WorldWideScience

Sample records for underlying regulatory mechanisms

  1. Phosphoproteomics-based modeling defines the regulatory mechanism underlying aberrant EGFR signaling.

    Directory of Open Access Journals (Sweden)

    Shinya Tasaki

    Full Text Available BACKGROUND: Mutation of the epidermal growth factor receptor (EGFR results in a discordant cell signaling, leading to the development of various diseases. However, the mechanism underlying the alteration of downstream signaling due to such mutation has not yet been completely understood at the system level. Here, we report a phosphoproteomics-based methodology for characterizing the regulatory mechanism underlying aberrant EGFR signaling using computational network modeling. METHODOLOGY/PRINCIPAL FINDINGS: Our phosphoproteomic analysis of the mutation at tyrosine 992 (Y992, one of the multifunctional docking sites of EGFR, revealed network-wide effects of the mutation on EGF signaling in a time-resolved manner. Computational modeling based on the temporal activation profiles enabled us to not only rediscover already-known protein interactions with Y992 and internalization property of mutated EGFR but also further gain model-driven insights into the effect of cellular content and the regulation of EGFR degradation. Our kinetic model also suggested critical reactions facilitating the reconstruction of the diverse effects of the mutation on phosphoproteome dynamics. CONCLUSIONS/SIGNIFICANCE: Our integrative approach provided a mechanistic description of the disorders of mutated EGFR signaling networks, which could facilitate the development of a systematic strategy toward controlling disease-related cell signaling.

  2. Take it of leave it : Mechanisms underlying bacterial bistable regulatory networks

    NARCIS (Netherlands)

    Siebring, Jeroen; Sorg, Robin; Herber, Martijn; Kuipers, Oscar; Filloux, Alain A.M.

    2012-01-01

    Bistable switches occur in regulatory networks that can exist in two distinct stable states. Such networks allow distinct switching of individual cells. In bacteria these switches coexist with regulatory networks that respond gradually to environmental input. Bistable switches play key roles in high

  3. Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress

    Directory of Open Access Journals (Sweden)

    Hossain eSazzad

    2016-05-01

    Full Text Available Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g. the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH, alternative oxidase (AOX, the plastid terminal oxidase (PTOX and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants.

  4. Crosstalk between adenylyl cyclase signaling pathway and Ca2+ regulatory mechanism under red blood cell microrheological changes.

    Science.gov (United States)

    Muravyov, Alexei V; Tikhomirova, Irina A; Maimistova, Alla A; Bulaeva, Svetlana V; Zamishlayev, Andrey V; Batalova, Ekaterina A

    2010-01-01

    There are evidences that red blood cell (RBC) deformation and aggregation change under their incubation with catecholamines and it is connected with activation of intracellular signaling pathways. The present study was designed to explore the adenylyl cyclase signaling pathway and Ca2+ regulatory mechanism of RBCs together with their microrheological changes. The washed RBCs were resuspended in PBS. In each of the three research sessions RBC suspensions were divided into two aliquots: 1) control (without drug) and 2) with an appropriate drug. After cell incubation RBC deformability (RBCD) and aggregation (RBCA) were estimated. RBC incubation with catecholamines resulted in RBCD changes by 18-30%. RBCs incubation with forskolin facilitated an increase of RBCD by 17% (p RBCA; whereas red cell deformability was changed only slightly. On the other hand, Ca2+ entry blocking into the cells by verapamil has led to significant RBCA decrease and RBCD rise. The obtained results make us believe that RBCD change was closely associated with Ca2+ control mechanisms. An effect of Ca2+ concentration increase on RBC microrheology was removed, if it was preliminary added to incubation medium EGTA as Ca2+ chelator. It was found that all four PDE inhibitors: IBMX, vinpocetine, rolipram, pentoxifylline decreased RBCA significantly and, quite the contrary, they increased red cell deformability. Our data have shown that Ca2+ entry increase was accompanied by red cell aggregation rise, while adenylyl cyclase-cAMP system stimulation led to red cell deformability increase and its aggregation lowered. The crosstalk between two intracellular signaling systems is probably connected with phosphodiesterase activity.

  5. Transcriptome profiling reveals the regulatory mechanism underlying pollination dependent and parthenocarpic fruit set mainly mediated by auxin and gibberellin.

    Science.gov (United States)

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set.

  6. Transcriptome profiling reveals the regulatory mechanism underlying pollination dependent and parthenocarpic fruit set mainly mediated by auxin and gibberellin.

    Directory of Open Access Journals (Sweden)

    Ning Tang

    Full Text Available Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs. Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set.In this work, digital gene expression tag profiling (DGE technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA.This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set.

  7. Consistent Regulatory Policy under Uncertainty

    OpenAIRE

    Michael J. Brennan; Eduardo S. Schwartz

    1982-01-01

    This article is concerned with the effects of regulation on the risk and value of the regulated firm in a dynamic context. Current regulatory practice is shown to be logically deficient, since it ignores the effect of regulatory policy on the cost of capital and therefore on the appropriate allowed rate of return. A notion of consistency in regulatory policy is developed, and it is shown how consistent regulatory policies may be implemented once the valuation problem is solved.

  8. A study of bacterial gene regulatory mechanisms

    DEFF Research Database (Denmark)

    Hansen, Sabine

    the different regulatory mechanisms affect system dynamics. We have designed a synthetic gene regulatory network (GRN) in bacterial cells that enables us to study the dynamics of GRNs. The results presented in this PhD thesis show that model equations based on the established mechanisms of action of each...... of a particular type of regulatory mechanism. The synthetic system presented in this thesis is, to our knowledge, the first of its kind to allow a direct comparison of the dynamic behaviors of gene regulatory networks that employ different mechanisms of regulation. In addition to studying the dynamic behavior...... switch off the expression of unfavorable proteins. This dynamic regulation requires a coordinated effort by a network of regulatory factors. The regulatory mechanisms employed by bacterial cell to regulate their protein expression have been extensively studied. However, little is known about how...

  9. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  10. Advances in Autophagy Regulatory Mechanisms

    Directory of Open Access Journals (Sweden)

    Laura E. Gallagher

    2016-05-01

    Full Text Available Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1. Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1.

  11. Child abuse: underlying mechanisms

    OpenAIRE

    Martínez, Gladys S.

    2009-01-01

    Exposure to traumatic stress during childhood, in the form of abuse or neglect, is related to an increased vulnerability resulting in the development of several pathologies, this relation has been confi rmed by epidemiological studies; however, the neural mechanisms underlying such abnormalities are still unknown. Most of the research done has focused on the effects in the infant, and only recently it has begun to focus on the neurobiological changes in the abusive parents. In this article, I...

  12. Biomolecular Cell-Signaling Mechanisms and Dental Implants: A Review on the Regulatory Molecular Biologic Patterns Under Functional and Immediate Loading.

    Science.gov (United States)

    Romanos, Georgios E

    2016-01-01

    Bone tissue adapts its structure and mass to the stresses of mechanical loading. The purpose of this review article was to summarize recent advances on cell signaling relating to the phenomenon of bone remodeling, focused on bone ossification and healing at the interface of dental implants and bone under loading conditions. When a dental implant is placed within an osteotomy, osteocytes, osteoblasts, and osteoclasts are all present. As functional loads are imposed, the remodeling processes adapt the peri-implant bony tissues to mechanical stimuli over time and reestablish a steady state. Based on the current literature, this article demonstrates fundamental information to these remodeling processes, such as the conversion of mechanical cues to electrical or biochemical signals. Multiple intracellular signals are involved in cellular mechanotransduction; the two Wnt signaling pathways (the canonical, β-catenin-dependent and the noncanonical, β-catenin-independent Wnt pathway) are particularly significant. Knowledge of how these molecular signaling pathways are translated into intracellular signals that regulate cell behavior may provide new therapeutic approaches to enhancing osteogenesis, especially around implants with immediate function or placed in areas of poor bone quality. New knowledge about the primary cilia as an organelle and bone cellular mechanosensor is critical for endochondral ossification and proper signal transduction. Other mechanisms, such as the expression of sclerostin as a negative regulator of bone formation (due to deactivation of the Wnt receptor) and downregulation of sclerostin under loading conditions, also present new understanding of the cellular and pericellular mechanics of bone. The complexity of the cell signaling pathways and the mechanisms involved in the mechanoregulation of the bone formation provide new technologies and perspectives for mechanically induced cellular response. Future novel therapeutic approaches based on the

  13. Gene regulatory mechanisms in infected fish

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Hajiabadi, Seyed Amir Hossein Jalali; Kristensen, Lasse Bøgelund Juel

    2011-01-01

    This talk will highlight the regulatory mechanisms of gene expression especially the programmed form of mRNA decay which is known as RNA interference (RNAi) and how this and other mechanisms contribute to the regulation of genes involved in immunity. In the RNAi mechanism small double stranded RNA...... with viral hemorrhagic septicemia virus (VHSV), and a genomic upstream sequence which we believe contains their promoter. Particular transcription factor binding motifs inside this potential promoter area point to its use in dsRNA induced antiviral defence. Other sites point to a role in leukocyte...... molecules produced by the eukaryotic cell is used to program the RNA Induced Silencing Complex (RISC) for cleavage of specific mRNA transcripts and/or translational repression in the cytoplasm or even chromatin methylation in the nucleus. All processes leading to silencing of the target gene. MicroRNAs (or...

  14. Underlying mechanism of regulatory actions of diclofenac, a nonsteroidal anti-inflammatory agent, on neuronal potassium channels and firing: an experimental and theoretical study.

    Science.gov (United States)

    Huang, C W; Hung, T Y; Liao, Y K; Hsu, M C; Wu, S N

    2013-06-01

    Diclofenac (DIC), a nonsteroidal anti-inflammatory drug, is known to exert anti-nociceptive and anti-convulsant actions; however, its effects on ion currents, in neurons remain debatable. We aimed to investigate (1) potential effects of diclofenac on membrane potential and potassium currents in differentiated NSC-34 neuronal cells and dorsal root ganglion (DRG) neurons with whole-cell patch-clamp technology, and (2) firing of action potentials (APs), using a simulation model from hippocampal CA1 pyramidal neurons based on diclofenac's effects on potassium currents. In the NSC-34 cells, diclofenac exerted an inhibitory effect on delayed-rectifier K⁺ current (I(KDR)) with an IC₅₀ value of 73 μM. Diclofenac not merely inhibited the I(KDR) amplitude in response to membrane depolarization, but also accelerated the process of current inactivation. The inhibition by diclofenac of IK(DR) was not reversed by subsequent application of either naloxone. Importantly, diclofenac (300 μM) increased the amplitude of M-type K⁺ current (I)(KM)), while flupirtine (10 μM) or meclofenamic acid (10 μM) enhanced it effectively. Consistently, diclofenac (100 μM) increased the amplitude of I(KM) and diminished the I(KDR) amplitude, with a shortening of inactivation time constant in DRG neurons. Furthermore, by using the simulation modeling, we demonstrated the potential electrophysiological mechanisms underlying changes in AP firing caused by diclofenac. During the exposure to diclofenac, the actions on both I(KM) and I(KDR) could be potential mechanism through which it influences the excitability of fast-spiking neurons. Caution needs to be made in attributing the effects of diclofenac primarily to those produced by the activation of I(KM).

  15. Regulatory behaviour under threat of court reversal

    DEFF Research Database (Denmark)

    Söderberg, Magnus; Menezes, Flavio; Santolino, Miguel

    2018-01-01

    This paper investigates howregulators influence outcomes in regulated marketswhen their decisions are subject to the threat of court review.We develop a theoretical model that provides a number of behavioural implications when (i) all regulators' dislike having their decisions overturned by courts......, (ii) inexperienced regulators care more about not having their decisions overturned than experienced regulators, and (iii) experienced regulators also care about consumer surplus. The theoretical implications are tested using a database of Swedish regulatory decisions from the electricity distribution...... experience, complexity and regulatory outcomes are both statistically and economically significant. Simulations show that if those decisions that were not appealed had been appealed, then the court would have lowered the prices by 10% on average....

  16. Regulatory capital requirements and bail in mechanisms

    NARCIS (Netherlands)

    Joosen, B.P.M.; Haentjens, M.; Wessels, B.

    2015-01-01

    With the introduction of the Capital Requirements Regulation (CRR) in the European Union, the qualitative requirements for bank regulatory capital have changed. These changes aim at implementing in Europe the Basel III principles for better bank capital that is able to absorb losses of banks,

  17. The regulatory mechanisms of NG2/CSPG4 expression.

    Science.gov (United States)

    Ampofo, Emmanuel; Schmitt, Beate M; Menger, Michael D; Laschke, Matthias W

    2017-01-01

    Neuron-glial antigen 2 (NG2), also known as chondroitin sulphate proteoglycan 4 (CSPG4), is a surface type I transmembrane core proteoglycan that is crucially involved in cell survival, migration and angiogenesis. NG2 is frequently used as a marker for the identification and characterization of certain cell types, but little is known about the mechanisms regulating its expression. In this review, we provide evidence that the regulation of NG2 expression underlies inflammation and hypoxia and is mediated by methyltransferases, transcription factors, including Sp1, paired box (Pax) 3 and Egr-1, and the microRNA miR129-2. These regulatory factors crucially determine NG2-mediated cellular processes such as glial scar formation in the central nervous system (CNS) or tumor growth and metastasis. Therefore, they are potential targets for the establishment of novel NG2-based therapeutic strategies in the treatment of CNS injuries, cancer and other conditions of these types.

  18. Underlying Mechanisms Affecting Institutionalisation of ...

    African Journals Online (AJOL)

    This paper discusses the underlying causal mechanisms that enabled or constrained institutionalisation of environmental education in 12 institutions in eight countries in southern Africa. The study was carried out in the context of the Southern Africa Development Community Regional Environmental Education Support ...

  19. Underlying Mechanisms Affecting Institutionalisation of ...

    African Journals Online (AJOL)

    doctoral study and draws on critical realism as the ontological lens. Data analysis was done by means of a retroductive mode of inference, as articulated by Danermark, Ekström, Jakosben and Karlsson (2002). The paper demonstrates that there are a number of underlying causal mechanisms, which may enable or.

  20. Molecular mechanisms underlying bacterial persisters

    DEFF Research Database (Denmark)

    Maisonneuve, Etienne; Gerdes, Kenn

    2014-01-01

    All bacteria form persisters, cells that are multidrug tolerant and therefore able to survive antibiotic treatment. Due to the low frequencies of persisters in growing bacterial cultures and the complex underlying molecular mechanisms, the phenomenon has been challenging to study. However, recent...

  1. Epigenetic regulatory mechanisms associated with infertility

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Madon, Prochi F; Parikh, Firuza R

    2010-01-01

    Infertility is a complex human condition and is known to be caused by numerous factors including genetic alterations and abnormalities. Increasing evidence from studies has associated perturbed epigenetic mechanisms with spermatogenesis and infertility. However, there has been no consensus...... on whether one or a collective of these altered states is responsible for the onset of infertility. Epigenetic alterations involve changes in factors that regulate gene expression without altering the physical sequence of DNA. Understanding these altered epigenetic states at the genomic level along...... with the phenotype could further determine what possible mechanisms are involved. This paper reviews certain mechanisms of epigenetic regulation with particular emphasis on their possible role in infertility....

  2. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    Science.gov (United States)

    Lv, Ke; Qu, Lina

    Purpose: It is vital for astronauts to maintain the optimal alertness and neurobehavioral function. Among various factors that exist in the space flight and long-duration mission environment, gravity changes may probably an essential environmental factor to interfere with internal circadian rhythms homeostasis and sleep quality, but the underlying mechanism is unclear. Mammals' biological clock is controlled by the suprachiasmatic nucleus (SCN), and peripheral organs adjust their own rhythmicity with the central signals. Nevertheless the mechanism underlying this synchronizition process is still unknown. microRNAs (miRNAs) are about 19˜22nt long regulatory RNAs that serve as critical modulators of post-transcriptional gene regulation. Recently, circulating miRNAs were found to have the regulatory role between cells and peripheral tissues, besides its function inside the cells. This study aims to investigate the regulatory signal transduction role of miRNAs between SCN and peripheral biological clock effecter tissues and to further decipher the mechanism of circadian disturbance under microgravity. Method: Firstly, based on the assumption that severe alterations in the expression of genes known to be involved in circadian rhythms may affect the expression of other genes, the labeled cDNA from liver and suprachiasmatic nucleus (SCN) of clock-knockout mice and control mice in different time points were cohybridized to microarrays. The fold change exceeding 2 (FC>2) was used to identify genes with altered expression levels in the knockout mice compared with control mice. Secondly, male C57BL/6J mice at 8 weeks of age were individually caged and acclimatized to the laboratory conditions (12h light/dark cycle) before being used for continuous core body temperature and activity monitoring. The mice were individually caged and tail suspended using a strip of adhesive surgical tape attached to a chain hanging from a pulley. Peripheral blood and liver tissues collection

  3. Density-dependence as a size-independent regulatory mechanism

    NARCIS (Netherlands)

    De Vladar, H.P.

    2006-01-01

    The growth function of populations is central in biomathematics. The main dogma is the existence of density-dependence mechanisms, which can be modelled with distinct functional forms that depend on the size of the Population. One important class of regulatory functions is the theta-logistic, which

  4. Subversion of Cell Cycle Regulatory Mechanisms by HIV

    OpenAIRE

    Rice, Andrew P.; Kimata, Jason T.

    2015-01-01

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein util...

  5. Subversion of Cell Cycle Regulatory Mechanisms by HIV.

    Science.gov (United States)

    Rice, Andrew P; Kimata, Jason T

    2015-06-10

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular processes toward viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell-cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activate proviral transcription, and regulation of Cyclin T1 levels in CD4(+) T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid

    Science.gov (United States)

    2011-01-01

    Background Seed germination is a complex multi-stage developmental process, and mainly accomplished through concerted activities of many gene products and biological pathways that are often subjected to strict developmental regulation. Gibberellins (GA) and abscisic acid (ABA) are two key phytohormones regulating seed germination and seedling growth. However, transcriptional regulatory networks underlying seed germination and its associated biological pathways are largely unknown. Results The studies examined transcriptomes of barley representing six distinct and well characterized germination stages and revealed that the transcriptional regulatory program underlying barley germination was composed of early, late, and post-germination phases. Each phase was accompanied with transcriptional up-regulation of distinct biological pathways. Cell wall synthesis and regulatory components including transcription factors, signaling and post-translational modification components were specifically and transiently up-regulated in early germination phase while histone families and many metabolic pathways were up-regulated in late germination phase. Photosynthesis and seed reserve mobilization pathways were up-regulated in post-germination phase. However, stress related pathways and seed storage proteins were suppressed through the entire course of germination. A set of genes were transiently up-regulated within three hours of imbibition, and might play roles in initiating biological pathways involved in seed germination. However, highly abundant transcripts in dry barley and Arabidopsis seeds were significantly conserved. Comparison with transcriptomes of barley aleurone in response to GA and ABA identified three sets of germination responsive genes that were regulated coordinately by GA, antagonistically by ABA, and coordinately by GA but antagonistically by ABA. Major CHO metabolism, cell wall degradation and protein degradation pathways were up-regulated by both GA and seed

  7. Strategic use of incentive mechanisms as a regulatory policy tool

    Energy Technology Data Exchange (ETDEWEB)

    McDermott, K.A. (Illinois Commerce Commission, Springfield (United States)); South, D.W.; Bailey, K.A. (Argonne National Lab., IL (United States))

    1992-12-01

    In many quarters, traditional cost-plus regulation has come to be perceived as a failure. This perception is, in part, the result of a conjunction of events, changing philosophy, and measurable performance problems in the electric utility industry. Risk, competition and prudence issues will dominate the regulatory agenda in the 1990s. The experience being gained through application of alternative regulation in the telecommunications industry will have a significant impact on the willingness of regulators to experiment with new incentive approaches in the electric and natural gas industries. If the goals of a program are well specified, and if the incentive mechanism is designed in the appropriate fashion, incentives can play a major role in least-cost planning programs and in more accommodating regulatory environments. Significant attention has been given to alternative incentive programs in the electric power industry. The purpose of this paper is not to review the extensive literature on incentives, but rather to provide a nuts and bolts, common-sense analysis of the strategic value of incentive mechanisms as a regulatory policy. 14 refs., 1 fig., 2 tabs.

  8. Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination

    Science.gov (United States)

    Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)

    2014-01-01

    Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

  9. Regulatory networks in pollen development under cold stress

    Directory of Open Access Journals (Sweden)

    Kamal Dev Sharma

    2016-03-01

    Full Text Available Cold stress modifies anthers’ metabolic pathways to induce pollen sterility. Cold-tolerant plants, unlike the susceptible ones, produce high proportion of viable pollen. Anthers in susceptible plants, when exposed to cold stress, increase abscisic acid (ABA metabolism and reduce ABA catabolism. Increased ABA negatively regulates expression of tapetum cell wall bound invertase and monosaccharide transport genes resulting in distorted carbohydrate pool in anther. Cold-stress also reduces endogenous levels of the bioactive gibberellins (GAs, GA4 and GA7, in susceptible anthers by repression of the GA biosynthesis genes. Here we discuss recent findings on mechanisms of cold susceptibility in anthers which determine pollen sterility. We also discuss differences in regulatory pathways between cold-stressed anthers of susceptible and tolerant plants that decide pollen sterility or viability.

  10. Regulatory Mechanisms in the P4-ATPase Complex

    DEFF Research Database (Denmark)

    Costa, Sara

    . The functionality on the P4-ATPase complex is essential for several cellular processes, such as vesicle-mediated transport. However, the specific role of flippase activity in vesicle biogenesis and the regulatory mechanism behind this process is still poorly understood. In these studies, we identified...... as these transporters are trapped in an environment formed by their own substrate (lipids). Most lipid uptake assays use fluorescent lipid analogues in combination with flow cytometry analysis. However, flow cytometry systems are rather expensive and require extensive maintenance. Thus, we present a simple and more...

  11. Oxidative phosphorylation: unique regulatory mechanism and role in metabolic homeostasis.

    Science.gov (United States)

    Wilson, David F

    2017-03-01

    Oxidative phosphorylation is the primary source of metabolic energy, in the form of ATP, in higher plants and animals, but its regulation in vivo is not well understood. A model has been developed for oxidative phosphorylation in vivo that predicts behavior patterns that are both distinctive and consistent with experimental measurements of metabolism in intact cells and tissues. A major regulatory parameter is the energy state ([ATP]/[ADP][P i ], where brackets denote concentration). Under physiological conditions, the [ATP] and [P i ] are ~100 times that of [ADP], and most of the change in energy state is through change in [ADP]. The rate of oxidative phosphorylation ( y -axis) increases slowly with increasing [ADP] until a threshold is reached and then increases very rapidly and linearly with further increase in [ADP]. The dependence on [ADP] can be characterized by a threshold [ADP] (T) and control strength (CS), the normalized slope above threshold (Δ y /(Δ x /T). For normoxic cells without creatine kinase, T is ~30 µM and CS is ~10 s -1 Myocytes and cells with larger ranges of rates of ATP utilization, however, have the same [ADP]- and [AMP]-dependent mechanisms regulating metabolism and gene expression. To compensate, these cells have creatine kinase, and hydrolysis/synthesis of creatine phosphate increases the change in [P i ] and thereby CS. Cells with creatine kinase have [ADP] and [AMP], which are similar to cells without creatine kinase, despite the large differences in metabolic rate. 31 P measurements in human muscles during work-to-rest and rest-to-work transitions are consistent with predictions of the model. NEW & NOTEWORTHY A model developed for oxidative phosphorylation in vivo is shown to predict behavior patterns that are both novel and consistent with experimental measurements of metabolism in working muscle and other cells. The dependence of the rate on ADP concentration shows a pronounced threshold with a steep, nearly linear increase

  12. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    Science.gov (United States)

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  13. Molecular and regulatory mechanisms controlling floral organ development.

    Science.gov (United States)

    Stewart, Darragh; Graciet, Emmanuelle; Wellmer, Frank

    2016-05-01

    The genetic and molecular mechanisms that underlie the formation of angiosperm flowers have been studied extensively for nearly three decades. This work has led to detailed insights into the gene regulatory networks that control this vital developmental process in plants. Here, we review some of the key findings in the field of flower development and discuss open questions that must be addressed in order to obtain a more comprehensive understanding of flower formation. In particular, we focus on the specification of the different types of floral organs and on how the morphogenesis of these organs is controlled to give rise to mature flowers. Central to this process are the floral organ identity genes, which encode members of the family of MADS-domain transcription factors. We summarize what is currently known about the functions of these master regulators and discuss a working model for the molecular mechanism that may underlie their activities. © 2016 Federation of European Biochemical Societies.

  14. Metacognitive mechanisms underlying lucid dreaming.

    Science.gov (United States)

    Filevich, Elisa; Dresler, Martin; Brick, Timothy R; Kühn, Simone

    2015-01-21

    Lucid dreaming is a state of awareness that one is dreaming, without leaving the sleep state. Dream reports show that self-reflection and volitional control are more pronounced in lucid compared with nonlucid dreams. Mostly on these grounds, lucid dreaming has been associated with metacognition. However, the link to lucid dreaming at the neural level has not yet been explored. We sought for relationships between the neural correlates of lucid dreaming and thought monitoring. Human participants completed a questionnaire assessing lucid dreaming ability, and underwent structural and functional MRI. We split participants based on their reported dream lucidity. Participants in the high-lucidity group showed greater gray matter volume in the frontopolar cortex (BA9/10) compared with those in the low-lucidity group. Further, differences in brain structure were mirrored by differences in brain function. The BA9/10 regions identified through structural analyses showed increases in blood oxygen level-dependent signal during thought monitoring in both groups, and more strongly in the high-lucidity group. Our results reveal shared neural systems between lucid dreaming and metacognitive function, in particular in the domain of thought monitoring. This finding contributes to our understanding of the mechanisms enabling higher-order consciousness in dreams. Copyright © 2015 the authors 0270-6474/15/351082-07$15.00/0.

  15. Molecular Mechanisms Underlying Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Christian Trepo

    2009-11-01

    Full Text Available Hepatocarcinogenesis is a complex process that remains still partly understood. That might be explained by the multiplicity of etiologic factors, the genetic/epigenetic heterogeneity of tumors bulks and the ignorance of the liver cell types that give rise to tumorigenic cells that have stem cell-like properties. The DNA stress induced by hepatocyte turnover, inflammation and maybe early oncogenic pathway activation and sometimes viral factors, leads to DNA damage response which activates the key tumor suppressive checkpoints p53/p21Cip1 and p16INK4a/pRb responsible of cell cycle arrest and cellular senescence as reflected by the cirrhosis stage. Still obscure mechanisms, but maybe involving the Wnt signaling and Twist proteins, would allow pre-senescent hepatocytes to bypass senescence, acquire immortality by telomerase reactivation and get the last genetic/epigenetic hits necessary for cancerous transformation. Among some of the oncogenic pathways that might play key driving roles in hepatocarcinogenesis, c-myc and the Wnt/β-catenin signaling seem of particular interest. Finally, antiproliferative and apoptosis deficiencies involving TGF-β, Akt/PTEN, IGF2 pathways for instance are prerequisite for cancerous transformation. Of evidence, not only the transformed liver cell per se but the facilitating microenvironment is of fundamental importance for tumor bulk growth and metastasis.

  16. Innovation under Regulatory Uncertainty: Evidence from Medical Technology.

    Science.gov (United States)

    Stern, Ariel Dora

    2017-01-01

    This paper explores how the regulatory approval process affects innovation incentives in medical technologies. Prior studies have found early mover regulatory advantages for drugs. I find the opposite for medical devices, where pioneer entrants spend 34 percent (7.2 months) longer than follow-on entrants in regulatory approval. Back-of-the- envelope calculations suggest that the cost of a delay of this length is upwards of 7 percent of the total cost of bringing a new high-risk device to market. Considering potential explanations, I find that approval times are largely unrelated to technological novelty, but are meaningfully reduced by the publication of objective regulatory guidelines. Finally, I consider how the regulatory process affects small firms' market entry patterns and find that small firms are less likely to be pioneers in new device markets, a fact consistent with relatively higher costs of doing so for more financially constrained firms.

