effects of ADAS use on speed and headway control in drivers diagnosed with Parkinson's disease

    NARCIS (Netherlands)

    Dotzauer, Mandy; Caljouw, Simone R.; De Waard, Dick; Brouwer, Wiebo H.

    2015-01-01

    Objective: An advanced driver assistance system (ADAS) provided information about speed limits, speed, speeding, and following distance. Information was presented to the participants by means of a head-up display. Methods: Effects of the information on speed and headway control were studied in a

  7. False-positive findings in mammography screening induces short-term distress - breast cancer-specific concern prevails longer

    DEFF Research Database (Denmark)

    Aro, A R; Pilvikki Absetz, S; van Elderen, T M

    2000-01-01

    -ups at 2 and 12 months postscreening. At 2 months, there was a moderate multivariate effect of group on distress; and intrusive thinking and worry about breast cancer, in particular, were most frequent amongst the false positives. Intrusive thinking still prevailed at 12 months, in addition to a higher...... findings (n=1407), false-positive findings (n=492) and referents from outside the screening programme (n=1718, age 48-49 years). Distress was measured as illness worry, anxiety, depression, cancer beliefs and early detection behaviour. Measurements were one month before screening invitation with follow...... perceived breast cancer risk and susceptibility. Distress related to screening and false-positive findings seems to be moderate, but prevailing cancer-specific concerns call for improvements in screening programmes....

  8. Longer-Term Assessment of Trastuzumab-Related Cardiac Adverse Events in the Herceptin Adjuvant (HERA) Trial

    NARCIS (Netherlands)

    Procter, Marion; Suter, Thomas M.; de Azambuja, Evandro; Dafni, Urania; van Dooren, Veerle; Muehlbauer, Susanne; Climent, Miguel Angel; Rechberger, Ernst; Liu, Walter Tsang-Wu; Toi, Mazakasu; Coombes, R. Charles; Dodwell, David; Pagani, Olivia; Madrid, Jorge; Hall, Marcia; Chen, Shin-Cheh; Focan, Christian; Muschol, Michael; van Veldhuisen, Dirk J.; Piccart-Gebhart, Martine J.

    2010-01-01

    Purpose We investigated the incidence of cardiac adverse events in patients with early breast cancer in the Herceptin Adjuvant (HERA) trial who were treated with 1 year of trastuzumab after completion of (neo)adjuvant chemotherapy. Patients and Methods The HERA trial is a three-group, randomized

  9. Rapid and Longer-Term Antidepressant Effects of Repeated Ketamine Infusions in Treatment-Resistant Major Depression

    NARCIS (Netherlands)

    Murrough, James W.; Perez, Andrew M.; Pillemer, Sarah; Stern, Jessica; Parides, Michael K.; aan het Rot, Marije; Collins, Katherine A.; Mathew, Sanjay J.; Charney, Dennis S.; Iosifescu, Dan V.

    2013-01-01

    Background: Ketamine is reported to have rapid antidepressant effects; however, there is limited understanding of the time-course of ketamine effects beyond a single infusion. A previous report including 10 participants with treatment-resistant major depression (TRD) found that six ketamine

  10. Ruptured Aneurysm Trials: The Importance of Longer-term Outcomes and Meta-analysis for 1-year Mortality

    NARCIS (Netherlands)

    Sweeting, M. J.; Ulug, P.; Powell, J. T.; Desgranges, P.; Balm, R.; Koelemay, M. J. W.; Idu, M. M.; Kox, C.; Legemate, D. A.; Huisman, L. C.; Willems, M. C. M.; Reekers, J. A.; van Delden, O. M.; van Lienden, K. P.; Hoornweg, L. L.; Reimerink, J. J.; van Beek, S. C.; Vahl, A. C.; Leijdekkers, V. J.; Bosma, J.; Montauban van Swijndregt, A. D.; de Vries, C.; van der Hulst, V. P. M.; Peringa, J.; Blomjous, J. G. A. M.; Visser, M. J. T.; van der Heijden, F. H. W. M.; Wisselink, W.; Hoksbergen, A. W. J.; Blankensteijn, J. D.; Visser, M. T. J.; Coveliers, H. M. E.; Nederhoed, J. H.; van den Berg, F. G.; van der Meijs, B. B.; van den Oever, M. L. P.; Lely, R. J.; Meijerink, M. R.; Voorwinde, A.; Ultee, J. M.; van Nieuwenhuizen, R. C.; Dwars, B. J.; Nagy, T. O. M.; Tolenaar, P.; Wiersema, A. M.; Lawson, J. A.; van Aken, P. J.; Stigter, A. A.; van den Broek, T. A. A.; VosZaans, G. A.; Mulder, W.; Strating, R. P.; Nio, D.; Akkersdijk, G. J. M.; van der Elst, A.; van Exter, P.; Mondor, Henri; Desgranges, Pascal; Becquemin, Jean- Pierre; Allaire, Eric; Castier, Yves; Leseche, Guy; Francis, Fady; Steinmetz, Eric; Berne, Jean-Pierre; Favier, Claire; Haulon, Stephan; Koussa, Mohammed; Azzaoui, Richard; Piervito, D.'elia; Alimi, Yves; Boufi, Mourad; Hartung, Olivier; Cerquetta, Pierre; Amabile, Philippe; Piquet, Philippe; Penard, Julien; Demasi, Mariangela; Alric, Pierre; Cannaud, Ludovic; Berthet, Jean-Pierre; Julia, Pierre; Fabiani, Jean-Nöel; Alsac, Jean Marc; Gouny, Pierre; Badra, Ali; Braesco, Jacques; Favre, Jean-Pierre; Albertini, Jean-Noel; Martinez, Robert; Batt, Michel; Jean, Elixène; Sosa, Miguel; Declemy, Serge; Destrieux-Garnier, Laurence; Lermusiaux, Patrick; Feugier, Patrick; Powell, Janet T.; Ashleigh, Ray; Gomes, Manuel; Greenhalgh, Roger M.; Grieve, Richard; Hinchliffe, Robert; Sweeting, Michael; Thompson, Matt M.; Thompson, Simon G.; Ulug, Pinar; Cheshire, Nicholas J.; Boyle, Jonathan R.; Serracino-Inglott, Ferdinand; Smyth, J. Vince; Hinchliffe, Robert J.; Bell, Rachel; Wilson, Noel; Bown, Matt; Dennis, Martin; Davis, Meryl; Howell, Simon; Wyatt, Michael G.; Valenti, Domenico; Bachoo, Paul; Walker, Paul; MacSweeney, Shane; Davies, Jonathan N.; Rittoo, Dynesh; Parvin, Simon D.; Yusuf, Waquar; Nice, Colin; Chetter, Ian; Howard, Adam; Chong, Patrick; Bhat, Raj; McLain, David; Gordon, Andrew; Lane, Ian; Hobbs, Simon; Pillay, Woolagasen; Rowlands, Timothy; El-Tahir, Amin; Asquith, John; Cavanagh, Steve; Dubois, Luc; Forbes, Thomas L.

    2015-01-01

    To assess current knowledge for the management of ruptured abdominal aortic aneurysm (AAA), based on the 1-year outcomes of 3 recent randomised trials. An individual patient data meta-analysis of three recent randomised trials of endovascular versus open repair, including 817 patients, was conducted

  11. The Immediate and Longer-Term Effectiveness of a Speech-Rhythm-Based Reading Intervention for Beginning Readers

    Science.gov (United States)

    Harrison, Emily; Wood, Clare; Holliman, Andrew J.; Vousden, Janet I.

    2018-01-01

    Despite empirical evidence of a relationship between sensitivity to speech rhythm and reading, there have been few studies that have examined the impact of rhythmic training on reading attainment, and no intervention study has focused on speech rhythm sensitivity specifically to enhance reading skills. Seventy-three typically developing 4- to…

  12. Canadian Registry of Implantable Electronic Device Outcomes: Longer-term follow-up of the Riata lead under advisory.

    Science.gov (United States)

    Parkash, Ratika; Thibault, Bernard; Philippon, Francois; Mangat, Iqwal; Coutu, Benoit; Bennett, Matthew; Crystal, Eugene; Healey, Jeffrey; Verma, Atul; Sandhu, Roopinder; Cameron, Douglas; Ayala-Paredes, Felix; Sterns, Laurence; Essebag, Vidal; Sturmer, Marcio; Nery, Pablo; Wells, George; Krahn, Andrew

    2017-12-02

    The Riata lead advisory was announced in 2011 and has posed unique management challenges because of cable externalization and insulation abrasion, in some cases leading to sudden loss of defibrillation. The purpose of this study was to provide further data on the rate of electrical failure in a population of patients with a Riata lead under advisory. Using the Canadian Registry of Electronic Device Outcomes, prospective follow-up data were collected on 1352 Riata leads under advisory in 17 implantable cardioverter-defibrillator (ICD) implantation centers in Canada. Data on electrical and structural failure were collected, as well as periprocedural complications related to lead revision (abandonment or extraction). Of the 1352 leads included in this 12-month follow-up cohort, 110 leads were revised. Mean follow-up time was 10.4 ± 1.5 years. The 12-year rate of electrical failure for the 8Fr lead was 9.45%, whereas the 10-year failure rate for the 7Fr lead was 7.25% and was not found to be accelerating. Of the leads revised because of advisory only (patient preference, advisory related, electrical or structural failure), the majority were abandoned (n = 54 [76.0%]), whereas 17 (24.0%) were extracted using power tools. The rate of major complications in each group was 5.6% and 5.9%, respectively. This report provides further data on the risk of electrical lead failure over a long lead dwell time. The risk of failure exceeds the risk of periprocedural major complications, indicating that the risk-to-benefit ratio is favorable to revise the lead in appropriate clinical scenarios. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  13. Towards the development of a longer-acting injectable contraceptive: past research and current trends.

    Science.gov (United States)

    Halpern, Vera; Stalter, Randy M; Owen, Derek H; Dorflinger, Laneta J; Lendvay, Anja; Rademacher, Kate H

    2015-07-01

    A longer-acting injectable contraceptive that lasts for 6 months would be a valuable addition to the contraceptive method mix and ideal for women who are interested in spacing births and/or uncertain about their future reproductive plans. Here we review past applications of drug delivery technologies to injectable contraceptives as well as recent advancements in sustained drug delivery technologies that hold promise for the development of a new longer-acting injectable contraceptive product. A global landscape analysis was conducted, promising sustained drug delivery technologies, and research opportunities and partnerships were established with experts in the fields of contraception and drug delivery to identify new approaches in developing a longer-acting injectable contraceptive product. The landscape analysis confirmed that a number of existing polymer systems, such as poly-lactic-co-glycolic acid and poly(epsilon-caprolactone), remain promising candidates for application to a longer-acting injectable product. Novel polymers and materials also hold promise for achieving longer release profiles and/or having other advantages over existing polymer systems, but products using these materials could potentially have longer roads to regulatory approval. Additionally, recent advancements in the manufacturing process of microspheres may benefit the development of a longer-acting injectable contraceptive. The design of any new injectable product must take into account the limitations of current injectable contraceptives and address concerns that women may have for a longer-acting product. FHI 360 is supporting several research collaborations for proof of concept of various drug delivery approaches for achieving longer-acting product that fits an established target product profile. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Against all odds: genocidal trauma is associated with longer life-expectancy of the survivors.

    Directory of Open Access Journals (Sweden)

    Abraham Sagi-Schwartz

    Full Text Available Does surviving genocidal experiences, like the Holocaust, lead to shorter life-expectancy? Such an effect is conceivable given that most survivors not only suffered psychosocial trauma but also malnutrition, restriction in hygienic and sanitary facilities, and lack of preventive medical and health services, with potentially damaging effects for later health and life-expectancy. We explored whether genocidal survivors have a higher risk to die younger than comparisons without such background. This is the first population-based retrospective cohort study of the Holocaust, based on the entire population of immigrants from Poland to Israel (N = 55,220, 4-20 years old when the World War II started (1939, immigrating to Israel either between 1945 and 1950 (Holocaust group or before 1939 (comparison group; not exposed to the Holocaust. Hazard of death - a long-term outcome of surviving genocidal trauma - was derived from the population-wide official data base of the National Insurance Institute of Israel. Cox regression yielded a significant hazard ratio (HR = 0.935, CI (95% = 0.910-0.960, suggesting that the risk of death was reduced by 6.5 months for Holocaust survivors compared to non-Holocaust comparisons. The lower hazard was most substantial in males who were aged 10-15 (HR = 0.900, CI (95% = 0.842-0.962, i.e., reduced by 10 months or 16-20 years at the onset of the Holocaust (HR = 0.820, CI (95% = 0.782-0.859, i.e., reduced by18 months. We found that against all odds genocidal survivors were likely to live longer. We suggest two explanations: Differential mortality during the Holocaust and "Posttraumatic Growth" associated with protective factors in Holocaust survivors or in their environment after World War II.

  15. Investigating the Female Subaltern, Colonial Discourse and False Consciousness: A Spivakian Marxist-Postcolonialist Reading of Chinua Achebe's "Things Fall Apart" and "No Longer at Ease"

    Science.gov (United States)

    Mostafaee, Jalal

    2016-01-01

    The present research study attempts to investigate Chinua Achebe's "Things Fall Apart" and "No Longer at Ease" in terms of Gayatri Spivak Marxist-Post colonialist conceptions of subaltern, colonial discourse and false consciousness. In Postmodernist fiction, there is anxiety that historical concerns such as the scale of…

  16. U32: vehicle stability and dynamics longer combination vehicles final report.

    Science.gov (United States)

    2011-09-01

    This study investigated the safety and stability of longer combination vehicles (LCVs), in particular a triple trailer combination behind a commercial tractor, which has more complicated dynamics than the more common tractor in combination with a sin...

  17. Longer combination vehicles : an estimation of their benefits and public perception of their use.

    Science.gov (United States)

    2012-03-01

    Longer Combination Vehicles (LCVs) are able to carry more freight than conventional single trailer trucks. As a result, these trucks can increase : efficiencies and benefits for freight movements as less fuel and less labor is used per ton of cargo. ...

  18. The process of undertaking a quantitative dissertation for a taught M.Sc: Personal insights gained from supporting and examining students in the UK and Ireland

    International Nuclear Information System (INIS)

    Marshall, Gill; Brennan, Patrick

    2008-01-01

    Purpose: This article discusses the roles of the student and the supervisor in the process of undertaking and writing a dissertation, a potentially daunting process. Results: The authors have supervised and examined students within 20 institutions and the personal insights gained result in the guidance provided within this article. Conclusion: The authors conclude that much can be done by students working with their supervisors, to improve progress in both performing and writing up the dissertation. Taking account of these factors will ease the dissertation process and move students progressively towards the production of a well-written dissertation

  19. Processing of semen by density gradient centrifugation selects spermatozoa with longer telomeres for assisted reproduction techniques.

    Science.gov (United States)

    Yang, Qingling; Zhang, Nan; Zhao, Feifei; Zhao, Wanli; Dai, Shanjun; Liu, Jinhao; Bukhari, Ihtisham; Xin, Hang; Niu, Wenbing; Sun, Yingpu

    2015-07-01

    The ends of eukaryotic chromosomes contain specialized chromatin structures called telomeres, the length of which plays a key role in early human embryonic development. Although the effect of sperm preparation techniques on major sperm characteristics, such as concentration, motility and morphology have been previously documented, the possible status of telomere length and its relation with sperm preparation techniques is not well-known for humans. The aim of this study was to investigate the role of density gradient centrifugation in the selection of spermatozoa with longer telomeres for use in assisted reproduction techniques in 105 samples before and after sperm processing. After density gradient centrifugation, the average telomere length of the sperm was significantly longer (6.51 ± 2.54 versus 5.16 ± 2.29, P technique for selection of sperm with longer telomeres. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  20. Rapid realist review of the evidence: achieving lasting change when mental health rehabilitation staff undertake recovery-oriented training.

    Science.gov (United States)

    Gee, Melanie; Bhanbhro, Sadiq; Cook, Sarah; Killaspy, Helen

    2017-08-01

    The aim of this study was to identify the factors contributing to lasting change in practice following a recovery-based training intervention for inpatient mental health rehabilitation staff. Staff training may help nurses and other staff groups in inpatient mental health rehabilitative settings to increase their recovery-oriented practice. There are no published reviews on the effectiveness of such training and few long-term evaluations. This review informed a realist evaluation of a specific intervention (GetREAL). Rapid realist review methodology was used to generate and prioritize programme theories. ASSIA, CINAHL, Cochrane Library, Medline, PsycINFO, Scopus, Web of Science and grey literature searches were performed in September 2014-March 2015 with no date restrictions. Stakeholders suggested further documents. GetREAL project documentation was consulted. Programme theory development took place iteratively with literature identification. Stakeholders validated and prioritized emerging programme theories and the prioritized theories were refined using literature case studies. Fifty-one relevant documents fed into 49 programme theories articulating seven mechanisms for lasting change. Prioritized mechanisms were: staff receptiveness to change; and staff feeling encouraged, motivated and supported by colleagues and management to change. Seven programme theories were prioritized and refined using data from four case studies. Lasting change can be facilitated by collaborative action planning, regular collaborative meetings, appointing a change agent, explicit management endorsement and prioritization and modifying organizational structures. Conversely, a challenging organizational climate, or a prevalence of 'change fatigue', may block change. Pre-intervention exploration may help identify any potential barriers to embedding recovery in the organizational culture. © 2016 John Wiley & Sons Ltd.

  1. Enhanced performance of hybrid solar cells using longer arms of quantum cadmium selenide tetrapods

    KAUST Repository

    Lee, Kyu-Sung

    2011-12-01

    We demonstrate that enhanced device performance of hybrid solar cells based on tetrapod (TP)-shaped cadmium selenide (CdSe) nanoparticles and conjugated polymer of poly (3-hexylthiophene) (P3HT) can be obtained by using longer armed tetrapods which aids in better spatial connectivity, thus decreasing charge hopping events which lead to better charge transport. Longer tetrapods with 10 nm arm length lead to improved power conversion efficiency of 1.12% compared to 0.80% of device having 5 nm short-armed tetrapods:P3HT photoactive blends.

  2. Predictors of career progression and obstacles and opportunities for non-EU hospital doctors to undertake postgraduate training in Ireland.

    Science.gov (United States)

    Tyrrell, Ella; Keegan, Conor; Humphries, Niamh; McAleese, Sara; Thomas, Steve; Normand, Charles; Brugha, Ruairí

    2016-06-30

    progression than those in other specialities. The present study highlights differences in terms of achieving career progression and training for Irish-trained non-EU doctors, compared to those trained elsewhere. However, the findings herein warrant further attention from a workforce planning and policy development perspective regarding Ireland's obligations under the Global Code of hiring, promoting and remunerating migrant health personnel on the basis of equality of treatment with the domestically-trained health workforce.

  3. A study on the reproducibility of cephalometric landmarks when undertaking a three-dimensional (3D) cephalometric analysis

    Science.gov (United States)

    Llamas, José M.; Cibrián, Rosa; Gandia, José L.; Paredes, Vanessa

    2012-01-01

    Objectives: Cone Beam Computerized Tomography (CBCT) allows the possibility of modifying some of the diagnostic tools used in orthodontics, such as cephalometry. The first step must be to study the characteristics of these devices in terms of accuracy and reliability of the most commonly used landmarks. The aims were 1- To assess intra and inter-observer reliability in the location of anatomical landmarks belonging to hard tissues of the skull in images taken with a CBCT device, 2- To determine which of those landmarks are more vs. less reliable and 3- To introduce planes of reference so as to create cephalometric analyses appropriated to the 3D reality. Study design: Fifteen patients who had a CBCT (i-CAT®) as a diagnostic register were selected. To assess the reproducibility on landmark location and the differences in the measurements of two observers at different times, 41 landmarks were defined on the three spatial axes (X,Y,Z) and located. 3.690 measurements were taken and, as each determination has 3 coordinates, 11.070 data were processed with SPSS® statistical package. To discover the reproducibility of the method on landmark location, an ANOVA was undertaken using two variation factors: time (t1, t2 and t3) and observer (Ob1 and Ob2) for each axis (X, Y and Z) and landmark. The order of the CBCT scans submitted to the observers (Ob1, Ob2) at t1, t2, and t3, were different and randomly allocated. Multiple comparisons were undertaken using the Bonferroni test. The intra- and inter-examiner ICC´s were calculated. Results: Intra- and inter-examiner reliability was high, both being ICC ≥ 0.99, with the best frequency on axis Z. Conclusions: The most reliable landmarks were: Nasion, Sella, Basion, left Porion, point A, anterior nasal spine, Pogonion, Gnathion, Menton, frontozygomatic sutures, first lower molars and upper and lower incisors. Those with less reliability were the supraorbitals, right zygion and posterior nasal spine. Key words:Cone Beam

  4. EAO Supplement Working Group 4 - EAO CC 2015 Short implants versus sinus lifting with longer implants to restore the posterior maxilla: a systematic review.

    Science.gov (United States)

    Thoma, D S; Zeltner, M; Hüsler, J; Hämmerle, C H F; Jung, R E

    2015-09-01

    To compare short implants in the posterior maxilla to longer implants placed after or simultaneously with sinus floor elevation procedures. The focused question was as follows: Are short implants superior to longer implants in the augmented sinus in terms of survival and complication rates of implants and reconstructions, patient-reported outcome measures (PROMs) and costs? A MEDLINE search (1990-2014) was performed for randomized controlled clinical studies comparing short implants (≤8 mm) to longer implants (>8 mm) in augmented sinus. The search was complimented by an additional hand search of the selected papers and reviews published between 2011 and 2014. Eligible studies were selected based on the inclusion criteria, and quality assessments were conducted. Descriptive statistics were applied for a number of outcome measures. Survival rates of dental implants were pooled simply in case of comparable studies. Eight randomized controlled clinical trials (RCTs) comparing short implants versus longer implants in the augmented sinus derived from an initial search count of 851 titles were selected and data extracted. In general, all studies were well conducted with a low risk of bias for the majority of the analyzed parameters. Based on the pooled analyses of longer follow-ups (5 studies, 16-18 months), the survival rate of longer implants amounted to 99.5% (95% CI: 97.6-99.98%) and for shorter implants to 99.0% (95% CI: 96.4-99.8%). For shorter follow-ups (3 studies, 8-9 months), the survival rates of longer implants are 100% (95% CI: 97.1-100%) and for shorter implants 98.2% (95% CI: 93.9-99.7%). Complications were predominantly of biological origin, mainly occurred intraoperatively as membrane perforations, and were almost three times as higher for longer implant in the augmented sinus compared to shorter implants. PROMs, morbidity, surgical time and costs were generally in favor of shorter dental implants. All studies were performed by surgeons in specialized

  5. Longer Food Chains in Pelagic Ecosystems: Trophic Energetics of Animal Body Size and Metabolic Efficiency.

    Science.gov (United States)

    McGarvey, Richard; Dowling, Natalie; Cohen, Joel E

    2016-07-01

    Factors constraining the structure of food webs can be investigated by comparing classes of ecosystems. We find that pelagic ecosystems, those based on one-celled primary producers, have longer food chains than terrestrial ecosystems. Yet pelagic ecosystems have lower primary productivity, contrary to the hypothesis that greater energy flows permit higher trophic levels. We hypothesize that longer food chain length in pelagic ecosystems, compared with terrestrial ecosystems, is associated with smaller pelagic animal body size permitting more rapid trophic energy transfer. Assuming negative allometric dependence of biomass production rate on body mass at each trophic level, the lowest three pelagic animal trophic levels are estimated to add biomass more rapidly than their terrestrial counterparts by factors of 12, 4.8, and 2.6. Pelagic animals consequently transport primary production to a fifth trophic level 50-190 times more rapidly than animals in terrestrial webs. This difference overcomes the approximately fivefold slower pelagic basal productivity, energetically explaining longer pelagic food chains. In addition, ectotherms, dominant at lower pelagic animal trophic levels, have high metabolic efficiency, also favoring higher rates of trophic energy transfer in pelagic ecosystems. These two animal trophic flow mechanisms imply longer pelagic food chains, reestablishing an important role for energetics in food web structure.

  6. Genetically predicted longer telomere length is associated with increased risk of B-cell lymphoma subtypes

    NARCIS (Netherlands)

    Machiela, Mitchell J; Lan, Qing; Slager, Susan L; Vermeulen, Roel C H; Teras, Lauren R; Camp, Nicola J; Cerhan, James R; Spinelli, John J; Wang, Sophia S; Nieters, Alexandra; Vijai, Joseph; Yeager, Meredith; Wang, Zhaoming; Ghesquières, Hervé; McKay, James; Conde, Lucia; de Bakker, Paul I W; Cox, David G; Burdett, Laurie; Monnereau, Alain; Flowers, Christopher R; De Roos, Anneclaire J; Brooks-Wilson, Angela R; Giles, Graham G; Melbye, Mads; Gu, Jian; Jackson, Rebecca D; Kane, Eleanor; Purdue, Mark P; Vajdic, Claire M; Albanes, Demetrius; Kelly, Rachel S; Zucca, Mariagrazia; Bertrand, Kimberly A; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Hutchinson, Amy; Zhi, Degui; Habermann, Thomas M; Link, Brian K; Novak, Anne J; Dogan, Ahmet; Asmann, Yan W; Liebow, Mark; Thompson, Carrie A; Ansell, Stephen M; Witzig, Thomas E; Tilly, Hervé; Haioun, Corinne; Molina, Thierry J; Hjalgrim, Henrik; Glimelius, Bengt; Adami, Hans-Olov; Roos, Göran; Bracci, Paige M; Riby, Jacques; Smith, Martyn T; Holly, Elizabeth A; Cozen, Wendy; Hartge, Patricia; Morton, Lindsay M; Severson, Richard K; Tinker, Lesley F; North, Kari E; Becker, Nikolaus; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; Lightfoot, Tracy; Crouch, Simon; Smith, Alex; Roman, Eve; Diver, W Ryan; Offit, Kenneth; Zelenetz, Andrew; Klein, Robert J; Villano, Danylo J; Zheng, Tongzhang; Zhang, Yawei; Holford, Theodore R; Turner, Jenny; Southey, Melissa C; Clavel, Jacqueline; Virtamo, Jarmo; Weinstein, Stephanie; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Boeing, Heiner; Tjønneland, Anne; Angelucci, Emanuele; Di Lollo, Simonetta; Rais, Marco; De Vivo, Immaculata; Giovannucci, Edward; Kraft, Peter; Huang, Jinyan; Ma, Baoshan; Ye, Yuanqing; Chiu, Brian C H; Liang, Liming; Park, Ju-Hyun; Chung, Charles C; Weisenburger, Dennis D; Fraumeni, Joseph F; Salles, Gilles; Glenn, Martha; Cannon-Albright, Lisa; Curtin, Karen; Wu, Xifeng; Smedby, Karin E; de Sanjose, Silvia; Skibola, Christine F; Berndt, Sonja I; Birmann, Brenda M; Chanock, Stephen J; Rothman, Nathaniel

    2016-01-01

    Evidence from a small number of studies suggests that longer telomere length measured in peripheral leukocytes is associated with an increased risk of non-Hodgkin lymphoma (NHL). However, these studies may be biased by reverse causation, confounded by unmeasured environmental exposures and might

  7. PURSUIT ROTOR PERFORMANCE, 1. EFFECTS OF REINFORCING THE LONGER INTERVALS OF CONTINUOUS TRACKING WITHIN EACH TRIAL.

    Science.gov (United States)

    BJORKLUND, JOHN F.; SHELDON, RICHARD W.

    TO DETERMINE WHETHER SELECTIVE REINFORCEMENT OF PURSUIT ROTOR PERFORMANCE FACILITATES ACQUISITION OF SKILL AND PROMOTES ITS RETENTION, FIVE GROUPS OF SUBJECTS WERE INDIVIDUALLY TRAINED FOR TEN SESSIONS OF 15 TRIALS EACH. SELECTIVE REINFORCEMENT OF LONGER THAN AVERAGE TARGET CONTACTS WAS INTRODUCED FOR ONE GROUP OF SUBJECTS DURING SESSIONS SIX AND…

  8. Dissemination of English Culture in Chinua Achebe's "No Longer at Ease"

    Science.gov (United States)

    Zarrinjooee, Bahman; Khatar, Shahla

    2016-01-01

    This paper deals with Chinua Achebe's (1930-2013) "No Longer at Ease" (1960) which depicts the dissemination of English culture in Nigeria and its effects on the life and identity of Obi Okonkwo, the Western educated male protagonist. The focus of this paper is on the dissemination of English culture and submission of Nigerian culture in…

  9. Longer duration of asthma is significantly associated with increased RV/TLC ratio.

    Science.gov (United States)

    Tiwari, Anupama; Rahman, Kazi; Abejie, Belayneh; Jain, Vipul V; Vempilly, Jose Joseph

    2017-03-01

    Although FEV1/FVC ratio has been shown to be negatively associated with longer duration of asthma; an association between RV/TLC ratio and longer duration of asthma has not been explored. Patients with established asthma for more than a year and met inclusion and exclusion criteria were recruited. Data obtained by questionnaire after informed consent was obtained, Pulmonary function tests and laboratory results were collected through chart review. Correlation and multiple linear regressions were used to analyze the data. Among the 93 subjects, 61 were women. The mean age of patients was 58 ± 15 years, and the mean duration of asthma was 21 ± 18 years. The ethnic composition included: Caucasians 64%, Hispanics 28% and other groups 8%. The FEV1/FVC ratio was not significantly associated with duration of asthma (R2 = 0.15, p = 0.05). However, the RV/TLC ratio was significantly associated with duration of asthma (R2 = 0.46, p TLC ratio may be a better indicator than FEV1/FVC ratio to detect airway obstruction related to longer duration of asthma. Lung volume measurements should be done in addition to spirometry to detect changes related to airway obstruction in patients with longer duration of asthma. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Obstacles to researching the researchers: a case study of the ethical challenges of undertaking methodological research investigating the reporting of randomised controlled trials.

    Science.gov (United States)

    McKenzie, Joanne E; Herbison, G Peter; Roth, Paul; Paul, Charlotte

    2010-03-21

    Recent cohort studies of randomised controlled trials have provided evidence of within-study selective reporting bias; where statistically significant outcomes are more likely to be more completely reported compared to non-significant outcomes. Bias resulting from selective reporting can impact on meta-analyses, influencing the conclusions of systematic reviews, and in turn, evidence based clinical practice guidelines.In 2006 we received funding to investigate if there was evidence of within-study selective reporting in a cohort of RCTs submitted to New Zealand Regional Ethics Committees in 1998/99. This research involved accessing ethics applications, their amendments and annual reports, and comparing these with corresponding publications. We did not plan to obtain informed consent from trialists to view their ethics applications for practical and scientific reasons. In November 2006 we sought ethical approval to undertake the research from our institutional ethics committee. The Committee declined our application on the grounds that we were not obtaining informed consent from the trialists to view their ethics application. This initiated a seventeen month process to obtain ethical approval. This publication outlines what we planned to do, the issues we encountered, discusses the legal and ethical issues, and presents some potential solutions. Methodological research such as this has the potential for public benefit and there is little or no harm for the participants (trialists) in undertaking it. Further, in New Zealand, there is freedom of information legislation, which in this circumstance, unambiguously provided rights of access and use of the information in the ethics applications. The decision of our institutional ethics committee defeated this right and did not recognise the nature of this observational research. Methodological research, such as this, can be used to develop processes to improve quality in research reporting. Recognition of the potential

  11. Using Social Cognitive Theory to Explain the Intention of Final-year Pharmacy Students to Undertake a Higher Degree in Pharmacy Practice Research.

    Science.gov (United States)

    Carter, Stephen R; Moles, Rebekah J; Krass, Ines; Kritikos, Vicki S

    2016-08-25

    Objective. To develop and test a conceptual model that hypothesized student intention to undertake a higher degree in pharmacy practice research (PPR) would be increased by self-efficacy, outcome expectancy, and the social influence of faculty members. Methods. Cross-sectional surveys were completed by 387 final-year pharmacy undergraduates enrolled in 2012 and 2013. Structural equation modeling was used to explore relationships between variables and intention. Results. Fit indices were good. The model explained 55% of the variation in intention. As hypothesized, faculty social influence increased self-efficacy and indirectly increased outcome expectancy and intention. Conclusion. To increase pharmacy students' orientation towards a career in PPR, faculty members could use their social influence by highlighting PPR in their teaching.

  12. Longer leukocyte telomere length in Costa Rica's Nicoyan Peninsula: A population-based study

    Science.gov (United States)

    Rehkopf, David H; Dow, William H; Rosero-Bixby, Luis; Lin, Jue; Epel, Elissa S; Blackburn, Elizabeth H

    2013-01-01

    Studies in humans suggest that leukocyte telomere length may act as a marker of biological aging. We investigated whether individuals in the Nicoya region of Costa Rica, known for exceptional longevity, had longer telomere length than those in other parts of the country. After controlling for age, age squared, rurality, rainy season and gender, mean leukocyte telomere length in Nicoya was substantially longer (81 base pairs, pCosta Rica, providing evidence of a biological pathway to which this notable longevity may be related. This relationship remains unchanged (79 base pairs, p<0.05) after statistically controlling for nineteen potential biological, dietary and social and demographic mediators. Thus the difference in mean leukocyte telomere length that characterizes this unique region does not appear to be explainable by traditional behavioral and biological risk factors. More detailed examination of mean leukocyte telomere length by age shows that the regional telomere length difference declines at older ages. PMID:23988653

  13. Novel thermal annealing methodology for permanent tuning polymer optical fiber Bragg gratings to longer wavelengths.

    Science.gov (United States)

    Pospori, A; Marques, C A F; Sagias, G; Lamela-Rivera, H; Webb, D J

    2018-01-22

    The Bragg wavelength of a polymer optical fiber Bragg grating can be permanently shifted by utilizing the thermal annealing method. In all the reported fiber annealing cases, the authors were able to tune the Bragg wavelength only to shorter wavelengths, since the polymer fiber shrinks in length during the annealing process. This article demonstrates a novel thermal annealing methodology for permanently tuning polymer optical fiber Bragg gratings to any desirable spectral position, including longer wavelengths. Stretching the polymer optical fiber during the annealing process, the period of Bragg grating, which is directly related with the Bragg wavelength, can become permanently longer. The methodology presented in this article can be used to multiplex polymer optical fiber Bragg gratings at any desirable spectral position utilizing only one phase-mask for their photo-inscription, reducing thus their fabrication cost in an industrial setting.

  14. Danish travel activities: do we travel more and longer – and to what extent?

    DEFF Research Database (Denmark)

    Knudsen, Mette Aagaard

    Two separate Danish National travel surveys are analysed to outline the amount and extent of national and international travelling during the latest 15-20 years; the national travel survey (TU) describes mainly national daily travel activities, whereas the holiday and business travel survey...... describes national and international travel activities including overnight stay(s). When sampling only respondents with trips above 100 kilometres, they only accounts for around 2% of all daily travel activities, however, this share appears to increase and suggest in general that we do travel longer....... But due to this limited share of trips, the overall impacts of longer distance travelling vanish when considering all daily travel activities. Especially as about 95% of all daily travel destinations range less than 50 kilometres away and in total induce an average trip length of 20 kilometres. If focus...

  15. Complexity: no longer a communication barrier in journalism? The case of narrative journalism

    OpenAIRE

    Vanoost, Marie; International Conference on Communication, Media, Technology & Design

    2013-01-01

    Journalism schools and handbooks generally recommend writing short and simple sentences, using basic vocabulary and avoiding too long texts. This is supposed to ensure the readability of the news. But there are different styles and models in journalism. Among them is narrative journalism, which often offers longer articles, and advocates using literary writing devices and a more personal style. Several scholars consider, moreover, that it allows a deeper understanding of reality. Far from the...

  16. Targeted treatment trials for tuberous sclerosis and autism: no longer a dream

    OpenAIRE

    Sahin, Mustafa

    2012-01-01

    Genetic disorders that present with a high incidence of autism spectrum disorders (ASD) offer tremendous potential both for elucidating the underlying neurobiology of ASD and identifying therapeutic drugs and/or drug targets. As a result, clinical trials for genetic disorders associated with ASD are no longer a hope for the future but rather an exciting reality whose time has come. Tuberous sclerosis complex (TSC) is one such genetic disorder that presents with ASD, epilepsy, and intellectual...

  17. Conditions and Motivations to Undertake

    Directory of Open Access Journals (Sweden)

    Flor Ángela Marulanda Valencia

    2017-02-01

    Full Text Available This study aims at deepening in the analysis of motivations shown by a group of entrepreneurs in Medellin, Antioquia. It also describes the different perceptions about the enablers and obstacles for the development of entrepreneurship in appropriate environments to promote it. It was found that independence was the principal motivation for entrepreneurship and that the city offered the most favourable environment to foster it. Additionally, it was found that the most important obstacle to develop it was the difficulties to access a bank credit.

  18. Subclinical Hearing Loss, Longer Sleep Duration, and Cardiometabolic Risk Factors in Japanese General Population

    Directory of Open Access Journals (Sweden)

    Kei Nakajima

    2014-01-01

    Full Text Available Hearing loss leads to impaired social functioning and quality of life. Hearing loss is also associated with sleeping disorders and cardiometabolic risk factors. Here, we determined whether subclinical hearing loss is associated with sleep duration and cardiometabolic risk factors in a cross-sectional and longitudinal study of healthy Japanese general population. 48,091 men and women aged 20–79 years who underwent medical checkups were included in a cross-sectional study, and 6,674 were included in an 8-year longitudinal study. The prevalence of audiometrically determined hearing loss (>25 dB at 4000 and 1000 Hz increased significantly with increasing sleep duration in any age strata. Logistic regression analysis showed that compared with reference sleep duration (6 h longer sleep duration (≥8 h was significantly associated with hearing loss, even after adjusting for potential confounding factors. Simultaneously, hearing loss was significantly associated with male sex, diabetes, and no habitual exercise. In the longitudinal study, the risk of longer sleep duration (≥8 h after 8 years was significantly greater in subjects with hearing loss at 4000 Hz at baseline. In conclusion, current results suggest a potential association of subclinical hearing loss with longer sleep duration and cardiometabolic risk factors in a Japanese general population.

  19. Sexual selection on receptor organ traits: younger females attract males with longer antennae

    Science.gov (United States)

    Johnson, Tamara L.; Symonds, Matthew R. E.; Elgar, Mark A.

    2017-06-01

    Sexual selection theory predicts that female choice may favour the evolution of elaborate male signals. Darwin also suggested that sexual selection can favour elaborate receiver structures in order to better detect sexual signals, an idea that has been largely ignored. We evaluated this unorthodox perspective by documenting the antennal lengths of male Uraba lugens Walker (Lepidoptera: Nolidae) moths that were attracted to experimentally manipulated emissions of female sex pheromone. Either one or two females were placed in field traps for the duration of their adult lives in order to create differences in the quantity of pheromone emissions from the traps. The mean antennal length of males attracted to field traps baited with a single female was longer than that of males attracted to traps baited with two females, a pattern consistent with Darwin's prediction assuming the latter emits higher pheromone concentrations. Furthermore, younger females attracted males with longer antennae, which may reflect age-specific changes in pheromone emission. These field experiments provide the first direct evidence of an unappreciated role for sexual selection in the evolution of sexual dimorphism in moth antennae and raise the intriguing possibility that females select males with longer antennae through strategic emission of pheromones.

  20. Perceived discrimination predicts longer time to be accepted for kidney transplant.

    Science.gov (United States)

    Myaskovsky, Larissa; Almario Doebler, Donna; Posluszny, Donna M; Dew, Mary Amanda; Unruh, Mark; Fried, Linda F; Switzer, Galen E; Kim, Sunghee; Chang, Chung-Chou H; Ramkumar, Mohan; Shapiro, Ron

    2012-02-27

    Although end-stage kidney disease in African Americans (AAs) is four times greater than in whites, AAs are less than one half as likely to undergo kidney transplantation (KT). This racial disparity has been found even after controlling for clinical factors such as comorbid conditions, dialysis vintage and type, and availability of potential living donors. Therefore, studying nonmedical factors is critical to understanding disparities in KT. We conducted a longitudinal cohort study with 127 AA and white patients with end-stage kidney disease undergoing evaluation for KT (December 2006 to July 2007) to determine whether, after controlling for medical factors, differences in time to acceptance for transplant is explained by patients' cultural factors (e.g., perceived racism and discrimination, medical mistrust, religious objections to living donor KT), psychosocial characteristics (e.g., social support, anxiety, depression), or transplant knowledge. Participants completed two telephone interviews (shortly after initiation of transplant evaluation and after being accepted or found ineligible for transplant). Results indicated that AA patients reported higher levels of the cultural factors than did whites. We found no differences in comorbidity or availability of potential living donors. AAs took significantly longer to get accepted for transplant than did whites (hazard ratio=1.49, P=0.005). After adjustment for demographic, psychosocial, and cultural factors, the association of race with longer time for listing was no longer significant. We suggest that interventions to address racial disparities in KT incorporate key nonmedical risk factors in patients.

  1. Time to pediatric epilepsy surgery is longer and developmental outcomes lower for government compared with private insurance.

    Science.gov (United States)

    Hauptman, Jason S; Dadour, Andrew; Oh, Taemin; Baca, Christine B; Vickrey, Barbara G; Vassar, Stefanie; Sankar, Raman; Salamon, Noriko; Vinters, Harry V; Mathern, Gary W

    2013-07-01

    It is unclear if socioeconomic factors like type of insurance influence time to referral and developmental outcomes for pediatric patients undergoing epilepsy surgery. This study determined whether private compared with state government insurance was associated with shorter intervals of seizure onset to surgery and better developmental quotients for pediatric patients undergoing epilepsy surgery. A consecutive cohort (n = 420) of pediatric patients undergoing epilepsy surgery were retrospectively categorized into those with Medicaid (California Children's Services; n = 91) or private (Preferred Provider Organization, Health Maintenance Organization, Indemnity; n = 329) insurance. Intervals from seizure onset to referral and surgery and Vineland developmental assessments were compared by insurance type with the use of log-rank tests. Compared with private insurance, children with Medicaid had longer intervals from seizure onset to referral for evaluation (log-rank test, P = .034), and from seizure onset to surgery (P = .017). In a subset (25%) that had Vineland assessments, children with Medicaid compared with private insurance had lower Vineland scores presurgery (P = .042) and postsurgery (P = .003). Type of insurance was not associated with seizure severity, types of operations, etiology, postsurgical seizure-free outcomes, and complication rate. Compared with Medicaid, children with private insurance had shorter intervals from seizure onset to referral and to epilepsy surgery, and this was associated with lower Vineland scores before surgery. These findings may reflect delayed access for uninsured children who eventually obtained state insurance. Reasons for the delay and whether longer intervals before epilepsy surgery affect long-term cognitive and developmental outcomes warrant further prospective investigations.

  2. Smelling themselves: Dogs investigate their own odours longer when modified in an "olfactory mirror" test.

    Science.gov (United States)

    Horowitz, Alexandra

    2017-10-01

    While domestic dogs, Canis familiaris, have been found to be skillful at social cognitive tasks and even some meta-cognitive tasks, they have not passed the test of mirror self-recognition (MSR). Acknowledging the motivational and sensory challenges that might hinder performance, even before the question of self-recognition is broached, this study creates and enacts a novel design extrapolated from the species' natural behaviour. Given dogs' use of olfactory signals in communication, this experiment presents dogs with various canisters for approach and investigation. Each holds an odorous stimulus: in the critical test, either an "olfactory mirror" of the subject - the dog's own urine - or one in which the odour stimulus is modified. By looking at subjects' investigation times of each canister, it is shown that dogs distinguish between the olfactory "image" of themselves when modified: investigating their own odour for longer when it had an additional odour accompanying it than when it did not. Such behaviour implies a recognition of the odour as being of or from "themselves." The ecological validity of this odour presentation is examined by presenting to the subjects odours of other known or unknown dogs: dogs spend longer investigating the odour of other dogs than their own odour. Finally, in a second experiment, subjects spent longer with the modified stimulus than with the modified odour by itself, indicating that novelty alone does not explain the dogs' behavior. This study translates the MSR study for a species whose primary sensory modality is olfaction, and finds both that natural sniffing behaviour can be replicated in the lab and that dogs show more investigative interest in their own odours when modified. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Extending 3D near-cloud corrections from shorter to longer wavelengths

    International Nuclear Information System (INIS)

    Marshak, Alexander; Evans, K. Frank; Várnai, Tamás; Wen, Guoyong

    2014-01-01

    Satellite observations have shown a positive correlation between cloud amount and aerosol optical thickness (AOT) that can be explained by the humidification of aerosols near clouds, and/or by cloud contamination by sub-pixel size clouds and the cloud adjacency effect. The last effect may substantially increase reflected radiation in cloud-free columns, leading to overestimates in the retrieved AOT. For clear-sky areas near boundary layer clouds the main contribution to the enhancement of clear sky reflectance at shorter wavelengths comes from the radiation scattered into clear areas by clouds and then scattered to the sensor by air molecules. Because of the wavelength dependence of air molecule scattering, this process leads to a larger reflectance increase at shorter wavelengths, and can be corrected using a simple two-layer model [18]. However, correcting only for molecular scattering skews spectral properties of the retrieved AOT. Kassianov and Ovtchinnikov [9] proposed a technique that uses spectral reflectance ratios to retrieve AOT in the vicinity of clouds; they assumed that the cloud adjacency effect influences the spectral ratio between reflectances at two wavelengths less than it influences the reflectances themselves. This paper combines the two approaches: It assumes that the 3D correction for the shortest wavelength is known with some uncertainties, and then it estimates the 3D correction for longer wavelengths using a modified ratio method. The new approach is tested with 3D radiances simulated for 26 cumulus fields from Large-Eddy Simulations, supplemented with 40 aerosol profiles. The results showed that (i) for a variety of cumulus cloud scenes and aerosol profiles over ocean the 3D correction due to cloud adjacency effect can be extended from shorter to longer wavelengths and (ii) the 3D corrections for longer wavelengths are not very sensitive to unbiased random uncertainties in the 3D corrections at shorter wavelengths. - Highlights:

  4. Effects of shorter versus longer storage time of transfused red blood cells in adult ICU patients

    DEFF Research Database (Denmark)

    Rygård, Sofie L; Jonsson, Andreas B; Madsen, Martin B

    2018-01-01

    PURPOSE: Patients in the intensive care unit (ICU) are often transfused with red blood cells (RBC). During storage, the RBCs and storage medium undergo changes, which may have clinical consequences. Several trials now have assessed these consequences, and we reviewed the present evidence...... on the effects of shorter versus longer storage time of transfused RBCs on outcomes in ICU patients. METHODS: We conducted a systematic review with meta-analyses and trial sequential analyses (TSA) of randomised clinical trials including adult ICU patients transfused with fresher versus older or standard issue...... fresher versus older blood for transfusion....

  5. Women live longer than men even during severe famines and epidemics

    DEFF Research Database (Denmark)

    Zarulli, Virginia; Barthold Jones, Julia A; Oksuzyan, Anna

    2018-01-01

    Women in almost all modern populations live longer than men. Research to date provides evidence for both biological and social factors influencing this gender gap. Conditions when both men and women experience extremely high levels of mortality risk are unexplored sources of information. We...... high. The hypothesis that the survival advantage of women has fundamental biological underpinnings is supported by the fact that under very harsh conditions females survive better than males even at infant ages when behavioral and social differences may be minimal or favor males. Our findings also...... indicate that the female advantage differs across environments and is modulated by social factors....

  6. 'You have to be mindful of whose story it is': the challenges of undertaking life story work with people with dementia and their family carers.

    Science.gov (United States)

    McKeown, Jane; Ryan, Tony; Ingleton, Christine; Clarke, Amanda

    2015-03-01

    Life story work is increasingly being used with people with dementia; this work offers a critical appraisal of some challenges that may be faced in practice. An in-depth case study analysis was undertaken to understand the experiences of people with dementia, family carers and care staff in using life story work in an NHS Mental Health and Social Care Trust. Data collection included semi-structured interviews, observation, conversations and field notes. Private memories were sometimes recalled by the person with dementia that were not for inclusion in any written product; enabling the person with dementia to tell their own life story could be a challenge; quality of the life story books was variable and; at times, life story work may be overused with the person with dementia. Services should not be deterred from undertaking life story work with people with dementia, but there is a need to adopt a planned approach to its implementation that includes facilitation, education and supervision. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  7. A prospective phase II randomized study of deferasirox to prevent iatrogenic iron overload in patients undertaking induction/consolidation chemotherapy for acute myeloid leukaemia.

    Science.gov (United States)

    Kennedy, Glen A; Morris, Kirk L; Subramonpillai, Elango; Curley, Cameron; Butler, Jason; Durrant, Simon

    2013-06-01

    This prospective randomized phase II study aimed to determine the safety and efficacy of deferasirox in preventing iatrogenic iron overload in patients receiving induction/consolidation chemotherapy for acute myeloid leukaemia (AML) ize. Serum ferritin, transferrin saturation and CRP were measured pre-, mid- and post- each chemotherapy cycle. Patients were randomized to receive either therapy with deferasirox vs. no deferasirox therapy once serum ferritin increased to >500 μg/l. The trial was stopped prematurely due to excess gastrointestinal (GI) and infectious toxicity demonstrable in the deferasirox arm, after 10 patients had been randomized to deferasirox and 6 patients to the control arm. Overall, deferasirox was poorly tolerated, with median maximum tolerated dose only 13·8 mg/kg/d and no patient able to tolerate doses >20 mg/kg/d. Median duration of deferasirox therapy was only 72 d (range 19-130 d), with 9/10 patients requiring unplanned dose interruptions and 4/10 patients unable to continue the drug predominantly due to GI effects. Although all 3 treatment-related deaths occurred in the deferasirox arm (P = 0·25), median overall survival was similar between treatment arms. Use of deferasirox to prevent iatrogenic iron overload in AML patients undertaking induction/consolidation is poorly tolerated and appears to be associated with excess GI and infectious toxicity. © 2013 John Wiley & Sons Ltd.

  8. Women live longer than men even during severe famines and epidemics.

    Science.gov (United States)

    Zarulli, Virginia; Barthold Jones, Julia A; Oksuzyan, Anna; Lindahl-Jacobsen, Rune; Christensen, Kaare; Vaupel, James W

    2018-01-23

    Women in almost all modern populations live longer than men. Research to date provides evidence for both biological and social factors influencing this gender gap. Conditions when both men and women experience extremely high levels of mortality risk are unexplored sources of information. We investigate the survival of both sexes in seven populations under extreme conditions from famines, epidemics, and slavery. Women survived better than men: In all populations, they had lower mortality across almost all ages, and, with the exception of one slave population, they lived longer on average than men. Gender differences in infant mortality contributed the most to the gender gap in life expectancy, indicating that newborn girls were able to survive extreme mortality hazards better than newborn boys. Our results confirm the ubiquity of a female survival advantage even when mortality is extraordinarily high. The hypothesis that the survival advantage of women has fundamental biological underpinnings is supported by the fact that under very harsh conditions females survive better than males even at infant ages when behavioral and social differences may be minimal or favor males. Our findings also indicate that the female advantage differs across environments and is modulated by social factors. Copyright © 2018 the Author(s). Published by PNAS.

  9. Modified femoral pressuriser generates a longer lasting high pressure during cement pressurisation

    Directory of Open Access Journals (Sweden)

    Kjellson Fred

    2011-10-01

    Full Text Available Abstract Background The strength of the cement-bone interface in hip arthroplasty is strongly related to cement penetration into the bone. A modified femoral pressuriser has been investigated, designed for closer fitting into the femoral opening to generate higher and more constant cement pressure compared to a commercial (conventional design. Methods Femoral cementation was performed in 10 Sawbones® models, five using the modified pressuriser and five using a current commercial pressuriser as a control. Pressure during the cementation was recorded at the proximal and distal regions of the femoral implant. The peak pressure and the pressure-time curves were analysed by student's t-test and Two way ANOVA. Results The modified pressuriser showed significantly and substantially longer durations at higher cementation pressures and slightly, although not statistically, higher peak pressures compared to the conventional pressuriser. The modified pressuriser also produced more controlled cement leakage. Conclusion The modified pressuriser generates longer higher pressure durations in the femoral model. This design modification may enhance cement penetration into cancellous bone and could improve femoral cementation.

  10. Women live longer than men even during severe famines and epidemics

    Science.gov (United States)

    Zarulli, Virginia; Barthold Jones, Julia A.; Oksuzyan, Anna; Lindahl-Jacobsen, Rune; Christensen, Kaare; Vaupel, James W.

    2018-01-01

    Women in almost all modern populations live longer than men. Research to date provides evidence for both biological and social factors influencing this gender gap. Conditions when both men and women experience extremely high levels of mortality risk are unexplored sources of information. We investigate the survival of both sexes in seven populations under extreme conditions from famines, epidemics, and slavery. Women survived better than men: In all populations, they had lower mortality across almost all ages, and, with the exception of one slave population, they lived longer on average than men. Gender differences in infant mortality contributed the most to the gender gap in life expectancy, indicating that newborn girls were able to survive extreme mortality hazards better than newborn boys. Our results confirm the ubiquity of a female survival advantage even when mortality is extraordinarily high. The hypothesis that the survival advantage of women has fundamental biological underpinnings is supported by the fact that under very harsh conditions females survive better than males even at infant ages when behavioral and social differences may be minimal or favor males. Our findings also indicate that the female advantage differs across environments and is modulated by social factors. PMID:29311321

  11. Do faster swimmers spend longer underwater than slower swimmers at World Championships?

    Science.gov (United States)

    Veiga, Santiago; Roig, Andreu; Gómez-Ruano, Miguel A

    2016-11-01

    The main objectives of the present research were (1) to examine the relationships between the distances travelled underwater during the start and turn segments with swimming race performance at the elite level and (2) to determine if the individualised-distance start and turn parameters affect the overall race performance. The race parameters of the 100 and 200 m events during 2013 World Championships were measured by an innovative image-processing system (InThePool(®) 2.0). Overall, 100 m race times were largely related to faster start velocities in men's breaststroke and freestyle events. Conversely, overall, 200 m race times were largely related to longer starting distances in the women's butterfly events, to longer turn distances in men's and women's backstroke and women's butterfly events and to shorter turn distances in women's freestyle events. Changes on the start or turn velocities could represent moderate time improvements in most of the 100 m events, whereas modifications on the start or turn distances (especially in the last turn) could provide elite swimmers with time improvements of practical importance on the 200 m events. The evaluation of races by individualised-distance parameters should be provided to elite swimmers in order to decide the most appropriate race segment configuration for each event.

  12. Hyaluronic Acid Injections in Medicare Knee Osteoarthritis Patients Are Associated With Longer Time to Knee Arthroplasty.

    Science.gov (United States)

    Ong, Kevin L; Anderson, Allen F; Niazi, Faizan; Fierlinger, Anke L; Kurtz, Steven M; Altman, Roy D

    2016-08-01

    Few nonoperative treatment options for knee osteoarthritis (OA) are available, but there is ongoing debate about the effectiveness of intra-articular (IA) hyaluronic acid (HA) injections. We investigated whether the formulation of IA HA, or its combined use with IA corticosteroid (CS), may be contributing to some of the reported variation in clinical outcomes. The 5% Part B Medicare data (2005-2012) were used to identify knee OA patients who underwent knee arthroplasty (KA). The time from diagnosis of OA to KA was compared between patients with (HA) and without (no HA) IA HA use, using quantile regression with propensity score adjustment. These were further stratified by type of IA HA. Patient factors associated with time to KA were also assessed using Cox regression. The "HA" cohort was associated with a longer time to KA of 8.7 months (95% confidence interval: 8.3-9.1 months; P injection use. Patients with both IA HA and IA CS had an additional 6.3 months (95% confidence interval: 5.5-7.0 months; P < .001) to KA over those with only IA HA. In a large cohort of elderly patients undergoing KA, there was a significant longer time from diagnosis of OA to KA in those receiving IA HA. It is unclear if the extended time may lead to less KA utilization. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Longer Breastfeeding in Infancy Decreases Systolic Hypertension Risk in Young Adults

    Directory of Open Access Journals (Sweden)

    Rak Karolina

    2016-07-01

    Full Text Available Many studies show that breastfeeding is associated with numerous direct and indirect health benefits for children in later life, although the relationship between breastfeeding and cardiovascular risk is still equivocal. The aim of this study was to investigate the relationship between duration of breastfeeding and cardiovascular risk in young adults. The cross-sectional study was conducted on a group of 128 volunteers (71 women and 57 men at the age of 19 years. It consisted of a questionnaire, together with anthropometric and blood pressure measurements. It was demonstrated that 90.3% of the participants had been breastfed and the mean duration of breastfeeding was 8.8±7.6 months. Participants who were breastfed for longer than six months had a significantly lower systolic blood pressure than those breastfed for less than six months. Results of analyses were consistent for the female group, the male group and the combined group. The results suggest that breastfeeding for longer than six months decreases systolic hypertension risk in young adults. The promotion of breastfeeding may decrease the rate of cardiovascular disease and thus improve health status of the population.

  14. Modification of the GS LT Paired-end Library Protocol for Constructing Longer Insert Size Libraries

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Peng, Ze; Hamilton, Matthew; Ting, Sara; Tu, Hank; Goltsman, Eugene; Lapidus, Alla; Lucas, Susan; Cheng, Jan-Fang

    2008-05-22

    Paired-end library sequencing has been proven useful in scaffold construction during de novo assembly of genomic sequences. The ability of generating mate pairs with 8 Kb or greater insert sizes is especially important for genomes containing long repeats. While the current 454 GS LT Paired-end library preparation protocol can successfully construct libraries with 3 Kb insert size, it fails to generate longer insert sizes because the protocol is optimized to purify shorter fragments. We have made several changes in the protocol in order to increase the fragment length. These changes include the use of Promega column to increase the yield of large size DNA fragments, two gel purification steps to remove contaminated short fragments, and a large reaction volume in the circularization step to decrease the formation of chimeras. We have also made additional changes in the protocol to increase the overall quality of the libraries. The quality of the libraries are measured by a set of metrics, which include levels of redundant reads, linker positive, linker negative, half linker reads, and driver DNA contamination, and read length distribution, were used to measure the primary quality of these libraries. We have also assessed the quality of the resulted mate pairs including levels of chimera, distribution of insert sizes, and genome coverage after the assemblies are completed. Our data indicated that all these changes have improved the quality of the longer insert size libraries.

  15. Can we afford to wait any longer? Pre-school children are ready to learn mathematics

    Directory of Open Access Journals (Sweden)

    Nosisi Nellie Feza

    2012-12-01

    Full Text Available South African students’ poor mathematics performance on national and international tests can be attributed to the gap the children begin schooling with from different socio economics homes. Wright et al assert that this gap continues to grow the longer students are in school. Early childhood research highlights the significant educational gains of exposing young children to quality, structured mathematical play or activity that goes beyond what is learned within the family and community. South Africa has high levels of poverty and inequality and also has tremendous difficulties in overcoming these inequalities. Most provision of quality pre-school education is private, self-funded and not targeted to poor children resulting to different levels of mathematics readiness prior entry to primary school. This paper argues for quality mathematics interventions, longitudinal studies on impact of such interventions and tracking studies on schooling effects of early quality mathematics preparation, higher education effects, and labour market effects.

  16. Consumption, Retirement and Social Security: Evaluating the Efficiency of Reform that Encourages Longer Careers.

    Science.gov (United States)

    Laitner, John; Silverman, Dan

    2012-08-01

    This paper proposes and analyzes a Social Security reform in which individuals no longer face the OASI payroll tax after, say, age 54 or a career of 34 years, and their subsequent earnings have no bearing on their benefits. We first estimate parameters of a life-cycle model. Our specification includes non-separable preferences and possible disability. It predicts a consumption-expenditure change at retirement. We use the magnitude of the expenditure change, together with households' retirement-age decisions, to identify key structural parameters. The estimated magnitude of the change in consumption-expenditure depends importantly on the treatment of consumption by adult children of the household. Simulations indicate that the reform could increase retirement ages one year or more, equivalent variations could average more than $4,000 per household, and income tax revenues per household could increase by more than $14,000.

  17. Targeted treatment trials for tuberous sclerosis and autism: no longer a dream.

    Science.gov (United States)

    Sahin, Mustafa

    2012-10-01

    Genetic disorders that present with a high incidence of autism spectrum disorders (ASD) offer tremendous potential both for elucidating the underlying neurobiology of ASD and identifying therapeutic drugs and/or drug targets. As a result, clinical trials for genetic disorders associated with ASD are no longer a hope for the future but rather an exciting reality whose time has come. Tuberous sclerosis complex (TSC) is one such genetic disorder that presents with ASD, epilepsy, and intellectual disability. Cell culture and mouse model experiments have identified the mTOR pathway as a therapeutic target in this disease. This review summarizes the advantages of using TSC as model of ASD and the recent advances in the translational and clinical treatment trials in TSC. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Systematic review and meta-analysis of randomized controlled trials for the management of limited vertical height in the posterior region: short implants (5 to 8 mm) vs longer implants (> 8 mm) in vertically augmented sites.

    Science.gov (United States)

    Lee, Sung-Ah; Lee, Chun-Teh; Fu, Martin M; Elmisalati, Waiel; Chuang, Sung-Kiang

    2014-01-01

    The aim of this study was to undertake a systematic review with meta-analysis on randomized controlled trials (RCTs) to compare the rates of survival, success, and complications of short implants to those of longer implants in the posterior regions. Electronic literature searches were conducted through the MEDLINE (PubMed) and EMBASE databases to locate all relevant articles published between January 1, 1990, and April 30, 2013. Eligible studies were selected based on inclusion criteria, and quality assessments were conducted. After data extraction, meta-analyses were performed. In total, 539 dental implants (265 short implants [length 5 to 8 mm] and 274 control implants [length > 8 mm]) from four RCTs were included. The fixed prostheses of multiple short and control implants were all splinted. The mean follow-up period was 2.1 years. The 1-year and 5-year cumulative survival rates (CSR) were 98.7% (95% confidence interval [CI], 97.8% to 99.5%) and 93.6% (95% CI, 89.8% to 97.5%), respectively, for the short implant group and 98.0% (95% CI, 96.9% to 99.1%) and 90.3% (95% CI, 85.2% to 95.4%), respectively, for the control implant group. The CSRs of the two groups did not demonstrate a statistically significant difference. There were also no statistically significant differences in success rates, failure rates, or complications between the two groups. Placement of short dental implants could be a predictable alternative to longer implants to reduce surgical complications and patient morbidity in situations where vertical augmentation procedures are needed. However, only four studies with potential risk of bias were selected in this meta-analysis. Within the limitations of this meta-analysis, these results should be confirmed with robust methodology and RCTs with longer follow-up duration.

  19. Using quality scores and longer reads improves accuracy of Solexa read mapping

    Directory of Open Access Journals (Sweden)

    Xuan Zhenyu

    2008-02-01

    Full Text Available Abstract Background Second-generation sequencing has the potential to revolutionize genomics and impact all areas of biomedical science. New technologies will make re-sequencing widely available for such applications as identifying genome variations or interrogating the oligonucleotide content of a large sample (e.g. ChIP-sequencing. The increase in speed, sensitivity and availability of sequencing technology brings demand for advances in computational technology to perform associated analysis tasks. The Solexa/Illumina 1G sequencer can produce tens of millions of reads, ranging in length from ~25–50 nt, in a single experiment. Accurately mapping the reads back to a reference genome is a critical task in almost all applications. Two sources of information that are often ignored when mapping reads from the Solexa technology are the 3' ends of longer reads, which contain a much higher frequency of sequencing errors, and the base-call quality scores. Results To investigate whether these sources of information can be used to improve accuracy when mapping reads, we developed the RMAP tool, which can map reads having a wide range of lengths and allows base-call quality scores to determine which positions in each read are more important when mapping. We applied RMAP to analyze data re-sequenced from two human BAC regions for varying read lengths, and varying criteria for use of quality scores. RMAP is freely available for downloading at http://rulai.cshl.edu/rmap/. Conclusion Our results indicate that significant gains in Solexa read mapping performance can be achieved by considering the information in 3' ends of longer reads, and appropriately using the base-call quality scores. The RMAP tool we have developed will enable researchers to effectively exploit this information in targeted re-sequencing projects.

  20. Longer Interset Rest Periods Enhance Muscle Strength and Hypertrophy in Resistance-Trained Men.

    Science.gov (United States)

    Schoenfeld, Brad J; Pope, Zachary K; Benik, Franklin M; Hester, Garrett M; Sellers, John; Nooner, Josh L; Schnaiter, Jessica A; Bond-Williams, Katherine E; Carter, Adrian S; Ross, Corbin L; Just, Brandon L; Henselmans, Menno; Krieger, James W

    2016-07-01

    Schoenfeld, BJ, Pope, ZK, Benik, FM, Hester, GM, Sellers, J, Nooner, JL, Schnaiter, JA, Bond-Williams, KE, Carter, AS, Ross, CL, Just, BL, Henselmans, M, and Krieger, JW. Longer interset rest periods enhance muscle strength and hypertrophy in resistance-trained men. J Strength Cond Res 30(7): 1805-1812, 2016-The purpose of this study was to investigate the effects of short rest intervals normally associated with hypertrophy-type training versus long rest intervals traditionally used in strength-type training on muscular adaptations in a cohort of young, experienced lifters. Twenty-one young resistance-trained men were randomly assigned to either a group that performed a resistance training (RT) program with 1-minute rest intervals (SHORT) or a group that employed 3-minute rest intervals (LONG). All other RT variables were held constant. The study period lasted 8 weeks with subjects performing 3 total body workouts a week comprised 3 sets of 8-12 repetition maximum (RM) of 7 different exercises per session. Testing was performed prestudy and poststudy for muscle strength (1RM bench press and back squat), muscle endurance (50% 1RM bench press to failure), and muscle thickness of the elbow flexors, triceps brachii, and quadriceps femoris by ultrasound imaging. Maximal strength was significantly greater for both 1RM squat and bench press for LONG compared to SHORT. Muscle thickness was significantly greater for LONG compared to SHORT in the anterior thigh, and a trend for greater increases was noted in the triceps brachii (p = 0.06) as well. Both groups saw significant increases in local upper body muscle endurance with no significant differences noted between groups. This study provides evidence that longer rest periods promote greater increases in muscle strength and hypertrophy in young resistance-trained men.

  1. Slower Perception Followed by Faster Lexical Decision in Longer Words: A Diffusion Model Analysis.

    Science.gov (United States)

    Oganian, Yulia; Froehlich, Eva; Schlickeiser, Ulrike; Hofmann, Markus J; Heekeren, Hauke R; Jacobs, Arthur M

    2015-01-01

    Effects of stimulus length on reaction times (RTs) in the lexical decision task are the topic of extensive research. While slower RTs are consistently found for longer pseudo-words, a finding coined the word length effect (WLE), some studies found no effects for words, and yet others reported faster RTs for longer words. Moreover, the WLE depends on the orthographic transparency of a language, with larger effects in more transparent orthographies. Here we investigate processes underlying the WLE in lexical decision in German-English bilinguals using a diffusion model (DM) analysis, which we compared to a linear regression approach. In the DM analysis, RT-accuracy distributions are characterized using parameters that reflect latent sub-processes, in particular evidence accumulation and decision-independent perceptual encoding, instead of typical parameters such as mean RT and accuracy. The regression approach showed a decrease in RTs with length for pseudo-words, but no length effect for words. However, DM analysis revealed that the null effect for words resulted from opposing effects of length on perceptual encoding and rate of evidence accumulation. Perceptual encoding times increased with length for words and pseudo-words, whereas the rate of evidence accumulation increased with length for real words but decreased for pseudo-words. A comparison between DM parameters in German and English suggested that orthographic transparency affects perceptual encoding, whereas effects of length on evidence accumulation are likely to reflect contextual information and the increase in available perceptual evidence with length. These opposing effects may account for the inconsistent findings on WLEs.

  2. Posterolateral Trajectories Favor a Longer Motor Domain in Subthalamic Nucleus Deep Brain Stimulation for Parkinson Disease.

    Science.gov (United States)

    Tamir, Idit; Marmor-Levin, Odeya; Eitan, Renana; Bergman, Hagai; Israel, Zvi

    2017-10-01

    The clinical outcome of patients with Parkinson disease (PD) who undergo subthalamic nucleus (STN) deep brain stimulation (DBS) is, in part, determined by the length of the electrode trajectory through the motor STN domain, the dorsolateral oscillatory region (DLOR). Trajectory length has been found to correlate with the stimulation-related improvement in patients' motor function (estimated by part III of the United Parkinson's Disease Rating Scale [UPDRS]). Therefore, it seems that ideally trajectories should have maximal DLOR length. We retrospectively studied the influence of various anatomic aspects of the brains of patients with PD and the geometry of trajectories planned on the length of the DLOR and STN recorded during DBS surgery. We examined 212 trajectories and 424 microelectrode recording tracks in 115 patients operated on in our center between 2010 and 2015. We found a strong correlation between the length of the recorded DLOR and STN. Trajectories that were more lateral and/or posterior in orientation had a longer STN and DLOR pass, although the DLOR/STN fraction length remained constant. The STN target was more lateral when the third ventricle was wider, and the latter correlated with older age and male gender. Trajectory angles correlate with the recorded STN and DLOR lengths, and should be altered toward a more posterolateral angle in older patients and atrophied brains to compensate for the changes in STN location and geometry. These fine adjustments should yield a longer motor domain pass, thereby improving the patient's predicted outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. A comparison of classroom and online asynchronous problem-based learning for students undertaking statistics training as part of a Public Health Masters degree.

    Science.gov (United States)

    de Jong, N; Verstegen, D M L; Tan, F E S; O'Connor, S J

    2013-05-01

    This case-study compared traditional, face-to-face classroom-based teaching with asynchronous online learning and teaching methods in two sets of students undertaking a problem-based learning module in the multilevel and exploratory factor analysis of longitudinal data as part of a Masters degree in Public Health at Maastricht University. Students were allocated to one of the two study variants on the basis of their enrolment status as full-time or part-time students. Full-time students (n = 11) followed the classroom-based variant and part-time students (n = 12) followed the online asynchronous variant which included video recorded lectures and a series of asynchronous online group or individual SPSS activities with synchronous tutor feedback. A validated student motivation questionnaire was administered to both groups of students at the start of the study and a second questionnaire was administered at the end of the module. This elicited data about student satisfaction with the module content, teaching and learning methods, and tutor feedback. The module coordinator and problem-based learning tutor were also interviewed about their experience of delivering the experimental online variant and asked to evaluate its success in relation to student attainment of the module's learning outcomes. Student examination results were also compared between the two groups. Asynchronous online teaching and learning methods proved to be an acceptable alternative to classroom-based teaching for both students and staff. Educational outcomes were similar for both groups, but importantly, there was no evidence that the asynchronous online delivery of module content disadvantaged part-time students in comparison to their full-time counterparts.

  4. Cats and owners interact more with each other after a longer duration of separation.

    Directory of Open Access Journals (Sweden)

    Matilda Eriksson

    Full Text Available Little is known about the cat's (Felis silvestris catus need for human contact, although it is generally believed that cats are more independent pets than e.g. dogs. In this study, we investigated the effect of time left alone at home on cat behaviour (e.g. social and distress-related before, during and after separation from their owner. Fourteen privately owned cats (single-housed were each subjected to two treatments: the cat was left alone in their home environment for 30 min (T0.5 and for 4 h (T4. There were no differences between treatments in the behaviour of the cat (or owner before owner departure, nor during the first 5 min of separation. During separation, cats were lying down resting proportionally less (T = 22.5, P = 0.02 in T0.5 (0.27±0.1 (mean±SE compared to in T4 (0.58±0.08, probably due to a similar duration of higher activity early in the separation phase in both treatments. Comparisons of the time interval (min 20-25 in both treatments indicated no differences across treatments, which supports such an explanation. Towards the end of the separation phase (the last two 5-min intervals of separation in both treatments, no differences were observed in the cats' behaviour, indicating that cats were unaffected by separation length. At reunion however, cats purred more (T = 10.5, P = 0.03 and stretched their body more (T = 17, P = 0.04 after a longer duration of separation (T4:0.05±0.02; 0.03±0.01; T0.5: 0.01±0.007; 0.008±0.003. Also, owners initiated more verbal contact (T = 33.5, P = 0.04 after 4 h (0.18±0.05 compared to after 30 min (0.12±0.03. There was no evidence of any correlations between the level of purring or body stretching by the cat and verbal contact by the owner implying that the behavioural expressions seen in the cats are independent of the owner's behaviour. Hence, it seemed as cats coped well with being left alone, but they were affected by the time they were left alone, since they expressed differences in

  5. Post-sleep inertia performance benefits of longer naps in simulated nightwork and extended operations.

    Science.gov (United States)

    Mulrine, Hannah M; Signal, T Leigh; van den Berg, Margo J; Gander, Philippa H

    2012-11-01

    Operational settings involving shiftwork or extended operations require periods of prolonged wakefulness, which in conjunction with sleep loss and circadian factors, can have a negative impact on performance, alertness, and workplace safety. Napping has been shown to improve performance and alertness after periods of prolonged wakefulness and sleep loss. Longer naps may not only result in longer-lasting benefits but also increase the risk of sleep inertia immediately upon waking. The time course of performance after naps of differing durations is thus an important consideration in weighing the benefits and risks of napping in workplace settings. The objective of this study was to evaluate the effectiveness of nap opportunities of 20, 40, or 60 min for maintaining alertness and performance 1.5-6 h post-nap in simulated nightwork (P1) or extended operations (P2). Each protocol included 12 participants in a within-subjects design in a controlled laboratory environment. After a baseline 8 h time-in-bed, healthy young males (P1 mean age 25.1 yr; P2 mean age 23.2 yr) underwent either ≈ 20 h (P1) or ≈ 30 h (P2) of sleep deprivation on four separate occasions, followed by nap opportunities of 0, 20, 40, and 60 min. Sleep on the baseline night and during the naps was recorded polysomnographically. During the nap opportunities, sleep onset latency was short and sleep efficiency was high. A greater proportion of slow-wave sleep (SWS) was obtained in nap opportunities of 40 and 60 min compared with 20 min. Rapid eye movement (REM) sleep occurred infrequently. A subjective sleepiness rating (Karolinska Sleepiness Scale, KSS), 2-Back Working Memory Task (WMT), and Psychomotor Vigilance Task (PVT) were completed 1.5, 2, 2.5, 3, 4, 5, and 6 h post-nap. The slowest 10% of PVT responses were significantly faster after 40 and 60 min naps compared with a 20 min (P1) or no (P2) nap. There were significantly fewer PVT lapses after 40 and 60 min naps compared with no nap (P2), and

  6. Cats and owners interact more with each other after a longer duration of separation.

    Science.gov (United States)

    Eriksson, Matilda; Keeling, Linda J; Rehn, Therese

    2017-01-01

    Little is known about the cat's (Felis silvestris catus) need for human contact, although it is generally believed that cats are more independent pets than e.g. dogs. In this study, we investigated the effect of time left alone at home on cat behaviour (e.g. social and distress-related) before, during and after separation from their owner. Fourteen privately owned cats (single-housed) were each subjected to two treatments: the cat was left alone in their home environment for 30 min (T0.5) and for 4 h (T4). There were no differences between treatments in the behaviour of the cat (or owner) before owner departure, nor during the first 5 min of separation. During separation, cats were lying down resting proportionally less (T = 22.5, P = 0.02) in T0.5 (0.27±0.1 (mean±SE)) compared to in T4 (0.58±0.08), probably due to a similar duration of higher activity early in the separation phase in both treatments. Comparisons of the time interval (min 20-25) in both treatments indicated no differences across treatments, which supports such an explanation. Towards the end of the separation phase (the last two 5-min intervals of separation in both treatments), no differences were observed in the cats' behaviour, indicating that cats were unaffected by separation length. At reunion however, cats purred more (T = 10.5, P = 0.03) and stretched their body more (T = 17, P = 0.04) after a longer duration of separation (T4:0.05±0.02; 0.03±0.01; T0.5: 0.01±0.007; 0.008±0.003). Also, owners initiated more verbal contact (T = 33.5, P = 0.04) after 4 h (0.18±0.05) compared to after 30 min (0.12±0.03). There was no evidence of any correlations between the level of purring or body stretching by the cat and verbal contact by the owner implying that the behavioural expressions seen in the cats are independent of the owner's behaviour. Hence, it seemed as cats coped well with being left alone, but they were affected by the time they were left alone, since they expressed differences in

  7. Diminish electrostatic in piezoresponse force microscopy through longer or ultra-stiff tips

    Science.gov (United States)

    Gomez, A.; Puig, T.; Obradors, X.

    2018-05-01

    Piezoresponse Force Microscopy is a powerful but delicate nanoscale technique that measures the electromechanical response resulting from the application of a highly localized electric field. Though mechanical response is normally due to piezoelectricity, other physical phenomena, especially electrostatic interaction, can contribute to the signal read. We address this problematic through the use of longer ultra-stiff probes providing state of the art sensitivity, with the lowest electrostatic interaction and avoiding working in high frequency regime. In order to find this solution we develop a theoretical description addressing the effects of electrostatic contributions in the total cantilever vibration and its quantification for different setups. The theory is subsequently tested in a Periodically Poled Lithium Niobate (PPLN) crystal, a sample with well-defined 0° and 180° domains, using different commercial available conductive tips. We employ the theoretical description to compare the electrostatic contribution effects into the total phase recorded. Through experimental data our description is corroborated for each of the tested commercially available probes. We propose that a larger probe length can be a solution to avoid electrostatic forces, so the cantilever-sample electrostatic interaction is reduced. Our proposed solution has great implications into avoiding artifacts while studying soft biological samples, multiferroic oxides, and thin film ferroelectric materials.

  8. Moderate threat causes longer lasting disruption to processing in anxious individuals

    Directory of Open Access Journals (Sweden)

    Sophie eForster

    2014-08-01

    Full Text Available Anxiety is associated with increased attentional capture by threat. Previous studies have used simultaneous or briefly separated (< 1s presentation of threat distractors and target stimuli. Here, we tested the hypothesis that high trait anxious participants would show a longer time window within which distractors cause disruption to subsequent task processing, and that this would particularly be observed for stimuli of moderate or ambiguous threat value. A novel temporally separated emotional distractor task was used. Face or house distractors were presented for 250ms at short (~1.6s or long (~3s intervals prior to a letter string comprising Xs or Ns. Trait anxiety was associated with slowed identification of letter strings presented at long intervals after face distractors with part surprise / part fear expressions. In other words, these distractors had an impact on high anxious individuals’ speed of target identification seconds after their offset. This was associated with increased activity in the fusiform gyrus and amygdala and reduced dorsal anterior cingulate recruitment. This pattern of activity may reflect impoverished recruitment of reactive control mechanisms to damp down stimulus-specific processing in subcortical and higher visual regions. These findings have implications for understanding how threat-related attentional biases in anxiety may lead to dysfunction in everyday settings where stimuli of moderate, potentially ambiguous, threat value such as those used here are fairly common, and where attentional disruption lasting several seconds may have a profound impact.

  9. Emotion self-regulation and empathy depend upon longer stimulus exposure.

    Science.gov (United States)

    Ikezawa, Satoru; Corbera, Silvia; Wexler, Bruce E

    2014-10-01

    Observation of others in pain induces positive elevation (pain effect) in late event-related potentials (ERP). This effect is associated with top-down attention regulating processes. It has previously been shown that stimulus exposure duration can affect top-down attentional modulation of response to threat-related stimuli. We investigated the effect of exposure duration on ERP response to others in pain. Two late ERP components, P3 and late positive potentials (LPP), from 18 healthy people were measured while they viewed pictures of hands in painful or neutral situations for either 200 or 500 ms, during two task conditions (pain judgment and counting hands). P3 and LPP pain effects during the pain judgment condition were significantly greater with 500 ms than 200 ms stimulus presentation. Ours is the first study to suggest that engagement of empathy-related self-regulatory processes reflected in late potentials requires longer exposure to the pain-related stimulus. Although this is important information about the relationship between early sensory and subsequent brain processing, and about engagement of self-regulatory processes, the neural basis of this time-dependence remains unclear. It might be important to investigate the relationship between stimulus duration and empathic response in clinical populations where issues of self-regulation, empathic response and speed of information processing exist. © The Author (2013). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  10. Rolling stones and turbulent eddies: why the bigger live longer and travel farther

    Science.gov (United States)

    Bejan, Adrian

    2016-02-01

    Here we report the discovery that even the simplest, oldest and most prevalent forms of evolutionary movement—rolling bodies and whirls of turbulence—exhibit the same body-size effect on life time and life travel as the evolutionary movement united by the body-size effect so far: animals, rivers, vehicles, jets and plumes. In short, the bigger should last longer and travel farther. For rolling bodies, the life span (t) and the life travel (L) should increase with the body mass (M) raised to the powers 1/6 and 1/3, respectively. The number of rolls during this movement is constant, independent of body size. For an eddy of turbulence, t should increase with the eddy mass (M) raised to the power 2/3, while L should increase with M2/3 times the bulk speed of the turbulent stream that carries the eddy. The number of rolls during the eddy life span is a constant independent of eddy size.

  11. Longer duration of obesity is associated with a reduction in urinary angiotensinogen in prepubertal children.

    Science.gov (United States)

    Morato, Manuela; Correia-Costa, Liane; Sousa, Teresa; Cosme, Dina; Schaefer, Franz; Areias, José Carlos; Guerra, António; Afonso, Alberto Caldas; Barros, Henrique; Azevedo, Ana; Albino-Teixeira, António

    2017-08-01

    We aimed to study the impact of obesity on urinary excretion of angiotensinogen (U-AGT) in prepubertal children, focusing on the duration of obesity and gender. Also, we aimed to evaluate whether plasma angiotensinogen (P-AGT) and hydrogen peroxide (H 2 O 2 ) play a role in the putative association. Cross-sectional evaluation of 305 children aged 8-9 years (160 normal weight, 86 overweight, and 59 obese). Anthropometric measurements and 24-h ambulatory blood pressure monitoring were performed. Angiotensinogen (AGT) was determined by a commercial enzyme-linked immunosorbent assay (ELISA) kit and H 2 O 2 by a microplate fluorometric assay. U-AGT and P-AGT levels were similar across body mass index (BMI) groups and between sexes. However, boys who were overweight/obese since the age of 4 years presented lower levels of U-AGT compared with those of normal weight at the same age. In children who were overweight/obese since the age of 4, urinary H 2 O 2 decreased with P-AGT. A higher duration of obesity was associated with decreased U-AGT in boys, thus reflecting decreased intrarenal activity of the renin-angiotensin system. Also, children with a longer duration of obesity showed an inverse association between urinary H 2 O 2 and P-AGT. Future studies should address whether these results reflect an early compensatory mechanism to limit obesity-triggered renal dysfunction.

  12. Longer time interval between semen processing and intrauterine insemination does not affect pregnancy outcome.

    Science.gov (United States)

    Jansen, Charlotte H J R; Elisen, Marc G L M; Leenstra, Cor W; Kaaijk, Eugenie M; van Stralen, Karlijn J; Verhoeve, Harold R

    2017-11-01

    To study whether the pregnancy outcome of intrauterine insemination (IUI) is affected by a longer time interval between semen processing and insemination. Retrospective cohort. Teaching hospital. Couples with subfertility and an indication for IUI over a 10-year period. Insemination performed the day after but within 24 hours of semen collection and processing (delayed insemination) compared with insemination performed immediately after sperm collection and processing (immediate insemination). Ongoing pregnancy rate, defined as a pregnancy confirmed by ultrasound at 10 to 12 weeks of gestation. In total, 1,136 cycles were analyzed. In 77 of 547 couples (14%) an ongoing pregnancy occurred after delayed insemination, and in 77 of 589 couples (13%) an ongoing pregnancy occurred after immediate insemination. Both groups had similar baseline characteristics. After adjustment for confounders, there was no difference in the ongoing pregnancy rate between delayed as compared with immediate insemination (odds ratio 0.89; 95% confidence interval, 0.63-1.25). There is no negative effect on pregnancy rate when IUI of processed sperm is delayed until the next day. This approach allows additional flexibility for couples when the male partner is not available on the day of ovulation, and it allows for a spread of workload in the laboratory. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Intellectual maturity and longevity: late-blooming composers and writers live longer than child prodigies.