  17. Transcriptional regulatory networks underlying gene expression changes in Huntington's disease.

    Science.gov (United States)

    Ament, Seth A; Pearl, Jocelynn R; Cantle, Jeffrey P; Bragg, Robert M; Skene, Peter J; Coffey, Sydney R; Bergey, Dani E; Wheeler, Vanessa C; MacDonald, Marcy E; Baliga, Nitin S; Rosinski, Jim; Hood, Leroy E; Carroll, Jeffrey B; Price, Nathan D

    2018-03-26

    Transcriptional changes occur presymptomatically and throughout Huntington's disease (HD), motivating the study of transcriptional regulatory networks (TRNs) in HD We reconstructed a genome-scale model for the target genes of 718 transcription factors (TFs) in the mouse striatum by integrating a model of genomic binding sites with transcriptome profiling of striatal tissue from HD mouse models. We identified 48 differentially expressed TF-target gene modules associated with age- and CAG repeat length-dependent gene expression changes in Htt CAG knock-in mouse striatum and replicated many of these associations in independent transcriptomic and proteomic datasets. Thirteen of 48 of these predicted TF-target gene modules were also differentially expressed in striatal tissue from human disease. We experimentally validated a specific model prediction that SMAD3 regulates HD-related gene expression changes using chromatin immunoprecipitation and deep sequencing (ChIP-seq) of mouse striatum. We found CAG repeat length-dependent changes in the genomic occupancy of SMAD3 and confirmed our model's prediction that many SMAD3 target genes are downregulated early in HD. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  18. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    Science.gov (United States)

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-09-05

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  19. Multiple post-transcriptional regulatory mechanisms in ferritin gene expression

    International Nuclear Information System (INIS)

    Mattia, E.; Den Blaauwen, J.; Van Renswoude, J.; Ashwell, G.

    1989-01-01

    The authors have investigated the mechanisms involved in the regulation of ferritin biosynthesis in K562 human erythroleukemia cells during prolonged exposure to iron. They show that, upon addition of hemin (an efficient iron donor) to the cell culture, the rate of ferritin biosynthesis reaches a maximum after a few hours and then decreases. During a 24-hr incubation with the iron donor the concentrations of total ferritin heavy (H) and light (L) subunit mRNAs rise 2- to 5-fold and 2- to 3-fold, respectively, over the control values, while the amount of the protein increases 10- to 30-fold. The hemin-induced increment in ferritin subunit mRNA is not prevented by deferoxamine, suggesting that it is not directly mediated by chelatable iron. In vitro nuclear transcription analyses performed on nuclei isolated from control cells and cells grown in the presence of hemin indicate that the rates of synthesis of H- and L-subunit mRNAs remain constant. They conclude that iron-induced ferritin biosynthesis is governed by multiple post-transcriptional regulatory mechanisms. They propose that exposure of cells to iron leads to stabilization of ferritin mRNAs, in addition to activation and translation of stored H-and L-subunit mRNAs

  20. A conserved regulatory mechanism in bifunctional biotin protein ligases.

    Science.gov (United States)

    Wang, Jingheng; Beckett, Dorothy

    2017-08-01

    Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.

  1. Critical protein GAPDH and its regulatory mechanisms in cancer cells

    International Nuclear Information System (INIS)

    Zhang, Jin-Ying; Zhang, Fan; Hong, Chao-Qun; Giuliano, Armando E.; Cui, Xiao-Jiang; Zhou, Guang-Ji; Zhang, Guo-Jun; Cui, Yu-Kun

    2015-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism; the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death; other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modifications (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent findings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described

  2. Deciphering the Cognitive and Neural Mechanisms Underlying ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Deciphering the Cognitive and Neural Mechanisms Underlying Auditory Learning. This project seeks to understand the brain mechanisms necessary for people to learn to perceive sounds. Neural circuits and learning. The research team will test people with and without musical training to evaluate their capacity to learn ...

  3. Technical efficiency under alternative environmental regulatory regimes: The case of Dutch horticulture

    NARCIS (Netherlands)

    Vlist, van der A.J.; Withagen, C.; Folmer, H.

    2007-01-01

    We consider the performance of small and medium sized enterprises in Dutch horticulture under different environmental policy regimes across time. We address the question whether technical performance differs under these alternative regulatory regimes to test Porter's hypothesis that stricter

  4. Technical efficiency under alternative environmental regulatory regimes : The case of Dutch horticulture

    NARCIS (Netherlands)

    van der Vlist, A.; Withagen, C.; Folmer, H.

    2007-01-01

    We consider the performance of small and medium sized enterprises in Dutch horticulture under different environmental policy regimes across time. We address the question whether technical performance differs under these alternative regulatory regimes to test Porter's hypothesis that stricter

  5. The molecular mechanism and regulatory pathways of cancer stem cells

    Directory of Open Access Journals (Sweden)

    Zhen Wang

    2016-01-01

    Full Text Available Malignant cancer is among the top of the life-threatening conditions, challenging humanity for a long time. Traditional methods of cancer therapy include surgery, chemotherapy, and radiotherapy, which aim to remove/destroy cancer cells. Although theoretically very promising, none of these methods can effectively eradicate cancer, the reason for which can be attributed to our incomplete understanding of the mechanism of cancer metastasis and recurrence. In recent years, researchers have proposed the theory of cancer stem cell (CSC. CSC is a small population of tumor cells that have unlimited self-renewal ability, exhibit a strong resistance to chemotherapy and radiotherapy, and have been proved to be the core reason of cancer metastasis and recurrence. CSC theory provides a deep insight into malignant tumorigenesis that brings new hope for tumor therapy. In this paper, we intend to discuss the development of CSC theory and summarize the regulatory pathways involved in CSC origin and self-renewal, which might be of assistance in the future development of malignant cancer therapy.

  6. Posttraumatic Stress Disorder Disturbs Coronary Tone and Its Regulatory Mechanisms.

    Science.gov (United States)

    Lazuko, Svetlana S; Kuzhel, Olga P; Belyaeva, Lyudmila E; Manukhina, Eugenia B; Fred Downey, H; Tseilikman, Olga B; Komelkova, Maria V; Tseilikman, Vadim E

    2018-01-01

    Posttraumatic stress disorder (PTSD) is associated with myocardial injury, but changes in coronary regulatory mechanisms in PTSD have not been investigated. This study evaluated the effect of PTSD-inducing stress on coronary tone and its regulation by nitric oxide (NO) and voltage-gated K + channels. PTSD was induced by exposing rats to predator stress, 15 min daily for 10 days, followed by 14 stress-free days. Presence of PTSD was confirmed by the elevated plus-maze test. Coronary tone was evaluated from changes in coronary perfusion pressure of Langendorff isolated hearts. Predator stress induced significant decreases in coronary tone of isolated hearts and in blood pressure of intact rats. L-NAME, a non-selective NO synthase (NOS) inhibitor, but not S-MT, a selective iNOS inhibitor, and increased coronary tone of control rats. In PTSD rats, both L-NAME and S-MT increased coronary tone. Therefore, the stress-induced coronary vasodilation resulted from NO overproduction by both iNOS and eNOS. NOS induction was apparently due to systemic inflammation as evidenced by increased serum interleukin-1β and C-reactive protein in PTSD rats. Decreased corticosterone in PTSD rats may have contributed to inflammation and its effect on coronary tone. PTSD was also associated with voltage-gated K + channel dysfunction, which would have also reduced coronary tone.

  7. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    Directory of Open Access Journals (Sweden)

    Tatiana P. Resende

    2014-01-01

    Full Text Available All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations.

  8. The regulatory mechanism in the U.S. lessons learned

    International Nuclear Information System (INIS)

    Roberts, T.M.

    1987-01-01

    The U.S. Nuclear Regulatory Commission is responsible for the regulation of the commercial uses of nuclear power in the United States in order to protect the public health and safety. The NRC has undertaken a number of initiatives to incorporate the experience gained from the over 25 years of commercial nuclear power plant operation. These initiatives are aimed at improving the regulatory structure currently in place by providing for a more predictable and stable regulatory environment and by more efficiently and effectively focusing the activities of utilities on the safe operation of their facilities. (author)

  9. Mechanical buckling of artery under pulsatile pressure.

    Science.gov (United States)

    Liu, Qin; Han, Hai-Chao

    2012-04-30

    Tortuosity that often occurs in carotid and other arteries has been shown to be associated with high blood pressure, atherosclerosis, and other diseases. However the mechanisms of tortuosity development are not clear. Our previous studies have suggested that arteries buckling could be a possible mechanism for the initiation of tortuous shape but artery buckling under pulsatile flow condition has not been fully studied. The objectives of this study were to determine the artery critical buckling pressure under pulsatile pressure both experimentally and theoretically, and to elucidate the relationship of critical pressures under pulsatile flow, steady flow, and static pressure. We first tested the buckling pressures of porcine carotid arteries under these loading conditions, and then proposed a nonlinear elastic artery model to examine the buckling pressures under pulsatile pressure conditions. Experimental results showed that under pulsatile pressure arteries buckled when the peak pressures were approximately equal to the critical buckling pressures under static pressure. This was also confirmed by model simulations at low pulse frequencies. Our results provide an effective tool to predict artery buckling pressure under pulsatile pressure. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of Dickeya dadantii.

    Science.gov (United States)

    Zeng, Quan; Ibekwe, A Mark; Biddle, Eulandria; Yang, Ching-Hong

    2010-10-01

    The type III secretion system (T3SS) is an essential virulence factor for many bacterial pathogens. Polynucleotide phosphorylase (PNPase) is one of the major exoribonucleases in bacteria and plays important roles in mRNA degradation, tRNA processing, and small RNA (sRNA) turnover. In this study, we showed that PNPase downregulates the transcription of T3SS structural and effector genes of the phytopathogenic bacterium Dickeya dadantii. This negative regulation of T3SS by PNPase occurs by repressing the expression of hrpL, encoding a master regulator of T3SS in D. dadantii. By reducing rpoN mRNA stability, PNPase downregulates the transcription of hrpL, which leads to a reduction in T3SS gene expression. Moreover, we have found that PNPase downregulates T3SS by decreasing hrpL mRNA stability. RsmB, a regulatory sRNA, enhances hrpL mRNA stability in D. dadantii. Our results suggest that PNPase decreases the amount of functional RsmB transcripts that could result in reduction of hrpL mRNA stability. In addition, bistable gene expression (differential expression of a single gene that creates two distinct subpopulations) of hrpA, hrpN, and dspE was observed in D. dadantii under in vitro conditions. Although PNPase regulates the proportion of cells in the high state and the low state of T3SS gene expression, it appears that PNPase is not the key switch that triggers the bistable expression patterns of T3SS genes.

  11. Amorphization of ice under mechanical stresses

    Science.gov (United States)

    Bordonskii, G. S.; Krylov, S. D.

    2017-11-01

    The dielectric parameters of freshly produced freshwater ice in the microwave range are investigated. It is established that this kind of ice contains a noticeable amount of amorphous ice. Its production is associated with plastic deformation under mechanical stresses. An assessment of the dielectric-permeability change caused by amorphous ice in the state of a slowly flowing medium is given.

  12. Gas Bubble Dynamics under Mechanical Vibrations

    Science.gov (United States)

    Mohagheghian, Shahrouz; Elbing, Brian

    2017-11-01

    The scientific community has a limited understanding of the bubble dynamics under mechanical oscillations due to over simplification of Navier-Stockes equation by neglecting the shear stress tensor and not accounting for body forces when calculating the acoustic radiation force. The current work experimental investigates bubble dynamics under mechanical vibration and resulting acoustic field by measuring the bubble size and velocity using high-speed imaging. The experimental setup consists of a custom-designed shaker table, cast acrylic bubble column, compressed air injection manifold and an optical imaging system. The mechanical vibrations resulted in accelerations between 0.25 to 10 times gravitational acceleration corresponding to frequency and amplitude range of 8 - 22Hz and 1 - 10mm respectively. Throughout testing the void fraction was limited to definition of Bjerknes force in combination with Rayleigh-Plesset equation. Physical behavior of the system was capture and classified. Bubble size, velocity as well as size and spatial distribution will be presented.

  13. The beginning of a seed: regulatory mechanisms of double fertilization.

    Science.gov (United States)

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    THE LAUNCH OF SEED DEVELOPMENT IN FLOWERING PLANTS (ANGIOSPERMS) IS INITIATED BY THE PROCESS OF DOUBLE FERTILIZATION: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success.

  14. The beginning of a seed: regulatory mechanisms of double fertilization

    Directory of Open Access Journals (Sweden)

    Andrea eBleckmann

    2014-09-01

    Full Text Available The launch of seed development in flowering plants (angiosperms is initiated by the process of double fertilization: two male gametes (sperm cells fuse with two female gametes (egg and central cell to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube towards the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy to maximize their reproductive success.

  15. CD38/cADPR Signaling Pathway in Airway Disease: Regulatory Mechanisms

    Directory of Open Access Journals (Sweden)

    Deepak A. Deshpande

    2018-01-01

    Full Text Available Asthma is an inflammatory disease in which proinflammatory cytokines have a role in inducing abnormalities of airway smooth muscle function and in the development of airway hyperresponsiveness. Inflammatory cytokines alter calcium (Ca2+ signaling and contractility of airway smooth muscle, which results in nonspecific airway hyperresponsiveness to agonists. In this context, Ca2+ regulatory mechanisms in airway smooth muscle and changes in these regulatory mechanisms encompass a major component of airway hyperresponsiveness. Although dynamic Ca2+ regulation is complex, phospholipase C/inositol tris-phosphate (PLC/IP3 and CD38-cyclic ADP-ribose (CD38/cADPR are two major pathways mediating agonist-induced Ca2+ regulation in airway smooth muscle. Altered CD38 expression or enhanced cyclic ADP-ribosyl cyclase activity associated with CD38 contributes to human pathologies such as asthma, neoplasia, and neuroimmune diseases. This review is focused on investigations on the role of CD38-cyclic ADP-ribose signaling in airway smooth muscle in the context of transcriptional and posttranscriptional regulation of CD38 expression. The specific roles of transcription factors NF-kB and AP-1 in the transcriptional regulation of CD38 expression and of miRNAs miR-140-3p and miR-708 in the posttranscriptional regulation and the underlying mechanisms of such regulation are discussed.

  16. DNA under Force: Mechanics, Electrostatics, and Hydration

    Directory of Open Access Journals (Sweden)

    Jingqiang Li

    2015-02-01

    Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

  17. DMPD: The interferon regulatory factor family in host defense: mechanism of action. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17502370 The interferon regulatory factor family in host defense: mechanism of acti....html) (.csml) Show The interferon regulatory factor family in host defense: mechanism of action. PubmedID 1...7502370 Title The interferon regulatory factor family in host defense: mechanism

  18. Regulatory Mechanisms Controlling Maturation of Serotonin Neuron Identity and Function

    Directory of Open Access Journals (Sweden)

    William C. Spencer

    2017-07-01

    Full Text Available The brain serotonin (5-hydroxytryptamine; 5-HT system has been extensively studied for its role in normal physiology and behavior, as well as, neuropsychiatric disorders. The broad influence of 5-HT on brain function, is in part due to the vast connectivity pattern of 5-HT-producing neurons throughout the CNS. 5-HT neurons are born and terminally specified midway through embryogenesis, then enter a protracted period of maturation, where they functionally integrate into CNS circuitry and then are maintained throughout life. The transcriptional regulatory networks controlling progenitor cell generation and terminal specification of 5-HT neurons are relatively well-understood, yet the factors controlling 5-HT neuron maturation are only recently coming to light. In this review, we first provide an update on the regulatory network controlling 5-HT neuron development, then delve deeper into the properties and regulatory strategies governing 5-HT neuron maturation. In particular, we discuss the role of the 5-HT neuron terminal selector transcription factor (TF Pet-1 as a key regulator of 5-HT neuron maturation. Pet-1 was originally shown to positively regulate genes needed for 5-HT synthesis, reuptake and vesicular transport, hence 5-HT neuron-type transmitter identity. It has now been shown to regulate, both positively and negatively, many other categories of genes in 5-HT neurons including ion channels, GPCRs, transporters, neuropeptides, and other transcription factors. Its function as a terminal selector results in the maturation of 5-HT neuron excitability, firing characteristics, and synaptic modulation by several neurotransmitters. Furthermore, there is a temporal requirement for Pet-1 in the control of postmitotic gene expression trajectories thus indicating a direct role in 5-HT neuron maturation. Proper regulation of the maturation of cellular identity is critical for normal neuronal functioning and perturbations in the gene regulatory

  19. Regulatory components of carbon concentrating mechanisms in aquatic unicellular photosynthetic organisms.

    Science.gov (United States)

    Tomar, Vandana; Sidhu, Gurpreet Kaur; Nogia, Panchsheela; Mehrotra, Rajesh; Mehrotra, Sandhya

    2017-11-01

    This review provides an insight into the regulation of the carbon concentrating mechanisms (CCMs) in lower organisms like cyanobacteria, proteobacteria, and algae. CCMs evolved as a mechanism to concentrate CO 2 at the site of primary carboxylating enzyme Ribulose-1, 5-bisphosphate carboxylase oxygenase (Rubisco), so that the enzyme could overcome its affinity towards O 2 which leads to wasteful processes like photorespiration. A diverse set of CCMs exist in nature, i.e., carboxysomes in cyanobacteria and proteobacteria; pyrenoids in algae and diatoms, the C 4 system, and Crassulacean acid metabolism in higher plants. Prime regulators of CCM in most of the photosynthetic autotrophs belong to the LysR family of transcriptional regulators, which regulate the activity of the components of CCM depending upon the ambient CO 2 concentrations. Major targets of these regulators are carbonic anhydrase and inorganic carbon uptake systems (CO 2 and HCO 3 - transporters) whose activities are modulated either at transcriptional level or by changes in the levels of their co-regulatory metabolites. The article provides information on the localization of the CCM components as well as their function and participation in the development of an efficient CCM. Signal transduction cascades leading to activation/inactivation of inducible CCM components on perception of low/high CO 2 stimuli have also been brought into picture. A detailed study of the regulatory components can aid in identifying the unraveled aspects of these mechanisms and hence provide information on key molecules that need to be explored to further provide a clear understanding of the mechanism under study.

  20. Comparative analysis of toxicological evaluations for dermal exposure performed under two different EU regulatory frameworks

    OpenAIRE

    Westerholm, Emma; Schenk, Linda

    2014-01-01

    Dermal exposure to chemicals is highly relevant in relation to the use of cosmetic products, both in consumers and in individuals exposed occupationally. Regulatory frameworks exist within the EU to limit the dermal exposure of the general population and workers to chemicals in general, as well as to limit the use of certain substances in cosmetic products. The objective of the study was to investigate and compare toxicological evaluations of dermal exposure performed under current regulatory...

  1. Age differences in the underlying mechanisms of stereotype threat effects.

    Science.gov (United States)

    Popham, Lauren E; Hess, Thomas M

    2015-03-01

    The goals of the present study were to (a) examine whether age differences exist in the mechanisms underlying stereotype threat effects on cognitive performance and (b) examine whether emotion regulation abilities may buffer against threat effects on performance. Older and younger adults were exposed to positive or negative age-relevant stereotypes, allowing us to examine the impact of threat on regulatory focus and working memory. Self-reported emotion regulation measures were completed prior to the session. Older adults' performance under threat suggested a prevention-focused approach to the task, indexed by increased accuracy and reduced speed. The same pattern was observed in younger adults, but the effects were not as strong. Age differences emerged when examining the availability of working memory resources under threat, with young adults showing decrements, whereas older adults did not. Emotion regulation abilities moderated threat effects in young adults but not in older adults. The results provide support for the notion that stereotype threat may lead to underperformance through somewhat different pathways in older and younger adults. Future research should further examine whether the underlying reason for this age difference is rooted in age-related improvements in emotion regulation. © The Author 2013. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. QUESTIONS TO REGULATORY FRAMEWORK ACCOUNTING AND FINANCIAL STATEMENTS UNDER IFRS

    Directory of Open Access Journals (Sweden)

    V. Shvets

    2015-10-01

    Full Text Available With the system approach in article analyzes the situation and problems of legal regulation and providing accounting and financial reporting in terms of standardization and harmonization of the principles of IFRS. The evaluation of the provisions and objectives of the strategy for reform of accounting and reporting rules and the requirements of European integration processes. Analyzed and determined the degree of influence of accounting and analytical science and education for the development and implementation of new approaches to the reform process and regulation of accounting, control and audit. critical analysis of the draft amendments to the existing regulations, current views on instytutsiynist accounting under uncertainty and systemic crisis outlined organizational problems and possible solutions to methodological council of accounting.

  3. Regulatory Coherence and Standardization Mechanisms in the Trans-Pacific Partnership

    Directory of Open Access Journals (Sweden)

    Cai Phoenix X. F.

    2016-12-01

    Full Text Available This article posits a new taxonomy and framework for assessing regulatory coherence in the new generation of mega-regional, cross-cutting free trade agreements. Using the Trans-Pacific Partnership as the primary example, this article situates the rise of regulatory coherence within the current trade landscape, provides clear definitions of regulatory coherence, and argues that the real engine of regulatory coherence lies in the work of international standard setting organizations. This work has been little examined in the current literature. The article provides a detailed examination of the mechanics by which the Trans-Pacific Partnership promotes regulatory standardization and concludes with some normative implications and calls for future research.

  4. Core regulatory network motif underlies the ocellar complex patterning in Drosophila melanogaster

    Science.gov (United States)

    Aguilar-Hidalgo, D.; Lemos, M. C.; Córdoba, A.

    2015-03-01

    During organogenesis, developmental programs governed by Gene Regulatory Networks (GRN) define the functionality, size and shape of the different constituents of living organisms. Robustness, thus, is an essential characteristic that GRNs need to fulfill in order to maintain viability and reproducibility in a species. In the present work we analyze the robustness of the patterning for the ocellar complex formation in Drosophila melanogaster fly. We have systematically pruned the GRN that drives the development of this visual system to obtain the minimum pathway able to satisfy this pattern. We found that the mechanism underlying the patterning obeys to the dynamics of a 3-nodes network motif with a double negative feedback loop fed by a morphogenetic gradient that triggers the inhibition in a French flag problem fashion. A Boolean modeling of the GRN confirms robustness in the patterning mechanism showing the same result for different network complexity levels. Interestingly, the network provides a steady state solution in the interocellar part of the patterning and an oscillatory regime in the ocelli. This theoretical result predicts that the ocellar pattern may underlie oscillatory dynamics in its genetic regulation.

  5. Regulatory inspection practices for industrial safety (electrical, mechanical, material handling and conventional aspects)

    International Nuclear Information System (INIS)

    Agarwal, K.

    2017-01-01

    Regulatory Inspection (RI) of BARC facilities and projects are carried out under the guidance of BARC Safety Council (BSC) Secretariat. Basically facilities and projects have been divided into two board categories viz. radiological facilities and non-radiological facilities. The Rls of radiological facilities should be carried out under OPSRC and of non-radiological facilities under CFSRC. Periodicity of inspection shall be at least once in a year. The RI of projects is carried out under concerned DSRC. RI practices with industrial safety which includes electrical, mechanical, material handling and conventional aspect for these facilities starts with check lists. The inspection areas are prepared in the form of checklists which includes availability of approved documents, compliance status of previous RIT and various safety committee's recommendations, radiological status of facilities, prompt reporting of safety related unusual occurrences, major incident, site visit for verification of actual status of system/plant. The practices for inspection in the area of electrical safety shall include checking of maintenance procedure for all critical class IV system equipment's such as HT panel, LT panel, transformer and motors. Load testing of Class III system such as D.G. set etc. shall be carried out as technical specification surveillance schedule. Status of aviation lights, number of qualified staff, availability of qualified staff etc. shall be form of inspection

  6. Evolved Mechanisms Versus Underlying Conditional Relations

    Directory of Open Access Journals (Sweden)

    Astorga Miguel López

    2015-03-01

    Full Text Available The social contracts theory claims that, in social exchange circumstances, human reasoning is not necessarily led by logic, but by certain evolved mental mechanisms that are useful for catching offenders. An emblematic experiment carried out with the intention to prove this thesis is the first experiment described by Fiddick, Cosmides, and Tooby in their paper of 2000. Lopez Astorga has questioned that experiment claiming that its results depend on an underlying conditional logical form not taken into account by Fiddick, Cosmides, and Tooby. In this paper, I propose an explanation alternative to that of Lopez Astorga, which does not depend on logical forms and is based on the mental models theory. Thus, I conclude that this other alternative explanation is one more proof that the experiment in question does not demonstrate the fundamental thesis of the social contracts theory.

  7. Mechanisms underlying UV-induced immune suppression

    Energy Technology Data Exchange (ETDEWEB)

    Ullrich, Stephen E. [Department of Immunology, University of Texas, MD Anderson Cancer Center, South Campus Research Building 1, 7455 Fannin St., P.O. Box 301402, Houston, TX 77030-1903 (United States)]. E-mail: sullrich@mdanderson.org

    2005-04-01

    Skin cancer is the most prevalent form of human neoplasia. Estimates suggest that in excess of one million new cases of skin cancer will be diagnosed this year alone in the United States (www.cancer.org/statistics). Fortunately, because of their highly visible location, skin cancers are more rapidly diagnosed and more easily treated than other types of cancer. Be that as it may, approximately 10,000 Americans a year die from skin cancer. The cost of treating non-melanoma skin cancer is estimated to be in excess of US$ 650 million a year [J.G. Chen, A.B. Fleischer, E.D. Smith, C. Kancler, N.D. Goldman, P.M. Williford, S.R. Feldman, Cost of non-melanoma skin cancer treatment in the United States, Dermatol. Surg. 27 (2001) 1035-1038], and when melanoma is included, the estimated cost of treating skin cancer in the United States is estimated to rise to US$ 2.9 billion annually (www.cancer.org/statistics). Because the morbidity and mortality associated with skin cancer is a major public health problem, it is important to understand the mechanisms underlying skin cancer development. The primary cause of skin cancer is the ultraviolet (UV) radiation found in sunlight. In addition to its carcinogenic potential, UV radiation is also immune suppressive. In fact, data from studies with both experimental animals and biopsy proven skin cancer patients suggest that there is an association between the immune suppressive effects of UV radiation and its carcinogenic potential. The focus of this manuscript will be to review the mechanisms underlying the induction of immune suppression following UV exposure. Particular attention will be directed to the role of soluble mediators in activating immune suppression.

  8. Mechanisms underlying UV-induced immune suppression

    International Nuclear Information System (INIS)

    Ullrich, Stephen E.

    2005-01-01

    Skin cancer is the most prevalent form of human neoplasia. Estimates suggest that in excess of one million new cases of skin cancer will be diagnosed this year alone in the United States (www.cancer.org/statistics). Fortunately, because of their highly visible location, skin cancers are more rapidly diagnosed and more easily treated than other types of cancer. Be that as it may, approximately 10,000 Americans a year die from skin cancer. The cost of treating non-melanoma skin cancer is estimated to be in excess of US$ 650 million a year [J.G. Chen, A.B. Fleischer, E.D. Smith, C. Kancler, N.D. Goldman, P.M. Williford, S.R. Feldman, Cost of non-melanoma skin cancer treatment in the United States, Dermatol. Surg. 27 (2001) 1035-1038], and when melanoma is included, the estimated cost of treating skin cancer in the United States is estimated to rise to US$ 2.9 billion annually (www.cancer.org/statistics). Because the morbidity and mortality associated with skin cancer is a major public health problem, it is important to understand the mechanisms underlying skin cancer development. The primary cause of skin cancer is the ultraviolet (UV) radiation found in sunlight. In addition to its carcinogenic potential, UV radiation is also immune suppressive. In fact, data from studies with both experimental animals and biopsy proven skin cancer patients suggest that there is an association between the immune suppressive effects of UV radiation and its carcinogenic potential. The focus of this manuscript will be to review the mechanisms underlying the induction of immune suppression following UV exposure. Particular attention will be directed to the role of soluble mediators in activating immune suppression

  9. Two distinct neural mechanisms underlying indirect reciprocity.

    Science.gov (United States)

    Watanabe, Takamitsu; Takezawa, Masanori; Nakawake, Yo; Kunimatsu, Akira; Yamasue, Hidenori; Nakamura, Mitsuhiro; Miyashita, Yasushi; Masuda, Naoki

    2014-03-18

    Cooperation is a hallmark of human society. Humans often cooperate with strangers even if they will not meet each other again. This so-called indirect reciprocity enables large-scale cooperation among nonkin and can occur based on a reputation mechanism or as a succession of pay-it-forward behavior. Here, we provide the functional and anatomical neural evidence for two distinct mechanisms governing the two types of indirect reciprocity. Cooperation occurring as reputation-based reciprocity specifically recruited the precuneus, a region associated with self-centered cognition. During such cooperative behavior, the precuneus was functionally connected with the caudate, a region linking rewards to behavior. Furthermore, the precuneus of a cooperative subject had a strong resting-state functional connectivity (rsFC) with the caudate and a large gray matter volume. In contrast, pay-it-forward reciprocity recruited the anterior insula (AI), a brain region associated with affective empathy. The AI was functionally connected with the caudate during cooperation occurring as pay-it-forward reciprocity, and its gray matter volume and rsFC with the caudate predicted the tendency of such cooperation. The revealed difference is consistent with the existing results of evolutionary game theory: although reputation-based indirect reciprocity robustly evolves as a self-interested behavior in theory, pay-it-forward indirect reciprocity does not on its own. The present study provides neural mechanisms underlying indirect reciprocity and suggests that pay-it-forward reciprocity may not occur as myopic profit maximization but elicit emotional rewards.

  10. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    Science.gov (United States)

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  11. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    Science.gov (United States)

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  12. Regulatory mechanisms of viral hepatitis B and C

    Indian Academy of Sciences (India)

    Unknown

    mic residence induce the generation of reactive oxygen species (ROS), which by an unknown mechanism acti- ... play an important role in the overall regulation of HBV gene expression in a liver-specific manner (Shaul et ... the intact HCV genome in a variety of cell culture sys- tems, efficient in vitro replication has not been ...

  13. 10 CFR 30.12 - Persons using byproduct material under certain Department of Energy and Nuclear Regulatory...

    Science.gov (United States)

    2010-01-01

    ... of Energy and Nuclear Regulatory Commission contracts. 30.12 Section 30.12 Energy NUCLEAR REGULATORY... Persons using byproduct material under certain Department of Energy and Nuclear Regulatory Commission... accomplished without undue risk to the public health and safety. [40 FR 8784, Mar. 3, 1975, as amended at 43 FR...

  14. Regulatory framework and development perspectives of the mechanism of public participation in the management of Russia’s forests

    Directory of Open Access Journals (Sweden)

    Nikolay Mikhaylovich Shmatkov

    2014-03-01

    Full Text Available The article dwells on the current state of the regulatory framework of the Russian Federation and the mechanism of public participation in forest management. The examples of addressing the problems of public participation in forest management in individual regions are disclosed. The article deals with the issues concerning the provision of in-interests of the local population through the voluntary forest certification system under the FSC scheme. Recommendations on improving the mechanism of public participation in solving the forest management issues are suggested

  15. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    Science.gov (United States)

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  16. Dissociable cognitive mechanisms underlying human path integration.

    Science.gov (United States)

    Wiener, Jan M; Berthoz, Alain; Wolbers, Thomas

    2011-01-01

    Path integration is a fundamental mechanism of spatial navigation. In non-human species, it is assumed to be an online process in which a homing vector is updated continuously during an outward journey. In contrast, human path integration has been conceptualized as a configural process in which travelers store working memory representations of path segments, with the computation of a homing vector only occurring when required. To resolve this apparent discrepancy, we tested whether humans can employ different path integration strategies in the same task. Using a triangle completion paradigm, participants were instructed either to continuously update the start position during locomotion (continuous strategy) or to remember the shape of the outbound path and to calculate home vectors on basis of this representation (configural strategy). While overall homing accuracy was superior in the configural condition, participants were quicker to respond during continuous updating, strongly suggesting that homing vectors were computed online. Corroborating these findings, we observed reliable differences in head orientation during the outbound path: when participants applied the continuous updating strategy, the head deviated significantly from straight ahead in direction of the start place, which can be interpreted as a continuous motor expression of the homing vector. Head orientation-a novel online measure for path integration-can thus inform about the underlying updating mechanism already during locomotion. In addition to demonstrating that humans can employ different cognitive strategies during path integration, our two-systems view helps to resolve recent controversies regarding the role of the medial temporal lobe in human path integration.

  17. Mechanics of carbon nanotube scission under sonication.

    Science.gov (United States)

    Stegen, J

    2014-06-28

    As-produced carbon nanotubes come in bundles that must be exfoliated for practical applications in nanocomposites. Sonication not only causes the exfoliation of nanotube bundles but also unwanted scission. An understanding of how precisely sonication induces the scission and exfoliation of nanotubes will help maximising the degree of exfoliation while minimising scission. We present a theoretical study of the mechanics of carbon nanotube scission under sonicaton, based on the accepted view that it is caused by strong gradients in the fluid velocity near a transiently collapsing bubble. We calculate the length-dependent scission rate by taking the actual movement of the nanotube during the collapse of a bubble into account, allowing for the prediction of the temporal evolution of the length distribution of the nanotubes. We show that the dependence of the scission rate on the sonication settings and the nanotube properties results in non-universal, experiment-dependent scission kinetics potentially explaining the variety in experimentally observed scission kinetics. The non-universality arises from the dependence of the maximum strain rate of the fluid experienced by a nanotube on its length. The maximum strain rate that a nanotube experiences increases with decreasing distance to the bubble. As short nanotubes are dragged along more easily by the fluid flow they experience a higher maximum strain rate than longer nanotubes. This dependence of the maximum strain rate on nanotube length affects the scaling of tensile strength with terminal length. We find that the terminal length scales with tensile strength to the power of 1/1.16 instead of with an exponent of 1/2 as found when nanotube motion is neglected. Finally, we show that the mechanism we propose responsible for scission can also explain the exfoliation of carbon nanotube bundles.

  18. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    Science.gov (United States)

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium.

  19. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Rødkaer, Steven V; Færgeman, Nils J.

    2014-01-01

    steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has...... been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae....

  20. Vascular Adventitia Calcification and Its Underlying Mechanism.

    Directory of Open Access Journals (Sweden)

    Na Li

    Full Text Available Previous research on vascular calcification has mainly focused on the vascular intima and media. However, we show here that vascular calcification may also occur in the adventitia. The purpose of this work is to help elucidate the pathogenic mechanisms underlying vascular calcification. The calcified lesions were examined by Von Kossa staining in ApoE-/- mice which were fed high fat diets (HFD for 48 weeks and human subjects aged 60 years and older that had died of coronary heart disease, heart failure or acute renal failure. Explant cultured fibroblasts and smooth muscle cells (SMCswere obtained from rat adventitia and media, respectively. After calcification induction, cells were collected for Alizarin Red S staining. Calcified lesions were observed in the aorta adventitia and coronary artery adventitia of ApoE-/-mice, as well as in the aorta adventitia of human subjects examined. Explant culture of fibroblasts, the primary cell type comprising the adventitia, was successfully induced for calcification after incubation with TGF-β1 (20 ng/ml + mineralization media for 4 days, and the phenotype conversion vascular adventitia fibroblasts into myofibroblasts was identified. Culture of SMCs, which comprise only a small percentage of all cells in the adventitia, in calcifying medium for 14 days resulted in significant calcification.Vascular calcification can occur in the adventitia. Adventitia calcification may arise from the fibroblasts which were transformed into myofibroblasts or smooth muscle cells.

  1. Proteoglycans remodeling in cancer: Underlying molecular mechanisms.

    Science.gov (United States)

    Theocharis, Achilleas D; Karamanos, Nikos K

    2017-11-08

    Extracellular matrix is a highly dynamic macromolecular network. Proteoglycans are major components of extracellular matrix playing key roles in its structural organization and cell signaling contributing to the control of numerous normal and pathological processes. As multifunctional molecules, proteoglycans participate in various cell functions during morphogenesis, wound healing, inflammation and tumorigenesis. Their interactions with matrix effectors, cell surface receptors and enzymes enable them with unique properties. In malignancy, extensive remodeling of tumor stroma is associated with marked alterations in proteoglycans' expression and structural variability. Proteoglycans exert diverse functions in tumor stroma in a cell-specific and context-specific manner and they mainly contribute to the formation of a permissive provisional matrix for tumor growth affecting tissue organization, cell-cell and cell-matrix interactions and tumor cell signaling. Proteoglycans also modulate cancer cell phenotype and properties, the development of drug resistance and tumor stroma angiogenesis. This review summarizes the proteoglycans remodeling and their novel biological roles in malignancies with particular emphasis to the underlying molecular mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Dynamic regulatory on/off minimization for biological systems under internal temporal perturbations

    Directory of Open Access Journals (Sweden)

    Kleessen Sabrina

    2012-03-01

    Full Text Available Abstract Background Flux balance analysis (FBA together with its extension, dynamic FBA, have proven instrumental for analyzing the robustness and dynamics of metabolic networks by employing only the stoichiometry of the included reactions coupled with adequately chosen objective function. In addition, under the assumption of minimization of metabolic adjustment, dynamic FBA has recently been employed to analyze the transition between metabolic states. Results Here, we propose a suite of novel methods for analyzing the dynamics of (internally perturbed metabolic networks and for quantifying their robustness with limited knowledge of kinetic parameters. Following the biochemically meaningful premise that metabolite concentrations exhibit smooth temporal changes, the proposed methods rely on minimizing the significant fluctuations of metabolic profiles to predict the time-resolved metabolic state, characterized by both fluxes and concentrations. By conducting a comparative analysis with a kinetic model of the Calvin-Benson cycle and a model of plant carbohydrate metabolism, we demonstrate that the principle of regulatory on/off minimization coupled with dynamic FBA can accurately predict the changes in metabolic states. Conclusions Our methods outperform the existing dynamic FBA-based modeling alternatives, and could help in revealing the mechanisms for maintaining robustness of dynamic processes in metabolic networks over time.

  3. Mechanical behaviour of nuclear fuel under irradiation

    International Nuclear Information System (INIS)

    Guerin, Y.

    1985-01-01

    The main mechanical properties (fracture, thermal and irradiation creep) of oxide and carbide fuels are summarised and discussed. Some examples are given of the influence of these mechanical properties on the in-pile behaviour of fuel pins [fr

  4. Regulatory design for RES-E support mechanisms: Learning curves, market structure, and burden-sharing

    International Nuclear Information System (INIS)

    Batlle, C.; Pérez-Arriaga, I.J.; Zambrano-Barragán, P.

    2012-01-01

    Drawing from relevant experiences in power systems around the world, this paper offers a review of existing policy support mechanisms for RES-E, with a detailed analysis of their regulatory implications. While recent studies provide an account of current RES-E support systems, in this paper we focus on some of the impacts these mechanisms have on the overall energy market structure and its performance. Given the rising importance of RES-E in systems everywhere, these impacts should no longer be overlooked. - Highlights: ► This paper offers a critical review of RES-E support mechanisms and their regulatory implications. ► The discussion focuses on how the different schemes impact the performance of the energy markets. ► We propose to redesign of current RES-E mechanisms to optimize incentives and market performance. ► Our recommendation is also to gradually move from price-based mechanisms to auctions.

  5. Distinct Regulatory Mechanisms Govern Embryonic versus Adult Adipocyte Maturation

    Science.gov (United States)

    Wang, Qiong A.; Tao, Caroline; Jiang, Lei; Shao, Mengle; Ye, Risheng; Zhu, Yi; Gordillo, Ruth; Ali, Aktar; Lian, Yun; Holland, William L.; Gupta, Rana K.; Scherer, Philipp E.

    2015-01-01

    Pathological expansion of adipose tissue contributes to the metabolic syndrome. Distinct depots develop at various times under different physiological conditions. The transcriptional cascade mediating adipogenesis is established in vitro, and centers around a core program involving PPARγ and C/EBPα. We developed an inducible, adipocyte-specific knockout system to probe the requirement of key adipogenic transcription factors at various stages of adipogenesis in vivo. C/EBPα is essential for all white adipogenic conditions in the adult stage, such as adipose tissue regeneration, adipogenesis in muscle and unhealthy expansion of white adipose tissue during high fat feeding or due to leptin deficiency. Surprisingly, terminal embryonic adipogenesis is fully C/EBPα independent, does depend however on PPARγ; cold-induced beige adipogenesis is also C/EBPα independent. Moreover, C/EBPα is not vital for adipocyte survival in the adult stage. We reveal a surprising diversity of transcriptional signals required at different stages of adipogenesis in vivo. PMID:26280538

  6. Survival under stress: molecular mechanisms of metabolic rate ...

    African Journals Online (AJOL)

    Studies in my laboratory are analysing the molecular mechanisms and regulatory events that underlie transitions to and from hypometabolic states In systems including anoxia-tolerant turtles and molluscs, estivating snails and toads, hibernating small mammals, and freeze tolerant frogs and insects. Our newest research ...

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    Directory of Open Access Journals (Sweden)

    Paola Miyazato

    2016-06-01

    Full Text Available Human T-cell leukemia virus type 1 (HTLV-1 is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP. As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  8. Regulatory mechanisms of group distributions in a gregarious arthropod

    Science.gov (United States)

    Broly, Pierre; Mullier, Romain; Devigne, Cédric; Deneubourg, Jean-Louis

    2015-01-01

    In a patchy environment, how social animals manage conspecific and environmental cues in their choice of habitat is a leading issue for understanding their spatial distribution and their exploitation of resources. Here, we experimentally tested the effects of environmental heterogeneities (artificial shelters) and some of their characteristics (size and fragmentation) on the aggregation process of a common species of terrestrial isopod (Crustacea). One hundred individuals were introduced into three different heterogeneous set-ups and in a homogeneous set-up. In the four set-ups, the populations split into two aggregates: one large (approx. 70 individuals) and one smaller (approx. 20 individuals). These aggregates were not randomly distributed in the arena but were formed diametrically opposite from one another. The similarity of the results among the four set-ups shows that under experimental conditions, the environmental heterogeneities have a low impact on the aggregation dynamics and spatial patterns of the isopod, merely serving to increase the probability of nucleation of the larger aggregation at these points. By contrast, the regulation of aggregate sizes and the regular distribution of groups are signatures of local amplification processes, in agreement with the short-range activator and long-range inhibitor model (scale-dependent feedbacks). In other words, we show how small-scale interactions may govern large-scale spatial patterns. This experimental illustration of spatial self-organization is an important step towards comprehension of the complex game of competition among groups in social species. PMID:26715999

  9. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  10. Regulatory Design of Capacity Remuneration Mechanisms in Regional and Low-Carbon Electric Power Markets

    NARCIS (Netherlands)

    Mastropietro, P.

    2016-01-01

    Capacity remuneration mechanisms (CRMs) are “climbing” regulatory agendas in all liberalised power sectors, especially in the European Union. CRMs are introduced to improve system reliability and to minimise power shortages to an economically efficient extent. These schemes will have a central role

  11. A New Mechanism for Mendelian Dominance in Regulatory Genetic Pathways: Competitive Binding by Transcription Factors.

    Science.gov (United States)

    Porter, Adam H; Johnson, Norman A; Tulchinsky, Alexander Y

    2017-01-01

    We report a new mechanism for allelic dominance in regulatory genetic interactions that we call binding dominance. We investigated a biophysical model of gene regulation, where the fractional occupancy of a transcription factor (TF) on the cis-regulated promoter site it binds to is determined by binding energy (-ΔG) and TF dosage. Transcription and gene expression proceed when the TF is bound to the promoter. In diploids, individuals may be heterozygous at the cis-site, at the TF's coding region, or at the TF's own promoter, which determines allele-specific dosage. We find that when the TF's coding region is heterozygous, TF alleles compete for occupancy at the cis-sites and the tighter-binding TF is dominant in proportion to the difference in binding strength. When the TF's own promoter is heterozygous, the TF produced at the higher dosage is also dominant. Cis-site heterozygotes have additive expression and therefore codominant phenotypes. Binding dominance propagates to affect the expression of downstream loci and it is sensitive in both magnitude and direction to genetic background, but its detectability often attenuates. While binding dominance is inevitable at the molecular level, it is difficult to detect in the phenotype under some biophysical conditions, more so when TF dosage is high and allele-specific binding affinities are similar. A body of empirical research on the biophysics of TF binding demonstrates the plausibility of this mechanism of dominance, but studies of gene expression under competitive binding in heterozygotes in a diversity of genetic backgrounds are needed. Copyright © 2017 by the Genetics Society of America.

  12. 10 CFR 70.11 - Persons using special nuclear material under certain Department of Energy and Nuclear Regulatory...

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Persons using special nuclear material under certain Department of Energy and Nuclear Regulatory Commission contracts. 70.11 Section 70.11 Energy NUCLEAR... using special nuclear material under certain Department of Energy and Nuclear Regulatory Commission...

  13. [Neurophysiologic mechanisms of arterial hypertension under experimental chronic emotional stress].

    Science.gov (United States)

    Baumann, H; Martin, G; Urmantscheeva, T G; Degen, G; Wolter, F; Chasabova, W A; Gurk, C; Hinays, I; Läuter, J

    1976-01-01

    Neurophysiological studies were conducted with subhuman primates (macaca mulatta) in order to obtain an estimate of central nervous effects of socio-emotional stress. This was combined with continuously aggravated conditioning procedures in view of the possible significance of chronic environmental stress escalation for etiology and pathogenesis of an arterial hypertension model. Our conclusions are based on evoked potentials (EP) as integrative characteristics of cerebral information processing. The EPs were recorded by means of electrodes chronically implanted in brain structures of emotional and cardio-vascular relevance. Multivariate mathematico-statistical analyses of average EPs (AEP) provide an objective measure of stress sensibility of the individual, particularly of the effects of acute and chronic environmental stress factors upon the functional organization of the CNS. By means of a quantitative approach to AEP we were able to demonstrate a disjunction between distinct limbic and hypothalamic structures starting under stress conditions of subchronic character. We assume that the constancy of functionally antagonistic hyperactive excitation foci at diencephalic and supradiencephalic levels and their specific interaction with the equally stress related neocortical functional insufficiency constitutes a decisive pathogenetic central mechanism of neurotic behaviour. Long-term changes of amplification of external and internal afferences could be demonstrated on the basis of hypo- and hyperreactive neuroelectric functional patterns. These processes cause cerebro-visceral regulatory diseases as, e. g., a primary arterial hypertension by restriction of neocortical control and the corresponding efferent reactions for re-establishment of the dynamic homeostasis.

  14. Comparative analysis of toxicological evaluations for dermal exposure performed under two different EU regulatory frameworks.

    Science.gov (United States)

    Westerholm, Emma; Schenk, Linda

    2014-02-01

    Dermal exposure to chemicals is highly relevant in relation to the use of cosmetic products, both in consumers and in individuals exposed occupationally. Regulatory frameworks exist within the EU to limit the dermal exposure of the general population and workers to chemicals in general, as well as to limit the use of certain substances in cosmetic products. The objective of the study was to investigate and compare toxicological evaluations of dermal exposure performed under current regulatory frameworks. The publicly disseminated hazard information under the respective regulatory frameworks was compiled and compared for the five substances resorcinol, p-phenylenediamine, p-aminophenol, N-phenyl-p-phenylenediamine, and diethylene glycol monoethyl ether. A low consistency between evaluations was observed in respect to data coverage and cited dose descriptors. No systematic differences over all five substances were identified from the viewpoint of dermal hazard assessment. The critical effect and corresponding systemic effect dose descriptor was identical for two substances, differed somewhat for two other (a factor of 2-2.5). For N-phenyl-p-phenylenediamine a critical effect was only identified under REACH. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    Science.gov (United States)

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  16. Epigenetic mechanisms underlying nervous system diseases.

    Science.gov (United States)

    Qureshi, Irfan A; Mehler, Mark F

    2018-01-01

    Epigenetic mechanisms act as control systems for modulating genomic structure and activity in response to evolving profiles of cell-extrinsic, cell-cell, and cell-intrinsic signals. These dynamic processes are responsible for mediating cell- and tissue-specific gene expression and function and gene-gene and gene-environmental interactions. The major epigenetic mechanisms include DNA methylation and hydroxymethylation; histone protein posttranslational modifications, nucleosome remodeling/repositioning, and higher-order chromatin reorganization; noncoding RNA regulation; and RNA editing. These mechanisms are intimately involved in executing fundamental genomic programs, including gene transcription, posttranscriptional RNA processing and transport, translation, X-chromosome inactivation, genomic imprinting, retrotransposon regulation, DNA replication, and DNA repair and the maintenance of genomic stability. For the nervous system, epigenetics offers a novel and robust framework for explaining how brain development and aging occur, neural cellular diversity is generated, synaptic and neural network connectivity and plasticity are mediated, and complex cognitive and behavioral phenotypes are inherited transgenerationally. Epigenetic factors and processes are, not surprisingly, implicated in nervous system disease pathophysiology through several emerging paradigms - mutations and genetic variation in genes encoding epigenetic factors; impairments in epigenetic factor expression, localization, and function; epigenetic mechanisms modulating disease-associated factors and pathways; and the presence of deregulated epigenetic profiles in central and peripheral tissues. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. An investigation into the mechanism underlying enhanced ...

    African Journals Online (AJOL)

    The solubilisation of primary sewage sludge under sulphate reducing conditions was conducted in controlled flask studies and previously reported findings of enhanced hydrolysis were confirmed. The maximum percentage solubilisation obtained in this study over a 10-day period was 31% and 64% for the methanogenic ...

  18. Supersymmetric quantum mechanics under point singularities

    International Nuclear Information System (INIS)

    Uchino, Takashi; Tsutsui, Izumi

    2003-01-01

    We provide a systematic study on the possibility of supersymmetry (SUSY) for one-dimensional quantum mechanical systems consisting of a pair of lines R or intervals [-l, l] each having a point singularity. We consider the most general singularities and walls (boundaries) at x = ±l admitted quantum mechanically, using a U(2) family of parameters to specify one singularity and similarly a U(1) family of parameters to specify one wall. With these parameter freedoms, we find that for a certain subfamily the line systems acquire an N = 1 SUSY which can be enhanced to N = 4 if the parameters are further tuned, and that these SUSY are generically broken except for a special case. The interval systems, on the other hand, can accommodate N = 2 or N = 4 SUSY, broken or unbroken, and exhibit a rich variety of (degenerate) spectra. Our SUSY systems include the familiar SUSY systems with the Dirac δ(x)-potential, and hence are extensions of the known SUSY quantum mechanics to those with general point singularities and walls. The self-adjointness of the supercharge in relation to the self-adjointness of the Hamiltonian is also discussed

  19. Translating Mechanism of Regulatory Action of Tolerogenic Dendritic Cells to Monitoring Endpoints in Clinical Trials

    Directory of Open Access Journals (Sweden)

    Jessica S. Suwandi

    2017-11-01

    Full Text Available Tolerogenic dendritic cells (tolDCs have reached patients with autoimmune and inflammatory disease, at least in clinical trials. The safety of tolDCs as intervention therapy has been established, but the capacity to modulate autoimmune response in vivo remains to be demonstrated. Studies have revealed a diversity of regulatory mechanisms that tolDCs may employ in vivo. These mechanisms differ between various types of modulated tolDC. The most often foreseen action of tolDCs is through regulatory polarization of naïve T cells or activation of existing regulatory T cells, which should ultimately diminish autoimmune inflammation. Yet, selection of a target autoantigen remains critical to expedite tissue specific tolerance induction, while measuring immune modulation incited by tolDCs in vivo provides a great challenge. We will discuss the regulatory action of different types of tolDCs and the possible methods to monitor immunological efficacy endpoints for the next generation clinical trials.

  20. Polymers under mechanical stress- an NMR investigation

    Energy Technology Data Exchange (ETDEWEB)

    Boehme, Ute; Scheler, Ulrich [Leibniz Institute of Polymer Research Dresden (Germany); Xu, Bo; Leisen, Johannes; Beckham, Haskell W. [Georgia Institute of Technology, Atlanta, Georgia (United States)

    2010-07-01

    Low-field NMR using permanent magnets in Halbach arrangements permit NMR investigation without the limits present in high-field NMR. The lower field in conjunction with confined stray field permit the application of NMR, in particular relaxation NMR in a stretching apparatus and a rheometer. Crystalline and amorphous fraction of semi-crystalline polymers are distinguished by their transverse relaxation times. Upon mechanical load the relaxation times of the amorphous fraction changes as seen in in-situ measurements on polypropylene rods. During the formation of a neck the crystalline fraction becomes more prominent.

  1. Mechanisms Underlying Sex Differences in Cannabis Use.

    Science.gov (United States)

    Calakos, Katina C; Bhatt, Shivani; Foster, Dawn W; Cosgrove, Kelly P

    2017-12-01

    Cannabis is the most commonly used illicit substance worldwide. In recent decades, highly concentrated products have flooded the market, and prevalence rates have increased. Gender differences exist in cannabis use, as men have higher prevalence of both cannabis use and cannabis use disorder (CUD), while women progress more rapidly from first use to CUD. This paper reviews findings from preclinical and human studies examining the sex-specific neurobiological underpinnings of cannabis use and CUD, and associations with psychiatric symptoms. Sex differences exist in the endocannabinoid system, in cannabis exposure effects on brain structure and function, and in the co-occurrence of cannabis use with symptoms of anxiety, depression and schizophrenia. In female cannabis users, anxiety symptoms correlate with larger amygdala volume and social anxiety disorder symptoms correlate with CUD symptoms. Female cannabis users are reported to be especially vulnerable to earlier onset of schizophrenia, and mixed trends emerge in the correlation of depressive symptoms with cannabis exposure in females and males. As prevalence of cannabis use may continue to increase given the shifting policy landscape regarding marijuana laws, understanding the neurobiological mechanisms of cannabis exposure in females and males is key. Examining these mechanisms may help inform future research on sex-specific pharmacological and behavioral interventions for women and men with high-risk cannabis use, comorbid psychiatric disease, and CUD.

  2. Habitats under Mechanical and Herbicide Management Regimes

    Directory of Open Access Journals (Sweden)

    Wendy-Ann P. Isaac

    2012-01-01

    Full Text Available Commelina diffusa is a colonising species of banana orchard habitats in St. Vincent in the Windward Islands of the Caribbean. In the present study, the population dynamics of C. diffusa were investigated in response to mechanical weed management with either a rotary string trimmer or glufosinate in ruderal and banana habitats. The study focused on density and size distribution of the weed over time and their response to two weed management strategies. The population dynamics of C. diffusa differed between the two habitats. Seedling establishment appeared to be an important factor influencing the dynamics of C. diffusa in banana orchards as there was little recruitment of seeds with less flower production compared with ruderal habitats where plants produced more flowers. Plants of C. diffusa in the banana orchard habitat had a longer growth cycle. In the banana orchard habitat, the C. diffusa population was greater and the plants were shorter with mechanical management than in areas treated with glufosinate. The results suggest that it is possible to manipulate the dynamics of C. diffusa in banana orchards as there is less chance of seed recruitment. Further research is necessary to refine an IPM approach for the management of C. diffusa.

  3. Physical and chemical mechanisms underlying hematoma evolution

    International Nuclear Information System (INIS)

    Cho, K.J.; Fanders, B.L.; Smid, A.R.; McLaughlin, P.

    1986-01-01

    Angiostat, a new collagen embolic material supplied at a concentration of 35 mg/ml (Target Therapeutics, Los Angeles) was used for flow-directed hepatic artery embolization in a series of rabbits to examine its acute effects on hepatic microcirculation. Arteriograms were obtained both before and after embolization. The aorta and portal vein were perfused with two different colors of Microfil after the animals were killed,. Cleared liver specimens were examined under a dissection microscope. Extent of dearterialization, status of portal sinusoidal perfusion, and collateral formation after embolization with Angiostat were evaluated. Results will be compared with results achieved using other liquid and particulate embolic agents

  4. Environmental genotoxicity: Probing the underlying mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Shugart, L. [Oak Ridge National Lab., TN (United States); Theodorakis, C. [Tennessee Univ., Knoxville, TN (United States)

    1993-12-31

    Environmental pollution is a complex issue because of the diversity of anthropogenic agents, both chemical and physical, that have been detected and catalogued. The consequences to biota from exposure to genotoxic agents present an additional problem because of the potential for these agents to produce adverse change at the cellular and organismal levels. Past studies in genetic toxicology at the Oak Ridge National Laboratory have focused on structural damage to the DNA of environmental species that may occur after exposure to genotoxic agents and the use of this information to document exposure and to monitor remediation. In an effort to predict effects at the population, community and ecosystem levels, current studies in genetic ecotoxicology are attempting to characterize the biological mechanisms at the gene level that regulate and limit the response of an individual organism to genotoxic factors in their environment.