    Science.gov (United States)

    Hafkamp, Maurits P J; Slaets, Joris P J; van Bodegom, David

    2017-05-30

    Life history theory links human physical and sexual development to longevity. However, there have been no studies on the association of intellectual development with longevity. This observational study investigates the relationship between the onset of intellectual maturity and lifespan through the life histories of composers and creative writers, whose intellectual development can be gauged through their compositions and writings. In these groups we model the relationship between the age at first creative work, and age at death using multilevel regression, adjusting for sex, date of birth, and nationality. Historical biographical records on 1110 musical composers and 1182 creative writers, born in the period 1400 AD through 1915 AD, were obtained from the Oxford Companion to Music and the Oxford Companion to English Literature. Composers and creative writers lived, respectively 0.16 ( p = 0.02) and 0.18 ( p < 0.01) years longer for each later year of age at first work. When completion of the first creative work is interpreted as a proxy for the onset of intellectual maturity in composers and creative writers, our findings indicate that a later onset of intellectual maturity is associated with higher longevity.

  14. Very slow classical Cepheids - Theoretical models with periods longer than 50 days

    Science.gov (United States)

    Carson, T. R.; Stothers, R. B.

    1984-01-01

    Systematics of the light curves of classical Cepheids with the longest known periods have been investigated with the help of full-amplitude models of pulsating stellar envelopes. For periods exceeding about 60 days, flat-topped light curves of the S Vul type are found to replace the smooth, asymmetric light curves characteristic of the slightly faster Cepheids. Predicted light and velocity amplitudes (although not the predicted radius amplitudes) agree well with observations. Variables with fluctuating light minima are observed to lie well off the mean period-luminosity relation, as are a few other (more stable?) variables with similarly long periods. The explanation for the long periods is probably low effective temperature rather than a low stellar mass. Because of the abnormal slowness of the classical Cepheids with periods longer than about 100 days, it is recommended that these variables not be used to calibrate the mean period-luminosity relation. Analogies between the slow classical Cepheids and the slow Population II Cepheids are drawn.

  15. News from the Library: Microsoft products no longer on sale at the Bookshop

    CERN Multimedia

    CERN Library

    2013-01-01

    As you might know, for some time the Bookshop also acted as a point of sale of Microsoft products. Please note that this is no longer the case.   The Swiss distributor of Microsoft software - DirAction AG - provides a website where CERN users can acquire copies of Microsoft software for home use. This website is available in three languages - English, French and German - and accepts payments by credit card or by money transfer from a bank account or PayPal. Should you have any problems or questions relating to this website, you can contact the DirAction Team directly at + 41 43 299 44 00 or using the contact form. Note that the CERN Service Desk will not be able to assist you as this is a service provided by DirAction rather than CERN IT. Please refer to this website for complete information on how to purchase Microsoft products. Your feedback is welcome! Please contact us by e-mail.

  16. Generation of longer 3' cDNA fragments from massively parallel signature sequencing tags.

    Science.gov (United States)

    Silva, Ana Paula M; Chen, Jianjun; Carraro, Dirce M; Wang, San Ming; Camargo, Anamaria A

    2004-07-06

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3'end of transcripts. A single MPSS experiment can generate over 10(7) tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (approximately 1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3' cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts.

  17. Generation of longer 3′ cDNA fragments from massively parallel signature sequencing tags

    Science.gov (United States)

    Silva, Ana Paula M.; Chen, Jianjun; Carraro, Dirce M.; Wang, San Ming; Camargo, Anamaria A.

    2004-01-01

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3′end of transcripts. A single MPSS experiment can generate over 107 tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (∼1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3′ cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts. PMID:15247327

  18. Development of longer Nd:LGGG crystal for high power laser application

    Science.gov (United States)

    Yin, Yanru; Tian, Hanlin; Zhang, Jian; Mu, Wenxiang; Zhang, Baitao; Jia, Zhitai; He, Jingliang; Tao, Xutang

    2017-11-01

    In order to further improve the Nd3+:(LuxGd1-x)3Ga5O12 (Nd:LGGG) crystal performance in high power laser field, a long Nd:LGGG crystal with dimensions of Φ 23 × 112 mm3 has been grown successfully by the Czochralski (Cz) method for laser rod fabrication. Compared with the normal size LGGG crystals (like 30-50 mm in length), we overcame several difficulties in the growth of longer ones, including crystal cracking by a large longitudinal temperature gradient, spiral growth by a small radial temperature gradient, and growth instability and even constitutional super cooling by Ga2O3 volatilizing continuously. The doping concentrations of Nd3+ and Lu3+ in the as-grown crystal and the crystal optical quality have been measured. The performance of diode-side-pumped Nd:LGGG rod laser has been preliminarily tested for the first time, simply by replacing the Nd:YAG crystal rod inside a commercial laser module. Under an incident pump power of 160 W, the maximum continuous wave output power of 38 W has been obtained, corresponding to an optical-optical conversion efficiency of 23.8% and a slope efficiency of 40.8%, respectively.

  19. Does eating less make you live longer and better? An update on calorie restriction

    Directory of Open Access Journals (Sweden)

    Picca A

    2017-11-01

    Full Text Available Anna Picca,1 Vito Pesce,2 Angela Maria Serena Lezza2 1Department of Geriatrics, Neuroscience and Orthopedics, Catholic University of the Sacred Heart School of Medicine, Rome, 2Department of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari, Bari, Italy Abstract: The complexity of aging is hard to be captured. However, apart from its tissue-specific features, a structural and functional progressive decline of the whole organism that leads to death, often preceded by a phase of chronic morbidity, characterizes the common process of aging. Therefore, the research goal of scientists in the field moved from the search for strategies able to extend longevity to those ensuring healthy aging associated with a longer lifespan referred to as “healthspan”. The aging process is plastic and can be tuned by multiple mechanisms including dietary and genetic interventions. To date, the most robust approach, efficient in warding off the cellular markers of aging, is calorie restriction (CR. Here, after a preliminary presentation of the major debate originated by CR, we concisely overviewed the recent results of CR treatment on humans. We also provided an update on the molecular mechanisms involved by CR and the effects on some of the age-associated cellular markers. We finally reviewed a number of tested CR mimetics and concluded with an evaluation of future applications of such dietary approach. Keywords: aging, calorie restriction, studies on humans, CR molecular mechanisms, CR mimetics

  20. Motivations for undertaking DNA sequencing-based non-invasive prenatal testing for fetal aneuploidy: a qualitative study with early adopter patients in Hong Kong.

    Science.gov (United States)

    Yi, Huso; Hallowell, Nina; Griffiths, Sian; Yeung Leung, Tak

    2013-01-01

    A newly introduced cell-free fetal DNA sequencing based non-invasive prenatal testing (DNA-NIPT) detects Down syndrome with sensitivity of 99% at early gestational stage without risk of miscarriage. Attention has been given to its public health implications; little is known from consumer perspectives. This qualitative study aimed to explore women's motivations for using, and perceptions of, DNA-NIPT in Hong Kong. In-depth interviews were conducted with 45 women who had undertaken DNA-NIPT recruited by purposive sampling based on socio-demographic and clinical characteristics. The sample included 31 women identified as high-risk from serum and ultrasound based Down syndrome screening (SU-DSS). Thematic narrative analysis examined informed-decision making of the test and identified the benefits and needs. Women outlined a number of reasons for accessing DNA-NIPT: reducing the uncertainty associated with risk probability-based results from SU-DSS, undertaking DNA-NIPT as a comprehensive measure to counteract risk from childbearing especially at advanced age, perceived predictive accuracy and absence of risk of harm to fetus. Accounts of women deemed high-risk or not high-risk are distinctive in a number of respects. High-risk women accessed DNA-NIPT to get a clearer idea of their risk. This group perceived SU-DSS as an unnecessary and confusing procedure because of its varying, protocol-dependent detection rates. Those women not deemed high-risk, in contrast, undertook DNA-NIPT for psychological assurance and to reduce anxiety even after receiving the negative result from SU-DSS. DNA-NIPT was regarded positively by women who chose this method of screening over the routine, less expensive testing options. Given its perceived utility, health providers need to consider whether DNA-NIPT should be offered as part of universal routine care to women at high-risk for fetal aneuploidy. If this is the case, then further development of guidelines and quality assurance will be

  1. Motivations for undertaking DNA sequencing-based non-invasive prenatal testing for fetal aneuploidy: a qualitative study with early adopter patients in Hong Kong.

    Directory of Open Access Journals (Sweden)

    Huso Yi

    Full Text Available BACKGROUND: A newly introduced cell-free fetal DNA sequencing based non-invasive prenatal testing (DNA-NIPT detects Down syndrome with sensitivity of 99% at early gestational stage without risk of miscarriage. Attention has been given to its public health implications; little is known from consumer perspectives. This qualitative study aimed to explore women's motivations for using, and perceptions of, DNA-NIPT in Hong Kong. METHODS AND FINDINGS: In-depth interviews were conducted with 45 women who had undertaken DNA-NIPT recruited by purposive sampling based on socio-demographic and clinical characteristics. The sample included 31 women identified as high-risk from serum and ultrasound based Down syndrome screening (SU-DSS. Thematic narrative analysis examined informed-decision making of the test and identified the benefits and needs. Women outlined a number of reasons for accessing DNA-NIPT: reducing the uncertainty associated with risk probability-based results from SU-DSS, undertaking DNA-NIPT as a comprehensive measure to counteract risk from childbearing especially at advanced age, perceived predictive accuracy and absence of risk of harm to fetus. Accounts of women deemed high-risk or not high-risk are distinctive in a number of respects. High-risk women accessed DNA-NIPT to get a clearer idea of their risk. This group perceived SU-DSS as an unnecessary and confusing procedure because of its varying, protocol-dependent detection rates. Those women not deemed high-risk, in contrast, undertook DNA-NIPT for psychological assurance and to reduce anxiety even after receiving the negative result from SU-DSS. CONCLUSIONS: DNA-NIPT was regarded positively by women who chose this method of screening over the routine, less expensive testing options. Given its perceived utility, health providers need to consider whether DNA-NIPT should be offered as part of universal routine care to women at high-risk for fetal aneuploidy. If this is the case, then

  2. "Ensure that you are well aware of the risks you are taking…": actions and activities medical tourists' informal caregivers can undertake to protect their health and safety.

    Science.gov (United States)

    Crooks, Valorie A; Whitmore, Rebecca; Snyder, Jeremy; Turner, Leigh

    2017-05-22

    When seeking care at international hospitals and clinics, medical tourists are often accompanied by family members, friends, or other caregivers. Such caregiver-companions assume a variety of roles and responsibilities and typically offer physical assistance, provide emotional support, and aid in decision-making and record keeping as medical tourists navigate unfamiliar environments. While traveling abroad, medical tourists' caregiver-companions can find themselves confronted with challenging communication barriers, financial pressures, emotional strain, and unsafe environments. To better understand what actions and activities medical tourists' informal caregivers can undertake to protect their health and safety, 20 interviews were conducted with Canadians who had experienced accompanying a medical tourist to an international health care facility for surgery. Interview transcripts were subsequently used to identify inductive and deductive themes central to the advice research participants offered to prospective caregiver-companions. Advice offered to future caregiver-companions spanned the following actions and activities to protect health and safety: become an informed health care consumer; assess and avoid exposure to identifiable risks; anticipate the care needs of medical tourists and thereby attempt to guard against caregiver burden; become familiar with important logistics related to travel and anticipated recovery timelines; and take practical measures to protect one's own health. Given that a key feature of public health is to use research findings to develop interventions and policies intended to promote health and reduce risks to individuals and populations, the paper draws upon major points of advice offered by study participants to take the first steps toward the development of an informational intervention designed specifically for the health and safety needs of medical tourists' caregiver companions. While additional research is required to finalize

  3. The Homeless Mentally Ill: No Longer Out of Sight and Out of Mind. Human Services Series.

    Science.gov (United States)

    Craig, Rebecca T.; Paterson, Andrea

    1988-01-01

    The homeless mentally ill, numbering approximately 300,000 persons, are a group neglected and forgotten by society. While deinstitutionalization promised a bright future, the necessary, long-term support to implement deinstitutionalization never materialized. Government policies have helped produce problems that encourage recidivism and…

  4. The Strategic Academic Enterprise: Why ERPs Will No Longer Be Adequate

    Science.gov (United States)

    Jones, Mary

    2009-01-01

    In the 1970s and '80s, manufacturing firms began purchasing centralized administrative software--"Enterprise Resource Planning (ERP) systems"--to support their infrastructure needs. In the 1990s, higher education adopted the term ERP to define the back-office systems used by institutions to meet their most pressing business needs--typically those…

  5. Leading Short-Term Study Abroad Courses: Motivations and Outcomes for Community College Faculty

    Science.gov (United States)

    Hull, Melinda Leigh

    2013-01-01

    This case study explored faculty motivations for choosing to lead short-term study abroad courses and the personal and professional outcomes of the undertaking as reported by the faculty members themselves. This study also identified specific instances of internationalized practice in the development and implementation of the course. Three faculty…

  6. Longer Intestinal Persistence of Enterococcus faecalis Compared to Enterococcus faecium Clones in Intensive-Care-Unit Patients▿

    Science.gov (United States)

    Ruiz-Garbajosa, Patricia; del Campo, Rosa; Coque, Teresa M.; Asensio, Angel; Bonten, Marc; Willems, Rob; Baquero, Fernando; Cantón, Rafael

    2009-01-01

    The dynamics of intestinal colonization with enterococcal clones in intensive-care-unit (ICU) patients was evaluated. Eight patients admitted directly to the neurosurgical ICU at the Ramón y Cajal University Hospital (Madrid, Spain) from the community and with no overlapping stay during a 10-month period in 2006 were studied. Rectal swab specimens were collected on admission and daily until the patients were discharged. Clonality was determined by pulsed-field gel electrophoresis and multilocus sequence typing. Clonal colonization dynamics were estimated by using two new parameters: the clonal diversity per patient per day (CDPD) and the clonal persistence ratio (CPR). Enterococcus faecalis isolates (n = 123) and Enterococcus faecium isolates (n = 66) were resolved into 13 and 15 clones, respectively. The CDPD of E. faecalis steadily increased during admission, and E. faecalis showed a higher (P = 0.001) CPR value than E. faecium (0.86 and 0.42, respectively). E. faecium, with the exception of an ampicillin-resistant clone belonging to clonal complex 17, frequently appeared as a short-term colonizer, even though the E. faecalis clones had significantly (P = 0.03) more days under antibiotic exposure than E. faecium (77.5 and 65 days/100 colonization days, respectively). E. faecalis had a longer persistence than E. faecium, except for the CC17 ampicillin-resistant clone, and E. faecalis showed a cumulative increase in CDPD, whereas E. faecium did not. CDPD and CPR were useful for measuring the dynamics of intestinal colonization with enterococcal clones. PMID:19052172

  7. A low psoas muscle volume predicts longer hospitalization and cancer recurrence in upper urinary tract urothelial carcinoma.

    Science.gov (United States)

    Tsutsumi, Sohgo; Kawahara, Takashi; Teranishi, Jun-Ichi; Yao, Masahiro; Uemura, Hiroji

    2018-02-01

    The aging population is becoming a primary global problem. The most important alteration that occurs in the body with age, is the loss of skeletal muscle. Previously, sarcopenia, which is associated with the loss of skeletal muscle, has been reported to be associated with the prognosis of cancer and complications. The present study investigated the importance of sarcopenia with regard to the prognosis or postoperative complications of upper urothelial cancer patients who underwent nephro-ureterectomy. A total of sixty patients (male, n=44; female, n=16) underwent nephro-ureterectomy for upper urothelial carcinoma. The psoas muscle volume was calculated at the level of the umbilicus using axial computed tomography images obtained prior to nephro-ureterectomy. The psoas muscle index (PMI) was calculated by the following formula: (right side psoas muscle area at the level of the umbilicus mm 2 )/(body height m) 2 . The median and mean (± standard deviation) ages of the 44 patients were 71 and 68.0 years (± 12.2 years). The lower PMI group demonstrated a significantly poorer recurrence-free survival compared with the higher PMI group (634 vs. 2,317 days, P=0.005). In terms of the duration of postoperative admission, the long-admission group (≥13 days) demonstrated a significantly lower PMI compared with the short-admission group (≤12 days) (383.0 vs. 433.1, P=0.039). Although the overall survival of the two groups did not differ significantly, the lower PMI group tended to have a shorter survival period compared with the higher PMI group (P=0.080). Of the patients with upper urothelial carcinoma, the lower PMI group exhibited a longer postoperative admission period and poorer recurrence-free survival compared with the higher PMI group. The present findings suggest that sarcopenia is a meaningful factor that should be considered when selecting therapy for upper urothelial carcinoma.

  8. Ethnographic Study at a Music Library Found Students Prefer Short Stopovers and Longer Solitary Study

    Directory of Open Access Journals (Sweden)

    Dominique Daniel

    2014-04-01

    technology. According to data from the flip books, 44% engaged in multitasking, which was therefore significant but not preferred. It was more likely to occur when electronic technology was involved. Patrons were most likely to be present in the library for less than 5 minutes or more than 20 minutes. Patrons who stayed in the library for only a short time were more likely to engage in leisure activities than those who stayed longer, but leisure activities overall were as prevalent as study time. The technology lab and the reference area were the most popular zones. Users stayed in the technology lab and stacks for short times only, whereas the reference area and carrels were favored for long visits. Users engaged in multitasking mostly in the carrels and reference area. Conclusion – The patrons’ preference for solitary study is at odds with academic libraries’ current interest in collaborative learning spaces, but can be explained by the specific nature of music studies (artistic creation is a solitary activity, and is in line with previous ethnographic studies of public libraries. Music students presumably use the technology labs for short visits between classes. They favor the study carrels for longer stays where they can multitask, using their own laptops and iPods. These findings can be used to help redesign the library. Design recommendations include placing the technology lab by the entrance to enable quick coming and going, increasing the number of carrels, placing them in quiet parts of the library, and equipping them with electrical outlets.

  9. Length Is Associated with Pain: Jellyfish with Painful Sting Have Longer Nematocyst Tubules than Harmless Jellyfish.

    Directory of Open Access Journals (Sweden)

    Ryuju Kitatani

    Full Text Available A large number of humans are stung by jellyfish all over the world. The stings cause acute pain followed by persistent pain and local inflammation. Harmful jellyfish species typically cause strong pain, whereas harmless jellyfish cause subtle or no pain. Jellyfish sting humans by injecting a tubule, contained in the nematocyst, the stinging organ of jellyfish. The tubule penetrates into the skin leading to venom injection. The detailed morphology of the nematocyst tubule and molecular structure of the venom in the nematocyst has been reported; however, the mechanism responsible for the difference in pain that is caused by harmful and harmless jellyfish sting has not yet been explored or explained. Therefore, we hypothesized that differences in the length of the nematocyst tubule leads to different degrees of epithelial damage. The initial acute pain might be generated by penetration of the tubule, which stimulates pain receptor neurons, whilst persistent pain might be caused by injection of venom into the epithelium. To test this hypothesis we compared the lengths of discharged nematocyst tubules from harmful and harmless jellyfish species and evaluated their ability to penetrate human skin. The results showed that the harmful jellyfish species, Chrysaora pacifica, Carybdea brevipedalia, and Chironex yamaguchii, causing moderate to severe pain, have nematocyst tubules longer than 200 μm, compared with a jellyfish species that cause little or no pain, Aurelia aurita. The majority of the tubules of harmful jellyfishes, C. yamaguchii and C. brevipedalia, were sufficiently long to penetrate the human epidermis and physically stimulate the free nerve endings of Aδ pain receptor fibers around plexuses to cause acute pain and inject the venom into the human skin epithelium to cause persistent pain and inflammation.

  10. Length Is Associated with Pain: Jellyfish with Painful Sting Have Longer Nematocyst Tubules than Harmless Jellyfish.

    Science.gov (United States)

    Kitatani, Ryuju; Yamada, Mayu; Kamio, Michiya; Nagai, Hiroshi

    2015-01-01

    A large number of humans are stung by jellyfish all over the world. The stings cause acute pain followed by persistent pain and local inflammation. Harmful jellyfish species typically cause strong pain, whereas harmless jellyfish cause subtle or no pain. Jellyfish sting humans by injecting a tubule, contained in the nematocyst, the stinging organ of jellyfish. The tubule penetrates into the skin leading to venom injection. The detailed morphology of the nematocyst tubule and molecular structure of the venom in the nematocyst has been reported; however, the mechanism responsible for the difference in pain that is caused by harmful and harmless jellyfish sting has not yet been explored or explained. Therefore, we hypothesized that differences in the length of the nematocyst tubule leads to different degrees of epithelial damage. The initial acute pain might be generated by penetration of the tubule, which stimulates pain receptor neurons, whilst persistent pain might be caused by injection of venom into the epithelium. To test this hypothesis we compared the lengths of discharged nematocyst tubules from harmful and harmless jellyfish species and evaluated their ability to penetrate human skin. The results showed that the harmful jellyfish species, Chrysaora pacifica, Carybdea brevipedalia, and Chironex yamaguchii, causing moderate to severe pain, have nematocyst tubules longer than 200 μm, compared with a jellyfish species that cause little or no pain, Aurelia aurita. The majority of the tubules of harmful jellyfishes, C. yamaguchii and C. brevipedalia, were sufficiently long to penetrate the human epidermis and physically stimulate the free nerve endings of Aδ pain receptor fibers around plexuses to cause acute pain and inject the venom into the human skin epithelium to cause persistent pain and inflammation.

  11. Dissemination of English Culture in Chinua Achebe’s No Longer at Ease

    Directory of Open Access Journals (Sweden)

    Bahman Zarrinjooee

    2016-08-01

    Full Text Available This paper deals with Chinua Achebe’s (1930-2013 No Longer at Ease (1960 which depicts the dissemination of English culture in Nigeria and its effects on the life and identity of Obi Okonkwo, the Western educated male protagonist. The focus of this paper is on the dissemination of English culture and submission of Nigerian culture in order to represent the inferiority of Nigerians. Edward Said’s (1935-2003 attempts regarding Orientalism and Frantz Fanon’s (1925-1961 issues relating inferiority of the indigenous people caused by colonization are used in this paper. The colonisers affect the life, mind, culture, and identity of the colonized through various ways such as education, religion, and language. Such effects cause some cultural transformation and changes in language of the colonized people. Moreover, the colonizer through stereotyping the colonized people assumes them as other. Indeed, the colonizer imposes his/her superiority on the natives who try to assimilate themselves with the colonizer. Achebe in his novel shows how this effort causes some binary relation among the characters. The novel shows the difference between two cultures, and Achebe puts emphasis on the superiority of English culture and depicts how colonialism and Western orientalism produce stereotyped images of Nigerians and Obi as corrupt. Consequently, such features have great impressions on the mind of Nigerians, which results in inferiority complex. Such characteristic invites the Nigerians to follow European’s value and forget their own culture, which is resulted in the rejection of native values. Keywords: Binary Relation, Colonization, Cultural Transformation, Cultural Dissemination, Orientalism, Stereotyping

  12. Development of high performance refractory fibers with enhanced insulating properties and longer service lifetimes

    Energy Technology Data Exchange (ETDEWEB)

    Martin, P.C.; DePoorter, G.L.; Munoz, D.R.

    1991-02-01

    We have initiated a three phase investigation of the development of high performance refractory fibers with enhanced insulating properties and longer usable lifetimes. This report presents the results of the first phase of the study, performed from Aug. 1989 through Feb. 1991, which shows that significant energy saving are possible through the use of high temperature insulating fibers that better retain their efficient insulating properties during the service lifetime of the fibers. The remaining phases of this program include the pilot scale development and then full scale production feasibility development and evaluation of enhanced high temperature refractory insulting fibers. This first proof of principle phase of the program presents a summary of the current use patterns of refractory fibers, a laboratory evaluation of the high temperature performance characteristics of selected typical refractory fibers and an analysis of the potential energy savings through the use of enhanced refractory fibers. The current use patterns of refractory fibers span a wide range of industries and high temperature furnaces within those industries. The majority of high temperature fiber applications are in furnaces operating between 2000 and 26000{degrees}F. The fibers used in furnaces operating within this range provide attractive thermal resistance and low thermal storage at reasonable cost. A series of heat treatment studies performed for this phase of the program has shown that the refractory fibers, as initially manufactured, have attractive thermal conductivities for high temperature applications but the fibers go through rapid devitrification and subsequent crystal growth upon high temperature exposure. Development of improved fibers, maintaining the favorable characteristics of the existing as-manufactured fibers, could save between 1 and 4% of the energy consumed in high temperature furnaces using refractory fibers.

  13. Longer and less overlapping food webs in anthropogenically disturbed marine ecosystems: confirmations from the past.

    Directory of Open Access Journals (Sweden)

    Fabiana Saporiti

    Full Text Available The human exploitation of marine resources is characterised by the preferential removal of the largest species. Although this is expected to modify the structure of food webs, we have a relatively poor understanding of the potential consequences of such alteration. Here, we take advantage of a collection of ancient consumer tissues, using stable isotope analysis and SIBER to assess changes in the structure of coastal marine food webs in the South-western Atlantic through the second half of the Holocene as a result of the sequential exploitation of marine resources by hunter-gatherers, western sealers and modern fishermen. Samples were collected from shell middens and museums. Shells of both modern and archaeological intertidal herbivorous molluscs were used to reconstruct changes in the stable isotopic baseline, while modern and archaeological bones of the South American sea lion Otaria flavescens, South American fur seal Arctocephalus australis and Magellanic penguin Spheniscus magellanicus were used to analyse changes in the structure of the community of top predators. We found that ancient food webs were shorter, more redundant and more overlapping than current ones, both in northern-central Patagonia and southern Patagonia. These surprising results may be best explained by the huge impact of western sealing on pinnipeds during the fur trade period, rather than the impact of fishing on fish populations. As a consequence, the populations of pinnipeds at the end of the sealing period were likely well below the ecosystem's carrying capacity, which resulted in a release of intraspecific competition and a shift towards larger and higher trophic level prey. This in turn led to longer and less overlapping food webs.

  14. Unveiling Skeletal Fragility in Patients Diagnosed with MGUS: No Longer a Condition of Undetermined Significance?

    OpenAIRE

    Drake, Matthew T.

    2014-01-01

    Monoclonal gammopathy of undetermined significance (MGUS) is a common finding in clinical practice, affecting greater than 3% of adults aged 50 years and older. As originally described, the term MGUS reflected the inherent clinical uncertainty of distinguishing patients with a benign stable monoclonal plasma cell disorder from subjects destined to progress to malignancy. There is now clear epidemiologic evidence, however, that patients with MGUS suffer from a significantly increased fracture ...

  15. Financial Statecraft: No Longer Limited to the Incumbent Powers (SWP 62)

    OpenAIRE

    Armijo, Leslie Elliott

    2018-01-01

    Traditional analyses of financial statecraft typically assume the term refers to major powers exercising influence over weaker states by such means as foreign aid blandishments or banking system sanctions. Newer scholarship highlights the subtler political influence advanced capitalist democracies also wield through their centrality to global monetary and financial markets and governance networks. Not surprisingly, rising powers are keen to expand the venues through which they too can support...

  16. Supporting the Sexual Intimacy Needs of Patients in a Longer Stay Inpatient Forensic Setting.

    Science.gov (United States)

    Quinn, Chris; Happell, Brenda

    2016-10-01

    To explore perceptions of nurses and patients regarding sexual intimacy in a long-term mental health unit. Qualitative exploratory design including in-depth semi-structured individual interviews with 12 registered nurses and 10 long-term patients of a forensic mental health hospital. The theme of supporting sexual intimacy was identified and described in this paper and included the following subthemes for nurses: It depends on the setting, need for guidelines and consent, and for patients-it depends on the setting; and need for support. The findings suggest that current guidelines regarding sexual intimacy in acute inpatient settings may not be appropriate in long-term facilities, with a need for guidelines to specifically address this setting. Furthermore, support for sexual intimacy needs of patients was identified as a strong need for patients and they believed not currently met. Nurses have an important role to play as part of their holistic approach to care and barriers to providing this aspect of care must be overcome to ensure patients' rights are respected. © 2015 Wiley Periodicals, Inc.

  17. Do Patients Live Longer After THA and Is the Relative Survival Diagnosis-specific?

    Science.gov (United States)

    Cnudde, Peter; Rolfson, Ola; Timperley, A John; Garland, Anne; Kärrholm, Johan; Garellick, Göran; Nemes, Szilard

    2018-02-28

    Hip replacements are successful in restoring mobility, reducing pain, and improving quality of life. However, the association between THA and the potential for increased life expectancy (as expressed by mortality rate) is less clear, and any such association could well be influenced by diagnosis and patient-related, socioeconomic, and surgical factors, which have not been well studied. (1) After controlling for birth year and sex, are Swedish patients who underwent THA likely to survive longer than individuals in the general population? (2) After controlling for relevant patient-related, socioeconomic/demographic factors and surgical factors, does relative survival differ across the various diagnoses for which THAs were performed in Sweden? Data from the Swedish Hip Arthroplasty Register, linked to administrative health databases, were used for this study. We identified 131,808 patients who underwent THA between January 1, 1999, and December 31, 2012. Of these, 21,755 had died by the end of followup. Patient- and surgery-specific data in combination with socioeconomic data were available for analysis. We compared patient survival (relative survival) with age- and sex-matched survival data in the entire Swedish population according to Statistics Sweden. We used multivariable modeling proceeded with a Cox proportional hazards model in transformed time. Patients undergoing elective THA had a slightly improved survival rate compared with the general population for approximately 10 years after surgery. At 1 year after surgery, the survival in patients undergoing THA was 1% better than the expected survival (r = 1.01; 95% confidence interval [CI], 1.01-1.02; p HR], 1.02; 95% CI, 0.88-1.18; p = 0.77). Patients undergoing surgery for osteonecrosis of the femoral head (HR, 1.69; 95% CI, 1.60-1.79; p HR, 1.49; 95% CI, 1.38-1.61; p HR, 2.46; 95% CI, 2.03-2.99; p HR, 0.90, 95% CI, 0.87-0.93, p HR, 1.33; 95% CI, 1.28-1.38; p < 0.001) were also negatively associated with

  18. The longer the better: Sleep-wake patterns during preparation of the World Rowing Junior Championships.

    Science.gov (United States)

    Kölling, Sarah; Steinacker, Jürgen M; Endler, Stefan; Ferrauti, Alexander; Meyer, Tim; Kellmann, Michael

    2016-01-01

    Recovery is essential for high athletic performance, and therefore especially sleep has been identified as a crucial source for physical and psychological well-being. However, due to early-morning trainings, which are general practice in many sports, athletes are likely to experience sleep restrictions. Therefore, this study investigated the sleep-wake patterns of 55 junior national rowers (17.7 ± 0.6 years) via sleep logs and actigraphy during a four-week training camp. Recovery and stress ratings were obtained every morning with the Short Recovery and Stress Scale on a 7-point Likert-type scale ranging from 0 (does not apply at all) to 6 (fully applies). The first training session was scheduled for 6:30 h every day. With two to four training sessions per day, the training load was considerably increased from athletes' home training. Objective sleep measures (n = 14) revealed less total sleep time (TST) in the first two weeks (409.6 ± 19.1 and 416.0 ± 16.3 min), while training volume and intensity were higher. In the second half of the camp, less training sessions were implemented, more afternoons were training free and TSTs were longer (436.3 ± 15.8 and 456.9 ± 25.7 min). A single occasion of 1.5-h delayed bedtime and usual early morning training (6:30 h) resulted in reduced ratings of Overall Recovery (OR) (M = 3.3 ± 1.3) and greater Negative Emotional State (NES) (M = 1.3 ± 1.2, p sleep-offset times were shifted from ~5:30 to ~8:00 h, and each recovery and stress score improved (p sleep and recovery. Intercorrelations of these sleep parameters emphasised the relationship between restful sleep and falling asleep quickly (r = .34, p sleep on subjective recovery measures in the setting of a training camp. Providing the opportunity of extended sleep (and a day off) seems the most simple and effective strategy to enhance recovery and stress-related ratings.

  19. Improving performance management for delivering appropriate care for patients no longer needing acute hospital care.

    Science.gov (United States)

    Penney, Christine; Henry, Effie

    2008-01-01

    The public, providers and policy-makers are interested in a service continuum where care is provided in the appropriate place. Alternate level of care is used to define patients who no longer need acute care but remain in an acute care bed. Our aims were to determine how subacute care and convalescent care should be defined in British Columbia (BC); how these care levels should be aligned with existing legislation to provide more consistent service standards to patients and what reporting requirements were needed for system planning and performance management. A literature review was conducted to understand the international trends in performance management, care delivery models and change management. A Canada-wide survey was carried out to determine the directions of other provinces on the defined issues and a BC survey provided a current state analysis of programming within the five regional health authorities (HAs). A provincial policy framework for subacute and convalescent care has been developed to begin to address the concerns raised and provide a base for performance measurement. The policy has been approved and disseminated to BC HAs for implementation. An implementation plan has been developed and implementation activities have been integrated into the work of existing provincial committees. Evaluation will occur through performance measurement. The benefits anticipated include: clear policy guidance for programme development; improved comparability of performance information for system monitoring, planning and integrity of the national acute care Discharge Abstracting Database; improved efficiency in acute care bed use; and improved equity of access, insurability and quality for patients requiring subacute and convalescent care. While a national reporting system exists for acute care in Canada, this project raises questions about the implications for this system, given the shifting definition of acute care as other care levels emerge. Questions are also

  20. Analysis of Prolonged Hospitalizations (Longer than 7 days: 115 Lung Cancer 
Patients after Video Assistant Thoracic Surgery (VATS

    Directory of Open Access Journals (Sweden)

    Liang DAI

    2018-03-01

    Full Text Available Background and objective Thoracoscopic surgery has gradually become the major procedure for lung cancer surgery in our department. Its characteristics are minimal trauma and quick recovery, which make approximately 90% of patients discharge from the hospital after surgery. However, the postoperative complications still happen now and then. We analyzed the patients who had been hospitalized for longer than 7 days after thoracoscopic lung cancer surgery, aiming to summarize the types and risk factors of complications, and improve postoperative safety of patients. Methods The data were come from the prospective database of Thoracic Surgery Unit One in Peking Cancer Hospital, and patients that underwent thoracoscopic pulmonary surgery between Jan. 2010 and Dec. 2014 with length of stay more than 7 days were included in the study. The classifications of the complications were investigated and graded as mild or severe complications according to modified Claviengrading, the relationship between clinical factors and degrees of complications was also analyzed. Results The hospitalization of 115 cases were longer than 7 days after surgery, accounting for 10.3% (115/1,112 of the whole patients that underwent surgery during the same period. Eighty-one cases had mild complications, accounting for 7.3% (81/1,112 of the whole cases that underwent surgery during the same period and 70.4% (81/115 of the cases with prolonged length of stay; the proportions of severe complications in both groups were 3.1% (34/1,112 and 29.6% (34/115, respectively; and the proportions of complications that caused perioperative deaths were 0.18% (2/1112 and 1.7% (2/115, respectively. Among all the postoperative complications, the most common was air leakage for more than 5 days after surgery, with a total of 20 cases (1.8% and 17.4%. The other common complications were: atelectasis (19 cases, 1.7% and 16.5%, pulmonary infection (18 cases, 1.6% and 15.7%, etc. The less common

  1. [Analysis of Prolonged Hospitalizations (Longer than 7 days): 115 Lung Cancer 
Patients after Video Assistant Thoracic Surgery (VATS)].

    Science.gov (United States)

    Dai, Liang; Kang, Xiaozheng; Yan, Wanpu; Yang, Yongbo; Zhao, Peiliang; Fu, Hao; Zhou, Haitao; Liang, Zhen; Xiong, Hongchao; Lin, Yao; Chen, Keneng

    2018-03-20

    Thoracoscopic surgery has gradually become the major procedure for lung cancer surgery in our department. Its characteristics are minimal trauma and quick recovery, which make approximately 90% of patients discharge from the hospital after surgery. However, the postoperative complications still happen now and then. We analyzed the patients who had been hospitalized for longer than 7 days after thoracoscopic lung cancer surgery, aiming to summarize the types and risk factors of complications, and improve postoperative safety of patients. The data were come from the prospective database of Thoracic Surgery Unit One in Peking Cancer Hospital, and patients that underwent thoracoscopic pulmonary surgery between Jan. 2010 and Dec. 2014 with length of stay more than 7 days were included in the study. The classifications of the complications were investigated and graded as mild or severe complications according to modified Claviengrading, the relationship between clinical factors and degrees of complications was also analyzed. The hospitalization of 115 cases were longer than 7 days after surgery, accounting for 10.3% (115/1,112) of the whole patients that underwent surgery during the same period. Eighty-one cases had mild complications, accounting for 7.3% (81/1,112) of the whole cases that underwent surgery during the same period and 70.4% (81/115) of the cases with prolonged length of stay; the proportions of severe complications in both groups were 3.1% (34/1,112) and 29.6% (34/115), respectively; and the proportions of complications that caused perioperative deaths were 0.18% (2/1112) and 1.7% (2/115), respectively. Among all the postoperative complications, the most common was air leakage for more than 5 days after surgery, with a total of 20 cases (1.8% and 17.4%). The other common complications were: atelectasis (19 cases, 1.7% and 16.5%), pulmonary infection (18 cases, 1.6% and 15.7%), etc. The less common complications was bronchopleural fistula (4 cases, 0

  2. Policy and programmatic considerations for introducing a longer-acting injectable contraceptive: perspectives of stakeholders from Kenya and Rwanda.

    Science.gov (United States)

    McKenna, Kevin; Arcara, Jennet; Rademacher, Kate H; Mackenzie, Caroline; Ngabo, Fidele; Munyambanza, Emmanuel; Wesson, Jennifer; Tolley, Elizabeth E

    2014-10-15

    approach. At the policy level, respondents indicated that obtaining regulatory approvals before introducing the new method could be costly and time-consuming. Manufacturing and procurement decisions could also affect cost and availability. Successful introduction of a potential longer-acting injectable may be enhanced by considering broader systemic issues, including managing cost to the health system and users, expanding access through community-based distribution, and training providers on the latest service delivery guidelines. © McKenna et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly cited. To view a copy of the license, visit http://creativecommons.org/licenses/by/3.0/. When linking to this article, please use the following permanent link: http://dx.doi.org/10.9745/GHSP-D-14-00106.

  3. The 2009 Retirement Confidence Survey: economy drives confidence to record lows; many looking to work longer.

    Science.gov (United States)

    Helman, Ruth; Copeland, Craig; VanDerhei, Jack

    2009-04-01

    RECORD LOW CONFIDENCE LEVELS: Workers who say they are very confident about having enough money for a comfortable retirement this year hit the lowest level in 2009 (13 percent) since the Retirement Confidence Survey started asking the question in 1993, continuing a two-year decline. Retirees also posted a new low in confidence about having a financially secure retirement, with only 20 percent now saying they are very confident (down from 41 percent in 2007). THE ECONOMY, INFLATION, COST OF LIVING ARE THE BIG CONCERNS: Not surprisingly, workers overall who have lost confidence over the past year about affording a comfortable retirement most often cite the recent economic uncertainty, inflation, and the cost of living as primary factors. In addition, certain negative experiences, such as job loss or a pay cut, loss of retirement savings, or an increase in debt, almost always contribute to loss of confidence among those who experience them. RETIREMENT EXPECTATIONS DELAYED: Workers apparently expect to work longer because of the economic downturn: 28 percent of workers in the 2009 RCS say the age at which they expect to retire has changed in the past year. Of those, the vast majority (89 percent) say that they have postponed retirement with the intention of increasing their financial security. Nevertheless, the median (mid-point) worker expects to retire at age 65, with 21 percent planning to push on into their 70s. The median retiree actually retired at age 62, and 47 percent of retirees say they retired sooner than planned. WORKING IN RETIREMENT: More workers are also planning to supplement their income in retirement by working for pay. The percentage of workers planning to work after they retire has increased to 72 percent in 2009 (up from 66 percent in 2007). This compares with 34 percent of retirees who report they actually worked for pay at some time during their retirement. GREATER WORRY ABOUT BASIC AND HEALTH EXPENSES: Workers who say they very confident in

  4. I'm no longer torn after choice: how explicit choices implicitly shape preferences of odors.

    Science.gov (United States)

    Coppin, Géraldine; Delplanque, Sylvain; Cayeux, Isabelle; Porcherot, Christelle; Sander, David

    2010-04-01

    Several studies have shown that preferences can be strongly modulated by cognitive processes such as decision making and choices. However, it is still unclear whether choices can influence preferences of sensory stimuli implicitly. This question was addressed here by asking participants to evaluate odors, to choose their preferred odors within pairs, to reevaluate the odors, and to perform an unexpected memory test. Results revealed, for the first time in the study of olfaction, the existence of postchoice preference changes, in the sense of an overvaluation of chosen odors and a devaluation of rejected ones, even when choices were forgotten. These results suggest that chemosensory preferences can be modulated by explicit choices and that such modulation might rely on implicit mechanisms. This finding rules out any explanation of postchoice preference changes in terms of experimental demand and strongly challenges the classical cognitive-dissonance-reduction account of such preference changes.

  5. Natural gas as a traded global commodity : no longer just a continental resource

    International Nuclear Information System (INIS)

    Pickard, A.