  5. Technical efficiency under alternative environmental regulatory regimes: The case of Dutch horticulture

    International Nuclear Information System (INIS)

    Van der Vlist, Arno J.; Withagen, Cees; Folmer, Henk

    2007-01-01

    We consider the performance of small and medium sized enterprises in Dutch horticulture under different environmental policy regimes across time. We address the question whether technical performance differs under these alternative regulatory regimes to test Porter's hypothesis that stricter environmental regulation reduces technical inefficiency. For this purpose, we use a stochastic production frontier framework allowing for inclusion of policy variables to measure the effect of alternative environmental policy regimes on firms' performance. The main result is that stricter environmental policy regimes have indeed reduced technical inefficiencies in Dutch horticulture. The estimation results indicate amongst others that the 1997 agreement on energy, nutrient and pesticides use enhances technical efficiency. Firms under the strict environmental policy regime are found to be more technically efficient than those under a lax regime, thereby supporting the claims by Porter and Van der Linde (Porter, M., Van der Linde, C., 1995. Green and Competitive: Ending the stalemate. Harvard Business Review 73, pp. 120-137) concerning Dutch horticulture. (author)

  6. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.

    Science.gov (United States)

    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine

    2018-04-01

    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  7. Toxoplasma gondii gene expression is under the control of regulatory pathways acting through chromatin structure

    Directory of Open Access Journals (Sweden)

    Bougdour A.

    2008-09-01

    Full Text Available The activity state of a gene is determined by a complex regulatory network of co-acting factors affecting the structure of the chromatin into which the gene is embedded. While significant changes of the transcriptome occur during cell differentiation in apicomplexan parasites, basic mechanisms controlling gene expression are still unknown. Recent studies support and expand the concept of the chromatin environment being key factor for the control of transcriptional activity in these lower eukaryotes organisms. Here, we review recent advances in the field of epigenetic gene regulation in Toxoplasma gondii, the model apicomplexan.

  8. Physiological mechanisms underlying animal social behaviour.

    Science.gov (United States)

    Seebacher, Frank; Krause, Jens

    2017-08-19

    Many species of animal live in groups, and the group represents the organizational level within which ecological and evolutionary processes occur. Understanding these processes, therefore, relies on knowledge of the mechanisms that permit or constrain group formation. We suggest that physiological capacities and differences in physiology between individuals modify fission-fusion dynamics. Differences between individuals in locomotor capacity and metabolism may lead to fission of groups and sorting of individuals into groups with similar physiological phenotypes. Environmental impacts such as hypoxia can influence maximum group sizes and structure in fish schools by altering access to oxygenated water. The nutritional environment determines group cohesion, and the increase in information collected by the group means that individuals should rely more on social information and form more cohesive groups in uncertain environments. Changing environmental contexts require rapid responses by individuals to maintain group coordination, which are mediated by neuroendocrine signalling systems such as nonapeptides and steroid hormones. Brain processing capacity may constrain social complexity by limiting information processing. Failure to evaluate socially relevant information correctly limits social interactions, which is seen, for example, in autism. Hence, functioning of a group relies to a large extent on the perception and appropriate processing of signals from conspecifics. Many if not all physiological systems are mechanistically linked, and therefore have synergistic effects on social behaviour. A challenge for the future lies in understanding these interactive effects, which will improve understanding of group dynamics, particularly in changing environments.This article is part of the themed issue 'Physiological determinants of social behaviour in animals'. © 2017 The Author(s).

  9. Regulatory mechanisms for absenteeism in the health sector: a systematic review of strategies and their implementation

    Science.gov (United States)

    Kisakye, Angela N; Tweheyo, Raymond; Ssengooba, Freddie; Pariyo, George W; Rutebemberwa, Elizeus; Kiwanuka, Suzanne N

    2016-01-01

    Background A systematic review was undertaken to identify regulatory mechanisms aimed at mitigating health care worker absenteeism, to describe where and how they have been implemented as well as their possible effects. The goal was to propose potential policy options for managing the problem of absenteeism among human resources for health in low- and middle-income countries. Mechanisms described in this review are at the local workplace and broader national policy level. Methods A comprehensive online search was conducted on EMBASE, CINAHL, PubMed, Google Scholar, Google, and Social Science Citation Index using MEDLINE search terms. Retrieved studies were uploaded onto reference manager and screened by two independent reviewers. Only publications in English were included. Data were extracted and synthesized according to the objectives of the review. Results Twenty six of the 4,975 published articles retrieved were included. All were from high-income countries and covered all cadres of health workers. The regulatory mechanisms and possible effects include 1) organizational-level mechanisms being reported as effective in curbing absenteeism in low- and middle-income countries (LMICs); 2) prohibition of private sector activities in LMICs offering benefits but presenting a challenge for the government to monitor the health workforce; 3) contractual changes from temporary to fixed posts having been associated with no reduction in absenteeism and not being appropriate for LMICs; 4) multifaceted work interventions being implemented in most settings; 5) the possibility of using financial and incentive regulatory mechanisms in LMICs; 6) health intervention mechanisms reducing absenteeism when integrated with exercise programs; and 7) attendance by legislation during emergencies being criticized for violating human rights in the United States and not being effective in curbing absenteeism. Conclusion Most countries have applied multiple strategies to mitigate health care

  10. Regulatory mechanisms for absenteeism in the health sector: a systematic review of strategies and their implementation.

    Science.gov (United States)

    Kisakye, Angela N; Tweheyo, Raymond; Ssengooba, Freddie; Pariyo, George W; Rutebemberwa, Elizeus; Kiwanuka, Suzanne N

    2016-01-01

    A systematic review was undertaken to identify regulatory mechanisms aimed at mitigating health care worker absenteeism, to describe where and how they have been implemented as well as their possible effects. The goal was to propose potential policy options for managing the problem of absenteeism among human resources for health in low- and middle-income countries. Mechanisms described in this review are at the local workplace and broader national policy level. A comprehensive online search was conducted on EMBASE, CINAHL, PubMed, Google Scholar, Google, and Social Science Citation Index using MEDLINE search terms. Retrieved studies were uploaded onto reference manager and screened by two independent reviewers. Only publications in English were included. Data were extracted and synthesized according to the objectives of the review. Twenty six of the 4,975 published articles retrieved were included. All were from high-income countries and covered all cadres of health workers. The regulatory mechanisms and possible effects include 1) organizational-level mechanisms being reported as effective in curbing absenteeism in low- and middle-income countries (LMICs); 2) prohibition of private sector activities in LMICs offering benefits but presenting a challenge for the government to monitor the health workforce; 3) contractual changes from temporary to fixed posts having been associated with no reduction in absenteeism and not being appropriate for LMICs; 4) multifaceted work interventions being implemented in most settings; 5) the possibility of using financial and incentive regulatory mechanisms in LMICs; 6) health intervention mechanisms reducing absenteeism when integrated with exercise programs; and 7) attendance by legislation during emergencies being criticized for violating human rights in the United States and not being effective in curbing absenteeism. Most countries have applied multiple strategies to mitigate health care worker absenteeism. The success of these

  11. Genetic and epigenetic regulatory mechanisms of the oxytocin receptor gene (OXTR) and the (clinical) implications for social behavior.

    Science.gov (United States)

    Tops, Sanne; Habel, Ute; Radke, Sina

    2018-03-12

    Oxytocin and the oxytocin receptor (OXTR) play an important role in a large variety of social behaviors. The oxytocinergic system interacts with environmental cues and is highly dependent on interindividual factors. Deficits in this system have been linked to mental disorders associated with social impairments, such as autism spectrum disorder (ASD). This review focuses on the modulation of social behavior by alterations in two domains of the oxytocinergic system. We discuss genetic and epigenetic regulatory mechanisms and alterations in these mechanisms that were found to have clinical implications for ASD. We propose possible explanations how these alterations affect the biological pathways underlying the aberrant social behavior and point out avenues for future research. We advocate the need for integration studies that combine multiple measures covering a broad range of social behaviors and link these to genetic and epigenetic profiles. Copyright © 2018. Published by Elsevier Inc.

  12. Integrative Genetic and Epigenetic Analysis Uncovers Regulatory Mechanisms of Autoimmune Disease.

    Science.gov (United States)

    Shooshtari, Parisa; Huang, Hailiang; Cotsapas, Chris

    2017-07-06

    Genome-wide association studies in autoimmune and inflammatory diseases (AID) have uncovered hundreds of loci mediating risk. These associations are preferentially located in non-coding DNA regions and in particular in tissue-specific DNase I hypersensitivity sites (DHSs). While these analyses clearly demonstrate the overall enrichment of disease risk alleles on gene regulatory regions, they are not designed to identify individual regulatory regions mediating risk or the genes under their control, and thus uncover the specific molecular events driving disease risk. To do so we have departed from standard practice by identifying regulatory regions which replicate across samples and connect them to the genes they control through robust re-analysis of public data. We find significant evidence of regulatory potential in 78/301 (26%) risk loci across nine autoimmune and inflammatory diseases, and we find that individual genes are targeted by these effects in 53/78 (68%) of these. Thus, we are able to generate testable mechanistic hypotheses of the molecular changes that drive disease risk. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  13. Evolutionary emergence of the rac3b/rfng/sgca regulatory cluster refined mechanisms for hindbrain boundaries formation.

    Science.gov (United States)

    Letelier, Joaquín; Terriente, Javier; Belzunce, Ivan; Voltes, Adria; Undurraga, Cristian Alberto; Polvillo, Rocio; Devos, Lucie; Tena, Juan J; Maeso, Ignacio; Retaux, Sylvie; Gomez-Skarmeta, José Luis; Martínez-Morales, Juan R; Pujades, Cristina

    2018-04-17

    Developmental programs often rely on parallel morphogenetic mechanisms that guarantee precise tissue architecture. While redundancy constitutes an obvious selective advantage, little is known on how novel morphogenetic mechanisms emerge during evolution. In zebrafish, rhombomeric boundaries behave as an elastic barrier, preventing cell intermingling between adjacent compartments. Here, we identify the fundamental role of the small-GTPase Rac3b in actomyosin cable assembly at hindbrain boundaries. We show that the novel rac3b / rfng / sgca regulatory cluster, which is specifically expressed at the boundaries, emerged in the Ostariophysi superorder by chromosomal rearrangement that generated new cis -regulatory interactions. By combining 4C-seq, ATAC-seq, transgenesis, and CRISPR-induced deletions, we characterized this regulatory domain, identifying hindbrain boundary-specific cis -regulatory elements. Our results suggest that the capacity of boundaries to act as an elastic mesh for segregating rhombomeric cells evolved by cooption of critical genes to a novel regulatory block, refining the mechanisms for hindbrain segmentation.

  14. Regulatory mechanisms for absenteeism in the health sector: a systematic review of strategies and their implementation

    Directory of Open Access Journals (Sweden)

    Kisakye AN

    2016-11-01

    Full Text Available Angela N Kisakye,1 Raymond Tweheyo,1 Freddie Ssengooba,1 George W Pariyo,2 Elizeus Rutebemberwa,1 Suzanne N Kiwanuka1 1Department of Health Policy Planning and Management, Makerere University School of Public Health, Kampala, Uganda; 2Department of International Health, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD, USA Background: A systematic review was undertaken to identify regulatory mechanisms aimed at mitigating health care worker absenteeism, to describe where and how they have been implemented as well as their possible effects. The goal was to propose potential policy options for managing the problem of absenteeism among human resources for health in low- and middle-income countries. Mechanisms described in this review are at the local workplace and broader national policy level. Methods: A comprehensive online search was conducted on EMBASE, CINAHL, PubMed, Google Scholar, Google, and Social Science Citation Index using MEDLINE search terms. Retrieved studies were uploaded onto reference manager and screened by two independent reviewers. Only publications in English were included. Data were extracted and synthesized according to the objectives of the review. Results: Twenty six of the 4,975 published articles retrieved were included. All were from high-income countries and covered all cadres of health workers. The regulatory mechanisms and possible effects include 1 organizational-level mechanisms being reported as effective in curbing absenteeism in low- and middle-income countries (LMICs; 2 prohibition of private sector activities in LMICs offering benefits but presenting a challenge for the government to monitor the health workforce; 3 contractual changes from temporary to fixed posts having been associated with no reduction in absenteeism and not being appropriate for LMICs; 4 multifaceted work interventions being implemented in most settings; 5 the possibility of using financial and incentive regulatory mechanisms

  15. Transcriptome analysis reveals regulatory networks underlying differential susceptibility to Botrytis cinerea in response to nitrogen availability in Solanum lycopersicum.

    Directory of Open Access Journals (Sweden)

    Andrea eVega

    2015-11-01

    Full Text Available Nitrogen (N is one of the main limiting nutrients for plant growth and crop yield. It is well documented that changes in nitrate availability, the main N source found in agricultural soils, influences a myriad of developmental programs and processes including the plant defense response. Indeed, many agronomical reports indicate that the plant N nutritional status influences their ability to respond effectively when challenged by different pathogens. However, the molecular mechanisms involved in N-modulation of plant susceptibility to pathogens are poorly characterized. In this work, we show that Solanum lycopersicum defense response to the necrotrophic fungus Botrytis cinerea is affected by plant N availability, with higher susceptibility in nitrate-limiting conditions. Global gene expression responses of tomato against B. cinerea under contrasting nitrate conditions reveals that plant primary metabolism is affected by the fungal infection regardless of N regimes. This result suggests that differential susceptibility to pathogen attack under contrasting N conditions is not only explained by a metabolic alteration. We used a systems biology approach to identify the transcriptional regulatory network implicated in plant response to the fungus infection under contrasting nitrate conditions. Interestingly, hub genes in this network are known key transcription factors involved in ethylene and jasmonic acid signaling. This result positions these hormones as key integrators of nitrate and defense against B. cinerea in tomato plants. Our results provide insights into potential crosstalk mechanisms between necrotrophic defense response and N status in plants.

  16. Rac1 in human diseases: The therapeutic potential of targeting Rac1 signaling regulatory mechanisms.

    Science.gov (United States)

    Marei, Hadir; Malliri, Angeliki

    2017-07-03

    Abnormal Rac1 signaling is linked to a number of debilitating human diseases, including cancer, cardiovascular diseases and neurodegenerative disorders. As such, Rac1 represents an attractive therapeutic target, yet the search for effective Rac1 inhibitors is still underway. Given the adverse effects associated with Rac1 signaling perturbation, cells have evolved several mechanisms to ensure the tight regulation of Rac1 signaling. Thus, characterizing these mechanisms can provide invaluable information regarding major cellular events that lead to aberrant Rac1 signaling. Importantly, this information can be utilized to further facilitate the development of effective pharmacological modulators that can restore normal Rac1 signaling. In this review, we focus on the pathological role of Rac1 signaling, highlighting the benefits and potential drawbacks of targeting Rac1 in a clinical setting. Additionally, we provide an overview of available compounds that target key Rac1 regulatory mechanisms and discuss future therapeutic avenues arising from our understanding of these mechanisms.

  17. [Regulatory Mechanisms of PD-L1 Expression and Its Role in Immune Evasion].

    Science.gov (United States)

    Kataoka, Keisuke

    2017-11-01

    Immune checkpoint blockade therapy using anti-PD-1 or anti-PD-L1 antibodies can unleash anti-tumor immunity and induce durable remission in a variety ofhuman cancers. However, the regulatory mechanisms of PD-L1 expression mediating immune evasion ofcancer cells have not been fully elucidated, including the genetic alterations causing PD-L1 overexpression. Recently, we have reported a novel genetic mechanism ofimmune evasion associated with structural variations(SVs)disrupting the 3'-untranslated region(UTR)ofthe PD-L1 gene in various malignancies, such as aggressive lymphomas and gastrointestinal cancers. Despite a heterogenous nature ofthese SVs, they are closely associated with a marked upregulation of PD-L1 expression, which augments tumor growth and escape from anti-tumor immunity. Here we present an overview of the regulatory mechanisms of PD-L1 expression in cancer cells, highlighting the genetic mechanisms of PD-L1 constitutive activation, with specific focus on PD-L1 3'-UTR disruption.

  18. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    KAUST Repository

    Yun, Kil-Young

    2010-01-25

    Background: The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach.Results: Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters.Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters.Conclusion: Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. 2010 Yun et al; licensee BioMed Central Ltd.

  19. [Regulatory mechanisms of young men heart rate during psychoemotional load accompanied by irritation with different sounds].

    Science.gov (United States)

    Nachkebiia, Dzh N; Kvachadze, I D; Tsibadze, A D

    2005-01-01

    The goal of our research was to evaluate regulatory mechanisms of young men heart rate during psychoemotional load on the background of sound irritations of different characteristics. The study was a community trial and performed by single blind method on volunteer young men (age 18-22, n=73). As a method of description of heart rate regulation mechanisms, analysis of heart rate variability was selected. Psychoemotional load was studied by Landolt rings. We observed that only high frequency sound irritation increases mistakes and reaction time during psychoemotional load. We conclude that despite of initial status of organism regulation mechanisms, during high frequency sound irritation, quality of psychoemotional functions worsens. Increasing of sympathetic effect in persons with initial sympathetic domination in vegetative nervous system is observed.

  20. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    Science.gov (United States)

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  1. Mechanisms underlying epithelium-dependent relaxation in rat bronchioles

    DEFF Research Database (Denmark)

    Kroigaard, Christel; Dalsgaard, Thomas; Simonsen, Ulf

    2010-01-01

    This study investigated the mechanisms underlying epithelium-derived hyperpolarizing factor (EpDHF)-type relaxation in rat bronchioles. Immunohistochemistry was performed, and rat bronchioles and pulmonary arteries were mounted in microvascular myographs for functional studies. An opener of small...

  2. Underlying Mechanisms of Improving Physical Activity Behavior after Rehabilitation

    NARCIS (Netherlands)

    van der Ploeg, Hidde P.; Streppel, Kitty R.M.; van der Beek, Allard J.; Woude, Luc H.V.; van Harten, Willem H.; Vollenbroek-Hutten, Miriam Marie Rosé; van Mechelen, Willem

    2008-01-01

    Background: Regular physical activity is beneficial for the health and functioning of people with a disability. Effective components of successful physical activity promotion interventions should be identified and disseminated. Purpose: To study the underlying mechanisms of the combined sport

  3. A review of human biomonitoring data used in regulatory risk assessment under Canada's Chemicals Management Program.

    Science.gov (United States)

    Zidek, Angelika; Macey, Kristin; MacKinnon, Leona; Patel, Mikin; Poddalgoda, Devika; Zhang, Yi

    2017-03-01

    As a part of the Chemicals Management Plan launched in 2006, the Government of Canada is assessing and managing, where appropriate, the potential health and ecological risks associated with approximately 4300 substances under the Canadian Environmental Protection Act (1999). Since that time, nearly 3000 substances have been assessed, with human biomonitoring (HBM) data playing an increasingly important role for some substances. Case studies are presented, including both inorganic and organic substances (i.e., selenium, triclosan, phthalates), which highlight the impact and overall role HBM has had in regulatory decision making in Canada for these three substances as well as criteria used in the application of HBM data in human health risk assessment. An overview of its limitations in terms of how and when HBM data can be applied, when assessing human health in a regulatory setting, is discussed as well as the role HBM data can play in priority setting. Crown Copyright © 2016. Published by Elsevier GmbH. All rights reserved.

  4. Stress analysis in a functionally graded disc under mechanical loads ...

    Indian Academy of Sciences (India)

    Stress analysis in a functionally graded disc under mechanical loads and a steady state temperature distribution. HASAN ÇALLIO ˘GLU. Department of Mechanical Engineering, Pamukkale University, 20070,. Denizli, Turkey e-mail: hcallioglu@pau.edu.tr. MS received 25 November 2009; revised 12 August 2010; accepted.

  5. Single-Nucleotide Mutations in Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    Directory of Open Access Journals (Sweden)

    Joshua A. Suhl

    2015-01-01

    Full Text Available Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1 , where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene.

  6. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    Science.gov (United States)

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat

    2016-01-01

    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: http://dx.doi.org/10.7554/eLife.21459.001 PMID:27996937

  7. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    Directory of Open Access Journals (Sweden)

    Wenjun eHuang

    2015-09-01

    Full Text Available Herba epimedii (Epimedium, a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs. However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated twelve structural genes and two putative transcription factors (TFs in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C and icariin decreased slightly or dramatically in two lines of E. sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1, together with a bHLH TF (EsGL3 and WD40 protein (EsTTG1, were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering and molecular breeding studies of Epimedium species.

  8. Structure-based elucidation of the regulatory mechanism for aminopeptidase activity.

    Science.gov (United States)

    Ta, Hai Minh; Bae, Sangsu; Han, Seungsu; Song, Jihyuck; Ahn, Tae Kyu; Hohng, Sungchul; Lee, Sangho; Kim, Kyeong Kyu

    2013-09-01

    The specificity of proteases for the residues in and length of substrates is key to understanding their regulatory mechanism, but little is known about length selectivity. Crystal structure analyses of the bacterial aminopeptidase PepS, combined with functional and single-molecule FRET assays, have elucidated a molecular basis for length selectivity. PepS exists in open and closed conformations. Substrates can access the binding hole in the open conformation, but catalytic competency is only achieved in the closed conformation by formation of the S1 binding pocket and proximal movement of Glu343, a general base, to the cleavage site. Hence, peptides longer than the depth of the binding hole block the transition from the open to the closed conformation, and thus length selection is a prerequisite for catalytic activation. A triple-sieve interlock mechanism is proposed featuring the coupling of length selectivity with residue specificity and active-site positioning.

  9. Regulatory RNAs and control of epigenetic mechanisms: expectations for cognition and cognitive dysfunction.

    Science.gov (United States)

    Butler, Anderson A; Webb, William M; Lubin, Farah D

    2016-01-01

    The diverse functions of noncoding RNAs (ncRNAs) can influence virtually every aspect of the transcriptional process including epigenetic regulation of genes. In the CNS, regulatory RNA networks and epigenetic mechanisms have broad relevance to gene transcription changes involved in long-term memory formation and cognition. Thus, it is becoming increasingly clear that multiple classes of ncRNAs impact neuronal development, neuroplasticity, and cognition. Currently, a large gap exists in our knowledge of how ncRNAs facilitate epigenetic processes, and how this phenomenon affects cognitive function. In this review, we discuss recent findings highlighting a provocative role for ncRNAs including lncRNAs and piRNAs in the control of epigenetic mechanisms involved in cognitive function. Furthermore, we discuss the putative roles for these ncRNAs in cognitive disorders such as schizophrenia and Alzheimer's disease.

  10. Regulatory RNAs and control of epigenetic mechanisms: expectations for cognition and cognitive dysfunction

    Science.gov (United States)

    Butler, Anderson A; Webb, William M; Lubin, Farah D

    2016-01-01

    The diverse functions of noncoding RNAs (ncRNAs) can influence virtually every aspect of the transcriptional process including epigenetic regulation of genes. In the CNS, regulatory RNA networks and epigenetic mechanisms have broad relevance to gene transcription changes involved in long-term memory formation and cognition. Thus, it is becoming increasingly clear that multiple classes of ncRNAs impact neuronal development, neuroplasticity, and cognition. Currently, a large gap exists in our knowledge of how ncRNAs facilitate epigenetic processes, and how this phenomenon affects cognitive function. In this review, we discuss recent findings highlighting a provocative role for ncRNAs including lncRNAs and piRNAs in the control of epigenetic mechanisms involved in cognitive function. Furthermore, we discuss the putative roles for these ncRNAs in cognitive disorders such as schizophrenia and Alzheimer's disease. PMID:26366811

  11. 76 FR 4602 - Declaration of Prion as a Pest Under FIFRA and Amendment of EPA's Regulatory Definition of Pests...

    Science.gov (United States)

    2011-01-26

    ... injurious to health or the environment.'' FIFRA section 2(t) defines a pest, in part, as ``* * * any other... Declaration of Prion as a Pest Under FIFRA and Amendment of EPA's Regulatory Definition of Pests To Include... declare a prion (i.e., proteinaceous infectious particle) a ``pest'' under the Federal Insecticide...

  12. Comparative proteomics of peanut gynophore development under dark and mechanical stimulation.

    Science.gov (United States)

    Sun, Yong; Wang, Qingguo; Li, Zhen; Hou, Lei; Dai, Shaojun; Liu, Wei

    2013-12-06

    Peanut (Arachis hypogaea. L) is an important leguminous crop and source of proteins and lipids. It has attracted widespread attention of researchers due to its unique growth habit of geocarpy, which is regulated by geotropism, negative phototropism, and haptotropism. However, the protein expression pattern and molecular regulatory mechanism underlying the physiological processes of peanut remain unknown. In this study, the peanut gynophores under five treatment conditions were used for proteomic analysis, including aerial growth of the gynophores, the gynophores penetrated into the soil, as well as aerial growth of the gynophores under mechanical stimulation, dark, and mechanical stimulation combined with dark. The analysis of protein abundances in peanut gynophores under these conditions were conducted using comparative proteomic approaches. A total of 27 differentially expressed proteins were identified and further classified into nine biological functional groups of stress and defense, carbohydrate and energy metabolism, metabolism, photosynthesis, cell structure, signaling, transcription, protein folding and degradation, and function unknown. By searching gene functions against peanut database, 10 genes with similar annotations were selected as corresponding changed proteins, and their variation trends in gynophores under such growth conditions were further verified using quantitative real-time PCR. Overall, the investigation will benefit to enrich our understanding of the internal mechanisms of peanut gynophore development and lay a foundation for breeding and improving crop varieties and qualities.

  13. Amount of fear extinction changes its underlying mechanisms.

    Science.gov (United States)

    An, Bobae; Kim, Jihye; Park, Kyungjoon; Lee, Sukwon; Song, Sukwoon; Choi, Sukwoo

    2017-07-03

    There has been a longstanding debate on whether original fear memory is inhibited or erased after extinction. One possibility that reconciles this uncertainty is that the inhibition and erasure mechanisms are engaged in different phases (early or late) of extinction. In this study, using single-session extinction training and its repetition (multiple-session extinction training), we investigated the inhibition and erasure mechanisms in the prefrontal cortex and amygdala of rats, where neural circuits underlying extinction reside. The inhibition mechanism was prevalent with single-session extinction training but faded when single-session extinction training was repeated. In contrast, the erasure mechanism became prevalent when single-session extinction training was repeated. Moreover, ablating the intercalated neurons of amygdala, which are responsible for maintaining extinction-induced inhibition, was no longer effective in multiple-session extinction training. We propose that the inhibition mechanism operates primarily in the early phase of extinction training, and the erasure mechanism takes over after that.

  14. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    Directory of Open Access Journals (Sweden)

    Saif Hameed

    2013-01-01

    Full Text Available Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR. Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies.

  15. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  16. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms.

    Science.gov (United States)

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-05-27

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms.DOI: http://dx.doi.org/10.7554/eLife.02200.001. Copyright © 2014, Allen et al.

  17. Mechanical Property Analysis of Circular Polymer Membrane under Uniform Pressure

    OpenAIRE

    Jianbing, Sang; Xiang, Li; Sufang, Xing; Wenjia, Wang

    2017-01-01

    Mechanical property analysis of circular hyperelastic polymer membrane under uniform pressure has been researched in this work. The polymer membrane material is assumed to be homogeneous and isotropic and incompressibility of materials has been considered. Based on the modified stain energy function from Gao and nonmomental theory of axial symmetry thin shell, finite deformation analysis of polymer membrane under uniform pressure has been proposed in current configuration and governing equati...

  18. Regulatory mechanism of endothelin receptor B in the cerebral arteries after focal cerebral ischemia

    DEFF Research Database (Denmark)

    Grell, Anne-Sofie; Thigarajah, Rushani; Edvinsson, Lars

    2014-01-01

    drug targets to restore normal cerebral artery contractile function as part of successful neuroprotective therapy. METHODS: We have employed in vitro methods on human and rat cerebral arteries to study the regulatory mechanisms and the efficacy of target selective inhibitor, Mithramycin A (MitA...... arteries. RESULTS: Increased expression of specificity protein (Sp1) was observed in human and rat cerebral arteries after organ culture, strongly correlating with the ETBR upregulation. Similar observations were made in MCAO rats. Treatment with MitA, a Sp1 specific inhibitor, significantly downregulated...... vasoconstriction in focal cerebral ischemia via MEK-ERK signaling, which is also conserved in humans. The results show that MitA can effectively be used to block ETBR mediated vasoconstriction as a supplement to an existing ischemic stroke therapy....

  19. Emotional responses to music: the need to consider underlying mechanisms.

    Science.gov (United States)

    Juslin, Patrik N; Västfjäll, Daniel

    2008-10-01

    Research indicates that people value music primarily because of the emotions it evokes. Yet, the notion of musical emotions remains controversial, and researchers have so far been unable to offer a satisfactory account of such emotions. We argue that the study of musical emotions has suffered from a neglect of underlying mechanisms. Specifically, researchers have studied musical emotions without regard to how they were evoked, or have assumed that the emotions must be based on the "default" mechanism for emotion induction, a cognitive appraisal. Here, we present a novel theoretical framework featuring six additional mechanisms through which music listening may induce emotions: (1) brain stem reflexes, (2) evaluative conditioning, (3) emotional contagion, (4) visual imagery, (5) episodic memory, and (6) musical expectancy. We propose that these mechanisms differ regarding such characteristics as their information focus, ontogenetic development, key brain regions, cultural impact, induction speed, degree of volitional influence, modularity, and dependence on musical structure. By synthesizing theory and findings from different domains, we are able to provide the first set of hypotheses that can help researchers to distinguish among the mechanisms. We show that failure to control for the underlying mechanism may lead to inconsistent or non-interpretable findings. Thus, we argue that the new framework may guide future research and help to resolve previous disagreements in the field. We conclude that music evokes emotions through mechanisms that are not unique to music, and that the study of musical emotions could benefit the emotion field as a whole by providing novel paradigms for emotion induction.

  20. Human and mouse switch-like genes share common transcriptional regulatory mechanisms for bimodality

    Directory of Open Access Journals (Sweden)

    Tozeren Aydin

    2008-12-01

    Full Text Available Abstract Background Gene expression is controlled over a wide range at the transcript level through complex interplay between DNA and regulatory proteins, resulting in profiles of gene expression that can be represented as normal, graded, and bimodal (switch-like distributions. We have previously performed genome-scale identification and annotation of genes with switch-like expression at the transcript level in mouse, using large microarray datasets for healthy tissue, in order to study the cellular pathways and regulatory mechanisms involving this class of genes. We showed that a large population of bimodal mouse genes encoding for cell membrane and extracellular matrix proteins is involved in communication pathways. This study expands on previous results by annotating human bimodal genes, investigating their correspondence to bimodality in mouse orthologs and exploring possible regulatory mechanisms that contribute to bimodality in gene expression in human and mouse. Results Fourteen percent of the human genes on the HGU133A array (1847 out of 13076 were identified as bimodal or switch-like. More than 40% were found to have bimodal mouse orthologs. KEGG pathways enriched for bimodal genes included ECM-receptor interaction, focal adhesion, and tight junction, showing strong similarity to the results obtained in mouse. Tissue-specific modes of expression of bimodal genes among brain, heart, and skeletal muscle were common between human and mouse. Promoter analysis revealed a higher than average number of transcription start sites per gene within the set of bimodal genes. Moreover, the bimodal gene set had differentially methylated histones compared to the set of the remaining genes in the genome. Conclusion The fact that bimodal genes were enriched within the cell membrane and extracellular environment make these genes as candidates for biomarkers for tissue specificity. The commonality of the important roles bimodal genes play in tissue

  1. Study on Mechanical Properties of Barite Concrete under Impact Load

    Science.gov (United States)

    Chen, Z. F.; Cheng, K.; Wu, D.; Gan, Y. C.; Tao, Q. W.

    2018-03-01

    In order to research the mechanical properties of Barite concrete under impact load, a group of concrete compression tests was carried out under the impact load by using the drop test machine. A high-speed camera was used to record the failure process of the specimen during the impact process. The test results show that:with the increase of drop height, the loading rate, the peak load, the strain under peak load, the strain rate and the dynamic increase factor (DIF) all increase gradually. The ultimate tensile strain is close to each other, and the time of impact force decreases significantly, showing significant strain rate effect.

  2. Damage mechanisms in PBT-GF30 under thermo-mechanical cyclic loading

    International Nuclear Information System (INIS)

    Schaaf, A.; De Monte, M.; Hoffmann, C.; Vormwald, M.; Quaresimin, M.

    2014-01-01

    The scope of this paper is the investigation of damage mechanisms at microscopic scale on a short glass fiber reinforced polybutylene terephthalate (PBT-GF30) under thermo-mechanical cyclic loading. In addition the principal mechanisms are verified through micro mechanical FE models. In order to investigate the fatigue behavior of the material both isothermal strain controlled fatigue (ISCF) tests at three different temperatures and thermo-mechanical fatigue (TMF) tests were conducted on plain and notched specimens, manufactured by injection molding. The goal of the work is to determine the damage mechanisms occurring under TMF conditions and to compare them with the mechanisms occurring under ISCF. For this reason fracture surfaces of TMF and ISCF samples loaded at different temperature levels were analyzed using scanning electron microscopy. Furthermore, specimens that failed under TMF were examined on microsections revealing insight into both crack initiation and crack propagation. The findings of this investigation give valuable information about the main damage mechanisms of PBT-GF30 under TMF loading and serve as basis for the development of a TMF life estimation methodology

  3. Neural Circuitry and Plasticity Mechanisms Underlying Delay Eyeblink Conditioning

    Science.gov (United States)

    Freeman, John H.; Steinmetz, Adam B.

    2011-01-01

    Pavlovian eyeblink conditioning has been used extensively as a model system for examining the neural mechanisms underlying associative learning. Delay eyeblink conditioning depends on the intermediate cerebellum ipsilateral to the conditioned eye. Evidence favors a two-site plasticity model within the cerebellum with long-term depression of…

  4. Metabolic and regulatory rearrangements underlying glycerol metabolism in Pseudomonas putida KT2440.

    Science.gov (United States)

    Nikel, Pablo I; Kim, Juhyun; de Lorenzo, Víctor

    2014-01-01

    While the natural niches of the soil bacterium Pseudomonas putida are unlikely to include significant amounts of free glycerol as a growth substrate, this bacterium is genetically equipped with the functions required for its metabolism. We have resorted to deep sequencing of the transcripts in glycerol-grown P. putida KT2440 cells to gain an insight into the biochemical and regulatory components involved in the shift between customary C sources (e.g. glucose or succinate) to the polyol. Transcriptomic results were contrasted with key enzymatic activities under the same culture conditions. Cognate expression profiles revealed that genes encoding enzymes of the Entner-Doudoroff route and other catabolic pathways, e.g. the gluconate and 2-ketogluconate loops, were significantly downregulated on glycerol. Yet, the compound simultaneously elicited a gluconeogenic response that indicated an efficient channelling of C skeletons back to biomass build-up through the glyoxylate shunt rather than energization of the cells through downwards pathways, i.e. tricarboxylic acid cycle and oxidative phosphorylation. The simultaneous glycolytic and gluconeogenic metabolic regimes on glycerol, paradoxical as they seem, make sense from an ecological point of view by favouring prevalence versus exploration. This metabolic situation was accompanied by a considerably low expression of stress markers as compared with other C sources. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Brainstem mechanisms underlying the cough reflex and its regulation.

    Science.gov (United States)

    Mutolo, Donatella

    2017-09-01

    Cough is a very important airway protective reflex. Cough-related inputs are conveyed to the caudal nucleus tractus solitarii (cNTS) that projects to the brainstem respiratory network. The latter is reconfigured to generate the cough motor pattern. A high degree of modulation is exerted on second-order neurons and the brainstem respiratory network by sensory inputs and higher brain areas. Two medullary structures proved to have key functions in cough production and to be strategic sites of action for centrally active drugs: the cNTS and the caudal ventral respiratory group (cVRG). Drugs microinjected into these medullary structures caused downregulation or upregulation of the cough reflex. The results suggest that inhibition and disinhibition are prominent regulatory mechanisms of this reflex and that both the cNTS and the cVRG are essential in the generation of the entire cough motor pattern. Studies on the basic neural mechanisms subserving the cough reflex may provide hints for novel therapeutic approaches. Different proposals for further investigations are advanced. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. 75 FR 38958 - Declaration of Prion as a Pest under FIFRA and Amendment of EPA's Regulatory Definition of Pests...

    Science.gov (United States)

    2010-07-07

    ... Prion as a Pest under FIFRA and Amendment of EPA's Regulatory Definition of Pests to Include Prion... Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA). The draft rule proposes to declare a prion (i... Rodenticide Act (FIFRA), so a product intended to reduce the infectivity of any prion on inanimate surfaces (i...

  7. Independent regulatory control and monitoring of the environment at the uranium legacy sites under reclamation

    International Nuclear Information System (INIS)

    Shandala, N.K.; Titov, A.V.; Kiselev, S.M.; Isaev, D.V.; Aladova, R.A.

    2012-01-01

    Full text: Radiation safety at areas affected by the natural uranium mining and milling facilities is very important for the environment protection and human health. For this purpose the close operator-regulator contact is required during remedial operations. One of the key mechanisms of the operating regulatory supervision of radiation safety at uranium legacy sites is organization of independent radiation control and monitoring in the course of reclamation and after its completion. The main stages of this strategy include: detailed radiation survey at the area and in the vicinity of the former uranium mining sites; threat assessment in order to identify the regulatory priorities; environmental radiation control and monitoring. Tailings and shallow disposal sites of the uranium mining wastes are the most critical areas in terms of potential hazard for the environment. Tailings are the source of contamination of the near-land air due to the radionuclide dust resuspension from the tailing surface; surface and ground water due to washing out from by precipitation and surface streams of toxic and radioactive elements. Frequently, contamination of surface and ground waters results in some problems, especially when using the leaching fluids for the solution mining and draining hydraulic fluids. Radiation risk for the residents of areas near not operating uranium mining and milling facilities depends on the following factors: radon exhalation from the surface of dumps and tailing; radioactive dust transfer; using radioactive material in building; contamination of surface water streams and aquifers used for drinking water supply; contamination of open ponds used for fish breeding and catching; contamination of foodstuffs grown in the nuclear legacy areas. Radiation monitoring is necessary for the up-to-date response to changing radiation situation during reclamation and arrangement of adequate countermeasures. We mean here comprehensive dynamic surveillance including long

  8. Just-in-Time Control of Spo0A Synthesis in Bacillus subtilis by Multiple Regulatory Mechanisms ▿ §

    Science.gov (United States)

    Chastanet, Arnaud; Losick, Richard

    2011-01-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σA-recognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O1, O2, O3, and O4 in reverse order of their proximity to the coding sequence. Here we report that O1 is responsible for repressing Pv during the transition to stationary phase, that O2 is responsible for repressing Ps during growth, that O3 is responsible for activating Ps at the start of sporulation, and that O4 is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from Pv is impeded due to RNA secondary structure whereas mRNAs originating from Ps are fully competent for protein synthesis. We propose that the opposing actions of O2 and O3 and the enhanced translatability of mRNAs originating from Ps create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation. PMID:21949067

  9. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    Science.gov (United States)

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  10. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    Directory of Open Access Journals (Sweden)

    Li Junlin

    2013-02-01

    Full Text Available Abstract Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd, which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX, Williams syndrome (WS, Rett syndrome and Rubinstein-Taybi syndrome (RTS. A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders.

  11. Regulatory mechanism and research progress of connective tissue growth factor in diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Xi-Da Liang

    2016-04-01

    Full Text Available Diabetic retinopathy is one of the microvascular abnormal diseases. In the late stage of disease progression, the antibody of vascular endothelial growth factor can significantly inhibit the formation of new blood vessels and improve macular edema, which is widely used in clinical. However, the aggravation of pro-fibrotic influence after long-term treated by the medicine also attracts a wide range of attention. Connective tissue growth factor, as an important cytokine in intraocular fibrosis, over expressed after treated by the drug, is considered to be one of the most important factors in the side effect of the drug, and is also a potential therapeutic target. After finishing the current research, the regulation mechanism of connective tissue growth factor, includes two ways, regulation of gene expression and direct binding to other cell factors or receptors. Because of its special four module structure, it has many kinds of cell factor specific binding sites, and its regulation mode is more dependent on the latter, which promotes or inhibits the expression of several important cytokine pathways. In diabetic retinopathy, its expression goes throughout the disease process. The accumulation of connective tissue growth factor plays an important role in promoting the thickening of basement membrane and the formation of new blood vessels in the early stage of the clinical stage and the formation of the new blood vessels. In this paper, the regulatory mechanism of connective tissue growth factor and the research progress of this factor in DR are systematically expounded.

  12. Regulatory Mechanisms of the Ihh/PTHrP Signaling Pathway in Fibrochondrocytes in Entheses of Pig Achilles Tendon

    Directory of Open Access Journals (Sweden)

    Xuesong Han

    2016-01-01

    Full Text Available This study is aimed at exploring the effect of stress stimulation on the proliferation and differentiation of fibrochondrocytes in entheses mediated via the Indian hedgehog (Ihh/parathyroid hormone-related protein (PTHrP signaling pathway. Differential stress stimulation on fibrochondrocytes in entheses was imposed. Gene expression and protein levels of signaling molecules including collagen type I (Col I, Col II, Col X, Ihh, and PTHrP in the cytoplasm of fibrochondrocytes were detected. Ihh signal blocking group was set up using Ihh signaling pathway-specific blocking agent cyclopamine. PTHrP enhancement group was set up using PTHrP reagent. Ihh/PTHrP double intervention group, as well as control group, was included to study the regulatory mechanisms of the Ihh/PTHrP signaling pathway in fibrochondrocytes. Under low cyclic stress tensile (CTS, PTHrP, Col I, and Col II gene expression and protein synthesis increased. Under high CTS, Ihh and Col X gene expression and protein synthesis increased. Blocking Ihh signaling with cyclopamine resulted in reduced PTHrP gene expression and protein synthesis and increased Col X gene expression and protein synthesis. Ihh and PTHrP coregulate fibrochondrocyte proliferation and differentiation in entheses through negative feedback regulation. Fibrochondrocyte is affected by the CTS. This phenomenon is regulated by stress stimulation through the Ihh/PTHrP signaling pathway.

  13. A possible realization of Einstein's causal theory underlying quantum mechanics

    International Nuclear Information System (INIS)

    Yussouff, M.

    1979-06-01

    It is shown that a new microscopic mechanics formulated earlier can be looked upon as a possible causal theory underlying quantum mechanics, which removes Einstein's famous objections against quantum theory. This approach is free from objections raised against Bohm's hidden variable theory and leads to a clear physical picture in terms of familiar concepts, if self interactions are held responsible for deviations from classical behaviour. The new level of physics unfolded by this approach may reveal novel frontiers in high-energy physics. (author)

  14. Permeability and mechanical properties of cracked glass under pressure

    International Nuclear Information System (INIS)

    Ougier-Simonin, A.

    2010-01-01

    Crack initiation and growth in brittle solids under tension have been extensively studied by various experimental, theoretical and numerical approaches. If has been established that dynamic brittle fracture is related to fundamental physical parameters and processes, such as crack speed, crack branching, surface roughening, and dynamic instabilities. On the other hand, less studies have been done in the area of compressive fracture despite its vital importance in geology, material science and engineering applications (such as the improvement and the insurance of the nuclear wastes storage). The present work aims to investigate thermo-mechanical cracking effects on elastic wave velocities, mechanical strength and permeability und r pressure to evaluate damage evolution, brittle failure and transport properties on a synthetic glass (SON 68), and to highlight the very different behavior of the glass amorphous structure compared to any rock structure. The original glass, produced in ideal conditions of slow cooling that prevent from any crack formation, exhibits a linear and reversible mechanical behavior and isotropic elastic velocities, as expected. It also presents a high strength as it fails at about 700 MPa of deviatoric stress for a confining pressure of 15 MPa. We choose to apply to some original glass samples a reproducible method (thermal treatment with a thermal shock of T=100,200 and 300 C) which creates cracks with a homogeneous distribution. The impact of the thermal treatment is clearly visible through the elastic wave velocity measurements as we observe crack closure under hydrostatic conditions (at about 30 MPa). For T ≥ 200 C, the glass mechanical behavior becomes non linear and records an irreversible damage. The total damage observed with the acoustic emissions in these samples underlines the combination of the thermal and the mechanical cracks which drive to the sample failure. The results obtained with pore fluid pressure show a very small

  15. 76 FR 38328 - Reducing Regulatory Burden; Retrospective Review Under E.O. 13563

    Science.gov (United States)

    2011-06-30

    ... for businesses and the public. Section 6 of the Executive Order focuses on the importance of maintaining a consistent culture of retrospective review and analysis by agencies of their regulatory programs... 38330

  16. An iterative genetic and dynamical modelling approach identifies novel features of the gene regulatory network underlying melanocyte development.

    Science.gov (United States)

    Greenhill, Emma R; Rocco, Andrea; Vibert, Laura; Nikaido, Masataka; Kelsh, Robert N

    2011-09-01

    The mechanisms generating stably differentiated cell-types from multipotent precursors are key to understanding normal development and have implications for treatment of cancer and the therapeutic use of stem cells. Pigment cells are a major derivative of neural crest stem cells and a key model cell-type for our understanding of the genetics of cell differentiation. Several factors driving melanocyte fate specification have been identified, including the transcription factor and master regulator of melanocyte development, Mitf, and Wnt signalling and the multipotency and fate specification factor, Sox10, which drive mitf expression. While these factors together drive multipotent neural crest cells to become specified melanoblasts, the mechanisms stabilising melanocyte differentiation remain unclear. Furthermore, there is controversy over whether Sox10 has an ongoing role in melanocyte differentiation. Here we use zebrafish to explore in vivo the gene regulatory network (GRN) underlying melanocyte specification and differentiation. We use an iterative process of mathematical modelling and experimental observation to explore methodically the core melanocyte GRN we have defined. We show that Sox10 is not required for ongoing differentiation and expression is downregulated in differentiating cells, in response to Mitfa and Hdac1. Unexpectedly, we find that Sox10 represses Mitf-dependent expression of melanocyte differentiation genes. Our systems biology approach allowed us to predict two novel features of the melanocyte GRN, which we then validate experimentally. Specifically, we show that maintenance of mitfa expression is Mitfa-dependent, and identify Sox9b as providing an Mitfa-independent input to melanocyte differentiation. Our data supports our previous suggestion that Sox10 only functions transiently in regulation of mitfa and cannot be responsible for long-term maintenance of mitfa expression; indeed, Sox10 is likely to slow melanocyte differentiation in the

  17. Frictional behaviour of polymer films under mechanical and electrostatic loads

    International Nuclear Information System (INIS)

    Ginés, R; Christen, R; Motavalli, M; Bergamini, A; Ermanni, P

    2013-01-01

    Different polymer foils, namely polyimide, FEP, PFA and PVDF were tested on a setup designed to measure the static coefficient of friction between them. The setup was designed according to the requirements of a damping device based on electrostatically tunable friction. The foils were tested under different mechanically applied forces and showed reproducible results for the static coefficient of friction. With the same setup the measurements were performed under an electric field as the source of the normal force. Up to a certain electric field the values were in good agreement. Beyond this field discrepancies were found. (paper)

  18. Building hospital capacity planning mechanisms in Poland: The impact of 2016/2017 regulatory changes.

    Science.gov (United States)

    Dubas-Jakóbczyk, Katarzyna; Sowada, Christoph; Domagała, Alicja; Więckowska, Barbara

    2018-02-07

    Capacity planning is a crucial component of modern health care governance. The aim of this paper is to analyze the requirements that need to be met to build effective hospital capacity planning mechanisms in Poland. In this context, the recent regulatory changes strongly influencing hospital sector functioning, including introduction of health care needs maps, capital investment assessment, and hospital network regulations, are analyzed. Some possible ways forward, based on review of international experiences in hospital capacity planning, are discussed. Applied methods include literature review and analysis of statistical data as well as desk analysis of key national regulations related to hospital sector. Results indicate that at the system level, the process of capacity planning involves 4 elements: capital investment in facilities, equipment, and technology; service delivery; allocation of staff; and financial resources. For hospital capacity planning to be effective, the strategic decision at the macrolevel must be complemented by appropriate management of individual hospitals. The major challenge of building hospital capacity planning mechanism in Poland is imbedding it into the overall health system strategy. Because of the lack of such a strategy, the practical implementation of the ad hoc changes, which have been introduced, shows some inconsistencies. The regulations implemented between 2016 and 2017 provided a basis for hospital capacity planning, yet still need evaluation and adjustments. Also, including a mechanism for human resources planning is of crucial importance. The regulations should provide incentives for reducing oversized hospital infrastructure with simultaneous development of the long-term and coordinated care models. Copyright © 2018 John Wiley & Sons, Ltd.

  19. Functional Development of the Human Gastrointestinal Tract: Hormone- and Growth Factor-Mediated Regulatory Mechanisms

    Directory of Open Access Journals (Sweden)

    Daniel Ménard

    2004-01-01

    Full Text Available The present review focuses on the control of gastrointestinal (GI tract development. The first section addresses the differences in general mechanisms of GI development in humans versus rodents, highlighting that morphogenesis of specific digestive organs and the differentiation of digestive epithelia occur not only at different stages of ontogeny but also at different rates. The second section provides an overview of studies from the author's laboratory at the Université de Sherbrooke pertaining to the development of the human fetal small intestine and colon. While both segments share similar morphological and functional characteristics, they are nevertheless modulated by distinct regulatory mechanisms. Using the organ culture approach, the author and colleagues were able to establish that hormones and growth factors, such as glucocorticoids, epidermal growth factor, insulin and keratinocyte growth factor, not only exert differential effects within these two segments, they can also trigger opposite responses in comparison with animal models. In the third section, emphasis is placed on the functional development of human fetal stomach and its various epithelial cell types; in particular, the glandular chief cells responsible for the synthesis and secretion of gastric enzymes such as pepsinogen-5 and gastric lipase. Bearing in mind that limitations of available cell models have, until now, greatly impeded the comprehension of molecular mechanisms regulating human gastric epithelial cell functions, the last section focuses on new human gastric epithelial cell models recently developed in the author's laboratory. These models comprise a novel primary culture system of human fetal gastric epithelium including, for the first time, functional chief cells, and human gastric epithelium cell lines cloned from the parental NCI-N87 strain. These new cells lines could serve important applications in the study of pathogenic action and epithelial

  20. Reliability Issues and Solutions in Flexible Electronics Under Mechanical Fatigue

    Science.gov (United States)

    Yi, Seol-Min; Choi, In-Suk; Kim, Byoung-Joon; Joo, Young-Chang

    2018-03-01

    Flexible devices are of significant interest due to their potential expansion of the application of smart devices into various fields, such as energy harvesting, biological applications and consumer electronics. Due to the mechanically dynamic operations of flexible electronics, their mechanical reliability must be thoroughly investigated to understand their failure mechanisms and lifetimes. Reliability issue caused by bending fatigue, one of the typical operational limitations of flexible electronics, has been studied using various test methodologies; however, electromechanical evaluations which are essential to assess the reliability of electronic devices for flexible applications had not been investigated because the testing method was not established. By employing the in situ bending fatigue test, we has studied the failure mechanism for various conditions and parameters, such as bending strain, fatigue area, film thickness, and lateral dimensions. Moreover, various methods for improving the bending reliability have been developed based on the failure mechanism. Nanostructures such as holes, pores, wires and composites of nanoparticles and nanotubes have been suggested for better reliability. Flexible devices were also investigated to find the potential failures initiated by complex structures under bending fatigue strain. In this review, the recent advances in test methodology, mechanism studies, and practical applications are introduced. Additionally, perspectives including the future advance to stretchable electronics are discussed based on the current achievements in research.

  1. Transcriptional regulatory networks underlying the reprogramming of spermatogonial stem cells to multipotent stem cells.

    Science.gov (United States)

    Jeong, Hoe-Su; Bhin, Jinhyuk; Joon Kim, Hyung; Hwang, Daehee; Ryul Lee, Dong; Kim, Kye-Seong

    2017-04-14

    Spermatogonial stem cells (SSCs) are germline stem cells located along the basement membrane of seminiferous tubules in testes. Recently, SSCs were shown to be reprogrammed into multipotent SSCs (mSSCs). However, both the key factors and biological networks underlying this reprogramming remain elusive. Here, we present transcriptional regulatory networks (TRNs) that control cellular processes related to the SSC-to-mSSC reprogramming. Previously, we established intermediate SSCs (iSSCs) undergoing the transition to mSSCs and generated gene expression profiles of SSCs, iSSCs and mSSCs. By comparing these profiles, we identified 2643 genes that were up-regulated during the reprogramming process and 15 key transcription factors (TFs) that regulate these genes. Using the TF-target relationships, we developed TRNs describing how these TFs regulate three pluripotency-related processes (cell proliferation, stem cell maintenance and epigenetic regulation) during the reprogramming. The TRNs showed that 4 of the 15 TFs (Oct4/Pou5f1, Cux1, Zfp143 and E2f4) regulated cell proliferation during the early stages of reprogramming, whereas 11 TFs (Oct4/Pou5f1, Foxm1, Cux1, Zfp143, Trp53, E2f4, Esrrb, Nfyb, Nanog, Sox2 and Klf4) regulated the three pluripotency-related processes during the late stages of reprogramming. Our TRNs provide a model for the temporally coordinated transcriptional regulation of pluripotency-related processes during the SSC-to-mSSC reprogramming, which can be further tested in detailed functional studies.

  2. Structural and Mechanical Properties of Intermediate Filaments under Extreme Conditions and Disease

    Science.gov (United States)

    Qin, Zhao

    Intermediate filaments are one of the three major components of the cytoskeleton in eukaryotic cells. It was discovered during the recent decades that intermediate filament proteins play key roles to reinforce cells subjected to large-deformation as well as participate in signal transduction. However, it is still poorly understood how the nanoscopic structure, as well as the biochemical properties of these protein molecules contribute to their biomechanical functions. In this research we investigate the material function of intermediate filaments under various extreme mechanical conditions as well as disease states. We use a full atomistic model and study its response to mechanical stresses. Learning from the mechanical response obtained from atomistic simulations, we build mesoscopic models following the finer-trains-coarser principles. By using this multiple-scale model, we present a detailed analysis of the mechanical properties and associated deformation mechanisms of intermediate filament network. We reveal the mechanism of a transition from alpha-helices to beta-sheets with subsequent intermolecular sliding under mechanical force, which has been inferred previously from experimental results. This nanoscale mechanism results in a characteristic nonlinear force-extension curve, which leads to a delocalization of mechanical energy and prevents catastrophic fracture. This explains how intermediate filament can withstand extreme mechanical deformation of > 1 00% strain despite the presence of structural defects. We combine computational and experimental techniques to investigate the molecular mechanism of Hutchinson-Gilford progeria syndrome, a premature aging disease. We find that the mutated lamin tail .domain is more compact and stable than the normal one. This altered structure and stability may enhance the association of intermediate filaments with the nuclear membrane, providing a molecular mechanism of the disease. We study the nuclear membrane association

  3. Control of a perturbed under-actuated mechanical system

    KAUST Repository

    Zayane, Chadia

    2015-11-05

    In this work, the trajectory tracking problem for an under-actuated mechanical system in presence of unknown input disturbances is addressed. The studied inertia wheel inverted pendulum falls in the class of non minimum phase systems. The proposed high order sliding mode control architecture including a controller and differentiator allows to track accurately the predefined trajectory and to stabilize the internal dynamics. The robustness of the proposed approach is illustrated through different perturbation and output noise configurations.

  4. Neural mechanisms underlying morphine withdrawal in addicted patients: a review

    Directory of Open Access Journals (Sweden)

    Nima Babhadiashar

    2015-06-01

    Full Text Available Morphine is one of the most potent alkaloid in opium, which has substantial medical uses and needs and it is the first active principle purified from herbal source. Morphine has commonly been used for relief of moderate to severe pain as it acts directly on the central nervous system; nonetheless, its chronic abuse increases tolerance and physical dependence, which is commonly known as opiate addiction. Morphine withdrawal syndrome is physiological and behavioral symptoms that stem from prolonged exposure to morphine. A majority of brain regions are hypofunctional over prolonged abstinence and acute morphine withdrawal. Furthermore, several neural mechanisms are likely to contribute to morphine withdrawal. The present review summarizes the literature pertaining to neural mechanisms underlying morphine withdrawal. Despite the fact that morphine withdrawal is a complex process, it is suggested that neural mechanisms play key roles in morphine withdrawal.

  5. An NMDA Receptor-Dependent Mechanism Underlies Inhibitory Synapse Development

    Directory of Open Access Journals (Sweden)

    Xinglong Gu

    2016-01-01

    Full Text Available In the mammalian brain, GABAergic synaptic transmission provides inhibitory balance to glutamatergic excitatory drive and controls neuronal output. The molecular mechanisms underlying the development of GABAergic synapses remain largely unclear. Here, we report that NMDA-type ionotropic glutamate receptors (NMDARs in individual immature neurons are the upstream signaling molecules essential for GABAergic synapse development, which requires signaling via Calmodulin binding motif in the C0 domain of the NMDAR GluN1 subunit. Interestingly, in neurons lacking NMDARs, whereas GABAergic synaptic transmission is strongly reduced, the tonic inhibition mediated by extrasynaptic GABAA receptors is increased, suggesting a compensatory mechanism for the lack of synaptic inhibition. These results demonstrate a crucial role for NMDARs in specifying the development of inhibitory synapses, and suggest an important mechanism for controlling the establishment of the balance between synaptic excitation and inhibition in the developing brain.