    2004-01-01

    Many consider natural gas to be the fuel of choice for the future because it is abundant, clean and cost competitive. This presentation reviewed how gas markets are changing in terms of globalization, the critical role of liquefied natural gas (LNG), the politics, technology and how the evolution will differ from oil. Other topics of discussion included the expanding world trade of LNG, LNG markets, supply countries, LNG flows in 2002 and potential future flows. Developments in the market were reviewed with reference to limited LNG spot market, mix of contract types, and the role of powerful aggregator partners. The impact of joining suppliers and markets was also discussed along with the value chain of the tramline model. Shell's LNG shipping position was outlined. Shell wholly owns 4 LNG ships and partly owns and operates 16 more ships. The presentation listed existing, permitted, publicly announced and scouting LNG regas terminals in North America, along with Shell interests. It was noted that LNG has the potential to meet some of the growing deficit in North American gas production. The issues that require consideration include permitting uncertainties, basis risk, impact of imports on basis, expansion possibilities, constraints on pipeline infrastructure, marketing capabilities, global supply issues and finance possibilities. figs

  6. Financial viability of perinatal centers in the longer term, taking legislative requirements into account. An examination of the cost-revenue structure of a Level I perinatal center.

    Science.gov (United States)

    Lux, Michael P; Kraml, Florian; Wagner, Stefanie; Hack, Carolin C; Schulze, Christine; Faschingbauer, Florian; Winkler, Mathias; Fasching, Peter A; Beckmann, Matthias W; Hildebrandt, Thomas

    2013-01-01

    Debate is currently taking place over minimum case numbers for the care of premature infants and neonates in Germany. As a result of the Federal Joint Committee (Gemeinsamer Bundesauschuss, G-BA) guidelines for the quality of structures, processes, and results, requiring high levels of staffing resources, Level I perinatal centers are increasingly becoming the focus for health-economics questions, specifically, debating whether Level I structures are financially viable. Using a multistep contribution margin analysis, the operating results for the Obstetrics Section at the University Perinatal Center of Franconia (Universitäts-Perinatalzentrum Franken) were calculated for the year 2009. Costs arising per diagnosis-related group (DRG) (separated into variable costs and fixed costs) and the corresponding revenue generated were compared for 4,194 in-patients and neonates, as well as for 3,126 patients in the outpatient ultrasound and pregnancy clinics. With a positive operating result of € 374,874.81, a Level I perinatal center on the whole initially appears to be financially viable, from the obstetrics point of view (excluding neonatology), with a high bed occupancy rate and a profitable case mix. By contrast, the costs of prenatal diagnostics, with a negative contribution margin II of € 50,313, cannot be covered. A total of 79.4% of DRG case numbers were distributed to five DRGs, all of which were associated with pregnancies and neonates with the lowest risk profiles. A Level I perinatal center is currently capable of covering its costs. However, the cost-revenue ratio is fragile due to the high requirements for staffing resources and numerous economic, social, and regional influencing factors.

  7. The development of the Quality Indicator for Rehabilitative Care (QuIRC) : a measure of best practice for facilities for people with longer term mental health problems

    NARCIS (Netherlands)

    Killaspy, Helen; White, Sarah; Wright, Christine; Taylor, Tatiana L.; Turton, Penny; Schuetzwohl, Matthias; Schuster, Mirjam; Cervilla, Jorge A.; Brangier, Paulette; Raboch, Jiri; Kalisova, Lucie; Onchev, Georgi; Alexiev, Spiridon; Mezzina, Roberto; Ridente, Pina; Wiersma, Durk; Visser, Ellen; Kiejna, Andrzej; Adamowski, Tomasz; Ploumpidis, Dimitri; Gonidakis, Fragiskos; Caldas-de-Almeida, Jose; Cardoso, Graca; King, Michael B.

    2011-01-01

    Background: Despite the progress over recent decades in developing community mental health services internationally, many people still receive treatment and care in institutional settings. Those most likely to reside longest in these facilities have the most complex mental health problems and are at

  8. Effectiveness of Supplemental Kindergarten Vocabulary Instruction for English Learners: A Randomized Study of Immediate and Longer-Term Effects of Two Approaches

    Science.gov (United States)

    Vadasy, Patricia F.; Sanders, Elizabeth A.; Nelson, J. Ron

    2015-01-01

    A two-cohort cluster-randomized trial was conducted to estimate effects of small-group supplemental vocabulary instruction for at-risk kindergarten English learners (ELs). Connections students received explicit instruction in high-frequency decodable root words, and interactive book reading (IBR) students were taught the same words in a storybook…

  9. Immediate and longer term impact of the varicella shortage on children 18 and 24 months of age in a community population

    OpenAIRE

    Yawn, Barbara P; Schroeder, Clayton; Wollan, Peter; Rocca, Liliana; Zimmerman, Rick; Bardenheier, Barbara

    2006-01-01

    Abstract Background Little is known about the impact of the recent varicella vaccine shortage. To assess the temporal trend in varicella vaccine administration before 18 and 24 months of age in a community cohort of children prior to, during and after the recent varicella vaccine shortage. And to compare the temporal trends in varicella vaccinations to trends of an older, more widely accepted vaccine, the MMR. Methods Community population-based birth cohorts were identified who were eligible ...

  10. Out of Unemployment? A Comparative Analysis of the Risks and Opportunities Longer-Term Unemployed Immigrant Youth Face when Entering the Labour Market

    Science.gov (United States)

    Malmberg-Heimonen, Ira; Julkunen, Ilse

    2006-01-01

    Because of high unemployment rates among youth in Europe, comparative research has focused on identification of those risks and opportunities associated with the integration process from unemployment to work. The integration process of immigrant youth, however, received much less attention, despite their initially higher risk of unemployment than…

  11. The effects of dietary and lifestyle interventions among pregnant women who are overweight or obese on longer-term maternal and early childhood outcomes

    DEFF Research Database (Denmark)

    Dodd, Jodie M.; Grivell, Rosalie M.; Louise, Jennie

    2017-01-01

    or is being undertaken. The primary maternal outcome is a diagnosis of maternal metabolic syndrome. The primary childhood outcome is BMI above 90%. We have identified 7 relevant trials, involving 5425 women who were overweight or obese during pregnancy, with approximately 3544 women and children with follow......Background: The aim of this individual participant data meta-analysis (IPDMA) is to evaluate the effects of dietary and lifestyle interventions among pregnant women who are overweight or obese on later maternal and early childhood outcomes at ages 3-5 years. Methods/design: We will build...... on the established International Weight Management in Pregnancy (i-WIP) IPD Collaborative Network, having identified researchers who have conducted randomised dietary and lifestyle interventions among pregnant women who are overweight or obese, and where ongoing childhood follow-up of participants has been...

  12. "Short Courses Shouldn't Be Short-Lived!" Enhancing Longer-Term Impact of Short English as a Foreign Language INSET Initiatives in China

    Science.gov (United States)

    Yan, Chunmei; He, Chuanjun

    2015-01-01

    Short in-service teacher development (INSET) programmes have been globally used as a form of teacher development, but their impact has been under question. This study sought to examine teacher participants' perceptions of short INSET programmes to come up with better solutions to enhancing their effect on teachers' professional learning. A…

  13. Longer-term effects of ADAS use on driving performance of healthy older drivers and drivers diagnosed with Parkinson’s disease

    NARCIS (Netherlands)

    Dotzauer, Mandy

    2015-01-01

    Oudere automobilisten vormen een groep met unieke kenmerken. Enerzijds hebben ze vaak heel veel rijervaring, anderzijds kan er sprake zijn van leeftijdgerelateerde achteruitgang in visuele, cogitieve en motorische functies die de verkeersveiligheid kan verminderen. Recent op de markt gebrachte

  14. Budget Issues: Accrual Budgeting Useful in Certain Areas but Does Not Provide Sufficient Information for Reporting on Our Nation's Longer-Term Fiscal Challenge

    National Research Council Canada - National Science Library

    2007-01-01

    .... The six countries have taken different approaches in the design of their accrual-based budgets, and all continue to use cash information particularly for evaluating the overall fiscal condition...

  15. Short and longer-term psychological consequences of Operation Cast Lead: documentation from a mental health program in the Gaza Strip

    Directory of Open Access Journals (Sweden)

    Llosa Augusto E

    2012-10-01

    Full Text Available Abstract Background There is growing recognition of the psychological impact of adversity associated with armed conflict on exposed civilian populations. Yet there is a paucity of evidence on the value of mental health programs in these contexts, and of the chronology of psychological sequelae, especially in prolonged conflicts with repeated cycles of extreme violence. Here, we describe changes in the psychological profile of new patients in a mental health program after the military offensive Cast Lead, in the context of the prolonged armed conflict involving the Gaza Strip. Methods This study analyses routinely collected program data from a Médecins Sans Frontières mental health program in the Gaza Strip spanning 2007–2011. Data consist of socio-demographic as well as clinical baseline and follow-up data on new patients entering the program. Comparisons were made through Chi square and Fisher’s exact tests, univariate and multivariate logistic and linear regression. Results PTSD, depression and other anxiety disorders were the most frequent psychopathologies, with 21% having multiple diagnoses. With a median of nine sessions, clinical improvement was recorded for 83% (1122/1357, and more common for those with separation anxiety, acute and posttraumatic disorders as principal diagnosis (855/1005, compared to depression (141/183, p Conclusion Evolving changes in patient volume, diagnoses and recall period to triggering events suggest a lengthy and durable effect of an intensified exposure to violence in a context of prolonged conflict. Our findings suggest that mental health related humanitarian relief in protracted conflicts might need to prepare for an increase in patients with changing profiles over an extended period following an acute flare-up in violence.

  16. Toward Integrated Disaster Risk Management in Vietnam : Recommendations Based on the Drought and Saltwater Intrusion Crisis and the Case for Investing in Longer-Term Resilience

    OpenAIRE

    Global Facility for Disaster Reduction and Recovery

    2017-01-01

    Vietnam is one of the most hazard-prone countries in the East Asia and Pacific region, with droughts, severe storms, and flooding causing substantial economic and human losses. Climate change is projected to increase the impact of disasters, especially the timing, frequency, severity, and intensity of hydro-meteorological events. Vietnam’s 2015–2016 drought and associated saltwater intrus...

  17. Ozone-Temperature Diurnal and Longer Term Correlations, in the Lower Thermosphere, Mesosphere and Stratosphere, Based on Measurements from SABER on TIMED

    Science.gov (United States)

    Huang, Frank T.; Mayr, Hans G.; Russell, James M., III; Mlynczak, Martin G.

    2012-01-01

    The analysis of mutual ozone-temperature variations can provide useful information on their interdependencies relative to the photochemistry and dynamics governing their behavior. Previous studies have mostly been based on satellite measurements taken at a fixed local time in the stratosphere and lower mesosphere. For these data, it is shown that the zonal mean ozone amounts and temperatures in the lower stratosphere are mostly positively correlated, while they are mostly negatively correlated in the upper stratosphere and in the lower mesosphere. The negative correlation, due to the dependence of photochemical reaction rates on temperature, indicates that ozone photochemistry is more important than dynamics in determining the ozone amounts. In this study, we provide new results by extending the analysis to include diurnal variations over 24 hrs of local time, and to larger spatial regimes, to include the upper mesosphere and lower thermosphere (MLT). The results are based on measurements by the SABER instrument on the TIMED satellite. For mean variations (i.e., averages over local time and longitude) in the MLT, our results show that there is a sharp reversal in the correlation near 80 km altitude, above which the ozone mixing ratio and temperature are mostly positively correlated, while they are mostly negatively correlated below 80 km. This is consistent with the view that above -80 km, effects due to dynamics are more important compared to photochemistry. For diurnal variations, both the ozone and temperature show phase progressions in local time, as a function of altitude and latitude. For temperature, the phase progression is as expected, as they represent migrating tides. For day time ozone, we also find regular phase progression in local time over the whole altitude range of our analysis, 25 to 105 km, at least for low latitudes. This was not previously known, although phase progressions had been noted by us and by others at lower altitudes. For diurnal variations, we find that between about 40 and 65 km, the ozone amounts and temperatures are mostly negatively correlated or neutral, while below approx. 40 km they are mostly positively correlated or neutral. The correlations are less systematic and less robust than for correlations of the mean. At altitudes above approx.65 km, the correlations are more complex, and depend on the tidal temperature variations. For the diurnal case, consideration needs to be given to transport by thermal tides and to the efficacy of response times of ozone concentrations and temperature to each other.

  18. Testing Mediators Hypothesized to Account for the Effects of a Dissonance-Based Eating Disorder Prevention Program over Longer Term Follow-Up

    Science.gov (United States)

    Stice, Eric; Marti, C. Nathan; Rohde, Paul; Shaw, Heather

    2011-01-01

    Objective: Test the hypothesis that reductions in thin-ideal internalization and body dissatisfaction mediate the effects of a dissonance-based eating disorder prevention program on reductions in eating disorder symptoms over 1-year follow-up. Method: Data were drawn from a randomized effectiveness trial in which 306 female high school students…

  19. Mediation of Short and Longer Term Effects of an Intervention Program to Enhance Resilience in Immigrants from Mainland China to Hong Kong

    OpenAIRE

    Yu, Nancy X.; Lam, T. H.; Liu, Iris K. F.; Stewart, Sunita M.

    2015-01-01

    Few clinical trials report on the active intervention components that result in outcome changes, although this is relevant to further improving efficacy and adapting effective programs to other populations. This paper presents follow-up analyses of a randomized controlled trial to enhance adaptation by increasing knowledge and personal resilience in two separate brief interventions with immigrants from Mainland China to Hong Kong (Yu et al., 2014b). The present paper extends our previous one ...

  20. Outsourcing the Nucleus: Nuclear Pore Complex Genes are no Longer Encoded in Nucleomorph Genomes

    Directory of Open Access Journals (Sweden)

    Nadja Neumann

    2006-01-01

    Full Text Available The nuclear pore complex (NPC facilitates transport between nucleus and cytoplasm. The protein constituents of the NPC, termed nucleoporins (Nups, are conserved across a wide diversity of eukaryotes. In apparent exception to this, no nucleoporin genes have been identified in nucleomorph genomes. Nucleomorphs, nuclear remnants of once free-living eukaryotes, took up residence as secondary endosymbionts in cryptomonad and chlorarachniophyte algae. As these genomes are highly reduced, Nup genes may have been lost, or relocated to the host nucleus. However, Nup genes are often poorly conserved between species, so absence may be an artifact of low sequence similarity. We therefore constructed an evolutionary bioinformatic screen to establish whether the apparent absence of Nup genes in nucleomorph genomes is due to genuine absence or the inability of current methods to detect homologues. We searched green plant (Arabidopsis and rice, green alga (Chlamydomonas reinhardtii and red alga (Cyanidioschyzon merolae genomes, plus two nucleomorph genomes (Bigelowiella natans and Guillardia theta with profile hidden Markov models (HMMs from curated alignments of known vertebrate/yeast Nups. Since the plant, algal and nucleomorph genomes all belong to the kingdom Plantae, and are evolutionarily distant from the outgroup (vertebrate/yeast training set, we use the plant and algal genomes as internal positive controls for the sensitivity of the searches in nucleomorph genomes. We fi nd numerous Nup homologues in all plant and free-living algal species, but none in either nucleomorph genome. BLAST searches using identified plant and algal Nups also failed to detect nucleomorph homologues. We conclude that nucleomorph Nup genes have either been lost, being replaced by host Nup genes, or, that nucleomorph Nup genes have been transferred to the host nucleus twice independently; once in the evolution of the red algal nucleomorph and once in the green algal nucleomorph.

  1. Oxygen no longer plays a major role in Body Size Evolution

    Science.gov (United States)

    Datta, H.; Sachson, W.; Heim, N. A.; Payne, J.

    2015-12-01

    When observing the long-term relationship between atmospheric oxygen and the maximum size in organisms across the Geozoic (~3.8 Ga - present), it appears that as oxygen increases, organism size grows. However, during the Phanerozoic (541 Ma - Present) oxygen levels varied, so we set out to test the hypothesis that oxygen levels drive patterns marine animal body size evolution. Expected decreases in maximum size due to a lack of oxygen do not occur, and instead, body size continues to increase regardless. In the oxygen data, a relatively low atmospheric oxygen percentage can support increasing body size, so our research tries to determine whether lifestyle affects body size in marine organisms. The genera in the data set were organized based on their tiering, motility, and feeding, such as a pelagic, fully-motile, predator. When organisms fill a certain ecological niche to take advantage of resources, they will have certain life modes, rather than randomly selected traits. For example, even in terrestrial environments, large animals have to constantly feed themselves to support their expensive terrestrial lifestyle which involves fairly consistent movement, and the structural support necessary for that movement. Only organisms with access to high energy food sources or large amounts of food can support themselves, and that is before they expend energy elsewhere. Organisms that expend energy frugally when active or have slower metabolisms in comparison to body size have a more efficient lifestyle and are generally able to grow larger, while those who have higher energy demands like predators are limited to comparatively smaller sizes. Therefore, in respect to the fossil record and modern measurements of animals, the metabolism and lifestyle of an organism dictate its body size in general. With this further clarification on the patterns of evolution, it will be easier to observe and understand the reasons for the ecological traits of organisms today.

  2. Longer Nature-Based Rehabilitation May Contribute to a Faster Return to Work in Patients with Reactions to Severe Stress and/or Depression

    Directory of Open Access Journals (Sweden)

    Patrik Grahn

    2017-10-01

    Full Text Available The global burden of depression and stress-related mental disorders is substantial, and constitutes a major need for effective rehabilitation. Can nature-based rehabilitation help people return to work? Objective: To study if the length of a nature-based rehabilitation program affects the outcome with regard to return to work one year after the onset of the program, in a group of patients with long-term reactions to severe stress and/or depression. Methods: A prospective, quasi-experimental study comparing results from 8-, 12-, and 24-week periods of rehabilitation. The rehabilitation of 106 participants was carried out by a multimodal rehabilitation team in a specially designed rehabilitation garden. Return to work data were collected before the intervention and one year after the start of rehabilitation. In addition, data were collected regarding self-assessed occupational competence, personal control, and sense of coherence. As many as 68% of the participants returned to work or participated in job training or work-oriented measures, full- or part-time, after one year. Participants with a longer period of rehabilitation reported better results on occupational competence, and were more likely to participate in paid work, full-time or part-time, one year after rehabilitation. Study outcomes indicate that a longer rehabilitation period in a rehabilitation garden increases the possibility of a return to paid work.

  3. Longer Nature-Based Rehabilitation May Contribute to a Faster Return to Work in Patients with Reactions to Severe Stress and/or Depression

    Science.gov (United States)

    Grahn, Patrik; Pálsdóttir, Anna María; Ottosson, Johan; Jonsdottir, Ingibjörg H.

    2017-01-01

    The global burden of depression and stress-related mental disorders is substantial, and constitutes a major need for effective rehabilitation. Can nature-based rehabilitation help people return to work? Objective: To study if the length of a nature-based rehabilitation program affects the outcome with regard to return to work one year after the onset of the program, in a group of patients with long-term reactions to severe stress and/or depression. Methods: A prospective, quasi-experimental study comparing results from 8-, 12-, and 24-week periods of rehabilitation. The rehabilitation of 106 participants was carried out by a multimodal rehabilitation team in a specially designed rehabilitation garden. Return to work data were collected before the intervention and one year after the start of rehabilitation. In addition, data were collected regarding self-assessed occupational competence, personal control, and sense of coherence. As many as 68% of the participants returned to work or participated in job training or work-oriented measures, full- or part-time, after one year. Participants with a longer period of rehabilitation reported better results on occupational competence, and were more likely to participate in paid work, full-time or part-time, one year after rehabilitation. Study outcomes indicate that a longer rehabilitation period in a rehabilitation garden increases the possibility of a return to paid work. PMID:29076997

  4. 42 CFR 60.59 - Records and Federal access after a school is no longer a HEAL school.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Records and Federal access after a school is no longer a HEAL school. 60.59 Section 60.59 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS HEALTH EDUCATION ASSISTANCE LOAN PROGRAM The School § 60.59 Records and Federal...

  5. Mechanistic Evaluation of Motion in Redox-Driven Rotaxanes Reveals Longer Linkers Hasten Forward Escape's and Hinder Backward Translations

    DEFF Research Database (Denmark)

    Andersen, S. S.; Share, A. I.; Poulsen, B. L.

    2014-01-01

    temperatures to provide activation enthalpies (Delta H-double dagger) and entropies (Delta S-double dagger). Longer glycol linkers led to modest increases in the forward escape (t(1/2) = 60 to 69 s); though not because of a diffusive walk. The reduced rate of motion backward depended on folded structures...

  6. 77 FR 61452 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of Longer...

    Science.gov (United States)

    2012-10-09

    ... COMMISSION Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of Longer Period... Change, as Modified by Amendment No. 1 Thereto, To Establish the Market Quality Program October 2, 2012. On March 23, 2012, The NASDAQ Stock Market LLC (``Exchange'' or ``NASDAQ'') filed with the Securities...

  7. 78 FR 12116 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of a Longer...

    Science.gov (United States)

    2013-02-21

    ... COMMISSION Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of a Longer... Establish the Market Quality Program February 14, 2013. On December 7, 2012, The NASDAQ Stock Market LLC... proposed rule change to establish the Market Quality Program (``MQP'' or ``Program'') on a pilot basis. On...

  8. 78 FR 24281 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of a Longer...

    Science.gov (United States)

    2013-04-24

    .... Oldham, Chief Financial Officer and Vice President Finance Administration, Electro Scientific Industries... March 29, 2013; Sharon Barbari, Executive Vice President Finance and Chief Financial Officer...-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Designation of a Longer Period for...

  9. Investigating the Female Subaltern, Colonial Discourse and False Consciousness: A Spivakian Marxist-Postcolonialist Reading of Chinua Achebe’s Things Fall Apart and No Longer at Ease

    Directory of Open Access Journals (Sweden)

    Jalal Mostafaee

    2016-10-01

    Full Text Available The present research study attempts to investigate Chinua Achebe’s Things Fall Apart and No Longer at Ease in terms of Gayatri Spivak Marxist-Post colonialist conceptions of subaltern, colonial discourse and false consciousness. In Post-modernist fiction, there is anxiety that historical concerns such as the scale of violence in the Second World War, the Nazi genocide, the paranoiac politics of the Cold War and European colonialism have made fiction a medium for history. Chinua Achebe’s novels, indeed, are manifestation of colonialism and its subsequent impact on the literary text and dominant discourse. In exploring these terms, this dissertation endeavors to closely examine Gayatri Spivak’s concept of subaltern in the Chinua Achebe’s Things Fall Apart and No Longer at Ease. Furthermore, the present paper demonstrates Spivak’s voice to differences: that is, class categorization and marginalized subaltern subjects. By the emergence of colonialism, the significance of social class and social discourse became predominant; therefore, colonial discourses instilled into the social, cultural construction and literary text, particularly novel. In this regard, the investigation of the dominate discourses is pursued, and this helps to show how colonialism resulted in discourse inculcation. The resistant perspective against ruling ideology, as the Italian Marxist political activist, Antonio Gramsci calls it cultural hegemony is presented through language, tradition, and customs. Finally, the study focuses on Marxist concept of false consciousness from the viewpoint of Antonio Gramsci to Louis Althusser. Keywords: Colonial discourse, Subaltern, False Consciousness, Social Class, Change and Tradition, Language, Culture

  10. Diamonds are not forever : Botswana medium-term fiscal sustainability

    OpenAIRE

    Kojo, Naoko C.

    2010-01-01

    This paper analyzes Botswana's medium-term fiscal sustainability in view of the expected depletion of diamonds in the future. The analysis shows that in the absence of policy adjustments, Botswana's current fiscal policy strategy is unsustainable over the longer term, which could endanger macroeconomic stability and Botswana's reputation as Africa's success story. Ensuring medium-term sust...

  11. Intrauterine inoculation of minipigs with Chlamydia trachomatis during diestrus establishes a longer lasting infection compared to vaginal inoculation during estrus

    DEFF Research Database (Denmark)

    Lorenzen, Emma; Follmann, Frank; Secher, Jan O

    2017-01-01

    Advanced animal models, such as minipigs, are needed for the development of a globally requested human Chlamydia vaccine. Previous studies have shown that vaginal inoculation of sexually mature Göttingen minipigs with Chlamydia trachomatis resulted in an infection lasting only 3-5 days. The aim...... of a C. trachomatis infection in the minipig. Targeting the upper genital tract (transcervical inoculation) resulted in a longer lasting infection (at least 7 days) compared to vaginal inoculation (3-5 days). When comparing intrauterine inoculation during estrus and diestrus, inoculation during diestrus...... resulted in a longer lasting infection (at least 10 days) compared to estrus (3-5 days). Furthermore, we found a significant C. trachomatis specific IFN-γ response in pigs inoculated during estrus correlating with the accelerated clearance of infection in these pigs. These findings suggest...

  12. Immigration as a policy instrument for an economy with an aging population: A longer-run perspective

    OpenAIRE

    Denton, Frank T.; Spencer, Byron G.

    2014-01-01

    Population aging is a problem common to many countries: an increasing proportion of retired people, a decreasing proportion of working age, and resultant downward pressure on national product per capita. We explore longer-run aspects of immigration as a policy instrument in this context. We consider, by simulation, the importance of immigrant age distribution, proportion of child immigrants, productivity growth as an offset to aging, possible higher fertility, increased life expectancy, and g...

  13. Effect of longer health service provider delays on stage at diagnosis and mortality in symptomatic breast cancer.

    Science.gov (United States)

    Murchie, P; Raja, E A; Lee, A J; Brewster, D H; Campbell, N C; Gray, N M; Ritchie, L D; Robertson, R; Samuel, L

    2015-06-01

    This study explored whether longer provider delays (between first presentation and treatment) were associated with later stage and poorer survival in women with symptomatic breast cancer. Data from 850 women with symptomatic breast cancer were linked with the Scottish Cancer Registry; Death Registry; and hospital discharge dataset. Logistic regression and Cox survival analyses with restricted cubic splines explored relationships between provider delays, stage and survival, with sequential adjustment for patient and tumour factors. Although confidence intervals were wide in both adjusted analyses, those with the shortest provider delays had more advanced breast cancer at diagnosis. Beyond approximately 20 weeks, the trend suggests longer delays are associated with more advanced stage, but is not statistically significant. Those with symptomatic breast cancer and the shortest presentation to treatment time (within 4 weeks) had the poorest survival. Longer time to treatment was not significantly associated with worsening mortality. Poor prognosis patients with breast cancer are being triaged for rapid treatment with limited effect on outcome. Prolonged time to treatment does not appear to be strongly associated with poorer outcomes for patients with breast cancer, but the power of this study to assess the effect of very long delays (>25 weeks) was limited. Efforts to reduce waiting times are important from a quality of life perspective, but tumour biology may often be a more important determinant of stage at diagnosis and survival outcome. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Superparamagnetic anisotropic nano-assemblies with longer blood circulation in vivo: a highly efficient drug delivery carrier for leukemia therapy.

    Science.gov (United States)

    Xiong, Fei; Tian, Jilai; Hu, Ke; Zheng, Xiawen; Sun, Jianfei; Yan, Caiyun; Yao, Juan; Song, Lina; Zhang, Yu; Gu, Ning

    2016-10-06

    Leukemia, unlike solid tumors, has no definite shape and spreads throughout the whole circulatory system, therefore the therapy of leukemia requires medication to stay longer in the circulatory system. Anisotropic nanoparticles, showing longer blood circulating life than that of isotropic nanoparticles reported in previous research, meet the demands of leukemia therapy. Based on this strategy, superparamagnetic anisotropic nano-assemblies (SANs) were fabricated and loaded with vincristine (VCR) to form VCR-SANs. When compared to the same dose of VCR-loaded isotropic nano-assemblies (SINs), the decrease in the leukocytes count and the positive expression ratio of CD13 in the VCR-SANs group were 19.38% and 16.4%, respectively, which indicated the improved anti-leukemia activity of the VCR-SANs. From the results of the pharmacokinetics study, the VCR-SANs remarkably held the amount of drug removed from the whole body per unit time half of the isotropic group and the concentration of drug in blood plasma against time was 2.1 times the isotropic group, demonstrating the rapid and sustained release behavior and longer blood circulation when combined with the results of in vivo tissue distribution studies. In summary, anisotropic nano-assemblies were found to be more promising than isotropic nano-assemblies via our in vivo and in vitro examinations.

  15. Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

    Directory of Open Access Journals (Sweden)

    Eric B Alsop

    Full Text Available Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

  16. Does the Longer Application of Anodal-Transcranial Direct Current Stimulation Increase Corticomotor Excitability Further? A Pilot Study

    Directory of Open Access Journals (Sweden)

    Shapour Jaberzadeh

    2012-09-01

    Full Text Available Introduction: Anodal transcranial direct current stimulation (a-tDCS of the primary motor cortex (M1 has been shown to be effective in increasing corticomotor excitability.Methods: We investigated whether longer applications of a-tDCS coincide with greater increases in corticomotor excitability compared to shorter application of a-tDCS. Ten right-handed healthy participants received one session of a-tDCS(1mA current with shorter (10 min and longer (10+10 min stimulation durationsapplied to the left M1 of extensor carpi radialis muscle (ECR. Corticomotorexcitability following application of a-tDCS was assessed at rest with transcranial magnetic stimulation (TMS elicited motor evoked otentials (MEP and compared with baseline data for each participant.Results: MEP amplitudes were increased following 10 min of a-tDCS by 67%(p = 0.001 with a further increase (32% after the second 10 min of a-tDCS (p = 0.005. MEP amplitudes remained elevated at 15 min post stimulation compared to baseline values by 65% (p = 0.02.Discussion: The results demonstrate that longer application of a-tDCS within the recommended safety limits, increases corticomotor excitability with after effects of up to 15 minutes post stimulation.

  17. Does the Longer Application of Anodal-Transcranial Direct Current Stimulation Increase Corticomotor Excitability Further? A Pilot Study

    Directory of Open Access Journals (Sweden)

    Shapour Jaberzadeh

    2012-08-01

    Full Text Available Introduction: Anodal transcranial direct current stimulation (a-tDCS of the primary motor cortex (M1 has been shown to be effective in increasing corticomotor excitability.  Methods: We investigated whether longer applications of a-tDCS coincide with greater increases in corticomotor excitability compared to shorter application of a-tDCS. Ten right-handed healthy participants received one session of a-tDCS (1mA current with shorter (10 min and longer (10+10 min stimulation durations applied to the left M1 of extensor carpi radialis muscle (ECR. Corticomotor excitability following application of a-tDCS was assessed at rest with transcranial magnetic stimulation (TMS elicited motor evoked potentials (MEP and compared with baseline data for each participant.  Results: MEP amplitudes were increased following 10 min of a-tDCS by 67% (p = 0.001 with a further increase (32% after the second 10 min of a-tDCS (p = 0.005. MEP amplitudes remained elevated at 15 min post stimulation compared to baseline values by 65% (p = 0.02.  Discussion: The results demonstrate that longer application of a-tDCS within the recommended safety limits, increases corticomotor excitability with after effects of up to 15 minutes post stimulation.

  18. A feasibility study on the longer cycle operation of Yonggwang nuclear power plants 3 and 4 NSSS design

    Energy Technology Data Exchange (ETDEWEB)

    Ha, Young Joon; Choi, Hae Yoon; Chang, Young Woo [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of)] [and others

    1996-06-01

    A feasible study on the NSSS design safety assessment is performed for a longer cycle operation of Yonggang units 3 and 4. The analysis of the drift errors increased and setting point changed for safety related instrument channels due to the longer refueling interval was done to assess the impact on the operational safety performance and availability of the plant if the refueling interval was extended. In the result of LOCA analysis, even though the Peak Cladding Temperature (PCT) is slightly increased due to Pin/Box ratio decrease, the PCT has enough margin and, therefore, it was proven to be acceptable. From the perspective of return-to-power and the pre-trip fuel performance during the transient operation, an impact on the results of an SLB accident analysis were assessed. The overall trend of the longer refueling operation of 18 months is similar to the standard refuel operation of 12 months. The possibility of the return to power during SLB accident condition was estimated, the detailed analysis of the reactor core using the 3-dimensional model methodology is required to confirm the fuel integrity. 11 refs.(Author) .new.

  19. Experiences of persons with spinal cord injury undertaking a physical activity programme as part of the SCIPA 'Full-On' randomized controlled trial.

    Science.gov (United States)

    Calder, Allyson; Nunnerley, Jo; Mulligan, Hilda; Ahmad Ali, Nordawama; Kensington, Gemma; McVicar, Tim; van Schaik, Olivia

    2018-04-01

    For individuals with spinal cord injury the long term benefits of physical activity are well documented, however the majority of this population report inactivity secondary to participatory barriers. Research investigating physically intensive exercise programs for people with spinal cord injury is limited, with even less attention paid to the experience of the participants. To explore the experiences of persons with spinal cord injury of their participation in the New Zealand arm of the Spinal Cord Injury and Physical Activity (SCIPA) 'Full-On' randomized controlled trial. Eight participants recruited to SCIPA Full-On completed individual virtual video diary interviews three times across the duration of their twelve week Full-On trial. Expectations and highs and lows of the program were recorded via a webcam. The video diary data were transcribed verbatim and analyzed inductively for themes. Three independent themes were identified from the data: the participants' excitement of opportunity to participate in SCIPA Full-On' randomized controlled trial, personal rewards from participation and also the frustrations to participation they experienced. This study provides valuable information on factors that motivate participation in physical activity for individuals with spinal cord injury, within a research setting. The findings highlighted the importance of accessibility and a supportive network which may be a way to provide individuals with spinal cord injury the means to become self-efficacious to participate in community physical activity outside of the research environment. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. War No Longer Exists

    Science.gov (United States)

    2012-03-22

    biological of chemical weapons.36 The U.K.’s top defense priorities are protecting counter-terrorism capabilities to defeat terrorism, particularly...Also, importation of Nigerian oil continues to increase while Ghana is just beginning to exploit its offshore oilfields . These oil revenues are

  1. Ethics: No Longer Optional.

    Science.gov (United States)

    Eveslage, Thomas; D'Angelo, Paul

    1994-01-01

    Suggests that publications advisors have sound, practical reasons for addressing ethical decision making. Presents a brief review of the Supreme Court's message in "Hazelwood." Surveys staffs and advisors of award-winning high school newspapers concerning ethical issues facing the student press. Finds that advisors believe ethics to be…

  2. Longer - Faster - Purer

    CERN Document Server

    Caroline Duc

    2013-01-01

    The MR-ToF-MS, a new ion trap, has been integrated into ISOLTRAP, the experiment that performs accurate mass measurements on short-lived nuclides produced at ISOLDE. When used as a mass separator and spectrometer, it extends ISOLTRAP’s experimental reach towards the limits of nuclear stability.   Susanne Kreim, the ISOLTRAP local group leader at CERN in front of a part of the ISOLTRAP device. When mass measurement experiments like ISOLTRAP* are placed in an on-line radioactive ion-beam facility they face a major challenge: the efficient and fast transfer of the nuclide of interest to the location where the mass measurement is performed. The biggest yield of one selected nuclide, without contaminants, needs to be transferred to the set-up as quickly as possible in order to measure its mass with the greatest precision. Recently, the ISOLTRAP collaboration installed a new device that provides a faster separation of isobars.** It has significantly improved ISOLTRAP’s purificat...

  3. Who worries lives longer

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    A list of radioactivity of different foods measured in June-July 1987 in Austria is given. There is also an explanation how the reader can calculate his personal dose ('from nanocuries to millirems'). An additional warning is given to mushroom- and blueberry collectors. (qui)

  4. Analysing long term discursive processes

    DEFF Research Database (Denmark)

    Horsbøl, Anders

    What do timescales - the notion that processes take place or can be viewed within a shorter or longer temporal range (Lemke 2005) - mean for the analysis of discourse? What are the methodological consequences of analyzing discourse at different timescales? It may be argued that discourse analysis...... in general has favored either the analysis of short term processes such as interviews, discussions, and lessons, or the analysis of non-processual entities such as (multimodal) texts, arguments, discursive repertoires, and discourses (in a Foucaultian sense). In contrast, analysis of long term processes...... which extend beyond the single interaction, for instance negotiations or planning processes, seems to have played a less important role, with studies such as Iedema 2001 and Wodak 2000 as exceptions. These long term processes, however, are central to the constitution and workings of organizations...

  5. Workflows and the Role of Images for Virtual 3d Reconstruction of no Longer Extant Historic Objects

    Science.gov (United States)

    Münster, S.

    2013-07-01

    3D reconstruction technologies have gained importance as tools for the research and visualization of no longer extant historic objects during the last decade. Within such reconstruction processes, visual media assumes several important roles: as the most important sources especially for a reconstruction of no longer extant objects, as a tool for communication and cooperation within the production process, as well as for a communication and visualization of results. While there are many discourses about theoretical issues of depiction as sources and as visualization outcomes of such projects, there is no systematic research about the importance of depiction during a 3D reconstruction process and based on empirical findings. Moreover, from a methodological perspective, it would be necessary to understand which role visual media plays during the production process and how it is affected by disciplinary boundaries and challenges specific to historic topics. Research includes an analysis of published work and case studies investigating reconstruction projects. This study uses methods taken from social sciences to gain a grounded view of how production processes would take place in practice and which functions and roles images would play within them. For the investigation of these topics, a content analysis of 452 conference proceedings and journal articles related to 3D reconstruction modeling in the field of humanities has been completed. Most of the projects described in those publications dealt with data acquisition and model building for existing objects. Only a small number of projects focused on structures that no longer or never existed physically. Especially that type of project seems to be interesting for a study of the importance of pictures as sources and as tools for interdisciplinary cooperation during the production process. In the course of the examination the authors of this paper applied a qualitative content analysis for a sample of 26 previously

  6. Black bears with longer disuse (hibernation) periods have lower femoral osteon population density and greater mineralization and intracortical porosity.

    Science.gov (United States)

    Wojda, Samantha J; Weyland, David R; Gray, Sarah K; McGee-Lawrence, Meghan E; Drummer, Thomas D; Donahue, Seth W

    2013-08-01

    Intracortical bone remodeling is persistent throughout life, leading to age related increases in osteon population density (OPD). Intracortical porosity also increases with age in many mammals including humans, contributing to bone fragility and fracture risk. Unbalanced bone resorption and formation during disuse (e.g., physical inactivity) also increases intracortical porosity. In contrast, hibernating bears are a naturally occurring model for the prevention of both age-related and disuse osteoporoses. Intracortical bone remodeling is decreased during hibernation, but resorption and formation remain balanced. Black bears spend 0.25-7 months in hibernation annually depending on climate and food availability. We found longer hibernating bears demonstrate lower OPD and higher cortical bone mineralization than bears with shorter hibernation durations, but we surprisingly found longer hibernating bears had higher intracortical porosity. However, bears from three different latitudes showed age-related decreases in intracortical porosity, indicating that regardless of hibernation duration, black bears do not show the disuse- or age-related increases in intracortical porosity which is typical of other animals. This ability to prevent increases in intracortical porosity likely contributes to their ability to maintain bone strength during prolonged periods of physical inactivity and throughout life. Improving our understanding of the unique bone metabolism in hibernating bears will potentially increase our ability to develop treatments for age- and disuse-related osteoporoses in humans. Copyright © 2013 Wiley Periodicals, Inc.

  7. The Longer You Stay, the Worse Your Health? A Critical Review of the Negative Acculturation Theory among Asian Immigrants

    Directory of Open Access Journals (Sweden)

    Annie Ro

    2014-08-01

    Full Text Available Researchers have become increasingly interested in the health patterns of immigrants with longer residence in the United States, as this reveals the health consequences of integration processes. The negative acculturation effect has been the dominant interpretation of duration patterns, despite empirical and theoretical uncertainties about this assumption. This theory assumes that immigrant health declines with longer residence in the United States because of poorer health behaviors and health risks that reflect Americanized lifestyles. This paper reviews the empirical support for the negative acculturation theory among Asian immigrants to determine if and when it is an appropriate interpretation for duration patterns. I conclude that empirical inconsistencies and methodological issues limit the negative acculturation theory as the primary interpretation for duration patterns. First, there is no consistent evidence that health behaviors decline with time. There is also substantial group heterogeneity in duration patterns as well as heterogeneity across health outcomes. The literature has not adequately addressed methodological shortcomings, such as confounding by cohort effects or non-linear duration patterns. Length of residence in the United States is still an important aspect of Asian immigrant health, but the mechanisms of this relationship are still understudied. I propose alternative frameworks between duration and health that consider environmental influences and end with future research directions to explore research gaps.

  8. The longer you stay, the worse your health? A critical review of the negative acculturation theory among Asian immigrants.

    Science.gov (United States)

    Ro, Annie

    2014-08-08

    Researchers have become increasingly interested in the health patterns of immigrants with longer residence in the United States, as this reveals the health consequences of integration processes. The negative acculturation effect has been the dominant interpretation of duration patterns, despite empirical and theoretical uncertainties about this assumption. This theory assumes that immigrant health declines with longer residence in the United States because of poorer health behaviors and health risks that reflect Americanized lifestyles. This paper reviews the empirical support for the negative acculturation theory among Asian immigrants to determine if and when it is an appropriate interpretation for duration patterns. I conclude that empirical inconsistencies and methodological issues limit the negative acculturation theory as the primary interpretation for duration patterns. First, there is no consistent evidence that health behaviors decline with time. There is also substantial group heterogeneity in duration patterns as well as heterogeneity across health outcomes. The literature has not adequately addressed methodological shortcomings, such as confounding by cohort effects or non-linear duration patterns. Length of residence in the United States is still an important aspect of Asian immigrant health, but the mechanisms of this relationship are still understudied. I propose alternative frameworks between duration and health that consider environmental influences and end with future research directions to explore research gaps.

  9. Short implants versus longer implants in vertically augmented posterior mandibles: a randomised controlled trial with 5-year after loading follow-up.

    Science.gov (United States)

    Felice, Pietro; Cannizzaro, Gioacchino; Barausse, Carlo; Pistilli, Roberto; Esposito, Marco

    2014-01-01

    of 1.49 mm peri-implant bone compared with 2.34 mm in the augmented group. Short implants experienced statistically significantly less bone loss (0.82 mm, 95% CI 0.48; 1.16, P implants. When residual bone height over the mandibular canal is between 7 to 8 mm, 6.6 mm short implants could be an interesting alternative to vertical augmentation in posterior atrophic mandibles since the treatment is faster, cheaper and associated with less morbidity. Longer follow-ups may still be needed to confirm these results, however the medium-term prognosis (5 years after loading) of short implants is at least as good as those of longer implants placed vertically in augmented mandibles.

  10. Empowering Workers to Rebuild America's Economy and Longer-Term Competitiveness: Green Skills Training for Workers. Hearing of the Committee on Health, Education, Labor, and Pensions, United States Senate, One Hundred Eleventh Congress, First Session on Examining Empowering Workers to Rebuild America's Economy and Longer-Term Competitiveness, Focusing on Green Skills Training for Workers (April 21, 2009). Senate Hearing 111-813

    Science.gov (United States)

    US Senate, 2011

    2011-01-01

    Among the topics discussed in this hearing were: what constitutes green energy, how workers can best be provided the skills to thrive in green industries, and the future of America's energy and environmental policies. Statements were presented by: Honorable Patty Murray, a U.S. Senator from the State of Washington, opening statement; Honorable…

  11. Antepartum depression severity is increased during seasonally longer nights: relationship to melatonin and cortisol timing and quantity.

    Science.gov (United States)

    Meliska, Charles J; Martínez, Luis F; López, Ana M; Sorenson, Diane L; Nowakowski, Sara; Kripke, Daniel F; Elliott, Jeffrey; Parry, Barbara L

    2013-11-01

    Current research suggests that mood varies from season to season in some individuals, in conjunction with light-modulated alterations in chronobiologic indices such as melatonin and cortisol. The primary aim of this study was to evaluate the effects of seasonal variations in darkness on mood in depressed antepartum women, and to determine the relationship of seasonal mood variations to contemporaneous blood melatonin and cortisol measures; a secondary aim was to evaluate the influence of seasonal factors on measures of melancholic versus atypical depressive symptoms. We obtained measures of mood and overnight concentrations of plasma melatonin and serum cortisol in 19 depressed patients (DP) and 12 healthy control (HC) antepartum women, during on-going seasonal variations in daylight/darkness, in a cross-sectional design. Analyses of variance showed that in DP, but not HC, Hamilton Depression Rating Scale (HRSD) scores were significantly higher in women tested during seasonally longer versus shorter nights. This exacerbation of depressive symptoms occurred when the dim light melatonin onset, the melatonin synthesis offset, and the time of maximum cortisol secretion (acrophase) were phase-advanced (temporally shifted earlier), and melatonin quantity was reduced, in DP but not HC. Serum cortisol increased across gestational weeks in both the HC and DP groups, which did not differ significantly in cortisol concentration. Nevertheless, serum cortisol concentration correlated positively with HRSD score in DP but not HC; notably, HC showed neither significant mood changes nor altered melatonin and cortisol timing or quantity in association with seasonal variations. These findings suggest that depression severity during pregnancy may become elevated in association with seasonally related phase advances in melatonin and cortisol timing and reduced melatonin quantity that occur in DP, but not HC. Thus, women who experience antepartum depression may be more susceptible than

  12. Antepartum depression severity is increased during seasonally longer nights: Relationship to melatonin and cortisol timing and quantity

    Science.gov (United States)

    Meliska, Charles J.; Martínez, Luis F.; López, Ana M.; Sorenson, Diane L.; Nowakowski, Sara; Kripke, Daniel F.; Elliott, Jeffrey; Parry, Barbara L.

    2014-01-01

    Current research suggests that mood varies from season to season in some individuals, in conjunction with light-modulated alterations in chronobiologic indices like melatonin and cortisol. The primary aim of this study was to evaluate the effects of seasonal variations in darkness on mood in depressed antepartum women, and to determine the relationship of seasonal mood variations to contemporaneous blood melatonin and cortisol measures; a secondary aim was to evaluate the influence of seasonal factors on measures of melancholic versus atypical depressive symptoms. We obtained measures of mood and overnight concentrations of plasma melatonin and serum cortisol in 19 depressed patients (DP) and 12 healthy control (HC) antepartum women, during on-going seasonal variations in daylight/darkness, in a cross-sectional design. Analyses of variance showed that in DP, but not HC, Hamilton Depression Rating Scale (HRSD) scores were significantly higher in women tested during seasonally longer vs. shorter nights. This exacerbation of depressive symptoms occurred when the dim light melatonin onset, the melatonin synthesis offset and the time of maximum cortisol secretion (acrophase) were phase-advanced (temporally shifted earlier), and melatonin quantity was reduced, in DP but not HC. Serum cortisol increased across gestational weeks in both the HC and DP groups, which did not differ significantly in cortisol concentration. Nevertheless, serum cortisol concentration correlated positively with HRSD score in DP but not HC; notably, HC showed neither significant mood changes nor altered melatonin and cortisol timing or quantity in association with seasonal variations. These findings suggest that depression severity during pregnancy may become elevated in association with seasonally-related phase-advances in melatonin and cortisol timing and reduced melatonin quantity that occur in DP, but not HC. Thus, women who experience antepartum depression may be more susceptible than their

  13. Short-term mudflat dynamics drive long-term cyclic salt marsh dynamics

    NARCIS (Netherlands)

    Bouma, T.; van Belzen, J; Balke, T; van Dalen, J.H.; Klaassen, P.; Hartog, A. M.; Callaghan, D.P.; Hu, Z.; Stive, M.J.F.; Temmerman, S.; Herman, P.M.J.

    2016-01-01

    Our study aims to enhance process understanding of the long-term (decadal and longer) cyclic marsh dynamics by identifying the mechanisms that translate large-scale physical forcing in the system into vegetation change, in particular (i) the initiation of lateral erosion on an expanding marsh,

  14. Short-term mudflat dynamics drive long-term cyclic salt marsh dynamics

    NARCIS (Netherlands)

    Bouma, T.J.; van Belzen, J.; Balke, T.; van Dalen, J.; KLaassen, P.; Hartog, A.M.; Callaghan, D.P.; Hu, Z.; Stive, M.J.F.; Temmerman, S.; Herman, P.M.J.

    2016-01-01

    Our study aims to enhance process understanding of the long-term (decadal and longer) cyclic marsh dynamics by identifying the mechanisms that translate large-scale physical forcing in the system into vegetation change, in particular (i) the initiation of lateral erosion on an expanding

  15. Longer ice-free seasons increase the risk of nest depredation by polar bears for colonial breeding birds in the Canadian Arctic.

    Science.gov (United States)

    Iverson, Samuel A; Gilchrist, H Grant; Smith, Paul A; Gaston, Anthony J; Forbes, Mark R

    2014-03-22

    Northern polar regions have warmed more than other parts of the globe potentially amplifying the effects of climate change on biological communities. Ice-free seasons are becoming longer in many areas, which has reduced the time available to polar bears (Ursus maritimus) to hunt for seals and hampered bears' ability to meet their energetic demands. In this study, we examined polar bears' use of an ancillary prey resource, eggs of colonial nesting birds, in relation to diminishing sea ice coverage in a low latitude region of the Canadian Arctic. Long-term monitoring reveals that bear incursions onto common eider (Somateria mollissima) and thick-billed murre (Uria lomvia) nesting colonies have increased greater than sevenfold since the 1980s and that there is an inverse correlation between ice season length and bear presence. In surveys encompassing more than 1000 km of coastline during years of record low ice coverage (2010-2012), we encountered bears or bear sign on 34% of eider colonies and estimated greater egg loss as a consequence of depredation by bears than by more customary nest predators, such as foxes and gulls. Our findings demonstrate how changes in abiotic conditions caused by climate change have altered predator-prey dynamics and are leading to cascading ecological impacts in Arctic ecosystems.

  16. Longer distance from home to invasive centre is associated with lower rate of coronary angiographies following acute coronary syndrome

    DEFF Research Database (Denmark)

    Hvelplund, Anders; Galatius, Søren; Madsen, Mette

    -morbidity were recorded for each patient. Information on distance from each patients place of residence to the nearest invasive centre was obtained from Statistics Denmark along with information on education, family income, previous medicine use and vital status. Patients were grouped in tertiles according...... to distance to centre. Outcome was CAG within 60 days identified in the Danish Heart Registry. Cox proportional-hazard models were used to estimate the difference in the rate of CAG related to distance when adjusting for explanatory variables. Results: Of 24 910 patients with first ACS 33% lived less than 21...... km from one of the 5 invasive centres, 33% lived between 21-64 km, and 33% >64 km away. Longer distance to an invasive centre was associated with less invasive examination after the event. The cumulative incidence of CAG was 77% for the third living closest to a centre vs. 68% for those living...

  17. Jet joint undertaking. Annual report 1985

    International Nuclear Information System (INIS)

    1986-06-01

    After a presentation of the Jet and nuclear fusion, the results of Jet operations in 1985 are given: energy confinement, MHD activity and disruptive instabilities, impurities and radiation losses, plasma evolution, plasma boundary phenomena, control of plasma current, position and shape, RF heating. Technical achievements in 1985 are summarized: vacuum systems, first wall, multi-pellet injection for fuelling and re-fuelling, containment of forces during vertical instabilities, magnet systems, safety systems, power supplies, neutral beam heating, radio-frequency heating, remote handling, tritium handling, control and data acquisition, diagnostic systems are implied

  18. Benchmark analysis of railway networks and undertakings

    NARCIS (Netherlands)

    Hansen, I.A.; Wiggenraad, P.B.L.; Wolff, J.W.

    2013-01-01

    Benchmark analysis of railway networks and companies has been stimulated by the European policy of deregulation of transport markets, the opening of national railway networks and markets to new entrants and separation of infrastructure and train operation. Recent international railway benchmarking

  19. The Challenges Facing Distance Students in Undertaking ...

    African Journals Online (AJOL)

    This paper discusses the challenges facing distance students in Geography field Practical projects (GFPs) at The Open University of Tanzania (OUT). A random sample size of 19 students who participated in GFP1 in 2009 and 2010 were selected from randomly sampled regional centres of Singida, Dodoma, Njombe, and ...

  20. Jet Joint Undertaking Progress Report 1992

    International Nuclear Information System (INIS)

    1993-04-01

    The report sets out an overview of progress on JET during 1992 and with a survey of scientific and technical achievements during 1992 sets these advances in their general context. This summary is specifically cross-referenced to reports and articles prepared and presented by JET staff during 1992. The last section is devoted to future plans and certain developments which might enable enhancements of the machine to further improve its overall performance. The Appendices contain a list of work topics which have been carried out under Task Agreements with various Association Laboratories. In addition, a full list is included of all Articles, Reports and Conference papers published by JET authors in 1992

  1. Jet joint undertaking annual report 1988

    International Nuclear Information System (INIS)

    1989-07-01

    The 1988 activity report of the Joint European Torus (JET) project, is presented. The report provides an overview of the scientific, technical and administrative status of the program. The background of the project, the description of JET and Euratom and International Fusion Programs are explained. The technical status of the machine is given and it includes: technical changes and achievements during 1988; details of the operational organisation of experiments and pulse statistics; and progress on enhancements in machine systems for future operations. The results of JET operations in 1988, under various conditions of heating and combined scenarios in different magnetic field configurations, are provided. The project budget situation, contractual arrangements, in 1988, and staff complements, are included

  2. Jet Joint Undertaking. Progress report 1990

    International Nuclear Information System (INIS)

    1991-03-01

    This JET Progress Reports provides an overview summary and puts into context the scientific and technical advances made on JET during 1990. In addition, the Report is supplemented by appendices of contributions (in preprint form) of the more important JET articles published during the year, which set out the details of JET activities

  3. Jet joint undertaking. Progress report 1985

    International Nuclear Information System (INIS)

    1986-03-01

    A brief introduction and some background information relevant to the Report is first provided. Progress on JET during 1984 is overviewed and, with a survey of scientific and technical achievements during 1984, these advances are set in their general context. This summary is specifically crossreferenced to reports and articles prepared and presented by JET staff during 1985. The more important of these articles, which are of general interest, are reproduced as appendices to this Report. Certain developments are considered, which might enable additional improvements/modifications of the machine to further improve its overall performance. These improvements are considered to overcome certain limitations encountered generally on Tokmaks, particularly concerned with density limits, with plasma MHD behaviour, with impurities and with plasma transport. Some attention has been devoted to methods of surmounting these limitations and these are detailed in this section. In the Appendices, selected articles prepared by JET authors are reproduced in detail, and provide more details of the activities and achievements made on JET during 1985. In addition, a full list is included of all Articles, Reports and Conference papers published in 1985

  4. Undertaking midwifery studies: commencing students' views.

    Science.gov (United States)

    Carolan, Mary; Kruger, Gina

    2011-10-01

    to explore the motivations and beliefs of commencing midwifery students against a background of high course demand and high student attrition. a qualitative analysis of student reflective essays. Melbourne, Australia. all commencing midwifery students, in 2008, were invited to participate (n = 41). three primary motivations for choosing midwifery were identified, including: notions of altruism (wanting to help), a fascination with pregnancy and birth, and a view of midwifery as a personally satisfying career. Bachelor of Midwifery programmes attract students with idealised views about midwifery practice. Such views may lead to student disillusionment, tensions with educators and clinicians, and higher rates of student attrition. Students need greater support to examine their views about midwifery practice. More meaningful support may assist the students' successful socialisation into clinical practice. Copyright © 2009 Elsevier Ltd. All rights reserved.

  5. An Applied Method for Undertaking Phenomenological Explication ...

    African Journals Online (AJOL)

    denise

    knotted line rather than catching fish. I needed something which would group related material together in an ordered and meaningful fashion, and which ..... being “in pain ... on the inside of my heart and mind.” On another occasion he was strumming his guitar and singing a worship song entitled,. 'Jesus what a beautiful ...

  6. Fetal size in the second trimester is associated with the duration of pregnancy, small fetuses having longer pregnancies

    Directory of Open Access Journals (Sweden)

    Rasmussen Svein

    2008-07-01

    Full Text Available Abstract Background Conventionally, the pregnancy duration is accepted to be 280–282 days. Fetuses determined by ultrasound biometry to be small in early pregnancy, have an increased risk of premature birth. We speculate that the higher rate of preterm delivery in such small fetuses represents a pathological outcome not applicable to physiological pregnancies. Here we test the hypothesis that in low-risk pregnancies fetal growth (expressed by fetal size in the second trimester is itself a determinant for pregnancy duration with the slower growing fetuses having a longer pregnancy. Methods We analysed duration of gestation data for 541 women who had a spontaneous delivery having previously been recruited to a cross-sectional study of 650 low-risk pregnancies. All had a regular menses and a known date of their last menstrual period (LMP. Subjects were examined using ultrasound to determine fetal head circumference (HC, abdominal circumference (AC and femur length (FL at 10–24 weeks of gestation. Length of the pregnancy was calculated from LMP, and birth weights were noted. The effect of fetal size at 10–24 weeks of gestation on pregnancy duration was assessed also when adjusting for the difference between LMP and ultrasound based fetal age. Results Small fetuses (z-score -2.5 at second trimester ultrasound scan had lower birth weights (p Conclusion Fetal size in the second trimester is a determinant of birth weight and pregnancy duration, small fetuses having lower birth weights and longer pregnancies (up to 13 days compared with large fetuses. Our results support a concept of individually assigned pregnancy duration according to growth rates rather than imposing a standard of 280–282 days on all pregnancies.

  7. Comparison of single questions and brief questionnaire with longer validated food frequency questionnaire to assess adequate fruit and vegetable intake.

    Science.gov (United States)

    Cook, Amelia; Roberts, Kia; O'Leary, Fiona; Allman-Farinelli, Margaret Anne

    2015-01-01

    The aim of this study was to determine if a single question (SQ) for fruit and a SQ or five-item questionnaire for vegetable consumption (VFQ) could replace a longer food frequency questionnaire (FFQ) to screen for inadequate versus adequate intakes in populations. Participants (109) completed three test screeners: fruit SQ, vegetable SQ, and a five-item VFQ followed by the reference 74-item FFQ (version 2 of the Dietary Questionnaire for Epidemiological Studies [DQESv2]) including 13 fruit and 25 vegetable items. The five-item VFQ asked about intake of salad vegetables, cooked vegetables, white potatoes, legumes, and vegetable juice. The screeners were compared with the reference (DQESv2 FFQ) for sensitivity, specificity, and positive and negative predictive powers (PPV, NPV) to detect intakes of two or more servings of fruit and three or more servings of vegetables. Relative validity was examined using Bland-Altman statistics. The fruit SQ showed a PPV of 56% and an NPV of 83%. The PPV for the vegetable SQ was 30% and the NPV was 89%. For the five-item VFQ, the PPV was 39% and the NPV was 85%. Bland-Altman plots and linear regression equations showed that although the screener showed good agreement for fruit (unstandardized b1 coefficient = 0.04) for vegetable intake the difference between methods increased at higher intake levels (unstandardized b1 coefficients = -0.3 for the SQ, b1 = -0.6 for five-item VFQ). The fruit SQ and the five-item VFQ are suitable replacements for longer FFQs to detect inadequate intake and assess population mean but not individual intakes. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Is the Rise in the Prevalence of Renal Replacement Therapy at Older Ages the Price for Living Longer?

    Directory of Open Access Journals (Sweden)

    Frederik Peters

    2018-05-01

    Full Text Available BackgroundRenal replacement therapy (RRT is one of the most expensive in renal medicine. Cross-sectional studies suggest that life expectancy increases in the general population are associated with a higher burden of RRT. This study tests this hypothesis in a prospective setting among people aged 75+ living in Western Europe.MethodsWe gathered sex-specific data for 11 Western European countries in 2005–2014. RRT prevalence on country level was extracted from the ERA-EDTA registry, while data on population size and life expectancy for the 75+ age group came from the Eurostat database. GDP per capita was extracted from the OECD database. To measure the association between RRT prevalence and life expectancy, we performed Poisson regression models separately for each country and for all countries combined. To adjust for confounding, GDP per capita as well as time and country-fixed effects were included.ResultsOur analysis revealed that living longer coincides with rising RRT prevalence at ages 75+ in Western Europe between 2005 and 2014. On average, a 1-year increase in life expectancy was associated with a roughly 20% increase in RRT prevalence [(95% CI 21–23% in men and 19–22% in women]. However, after adjustments for confounding were made, the association became insignificant among women and became weaker among men, falling to a level of 11% [(95% CI 6–17%].ConclusionLiving longer was not necessarily associated with a higher burden of RRT in Western European countries.

  9. Exploring Lactobacillus reuteri DSM20016 as a biocatalyst for transformation of longer chain 1,2-diols: Limits with microcompartment.

    Science.gov (United States)

    Chen, Lu; Hatti-Kaul, Rajni

    2017-01-01

    Lactobacillus reuteri metabolises glycerol efficiently to form 3-hydroxypropionic acid (3-HP) and 1,3-propanediol (1,3PDO) by the same mechanism as that for 1,2-propanediol (1,2PDO) conversion to propionic acid and propanol via its propanediol utilization (pdu) pathway. Pdu enzymes are encoded by the pdu-operon, which also contain genes encoding the shell proteins of the microcompartment housing the metabolic pathway. In this work the selectivity and kinetics of the reactions catalysed by L. reuteri DSM20016 Pdu enzymes glycerol dehydratase (GDH), 1,3-propanediol oxidoreductase (PduQ) and coenzyme-A acylating propionaldehyde dehydrogenase (PduP), produced recombinantly, was investigated against corresponding substrates of different chain lengths. Glycerol dehydratase exhibited activity against C2-C4 polyols, with the highest activity against glycerol and 1,2-propanediol (1,2-PDO). A double mutant of the pduC gene of GDH (PduC-S302A/Q337A) was constructed that displayed lowered activity against glycerol and 1,2PDO but extended the substrate range upto C6-diol. The best substrate for both PduQ and PduP was 3-hydroxypropanal (3HPA), although PduP exhibited nearly 10-fold higher specific activity. The enzymes also showed some activity against C3-C10 aliphatic aldehydes, with PduP having higher relative activity. Subsequently, transformation of polyols using whole cells of L. reuteri containing the wild type- and mutated GDH, respectively, confirmed the reduced activity of the mutant against glycerol and 1,2PDO, but its activity against longer substrates was negligible. In contrast, recombinant Escherichia coli BL21(DE3) cells harboring the GDH variant converted diols with up to C6 carbon chain length to their respective aldehydes, suggesting that the protein shell of the microcompartment in L. reuteri posed a barrier to the passage of longer chain substrate.

  10. Analysis of longer period variation of the Kuroshio Current intrusion into the Luzon Strait using rectified wavelet power spectra

    Science.gov (United States)

    Yuan, Yaochu; Yang, Chenghao; Tseng, Yu-heng; Zhu, Xiao-Hua; Wang, Huiqun; Chen, Hong

    2017-08-01

    Longer period variation of the Kuroshio into the Luzon Strait (LS) was identified using acoustic Doppler current profiler (ADCP) observations as well as pressure and temperature time series data recorded by two TDs (manufactured by the RBR Ltd.) at mooring station N2 (20°40.441‧N, 120°38.324‧E). The ADCP was deployed at depths of 50-300 m between July 7, 2009 and April 10, 2011, and the TDs at around 340 and 365 m between July 9, 2009 and July 9, 2011. Observations provide strong evidence of longer period variation of the Kuroshio into the LS using the Vector rotary spectra (VRS) and Rectified wavelet power spectra analysis (RWPSA). RWPSA of the observations allowed the identification of two types of dominant periods. The first type, with the strongest power spectral density (PSD), had a dominant period of 112 d and was found throughout the upper 300 m. For example, the maximum PSD for western and northern velocity components time series were 3800 and 3550 at 50 m, respectively. The maximum power spectral density decrease with deeper depths, i.e., the depth dependence of maximum PSD. The 112 d period was also identified in the pressure and temperature time series data, at 340 m and 365 m. Combined RWPSA with VRS and mechanism analysis, it is clear that the occurrence of the most dominant period of 112 d in the upper 300 m is related to the clockwise meandering of the Kuroshio into the LS, which is caused by westward propagating stronger anticyclonic eddies from the interior ocean due to the interaction of Rossby eddies with the Kuroshio. The second type of dominant period, for example a 40 d period, is related to the anticlockwise meandering of the Kuroshio. The final dominant period of 14 d coincides with the fortnightly spring-neap tidal period.

  11. Panorama 2012 - Short-term trends in the gas industry

    International Nuclear Information System (INIS)

    Lecarpentier, Armelle

    2011-12-01

    Against the background of an energy market beset by the Fukushima crisis, the Arab spring and economic uncertainty, 2011 saw dynamic growth in demand for natural gas, although developments varied widely from region to region. New trends are emerging in the gas market, and these will have both short-term and longer-term impacts on how the industry develops. (author)

  12. Cancer Terms: After Treatment

    Science.gov (United States)

    ... Gallery Cancer Terms: Cancer Basics Cancer Terms: Research Statistics Cancer Terms: Treatment Cancer Terms: After Treatment Online Medical Dictionaries Diagnosing Cancer Managing Your Care Financial Considerations How ...

  13. Coast Guard: Strategies for Mitigating the Loss of Patrol Boats Are Achieving Results in the Near Term, but They Come at a Cost and Longer Term Sustainability Is Unknown

    Science.gov (United States)

    2008-06-01

    hours in future years. On the negative side, these strategies have ncreased operating and maintenance costs; reduced the availability for some n...legacy assets with a single, integrated package.7 To carry out this acquisition, the Coast Guard awarded the competitive contract to a systems

  14. Variability of the quasi-2-day wave and interaction with longer period planetary waves in the MLT at Cachoeira Paulista (22.7°S, 45°W)

    Science.gov (United States)

    Guharay, A.; Batista, P. P.; Clemesha, B. R.

    2015-08-01

    An exclusive study has been carried out with long term meteor wind data (2000-2014) to characterize the quasi-2-day wave (QTDW) in the mesosphere and lower thermosphere (MLT) and its interactions with the longer period planetary waves at Cachoeira Paulista (22.7°S, 45°W). The QTDW is observed to be dominant during late summer (January-February) all the years under consideration except 2013. All the wave parameters exhibit significant interannual variability. The maximum wave amplitude comes out to be 39 m/s, which is significantly higher than the reported northern hemispheric findings. The mean MLT period exhibits a wide range of variability (36-70 h) indicating the presence of multiple Rossby normal modes with varying zonal wave numbers. Modulations of the QTDW amplitude by the planetary waves with longer periodicities (>9 days) are evident, especially during summer. The nonlinear interactions between the 2-day wave and longer period waves are believed to give rise to a host of secondary waves with frequencies lying close to 2-day. The strong QTDW activity, as observed at this location, has potential to cause significant effect on the overlying ionosphere and hence the atmosphere-ionosphere dynamical coupling.

  15. Long-Term Ownership by Industrial Foundations

    DEFF Research Database (Denmark)

    Børsting, Christa Winther; Kuhn, Johan Moritz; Poulsen, Thomas

    2016-01-01

    in Denmark. Industrial foundations are independent legal entities without owners or members typically with the dual objective of preserving the company and using excess profits for charity. We use a unique Danish data set to examine the governance of foundation-owned companies. We show that they are long......-term in several respects. Foundations hold on to their shares for longer. Foundation-owned companies replace managers less frequently. They have more conservative capital structures with less leverage. Their companies survive longer. Their business decisions appear to be more long term. This paper supports...... the hypothesis that time horizons are influenced by ownership structures and particularly that industrial foundations promote longtermism. Policymakers which are interested in promoting longtermism should allow and perhaps even encourage the creation of industrial foundations. More generally they should consider...

  16. Inter-birth interval in zebras is longer following the birth of male foals than after female foals

    Science.gov (United States)

    Barnier, Florian; Grange, Sophie; Ganswindt, Andre; Ncube, Hlengisizwe; Duncan, Patrick

    2012-07-01

    Mammalian reproductive rates vary among individuals for physiological and environmental reasons. This study aims to determine reproductive rates from an individually monitored population of wild Plains zebras Equus quagga, and to assess the sources of variability in inter-birth intervals. The animals were monitored, where possible, every six months from 2004 to 2011. Thirty nine intervals corresponding to 65 births in 26 mares were identified, using direct observations and faecal steroid monitoring. Mean foaling rate of the population is 0.74 foal/year, and comparable with the literature. There was no significant effect of mother's age, nor of the season of previous birth on the length of inter-birth intervals. Inter-birth interval was significantly longer when the first foal was a male. This finding indicates that additional costs of having a son may delay future reproduction and thus reduce the total number of offspring a mare can have during her lifetime. Individually-based data provide critical information on the determinants of reproductive rates, and are therefore a key to understanding the causes of variations in life-history traits.

  17. Self-selection contributes significantly to the lower adiposity offaster, longer-distanced, male and female walkers

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Paul T.

    2006-01-06

    Although cross-sectional studies show active individuals areleaner than their sedentary counterparts, it remains to be determined towhat extent this is due to initially leaner men and women choosing toexercise longer and more intensely (self-selection bias). In this reportwalking volume (weekly distance) and intensity (speed) were compared tocurrent BMI (BMIcurrent) and BMI at the start of walking (BMIstarting) in20,353 women and 5,174 men who had walked regularly for exercise for 7.2and 10.6 years,respectively. The relationships of BMIcurrent andBMIstarting with distance and intensity were nonlinear (convex). Onaverage, BMIstarting explained>70 percent of the association betweenBMIcurrent and intensity, and 40 percent and 17 percent of theassociation between BMIcurrent and distance in women and men,respectively. Although the declines in BMIcurrent with distance andintensity were greater among fatter than leaner individuals, the portionsattributable to BMIstarting remained relatively constant regardless offatness. Thus self-selection bias accounts for most of the decline in BMIwith walking intensity and smaller albeit significant proportions of thedecline with distance. This demonstration of self-selection is germane toother cross-sectional comparisons in epidemiological research, givenself-selection is unlikely to be limited to weight or peculiar tophysical activity.

  18. Coeliac disease in Type 1 diabetes from 1990 to 2009: higher incidence in young children after longer diabetes duration.

    Science.gov (United States)

    Pham-Short, A; Donaghue, K C; Ambler, G; Chan, A K; Craig, M E

    2012-09-01

    To determine the incidence of coeliac disease in young people with Type 1 diabetes and to examine the effect of age at diabetes onset and disease duration. This was a clinic-based observational cohort study of 4379 people aged ≤ 18 years (49% male) between 1990 and 2009 from Sydney, Australia. Screening for coeliac disease was performed at diagnosis and 1-2 yearly using anti-endomysial and/or anti-tissue transglutaminase immunoglobulin A (IgA) antibodies. Coeliac disease was diagnosed by small bowel biopsy based on Marsh score ≥ III. Coeliac disease was confirmed by biopsy in 185; of these, 61 (33%) were endomysial or tissue transglutaminase IgA antibody-positive at diabetes diagnosis. Mean age at diabetes onset was 6.6 ± 4.0 vs. 8.4 ± 4.1 years in those without coeliac disease (P Coeliac disease was diagnosed after 2, 5 and 10 years of diabetes in 45, 78 and 94% of cases, respectively. Median time to coeliac disease diagnosis was longer in children aged Coeliac disease is common in young people with Type 1 diabetes; the risk is greatest with diabetes onset coeliac disease should be performed at diabetes diagnosis and for at least 10 years in young children. © 2012 The Sydney Children’s Hospitals Network (SCHN). Diabetic Medicine © 2012 Diabetes UK.

  19. Choice of quantum dot materials for fabricating memory devices with longer storage and faster writing of information

    Science.gov (United States)

    Damodaran, V.; Ghosh, Kaustab

    2016-12-01

    We present theoretical modelling and simulation approach for studying the electron and hole dynamics in various III-V quantum dot (QD) device systems for high performance memory applications. A rigorous computation is carried out by developing a self-consistent Schrödinger Poisson solver for obtaining the potential state of the QD for various applied voltages of the device. A detailed capture as well as emission mechanism of the carriers is elucidated at various operating temperatures ranging from 10 to 300 K. Our results showed suitability of holes in GaSb/GaAs dots for 107 times increase in the duration of data storage and 34 times faster writing capability as compared to InAs/GaAs QDs at room temperature operation. A trade-off is necessary between extending the storage time and increasing the write time by incorporation of high bandgap AlAs barrier. However, a technique is proposed to avoid the trade-off and minimize the write and erase time along with longer storage of data for QD memories with barrier layers. Our computation also reveals greater retention capacity of electrons over holes when localized to the same potential barrier. Applications of these QDs at cryogenic temperatures are also elucidated. Thus, based on our comparative analysis, valuable information is being provided to the device scientist in choosing suitable quantum dot material for memory devices and optimizing its performance.

  20. A computational feedforward model predicts categorization of masked emotional body language for longer, but not for shorter, latencies.

    Science.gov (United States)

    Stienen, Bernard M C; Schindler, Konrad; de Gelder, Beatrice

    2012-07-01

    Given the presence of massive feedback loops in brain networks, it is difficult to disentangle the contribution of feedforward and feedback processing to the recognition of visual stimuli, in this case, of emotional body expressions. The aim of the work presented in this letter is to shed light on how well feedforward processing explains rapid categorization of this important class of stimuli. By means of parametric masking, it may be possible to control the contribution of feedback activity in human participants. A close comparison is presented between human recognition performance and the performance of a computational neural model that exclusively modeled feedforward processing and was engineered to fulfill the computational requirements of recognition. Results show that the longer the stimulus onset asynchrony (SOA), the closer the performance of the human participants was to the values predicted by the model, with an optimum at an SOA of 100 ms. At short SOA latencies, human performance deteriorated, but the categorization of the emotional expressions was still above baseline. The data suggest that, although theoretically, feedback arising from inferotemporal cortex is likely to be blocked when the SOA is 100 ms, human participants still seem to rely on more local visual feedback processing to equal the model's performance.

  1. Longer wings for faster springs - wing length relates to spring phenology in a long-distance migrant across its range.

    Science.gov (United States)

    Hahn, Steffen; Korner-Nievergelt, Fränzi; Emmenegger, Tamara; Amrhein, Valentin; Csörgő, Tibor; Gursoy, Arzu; Ilieva, Mihaela; Kverek, Pavel; Pérez-Tris, Javier; Pirrello, Simone; Zehtindjiev, Pavel; Salewski, Volker

    2016-01-01

    In migratory birds, morphological adaptations for efficient migratory flight often oppose morphological adaptations for efficient behavior during resident periods. This includes adaptations in wing shape for either flying long distances or foraging in the vegetation and in climate-driven variation of body size. In addition, the timing of migratory flights and particularly the timely arrival at local breeding sites is crucial because fitness prospects depend on site-specific phenology. Thus, adaptations for efficient long-distance flights might be also related to conditions at destination areas. For an obligatory long-distance migrant, the common nightingale, we verified that wing length as the aerodynamically important trait, but not structural body size increased from the western to the eastern parts of the species range. In contrast with expectation from aerodynamic theory, however, wing length did not increase with increasing migration distances. Instead, wing length was associated with the phenology at breeding destinations, namely the speed of local spring green-up. We argue that longer wings are beneficial for adjusting migration speed to local conditions for birds breeding in habitats with fast spring green-up and thus short optimal arrival periods. We suggest that the speed of spring green-up at breeding sites is a fundamental variable determining the timing of migration that fine tune phenotypes in migrants across their range.

  2. The development and evaluation of the use of a virtual learning environment (Blackboard 5) to support the learning of pre-qualifying nursing students undertaking a human anatomy and physiology module.

    Science.gov (United States)

    Green, Sue M; Weaver, Mike; Voegeli, David; Fitzsimmons, Debs; Knowles, Jess; Harrison, Maureen; Shephard, Kerry

    2006-07-01

    Students commence nurse education with varying levels of understanding of human anatomy and physiology due to a wide range of previous exposure to the topic. All students, however, are required to attain a broad knowledge of this topic prior to qualification. This paper describes the use of a Virtual Learning Environment (VLE), Blackboard 5, and the associated development of appropriate resources aimed at supporting nursing students undertaking a human anatomy and physiology module at Higher Education Level 1. The VLE was used as part of a blended learning approach. The results suggested that the majority of students utilised the VLE throughout the academic year. Opportunities for independent and self-directed learning were available in that students chose when and where to learn. Students generally commented favourably on ease of use and type of resources available. Frequency of use of the VLE, however, did not correlate strongly with the final examination mark achieved. Overall the VLE and the associated available resources appeared useful in supporting student learning and has been adopted for use in subsequent years.

  3. Obese motorcycle riders have a different injury pattern and longer hospital length of stay than the normal-weight patients.

    Science.gov (United States)

    Liu, Hang-Tsung; Rau, Cheng-Shyuan; Wu, Shao-Chun; Chen, Yi-Chun; Hsu, Shiun-Yuan; Hsieh, Hsiao-Yun; Hsieh, Ching-Hua

    2016-04-14

    The adverse effects of obesity on the physical health have been extensively studied in the general population, but not in motorcycle riders (includes both drivers and pillions). The aim of this study was to compare injury patterns, injury severities, mortality rates, and in-hospital or intensive care unit (ICU) length of stay (LOS) between obese and normal-weight patients who were hospitalized for the treatment of trauma following motorcycle accidents in a level I trauma center. Detailed data of 466 obese adult patients with a body mass index (BMI) ≥30 kg/m(2) and 2701 normal-weight patients (25 > BMI ≥18.5 kg/m(2)) who had sustained motorcycle accident-related injuries were retrieved from the Trauma Registry System between January 1, 2009 and December 31, 2013. We used the Pearson's chi-squared test, Fisher's exact test, and independent Student's t-test to analyze differences between the two groups. Compared to normal-weight motorcycle riders, more obese riders were men and drivers as opposed to pillions. In addition, fewer obese motorcycle riders showed alcohol intoxication. Analyses of the patients' Abbreviated Injury Scale (AIS) scores revealed that obese motorcycle riders presented with a higher rate of injury to the thorax, but a lower rate of injury to the face than normal-weight patients. In addition, obese motorcycle riders had a 2.7-fold greater incidence of humeral, 1.9-fold greater incidence of pelvic, and 1.5-fold greater incidence of rib fractures. In contrast, normal-weight motorcycle riders sustained a significantly higher rate of maxillary and clavicle fractures. Obese motorcycle riders had a significant longer in-hospital LOS than normal-weight motorcycle riders did (10.6 days vs. 9.5 days, respectively; p = 0.044), with an increase in in-hospital LOS of 0.82 days associated with every 10-unit increase in BMI. No statistically significant differences in Injury Severity Score (ISS), New Injury Severity Score (NISS), Trauma

  4. Realistic minimum accident source terms - Evaluation, application, and risk acceptance

    International Nuclear Information System (INIS)

    Angelo, P. L.

    2009-01-01

    The evaluation, application, and risk acceptance for realistic minimum accident source terms can represent a complex and arduous undertaking. This effort poses a very high impact to design, construction cost, operations and maintenance, and integrated safety over the expected facility lifetime. At the 2005 Nuclear Criticality Safety Division (NCSD) Meeting in Knoxville Tenn., two papers were presented mat summarized the Y-12 effort that reduced the number of criticality accident alarm system (CAAS) detectors originally designed for the new Highly Enriched Uranium Materials Facility (HEUMF) from 258 to an eventual as-built number of 60. Part of that effort relied on determining a realistic minimum accident source term specific to the facility. Since that time, the rationale for an alternate minimum accident has been strengthened by an evaluation process that incorporates realism. A recent update to the HEUMF CAAS technical basis highlights the concepts presented here. (authors)

  5. White matter measures are near normal in controlled HIV infection except in those with cognitive impairment and longer HIV duration.

    Science.gov (United States)

    Cysique, Lucette A; Soares, James R; Geng, Guangqiang; Scarpetta, Maia; Moffat, Kirsten; Green, Michael; Brew, Bruce J; Henry, Roland G; Rae, Caroline

    2017-08-01

    The objective of the current study was to quantify the degree of white matter (WM) abnormalities in chronic and virally suppressed HIV-infected (HIV+) persons while carefully taking into account demographic and disease factors. Diffusion tensor imaging (DTI) was conducted in 40 HIV- and 82 HIV+ men with comparable demographics and life style factors. The HIV+ sample was clinically stable with successful viral control. Diffusion was measured across 32 non-colinear directions with a b-value of 1000 s/mm 2 ; fractional anisotropy (FA) and mean diffusivity (MD) maps were quantified with Itrack IDL. Using the ENIGMA DTI protocol, FA and MD values were extracted for each participant and in 11 skeleton regions of interest (SROI) from standard labels in the JHU ICBM-81 atlas covering major striato-frontal and parietal tracks. We found no major differences in FA and MD values across the 11 SROI between study groups. Within the HIV+ sample, we found that a higher CNS penetrating antiretroviral treatment, higher current CD4+ T cell count, and immune recovery from the nadir CD4+ T cell count were associated with increased FA and decreased MD (p < 0.05-0.006), while HIV duration, symptomatic, and asymptomatic cognitive impairment were associated with decreased FA and increased MD (p < 0.01-0.004). Stability of HIV treatment and antiretroviral CNS penetration efficiency in addition to current and historical immune recovery were related to higher FA and lower MD (p = 0.04-p < 0.01). In conclusion, WM DTI measures are near normal except for patients with neurocognitive impairment and longer HIV disease duration.

  6. Growing Lots of Food Very Fast Can Hurt our Water for a Long Time, Longer Than You Might Think

    Science.gov (United States)

    Van Meter, K. J.; Basu, N. B.

    2016-12-01

    More people arrive here every day, and we keep trying to grow enough food for them to eat. We try to grow more and more by adding things that can hurt our water and our air. We try to keep track of these things that we add, but we don't understand where it all goes. We don't understand how much is in the ground. We don't understand how much is in the water under the ground. We don't understand how long the water will be bad, even after we stop adding things to help grow more food. Many people have tried to stop adding these things, or to stop these things from getting to the water, and they get sad when they have worked hard to do better but the water stays bad. In our work, we try to help people understand how to make the water better, even when they have to grow a lot of food. We have looked at the ground all around where people grow a lot of food, and have found that some of the bad things stay behind in the ground. This means that even when we work hard to make our water good, the things left in the ground might make our water stay bad for a long time. We tried to find out how long it would take to make our water good if we are working our hardest to be better. It will take longer than you might think, maybe three times as many years as you have fingers.

  7. Cotton fiber elongation network revealed by expression profiling of longer fiber lines introgressed with different Gossypium barbadense chromosome segments.