  6. Giant panda׳s tooth enamel: Structure, mechanical behavior and toughening mechanisms under indentation.

    Science.gov (United States)

    Weng, Z Y; Liu, Z Q; Ritchie, R O; Jiao, D; Li, D S; Wu, H L; Deng, L H; Zhang, Z F

    2016-12-01

    The giant panda׳s teeth possess remarkable load-bearing capacity and damage resistance for masticating bamboos. In this study, the hierarchical structure and mechanical behavior of the giant panda׳s tooth enamel were investigated under indentation. The effects of loading orientation and location on mechanical properties of the enamel were clarified and the evolution of damage in the enamel under increasing load evaluated. The nature of the damage, both at and beneath the indentation surfaces, and the underlying toughening mechanisms were explored. Indentation cracks invariably were seen to propagate along the internal interfaces, specifically the sheaths between enamel rods, and multiple extrinsic toughening mechanisms, e.g., crack deflection/twisting and uncracked-ligament bridging, were active to shield the tips of cracks from the applied stress. The giant panda׳s tooth enamel is analogous to human enamel in its mechanical properties, yet it has superior hardness and Young׳s modulus but inferior toughness as compared to the bamboo that pandas primarily feed on, highlighting the critical roles of the integration of underlying tissues in the entire tooth and the highly hydrated state of bamboo foods. Our objective is that this study can aid the understanding of the structure-mechanical property relations in the tooth enamel of mammals and further provide some insight on the food habits of the giant pandas. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Mechanical properties of graphene nanoribbons under uniaxial tensile strain

    Science.gov (United States)

    Yoneyama, Kazufumi; Yamanaka, Ayaka; Okada, Susumu

    2018-03-01

    Based on the density functional theory with the generalized gradient approximation, we investigated the mechanical properties of graphene nanoribbons in terms of their edge shape under a uniaxial tensile strain. The nanoribbons with armchair and zigzag edges retain their structure under a large tensile strain, while the nanoribbons with chiral edges are fragile against the tensile strain compared with those with armchair and zigzag edges. The fracture started at the cove region, which corresponds to the border between the zigzag and armchair edges for the nanoribbons with chiral edges. For the nanoribbons with armchair edges, the fracture started at one of the cove regions at the edges. In contrast, the fracture started at the inner region of the nanoribbons with zigzag edges. The bond elongation under the tensile strain depends on the mutual arrangement of covalent bonds with respect to the strain direction.

  8. Peripheral Receptor Mechanisms Underlying Orofacial Muscle Pain and Hyperalgesia

    Science.gov (United States)

    Saloman, Jami L.

    Musculoskeletal pain conditions, particularly those associated with temporomandibular joint and muscle disorders (TMD) are severely debilitating and affect approximately 12% of the population. Identifying peripheral nociceptive mechanisms underlying mechanical hyperalgesia, a prominent feature of persistent muscle pain, could contribute to the development of new treatment strategies for the management of TMD and other muscle pain conditions. This study provides evidence of functional interactions between ligand-gated channels, P2X3 and TRPV1/TRPA1, in trigeminal sensory neurons, and proposes that these interactions underlie the development of mechanical hyperalgesia. In the masseter muscle, direct P2X3 activation, via the selective agonist αβmeATP, induced a dose- and time-dependent hyperalgesia. Importantly, the αβmeATP-induced hyperalgesia was prevented by pretreatment of the muscle with a TRPV1 antagonist, AMG9810, or the TRPA1 antagonist, AP18. P2X3 was co-expressed with both TRPV1 and TRPA1 in masseter muscle afferents confirming the possibility for intracellular interactions. Moreover, in a subpopulation of P2X3 /TRPV1 positive neurons, capsaicin-induced Ca2+ transients were significantly potentiated following P2X3 activation. Inhibition of Ca2+-dependent kinases, PKC and CaMKII, prevented P2X3-mechanical hyperalgesia whereas blockade of Ca2+-independent PKA did not. Finally, activation of P2X3 induced phosphorylation of serine, but not threonine, residues in TRPV1 in trigeminal sensory neurons. Significant phosphorylation was observed at 15 minutes, the time point at which behavioral hyperalgesia was prominent. Similar data were obtained regarding another nonselective cation channel, the NMDA receptor (NMDAR). Our data propose P2X3 and NMDARs interact with TRPV1 in a facilitatory manner, which could contribute to the peripheral sensitization underlying masseter hyperalgesia. This study offers novel mechanisms by which individual pro-nociceptive ligand

  9. Mechanical properties of a collagen fibril under simulated degradation.

    Science.gov (United States)

    Malaspina, David C; Szleifer, Igal; Dhaher, Yasin

    2017-11-01

    Collagen fibrils are a very important component in most of the connective tissue in humans. An important process associated with several physiological and pathological states is the degradation of collagen. Collagen degradation is usually mediated by enzymatic and non-enzymatic processes. In this work we use molecular dynamics simulations to study the influence of simulated degradation on the mechanical properties of the collagen fibril. We applied tensile stress to the collagen fiber at different stages of degradation. We compared the difference in the fibril mechanical priorities due the removal of enzymatic crosslink, surface degradation and volumetric degradation. As anticipated, our results indicated that, regardless of the degradation scenario, fibril mechanical properties is reduced. The type of degradation mechanism (crosslink, surface or volumetric) expressed differential effect on the change in the fibril stiffness. Our simulation results showed dramatic change in the fibril stiffness with a small amount of degradation. This suggests that the hierarchical structure of the fibril is a key component for the toughness and is very sensitive to changes in the organization of the fibril. The overall results are intended to provide a theoretical framework for the understanding the mechanical behavior of collagen fibrils under degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Constitutive, Institutive and Up-Regulation of Carotenogenesis Regulatory Mechanism via In Vitro Culture Model System and Elicitors

    International Nuclear Information System (INIS)

    Rashidi Othman; Fatimah Azzahra Mohd Zaifuddin; Norazian Mohd Hassan

    2015-01-01

    Phyto hormone abscisic acid (ABA) plays a regulatory role in many physiological processes in plants and is regulated and controlled by specific key factors or genes. Different environmental stress conditions such as water, drought, cold, light, and temperature result in increased amounts of ABA. The action of ABA involves modification of gene expression and analysis of in vitro callus model system cultures revealed several potential of constitutive, institutive and up-regulation acting regulatory mechanisms. Therefore, this study was aimed at establishing in vitro cultures as potential research tools to study the regulatory mechanisms of the carotenoid biosynthesis in selected plant species through a controlled environment. The presence and absence of zeaxanthin and neoxanthin in callus cultures and intact plants could be explained by changes in gene expression in response to stress. Abiotic stress can alter gene expression and trigger cellular metabolism in plants. This study suggested that the key factors which involved in regulatory mechanisms of individual carotenoid biosynthesis in a particular biology system of plants can be either be silenced or activated. Therefore, based on the results in this study environmental stress is made possible for enhancement or enrichment of certain carotenoid of interest in food crops without altering the genes. (author)

  11. On the underlying assumptions of threshold Boolean networks as a model for genetic regulatory network behavior.

    Science.gov (United States)

    Tran, Van; McCall, Matthew N; McMurray, Helene R; Almudevar, Anthony

    2013-01-01

    Boolean networks (BoN) are relatively simple and interpretable models of gene regulatory networks. Specifying these models with fewer parameters while retaining their ability to describe complex regulatory relationships is an ongoing methodological challenge. Additionally, extending these models to incorporate variable gene decay rates, asynchronous gene response, and synergistic regulation while maintaining their Markovian nature increases the applicability of these models to genetic regulatory networks (GRN). We explore a previously-proposed class of BoNs characterized by linear threshold functions, which we refer to as threshold Boolean networks (TBN). Compared to traditional BoNs with unconstrained transition functions, these models require far fewer parameters and offer a more direct interpretation. However, the functional form of a TBN does result in a reduction in the regulatory relationships which can be modeled. We show that TBNs can be readily extended to permit self-degradation, with explicitly modeled degradation rates. We note that the introduction of variable degradation compromises the Markovian property fundamental to BoN models but show that a simple state augmentation procedure restores their Markovian nature. Next, we study the effect of assumptions regarding self-degradation on the set of possible steady states. Our findings are captured in two theorems relating self-degradation and regulatory feedback to the steady state behavior of a TBN. Finally, we explore assumptions of synchronous gene response and asynergistic regulation and show that TBNs can be easily extended to relax these assumptions. Applying our methods to the budding yeast cell-cycle network revealed that although the network is complex, its steady state is simplified by the presence of self-degradation and lack of purely positive regulatory cycles.

  12. Temporomandibular disorders and painful comorbidities: clinical association and underlying mechanisms.

    Science.gov (United States)

    Costa, Yuri Martins; Conti, Paulo César Rodrigues; de Faria, Flavio Augusto Cardoso; Bonjardim, Leonardo Rigoldi

    2017-03-01

    The association between temporomandibular disorders (TMDs) and headaches, cervical spine dysfunction, and fibromyalgia is not artefactual. The aim of this review is to describe the comorbid relationship between TMD and these three major painful conditions and to discuss the clinical implications and the underlying pain mechanisms involved in these relationships. Common neuronal pathways and central sensitization processes are acknowledged as the main factors for the association between TMD and primary headaches, although the establishment of cause-effect mechanisms requires further clarification and characterization. The biomechanical aspects are not the main factors involved in the comorbid relationship between TMD and cervical spine dysfunction, which can be better explained by the neuronal convergence of the trigeminal and cervical spine sensory pathways as well as by central sensitization processes. The association between TMD and fibromyalgia also has supporting evidence in the literature, and the proposed main mechanism underlying this relationship is the impairment of the descending pain inhibitory system. In this particular scenario, a cause-effect relationship is more likely to occur in one direction, that is, fibromyalgia as a risk factor for TMD. Therefore, clinical awareness of the association between TMD and painful comorbidities and the support of multidisciplinary approaches are required to recognize these related conditions. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Comparative study between transcriptionally- and translationally-acting adenine riboswitches reveals key differences in riboswitch regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Jean-François Lemay

    2011-01-01

    Full Text Available Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic. While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms.

  14. Disturbance of smooth muscle regulatory function by Eisenia foetida toxin lysenin: insight into the mechanism of smooth muscle contraction.

    Science.gov (United States)

    Czuryło, Edward A; Kulikova, Natalia; Sobota, Andrzej

    2008-05-01

    Lysenin, a toxin present in the coelomic fluid of the earthworm Eisenia foetida, is known to cause a long-lasting contraction of rat aorta smooth muscle strips. We addressed the mechanisms underlying its action on smooth muscle cells and present the first report demonstrating a completely new property of lysenin unrelated to its basic sphingomyelin-binding ability. Here we report lysenin enhancement effect on smooth muscle actomyosin ATPase activity and the ability of networking the actin filaments. The maximum enhancement of the ATPase activity of actomyosin at 120 mM KCl was observed at a molar ratio of lysenin to actin of about 1:10(5), while at 70 mM KCl at the ratio of about 1:10(6). The effect of lysenin became most pronounced only when both smooth muscle regulatory proteins, tropomyosin and caldesmon, were present. Co-sedimentation experiments indicated that lysenin did not displace neither tropomyosin nor caldesmon from the thin filament. Thus, the lysenin-dependent abolishment of the inhibitory effect of caldesmon on the ATPase activity was related rather to the modification of the filament structure. The ability of the toxin to exert its stimulatory effect at extremely low concentrations (as low as one molecule of lysenin per 10(6) actin molecules) may result from the long-range cooperative transitions in the entire thin filament with an involvement of smooth muscle tropomyosin, while the role of caldesmon may be limited exclusively to the inhibition of ATPase activity.

  15. Frequency, suppressive capacity, recruitment and induction mechanisms of regulatory T cells in sinonasal squamous cell carcinoma and nasal inverted papilloma.

    Directory of Open Access Journals (Sweden)

    Hongfei Lou

    Full Text Available Sinonasal squamous cell carcinoma (SSCC and nasal inverted papilloma (NIP represent the predominant type of malignant and benign tumors in sinonasal tract, respectively. CD4+ CD25+ Foxp3+ natural regulatory T (Treg cells might play critical role(s in the suppression of anti-tumor immune response and thus shed light on tumor progression from benign to malignant.This study aimed to evaluate the frequency and suppressive capacity of Treg cells in SSCC compared to NIP and further to explore the underlying mechanisms.Frequencies of Treg, Th1 and Th2 cells were evaluated by flow cytometry in tissue homogenate and peripheral blood from 31 SSCC patients, 32 NIP patients and 35 normal controls. Treg cells were tested for regulatory function by co-culture with effector T cells. CCR4 and its ligands, CCL22 and CCL17, were analyzed by flow cytometry and Luminex, respectively. The chemoattractant properties of CCR4/CCL22 and CCR4/CCL17 for Treg cells were assessed using the Boyden chamber technique, to elucidate the potential mechanisms of Treg recruitment in tumor microenvironment. Treg cells induction via TGF-β was assessed with transwells after local CD4+ Foxp3+ T cells were assessed by immunohistochemistry and TGF-β concentration was measured by Luminex.Tumor-infiltrating Treg cells increased significantly from normal to NIP to SSCC (P ≤ 0.001 for normal vs. NIP and P = 0.004 for NIP vs. SSCC. Significantly elevated frequency and enhanced suppression capacity of circulating Treg cells in SSCC were detected compared to NIP and healthy controls, concomitant with Th1 decrease and Th2 increase. Apparently increased CCL22 attracted CCR4-expressing Treg cells to tumor microenvironment in SSCC, compared to NIP. SSCC produced significantly more TGF-β than NIP and thus possessed greater potential for Treg cell induction.Frequency and suppressive capacity of Treg cells enhanced with progression of malignancy from NIP to SSCC. Circulating Treg cells were

  16. Failure Mechanisms of Brittle Rocks under Uniaxial Compression

    Directory of Open Access Journals (Sweden)

    Liu Taoying

    2017-09-01

    Full Text Available The behaviour of a rock mass is determined not only by the properties of the rock matrix, but mostly by the presence and properties of discontinuities or fractures within the mass. The compression test on rock-like specimens with two prefabricated transfixion fissures, made by pulling out the embedded metal inserts in the pre-cured period was carried out on the servo control uniaxial loading tester. The influence of the geometry of pre-existing cracks on the cracking processes was analysed with reference to the experimental observation of crack initiation and propagation from pre-existing flaws. Based on the rock fracture mechanics and the stress-strain curves, the evolution failure mechanism of the fissure body was also analyzed on the basis of exploring the law of the compression-shear crack initiation, wing crack growth and rock bridge connection. Meanwhile, damage fracture mechanical models of a compression-shear rock mass are established when the rock bridge axial transfixion failure, tension-shear combined failure, or wing crack shear connection failure occurs on the specimen under axial compression. This research was of significance in studying the failure mechanism of fractured rock mass.

  17. The mechanism underlying fast germination of tomato cultivar LA2711.

    Science.gov (United States)

    Yang, Rongchao; Chu, Zhuannan; Zhang, Haijun; Li, Ying; Wang, Jinfang; Li, Dianbo; Weeda, Sarah; Ren, Shuxin; Ouyang, Bo; Guo, Yang-Dong

    2015-09-01

    Seed germination is important for early plant morphogenesis as well as abiotic stress tolerance, and is mainly controlled by the phytohormones abscisic acid (ABA) and gibberellic acid (GA). Our previous studies identified a salt-tolerant tomato cultivar, LA2711, which is also a fast-germinating genotype, compared to its salt-sensitive counterpart, ZS-5. In an effort to further clarify the mechanism underlying this phenomenon, we compared the dynamic levels of ABA and GA4, the transcript abundance of genes involved in their biosynthesis and catabolism as well as signal transduction between the two cultivars. In addition, we tested seed germination sensitivity to ABA and GAs. Our results revealed that insensitivity of seed germination to exogenous ABA and low ABA content in seeds are the physiological mechanisms conferring faster germination rates of LA2711 seeds. SlCYP707A2, which encodes an ABA catabolic enzyme, may play a decisive role in the fast germination rate of LA2711, as it showed a significantly higher level of expression in LA2711 than ZS-5 at most time points tested during germination. The current results will enable us to gain insight into the mechanism(s) regarding seed germination of tomato and the role of fast germination in stress tolerance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Mechanisms underlying HIV-1 Vpu-mediated viral egress

    Directory of Open Access Journals (Sweden)

    Nicolas eRoy

    2014-05-01

    Full Text Available Viruses such as lentiviruses that are responsible for long lasting infections, have to evade several level of cellular immune mechanisms to persist and efficiently disseminate in the host. Over the past decades, many evidences have emerged regarding the major role of accessory proteins of primate lentiviruses (Human (HIV and simian immunodeficiency viruses (SIV in viral evasion from the host immune defense. This short review will provide an overview of the mechanism whereby the accessory protein Vpu contributes to this escape. Vpu is a multifunctional protein that was shown to contribute to viral egress by down-regulating several mediators of the immune system such as CD4, CD1d, NTB-A and the restriction factor BST2. The mechanisms underlying its activity are not fully characterized but rely on its ability to interfere with the host machinery regulating proteins turnover and vesicular trafficking. This review will focus on our current understanding of the mechanisms whereby Vpu down-regulates CD4 and BST2 expression level to favour viral egress.

  19. Mechanical Design of AM Fabricated Prismatic Rods under Torsion

    Directory of Open Access Journals (Sweden)

    Manzhirov Alexander V.

    2017-01-01

    Full Text Available We study the stress-strain state of viscoelastic prismatic rods fabricated or repaired by additive manufacturing technologies under torsion. An adequate description of the processes involved is given by methods of a new scientific field, mechanics of growing solids. Three main stages of the deformation process (before the beginning of growth, in the course of growth, and after the termination of growth are studied. Two versions of statement of two problems are given: (i given the torque, find the stresses, displacements, and torsion; (ii given the torsion, find the stresses, displacements, and torque. Solution methods using techniques of complex analysis are presented. The results can be used in mechanical and instrument engineering.

  20. Nanomaterials modulate stem cell differentiation: biological interaction and underlying mechanisms.

    Science.gov (United States)

    Wei, Min; Li, Song; Le, Weidong

    2017-10-25

    Stem cells are unspecialized cells that have the potential for self-renewal and differentiation into more specialized cell types. The chemical and physical properties of surrounding microenvironment contribute to the growth and differentiation of stem cells and consequently play crucial roles in the regulation of stem cells' fate. Nanomaterials hold great promise in biological and biomedical fields owing to their unique properties, such as controllable particle size, facile synthesis, large surface-to-volume ratio, tunable surface chemistry, and biocompatibility. Over the recent years, accumulating evidence has shown that nanomaterials can facilitate stem cell proliferation and differentiation, and great effort is undertaken to explore their possible modulating manners and mechanisms on stem cell differentiation. In present review, we summarize recent progress in the regulating potential of various nanomaterials on stem cell differentiation and discuss the possible cell uptake, biological interaction and underlying mechanisms.

  1. Mechanism of attenuation of leptin signaling under chronic ligand stimulation

    Directory of Open Access Journals (Sweden)

    Bamberg-Lemper Simone

    2010-01-01

    Full Text Available Abstract Background Leptin is an adipocyte-derived hormone that acts via its hypothalamic receptor (LEPRb to regulate energy balance. A downstream effect essential for the weight-regulatory action of leptin is the phosphorylation and activation of the latent transcription factor STAT3 by LEPRb-associated Janus kinases (JAKs. Obesity is typically associated with chronically elevated leptin levels and a decreased ability of LEPRb to activate intracellular signal transduction pathways (leptin resistance. Here we have studied the roles of the intracellular tyrosine residues in the negative feedback regulation of LEPRb-signaling under chronic leptin stimulation. Results Mutational analysis showed that the presence of either Tyr985 and Tyr1077 in the intracellular domain of LEPRb was sufficient for the attenuation of STAT3 phosphorylation, whereas mutation of both tyrosines rendered LEPRb resistant to feedback regulation. Overexpression and RNA interference-mediated downregulation of suppressor of cytokine signaling 3 (SOCS3 revealed that both Tyr985 and Tyr1077 were capable of supporting the negative modulatory effect of SOCS3 in reporter gene assays. In contrast, the inhibitory effect of SOCS1 was enhanced by the presence of Tyr985 but not Tyr1077. Finally, the reduction of the STAT-phosphorylating activity of the LEPRb complex after 2 h of leptin stimulation was not accompanied by the dephosphorylation or degradation of LEPRb or the receptor-associated JAK molecule, but depended on Tyr985 and/or Tyr1077. Conclusions Both Tyr985 and Tyr1077 contribute to the negative regulation of LEPRb signaling. The inhibitory effects of SOCS1 and SOCS3 differ in the dependence on the tyrosine residues in the intracellular domain of LEPRb.

  2. Kidney branching morphogenesis under the control of a ligand-receptor-based Turing mechanism

    Science.gov (United States)

    Menshykau, Denis; Iber, Dagmar

    2013-08-01

    The main signalling proteins that control early kidney branching have been defined. Yet the underlying mechanism is still elusive. We have previously shown that a Schnakenberg-type Turing mechanism can recapitulate the branching and protein expression patterns in wild-type and mutant lungs, but it is unclear whether this mechanism would extend to other branched organs that are regulated by other proteins. Here, we show that the glial cell line-derived neurotrophic factor-RET regulatory interaction gives rise to a Schnakenberg-type Turing model that reproduces the observed budding of the ureteric bud from the Wolffian duct, its invasion into the mesenchyme and the observed branching pattern. The model also recapitulates all relevant protein expression patterns in wild-type and mutant mice. The lung and kidney models are both based on a particular receptor-ligand interaction and require (1) cooperative binding of ligand and receptor, (2) a lower diffusion coefficient for the receptor than for the ligand and (3) an increase in the receptor concentration in response to receptor-ligand binding (by enhanced transcription, more recycling or similar). These conditions are met also by other receptor-ligand systems. We propose that ligand-receptor-based Turing patterns represent a general mechanism to control branching morphogenesis and other developmental processes.

  3. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    Science.gov (United States)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  4. Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

    KAUST Repository

    Othoum, Ghofran K

    2013-05-01

    Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

  5. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    Science.gov (United States)

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. © 2016 Elsevier Ltd. All rights reserved.

  6. Electrochemical mechanism of tin membrane electrodeposition under ultrasonic waves.

    Science.gov (United States)

    Nan, Tianxiang; Yang, Jianguang; Chen, Bing

    2018-04-01

    Tin was electrodeposited from chloride solutions using a membrane cell under ultrasonic waves. Cyclic voltammetry (CV), linear sweep voltammetry (LSV), chronoamperometry (CHR), and chronopotentiometry were applied to investigate the electrochemical mechanism of tin electrodeposition under ultrasonic field. Chronoamperometry curves showed that the initial process of tin electrodeposition followed the diffusion controlled three-dimensional nucleation and grain growth mechanism. The analysis of the cyclic voltammetry and linear sweep voltammetry diagrams showed that the application of ultrasound can change the tin membrane electro-deposition reaction from diffusion to electrochemical control, and the optimum parameters for tin electrodeposition were H + concentration 3.5 mol·L -1 , temperature 35 °C and ultrasonic power 100 W. The coupling ultrasonic field played a role in refining the grain in this process. The growth of tin crystals showed no orientation preferential, and the tin deposition showed a tendency to form a regular network structure after ultrasonic coupling. While in the absence of ultrasonic coupling, the growth of tin crystals has a high preferential orientation, and the tin deposition showed a tendency to form tin whiskers. Ultrasonic coupling was more favorable for obtaining a more compact and smoother cathode tin layer. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Mechanisms Underlying the Antidepressant Response and Treatment Resistance

    Directory of Open Access Journals (Sweden)

    Marjorie Rose Levinstein

    2014-06-01

    Full Text Available Depression is a complex and heterogeneous disorder affecting millions of Americans. There are several different medications and other treatments that are available and effective for many patients with depression. However, a substantial percentage of patients fail to achieve remission with these currently available interventions, and relapse rates are high. Therefore, it is necessary to determine both the mechanisms underlying the antidepressant response and the differences between responders and non-responders to treatment. Delineation of these mechanisms largely relies on experiments that utilize animal models. Therefore, this review provides an overview of the various mouse models that are currently used to assess the antidepressant response, such as chronic mild stress, social defeat, and chronic corticosterone. We discuss how these mouse models can be used to advance our understanding of the differences between responders and non-responders to antidepressant treatment. We also provide an overview of experimental treatment modalities that are used for treatment-resistant depression, such as deep brain stimulation and ketamine administration. We will then review the various genetic polymorphisms and transgenic mice that display resistance to antidepressant treatment. Finally, we synthesize the published data to describe a potential neural circuit underlying the antidepressant response and treatment resistance.

  8. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.

    Science.gov (United States)

    Chastanet, Arnaud; Losick, Richard

    2011-11-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.

  9. Autophagy as a Possible Underlying Mechanism of Nanomaterial Toxicity

    Directory of Open Access Journals (Sweden)

    Vanessa Cohignac

    2014-07-01

    Full Text Available The rapid development of nanotechnologies is raising safety concerns because of the potential effects of engineered nanomaterials on human health, particularly at the respiratory level. Since the last decades, many in vivo studies have been interested in the pulmonary effects of different classes of nanomaterials. It has been shown that some of them can induce toxic effects, essentially depending on their physico-chemical characteristics, but other studies did not identify such effects. Inflammation and oxidative stress are currently the two main mechanisms described to explain the observed toxicity. However, the exact underlying mechanism(s still remain(s unknown and autophagy could represent an interesting candidate. Autophagy is a physiological process in which cytoplasmic components are digested via a lysosomal pathway. It has been shown that autophagy is involved in the pathogenesis and the progression of human diseases, and is able to modulate the oxidative stress and pro-inflammatory responses. A growing amount of literature suggests that a link between nanomaterial toxicity and autophagy impairment could exist. In this review, we will first summarize what is known about the respiratory effects of nanomaterials and we will then discuss the possible involvement of autophagy in this toxicity. This review should help understand why autophagy impairment could be taken as a promising candidate to fully understand nanomaterials toxicity.

  10. Effects of manual hyperinflation in preterm newborns under mechanical ventilation.

    Science.gov (United States)

    Viana, Camila Chaves; Nicolau, Carla Marques; Juliani, Regina Celia Turola Passos; Carvalho, Werther Brunow de; Krebs, Vera Lucia Jornada

    2016-09-01

    To assess the effects of manual hyperinflation, performed with a manual resuscitator with and without the positive end-expiratory pressure valve, on the respiratory function of preterm newborns under mechanical ventilation. Cross-sectional study of hemodynamically stable preterm newborns with gestational age of less than 32 weeks, under mechanical ventilation and dependent on it at 28 days of life. Manual hyperinflation was applied randomly, alternating the use or not of the positive end-expiratory pressure valve, followed by tracheal aspiration for ending the maneuver. For nominal data, the two-tailed Wilcoxon test was applied at the 5% significance level and 80% power. Twenty-eight preterm newborns, with an average birth weight of 1,005.71 ± 372.16g, an average gestational age of 28.90 ± 1.79 weeks, an average corrected age of 33.26 ± 1.78 weeks, and an average mechanical ventilation time of 29.5 (15 - 53) days, were studied. Increases in inspiratory and expiratory volumes occurred between time-points A5 (before the maneuver) and C1 (immediately after tracheal aspiration) in both the maneuver with the valve (p = 0.001 and p = 0.009) and without the valve (p = 0.026 and p = 0.001), respectively. There was also an increase in expiratory resistance between time-points A5 and C1 (p = 0.044). Lung volumes increased when performing the maneuver with and without the valve, with a significant difference in the first minute after aspiration. There was a significant difference in expiratory resistance between the time-points A5 (before the maneuver) and C1 (immediately after tracheal aspiration) in the first minute after aspiration within each maneuver.

  11. Drought response in wheat: key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency

    Science.gov (United States)

    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh

    2017-12-01

    sequence and advent genome editing technologies, are expected to aid in deciphering of the functional roles of genes and regulatory networks underlying adaptive phenological traits, and utilizing the outcomes of such studies in developing drought tolerance cultivars.