    Science.gov (United States)

    Fang, Lei; Tian, Ruiping; Li, Xinghe; Chen, Jiedan; Wang, Sen; Wang, Peng; Zhang, Tianzhen

    2014-10-02

    Cotton fiber, a highly elongated, thickened single cell of the seed epidermis, is a powerful cell wall research model. Fiber length, largely determined during the elongation stage, is a key property of fiber quality. Several studies using expressed sequence tags and microarray analysis have identified transcripts that accumulate preferentially during fiber elongation. To further show the mechanism of fiber elongation, we used Digital Gene Expression Tag Profiling to compare transcriptome data from longer fiber chromosome introgressed lines (CSILs) containing segments of various Gossypium barbadense chromosomes with data from its recurrent parent TM-1 during fiber elongation (from 5 DPA to 20 DPA). A large number of differentially expressed genes (DEGs) involved in carbohydrate, fatty acid and secondary metabolism, particularly cell wall biosynthesis, were highly upregulated during the fiber elongation stage, as determined by functional enrichment and pathway analysis. Furthermore, DEGs related to hormone responses and transcription factors showed upregulated expression levels in the CSILs. Moreover, metabolic and regulatory network analysis indicated that the same pathways were differentially altered, and distinct pathways exhibited altered gene expression, in the CSILs. Interestingly, mining of upregulated DEGs in the introgressed segments of these CSILs based on D-genome sequence data showed that these lines were enriched in glucuronosyltransferase, inositol-1, 4, 5-trisphosphate 3-kinase and desulfoglucosinolate sulfotransferase activity. These results were similar to the results of transcriptome analysis. This report provides an integrative network about the molecular mechanisms controlling fiber length, which are mainly tied to carbohydrate metabolism, cell wall biosynthesis, fatty acid metabolism, secondary metabolism, hormone responses and Transcription factors. The results of this study provide new insights into the critical factors associated with cell

  8. What are the keys to a longer, happier life? Answers from five decades of health psychology research.

    Science.gov (United States)

    Johnson, Blair T; Acabchuk, Rebecca L

    2018-01-01

    It has long been known that factors of the mind and of interpersonal relationships influence health, but it is only in the last 50 years that an independent scientific field of health psychology appeared, dedicated to understanding psychological and behavioral processes in health, illness, and healthcare. This article (a) reviews important research that answers the question of how human beings can have longer, happier lives; and (b) highlights trends in health psychology featuring articles in Social Science & Medicine as well as other related literature. Since the 1970s, health psychology has embraced a biopsychosocial model such that biological factors interact and are affected by psychological and social elements. This model has illuminated all subjects of health, ranging from interventions to lower stress and/or to improve people's ability to cope with stressors, to mental and physical health. Importantly, a health psychology perspective is behavioral: The majority of chronic diseases of today can be avoided or reduced through healthy lifestyles (e.g., sufficient exercise, proper diet, sufficient sleep). Thus, behavior change is the key target to help reduce the immense public health burden of chronic lifestyle illnesses. Health psychology also focuses on how social patterns influence health behavior and outcomes, in the form of patient-provider interactions or as social forces in communities where people live, work, and play. Health psychology is congenial to other health sciences, especially when allied with ecological perspectives that incorporate factors upstream from individual behavior, such as networks linked to individuals (e.g., peer groups, communities). Over its history, health psychology research has been responsive to societal and medical needs and has routinely focused on understanding health disparities. By relying on a strong interdisciplinary approach, research in health psychology provides a remarkably comprehensive perspective on how people

  9. Resistant Hypertension after Hypertensive Intracerebral Hemorrhage Is Associated with More Medical Interventions and Longer Hospital Stays without Affecting Outcome

    Directory of Open Access Journals (Sweden)

    Daojun Hong

    2017-05-01

    Full Text Available BackgroundHypertension (HTN is the most common cause of spontaneous intracerebral hemorrhage (ICH. The aim of this study is to investigate the role of resistant HTN in patients with ICH.Methods and resultsWe conducted a retrospective study of all consecutive ICH admissions at our medical center from November 2013 to October 2015. The clinical features of patients with resistant HTN (requiring four or more antihypertensive agents to keep systolic blood pressure <140 mm Hg were compared with those with responsive HTN (requiring three or fewer agents. Of the 152 patients with hypertensive ICH, 48 (31.6% had resistant HTN. Resistant HTN was independently associated with higher body mass index and proteinuria. Compared to the responsive group, patients with resistant HTN had higher initial blood pressures and greater requirement for ventilator support, hematoma evacuation, hypertonic saline therapy, and nicardipine infusion. Resistant HTN increases length of stay (LOS in the intensive care unit (ICU (4.2 vs 2.1 days; p = 0.007 and in the hospital (11.5 vs 7.0 days; p = 0.003. Multivariate regression analysis showed that the rate of systolic blood pressure >140 mm Hg and duration of nicardipine infusion were independently associated with LOS in the ICU. There was no significant difference in hematoma expansion and functional outcome at hospital discharge between the two groups.ConclusionResistant HTN in patients with ICH is associated with more medical interventions and longer LOS without effecting outcome at hospital discharge.

  10. Plantar pressures are higher in cases with diabetic foot ulcers compared to controls despite a longer stance phase duration.

    Science.gov (United States)

    Fernando, Malindu E; Crowther, Robert G; Lazzarini, Peter A; Sangla, Kunwarjit S; Wearing, Scott; Buttner, Petra; Golledge, Jonathan

    2016-09-15

    Current international guidelines advocate achieving at least a 30 % reduction in maximum plantar pressure to reduce the risk of foot ulcers in people with diabetes. However, whether plantar pressures differ in cases with foot ulcers to controls without ulcers is not clear. The aim of this study was to assess if plantar pressures were higher in patients with active plantar diabetic foot ulcers (cases) compared to patients with diabetes without a foot ulcer history (diabetes controls) and people without diabetes or a foot ulcer history (healthy controls). Twenty-one cases with diabetic foot ulcers, 69 diabetes controls and 56 healthy controls were recruited for this case-control study. Plantar pressures at ten sites on both feet and stance phase duration were measured using a pre-established protocol. Primary outcomes were mean peak plantar pressure, pressure-time integral and stance phase duration. Non-parametric analyses were used with Holm's correction to correct for multiple testing. Binary logistic regression models were used to adjust outcomes for age, sex and body mass index. Median differences with 95 % confidence intervals and Cohen's d values (standardised mean difference) were reported for all significant outcomes. The majority of ulcers were located on the plantar surface of the hallux and toes. When adjusted for age, sex and body mass index, the mean peak plantar pressure and pressure-time integral of toes and the mid-foot were significantly higher in cases compared to diabetes and healthy controls (p diabetic foot ulcers despite having a longer stance phase duration which would be expected to lower plantar pressure. Whether plantar pressure changes can predict ulcer healing should be the focus of future research. These results highlight the importance of offloading feet during active ulceration in addition to before ulceration.

  11. Maternal effects on male weaponry: female dung beetles produce major sons with longer horns when they perceive higher population density.

    Science.gov (United States)

    Buzatto, Bruno A; Tomkins, Joseph L; Simmons, Leigh W

    2012-07-23

    Maternal effects are environmental influences on the phenotype of one individual that are due to the expression of genes in its mother, and are expected to evolve whenever females are better capable of assessing the environmental conditions that their offspring will experience than the offspring themselves. In the dung beetle Onthophagus taurus, conditional male dimorphism is associated with alternative reproductive tactics: majors fight and guard females whereas minors sneak copulations. Furthermore, variation in dung beetle population density has different fitness consequences for each male morph, and theory predicts that higher population density might select for a higher frequency of minors and/or greater expenditure on weaponry in majors. Because adult dung beetles provide offspring with all the nutritional resources for their development, maternal effects strongly influence male phenotype. Here we tested whether female O. taurus are capable of perceiving population density, and responding by changing the phenotype of their offspring. We found that mothers who were reared with other conspecifics in their pre-mating period produced major offspring that had longer horns across a wider range of body sizes than the major offspring of females that were reared in isolation in their pre-mating period. Moreover, our results indicate that this maternal effect on male weaponry does not operate through the amount of dung provided by females to their offspring, but is rather transmitted through egg or brood mass composition. Finally, although theory predicts that females experiencing higher density might produce more minor males, we found no support for this, rather the best fitting models were equivocal as to whether fewer or the same proportions of minors were produced. Our study describes a new type of maternal effect in dung beetles, which probably allows females to respond to population density adaptively, preparing at least their major offspring for the sexual

  12. Long-lived weight-reduced αMUPA mice show higher and longer maternal-dependent postnatal leptin surge.

    Directory of Open Access Journals (Sweden)

    Mariel Pinsky

    Full Text Available We investigated whether long-lived weight-reduced αMUPA mice differ from their wild types in postnatal body composition and leptin level, and whether these differences are affected by maternal-borne factors. Newborn αMUPA and wild type mice had similar body weight and composition up to the third postnatal week, after which αMUPA mice maintained lower body weight due to lower fat-free mass. Both strains showed a surge in leptin levels at the second postnatal week, initiating earlier in αMUPA mice, rising higher and lasting longer than in the wild types, mainly in females. Leptin level in dams' serum and breast milk, and in their pup's stomach content were also higher in αMUPA than in the WT during the surge peak. Leptin surge preceded the strain divergence in body weight, and was associated with an age-dependent decrease in the leptin:fat mass ratio-suggesting that postnatal sex and strain differences in leptin ontogeny are strongly influenced by processes independent of fat mass, such as production and secretion, and possibly outside fat tissues. Dam removal elevated corticosterone level in female pups from both strains similarly, yet mitigated the leptin surge only in αMUPA-eliminating the strain differences in leptin levels. Overall, our results indicate that αMUPA's postnatal leptin surge is more pronounced than in the wild type, more sensitive to maternal deprivation, less related to pup's total adiposity, and is associated with a lower post-weaning fat-free mass. These strain-related postnatal differences may be related to αMUPA's higher milk-borne leptin levels. Thus, our results support the use of αMUPA mice in future studies aimed to explore the relationship between maternal (i.e. milk-borne factors, postnatal leptin levels, and post-weaning body composition and energy homeostasis.

  13. Long-lived weight-reduced αMUPA mice show higher and longer maternal-dependent postnatal leptin surge.

    Science.gov (United States)

    Pinsky, Mariel; Rauch, Maayan; Abbas, Atallah; Sharabi-Nov, Adi; Tamir, Snait; Gutman, Roee

    2017-01-01

    We investigated whether long-lived weight-reduced αMUPA mice differ from their wild types in postnatal body composition and leptin level, and whether these differences are affected by maternal-borne factors. Newborn αMUPA and wild type mice had similar body weight and composition up to the third postnatal week, after which αMUPA mice maintained lower body weight due to lower fat-free mass. Both strains showed a surge in leptin levels at the second postnatal week, initiating earlier in αMUPA mice, rising higher and lasting longer than in the wild types, mainly in females. Leptin level in dams' serum and breast milk, and in their pup's stomach content were also higher in αMUPA than in the WT during the surge peak. Leptin surge preceded the strain divergence in body weight, and was associated with an age-dependent decrease in the leptin:fat mass ratio-suggesting that postnatal sex and strain differences in leptin ontogeny are strongly influenced by processes independent of fat mass, such as production and secretion, and possibly outside fat tissues. Dam removal elevated corticosterone level in female pups from both strains similarly, yet mitigated the leptin surge only in αMUPA-eliminating the strain differences in leptin levels. Overall, our results indicate that αMUPA's postnatal leptin surge is more pronounced than in the wild type, more sensitive to maternal deprivation, less related to pup's total adiposity, and is associated with a lower post-weaning fat-free mass. These strain-related postnatal differences may be related to αMUPA's higher milk-borne leptin levels. Thus, our results support the use of αMUPA mice in future studies aimed to explore the relationship between maternal (i.e. milk-borne) factors, postnatal leptin levels, and post-weaning body composition and energy homeostasis.

  14. Conformal radiotherapy for prostate cancer - Longer duration of acute genitourinary toxicity in patients with prior history of invasive urological procedure

    Energy Technology Data Exchange (ETDEWEB)

    Odrazka, Karel; Vanasek, Jaroslav; Vaculikova, Miloslava; Petera, Jiri; Zouhar, Milan; Zoul, Zdenk; Stejskal, Jan; Skrabkova, Zuzana; Kadeka, David [Charles Univ. Medical School and Teaching Hospital, Hradec Kralove (Czech Republic). Dept. of Radiotherapy and Oncology

    2001-11-01

    The incidence and predictors of acute toxicity were evaluated in patients treated with three-dimensional conformal radiotherapy (3D-CRT) for localized prostate cancer. Between December 1997 and November 1999, 116 patients with T1-T3 prostatic carcinoma were enrolled in the study. Ninety patients were treated with 70 Gy and 26 patients with T3 tumors received 74 Gy. Of the 116 patients 42 (36.2%) had a prior history of invasive urological procedure (IUP) (transurethral resection of the prostate or transvesical prostatectomy for benign prostatic hyperplasia). Acute gastrointestinal (GI) and genitourinary (GU) symptoms were graded according to the EORTC/RTOG scoring system. Toxicity duration after the completion of 3D-CRT was recorded. The majority of patients experienced only mild or no (Grade 1) acute toxicities. Medications for GI and GU symptoms (Grade 2) were required by 28.4% and 12.9% of patients, respectively. Only one case of Grade 3 GI toxicity (0.9%) was observed. Seven patients (6.1%) experienced severe GU toxicity (Grade 3 or 4). No correlation was found between acute toxicity and age, stage, dose (70 Gy vs. 74 Gy), IUP and pelvic lymphadenectomy. A significant relationship was observed between the duration of acute GU toxicity and prior IUP. Symptoms persisted for more than 4 weeks in 51.9% and 26.0% of patients with and without a prior history of IUP, respectively (p = 0.02). The incidence of acute complications, associated with 3D-CRT for prostate cancer, was acceptable in our cohort of patients. A prior history of IUP resulted in a significantly longer duration of acute GU toxicity.

  15. Reasons for and factors associated with issuing sickness certificates for longer periods than necessary: results from a nationwide survey of physicians

    OpenAIRE

    Br?nstr?m, Richard; Arrel?v, Britt; Gustavsson, Catharina; Kjeldg?rd, Linnea; Ljungquist, Therese; Nilsson, Gunnar H; Alexanderson, Kristina

    2013-01-01

    Background Physicians? work with sickness certifications is an understudied field. Physicians? experience of sickness certifying for longer periods than necessary has been previous reported. However, the extent and frequency of such sickness certification is largely unknown. The aims of this study were: a) to explore the frequency of sickness certifying for longer periods than necessary among physicians working in different clinical settings; b) to examine main reasons for issuing sickness ce...

  16. Significantly longer envelope V2 loops are characteristic of heterosexually transmitted subtype B HIV-1 in Trinidad.

    Directory of Open Access Journals (Sweden)

    Aneisha M Collins-Fairclough

    Full Text Available In Trinidad and the wider Caribbean, subtype B Human Immunodeficiency Virus-type 1 (HIV-1B overwhelmingly accounts for HIV infection among heterosexuals; this contrasts with the association of HIV-1B with homosexual transmission and injecting drug use globally. The HIV envelope contains genetic determinants of cell tropism and evasion from immune attack. In this study we investigate the genetic properties of the env V1-C4 of HIV-1B soon after transmission to Trinidadian heterosexuals. This will reveal distinctive genetic features of the strains that cause the HIV-1B epidemic in Trinidad and generate insights to better understand their properties.Quasispecies sampling was performed on the env V1-C4 of HIV-1B strains soon after transmission to heterosexual Trinidadians in a cohort of seroconverters. Phylogenetic relationships were determined for these quasispecies and the length and number of asparagine (N linked glycosylation sites (NLGS in their variable loops compared to that for HIV-1B globally. Signature amino acids within the constant domains of the env V1-C4 were identified for heterosexually transmitted HIV-1B from Trinidad relative to HIV-1B globally. HIV-1B obtained from Trinidadian heterosexuals soon after seroconversion had significantly longer V2 loops with one more glycosylation site, shorter V3 loops and no significant difference in V1 or V4 when compared to HIV-1B obtained soon after seroconversion from infected individuals in the rest of the world. HIV-1B soon after seroconversion and during chronic infection of Trinidadians was not significantly different, suggesting that distinctly long V2 loops are characteristic of HIV-1B in Trinidad. A threonine deletion at position 319 (T319- along with the substitutions R315K and S440R were found to be distinctly associated with HIV-1B from Trinidad compared to HIV-1B globally.This finding of distinctive genetic features that are characteristic of HIV-1B strains from Trinidad is consistent

  17. Professional Music Training and Novel Word Learning: From Faster Semantic Encoding to Longer-lasting Word Representations.

    Science.gov (United States)

    Dittinger, Eva; Barbaroux, Mylène; D'Imperio, Mariapaola; Jäncke, Lutz; Elmer, Stefan; Besson, Mireille

    2016-10-01

    On the basis of previous results showing that music training positively influences different aspects of speech perception and cognition, the aim of this series of experiments was to test the hypothesis that adult professional musicians would learn the meaning of novel words through picture-word associations more efficiently than controls without music training (i.e., fewer errors and faster RTs). We also expected musicians to show faster changes in brain electrical activity than controls, in particular regarding the N400 component that develops with word learning. In line with these hypotheses, musicians outperformed controls in the most difficult semantic task. Moreover, although a frontally distributed N400 component developed in both groups of participants after only a few minutes of novel word learning, in musicians this frontal distribution rapidly shifted to parietal scalp sites, as typically found for the N400 elicited by known words. Finally, musicians showed evidence for better long-term memory for novel words 5 months after the main experimental session. Results are discussed in terms of cascading effects from enhanced perception to memory as well as in terms of multifaceted improvements of cognitive processing due to music training. To our knowledge, this is the first report showing that music training influences semantic aspects of language processing in adults. These results open new perspectives for education in showing that early music training can facilitate later foreign language learning. Moreover, the design used in the present experiment can help to specify the stages of word learning that are impaired in children and adults with word learning difficulties.

  18. A Lipidomics Approach to Assess the Association Between Plasma Sphingolipids and Verbal Memory Performance in Coronary Artery Disease Patients Undertaking Cardiac Rehabilitation: A C18:0 Signature for Cognitive Response to Exercise.

    Science.gov (United States)

    Saleem, Mahwesh; Herrmann, Nathan; Dinoff, Adam; Mielke, Michelle M; Oh, Paul I; Shammi, Prathiba; Cao, Xingshan; Venkata, Swarajya Lakshmi Vattem; Haughey, Norman J; Lanctôt, Krista L

    2017-01-01

    Early subtle deficits in verbal memory, which may indicate early neural risk, are common in patients with coronary artery disease (CAD). While exercise can improve cognition, cognitive response to exercise is heterogeneous. Sphingolipids have been associated with the development and progression of CAD, and impairments in sphingolipid metabolism may play roles in neurodegeneration and in the neural adaptation response to exercise. In this study, change in plasma concentrations of sphingolipids was assessed in relation to change in verbal memory performance and in other cognitive domains among CAD subjects undertaking a 6-month cardiac rehabilitation (CR) program. Patients with CAD (n = 120, mean age = 64±6 y, 84% male, years of education = 16±3) underwent CR with neuropsychological assessments and blood collected at baseline, 3-, and 6-months. Z-scores based on age, gender, and education were combined for verbal memory, visuospatial memory, processing speed, executive function, and global cognition tasks to calculate cognitive domain Z-scores. Plasma sphingolipid concentrations were measured from fasting blood samples using high performance liquid chromatography coupled electrospray ionization tandem mass spectrometry (LC/MS/MS). Mixed models were used to identify sphingolipids significantly associated with performance in verbal memory and other cognitive domains, adjusting for potential confounders. A decrease in ceramide C18:0 concentration was significantly associated with improvement in verbal memory performance (b[SE] = -0.51 [0.25], p = 0.04), visuospatial memory (b[SE] = -0.44 [0.22], p = 0.05), processing speed (b[SE] = -0.89 [0.32], p = 0.007), and global cognition (b[SE] = -1.47 [0.59], p = 0.01) over 6 months of CR. Plasma ceramide C18:0 concentrations may be a sensitive marker of cognitive response to exercise in patients with CAD.

  19. Social and environmental assessment: a preliminary data base on population and territory in the undertakings pipelines: a natural gas pipeline GASBEL II; Avaliacao socioambiental - base de dados preliminar sobre populacao e territorio em empreendimentos de dutos - estudo de caso: avaliacao socioambiental GASBEL II

    Energy Technology Data Exchange (ETDEWEB)

    Bartolini, Marcia; Bach, Vanessa [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil); Ismerio, Marcia [Pallos Consultorias, Rio de Janeiro, RJ (Brazil); Leal, Edna Mara [Camargo Correa Engenharia (Brazil)

    2008-07-01

    The social environmental assessment consists in an instrument of planning which principal objective is to know the social ambient that will be changed by the PETROBRAS' pipe undertakings, that are planning to be implemented and will be analyzed by the licensers environmental organs. When pipeline projects are planned, their route cross some regions and ecological sensitive areas, therefore, the attitude of consider the social environmental aspects at the planning stage through the use of valuation instruments, anticipating, the potential social and environmental impacts, assumes more importance in integrating management of these undertakings. This presentation has the main objective to stand out the relevance of the social environmental assessment realization as preliminary knowledge base to the undertakings, since the research results developed represents a support of information about the regions where the undertakings install themselves in distinct stages: environmental permits, assembly and construction and operating. The social environmental assessment of the project named GASBEL II is presented as a case study once it allow to observe a gas pipeline transport project to be implemented at different regions and areas. The Pipeline will cross two different federal states, where the local research boarded many communities with different ways and conditions of life, territory use, cultural expressions and other aspects. (author)

  20. No Longer Invisible: Understanding the Psychosocial Impact of Skin Color Stratification in the Lives of African American Women.

    Science.gov (United States)

    Hall, J Camille

    2017-05-01

    This article examines how skin color stratification, termed "colorism," affects the psychological well-being of African American women. Previous research has shown that the experience of colorism is pervasive within the black community and that black women have been culturally or personally affected by intraracial discrimination. This article describes a qualitative study that used focus groups to investigate the experiences of black women that were categorized according to their self-ascribed skin tone group. The findings indicated that women of different hues have distinctive experiences based on their skin tone, and that these experiences influence how they felt about themselves and interact with others. The article concludes with a discussion of practice, research, and policy implications. © 2017 National Association of Social Workers.

  1. Long-term effects of a home-visiting intervention for depressed mothers and their infants

    NARCIS (Netherlands)

    Kersten-Alvarez, L.E.; Hosman, C.M.H.; Riksen-Walraven, J.M.A.; Doesum, K.T.M. van; Hoefnagels, C.C.J.

    2010-01-01

    Background - Whereas preventive interventions for depressed mothers and their infants have yielded positive short-term outcomes, few studies have examined their long-term effectiveness. The present follow-up of a randomised controlled trial (RCT) is one of the first to examine the longer-term

  2. The role of institutional investors in promoting long-term value ...

    African Journals Online (AJOL)

    African Review of Economics and Finance ... The excessive focus of corporate decision-makers on short-term profit maximising goals, often at the expense of longer-term objectives, results in insufficient attention being paid to the ... Can institutional investors be held to a more long-term view of corporate governance?

  3. Polar zoobenthos blue carbon storage increases with sea ice losses, because across-shelf growth gains from longer algal blooms outweigh ice scour mortality in the shallows.

    Science.gov (United States)

    Barnes, David K A

    2017-12-01

    One of the major climate-forced global changes has been white to blue to green; losses of sea ice extent in time and space around Arctic and West Antarctic seas has increased open water and the duration (though not magnitude) of phytoplankton blooms. Blueing of the poles has increases potential for heat absorption for positive feedback but conversely the longer phytoplankton blooms have increased carbon export to storage and sequestration by shelf benthos. However, ice shelf collapses and glacier retreat can calve more icebergs, and the increased open water allows icebergs more opportunities to scour the seabed, reducing zoobenthic blue carbon capture and storage. Here the size and variability in benthic blue carbon in mega and macrobenthos was assessed in time and space at Ryder and Marguerite bays of the West Antarctic Peninsula (WAP). In particular the influence of the duration of primary productivity and ice scour are investigated from the shallows to typical shelf depths of 500 m. Ice scour frequency dominated influence on benthic blue carbon at 5 m, to comparable with phytoplankton duration by 25 m depth. At 500 m only phytoplankton duration was significant and influential. WAP zoobenthos was calculated to generate ~10 7 , 4.5 × 10 6 and 1.6 × 10 6 tonnes per year (between 2002 and 2015) in terms of production, immobilization and sequestration of carbon respectively. Thus about 1% of annual primary productivity has sequestration potential at the end of the trophic cascade. Polar zoobenthic blue carbon capture and storage responses to sea ice losses, the largest negative feedback on climate change, has been underestimated despite some offsetting of gain by increased ice scouring with more open water. Equivalent survey of Arctic and sub-Antarctic shelves, for which new projects have started, should reveal the true extent of this feedback and how much its variability contributes to uncertainty in climate models. © 2017 John Wiley & Sons Ltd.

  4. Adolescent Metabolic Syndrome Risk Is Increased with Higher Infancy Weight Gain and Decreased with Longer Breast Feeding

    Directory of Open Access Journals (Sweden)

    Kim Khuc

    2012-01-01

    Full Text Available Background. Prevalence of the metabolic syndrome is increasing in pediatric age groups worldwide. Meeting the criteria for the metabolic syndrome puts children at risk for later cardiovascular and metabolic disease. Methods. Using linear regression, we examined the association between infant weight gain from birth to 3 months and risk for the metabolic syndrome among 16- to 17-year-old Chilean adolescents (n=357, accounting for the extent of breastfeeding in infancy and known covariates including gender, birth weight, and socioeconomic status. Results. Participants were approximately half male (51%, born at 40 weeks of gestation weighing 3.5 kg, and 48% were exclusively breastfed for ≥90 days. Factors independently associated with increased risk of metabolic syndrome in adolescence were faster weight gain in the first 3 months of life (B=0.16, P<0.05 and male gender (B=0.24, P<0.05. Breastfeeding as the sole source of milk for ≥90 days was associated with significantly decreased risk of metabolic syndrome (B=−0.16. Conclusion. This study adds to current knowledge about early infant growth and breastfeeding and their long-term health effects.

  5. “Ensure that you are well aware of the risks you are taking…”: actions and activities medical tourists’ informal caregivers can undertake to protect their health and safety

    Directory of Open Access Journals (Sweden)

    Valorie A. Crooks

    2017-05-01

    Full Text Available Abstract Background When seeking care at international hospitals and clinics, medical tourists are often accompanied by family members, friends, or other caregivers. Such caregiver-companions assume a variety of roles and responsibilities and typically offer physical assistance, provide emotional support, and aid in decision-making and record keeping as medical tourists navigate unfamiliar environments. While traveling abroad, medical tourists’ caregiver-companions can find themselves confronted with challenging communication barriers, financial pressures, emotional strain, and unsafe environments. Methods To better understand what actions and activities medical tourists’ informal caregivers can undertake to protect their health and safety, 20 interviews were conducted with Canadians who had experienced accompanying a medical tourist to an international health care facility for surgery. Interview transcripts were subsequently used to identify inductive and deductive themes central to the advice research participants offered to prospective caregiver-companions. Results Advice offered to future caregiver-companions spanned the following actions and activities to protect health and safety: become an informed health care consumer; assess and avoid exposure to identifiable risks; anticipate the care needs of medical tourists and thereby attempt to guard against caregiver burden; become familiar with important logistics related to travel and anticipated recovery timelines; and take practical measures to protect one’s own health. Conclusion Given that a key feature of public health is to use research findings to develop interventions and policies intended to promote health and reduce risks to individuals and populations, the paper draws upon major points of advice offered by study participants to take the first steps toward the development of an informational intervention designed specifically for the health and safety needs of medical tourists

  6. Nested Term Graphs

    NARCIS (Netherlands)

    Grabmayer, C.A.; van Oostrom, V.

    2014-01-01

    We report on work in progress on `nested term graphs' for formalizing higher-order terms (e.g. finite or infinite lambda-terms), including those expressing recursion (e.g. terms in the lambda-calculus with letrec). The idea is to represent the nested scope structure of a higher-order term by a

  7. Deficits in verbal long-term memory and learning in children with poor phonological short-term memory skills.

    Science.gov (United States)

    Gathercole, Susan E; Briscoe, Josie; Thorn, Annabel; Tiffany, Claire

    2008-03-01

    Possible links between phonological short-term memory and both longer term memory and learning in 8-year-old children were investigated in this study. Performance on a range of tests of long-term memory and learning was compared for a group of 16 children with poor phonological short-term memory skills and a comparison group of children of the same age with matched nonverbal reasoning abilities but memory scores in the average range. The low-phonological-memory group were impaired on longer term memory and learning tasks that taxed memory for arbitrary verbal material such as names and nonwords. However, the two groups performed at comparable levels on tasks requiring the retention of visuo-spatial information and of meaningful material and at carrying out prospective memory tasks in which the children were asked to carry out actions at a future point in time. The results are consistent with the view that poor short-term memory function impairs the longer-term retention and ease of learning of novel verbal material.

  8. Short term results of pterygium surgery with adjunctive amniotic ...

    African Journals Online (AJOL)

    One patient developed dellen 1 week post‑operatively with complete resolution following conservative large soft contact lens application. Conclusion: Short term results suggests that adjunctive amniotic membrane transplant with pterygium excision is effective and safe. A larger randomized clinical trial with a longer ...

  9. The influence of socio-economic characteristics, land use and travel time considerations on mode choice for medium- and longer-distance trips

    OpenAIRE

    Limtanakool, N.; Dijst, M.J.; Schwanen, T.

    2006-01-01

    This paper contributes to the limited number of investigations into the influence of the spatial configuration of land use and transport systems on mode choice for medium- and longer-distance travel (defined here as home-based trips of 50 km and over) in the Netherlands. We have employed data from the 1998 Netherlands National Travel Survey to address the question as to how socioeconomic factors, land use attributes, and travel time affect mode choice for medium- and longer-distance travel, a...

  10. Reasons for and factors associated with issuing sickness certificates for longer periods than necessary: results from a nationwide survey of physicians

    Science.gov (United States)

    2013-01-01

    Background Physicians’ work with sickness certifications is an understudied field. Physicians’ experience of sickness certifying for longer periods than necessary has been previous reported. However, the extent and frequency of such sickness certification is largely unknown. The aims of this study were: a) to explore the frequency of sickness certifying for longer periods than necessary among physicians working in different clinical settings; b) to examine main reasons for issuing sickness certificates for longer periods than necessary; and c) to examine factors associated with unnecessary issued sickness certificates. Methods In 2008, all physicians living and working in Sweden (a total of 36,898) were sent an invitation to participate in a questionnaire study concerning their sick-listing practices. A total of 22,349 (60.6%) returned the questionnaire. In the current study, physicians reporting handling sickness certification consultations at least weekly were included in the analyses, a total of 12,348. Results The proportion of physicians reporting issuing sickness certificates for longer periods than actually necessary varied greatly between different types of clinics, with the highest frequency among those working at: occupational medicine, orthopedic, primary health care, and psychiatry clinics; and lowest among those working in: eye, dermatology, ear/nose/throat, oncology, surgery, and infection clinics. Logistic analyses showed that sickness certifying for longer periods than necessary due to limitations in the health care system was particularly common among physicians working at occupational medicine, orthopedic, and primary health care clinics. Sickness certifying for longer periods than necessary due to patient-related factors was much more common among physicians working at psychiatric clinics. In addition to differences between clinics, frequency of sickness certificates issued for longer periods than necessary varied by age, physicians

  11. Satisfaction and compensatory hyperhidrosis rates 5 years and longer after video-assisted thoracoscopic sympathotomy for hyperhidrosis.

    Science.gov (United States)

    Bryant, Ayesha S; Cerfolio, Robert James

    2014-04-01

    The objective of the present study was to determine the long-term fate and factors of compensatory hyperhidrosis (CH) in patients who have undergone video-assisted thoracoscopic sympathotomy for focal hyperhidrosis. The same quality-of-life survey was administered 6 months postoperatively and then annually to all patients who underwent video-assisted thoracoscopic sympathotomy for hyperhidrosis. A second rib (R2)/R3 sympathotomy was most commonly performed until September 2007 and then R4/R5 sympathotomy was used. From January 1999 until December 2012, 193 patients underwent video-assisted thoracoscopic sympathotomy for hyperhidrosis, of whom, 173 had provided ≥1 year of postoperative survey information. No operative mortalities occurred. Of the 173 patients, 133 (77%) reported "clinically bothersome" CH. This rate had decreased to an average of 35% at 5 and 12 years postoperatively. Univariate analysis showed the CH incidence was significantly greater for the patients who had undergone R2/R3 versus R4/R5 sympathotomy (P hyperhidrosis preoperatively (P = .022), or were female (P = .002). On multivariate analysis, only R2/R3 versus R4/R5 sympathotomy (P hyperhidrosis will commonly report "clinically bothersome" compensatory hyperhidrosis. CH will more likely if R2/R3 sympathetic interruption has been performed instead of R4/R5 and in patients who present with multiple areas of sweating. The severity of clinically bothersome CH decreased during the first 3 years postoperatively. Copyright © 2014 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

  12. Nuclear Energy, Long Term Requirements

    International Nuclear Information System (INIS)

    Knapp, V.

    2006-01-01

    There are serious warnings about depletion of oil and gas and even more serious warnings about dangers of climate change caused by emission of carbon dioxide. Should developed countries be called to replace CO2 emitting energy sources as soon as possible, and the time available may not be longer then few decades, can nuclear energy answer the call and what are the requirements? Assuming optimistic contribution of renewable energy sources, can nuclear energy expand to several times present level in order to replace large part of fossil fuels use? Paper considers intermediate and long-term requirements. Future of nuclear power depends on satisfactory answers on several questions. First group of questions are those important for near and intermediate future. They deal with economics and safety of nuclear power stations in the first place. On the same time scale a generally accepted concept for radioactive waste disposal is also required. All these issues are in the focus of present research and development. Safer and more economical reactors are targets of international efforts in Generation IV and INPRO projects, but aiming further ahead these innovative projects are also addressing issues such as waste reduction and proliferation resistance. However, even assuming successful technical development of these projects, and there is no reason to doubt it, long term and large-scale nuclear power use is thereby not yet secured. If nuclear power is to play an essential role in the long-term future energy production and in reduction of CO2 emission, than several additional questions must be replied. These questions will deal with long-term nuclear fuel sufficiency, with necessary contribution of nuclear power in sectors of transport and industrial processes and with nuclear proliferation safety. This last issue is more political then technical, thus sometimes neglected by nuclear engineers, yet it will have essential role for the long-term prospects of nuclear power. The

  13. C14–22 n-Alkanes in Soil from the Freetown Layered Intrusion, Sierra Leone: Products of Pt Catalytic Breakdown of Natural Longer Chain n-Alkanes?

    Directory of Open Access Journals (Sweden)

    John F. W. Bowles

    2018-03-01

    Full Text Available Soil above a platinum-group element (PGE-bearing horizon within the Freetown Layered Intrusion, Sierra Leone, contains anomalous concentrations of n-alkanes (CnH2n+2 in the range C14 to C22 not readily attributable to an algal or lacustrine origin. Longer chain n-alkanes (C23 to C31 in the soil were derived from the breakdown of leaf litter beneath the closed canopy humid tropical forest. Spontaneous breakdown of the longer chain n-alkanes to form C14–22 n-alkanes without biogenic or abiogenic catalysts is unlikely as the n-alkanes are stable. In the Freetown soil, the catalytic properties of the PGE (Pt in particular may lower the temperature at which oxidation of the longer chain n-alkanes can occur. Reaction between these n-alkanes and Pt species, such as Pt2+(H2O2(OH2 and Pt4+(H2O2(OH4 can bend and twist the alkanes, and significantly lower the Heat of Formation. Microbial catalysis is a possibility. Since a direct organic geochemical source of the lighter n-alkanes has not yet been identified, this paper explores the theoretical potential for abiogenic Pt species catalysis as a mechanism of breakdown of the longer n-alkanes to form C14–22 alkanes. This novel mechanism could offer additional evidence for the presence of the PGE in solution, as predicted by soil geochemistry.

  14. The influence of socio-economic characteristics, land use and travel time considerations on mode choice for medium- and longer-distance trips

    NARCIS (Netherlands)

    Limtanakool, N.; Dijst, M.J.; Schwanen, T.

    2006-01-01

    This paper contributes to the limited number of investigations into the influence of the spatial configuration of land use and transport systems on mode choice for medium- and longer-distance travel (defined here as home-based trips of 50 km and over) in the Netherlands. We have employed data from

  15. Glargine and protamine zinc insulin have a longer duration of action and result in lower mean daily glucose concentrations than lente insulin in healthy cats.

    Science.gov (United States)

    Marshall, R D; Rand, J S; Morton, J M

    2008-06-01

    The pharmacological effects of glargine, protamine zinc (PZI), and lente insulins were evaluated in nine healthy cats. A 3-way crossover study was performed and plasma concentrations of insulin and glucose were determined for 24 h after a single subcutaneous injection of each insulin at 3-day intervals. Time to onset of action did not differ between insulins. Mean time to first nadir glucose was longer for glargine (14 h) relative to PZI (4 h) and lente (5 h). PZI was biphasic in action with nadirs at 4 and 14 h with the second nadir occurring at a similar time to glargine. Nadir glucose did not differ significantly between insulin types. The duration of action was similar for glargine and PZI and was longer than that for lente insulin. Mean daily glucose after glargine and PZI were also similar and were lower than after lente insulin. Time to reach peak insulin did not differ between insulin types. Time to return to baseline insulin level for PZI was longer than glargine but did not differ significantly from lente. In conclusion, healthy cats injected subcutaneously with glargine, compared to those injected with lente insulin, have a later glucose nadir and longer duration of action. Glargine and PZI had similar durations of action in study cats but a larger study is required to obtain precise comparisons of duration of action.

  16. Dictionary of machine terms

    International Nuclear Information System (INIS)

    1990-06-01

    This book has introduction of dictionary of machine terms, and a compilation committee and introductory remarks. It gives descriptions of the machine terms in alphabetical order from a to Z and also includes abbreviation of machine terms and symbol table, way to read mathematical symbols and abbreviation and terms of drawings.

  17. Long Term Care

    Science.gov (United States)

    ... us! Living with HD Long-Term Care Long Term Care Click here to download Long-Term Care for HD, (part of HDSA’s Family Guide ... on patient and family issues related to long-term HD care. For many caregivers of people with ...

  18. Short Implants (5 to 8 mm) Versus Longer Implants (>8 mm) with Sinus Lifting in Atrophic Posterior Maxilla: A Meta-Analysis of RCTs.

    Science.gov (United States)

    Fan, Tengfei; Li, Yicun; Deng, Wei-Wei; Wu, Tianfu; Zhang, Wenfeng

    2017-02-01

    The specific purposes of this study were (1) to undertake a thorough systematic review and meta-analysis based only on randomized clinical trials (RCTs) to compare the rates of survival and complications of short implants to those of long implants; (2) to compare the surgical time and cost of short implants to those of long implants. RCTs were identified from the major electronic databases (MEDLINE, Embase and Cochrane Library) using the keywords "dental implant," "short implant" and "atrophic maxilla," and a quantitative meta-analysis was conducted. The survival rate of implants and complications were the primary outcome measures, and other parameters assessed included costs and surgical time. Seven RCTs that met the inclusion criteria included 554 implants (265 implants in the short implant group). There was no significant difference in survival rate between two groups (RR: 1.00; 95% CI: [0.97, 1.03]; p = .96; seven trials, 554 participants). Compared with long implant group, the short implant group had a lower complications and the effect measure was significant (RR: 0.58; 95% CI: [0.37, 0.90]; p = .02; seven trials, 554 participants). This systematic review showed that no difference between the survival rates of short implants (5-8 mm) and long implants (>8 mm); complications in short implants are lower than that in long implants. However, further studies are required to substantiate our findings. © 2016 Wiley Periodicals, Inc.

  19. Acute and long-term management of food allergy

    DEFF Research Database (Denmark)

    de Silva, D; Geromi, M; Panesar, S S

    2014-01-01

    management for non-life-threatening reactions. H1-antihistamines may be of benefit, but this evidence was in part derived from studies on those with cross-reactive birch pollen allergy. Regarding long-term management, avoiding the allergenic food or substituting an alternative was commonly recommended...... helpful, but allergen-specific immunotherapy may be disease modifying and therefore warrants further exploration. CONCLUSIONS: Food allergy can be debilitating and affects a significant number of people. However, the evidence base about acute and longer-term management is weak and needs to be strengthened......BACKGROUND: Allergic reactions to food can have serious consequences. This systematic review summarizes evidence about the immediate management of reactions and longer-term approaches to minimize adverse impacts. METHODS: Seven bibliographic databases were searched from their inception to September...

  20. Is Longer Unemployment Rewarded with Longer Job Tenure?

    DEFF Research Database (Denmark)

    Kohara, Miki; Sasaki, Masaru; Machikita, Tomohiro

    the sample to job seekers who changed search behaviors in the final 59 days before expiration of unemployment insurance, we secondly show an even greater negative effect of unemployment duration on the following job duration. The importance lies not only in the duration of unemployment. If job seekers keep......This paper examines whether or not a prolonged unemployment period can raise the quality of job matching after unemployment. We focus on job tenure as an indicator of a good quality job match after unemployment. We match two sets of Japanese administrative data compiled by the public employment...... security offices: one includes information about the circumstances of job seekers receiving unemployment insurance, and the other includes information about job seekers applying for jobs. We first show a negative relationship between unemployment duration and the subsequent job duration. Restricting...

  1. Adaptations to short, frequent sessions of endurance and strength training are similar to longer, less frequent exercise sessions when the total volume is the same

    DEFF Research Database (Denmark)

    Kilen, Anders; Hjelvang, Line B; Dall, Niels

    2015-01-01

    ]: n = 21) performed nine 15-minute training sessions weekly, whereas a second group ("classical training" [CL]: n = 8) completed exactly the same training on a weekly basis but as three 45-minute sessions. For each group, each session comprised exclusively strength, high-intensity cardiovascular......Kilen, A, Hjelvang, LB, Dall, N, Kruse, NL, and Nordsborg, NB. Adaptations to short, frequent sessions of endurance and strength training are similar to longer, less frequent exercise sessions when the total volume is the same. J Strength Cond Res 29(11S): S46-S51, 2015-The hypothesis...... that the distribution of weekly training across several short sessions, as opposed to fewer longer sessions, enhances maximal strength gain without compromising maximal oxygen uptake was evaluated. Twenty-nine subjects completed an 8-week controlled parallel-group training intervention. One group ("micro training" [MI...

  2. New conceptual copper alloy bearing for diesel engine to achieve longer life under higher load; Diesel engine yo komen`atsu chojumyo jikuuke no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Tomikawa, T.; Oshiro, H.; Hashizume, K.; Kamiya, S. [Taiho Kogyo Co. Ltd., Aichi (Japan)

    1997-10-01

    Recently, the requirement like higher output, lower fuel consumption and cleaner exhaust gas for automotive engines has been increased. As a result, especially, higher bearing performance is required for diesel engine under a higher unit load and longer period. For this reason, we have developed the new conceptual copper alloy bearing to achieve higher performance under a higher unit load. This paper describes about the performance of this new bearing material. 3 refs., 12 figs., 5 tabs.

  3. Interference Cancellation Using Replica Signal for HTRCI-MIMO/OFDM in Time-Variant Large Delay Spread Longer Than Guard Interval

    Directory of Open Access Journals (Sweden)

    Yuta Ida

    2012-01-01

    Full Text Available Orthogonal frequency division multiplexing (OFDM and multiple-input multiple-output (MIMO are generally known as the effective techniques for high data rate services. In MIMO/OFDM systems, the channel estimation (CE is very important to obtain an accurate channel state information (CSI. However, since the orthogonal pilot-based CE requires the large number of pilot symbols, the total transmission rate is degraded. To mitigate this problem, a high time resolution carrier interferometry (HTRCI for MIMO/OFDM has been proposed. In wireless communication systems, if the maximum delay spread is longer than the guard interval (GI, the system performance is significantly degraded due to the intersymbol interference (ISI and intercarrier interference (ICI. However, the conventional HTRCI-MIMO/OFDM does not consider the case with the time-variant large delay spread longer than the GI. In this paper, we propose the ISI and ICI compensation methods for a HTRCI-MIMO/OFDM in the time-variant large delay spread longer than the GI.

  4. [The proportion of suicides committed by patients with a mental health disorder for which treatment costs are now no longer reimbursed by health insurance].

    Science.gov (United States)

    Spuijbroek, A T; Leezer, Y M; de Beurs, D P; de Winter, R F P

    Suffering from a psychiatric disorder is a well-known risk factor for suicide and suicidal behavior. Treatment of psychiatric disorders can reduce the risk of suicidal behavior and suicide. In the Netherlands, however, since 2012 the treatment costs of some psychiatric disorders have no longer been covered by health insurance. AIM: To find out what proportion of suicides were committed by patients with a psychiatric disorder for which treatment costs are no longer covered by health insurance since the rules changed in 2012. METHOD: We studied the files of 314 patients who were known to one of the large mental health hospitals in the Netherlands and who had committed suicide between 1 January 1999 and January 2012. We were able to determine the various psychiatric disorders from which the patients were suffering at the time they died. RESULTS: About 6% of the patients who committed suicide between 1999 and 2012 suffered from a psychiatric disorder for which treatment costs are now no longer covered by health insurance. CONCLUSION: Given the results of this study, the increased rates of suicide in the Netherlands and the importance of scientific research into the characteristics of suicide, we recommend that patients with suicidal behavior are not excluded from adequate treatment in the event they may or may not have met the criteria for a DSM-IV classification.

  5. The paradox of longer sperm telomeres in older men's testes: a birth-cohort effect caused by transgenerational telomere erosion in the female germline.

    Science.gov (United States)

    Stindl, Reinhard

    2016-01-01

    Longer telomeres in the somatic cells of an individual have been regarded as a marker of youth and biological fitness within a population. Yet, several research groups have reported the surprising findings of longer telomeres in the germ cells of older men, which translated into longer leukocyte telomere length in their offspring. Although all these studies were purely cross-sectional, a longitudinal trend in the aging testes of individual males was taken for granted. Recently, a high-profile study reported a negative birth-cohort effect on leukocyte mean telomere length in human populations, namely the progressive loss of telomeric sequence between healthy human generations. This is what I based my theory of telomere-driven macroevolution on, 12 years ago. On the basis of published data on telomere length inheritance, I identified the source of human intergenerational telomere erosion in the female germline. Accordingly, because of the resulting birth-cohort effect, there is no need for any paradoxical telomere lengthening in older men's gonads to interpret the old-father-long-telomered-offspring data.

  6. Search Term Reports

    Science.gov (United States)

    Learn what search terms brought users to choose your page in their search results, and what terms they entered in the EPA search box after visiting your page. Use this information to improve links and content on the page.

  7. Live Longer with Vitamin D?

    Directory of Open Access Journals (Sweden)

    Uwe Gröber

    2015-03-01

    Full Text Available The global burden of vitamin D deficiency or insufficiency is of great concern for public health. According to recent studies, vitamin D deficiency is an important etiological factor in the pathogenesis of many chronic diseases. Whether or not there is a connection between 25-hydoxyvitamin D (25(OHD status and overall mortality is a matter of considerable debate. A new meta-analysis confirmed that low 25(OHD levels were associated with a significant increased risk for all-cause mortality. Individuals with severe vitamin D deficiency have almost twice the mortality rate as those with 25(OHD level ≥ 30 ng/mL, (≥75 nmol/L. Unlike previous meta-analyses which suggested that serum 25(OHD > 50 ng/mL was associated with increased mortality, this new analysis found that there was no increased risk even when 25(OHD levels were ≥70 ng/mL. In general, closer attention should be paid to vitamin D deficiency in medical and pharmaceutical practice than has been the case hitherto. The results of these studies are consistent with the recommendation to improve the general vitamin D status in children and adults by means of a healthy approach to sunlight exposure, consumption of foods containing vitamin D and supplementation with vitamin D preparations.

  8. Chagas Disease: No Longer Exotic

    Centers for Disease Control (CDC) Podcasts

    2008-04-03

    This podcast is designed to inform health care providers about Chagas disease, diagnosis, and treatment and to assist in identifying infected patients.  Created: 4/3/2008 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 4/8/2008.

  9. Working Longer Makes Students Stronger?

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup

    classroom hours in literacy and maths on ninth grade (aged 16) student performance in writing and maths, respectively. Using population data for Denmark in 2003-2006, I exploit unique policy-induced variation in classroom hours.On average, the reform changed classroom hours by 2.2-3.3% in literacy and maths...

  10. Why every national deep-geological-isolation program needs a long-term science & technology component

    International Nuclear Information System (INIS)

    Budnitz, R J

    2006-01-01

    The objective of this paper is to set down the rationale for a separate Science & Technology (S&T) Program within every national deep-geological-isolation program. The fundamental rationale for such a Program is to provide a dedicated focus for longer-term science and technology activities that ultimately will benefit the whole repository mission. Such a Program, separately funded and with a dedicated staff (separate from the ''mainline'' activities to develop the repository, the surface facilities, and the transportation system), can devote itself exclusively to the development and management of a long-term science and technology program. Broad experience in governments worldwide has demonstrated that line offices are unlikely to be able to develop and sustain both the appropriate longer-term philosophy and the specialized skills associated with managing longer-term science and technology projects. Accomplishing both of these requires a separate dedicated program office with its own staff

  11. Long-term treatment of nocturnal enuresis with desmopressin. A follow-up study

    DEFF Research Database (Denmark)

    Knudsen, U B; Rittig, Søren; Nørgaard, J P

    1991-01-01

    , and urinary osmolality were found after this long-term treatment. Overall no changes in either body weight, blood pressure, or hematological variables were demonstrated. This supports previous findings that the treatment appears to be well tolerated and free of side effects in longer term....

  12. The role of institutional investors in promoting long-term value ...

    African Journals Online (AJOL)

    “Short-termism” has been identified by many academics and business practitioners as a significant global problem in modern capitalist markets. The excessive focus of corporate decision-makers on short-term profit maximising goals, often at the expense of longer-term objectives, results in insufficient attention being paid to ...

  13. Percutaneous Chevron Osteotomy in Treating Hallux Valgus: Hong Kong Experience and Mid-Term Results

    Directory of Open Access Journals (Sweden)

    Ka-Lee Karry Lam

    2015-06-01

    Conclusion: The mid-term results are encouraging, indicating that this is an effective method in the treatment of mild to moderate hallux valgus with advantages of percutaneous technique. Further study with longer-term results and larger sample size is needed in order to compare with other percutaneous or open techniques.

  14. Rehabilitation of postrior atrophic edentulous jaws: prostheses supported by 5 mm short implants or by longer implants in augmented bone? One-year results from a pilot randomised clinical trial.

    Science.gov (United States)

    Esposito, Marco; Pellegrino, Gerardo; Pistilli, Roberto; Felice, Pietro

    2011-01-01

    To evaluate whether 5 mm short dental implants could be an alternative to augmentation with anorganic bovine bone and placement of at least 10 mm long implants in posterior atrophic jaws. Fifteen patients with bilateral atrophic mandibles (5-7 mm bone height above the mandibular canal), and 15 patients with bilateral atrophic maxillae (4-6 mm bone height below the maxillary sinus) and bone thickness of at least 8 mm, were randomised according to a splitmouth design to receive one to three 5 mm short implants or at least 10 mm long implants in augmented bone. Mandibles were vertically augmented with interpositional bone blocks and maxillary sinuses with particulated bone via a lateral window. Implants were placed after 4 months, submerged and loaded, after 4 months, with provisional prostheses. Four months later, definitive provisionally cemented prostheses were delivered. Outcome measures were: prosthesis and implant failures, any complication and peri-implant marginal bone level changes. In 5 augmented mandibles, the planned 10 mm long implants could not be placed and shorter implants (7 and 8.5 mm) had to be used instead. One year after loading no patient dropped out. Two long (8.5 mm in the mandible and 13 mm in the maxilla) implants and one 5 mm short maxillary implant failed. There were no statistically significant differences in failures or complications. Patients with short implants lost on average 1 mm of peri-implant bone and patients with longer implants lost 1.2 mm. This difference was statistically significant. This pilot study suggests that 1 year after loading, 5 mm short implants achieve similar if not better results than longer implants placed in augmented bone. Short implants might be a preferable choice to bone augmentation since the treatment is faster, cheaper and associated with less morbidity, however their long-term prognosis is unknown.

  15. The preventive effect of breast-feeding for longer than 6 months on early pubertal development among children aged 7-9 years in Korea.

    Science.gov (United States)

    Lee, Hye Ah; Kim, Young Ju; Lee, Hwayoung; Gwak, Hye Sun; Hong, Young Sun; Kim, Hae Soon; Park, Eun Ae; Cho, Su Jin; Ha, Eun Hee; Park, Hyesook

    2015-12-01

    The present study was performed to investigate whether breast-feeding is associated with early pubertal development among children 7-9 years old in Korea. Children were divided into those who did and did not receive breast-feeding for 6 months or longer in accordance with the recommendations of the WHO. Pubertal status was determined by clinical examination using Tanner staging. Prospective observational study. We conducted a follow-up study of children aged 7-9 years in 2011 who had taken part in the Ewha Birth & Growth Cohort study. Fifty (22.8%) of the total of 219 children were in early puberty, with the proportion being slightly higher for girls (24.1%) than boys (21.4%). Children who had entered early puberty were taller, weighed more and had a higher concentration of insulin-like growth factor 1. Moreover, the change in weight Z-score from birth to follow-up was significantly lower in children who were breast-fed than in those who were not (weight Z-score change: 0.32 (sd 1.59) v. 0.77 (sd 1.61), respectively, P=0.04). Comparison of breast-feeding by puberty status indicated a preventive association with early puberty in children who were breast-fed for 6 months or longer (OR=0.37; 95% CI 0.18, 0.74). This association remained significant after adjustment for relevant covariates. These results demonstrate a beneficial association between breast-feeding and early pubertal development, especially in those breast-fed for 6 months or longer. The study suggests that interventions would need to start early in life to prevent early pubertal development.

  16. Extended Cancer Education for Longer-Term Survivors in Primary Care for Patients With Stage I-II Breast or Prostate Cancer or Stage I-III Colorectal Cancer

    Science.gov (United States)

    2017-11-15

    Stage I Breast Cancer; Stage I Colorectal Cancer AJCC v6 and v7; Stage I Prostate Cancer; Stage IA Breast Cancer; Stage IB Breast Cancer; Stage II Breast Cancer; Stage II Colorectal Cancer AJCC v7; Stage II Prostate Cancer; Stage IIA Breast Cancer; Stage IIA Colorectal Cancer AJCC v7; Stage IIA Prostate Cancer; Stage IIB Breast Cancer; Stage IIB Colorectal Cancer AJCC v7; Stage IIB Prostate Cancer; Stage IIC Colorectal Cancer AJCC v7; Stage III Colorectal Cancer AJCC v7; Stage IIIA Colorectal Cancer AJCC v7; Stage IIIB Colorectal Cancer AJCC v7; Stage IIIC Colorectal Cancer AJCC v7

  17. Remission and recovery associated with lurasidone in the treatment of major depressive disorder with subthreshold hypomanic symptoms (mixed features): post-hoc analysis of a randomized, placebo-controlled study with longer-term extension.

    Science.gov (United States)

    Goldberg, Joseph F; Ng-Mak, Daisy; Siu, Cynthia; Chuang, Chien-Chia; Rajagopalan, Krithika; Loebel, Antony

    2017-04-01

    This post-hoc analysis assessed rates of symptomatic and functional remission, as well as recovery (combination of symptomatic and functional remission), in patients treated with lurasidone for major depressive disorder (MDD) associated with subthreshold hypomanic symptoms (mixed features). Patients with MDD plus two or three manic symptoms (defined as per the DSM-5 mixed-features specifier) were randomly assigned to flexible-dose lurasidone 20-60 mg/day (n=109) or placebo (n=100) for 6 weeks, followed by a 3-month open-label, flexible-dose extension study for U.S. sites only (n=48). Cross-sectional recovery was defined as the presence of both symptomatic remission (Montgomery-Åsberg Depression Rating Scale score ≤ 12) and functional remission (all Sheehan Disability Scale [SDS] domain scores ≤3) at week 6, and at both months 1 and 3 of the extension study ("sustained recovery"). A significantly higher proportion of lurasidone-treated patients (31.3%) achieved recovery (assessed cross-sectionally) compared to placebo (12.2%, p=0.002) at week 6. The number of manic symptoms at baseline moderated the effect size for attaining cross-sectional recovery for lurasidone treatment (vs. placebo) (p=0.028). Sustained recovery rates were higher in patients initially treated with lurasidone (20.8%) versus placebo (12.5%). In this post-hoc analysis of a placebo-controlled study with open-label extension that involved patients with MDD and mixed features, lurasidone was found to significantly improve the rate of recovery at 6 weeks (vs. placebo) that was sustained at month 3 of the extension study. The presence of two (as opposed to three) manic symptoms moderated recovery at the acute study endpoint.

  18. Glossary of atomic terms

    International Nuclear Information System (INIS)

    1980-01-01

    This glossary (of about 400 terms) has been compiled to help people outside the atomic energy industry to understand what those inside it are saying. It is not intended to be a definitive dictionary of scientific or technical terms, nor does it aim to cover terms that are in general use in science and technology. A list of some initials and acronyms is appended. (author)

  19. Glossary of atomic terms

    International Nuclear Information System (INIS)

    1982-04-01

    This glossary, containing almost 400 terms, has been compiled to help people outside the atomic energy industry to understand what those inside it are saying. It is not intended to be a definitive dictionary of scientific or technical terms, nor does it aim to cover terms that are in general use in science and technology. A list of about 100 initials and acronyms will be found at the end. (author)

  20. Early multidisciplinary assessment was associated with longer periods of sick leave: a randomized controlled trial in a primary health care centre.

    Science.gov (United States)

    Carlsson, Lars; Englund, Lars; Hallqvist, Johan; Wallman, Thorne

    2013-09-01

    To study the effects on sick leave from an early multidisciplinary assessment at a primary health care centre. Randomized controlled trial. Patients who saw GPs at a primary health care centre in mid-Sweden and asked for a sickness certificate for psychiatric or musculoskeletal diagnoses were invited to participate. Patients included were sick-listed for less than four weeks; 33 patients were randomized either to an assessment within a week by a physiotherapist, a psychotherapist, and an occupational therapist or to "standard care". The therapists used methods and tools they normally use in their clinical work. Proportion of patients still sick-listed three months after randomization, total and net days on sick leave, and proportion who were on part-time sick leave. Results. At follow-up after three months, in contrast to the pre-trial hypothesis, there was a trend toward a higher proportion of patients still sick-listed in the intervention group (7/18) as compared with the control group (3/15). The intervention group also had significantly longer sick-listing periods (mean 58 days) than the control group (mean 36 days) (p = 0.038). The proportion of patients who were part time sick-listed was significantly higher in the intervention group (10/18) than in the control group (2/15) (p = 0.027). In this study an early multidisciplinary assessment was associated with longer periods on sick leave and more individuals on part-time sick leave.

  1. Neon soft x-ray emission studies from the UNU-ICTP plasma focus operated with longer than optimal anode length

    International Nuclear Information System (INIS)

    Mohammadi, M A; Verma, R; Sobhanian, S; Wong, C S; Lee, S; Springham, S V; Tan, T L; Lee, P; Rawat, R S

    2007-01-01

    The UNU-ICTP plasma focus with a significantly longer than conventional anode can still be a reasonably good neon soft x-ray (SXR) source. The highest average neon SXR yield of 3.3 J was achieved at 3 mbar. The time difference between the two first peaks of the voltage probe signal at the radial collapse phase was found to be inversely related to the SXR yield, i.e. the smaller the time difference, the higher the yield and vice versa. The estimation of average current sheath speeds using the shadowgraphic method coupled with laser and focus peak timing signals showed that the average axial rundown speed is similar to the one obtained for the optimal anode length but the average radial compression speed is decreased significantly. The range of pressure for a good neon SXR yield, however, has become much narrower, making efficient plasma focus operation a very sensitive function of the filling gas pressure for longer than the optimal anode length

  2. Longer Immediate Recovery Time After Anesthesia Increases Risk of Respiratory Complications After Laparotomy for Bariatric Surgery: a Randomized Clinical Trial and a Cohort Study.

    Science.gov (United States)

    Sudré, Eliana C M; de Batista, Priscila R; Castiglia, Yara M M

    2015-11-01

    We compared the effects of two anesthesia protocols in both immediate recovery time (IRT) and postoperative respiratory complications (PRCs) after laparotomy for bariatric surgery, and we determined the association between the longer IRT and the increase of PRC incidence. We conducted the study in two stages: (i) in a randomized controlled trial (RCT), patients received either intervention (sevoflurane-remifentanil-rocuronium-ropivacaine) or control protocol (isoflurane-sufentanil-atracurium-levobupivacaine). All patients received general anesthesia plus continuous epidural anesthesia and analgesia. Treatment was masked for all, except the provider anesthesiologist. We defined IRT as time since anesthetics discontinuation until tracheal extubation. Primary outcomes were IRT and PRCs incidence within 15 days after surgery. We also analyzed post-anesthesia care unit (PACU) and hospital length of stays; (ii) after the end of the RCT, we used the available data in an extension cohort study to investigate IRT > 20 min as exposure factor for PRCs. Control protocol (n = 152) resulted in longer IRT (30.4 ± 7.9 vs 18.2 ± 9.6 min; p  20 min (n = 190) presented higher incidence of PRCs (7.37 vs 0.62 %; p bariatric patients. We identified a 4.5-fold increase in the relative risk of PRCs when morbid obese patients are exposed to an IRT > 20 min.

  3. Impact of cryptic female choice on insemination success: Larger sized and longer copulating male squid ejaculate more, but females influence insemination success by removing spermatangia.

    Science.gov (United States)

    Sato, Noriyosi; Yoshida, Masa-Aki; Kasugai, Takashi

    2017-01-01

    In polyandrous mating systems, sperm competition and cryptic female choice (CFC) are well recognized as postcopulatory evolutionary forces. However, it remains challenging to separate CFC from sperm competition and to estimate how much CFC influences insemination success because those processes usually occur inside the female's body. The Japanese pygmy squid, Idiosepius paradoxus, is an ideal species in which to separate CFC from sperm competition because sperm transfer by the male and sperm displacement by the female can be observed directly at an external location on the female's body. Here, we counted the number of spermatangia transferred to, removed from, and remaining on the female body during single copulation episodes. We measured behavioral and morphological characteristics of the male, such as duration of copulation and body size. Although males with larger body size and longer copulation time were capable of transferring larger amounts of sperm, females preferentially eliminated sperm from males with larger body size and shorter copulation time by spermatangia removal; thus, CFC could attenuate sperm precedence by larger males, whereas it reinforces sperm precedence by males with longer copulation time. Genetic paternity analysis revealed that fertilisation success for each male was correlated with remaining sperm volume that is adjusted by females after copulation. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

  4. Short vs longer implants in mandibular alveolar ridge augmentated using osteogenic distraction: one year follow-up of a randomized split-mouth trial.

    Science.gov (United States)

    Bernardi, Sara; Gatto, Roberto; Severino, Marco; Botticelli, Gianluca; Caruso, Silvia; Rastelli, Claudio; Lupi, Ettore; Quiroz Rojas, Adolfo; Iacomino, Enzo; Falisi, Giovanni

    2018-02-13

    Aim of the study was to evaluate the reliability of 6 mm long implants compared to normal length implants placed in vertical augmented atrophic posterior mandible, supporting cemented single crowns. Thirty-six patients with bilateral posterior edentulous mandible and presented a bone availability height less than 9 mm from the mandibular canal were enrolled for the participation to this study. Patient hemi-arches were randomized to receive both 6 mm-long and normal length implants (10 mm). The technique used for the vertical bone augmentation was the "sandwich" technique, using a bone substitute block as graft. The data outcomes at 1 year post-loading follow-up were the loss of implants and the complications. Eighty-six 6 mm long implants and eighty-four normal implants were inserted. Five short implants and thirteen normal implants were lost. In 28 patients complications occurred, and in 21 cases the complication was present on the side of the ridge vertical augmentation. From the statistical analysis the association between the side of the ridge augmentation and the side of occurrence of the complication was statistically significant (p implants can be the preferred choice to vertical bone augmentation for the placement of longer implants in the rehabilitation of edentulous posterior mandibles. These initial results must be confirmed by larger and longer follow-ups of 5 years or more.

  5. Specific imaging characteristic of solitary necrotic nodule of the liver: Marked peripheral rim-like enhancement with internal hypointensity on longer delayed MRI

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Jiayang; Yu, Dexin; Ma, Xiangxing; Xiang, Ying; Guo, Lijuan [Qilu Hospital of Shandong University, Department of Radiology, Ji' nan City, Shandong (China); Ma, Xiaoyuan [Qilu Hospital of Shandong University, Department of Orthopaedics, Ji' nan City (China)

    2017-09-15

    To obtain specific imaging findings of solitary necrotic nodule of the liver (SNNL) using longer delayed contrast-enhanced MRI and compare them with those of three mimic hepatic diseases. Sixteen patients with SNNL underwent plain and contrast-enhanced triphasic CT and multiphasic MRI with delayed time prolonged to 2 h after contrast bolus injection. Twenty-three patients with mimic lesions including seven with eight HCCs, five with five iCCs and 11 with metastatic lesions served as the control group. Those patients also received plain and multiphasic contrast-enhanced MRI. Imaging features of lesions such as peripheral wash-out time were evaluated. Among the 16 SNNLs, with a prolonged delayed MRI time, the enhancement degree of tumour periphery increased gradually. When it was up to 1 h, all lesions represented moderate/marked peripheral enhancement with internal hypointensity. However, the peripheral wash-out in seven HCCs (87.5%) and all metastatic lesions except three appeared at 10 or 15 min, one iCC (20%) at 30 min and the other lesions at 1 h. Longer MRI with a delayed time of 1-2 h may be useful in diagnosis SNNL, revealing the specific imaging characteristic of SNNL as pronounced peripheral enhancement with internal hypointensity. (orig.)

  6. Measurement of dabigatran: previously demonstrated Hemoclot®Thrombin Inhibitor assay reagent instability on Sysmex CS-2100i is no longer an issue.

    Science.gov (United States)

    Comuth, Willemijn J; Faaborg, Louise; Henriksen, Linda Ø; Münster, Anna-Marie B

    The Hemoclot ® Thrombin Inhibitor (HTI) assay has been recommended for measurement of dabigatran concentrations in specific clinical situations. Traditionally, reagents for biochemical assays are prepared from instructions found in the package insert. For the HTI reagents the manufacturer recommends incubating the reagents much longer than indicated in the package insert. These recommendations are added to the application sheets designed for different analyzers. Many clinicians and laboratory personnel may be unaware of the discrepancy between the two instructions, resulting in incorrect handling of the reagents. The aim of this study was to investigate the effect of the two different preparation methods on reagent stability and test results. For the standard concentration range, reagent stability on Sysmex CS-2100i was only two hours instead of the eight hours indicated by the producer when following package insert instructions (incubation time: 15 min). Stability was increased to five hours when following the application sheet (incubation time: 60 min). Two years later, the study was repeated using samples of patients treated with dabigatran etexilate. This time, reagent stability was at least six hours. Since the reagent composition was unchanged, the increased stability could be due to changed logistics by the supplier, with stock and transfer closer by. Previously demonstrated HTI reagent instability is no longer an issue at our laboratory. The reliability of results of clinical studies in which the assay has been used is potentially compromised.

  7. Latent class analysis of diagnostic tests for adenovirus, Bordetella pertussis and influenza virus infections in German adults with longer lasting coughs.

    Science.gov (United States)

    Sobotzki, C; Riffelmann, M; Kennerknecht, N; Hülsse, C; Littmann, M; White, A; Von Kries, R; Wirsing VON König, C H

    2016-03-01

    Laboratory tests in adult outpatients with longer lasting coughs to identify a potential causal pathogen are rarely performed, and there is no gold standard for these diagnostic tests. While the diagnostic validity of serological tests for pertussis is well established their potential contribution for diagnosing adenovirus and influenza virus A and B infections is unclear. A sentinel study into the population-based incidence of longer lasting coughs in adults was done in Rostock (former East Germany) and Krefeld (former West Germany). A total of 971 outpatients who consulted general practitioners or internists were included. Inclusion criteria were coughing for ⩾1 week and no chronic respiratory diseases. We evaluated the performance of polymerase chain reaction (PCR) as well as IgG and IgA serology, applying a latent class model for diagnosing infections with adenovirus, B. pertussis, and influenza virus A and B. The adult outpatients first sought medical attention when they had been coughing for a median of 3 weeks. In this situation, direct detection of infectious agents by PCR had a low sensitivity. Modelling showed that additional serological tests equally improved sensitivity and specificity for diagnosis for adenovirus, B. pertussis and influenza virus A and B infections. The combination of serology and PCR may improve the overall performance of diagnostic tests for B. pertussis and also for adenovirus, and influenza virus A and B infections.

  8. Strategies to meet the need for long-term data.

    Science.gov (United States)

    Chalmers, John; Woodward, Mark; Borghi, Claudio; Manolis, Athanasios; Mancia, Giuseppe

    2016-08-01

    Chronic diseases afflict patients for many years, often to the end of life, and there is increasing need for estimating lifelong risk and for evaluating the effects of treatment in the long term. Yet recommendations for lifelong treatment are most frequently based on findings from randomized clinical trials lasting only a few years. There is therefore a clear need for much longer term data, and here we present the advantages and disadvantages of many strategies, including the use of long-term posttrial follow-up, of long-term prospective cohort studies, registry databases, and of administrative databases. We also emphasize the need for long-term cost-effectiveness studies. One of the most promising strategies comes from linkage of data gathered through the ever-expanding pool of administrative databases worldwide with data from other sources, including randomized trials and the many forms of observational study.

  9. Toyotarity. Term, model, range

    Directory of Open Access Journals (Sweden)

    Stanisław Borkowski

    2013-04-01

    Full Text Available The Toyotarity and BOST term was presented in the chapter. The BOST method allows to define relations between material resources and human resources and between human resources and human resources (TOYOTARITY. This term was also invented by the Author (and is legally protected. The idea of methodology is an outcome of 12 years of work.

  10. The Dividend Term Structure

    NARCIS (Netherlands)

    Kragt, Jac; de Jong, Frank; Driessen, Joost

    Dividend derivatives contain information about the expectations that investors have of stock dividends. We employ a state space model to estimate a term structure of discounted risk adjusted dividend growth enclosed in dividend derivative prices. A two state model of the term structure capturing

  11. RxTerms

    Data.gov (United States)

    U.S. Department of Health & Human Services — RxTerms is a drug interface terminology derived from RxNorm for prescription writing or medication history recording (e.g. in e-prescribing systems, PHRs). RxTerms...

  12. A 3-year post-loading report of a randomised controlled trial on the rehabilitation of posterior atrophic mandibles: short implants or longer implants in vertically augmented bone?

    Science.gov (United States)

    Esposito, Marco; Cannizarro, Gioacchino; Soardi, Elisa; Pellegrino, Gerardo; Pistilli, Roberto; Felice, Pietro

    2011-01-01

    To evaluate whether 6.3 mm-long implants could be a suitable alternative to longer implants placed in vertically augmented atrophic posterior mandibles. Sixty partially edentulous patients having 7 to 8 mm of residual crestal height and at least 5.5 mm thickness measured on CT scans above the mandibular canal were randomised according to a parallel group design either to receive 1 to 3 submerged 6.3 mm-long implants or 9.3 mm or longer implants (30 patients per group) placed in vertically augmented bone. Bone was augmented with interpositional an organic bovine bone blocks covered by resorbable barriers. Grafts were left to heal for 5 months before implant placement. Four months later, provisional acrylic prostheses were delivered, and were then replaced after another 4 months by definitive metal-ceramic prostheses. Outcome measures were prosthesis and implant failures, complications, and radiographic peri-implant marginal bone level changes. All patients were followed up to 3 years after loading. Four patients dropped out, two from each group. The augmentation procedure failed in two patients and only 6.3 mm-long implants could be inserted. There were no statistically significant differences for prosthesis and implant failures. Three prostheses could not be placed or had to be remade in the short implant group versus 4 prostheses in the augmented group. Two short implants failed versus 3 long implants, all in different patients. There were statistically significantly more complications in augmented patients (22 complications in 20 augmented patients versus 5 complications in 5 patients of the short implant group). Both groups gradually lost peri-implant bone in a statistically significant way at 4 months, and 1 and 3 years after loading. Three years after loading, patients of the short implant group lost an average of 1.24 mm of peri-implant bone compared with 1.76 mm in the long implant group. Short implants experienced statistically significantly less bone loss

  13. Optional part-time and longer GP training modules in GP practices associated with more trainees becoming GPs - a cohort study in Switzerland.

    Science.gov (United States)

    Studerus, Lara; Ahrens, Regina; Häuptle, Christian; Goeldlin, Adrian; Streit, Sven

    2018-01-05

    Switzerland, like many other countries, has a shortage of General Practitioners (GPs). Optional GP training modules in GP practices were offered during the at least 5-year GP training program to increase student and trainee interest in becoming a GP. The training modules had not yet been evaluated. We determined how many Swiss GP trainees became practicing GPs after they completed optional training modules, and if longer modules were associated with higher rates of GP specialization. In this population-based cohort study, we included GP trainees who chose an optional GP training module in GP practice, provided by the Foundation to Promote Training in General Practice (WHM) between 2006 and 2015. GP trainees were invited to complete an online survey to assess the primary outcome (becoming a practicing GP by 2016). Data on non-responders was collected via an internet search. We calculated univariate time-to-event curves to become a practicing GP, stratified by trainee's gender, length, part-time training, and number of years after graduation until training modules were completed. We used a multivariate model to adjust for characteristics of participants, training, and satisfaction with training modules. We assessed primary outcome for 351 (92.1%) of 381 former GP trainees who participated in a WHM program between 2006 and 2015. Of these 218 (57%) were practicing GPs by 2016. When focusing on the trainees who had completed training between 2006 and 2010, the rate of practicing GPs was even 73%. Longer (p = 0.018) and part-time training modules (p = 0.003) were associated with higher rates of being a practicing GP. Most (81%) practicing GPs thought their optional GP training module was (very) important in their choice of specialty. GP trainees who spent more time training in a GP practice, or who trained part-time were more likely to become practicing GPs. Most (80%) rated their training module as (very) important in their choice of career, highlighting that

  14. First update of the International Xenotransplantation Association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes--Chapter 3: Porcine islet product manufacturing and release testing criteria.

    Science.gov (United States)

    Rayat, Gina R; Gazda, Lawrence S; Hawthorne, Wayne J; Hering, Bernhard J; Hosking, Peter; Matsumoto, Shinichi; Rajotte, Ray V

    2016-01-01

    In the 2009 IXA consensus, the requirements for the quality and control of manufacturing of porcine islet products were based on the U.S. regulatory framework where the porcine islet products fall within the definition of somatic cell therapy under the statutory authority of the U.S. Food and Drug Administration (FDA). In addition, porcine islet products require pre-market approval as a biologic product under the Public Health Services Act and they meet the definition of a drug under the Federal Food, Drug, and Cosmetic Act (FD&C Act). Thus, they are subject to applicable provisions of the law and as such, control of manufacturing as well as reproducibility and consistency of porcine islet products, safety of porcine islet products, and characterization of porcine islet products must be met before proceeding to clinical trials. In terms of control of manufacturing as well as reproducibility and consistency of porcine islet products, the manufacturing facility must be in compliance with current Good Manufacturing Practices (cGMP) guidelines appropriate for the initiation of Phase 1/2 clinical trials. Sponsors intending to conduct a Phase 1/2 trial of islet xenotransplantation products must be able to demonstrate the safety of the product through the establishment of particular quality assurance and quality control procedures. All materials (including animal source and pancreas) used in the manufacturing process of the porcine islet products must be free of adventitious agents. The final porcine islet product must undergo tests for the presence of these adventitious agents including sterility, mycoplasma (if they are cultured), and endotoxin. Assessments of the final product must include the safety specifications mentioned above even if the results are not available until after release as these data would be useful for patient diagnosis and treatment if necessary. In addition, a plan of action must be in place for patient notification and treatment in case the

  15. Some problems of parametric neutron activation analysis based on the use of radioactive daughters of longer-lived mothers with low mother/daughter half-life ratios

    International Nuclear Information System (INIS)

    Cohen, I.M.

    2012-01-01

    The theoretical and practical aspects of the use of radioactive daughters originated from the decay of longer-lived radioactive mothers in parametric activation analysis, when the ratio: mother half-life to daughter half-life is less than 10, are discussed. The mother-daughter relationships: 47 Ca/ 47 Sc; 95 Zr/ 95 Nb; 140 Ba/ 140 La; 99 Mo/ 99m Tc and 115 Cd/ 115m In are selected as models for the study. The cases when the radionuclide of interest is formed through both direct and indirect routes are also analyzed. As illustrative example, the direct reaction and the reaction chain: 47 Ti(n,p) 47 Sc/ 46 Ca(n,γ) 47 Ca(β - ) 47 Sc are evaluated with respect to the determination of the elements involved and their reciprocal interferences. (author)

  16. Measurement of dabigatran: previously demonstrated Hemoclot® Thrombin Inhibitor assay reagent instability on Sysmex CS-2100i is no longer an issue

    DEFF Research Database (Denmark)

    Comuth, Willemijn; Faaborg, Louise; Henriksen, Linda Østervig

    2017-01-01

    package insert instructions (incubation time: 15 min). Stability was increased to five hours when following the application sheet (incubation time: 60 min). Two years later, the study was repeated using samples of patients treated with dabigatran etexilate. This time, reagent stability was at least six......The Hemoclot® Thrombin Inhibitor (HTI) assay has been recommended for measurement of dabigatran concentrations in specific clinical situations. Traditionally, reagents for biochemical assays are prepared from instructions found in the package insert. For the HTI reagents the manufacturer recommends...... incubating the reagents much longer than indicated in the package insert. These recommendations are added to the application sheets designed for different analyzers. Many clinicians and laboratory personnel may be unaware of the discrepancy between the two instructions, resulting in incorrect handling...

  17. Electron conjugation versus π-π repulsion in substituted benzenes: why the carbon-nitrogen bond in nitrobenzene is longer than in aniline.

    Science.gov (United States)

    Zhang, Huaiyu; Jiang, Xiaoyu; Wu, Wei; Mo, Yirong

    2016-04-28

    Gas-phase electron diffraction experiments show that the C-N bond in aniline (1.407 Å) is significantly shorter than in nitrobenzene (1.486 Å). It is known that the amino group is electron-donating and the nitro group is electron-withdrawing, and both substitution groups can effectively conjugate with benzene. Thus, it is puzzling why the C-N bond in nitrobenzene is even longer than the single C-N bond in methylamine (1.472 Å). In this work, we performed computations by strictly localizing the π electrons with the block-localized wavefunction (BLW) method, which is a variant of ab initio valence bond theory. Geometry optimizations of electron-localized states, where the conjugation over the C-N bond is quenched, show that the conjugation in nitrobenzene is only half of the conjugation in aniline. But even in optimal electron-localized states, the C-N bond in nitrobenzene is still 0.074 Å longer than in aniline. As a consequence, it is indeed not the π conjugation which is responsible for the disparity of the C-N bond distances in these systems. Instead, we demonstrated that the π-π repulsion, which is contributed by both Pauli exchange and electrostatic interaction, plays the key role in this "abnormal" behavior. Notably, the π resonance within the nitro group generates a considerable dipole, which repels the π electrons in the benzene ring. The deactivation of the resonance within the nitro group significantly shortens the C-N bond by 0.06 Å. The unfavorable π-π electrostatic repulsion is further exemplified by N2O4. In fact, the destabilizing π-π repulsion is ubiquitous but largely neglected in conjugated systems where only the stabilizing conjugation is the focus. Experimental phenomena such as the C-N bond distances in aniline and nitrobenzene result from the balance of both stabilizing and destabilizing forces.

  18. Longer travel time to district hospital worsens neonatal outcomes: a retrospective cross-sectional study of the effect of delays in receiving emergency cesarean section in Rwanda.

    Science.gov (United States)

    Niyitegeka, Joseph; Nshimirimana, Georges; Silverstein, Allison; Odhiambo, Jackline; Lin, Yihan; Nkurunziza, Theoneste; Riviello, Robert; Rulisa, Stephen; Banguti, Paulin; Magge, Hema; Macharia, Martin; Habimana, Regis; Hedt-Gauthier, Bethany

    2017-07-25

    In low-resource settings, access to emergency cesarean section is associated with various delays leading to poor neonatal outcomes. In this study, we described the delays a mother faces when needing emergency cesarean delivery and assessed the effect of these delays on neonatal outcomes in Rwanda. This retrospective study included 441 neonates and their mothers who underwent emergency cesarean section in 2015 at three district hospitals in Rwanda. Four delays were measured: duration of labor prior to hospital admission, travel time from health center to district hospital, time from admission to surgical incision, and time from decision for emergency cesarean section to surgical incision. Neonatal outcomes were categorized as unfavorable (APGAR cesarean sections started within 5 h after hospital admission and 85.2% (288 of 338) started more than 30 min after the decision for cesarean section was made. Neonatal outcomes were significantly worse among mothers with more than 90 min of travel time from the health center to the district hospital compared to mothers referred from health centers located on the same compound as the hospital (aOR = 5.12, p = 0.02). Neonates with cesarean deliveries starting more than 30 min after decision for cesarean section had better outcomes than those starting immediately (aOR = 0.32, p = 0.04). Longer travel time between health center and district hospital was associated with poor neonatal outcomes, highlighting a need to decrease barriers to accessing emergency maternal services. However, longer decision to incision interval posed less risk for adverse neonatal outcome. While this could indicate thorough pre-operative interventions including triage and resuscitation, this relationship should be studied prospectively in the future.

  19. Long-term collections

    CERN Multimedia

    Collectes à long terme

    2007-01-01

    The Committee of the Long Term Collections (CLT) asks for your attention for the following message from a young Peruvian scientist, following the earthquake which devastated part of her country a month ago.

  20. Dictionary of Cancer Terms

    Science.gov (United States)

    ... type of antifungal. Amplimexon listen (AM-plih-MEK-son) A substance that is being studied in the ... collapsed blood vessels, fainting, difficulty in breathing, and death. anaplastic listen (A-nuh-PLAS-tik) A term ...

  1. Astrophysical terms in Armenian

    Science.gov (United States)

    Yeghikian, A. G.

    2015-07-01

    There are quite a few astrophysical textbooks (to say nothing about monographs) in Armenian, which are, however out of date and miss all the modern terms concerning space sciences. Many terms have been earlier adopted from English and, especially, from Russian. On the other hand, teachers and lecturers in Armenia need scientific terms in Armenian adequately reproducing either their means when translating from other languages or (why not) creating new ones. In short, a permanently updated astrophysical glossary is needed to serve as explanation of such terms. I am not going here to present the ready-made glossary (which should be a task for a joint efforts of many professionals) but instead just would like to describe some ambiguous examples with comments where possible coming from my long-year teaching, lecturing and professional experience. A probable connection between "iron" in Armenian as concerned to its origin is also discussed.

  2. Nuclear Terms: a glossary

    Energy Technology Data Exchange (ETDEWEB)

    Freiwald, David A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    1981-05-31

    This booklet is a revision of Nuclear Terms: A Glossary, published in 1967 by the United States Atomic Energy Commission. New fields, such as laser fusion and laser isotope separation, are included and nuclear weapons terms are deleted. Thus, it is a glossary for nuclear fission and fusion science and for commercial applications. David A. Freiwald, Frank C. DiLuzio, and Leslie M. Redman prepared this revised glossary. Contributions were made by other members of the Los Alamos National Laboratory staff.

  3. Understanding anatomical terms.

    Science.gov (United States)

    Mehta, L A; Natrajan, M; Kothari, M L

    1996-01-01

    Words are our masters and words are our slaves, all depending on how we use them. The whole of medical science owes its origin to Greco-Roman culture and is replete with terms whose high sound is not necessarily accompanied by sound meaning. This is even more the case in the initial, pre-clinical years. Anatomical terminology seems bewildering to the initiate; and maybe that is a reason why love of anatomy as a subject does not always spill over through later years. Employing certain classifications of the origin of the anatomical terms, we have prepared an anthology that we hope will ease the student's task and also heighten the student's appreciation of the new terms. This centers on revealing the Kiplingian "how, why, when, where, what, and who" of a given term. This presentation should empower students to independently formulate a wide network of correlations once they understand a particular term. The article thus hopes to stimulate students' analytic and synthetic faculties as well. A small effort can reap large rewards in terms of enjoyment of the study of anatomy and the related subjects of histology, embryology, and genetics. It is helpful to teachers and students alike. This exercise in semantics and etymology does not demand of the student or his teacher any background in linguistics, grammar, Greek, Latin, Sanskrit, anatomy, or medicine.