  12. Exploration of mechanisms underlying the strain-rate-dependent mechanical property of single chondrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Trung Dung; Gu, YuanTong, E-mail: yuantong.gu@qut.edu.au [School of Chemistry, Physics and Mechanical Engineering, Queensland University of Technology, Brisbane, Queensland (Australia)

    2014-05-05

    Based on the characterization by Atomic Force Microscopy, we report that the mechanical property of single chondrocytes has dependency on the strain-rates. By comparing the mechanical deformation responses and the Young's moduli of living and fixed chondrocytes at four different strain-rates, we explore the deformation mechanisms underlying this dependency property. We found that the strain-rate-dependent mechanical property of living cells is governed by both of the cellular cytoskeleton and the intracellular fluid when the fixed chondrocytes are mainly governed by their intracellular fluid, which is called the consolidation-dependent deformation behavior. Finally, we report that the porohyperelastic constitutive material model which can capture the consolidation-dependent behavior of both living and fixed chondrocytes is a potential candidature to study living cell biomechanics.

  13. Toward a contingent resource-based view of nonmarket capabilities under regulatory uncertainty

    OpenAIRE

    Schwark, Bastian

    2009-01-01

    The article integrates theoretical perspectives from the resource-based view of the firm, dynamic capabilities and contingency. It explains one particular characteristic of the general business environment of the firm, regulatory uncertainty, and its influence on dynamic capabilities of a corporate political strategy (nonmarket strategy) and value creation. I argue that scanning and predictive capabilities as well as institutional influence capabilities will lead to a reduced perceived uncert...

  14. Octopamine Underlies the Counter-Regulatory Response to a Glucose Deficit in Honeybees (Apis mellifera)

    Science.gov (United States)

    Buckemüller, Christina; Siehler, Oliver; Göbel, Josefine; Zeumer, Richard; Ölschläger, Anja; Eisenhardt, Dorothea

    2017-01-01

    An animal’s internal state is a critical parameter required for adaptation to a given environment. An important aspect of an animal’s internal state is the energy state that is adjusted to the needs of an animal by energy homeostasis. Glucose is one essential source of energy, especially for the brain. A shortage of glucose therefore triggers a complex response to restore the animal’s glucose supply. This counter-regulatory response to a glucose deficit includes metabolic responses like the mobilization of glucose from internal glucose stores and behavioral responses like increased foraging and a rapid intake of food. In mammals, the catecholamines adrenalin and noradrenalin take part in mediating these counter-regulatory responses to a glucose deficit. One candidate molecule that might play a role in these processes in insects is octopamine (OA). It is an invertebrate biogenic amine and has been suggested to derive from an ancestral pathway shared with adrenalin and noradrenalin. Thus, it could be hypothesized that OA plays a role in the insect’s counter-regulatory response to a glucose deficit. Here we tested this hypothesis in the honeybee (Apis mellifera), an insect that, as an adult, mainly feeds on carbohydrates and uses these as its main source of energy. We investigated alterations of the hemolymph glucose concentration, survival, and feeding behavior after starvation and examined the impact of OA on these processes in pharmacological experiments. We demonstrate an involvement of OA in these three processes in honeybees and conclude there is an involvement of OA in regulating a bee’s metabolic, physiological, and behavioral response following a phase of prolonged glucose deficit. Thus, OA in honeybees acts similarly to adrenalin and noradrenalin in mammals in regulating an animal’s counter-regulatory response. PMID:28912693

  15. Quality standards under classical oligopoly and trade : regulatory protection or just over-regulation

    OpenAIRE

    Edwards, T. Huw

    2003-01-01

    Recent trade policy debates have focused increasingly on the supposed barriers caused by di¤ering country regulations, and at proposed remedies such as mutual recognition agreements. There are several motives for setting minimum quality standards in an open economy.\\ud This paper examines the motive of correcting an undersupply of quality when an industry is monopolistic, and sets up a theoretical model of regulatory setting of minimum vertical quality standards in a classical two-country cro...

  16. Skin transcriptome reveals the intrinsic molecular mechanisms underlying hair follicle cycling in Cashmere goats under natural and shortened photoperiod conditions.

    Science.gov (United States)

    Yang, Min; Song, Shen; Dong, Kunzhe; Chen, XiaoFei; Liu, Xuexue; Rouzi, Marhaba; Zhao, Qianjun; He, Xiaohong; Pu, Yabin; Guan, Weijun; Ma, Yuehui; Jiang, Lin

    2017-10-18

    The growth of cashmere exhibits a seasonal pattern arising from photoperiod change. However, the underlying molecular mechanism remains unclear. We profiled the skin transcriptome of six goats at seven time points during hair follicle cycling via RNA-seq. The six goats comprised three goats exposed to a natural photoperiod and three exposed to a shortened photoperiod. During hair cycle transition, 1713 genes showed differential expression, and 332 genes showed a pattern of periodic expression. Moreover, a short photoperiod induced the hair follicle to enter anagen early, and 246 genes overlapped with the periodic genes. Among these key genes, cold-shock domain containing C2 (CSDC2) was highly expressed in the epidermis and dermis of Cashmere goat skin, although its function in hair-follicle development remains unknown. CSDC2 silencing in mouse fibroblasts resulted in the decreased mRNA expression of two key hair-follicle factors, leading to reduced cell numbers and a lower cell density. Cashmere growth or molting might be controlled by a set of periodic regulatory genes. The appropriate management of short light exposure can induce hair follicles to enter full anagen early through the activation of these regulators. The CSDC2 gene is a potentially important transcription factor in the hair growth cycle.

  17. Signaling mechanism underlying the histamine-modulated action of hypoglossal motoneurons.

    Science.gov (United States)

    Liu, Zi-Long; Wu, Xu; Luo, Yan-Jia; Wang, Lu; Qu, Wei-Min; Li, Shan-Qun; Huang, Zhi-Li

    2016-04-01

    Histamine, an important modulator of the arousal states of the central nervous system, has been reported to contribute an excitatory drive at the hypoglossal motor nucleus to the genioglossus (GG) muscle, which is involved in the pathogenesis of obstructive sleep apnea. However, the effect of histamine on hypoglossal motoneurons (HMNs) and the underlying signaling mechanisms have remained elusive. Here, whole-cell patch-clamp recordings were conducted using neonatal rat brain sections, which showed that histamine excited HMNs with an inward current under voltage-clamp and a depolarization membrane potential under current-clamp via histamine H1 receptors (H1Rs). The phospholipase C inhibitor U-73122 blocked H1Rs-mediated excitatory effects, but protein kinase A inhibitor and protein kinase C inhibitor did not, indicating that the signal transduction cascades underlying the excitatory action of histamine on HMNs were H1R/Gq/11 /phospholipase C/inositol-1,4,5-trisphosphate (IP3). The effects of histamine were also dependent on extracellular Na(+) and intracellular Ca(2+), which took place via activation of Na(+)-Ca(2+) exchangers. These results identify the signaling molecules associated with the regulatory effect of histamine on HMNs. The findings of this study may provide new insights into therapeutic approaches in obstructive sleep apnea. We proposed the post-synaptic mechanisms underlying the modulation effect of histamine on hypoglossal motoneuron. Histamine activates the H1Rs via PLC and IP3, increases Ca(2+) releases from intracellular stores, promotes Na(+) influx and Ca(2+) efflux via the NCXs, and then produces an inward current and depolarizes the neurons. Histamine modulates the excitability of HMNs with other neuromodulators, such as noradrenaline, serotonin and orexin. We think that these findings should provide an important new direction for drug development for the treatment of obstructive sleep apnea. © 2016 International Society for Neurochemistry.

  18. Transcriptome profiling of a curdlan-producing Agrobacterium reveals conserved regulatory mechanisms of exopolysaccharide biosynthesis

    Directory of Open Access Journals (Sweden)

    Ruffing Anne M

    2012-02-01

    Full Text Available Abstract Background The ability to synthesize exopolysaccharides (EPS is widespread among microorganisms, and microbial EPS play important roles in biofilm formation, pathogen persistence, and applications in the food and medical industries. Although it is well established that EPS synthesis is invariably in response to environmental cues, it remains largely unknown how various environmental signals trigger activation of the biochemical synthesis machinery. Results We report here the transcriptome profiling of Agrobacterium sp. ATCC 31749, a microorganism that produces large amounts of a glucose polymer known as curdlan under nitrogen starvation. Transcriptome analysis revealed a nearly 100-fold upregulation of the curdlan synthesis operon upon transition to nitrogen starvation, thus establishing the prominent role that transcriptional regulation plays in the EPS synthesis. In addition to known mechanisms of EPS regulation such as activation by c-di-GMP, we identify novel mechanisms of regulation in ATCC 31749, including RpoN-independent NtrC regulation and intracellular pH regulation by acidocalcisomes. Furthermore, we show evidence that curdlan synthesis is also regulated by conserved cell stress responses, including polyphosphate accumulation and the stringent response. In fact, the stringent response signal, pppGpp, appears to be indispensible for transcriptional activation of curdlan biosynthesis. Conclusions This study identifies several mechanisms regulating the synthesis of curdlan, an EPS with numerous applications. These mechanisms are potential metabolic engineering targets for improving the industrial production of curdlan from Agrobacterium sp. ATCC 31749. Furthermore, many of the genes identified in this study are highly conserved across microbial genomes, and we propose that the molecular elements identified in this study may serve as universal regulators of microbial EPS synthesis.

  19. The mechanisms underlying fructose-induced hypertension: a review

    Science.gov (United States)

    Klein, Alice Victoria; Kiat, Hosen

    2015-01-01

    We are currently in the midst of an epidemic of metabolic disorders, which may, in part, be explained by excess fructose intake. This theory is supported by epidemiological observations as well as experimental studies in animals and humans. Rising consumption of fructose has been matched with growing rates of hypertension, leading to concern from public health experts. At this stage, the mechanisms underlying fructose-induced hypertension have not been fully characterized and the bulk of our knowledge is derived from animal models. Animal studies have shown that high-fructose diets up-regulate sodium and chloride transporters, resulting in a state of salt overload that increases blood pressure. Excess fructose has also been found to activate vasoconstrictors, inactivate vasodilators, and over-stimulate the sympathetic nervous system. Further work is required to determine the relevance of these findings to humans and to establish the level at which dietary fructose increases the risk of developing hypertension PMID:25715094

  20. Degradation Mechanisms of Transparent Polyurethane Interlayer under UV Irradiation

    Directory of Open Access Journals (Sweden)

    OU Yingchun

    2017-01-01

    Full Text Available According to the ageing problem of laminated transparency, the trasparent polyurethane film used as interlayer had been irradiated by fluorescent ultraviolet lamp for 0 h, 200 h, 300 h, and 500 h respectively. With the aid of ultraviolet/visible spectrophotometer, FTIR and SEM etc., the color, structure and morphology of the materials were studied. SEM shows that when the irradiation time is increased to 500 h, the film surface cracks. The UV degradation mechanisms are that -CH2- of the position connecting the O and N from hard segment and the soft segment are easy to oxidize and produce hydrogen peroxide under UV and oxygen, which is furtherly oxidized to CO, and some part of the C-O and C-N bonds is cracked through β scission, and then the materials are fractured.

  1. Nonlinear mechanical response of supercooled melts under applied forces

    Science.gov (United States)

    Cárdenas, Heliana; Frahsa, Fabian; Fritschi, Sebastian; Nicolas, Alexandre; Papenkort, Simon; Voigtmann, Thomas; Fuchs, Matthias

    2017-08-01

    We review recent progress on a microscopic theoretical approach to describe the nonlinear response of glass-forming colloidal dispersions under strong external forcing leading to homogeneous and inhomogeneous flow. Using mode-coupling theory (MCT), constitutive equations for the rheology of viscoelastic shear-thinning fluids are obtained. These are, in suitably simplified form, employed in continuum fluid dynamics, solved by a hybrid-Lattice Boltzmann (LB) algorithm that was developed to deal with long-lasting memory effects. The combined microscopic theoretical and mesoscopic numerical approach captures a number of phenomena far from equilibrium, including the yielding of metastable states, process-dependent mechanical properties, and inhomogeneous pressure-driven channel flow.

  2. Simulated airplane headache: a proxy towards identification of underlying mechanisms.

    Science.gov (United States)

    Bui, Sebastian Bao Dinh; Petersen, Torben; Poulsen, Jeppe Nørgaard; Gazerani, Parisa

    2017-12-01

    Airplane Headache (AH) occurs during flights and often appears as an intense, short lasting headache during take-off or landing. Reports are limited on pathological mechanisms underlying the occurrence of this headache. Proper diagnosis and treatments would benefit from identification of potential pathways involved in AH pathogenesis. This study aimed at providing a simulated airplane headache condition as a proxy towards identification of its underlying mechanisms. Fourteen participants including 7 volunteers suffering from AH and 7 healthy matched controls were recruited after meeting the diagnostic and safety criteria based on an approved study protocol. Simulation of AH was achieved by entering a pressure chamber with similar characteristics of an airplane flight. Selected potential biomarkers including salivary prostaglandin E 2 (PGE 2 ), cortisol, facial thermo-images, blood pressure, pulse, and saturation pulse oxygen (SPO) were defined and values were collected before, during and after flight simulation in the pressure chamber. Salivary samples were analyzed with ELISA techniques, while data analysis and statistical tests were handled with SPSS version 22.0. All participants in the AH-group experienced a headache attack similar to AH experience during flight. The non-AH-group did not experience any headaches. Our data showed that the values for PGE 2 , cortisol and SPO were significantly different in the AH-group in comparison with the non-AH-group during the flight simulation in the pressure chamber. The pressure chamber proved useful not only to provoke AH-like attack but also to study potential biomarkers for AH in this study. PGE 2 , and cortisol levels together with SPO presented dysregulation during the simulated AH-attack in affected individuals compared with healthy controls. Based on these findings we propose to use pressure chamber as a model to induce AH, and thus assess new potential biomarkers for AH in future studies.

  3. POSSIBLE MECHANISMS UNDERLYING THE THERAPEUTIC EFFECTS OF TRANSCRANIAL MAGNETIC STIMULATION

    Directory of Open Access Journals (Sweden)

    Alexander eChervyakov

    2015-06-01

    Full Text Available Transcranial magnetic stimulation (TMS is an effective method used to diagnose and treat many neurological disorders. Although repetitive TMS (rTMS has been used to treat a variety of serious pathological conditions including stroke, depression, Parkinson's disease, epilepsy, pain, and migraines, the pathophysiological mechanisms underlying the effects of long-term TMS remain unclear. In the present review, the effects of rTMS on neurotransmitters and synaptic plasticity are described, including the classic interpretations of TMS effects on synaptic plasticity via long-term potentiation (LTP and long-term depression (LTD. We also discuss the effects of rTMS on the genetic apparatus of neurons, glial cells and the prevention of neuronal death. The neurotrophic effects of rTMS on dendritic growth and sprouting and neurotrophic factors are described, including change in brain-derived neurotrophic factor (BDNF concentration under the influence of rTMS. Also, non-classical effects of TMS related to biophysical effects of magnetic fields are described, including the quantum effects, the magnetic spin effects, genetic magnetoreception, the macromolecular effects of TMS, and the electromagnetic theory of consciousness. Finally, we discuss possible interpretations of TMS effects according to dynamical systems theory. Evidence suggests that a rTMS-induced magnetic field should be considered a separate physical factor that can be impactful at the subatomic level and that rTMS is capable of significantly altering the reactivity of molecules (radicals. It is thought that these factors underlie the therapeutic benefits of therapy with TMS. Future research on these mechanisms will be instrumental to the development of more powerful and reliable TMS treatment protocols.

  4. Nonlinear Mechanics of MEMS Rectangular Microplates under Electrostatic Actuation

    KAUST Repository

    Saghir, Shahid

    2016-12-01

    The first objective of the dissertation is to develop a suitable reduced order model capable of investigating the nonlinear mechanical behavior of von-Karman plates under electrostatic actuation. The second objective is to investigate the nonlinear static and dynamic behavior of rectangular microplates under small and large actuating forces. In the first part, we present and compare various approaches to develop reduced order models for the nonlinear von-Karman rectangular microplates actuated by nonlinear electrostatic forces. The reduced-order models aim to investigate the static and dynamic behavior of the plate under small and large actuation forces. A fully clamped microplate is considered. Different types of basis functions are used in conjunction with the Galerkin method to discretize the governing equations. First we investigate the convergence with the number of modes retained in the model. Then for validation purpose, a comparison of the static results is made with the results calculated by a nonlinear finite element model. The linear eigenvalue problem for the plate under the electrostatic force is solved for a wide range of voltages up to pull-in. In the second part, we present an investigation of the static and dynamic behavior of a fully clamped microplate. We investigate the effect of different non-dimensional design parameters on the static response. The forced-vibration response of the plate is then investigated when the plate is excited by a harmonic AC load superimposed to a DC load. The dynamic behavior is examined near the primary and secondary (superharmonic and subharmonic) resonances. The microplate shows a strong hardening behavior due to the cubic nonlinearity of midplane stretching. However, the behavior switches to softening as the DC load is increased. Next, near-square plates are studied to understand the effect of geometric imperfections of microplates. In the final part of the dissertation, we investigate the mechanical behavior of

  5. Mechanisms underlying the social enhancement of vocal learning in songbirds.

    Science.gov (United States)

    Chen, Yining; Matheson, Laura E; Sakata, Jon T

    2016-06-14

    Social processes profoundly influence speech and language acquisition. Despite the importance of social influences, little is known about how social interactions modulate vocal learning. Like humans, songbirds learn their vocalizations during development, and they provide an excellent opportunity to reveal mechanisms of social influences on vocal learning. Using yoked experimental designs, we demonstrate that social interactions with adult tutors for as little as 1 d significantly enhanced vocal learning. Social influences on attention to song seemed central to the social enhancement of learning because socially tutored birds were more attentive to the tutor's songs than passively tutored birds, and because variation in attentiveness and in the social modulation of attention significantly predicted variation in vocal learning. Attention to song was influenced by both the nature and amount of tutor song: Pupils paid more attention to songs that tutors directed at them and to tutors that produced fewer songs. Tutors altered their song structure when directing songs at pupils in a manner that resembled how humans alter their vocalizations when speaking to infants, that was distinct from how tutors changed their songs when singing to females, and that could influence attention and learning. Furthermore, social interactions that rapidly enhanced learning increased the activity of noradrenergic and dopaminergic midbrain neurons. These data highlight striking parallels between humans and songbirds in the social modulation of vocal learning and suggest that social influences on attention and midbrain circuitry could represent shared mechanisms underlying the social modulation of vocal learning.

  6. Neurodevelopmental Disorders and Environmental Toxicants: Epigenetics as an Underlying Mechanism

    Directory of Open Access Journals (Sweden)

    Nguyen Quoc Vuong Tran

    2017-01-01

    Full Text Available The increasing prevalence of neurodevelopmental disorders, especially autism spectrum disorders (ASD and attention deficit hyperactivity disorder (ADHD, calls for more research into the identification of etiologic and risk factors. The Developmental Origin of Health and Disease (DOHaD hypothesizes that the environment during fetal and childhood development affects the risk for many chronic diseases in later stages of life, including neurodevelopmental disorders. Epigenetics, a term describing mechanisms that cause changes in the chromosome state without affecting DNA sequences, is suggested to be the underlying mechanism, according to the DOHaD hypothesis. Moreover, many neurodevelopmental disorders are also related to epigenetic abnormalities. Experimental and epidemiological studies suggest that exposure to prenatal environmental toxicants is associated with neurodevelopmental disorders. In addition, there is also evidence that environmental toxicants can result in epigenetic alterations, notably DNA methylation. In this review, we first focus on the relationship between neurodevelopmental disorders and environmental toxicants, in particular maternal smoking, plastic-derived chemicals (bisphenol A and phthalates, persistent organic pollutants, and heavy metals. We then review studies showing the epigenetic effects of those environmental factors in humans that may affect normal neurodevelopment.

  7. Thermal stability of nafion membranes under mechanical stress

    Energy Technology Data Exchange (ETDEWEB)

    Quintilii, M.; Struis, R. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    The feasibility of adequately modified fluoro-ionomer membranes (NAFION{sup R}) is demonstrated for the selective separation of methanol synthesis products from the raw reactor gas at temperatures around 200{sup o}C. For an economically relevant application of this concept on a technical scale the Nafion membranes should be thin ({approx_equal}10 {mu}m) and thermally stable over a long period of time (1-2 years). In cooperation with industry (Methanol Casale SA, Lugano (CH)), we test the thermal stability of Nafion hollow fibers and supported Nafion thin sheet membranes at temperatures between 160 and 200{sup o}C under mechanical stress by applying a gas pressure difference over the membrane surface ({Delta}P{<=} 40 bar). Tests with the hollow fibers revealed that Nafion has visco-elastic properties. Tests with 50 {mu}m thin Nafion sheets supported by a porous metal carrier at 200{sup o}C and {Delta}P=39 bar showed no mechanical defects over a period of 92 days. (author) 5 figs., 4 refs.

  8. Using Drosophila to discover mechanisms underlying type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Ronald W. Alfa

    2016-04-01

    Full Text Available Mechanisms of glucose homeostasis are remarkably well conserved between the fruit fly Drosophila melanogaster and mammals. From the initial characterization of insulin signaling in the fly came the identification of downstream metabolic pathways for nutrient storage and utilization. Defects in these pathways lead to phenotypes that are analogous to diabetic states in mammals. These discoveries have stimulated interest in leveraging the fly to better understand the genetics of type 2 diabetes mellitus in humans. Type 2 diabetes results from insulin insufficiency in the context of ongoing insulin resistance. Although genetic susceptibility is thought to govern the propensity of individuals to develop type 2 diabetes mellitus under appropriate environmental conditions, many of the human genes associated with the disease in genome-wide association studies have not been functionally studied. Recent advances in the phenotyping of metabolic defects have positioned Drosophila as an excellent model for the functional characterization of large numbers of genes associated with type 2 diabetes mellitus. Here, we examine results from studies modeling metabolic disease in the fruit fly and compare findings to proposed mechanisms for diabetic phenotypes in mammals. We provide a systematic framework for assessing the contribution of gene candidates to insulin-secretion or insulin-resistance pathways relevant to diabetes pathogenesis.

  9. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    Science.gov (United States)

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  10. Regulatory mechanism of radiation-induced cancer cell death by the change of cell cycle

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Soo Jin; Jeong, Min Ho; Jang, Ji Yeon [College of Medicine, Donga Univ., Pusan (Korea, Republic of)

    2003-09-01

    cycle regulatory activites. In this study, we present a unique and reproducible model in which for investigating the mechanisms of various, radiation-induced, cancer cell death patterns. Further evaluation by using this model will provide a potent target for a new strategy of radiotherapy.

  11. Mechanisms underlying temperature extremes in Iberia: a Lagrangian perspective

    Directory of Open Access Journals (Sweden)

    João A. Santos

    2015-04-01

    Full Text Available The mechanisms underlying the occurrence of temperature extremes in Iberia are analysed considering a Lagrangian perspective of the atmospheric flow, using 6-hourly ERA-Interim reanalysis data for the years 1979–2012. Daily 2-m minimum temperatures below the 1st percentile and 2-m maximum temperatures above the 99th percentile at each grid point over Iberia are selected separately for winter and summer. Four categories of extremes are analysed using 10-d backward trajectories initialized at the extreme temperature grid points close to the surface: winter cold (WCE and warm extremes (WWE, and summer cold (SCE and warm extremes (SWE. Air masses leading to temperature extremes are first transported from the North Atlantic towards Europe for all categories. While there is a clear relation to large-scale circulation patterns in winter, the Iberian thermal low is important in summer. Along the trajectories, air mass characteristics are significantly modified through adiabatic warming (air parcel descent, upper-air radiative cooling and near-surface warming (surface heat fluxes and radiation. High residence times over continental areas, such as over northern-central Europe for WCE and, to a lesser extent, over Iberia for SWE, significantly enhance these air mass modifications. Near-surface diabatic warming is particularly striking for SWE. WCE and SWE are responsible for the most extreme conditions in a given year. For WWE and SCE, strong temperature advection associated with important meridional air mass transports are the main driving mechanisms, accompanied by comparatively minor changes in the air mass properties. These results permit a better understanding of mechanisms leading to temperature extremes in Iberia.

  12. Different neurophysiological mechanisms underlying word and rule extraction from speech.

    Directory of Open Access Journals (Sweden)

    Ruth De Diego Balaguer

    Full Text Available The initial process of identifying words from spoken language and the detection of more subtle regularities underlying their structure are mandatory processes for language acquisition. Little is known about the cognitive mechanisms that allow us to extract these two types of information and their specific time-course of acquisition following initial contact with a new language. We report time-related electrophysiological changes that occurred while participants learned an artificial language. These changes strongly correlated with the discovery of the structural rules embedded in the words. These changes were clearly different from those related to word learning and occurred during the first minutes of exposition. There is a functional distinction in the nature of the electrophysiological signals during acquisition: an increase in negativity (N400 in the central electrodes is related to word-learning and development of a frontal positivity (P2 is related to rule-learning. In addition, the results of an online implicit and a post-learning test indicate that, once the rules of the language have been acquired, new words following the rule are processed as words of the language. By contrast, new words violating the rule induce syntax-related electrophysiological responses when inserted online in the stream (an early frontal negativity followed by a late posterior positivity and clear lexical effects when presented in isolation (N400 modulation. The present study provides direct evidence suggesting that the mechanisms to extract words and structural dependencies from continuous speech are functionally segregated. When these mechanisms are engaged, the electrophysiological marker associated with rule-learning appears very quickly, during the earliest phases of exposition to a new language.

  13. Understanding and imitating unfamiliar actions: distinct underlying mechanisms.

    Directory of Open Access Journals (Sweden)

    Joana C Carmo

    Full Text Available The human "mirror neuron system" has been proposed to be the neural substrate that underlies understanding and, possibly, imitating actions. However, since the brain activity with mirror properties seems insufficient to provide a good description for imitation of actions outside one's own repertoire, the existence of supplementary processes has been proposed. Moreover, it is unclear whether action observation requires the same neural mechanisms as the explicit access to their meaning. The aim of this study was two-fold as we investigated whether action observation requires different processes depending on 1 whether the ultimate goal is to imitate or understand the presented actions and 2 whether the to-be-imitated actions are familiar or unfamiliar to the subject. Participants were presented with both meaningful familiar actions and meaningless unfamiliar actions that they had to either imitate or discriminate later. Event-related Potentials were used as differences in brain activity could have been masked by the use of other techniques with lower temporal resolution. In the imitation task, a sustained left frontal negativity was more pronounced for meaningless actions than for meaningful ones, starting from an early time-window. Conversely, observing unfamiliar versus familiar actions with the intention of discriminating them led to marked differences over right centro-posterior scalp regions, in both middle and latest time-windows. These findings suggest that action imitation and action understanding may be sustained by dissociable mechanisms: while imitation of unfamiliar actions activates left frontal processes, that are likely to be related to learning mechanisms, action understanding involves dedicated operations which probably require right posterior regions, consistent with their involvement in social interactions.

  14. Retrievability of high-level nuclear waste from geologic repositories - Regulatory and rock mechanics/design considerations

    International Nuclear Information System (INIS)

    Tanious, N.S.; Nataraja, M.S.; Daemen, J.J.K.

    1987-01-01

    Retrievability of nuclear waste from high-level geologic repositories is one of the performance objectives identified in 10CFR60 (Code of Federal Regulations, 1985). 10CFR60.111 states that the geologic repository operations area shall be designed to preserve the option of waste retrieval. In designing the repository operations area, rock mechanics considerations play a major role especially in evaluating the feasibility of retrieval operations. This paper discusses generic considerations affecting retrievability as they relate to repository design, construction, and operation, with emphasis on regulatory and rock mechanics aspects

  15. Mechanical properties and failure mechanisms of graphene under a central load.

    Science.gov (United States)

    Wang, Shuaiwei; Yang, Baocheng; Zhang, Shouren; Yuan, Jinyun; Si, Yubing; Chen, Houyang

    2014-09-15

    By employing molecular dynamics simulations, the evolution of deformation of a monolayer graphene sheet under a central transverse loading are investigated. Dependence of mechanical responses on the symmetry (shape) of the loading domain, on the size of the graphene sheet, and on temperature, is determined. It is found that the symmetry of the loading domain plays a central role in fracture strength and strain. By increasing the size of the graphene sheet or increasing temperature, the tensile strength and fracture strain decrease. The results have demonstrated that the breaking force and breaking displacement are sensitive to both temperature and the symmetry of the loading domain. In addition, we find that the intrinsic strength of graphene under a central load is much smaller than that of graphene under a uniaxial load. By examining the deformation processes, two failure mechanisms are identified namely, brittle bond breaking and plastic relaxation. In the second mechanism, the Stone-Wales transformation occurs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Microcracking in composite laminates under thermal and mechanical loading. Thesis

    Science.gov (United States)

    Maddocks, Jason R.