  4. Long-term stability of salivary cortisol

    DEFF Research Database (Denmark)

    Garde, A H; Hansen, Åse Marie

    2005-01-01

    The measurement of salivary cortisol provides a simple, non-invasive, and stress-free measure frequently used in studies of the hypothalamic-pituitary-adrenal axis activity. In research projects, samples are often required to be stored for longer periods of time either because of the protocol...... of the project or because of lack of funding for analysis. The aim of the present study was to explore the effects of long-term storage of samples on the amounts of measurable cortisol. Ten pools of saliva were collected on polyester Salivette tampons from five subjects. After centrifugation the samples were...... either stored in small vials or spiked to polyester Salivette tampons before analysis for cortisol using Spectria RIA kits. The effects of storage were evaluated by a linear regression model (mixed procedure) on a logarithmic scale. No effects on cortisol concentrations were found after storage of saliva...

  5. The International Xenotransplantation Association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes--chapter 1: Key ethical requirements and progress toward the definition of an international regulatory framework.

    Science.gov (United States)

    Cozzi, Emanuele; Tallacchini, Mariachiara; Flanagan, Enda B; Pierson, Richard N; Sykes, Megan; Vanderpool, Harold Y

    2009-01-01

    The outstanding results recently obtained in islet xenotransplantation suggest that porcine islet clinical trials may soon be scientifically appropriate. Before the initiation of such clinical studies, however, it is essential that a series of key ethical and regulatory conditions are satisfied. As far as ethics is concerned, the fundamental requirements have been previously reported in a position paper of the Ethics Committee of the International Xenotransplantation Association. These include aspects related to the selection of adequately informed, appropriate recipients; animal breeding and welfare; safety issues and the need for a favorable risk/benefit assessment based on strong efficacy data in relevant xenotransplantation studies in the primate. As most diabetic patients are not at risk of short-term mortality without islet transplantation, only a small subset of patients could currently be considered for any type of islet transplant. However, there are potential advantages to xenotransplantation that could result in a favorable benefit-over-harm determination for islet xenotransplantation in this subpopulation and ultimately in a broader population of diabetic patients. With regard to regulatory aspects, the key concepts underlying the development of the regulatory models in existence in the United States, Europe and New Zealand are discussed. Each of these models provides an example of a well-defined regulatory approach to ensure the initiation of well-regulated and ethically acceptable clinical islet xenotransplantation trials. At this stage, it becomes apparent that only a well-coordinated international effort such as that initiated by the World Health Organization, aimed at harmonizing xenotransplantation procedures according to the highest ethical and regulatory standards on a global scale, will enable the initiation of clinical xenotransplantation trials under the best auspices for its success and minimize any risk of failure.

  6. Short (6-mm) dental implants versus sinus floor elevation and placement of longer (≥10-mm) dental implants: a randomized controlled trial with a 3-year follow-up.

    Science.gov (United States)

    Bechara, Souheil; Kubilius, Ricardas; Veronesi, Giovanni; Pires, Jefferson T; Shibli, Jamil A; Mangano, Francesco G

    2017-09-01

    To investigate whether short (6-mm) dental implants could be an alternative to sinus floor elevation (SFE) and placement of longer (≥10-mm) implants in the posterior maxilla. Over a 3-year period, all patients presenting with partial edentulism in the posterior maxilla were considered for inclusion in this randomized controlled trial. Patients were randomly chosen either to receive short (6-mm) implants (test group [TG]) or to undergo SFE with simultaneous placement of standard-length (≥10-mm) implants (control group [CG]). SFE was performed using the lateral technique. In both groups, tapered implants (AnyRidge, MegaGen, Gyeongbuk, South Korea) were placed. All implants were loaded after 4 months of healing. At each annual follow-up session, clinical and radiographic parameters were assessed. Primary outcomes were implant survival, stability (measured with the implant stability quotient [ISQ]), marginal bone loss (MBL), and complications; secondary outcomes were patient satisfaction and treatment time and cost. Thirty-three patients were assigned to the TG and 20 to the CG. Forty-five implants were inserted in each group. At 3 years, implant survival rates were 100% and 95.0% for the TG and CG, respectively; this difference was not statistically significant (P = 0.38). The mean ISQ values of the TG and CG did not differ at placement (68.2 vs. 67.8, P = 0.1), at delivery of the final restoration (69.5 vs. 69.4, P = 0.9), and after 1 year (71.0 vs. 71.5, P = 0.1); at 3 years, the CG had a significantly higher mean ISQ than the TG (72.4 vs. 71.6, P = 0.004). Mean MBL was significantly higher in the CG than in the TG, both at 1 year (0.14 mm vs. 0.21 mm, P = 0.006) and at 3 years (0.20 mm vs. 0.27 mm, P = 0.01). A few complications were reported. Surgical time and cost were significantly higher in the CG than in the TG (P implants were similar to those for longer (≥10-mm) implants in augmented bone. Short implants might be preferable to

  7. CHANGES IN FARMER TERMS OF TRADE AND AGRICULTURE NET-BARTER TERMS OF TRADE: AN EMPIRICAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Hermanto Siregar

    2011-08-01

    Full Text Available Normal 0 false false false MicrosoftInternetExplorer4 st1\\:*{behavior:url(#ieooui } /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} In line with the Prebisch-Singerhypothesis, it is found that the Indonesian farmer terms of trade in aggregatefollowed a negative trend. Spatially, this tendency was mainly the case for theWestern Part of Indonesia, whereas in the Eastern Part of the country,especially in some Sulawesi and Kalimantan provinces, the farmer terms of tradeincreased significantly. This shows a potency to properly expand theagricultural sector in these provinces without risking the relative welfare offarmers to decline. Thus more agricultural development efforts should bedevoted to these regions. The net barter terms of trade for agriculture, whichmay be seen as a proxy of relative welfare of farmers with some accesses toexport/import market, on the other hand, generally depict a non-negative trend.This suggest that in average this group of farmers, or perhaps a group ofagricultural exporters, was less severaly affected by the crisis or crisis-likeevents than the peasant farmers. Therefore, systematic development program,which should be more than a rescue-short-term-demand-side program, is neededwith a main aim to stabilize the relative welfare of the peasant. The analysisalso suggests that Indonesiaagricultural exports are supply determined, which means that eliminations ofsupply bottlenecks and technological advancement leading to a lower unit costrelative to price received are necessary to undertake.

  8. Increased left ventricular myocardial extracellular volume is associated with longer cardiopulmonary bypass times, biventricular enlargement and reduced exercise tolerance in children after repair of Tetralogy of Fallot.

    Science.gov (United States)

    Riesenkampff, Eugénie; Luining, Wietske; Seed, Mike; Chungsomprasong, Paweena; Manlhiot, Cedric; Elders, Bernadette; McCrindle, Brian W; Yoo, Shi-Joon; Grosse-Wortmann, Lars

    2016-10-26

    Unfavorable left ventricular (LV) remodelling may be associated with adverse outcomes after Tetralogy of Fallot (TOF) repair. We sought to assess T1 cardiovascular magnetic resonance (CMR) markers of diffuse LV myocardial fibrosis in children after TOF repair, and associated factors. In this prospective, cross-sectional study, native (=non-contrast) T1 times and extracellular volume fraction (ECV) were quantified in the LV myocardium using CMR. Results were related to ventricular volumes and function, degree of pulmonary regurgitation, as well as surgical characteristics, and exercise capacity. There was no difference in native T1 times or ECV between 31 TOF patients (age at CMR 13.9 ± 2.4 years, 19 male) and 15 controls (age at CMR 13.4 ± 2.6 years, 7 male). Female TOF patients had higher ECVs than males (25.2 ± 2.9 % versus 22.7 ± 3.3 %, p < 0.05). In the patient group, higher native T1 and ECV correlated with higher Z-Scores of right and left ventricular end-diastolic volumes, but not with reduced left and right ventricular ejection fraction or higher pulmonary regurgitation fraction. Longer cardiopulmonary bypass and aortic cross clamp times at surgery correlated with increased native T1 times and ECVs (r = 0.48, p < 0.05 and r = 0.65, p < 0.01, respectively). Maximum workload (percent of predicted for normal) correlated inversely with ECV (r = -0.62, p < 0.05). Higher native T1 times correlated with worse LV longitudinal (r = 0.50, p < 0.05) and mid short axis circumferential strain (r = 0.38, p < 0.05). As compared to controls, TOF patients did not express higher markers of diffuse fibrosis. Longer cardiopulmonary bypass and aortic cross clamp times at surgery as well as biventricular enlargement and reduced exercise tolerance are associated with markers of diffuse myocardial fibrosis after TOF repair. Female patients have higher markers of diffuse myocardial fibrosis than males.

  9. A Meta-analysis of the effects of Exercise Training on Left Ventricular Remodeling Following Myocardial Infarction: Start early and go longer for greatest exercise benefits on remodeling

    Directory of Open Access Journals (Sweden)

    Warburton Darren

    2011-04-01

    Full Text Available Abstract Background The effects of variations in exercise training on Left ventricular (LV remodeling in patients shortly after Myocardial Infarction (MI are important but poorly understood. Methods Systematic review incorporating meta-analysis using meta-regression. Studies were identified via systematic searches of: OVID MEDLINE (1950 to 2009, Cochrane Central Register of Controlled Trials (1991 to 2009, AMED (1985 to 2009, EMBASE (1988 to 2009, PUBMED (1966 to 2009, SPORT DISCUS (1975 to 2009, SCOPUS (1950 to 2009 and WEB OF SCIENCE (1950 to 2009 using the medical subject headings: myocardial infarction, post myocardial infarction, post infarction, heart attack, ventricular remodeling, ventricular volumes, ejection fraction, left ventricular function, exercise, exercise therapy, kinesiotherapy, exercise training. Reference lists of all identified studies were also manually searched for further relevant studies. Studies selected were randomized controlled trials of exercise training interventions reporting ejection fraction (EF and/or ventricular volumes in patients following recent MI (≤ 3 months post-MI patients involving control groups. Studies were excluded if they were not randomized, did not have a 'usual-care' control (involving no exercise, evaluated a non-exercise intervention, or did not involve human subjects. Non-English studies were also excluded. Results After screening of 1029 trials, trials were identified that reported EF (12 trials, n = 647, End Systolic Volumes (ESV (9 trials, n = 475 and End Diastolic Volumes (EDV (10 trials, n = 512. Meta-regression identified that changes in EF effect size difference decreased as the time between MI and initiation of the exercise program lengthened, and increased as the duration of the program increased (Q = 25.48, df = 2, p 2 = 0.76. Greater reductions in ESV and EDV (as indicated by effect size decreases occurred with earlier initiation of exercise training and with longer training

  10. Treatment of the atrophic edentulous maxilla: short implants versus bone augmentation for placing longer implants. Five-month post-loading results of a pilot randomised controlled trial.

    Science.gov (United States)

    Felice, Pietro; Soardi, Elisa; Pellegrino, Gerardo; Pistilli, Roberto; Marchetti, Claudio; Gessaroli, Manlio; Esposito, Marco

    2011-01-01

    To evaluate whether short (5 to 8.5 mm) dental implants could be a suitable alternative to longer (>11.5 mm) implants placed in atrophic maxillae augmented with autogenous bone for supporting dental prostheses. Twenty-eight patients with fully edentulous atrophic maxillae having 5 to 9 mm of residual crestal bone height at least 5 mm thick, as measured on computerised tomography scans, were randomised into two groups either to receive 4 to 8 short (5 to 8.5 mm) implants (15 patients) or autogenous bone from the iliac crest to allow the placement of at least 11.5 mmlong implants (13 patients). Bone blocks and the windows at maxillary sinuses were covered with rigid resorbable barriers. Grafts were left to heal for 4 months before placing implants, which were submerged. After 4 months, provisional reinforced acrylic prostheses or bar-retained overdentures were delivered. Provisional prostheses were replaced, after 4 months, by definitive screw-retained metal-resin cross-arch fixed dental prostheses. Outcome measures were: prosthesis and implant failures, any complications (including prolonged postoperative pain) and patient satisfaction. All patients were followed for 5 months after loading. All patients could be rehabilitated with implant-supported prostheses and none dropped out. One bilateral sinus lift procedure failed due to infection, though short implants could be placed. One implant failed in the augmented group versus 2 short implants in 2 patients. All failures occurred before loading. Significantly more complications occurred in augmented patients: 8 complications occurred in 5 augmented patients (all complained of pain 1 month after bone harvesting from the iliac crest). No complications occurred in the short implant group. All patients were fully satisfied with the treatment and would do it again. This pilot study suggests that short implants may be a suitable, cheaper and faster alternative to longer implants placed in bone augmented with autogenous

  11. Nonprice terms and conditions

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    In this and the following chapter the authors review some of the more common provisions contained in wheeling contracts. Here they discuss nonprice terms and conditions. In the next chapter they look at the manner in which they address the pricing issue. At the outset one should note that there is a relationship between price and nonprice terms and condition. A couple of the provisions discussed here affect the risks incurred by the wheeling utility and the price it may charge for that service. These provisions include the length of the contract, the degree to which service can be interrupted and the ability to terminate the contract early, among others. These provisions are often characterized as nonprice terms and conditions. In reality, however, these factors have a direct bearing on the overall cost of wheeling services provided

  12. Fixed-Term Homotopy

    Directory of Open Access Journals (Sweden)

    Hector Vazquez-Leal

    2013-01-01

    Full Text Available A new tool for the solution of nonlinear differential equations is presented. The Fixed-Term Homotopy (FTH delivers a high precision representation of the nonlinear differential equation using only a few linear algebraic terms. In addition to this tool, a procedure based on Laplace-Padé to deal with the truncate power series resulting from the FTH method is also proposed. In order to assess the benefits of this proposal, two nonlinear problems are solved and compared against other semianalytic methods. The obtained results show that FTH is a power tool capable of generating highly accurate solutions compared with other methods of literature.

  13. Measurement of Driving Terms

    CERN Document Server

    Schmidt, F; Faus-Golfe, A

    2001-01-01

    In 2000 a series of MDs has been performed at the SPS to measure resonance driving terms. Theory predicts that these terms can be determined by harmonic analysis of BPM data recorded after applying single kicks at various amplitudes. Strong sextupoles were introduced to create a sizeable amount of nonlinearities. Experiments at injection energy (26 GeV) with single bunch as well as one experiment at 120 GeV with 84 bunches were carried out. The expected nonlinear content is compared to the experimenteal observation.

  14. Short and longer duration effects of protective gloves on hand performance capabilities and subjective assessments in a screw-driving task.

    Science.gov (United States)

    Dianat, Iman; Haslegrave, Christine M; Stedmon, Alex W

    2010-12-01

    The study investigated short and longer duration effects of gloves on hand performance capabilities (muscle activity, dexterity, touch sensitivity, finger pinch and forearm torque strength) and subjective assessments of discomfort and ease of manipulation when performing a light assembly task. The independent variables were hand condition with four levels (wearing cotton, nylon or nitrile gloves as well as barehanded) and point of time within the 2 h duration of the task (with measurements taken at 0, 30, 60, 90 and 120 min). Participants worked with a screwdriver to fit two components together using screws. Wearing gloves significantly increased the muscle activity, pinch strength and discomfort but reduced the dexterity and touch sensitivity. There was also a significant effect of task time on the muscle activity, dexterity, forearm torque strength and touch sensitivity, which indicates that the duration of the task should be an important consideration in glove evaluation studies and in the selection of work gloves. STATEMENT OF RELEVANCE: It is important to evaluate the effects of gloves on hand performance capabilities in a working context so that job demands can be taken into account and the most appropriate type of glove be chosen for each task. This study gives recommendations regarding the evaluation and use of gloves for screw-driving tasks.

  15. Longer epilepsy duration and multiple lobe involvement predict worse seizure outcomes for patients with refractory temporal lobe epilepsy associated with neurocysticercosis

    Directory of Open Access Journals (Sweden)

    Lucas Crociati Meguins

    2015-12-01

    Full Text Available ABSTRACT Objective To investigate the surgical outcomes of temporal lobe epilepsy associated with hippocampal sclerosis (TLE-HS and neurocysticercosis (NCC. Methods A retrospective investigation of patients with TLE-HS was conducted in a tertiary center. Results Seventy-nine (62.2%, 37 (29.1%, 6 (4.7%, and 5 (3.9% patients were Engel class I, II, III, and IV, respectively. Fifty-two (71.2% patients with epilepsy durations ≤ 10 years prior to surgery were seizure-free 1 year after the operation compared to 27 (50.0% patients with epilepsy durations > 10 years (p = 0.0121. Forty-three (72.9% patients with three or fewer lobes affected by NCC were seizure-free one year after the operation, and 36 (52.9% patients with more than three involved lobes were seizure-free after surgery (p = 0.0163. Conclusions Longer epilepsy durations and multiple lobe involvement predicted worse seizure outcomes in TLE-HS plus NCC patients.

  16. Improving the Efficiency of Dye-Sensitized Solar Cells by Growing Longer ZnO Nanorods on TiO2 Photoanodes

    Directory of Open Access Journals (Sweden)

    Bao-gai Zhai

    2017-01-01

    Full Text Available By increasing the temperature of hydrothermal reactions from 70 to 100°C, vertically aligned ZnO nanorods were grown on the TiO2 thin film in the photoanode of dye-sensitized solar cells (DSSCs as the blocking layer to reduce the electron back recombinations at the TiO2/electrolyte interfaces. The length effects of ZnO nanorods on the photovoltaic performances of TiO2 based DSSCs were investigated by means of scanning electron microscope, X-ray diffractometer, photoluminescence spectrophotometer, and the photocurrent-voltage measurement. Under the illumination of 100 mW/cm2, the power conversion efficiency of DSSC with ZnO nanorods decorated TiO2 thin film as its photoanode can be increased nearly fourfold from 0.27% to 1.30% as the length of ZnO nanorods increases from 300 to 1600 nm. The enhanced efficiency of DSSC with ZnO nanorods decorated TiO2 thin film as the photoanode can be attributed to the larger surface area and the lower defect density in longer ZnO nanorods, which are in favor of more dye adsorption and more efficient transport in the photoanode.

  17. The potential for extending the spectral range accessible to the european X-ray free electron laser in the direction of longer wavelengths

    CERN Document Server

    Saldin, E L; Yurkov, M V

    2004-01-01

    The baseline specifications of European XFEL give a range of wavelengths between 0.1 nm and 2 nm. This wavelength range at fixed electron beam energy 17.5 GeV can be covered by operating the SASE FEL with three undulators which have different period and tunable gap. A study of the potential for the extending the spectral range accessible to the XFEL in the direction of longer wavelengths is presented. The extension of the wavelength range to 6 nm would be cover the water window in the VUV region, opening the facility to a new class of experiments. There are at least two possible sources of VUV radiation associated with the X-ray FEL; the "low (2.5 GeV) energy electron beam dedicated" and the " 17.5 GeV spent beam parasitic" (or "after-burner") source modes. The second alternative, "after-burner undulator" is the one we regard as most favorable. It is possible to place an undulator as long as 80 meters after 2 nm undulator. Ultimately, VUV undulator would be able to deliver output power approaching 100 GW. A b...

  18. Clinical Investigation and Patient Satisfaction of Short Implants Versus Longer Implants with Osteotome Sinus Floor Elevation in Atrophic Posterior Maxillae: A Pilot Randomized Trial.

    Science.gov (United States)

    Zhang, Xiao-Meng; Shi, Jun-Yu; Gu, Ying-Xin; Qiao, Shi-Chong; Mo, Jia-Ji; Lai, Hong-Chang

    2017-02-01

    The aim of the study was to evaluate the clinical parameters and patient satisfaction of the treatments with short implants compared to longer implants with osteotome sinus floor elevation (OSFE) in atrophic posterior maxillae. The patient data were retrieved from an ongoing randomized controlled trial (NCT02350075). Patients were randomly allocated into three groups: (group1: short-6 mm implant, group 2: short-8-mm implant with OSFE, group 3: standard-10 mm implant with OSFE). Early implant failure, complications, implant stability quotient (ISQ) and patient satisfaction by means of visual analogue scale (VAS) were evaluated. ANOVA analysis was performed for the data comparison. Fifty-six patients were enrolled in the present study. No implant loss was found by the end of the restoration placement. No significant difference of ISQ values was found among three groups at the time of implant surgery and impression taking (p = .67 and.54, respectively). VAS values regarding intraoperative vibratory sense in group 1 were significantly higher than those in group 3 (p = .01). All three treatments were safe in atrophic posterior maxilla (6 mm ≤ residual bone height < 8 mm). Patients were satisfied with all three treatments, while the malleting during the osteotome procedure could make patients feel uncomfortable. © 2016 Wiley Periodicals, Inc.

  19. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  20. Desigualdades en salud y desigualdades sociales: un abordaje epidemiológico en un municipio urbano de Argentina Inequalities in health and socioeconomics: an epidemiological undertaking in an urban area of Argentina

    Directory of Open Access Journals (Sweden)

    Marcio Alazraqui

    2007-01-01

    salud-enfermedad-atención, en particular, la tasa de embarazos en adolescentes y la mortalidad por tumores de mama en mujeres mayores de 40 años. Estos resultados son de gran utilidad para diseñar intervenciones específicas dirigidas a reducir desigualdades en el nivel local.OBJECTIVES: To understand how certain socioeconomic factors interact with health indicators at the local level, so that health inequalities may be better addressed. METHODS: Several epidemiological methods were applied to study the 431 census block groups of the Lanús municipality in the province of Buenos Aires, Argentina, from January 1995 to December 2002. Using a cluster study, the block groups were categorized according to demographic and socioeconomic traits. A spatial distribution analysis was conducted of each health-related event in terms of its geographic location (georeference, and comparisons were drawn using box-plot charting for each group. Four types of demographic and socioeconomic data were gathered from the 1991 National Population and Housing Census: housing adequacy, overcrowding, percentage of persons 65 and older in the household, and level of education. The health indicators studied were vaccination coverage among children entering primary school, teen pregnancy rates, and breast cancer mortality rates in women over 40 years old. RESULTS: Teen pregnancy rates fell as socioeconomic conditions improved (chi2 = 60.7452; P = 4.074 ´ 10-13. In contrast, the breast cancer mortality rate among women over 40 was higher among those with a better standard of living (chi2 = 12.9766; P = 0.0047. Although the average number of children with incomplete vaccination schedules at school entry decreased with improved socioeconomic conditions, the difference was not statistically significant (chi2 = 6.3993; P = 0.0937. CONCLUSIONS: The combined methodologies confirmed the correlation between socioeconomic factors and health indicators, especially regarding teen pregnancy and breast cancer

  1. Long-Term Collections

    CERN Multimedia

    Comité des collectes à long terme

    2011-01-01

    It is the time of the year when our fireman colleagues go around the laboratory for their traditional calendars sale. A part of the money of the sales will be donated in favour of the long-term collections. We hope that you will welcome them warmly.

  2. Nuclear energy terms

    International Nuclear Information System (INIS)

    1976-01-01

    This is an English-Afrikaans / Afrikaans-English dictionary compiled by the Technical Language Committee of the Atomic Energy Board in collaboration with the Vaktaalburo of the Suid-Afrikaanse Akademie vir Wetenskap en Kuns containing 8515 terms on nuclear energy

  3. Short-Term Market Risks Implied by Weekly Options

    DEFF Research Database (Denmark)

    Andersen, Torben Gustav; Fusari, Nicola; Todorov, Viktor

    We study short-term market risks implied by weekly S&P 500 index options. The introduction of weekly options has dramatically shifted the maturity profile of traded options over the last five years, with a substantial proportion now having expiry within one week. Such short-dated options provide...... a direct way to study volatility and jump risks. Unlike longer-dated options, they are largely insensitive to the risk of intertemporal shifts in the economic environment. Adopting a novel semi-nonparametric approach, we uncover variation in the negative jump tail risk which is not spanned by market...... volatility and helps predict future equity returns. Incidents of tail shape shifts coincide with mispricing of standard parametric models for longer-dated options. As such, our approach allows for easy identification of periods of heightened concerns about negative tail events that are not always "signaled...

  4. Murine model of long term obstructive jaundice

    Science.gov (United States)

    Aoki, Hiroaki; Aoki, Masayo; Yang, Jing; Katsuta, Eriko; Mukhopadhyay, Partha; Ramanathan, Rajesh; Woelfel, Ingrid A.; Wang, Xuan; Spiegel, Sarah; Zhou, Huiping; Takabe, Kazuaki

    2016-01-01

    Background With the recent emergence of conjugated bile acids as signaling molecules in cancer, a murine model of obstructive jaundice by cholestasis with long-term survival is in need. Here, we investigated the characteristics of 3 murine models of obstructive jaundice. Methods C57BL/6J mice were used for total ligation of the common bile duct (tCL), partial common bile duct ligation (pCL), and ligation of left and median hepatic bile duct with gallbladder removal (LMHL) models. Survival was assessed by Kaplan-Meier method. Fibrotic change was determined by Masson-Trichrome staining and Collagen expression. Results 70% (7/10) of tCL mice died by Day 7, whereas majority 67% (10/15) of pCL mice survived with loss of jaundice. 19% (3/16) of LMHL mice died; however, jaundice continued beyond Day 14, with survival of more than a month. Compensatory enlargement of the right lobe was observed in both pCL and LMHL models. The pCL model demonstrated acute inflammation due to obstructive jaundice 3 days after ligation but jaundice rapidly decreased by Day 7. The LHML group developed portal hypertension as well as severe fibrosis by Day 14 in addition to prolonged jaundice. Conclusion The standard tCL model is too unstable with high mortality for long-term studies. pCL may be an appropriate model for acute inflammation with obstructive jaundice but long term survivors are no longer jaundiced. The LHML model was identified to be the most feasible model to study the effect of long-term obstructive jaundice. PMID:27916350

  5. Plant diversity maintains long-term ecosystem productivity under frequent drought by increasing short-term variation.

    Science.gov (United States)

    Wagg, Cameron; O'Brien, Michael J; Vogel, Anja; Scherer-Lorenzen, Michael; Eisenhauer, Nico; Schmid, Bernhard; Weigelt, Alexandra

    2017-11-01

    Increasing frequency of extreme climatic events can disrupt ecosystem processes and destabilize ecosystem functioning. Biodiversity may dampen these negative effects of environmental perturbations to provide greater ecosystem stability. We assessed the effects of plant diversity on the resistance, recovery and stability of experimental grassland ecosystems in response to recurring summer drought over 7 yr. Plant biomass production was reduced during the summer drought treatment compared with control plots. However, the negative effect of drought was relatively less pronounced at high than at low plant diversity, demonstrating that biodiversity increased ecosystem resistance to environmental perturbation. Furthermore, more diverse plant communities compensated for the reduced productivity during drought by increasing spring productivity compared to control plots. The drought-induced compensatory recovery led to increased short-term variations in productivity across growing seasons in more diverse communities that stabilized the longer-term productivity across years. Our findings show that short-term variation between seasons in the face of environmental perturbation can lead to longer-term stability of annual productivity in diverse ecosystems compared to less diverse ecosystems. © 2017 by the Ecological Society of America.

  6. Short implants versus bone augmentation for placing longer implants in atrophic maxillae: One-year post-loading results of a pilot randomised controlled trial.

    Science.gov (United States)

    Esposito, Marco; Barausse, Carlo; Pistilli, Roberto; Sammartino, Gilberto; Grandi, Giovanni; Felice, Pietro

    2015-01-01

    To evaluate whether short (5.0 to 8.5 mm) dental implants could be a suitable alternative to longer (at least 11.5 mm-long) implants placed in atrophic maxillae augmented with autogenous bone for supporting dental prostheses. Twenty-eight patients with fully edentulous atrophic maxillae, whom had 5 to 9 mm of residual crestal bone height which was at least 5 mm thick, measured using computerised tomography (CT) scans, were randomised into two groups either to receive 4 to 8 short (5.0 to 8.5 mm) implants (15 patients) or autogenous bone from the iliac crest to allow the placement of at least 11.5 mm-long implants (13 patients). Bone blocks and the windows at the maxillary sinuses were covered with rigid resorbable barriers. Grafts were left to heal for 4 months before placing implants which were submerged. After 4 months, provisional reinforced acrylic prostheses or bar retained overdentures were delivered. Provisional prostheses were replaced, after 4 months, by definitive screw-retained metal-resin cross-arch restorations. Outcome measures were prosthesis and implant failures, any complications, peri-implant marginal bone level changes and patient satisfaction. Patients were followed up to 1 year after loading. All patients were rehabilitated with implant-supported prostheses but two patients dropped out from the augmented group. One bilateral sinus lift procedure failed for infection, although short implants could be placed. One implant failed in the augmented group versus two short implants in two patients (Fishers exact test P = 1.00; difference in proportions = 0.06; 95% CI -0.28 to 0.17). All failures occurred before loading. Significantly more complications occurred in augmented patients: eight complications occurred in 5 augmented patients (all of them complained of pain 1 month after bone harvesting from the iliac crest) versus no complications in the short implant (Fisher's exact test P = 0.013; difference in proportions = 0.38; 95% CI 0.11 to 0

  7. Effects of shorter versus longer storage time of transfused red blood cells in adult ICU patients: a systematic review with meta-analysis and Trial Sequential Analysis.

    Science.gov (United States)

    Rygård, Sofie L; Jonsson, Andreas B; Madsen, Martin B; Perner, Anders; Holst, Lars B; Johansson, Pär I; Wetterslev, Jørn

    2018-02-01

    Patients in the intensive care unit (ICU) are often transfused with red blood cells (RBC). During storage, the RBCs and storage medium undergo changes, which may have clinical consequences. Several trials now have assessed these consequences, and we reviewed the present evidence on the effects of shorter versus longer storage time of transfused RBCs on outcomes in ICU patients. We conducted a systematic review with meta-analyses and trial sequential analyses (TSA) of randomised clinical trials including adult ICU patients transfused with fresher versus older or standard issue blood. We included seven trials with a total of 18,283 randomised ICU patients; two trials of 7504 patients were judged to have low risk of bias. We observed no effects of fresher versus older blood on death (relative risk 1.04, 95% confidence interval (CI) 0.97-1.11; 7349 patients; TSA-adjusted CI 0.93-1.15), adverse events (1.26, 0.76-2.09; 7332 patients; TSA-adjusted CI 0.16-9.87) or post-transfusion infections (1.07, 0.96-1.20; 7332 patients; TSA-adjusted CI 0.90-1.27). The results were unchanged by including trials with high risk of bias. TSA confirmed the results and the required information size was reached for mortality for a relative risk change of 20%. We may be able to reject a clinically meaningful effect of RBC storage time on mortality in transfused adult ICU patients as our trial sequential analyses reject a 10% relative risk change in death when comparing fresher versus older blood for transfusion.

  8. Perforation of the IVC: Rule Rather Than Exception After Longer Indwelling Times for the Günther Tulip and Celect Retrievable Filters

    International Nuclear Information System (INIS)

    Durack, Jeremy C.; Westphalen, Antonio C.; Kekulawela, Stephanie; Bhanu, Shiv B.; Avrin, David E.; Gordon, Roy L.; Kerlan, Robert K.

    2012-01-01

    Purpose: This study was designed to assess the incidence, magnitude, and impact upon retrievability of vena caval perforation by Günther Tulip and Celect conical inferior vena cava (IVC) filters on computed tomographic (CT) imaging. Methods: Günther Tulip and Celect IVC filters placed between July 2007 and May 2009 were identified from medical records. Of 272 IVC filters placed, 50 (23 Günther Tulip, 46%; 27 Celect, 54%) were retrospectively assessed on follow-up abdominal CT scans performed for reasons unrelated to the filter. Computed tomography scans were examined for evidence of filter perforation through the vena caval wall, tilt, or pericaval tissue injury. Procedure records were reviewed to determine whether IVC filter retrieval was attempted and successful. Results: Perforation of at least one filter component through the IVC was observed in 43 of 50 (86%) filters on CT scans obtained between 1 and 880 days after filter placement. All filters imaged after 71 days showed some degree of vena caval perforation, often as a progressive process. Filter tilt was seen in 20 of 50 (40%) filters, and all tilted filters also demonstrated vena caval perforation. Transjugular removal was attempted in 12 of 50 (24%) filters and was successful in 11 of 12 (92%). Conclusions: Longer indwelling times usually result in vena caval perforation by retrievable Günther Tulip and Celect IVC filters. Although infrequently reported in the literature, clinical sequelae from IVC filter components breaching the vena cava can be significant. We advocate filter retrieval as early as clinically indicated and increased attention to the appearance of IVC filters on all follow-up imaging studies.

  9. Longer pre-hospital delay in first myocardial infarction among patients with diabetes: an analysis of 4266 patients in the Northern Sweden MONICA Study

    Science.gov (United States)

    2013-01-01

    Background Reperfusion therapy reduces both morbidity and mortality in myocardial infarction, but the effectiveness depends on how fast the patient receives treatment. Despite the time-dependent effectiveness of reperfusion therapy, many patients with myocardial infarction have delays in seeking medical care. The aim of this study was to describe pre-hospital delay in a first myocardial infarction among men and women with and without diabetes and to describe the association between pre-hospital delay time and diabetes, sex, age, symptoms and size of residential area as a proxy for distance to hospital. Methods This population based study was based on data from 4266 people aged 25–74 years, with a first myocardial infarction registered in the Northern Sweden MONICA myocardial infarction registry between 2000 and 2008. Results The proportion of patients with delay times ≥ 2 h was 64% for patients with diabetes and 58% for patients without diabetes. There was no difference in delay time ≥ 2 h between men and women with diabetes. Diabetes, older age and living in a town or rural areas were factors associated with pre-hospital delay times ≥ 2 h. Atypical symptoms were not a predictor for pre-hospital delay times ≥ 2 h, OR 0.59 (0.47; 0.75). Conclusions A higher proportion of patients with diabetes have longer pre-hospital delay in myocardial infarction than patients without diabetes. There are no differences in pre-hospital delay between men and women with diabetes. The largest risk difference for pre-hospital delay ≥ 2 h is between women with and without diabetes. Diabetes, older age and living in a town or rural area are predictors for pre-hospital delay ≥ 2 h. PMID:23356233

  10. Perforation of the IVC: rule rather than exception after longer indwelling times for the Günther Tulip and Celect retrievable filters.

    Science.gov (United States)

    Durack, Jeremy C; Westphalen, Antonio C; Kekulawela, Stephanie; Bhanu, Shiv B; Avrin, David E; Gordon, Roy L; Kerlan, Robert K

    2012-04-01

    This study was designed to assess the incidence, magnitude, and impact upon retrievability of vena caval perforation by Günther Tulip and Celect conical inferior vena cava (IVC) filters on computed tomographic (CT) imaging. Günther Tulip and Celect IVC filters placed between July 2007 and May 2009 were identified from medical records. Of 272 IVC filters placed, 50 (23 Günther Tulip, 46%; 27 Celect, 54%) were retrospectively assessed on follow-up abdominal CT scans performed for reasons unrelated to the filter. Computed tomography scans were examined for evidence of filter perforation through the vena caval wall, tilt, or pericaval tissue injury. Procedure records were reviewed to determine whether IVC filter retrieval was attempted and successful. Perforation of at least one filter component through the IVC was observed in 43 of 50 (86%) filters on CT scans obtained between 1 and 880 days after filter placement. All filters imaged after 71 days showed some degree of vena caval perforation, often as a progressive process. Filter tilt was seen in 20 of 50 (40%) filters, and all tilted filters also demonstrated vena caval perforation. Transjugular removal was attempted in 12 of 50 (24%) filters and was successful in 11 of 12 (92%). Longer indwelling times usually result in vena caval perforation by retrievable Günther Tulip and Celect IVC filters. Although infrequently reported in the literature, clinical sequelae from IVC filter components breaching the vena cava can be significant. We advocate filter retrieval as early as clinically indicated and increased attention to the appearance of IVC filters on all follow-up imaging studies.

  11. Four mm-long versus longer implants in augmented bone in atrophic posterior jaws: 4-month post-loading results from a multicentre randomised controlled trial.

    Science.gov (United States)

    Esposito, Marco; Zucchelli, Giovanni; Barausse, Carlo; Pistilli, Roberto; Trullenque-Eriksson, Anna; Felice, Pietro

    dropped into the maxillary sinus). Two prostheses on short implants (one mandibular and one maxillary) were placed at a later stage because of implant failures versus four prostheses (one mandibular and three maxillary) at augmented sites. In particular, three patients of the augmented group (one mandible and two maxillary) were not prosthetically rehabilitated. There were no statistically significant differences in implant failures (P (chi-square test) = 1.000; difference in proportion = 0; 95% Cl: -0.13 to 0.13 or prostheses failures (P (chi-square test) = 0.399; difference in proportion = 0.05; 95% Cl: -0.06 to 0.16). At mandibular sites, nine augmented patients were affected by complications versus one patient treated with short implants (P (chi-square test) = 0.003; difference in proportion = 0.40; 95% Cl: 0.16 to 0.64), with the difference being statistically significant. No significant differences were found for the maxillae: eight sinus lift patients versus three patients rehabilitated with maxillary short implants were affected by complications (P (chi-square test) = 0.077; difference in proportion = 0.25; 95% Cl: -0.02 to 0.52). Patients with mandibular short implants lost on average 0.40 mm of peri-implant bone at 4 months and patients with 10 mm or longer mandibular implants lost 0.52 mm. Patients with short maxillary implants lost on average 0.48 mm peri-implant bone at 4 months and patients with 10 mm or longer maxillary implants lost 0.50 mm. The difference was statistically significant in the mandibles (mean difference: -0.12 mm, 95% CI: -0.20 to -0.04, P (ANCOVA) = 0.006), but not in the maxillae (mean difference: -0.02 mm, 95% CI: -0.10 to 0.07, P (ANCOVA) = 0.711). Four months after loading 4.0 mm-long implants achieved similar results, if not better, than longer implants in augmented jaws, but were affected by fewer complications. Short implants might be a preferable choice to bone

  12. Level of threshold weed density does not affect the long-term frequency of weed control.

    NARCIS (Netherlands)

    Wallinga, J.; Oijen, van M.

    1997-01-01

    Weed control thresholds are often presented as a means to reduce unnecessary control measures, thereby increasing the effectiveness of weed management. While the threshold is a useful tool for cost-effective application of control on a single-year base, its role over the longer term is more

  13. Prepectoral Implant-Based Breast Reconstruction and Postmastectomy Radiotherapy: Short-Term Outcomes

    Directory of Open Access Journals (Sweden)

    Steven Sigalove, MD

    2017-12-01

    Conclusions:. Immediate implant-based prepectoral breast reconstruction followed by PMRT appears to be well tolerated, with no excess risk of adverse outcomes, at least in the short term. Longer follow-up is needed to better understand the risk of PMRT in prepectorally reconstructed breasts.

  14. Acorns and acorn woodpeckers: ups and downs in a long-term relationship

    Science.gov (United States)

    Walter D. Koenig; Eric L. Walters; Johannes M.H. Knops; William J. Carmen

    2015-01-01

    Acorn woodpeckers are one of the most conspicuous and abundant birds in California oak forests due to their unique dependence on acorns, a food resource eaten directly and stored in specialized structures on their territories for later use when acorns are no longer present on trees. Parallel long-term studies of the demography and behavior of this species and of...

  15. From Spark to Fire: Can Situational Reading Interest Lead to Long-Term Reading Motivation?

    Science.gov (United States)

    Guthrie, John T.; Hoa, Laurel W.; Wigfield, Allan; Tonks, Stephen M.; Perencevich, Kathleen C.

    2006-01-01

    The processes of change in children's reading motivation have not been widely studied. We investigated whether situated interest for a specific book may lead to longer-term intrinsic motivation for general reading. Two schools with 120 grade 3 students filled out reading logs identifying their reasons for reading their favorite books twice. In…

  16. Preface: long-term response of a forest watershed ecosystem, clearcutting in the Southern Appalachians

    Science.gov (United States)

    Wayne Swank; Jackson Webster

    2014-01-01

    Our North American forests are no longer the wild areas of past centuries; they are an economic and ecological resource undergoing changes from both natural and management disturbances. A watershed-scale and long-term perspective of forest ecosystem responses is requisite to understanding and predicting cause and effect relationships. This book synthesizes...

  17. Long-Term Priming of Visual Search Prevails against the Passage of Time and Counteracting Instructions

    Science.gov (United States)

    Kruijne, Wouter; Meeter, Martijn

    2016-01-01

    Studies on "intertrial priming" have shown that in visual search experiments, the preceding trial automatically affects search performance: facilitating it when the target features repeat and giving rise to switch costs when they change--so-called (short-term) intertrial priming. These effects also occur at longer time scales: When 1 of…

  18. Long-Term Consequences for Teens with Older Sexual Partners. Fact Sheet. Publication #2008-16

    Science.gov (United States)

    Schelar, Erin; Ryan, Suzanne; Manlove, Jennifer

    2008-01-01

    Existing research on the risks of having sex at a young age with an older partner has focused on poorer reproductive health outcomes in the adolescent years, but scant attention has been paid to the longer-term implications of these relationships. Using survey data from high school students, this "Fact Sheet" presents findings from recent Child…

  19. Long-term follow-up of patients with surgical intractable acromegaly after linear accelerator radiosurgery

    Directory of Open Access Journals (Sweden)

    Jiun-Lin Yan

    2013-07-01

    Conclusion: In comparison to other radiosurgery modalities, LINAC radiosurgery also provides a satisfactory outcome. SRS has maximum effect over the first 2 years and stabilizes after 7.5 years. Moreover, SRS elicits long-term biochemical effects and requires longer follow-up for better biochemical remission.

  20. Manipulations of attention dissociate fragile visual short-term memory from visual working memory

    NARCIS (Netherlands)

    Vandenbroucke, A.R.E.; Sligte, I.G.; Lamme, V.A.F.

    2011-01-01

    People often rely on information that is no longer in view, but maintained in visual short-term memory (VSTM). Traditionally, VSTM is thought to operate on either a short time-scale with high capacity - iconic memory - or a long time scale with small capacity - visual working memory. Recent research