    1995-01-01

    Composites used in space structures are exposed to both extremes in temperature and applied mechanical loads. Cracks in the matrix form, changing the laminate thermoelastic properties. The goal of the present investigation is to develop a predictive methodology to quantify microcracking in general composite laminates under both thermal and mechanical loading. This objective is successfully met through a combination of analytical modeling and experimental investigation. In the analysis, the stress and displacement distributions in the vicinity of a crack are determined using a shear lag model. These are incorporated into an energy based cracking criterion to determine the favorability of crack formation. A progressive damage algorithm allows the inclusion of material softening effects and temperature-dependent material properties. The analysis is implemented by a computer code which gives predicted crack density and degraded laminate properties as functions of any thermomechanical load history. Extensive experimentation provides verification of the analysis. AS4/3501-6 graphite/epoxy laminates are manufactured with three different layups to investigate ply thickness and orientation effects. Thermal specimens are cooled to progressively lower temperatures down to -184 C. After conditioning the specimens to each temperature, cracks are counted on their edges using optical microscopy and in their interiors by sanding to incremental depths. Tensile coupons are loaded monotonically to progressively higher loads until failure. Cracks are counted on the coupon edges after each loading. A data fit to all available results provides input parameters for the analysis and shows them to be material properties, independent of geometry and loading. Correlation between experiment and analysis is generally very good under both thermal and mechanical loading, showing the methodology to be a powerful, unified tool. Delayed crack initiation observed in a few cases is attributed to a

  17. Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency

    Directory of Open Access Journals (Sweden)

    Manoj Kulkarni

    2017-12-01

    gold-standard reference genome sequence and advent of genome editing technologies, are expected to aid in deciphering of the functional roles of genes and regulatory networks underlying adaptive phenological traits, and utilizing the outcomes of such studies in developing drought tolerant cultivars.

  18. Regulation of the CDP-choline pathway by sterol regulatory element binding proteins involves transcriptional and post-transcriptional mechanisms.

    Science.gov (United States)

    Ridgway, Neale D; Lagace, Thomas A

    2003-06-15

    The synthesis of phosphatidylcholine (PtdCho) by the CDP-choline pathway is under the control of the rate-limiting enzyme CTP:phosphocholine cytidylyltransferase (CCT). Sterol regulatory element binding proteins (SREBPs) have been proposed to regulate CCT at the transcriptional level, or via the synthesis of lipid activators or substrates of the CDP-choline pathway. To assess the contributions of these two mechanisms, we examined CCTalpha expression and PtdCho synthesis by the CDP-choline pathway in cholesterol and fatty acid auxotrophic CHO M19 cells inducibly expressing constitutively active nuclear forms of SREBP1a or SREBP2. Induction of either SREBP resulted in increased expression of mRNAs for sterol-regulated genes, elevated fatty acid and cholesterol synthesis (>10-50-fold) and increased PtdCho synthesis (2-fold). CCTalpha mRNA was increased 2-fold by enforced expression of SREBP1a or SREBP2. The resultant increase in CCTalpha protein and activity (2-fold) was restricted primarily to the soluble fraction of cells, and increased CCTalpha activity in vivo was not detected. Inhibition of the synthesis of fatty acids or their CoA esters by cerulenin or triacsin C respectively following SREBP induction effectively blocked the accompanying elevation in PtdCho synthesis. Thus PtdCho synthesis was driven by increased synthesis of fatty acids or a product thereof. These data show that transcriptional activation of CCTalpha is modest relative to that of other SREBP-regulated genes, and that stimulation of PtdCho synthesis by SREBPs in CHO cells is due primarily to increased fatty acid synthesis.

  19. Blue Water Footprint Management in a UK Poultry Supply Chain under Environmental Regulatory Constraints

    Directory of Open Access Journals (Sweden)

    Naoum Tsolakis

    2018-02-01

    Full Text Available Chicken is the most consumed meat in the UK, accounting for 40% of meat consumption, while national production sufficiency reaches about 80%. As a farmed animal product, chicken meat is responsible for significant freshwater appropriation volumes during its production cycle. In this context, this research aims at exploring freshwater dynamics in the UK processed poultry industry. Specifically, we develop a System Dynamics model to capture the blue water footprint, as a key sustainability performance indicator of a poultry supply chain, in the case that relevant environmental and regulatory constraints are applied. The model contributes towards investigating the impact of two potential policy-making scenarios, namely, the “water penalty” and the “water tax”, on the nexus between profitability and water usage across the poultry supply chain. Responding to the regulatory constraints, the food processor either reconfigures the supply chain through rethinking desired inventory levels or implements a water management intervention. The results indicate that investing in water-friendly production technologies could offer a greater advantage to sustainable supply chains in terms of blue water efficiency and profitability, compared to employing inventory management strategies. Overall, our analysis highlights that effective policy-making and technology-driven interventions could provide potential towards ensuring economic growth and environmental sustainability of the UK poultry sector.

  20. Air Emissions Damages from Municipal Drinking Water Treatment Under Current and Proposed Regulatory Standards.

    Science.gov (United States)

    Gingerich, Daniel B; Mauter, Meagan S

    2017-09-19

    Water treatment processes present intersectoral and cross-media risk trade-offs that are not presently considered in Safe Drinking Water Act regulatory analyses. This paper develops a method for assessing the air emission implications of common municipal water treatment processes used to comply with recently promulgated and proposed regulatory standards, including concentration limits for, lead and copper, disinfection byproducts, chromium(VI), strontium, and PFOA/PFOS. Life-cycle models of electricity and chemical consumption for individual drinking water unit processes are used to estimate embedded NO x , SO 2 , PM 2.5 , and CO 2 emissions on a cubic meter basis. We estimate air emission damages from currently installed treatment processes at U.S. drinking water facilities to be on the order of $500 million USD annually. Fully complying with six promulgated and proposed rules would increase baseline air emission damages by approximately 50%, with three-quarters of these damages originating from chemical manufacturing. Despite the magnitude of these air emission damages, the net benefit of currently implemented rules remains positive. For some proposed rules, however, the promise of net benefits remains contingent on technology choice.

  1. Mechanical Modeling of a WIPP Drum Under Pressure

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Jeffrey A. [Sandia National Laboratories, Albuquerque, NM (United States)

    2014-11-25

    Mechanical modeling was undertaken to support the Waste Isolation Pilot Plant (WIPP) technical assessment team (TAT) investigating the February 14th 2014 event where there was a radiological release at the WIPP. The initial goal of the modeling was to examine if a mechanical model could inform the team about the event. The intention was to have a model that could test scenarios with respect to the rate of pressurization. It was expected that the deformation and failure (inability of the drum to contain any pressure) would vary according to the pressurization rate. As the work progressed there was also interest in using the mechanical analysis of the drum to investigate what would happen if a drum pressurized when it was located under a standard waste package. Specifically, would the deformation be detectable from camera views within the room. A finite element model of a WIPP 55-gallon drum was developed that used all hex elements. Analyses were conducted using the explicit transient dynamics module of Sierra/SM to explore potential pressurization scenarios of the drum. Theses analysis show similar deformation patterns to documented pressurization tests of drums in the literature. The calculated failure pressures from previous tests documented in the literature vary from as little as 16 psi to 320 psi. In addition, previous testing documented in the literature shows drums bulging but not failing at pressures ranging from 69 to 138 psi. The analyses performed for this study found the drums failing at pressures ranging from 35 psi to 75 psi. When the drums are pressurized quickly (in 0.01 seconds) there is significant deformation to the lid. At lower pressurization rates the deformation of the lid is considerably less, yet the lids will still open from the pressure. The analyses demonstrate the influence of pressurization rate on deformation and opening pressure of the drums. Analyses conducted with a substantial mass on top of the closed drum demonstrate that the

  2. Kinetic characterization of Vibrio cholerae ApbE: Substrate specificity and regulatory mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Xuan; Liang, Pingdong; Raba, Daniel Alexander; Rosas-Lemus, Mónica; Chakravarthy, Srinivas; Tuz, Karina; Juárez, Oscar; Permyakov, Eugene A.

    2017-10-24

    ApbE is a member of a novel family of flavin transferases that incorporates flavin mononucleotide (FMN) to subunits of diverse respiratory complexes, which fulfill important homeostatic functions. In this work a detailed characterization of Vibrio cholerae ApbE physiologic activity, substrate specificity and pH dependency was carried out. The data obtained show novel characteristics of the regulation and function of this family. For instance, our experiments indicate that divalent cations are essential for ApbE function, and that the selectivity depends largely on size and the coordination sphere of the cation. Our data also show that ApbE regulation by pH, ADP and potassium is an important mechanism that enhances the adaptation, survival and colonization of V. cholerae in the small intestine. Moreover, studies of the pH-dependency of the activity show that the reaction is favored under alkaline conditions, with a pKa of 8.4. These studies, together with sequence and structure analysis allowed us to identify His257, which is absolutely conserved in the family, as a candidate for the residue whose deprotonation controls the activity. Remarkably, the mutant H257G abolished the flavin transfer activity, strongly indicating that this residue plays an important role in the catalytic mechanism of ApbE.

  3. Video analysis of concussion injury mechanism in under-18 rugby

    Science.gov (United States)

    Hendricks, Sharief; O'Connor, Sam; Lambert, Michael; Brown, James C; Burger, Nicholas; Mc Fie, Sarah; Readhead, Clint; Viljoen, Wayne

    2016-01-01

    Background Understanding the mechanism of injury is necessary for the development of effective injury prevention strategies. Video analysis of injuries provides valuable information on the playing situation and athlete-movement patterns, which can be used to formulate these strategies. Therefore, we conducted a video analysis of the mechanism of concussion injury in junior-level rugby union and compared it with a representative and matched non-injury sample. Methods Injury reports for 18 concussion events were collected from the 2011 to 2013 under-18 Craven Week tournaments. Also, video footage was recorded for all 3 years. On the basis of the injury events, a representative ‘control’ sample of matched non-injury events in the same players was identified. The video footage, which had been recorded at each tournament, was then retrospectively analysed and coded. 10 injury events (5 tackle, 4 ruck, 1 aerial collision) and 83 non-injury events were analysed. Results All concussions were a result of contact with an opponent and 60% of players were unaware of the impending contact. For the measurement of head position on contact, 43% had a ‘down’ position, 29% the ‘up and forward’ and 29% the ‘away’ position (n=7). The speed of the injured tackler was observed as ‘slow’ in 60% of injurious tackles (n=5). In 3 of the 4 rucks in which injury occurred (75%), the concussed player was acting defensively either in the capacity of ‘support’ (n=2) or as the ‘jackal’ (n=1). Conclusions Training interventions aimed at improving peripheral vision, strengthening of the cervical muscles, targeted conditioning programmes to reduce the effects of fatigue, and emphasising safe and effective playing techniques have the potential to reduce the risk of sustaining a concussion injury. PMID:27900149

  4. Video analysis of concussion injury mechanism in under-18 rugby.

    Science.gov (United States)

    Hendricks, Sharief; O'Connor, Sam; Lambert, Michael; Brown, James C; Burger, Nicholas; Mc Fie, Sarah; Readhead, Clint; Viljoen, Wayne

    2016-01-01

    Understanding the mechanism of injury is necessary for the development of effective injury prevention strategies. Video analysis of injuries provides valuable information on the playing situation and athlete-movement patterns, which can be used to formulate these strategies. Therefore, we conducted a video analysis of the mechanism of concussion injury in junior-level rugby union and compared it with a representative and matched non-injury sample. Injury reports for 18 concussion events were collected from the 2011 to 2013 under-18 Craven Week tournaments. Also, video footage was recorded for all 3 years. On the basis of the injury events, a representative 'control' sample of matched non-injury events in the same players was identified. The video footage, which had been recorded at each tournament, was then retrospectively analysed and coded. 10 injury events (5 tackle, 4 ruck, 1 aerial collision) and 83 non-injury events were analysed. All concussions were a result of contact with an opponent and 60% of players were unaware of the impending contact. For the measurement of head position on contact , 43% had a 'down' position, 29% the 'up and forward' and 29% the 'away' position (n=7). The speed of the injured tackler was observed as 'slow' in 60% of injurious tackles (n=5). In 3 of the 4 rucks in which injury occurred (75%), the concussed player was acting defensively either in the capacity of 'support' (n=2) or as the 'jackal' (n=1). Training interventions aimed at improving peripheral vision, strengthening of the cervical muscles, targeted conditioning programmes to reduce the effects of fatigue, and emphasising safe and effective playing techniques have the potential to reduce the risk of sustaining a concussion injury.

  5. Underlying Mechanisms of Tinnitus: Review and Clinical Implications

    Science.gov (United States)

    Henry, James A.; Roberts, Larry E.; Caspary, Donald M.; Theodoroff, Sarah M.; Salvi, Richard J.

    2016-01-01

    Background The study of tinnitus mechanisms has increased tenfold in the last decade. The common denominator for all of these studies is the goal of elucidating the underlying neural mechanisms of tinnitus with the ultimate purpose of finding a cure. While these basic science findings may not be immediately applicable to the clinician who works directly with patients to assist them in managing their reactions to tinnitus, a clear understanding of these findings is needed to develop the most effective procedures for alleviating tinnitus. Purpose The goal of this review is to provide audiologists and other health-care professionals with a basic understanding of the neurophysiological changes in the auditory system likely to be responsible for tinnitus. Results It is increasingly clear that tinnitus is a pathology involving neuroplastic changes in central auditory structures that take place when the brain is deprived of its normal input by pathology in the cochlea. Cochlear pathology is not always expressed in the audiogram but may be detected by more sensitive measures. Neural changes can occur at the level of synapses between inner hair cells and the auditory nerve and within multiple levels of the central auditory pathway. Long-term maintenance of tinnitus is likely a function of a complex network of structures involving central auditory and nonauditory systems. Conclusions Patients often have expectations that a treatment exists to cure their tinnitus. They should be made aware that research is increasing to discover such a cure and that their reactions to tinnitus can be mitigated through the use of evidence-based behavioral interventions. PMID:24622858

  6. Mechanisms underlying recovery of zooplankton in Lake Orta after liming

    Directory of Open Access Journals (Sweden)

    Roberta Piscia

    2016-04-01

    Full Text Available The goal of this study was to improve the understanding of the large-scale mechanisms underlying the recovery of the zooplankton of Lake Orta from historical contamination, following reduced input of ammonia and metals and the subsequent 1989/90 liming intervention. The industrial pollution had been severe and long-lasting (1929-1990. Zooplankton biodiversity has improved, but most of the new taxa appearing in our counts are rotifers, while many calanoids and the large cladoceran predators (Bythotrephes and Leptodora that are common in the nearby Lake Maggiore, were still absent from Lake Orta 17 years after liming. To aid understanding of the large-scale mechanisms controlling changes in annual richness, we assessed the annual persistence (P of Crustacea and Rotifera taxa as an estimator of whether propagules that survived introduction, as result of the natural recolonization process, also thrived. We found that the rate of introduction of zooplankton colonists and their persistence in the water column of Lake Orta changed from 1971 to 2007. New rotifer taxa appeared in the lake after the mid-1980s, when discharge of toxic substances decreased, but their annual persistence was low (P<0.5 until the turn of the century. The numerical values of rotifer and crustacean persistence in Lake Orta were unexpectedly high in 2001 and 2007 (0.55 and 0.72 for rotifers, 0.85 and 0.86 for crustacean, respectively, much higher than in limed lakes in Sudbury, Canada, and in adjacent Lake Maggiore. We hypothesize this could be related to the lack of Cladoceran predators and zooplanktivorous fish in the pelagic waters of Lake Orta.

  7. Mechanisms underlying stage-1 TRPL channel translocation in Drosophila photoreceptors.

    Directory of Open Access Journals (Sweden)

    Minh-Ha Lieu

    Full Text Available TRP channels function as key mediators of sensory transduction and other cellular signaling pathways. In Drosophila, TRP and TRPL are the light-activated channels in photoreceptors. While TRP is statically localized in the signaling compartment of the cell (the rhabdomere, TRPL localization is regulated by light. TRPL channels translocate out of the rhabdomere in two distinct stages, returning to the rhabdomere with dark-incubation. Translocation of TRPL channels regulates their availability, and thereby the gain of the signal. Little, however, is known about the mechanisms underlying this trafficking of TRPL channels.We first examine the involvement of de novo protein synthesis in TRPL translocation. We feed flies cycloheximide, verify inhibition of protein synthesis, and test for TRPL translocation in photoreceptors. We find that protein synthesis is not involved in either stage of TRPL translocation out of the rhabdomere, but that re-localization to the rhabdomere from stage-1, but not stage-2, depends on protein synthesis. We also characterize an ex vivo eye preparation that is amenable to biochemical and genetic manipulation. We use this preparation to examine mechanisms of stage-1 TRPL translocation. We find that stage-1 translocation is: induced with ATP depletion, unaltered with perturbation of the actin cytoskeleton or inhibition of endocytosis, and slowed with increased membrane sterol content.Our results indicate that translocation of TRPL out of the rhabdomere is likely due to protein transport, and not degradation/re-synthesis. Re-localization from each stage to the rhabdomere likely involves different strategies. Since TRPL channels can translocate to stage-1 in the absence of ATP, with no major requirement of the cytoskeleton, we suggest that stage-1 translocation involves simple diffusion through the apical membrane, which may be regulated by release of a light-dependent anchor in the rhabdomere.

  8. The behavior of the planetary rings under the Kozai Mechanism

    Science.gov (United States)

    Sucerquia, M. A.; Ramírez, C. V.; Zuluaga, J. I.

    2017-07-01

    Rings are one of the main feature of almost all giant planets in the Solar System. Even though thousands of exoplanets have been discovered to date, no evidence of exoplanetary rings have been found despite the effort made in the development and enhancing of techniques and methods for direct or indirect detection. In the transit of a ringed planet, the dynamic of the ring itself could play a meaningful role due to the so called Kozai Mechanism (KM) acting on each particle of it. When some specific initial conditions of the ring are fulfilled (as a ring inclination greater than ˜ 39°), KM generates short periodic changes in the inclination and eccentricity of each particle, leading to a meaningful characteristic collective behavior of the ring: it changes its width, inclination and optical depth. These changes induce periodic variations on the eclipsed area of the parent star, generating slight changes in the observed transit signal. Under this mechanism, light curves depths and shapes oscillate according to the fluctuations of the ring. To show this effect we have performed numerical simulations of the dynamic of a system of particles to asses the ring inclination and width variations over time. We have calculated the expected variations in the transit depth and finally, we have estimated the effect on the light curve of a hypothetical ringed exoplanet affected by the KM. The detection of this effect could be used as an alternative method to detect/confirm exoplanetary rings, and also it could be considered as a way to explain anomalous light curves patterns of exoplanets, as the case of KIC 8462852 star.

  9. Neural Mechanisms Underlying Hyperphagia in Prader-Willi Syndrome

    Science.gov (United States)

    Holsen, Laura M.; Zarcone, Jennifer R.; Brooks, William M.; Butler, Merlin G.; Thompson, Travis I.; Ahluwalia, Jasjit S.; Nollen, Nicole L.; Savage, Cary R.

    2006-01-01

    Objective Prader-Willi syndrome (PWS) is a genetic disorder associated with developmental delay, obesity, and obsessive behavior related to food consumption. The most striking symptom of PWS is hyperphagia; as such, PWS may provide important insights into factors leading to overeating and obesity in the general population. We used functional magnetic resonance imaging to study the neural mechanisms underlying responses to visual food stimuli, before and after eating, in individuals with PWS and a healthy weight control (HWC) group. Research Methods and Procedures Participants were scanned once before (pre-meal) and once after (post-meal) eating a standardized meal. Pictures of food, animals, and blurred control images were presented in a block design format during acquisition of functional magnetic resonance imaging data. Results Statistical contrasts in the HWC group showed greater activation to food pictures in the pre-meal condition compared with the post-meal condition in the amygdala, orbitofrontal cortex, medial prefrontal cortex (medial PFC), and frontal operculum. In comparison, the PWS group exhibited greater activation to food pictures in the post-meal condition compared with the pre-meal condition in the orbitofrontal cortex, medial PFC, insula, hippocampus, and parahippocampal gyrus. Between-group contrasts in the pre- and post-meal conditions confirmed group differences, with the PWS group showing greater activation than the HWC group after the meal in food motivation networks. Discussion Results point to distinct neural mechanisms associated with hyperphagia in PWS. After eating a meal, the PWS group showed hyperfunction in limbic and para-limbic regions that drive eating behavior (e.g., the amygdala) and in regions that suppress food intake (e.g., the medial PFC). PMID:16861608

  10. Neural mechanisms underlying hyperphagia in Prader-Willi syndrome.

    Science.gov (United States)

    Holsen, Laura M; Zarcone, Jennifer R; Brooks, William M; Butler, Merlin G; Thompson, Travis I; Ahluwalia, Jasjit S; Nollen, Nicole L; Savage, Cary R

    2006-06-01

    Prader-Willi syndrome (PWS) is a genetic disorder associated with developmental delay, obesity, and obsessive behavior related to food consumption. The most striking symptom of PWS is hyperphagia; as such, PWS may provide important insights into factors leading to overeating and obesity in the general population. We used functional magnetic resonance imaging to study the neural mechanisms underlying responses to visual food stimuli, before and after eating, in individuals with PWS and a healthy weight control (HWC) group. Participants were scanned once before (pre-meal) and once after (post-meal) eating a standardized meal. Pictures of food, animals, and blurred control images were presented in a block design format during acquisition of functional magnetic resonance imaging data. Statistical contrasts in the HWC group showed greater activation to food pictures in the pre-meal condition compared with the post-meal condition in the amygdala, orbitofrontal cortex, medial prefrontal cortex (medial PFC), and frontal operculum. In comparison, the PWS group exhibited greater activation to food pictures in the post-meal condition compared with the pre-meal condition in the orbitofrontal cortex, medial PFC, insula, hippocampus, and parahippocampal gyrus. Between-group contrasts in the pre- and post-meal conditions confirmed group differences, with the PWS group showing greater activation than the HWC group after the meal in food motivation networks. Results point to distinct neural mechanisms associated with hyperphagia in PWS. After eating a meal, the PWS group showed hyperfunction in limbic and paralimbic regions that drive eating behavior (e.g., the amygdala) and in regions that suppress food intake (e.g., the medial PFC).

  11. Energy conservation, energy efficiency and energy savings regulatory hypotheses - taxation, subsidies and underlying economics

    Energy Technology Data Exchange (ETDEWEB)

    Trumpy, T. [International Legal Counsel, Brussels (Belgium)

    1995-12-01

    More efficient use of energy resources can be promoted by various regulatory means, i.e., taxation, subsidies, and pricing. Various incentives can be provided by income and revenue tax breaks-deductible energy audit fees, energy saving investment credits, breaks for energy saving entrepreneurs, and energy savings accounts run through utility accounts. Value added and excise taxes can also be adjusted to reward energy saving investments and energy saving entrepreneurial activity. Incentives can be provided in the form of cash refunds, including trade-in-and-scrap programs and reimbursements or subsidies on audit costs and liability insurance. Pricing incentives include lower rates for less energy use, prepayment of deposit related to peak load use, electronically dispatched multiple tariffs, savings credits based on prior peak use, and subsidized {open_quotes}leasing{close_quotes} of more efficient appliances and lights. Credits, with an emphasis on pooling small loans, and 5-year energy savings contracts are also discussed.

  12. Forecasting future utility and industrial SO/sub 2/ emissions under regulatory and economic uncertainty

    Energy Technology Data Exchange (ETDEWEB)

    Pechan, E.H.; Graves, K.; Turner, D.

    1985-01-01

    In this paper, national and regional forecasts of sulfur dioxide (SO/sub 2/) emissions from various source sectors are presented. The results focus on the effects of alternative economic and regulatory scenarios on the emission patterns. These emission estimates were obtained using the Environmental Trends Analysis Model II (ETAM II), an environmental forecasting model originally developed to support the U.S. Department of Energy's (DOE) 1983 National Energy Policy Plan (NEPP). Since then, it has been updated with modified algorithms, additional capabilities, and additional data. The resulting model, ETAM II, has been used for policy and sensitivity analyses in support of programs such as the Interagency Disability Task Force and the Interagency Prevention of Significant Deterioration Task Force. ETAM II is unique in that it both covers numerous residuals and all economic sectors discharging those residuals, and it is easy to use for policy analysis purposes.

  13. Mechanisms Underlying HIV-Associated Noninfectious Lung Disease.

    Science.gov (United States)

    Presti, Rachel M; Flores, Sonia C; Palmer, Brent E; Atkinson, Jeffrey J; Lesko, Catherine R; Lau, Bryan; Fontenot, Andrew P; Roman, Jesse; McDyer, John F; Twigg, Homer L

    2017-11-01

    Pulmonary disease remains a primary source of morbidity and mortality in persons living with HIV (PLWH), although the advent of potent combination antiretroviral therapy has resulted in a shift from predominantly infectious to noninfectious pulmonary complications. PLWH are at high risk for COPD, pulmonary hypertension, and lung cancer even in the era of combination antiretroviral therapy. The underlying mechanisms of this are incompletely understood, but recent research in both human and animal models suggests that oxidative stress, expression of matrix metalloproteinases, and genetic instability may result in lung damage, which predisposes PLWH to these conditions. Some of the factors that drive these processes include tobacco and other substance use, direct HIV infection and expression of specific HIV proteins, inflammation, and shifts in the microbiome toward pathogenic and opportunistic organisms. Further studies are needed to understand the relative importance of these factors to the development of lung disease in PLWH. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  14. Deciphering Molecular Mechanism Underlying Hypolipidemic Activity of Echinocystic Acid

    Directory of Open Access Journals (Sweden)

    Li Han

    2014-01-01

    Full Text Available Our previous study showed that a triterpene mixture, consisting of echinocystic acid (EA and oleanolic acid (OA at a ratio of 4 : 1, dose-dependently ameliorated the hyperlipidemia and atherosclerosis in rabbits fed with high fat/high cholesterol diets. This study was aimed at exploring the mechanisms underlying antihyperlipidemic effect of EA. Molecular docking simulation of EA was performed using Molegro Virtual Docker (version: 4.3.0 to investigate the potential targets related to lipid metabolism. Based on the molecular docking information, isotope labeling method or spectrophotometry was applied to examine the effect of EA on the activity of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA reductase, acyl-CoA:cholesterol acyltransferase (ACAT, and diacylglycerol acyltransferase (DGAT in rat liver microsomes. Our results revealed a strong affinity of EA towards ACAT and DGAT in molecular docking analysis, while low binding affinity existed between EA and HMG-CoA reductase as well as between EA and cholesteryl ester transfer protein. Consistent with the results of molecular docking, in vitro enzyme activity assays showed that EA inhibited ACAT and DGAT, with IC50 values of 103 and 139 μM, respectively, and exhibited no significant effect on HMG-CoA reductase activity. The present findings suggest that EA may exert hypolipidemic effect by inhibiting the activity of ACAT and DGAT.

  15. Molecular mechanisms underlying phosphate sensing, signaling, and adaptation in plants.

    Science.gov (United States)

    Zhang, Zhaoliang; Liao, Hong; Lucas, William J

    2014-03-01

    As an essential plant macronutrient, the low availability of phosphorus (P) in most soils imposes serious limitation on crop production. Plants have evolved complex responsive and adaptive mechanisms for acquisition, remobilization and recycling of phosphate (Pi) to maintain P homeostasis. Spatio-temporal molecular, physiological, and biochemical Pi deficiency responses developed by plants are the consequence of local and systemic sensing and signaling pathways. Pi deficiency is sensed locally by the root system where hormones serve as important signaling components in terms of developmental reprogramming, leading to changes in root system architecture. Root-to-shoot and shoot-to-root signals, delivered through the xylem and phloem, respectively, involving Pi itself, hormones, miRNAs, mRNAs, and sucrose, serve to coordinate Pi deficiency responses at the whole-plant level. A combination of chromatin remodeling, transcriptional and posttranslational events contribute to globally regulating a wide range of Pi deficiency responses. In this review, recent advances are evaluated in terms of progress toward developing a comprehensive understanding of the molecular events underlying control over P homeostasis. Application of this knowledge, in terms of developing crop plants having enhanced attributes for P use efficiency, is discussed from the perspective of agricultural sustainability in the face of diminishing global P supplies. © 2014 Institute of Botany, Chinese Academy of Sciences.

  16. Fatigue life prediction of mechanical structures under stochastic loading

    Directory of Open Access Journals (Sweden)

    Leitner Bohuš

    2018-01-01

    Full Text Available Problems of fatigue life prediction of materials and structures are discussed in the paper. Service loading is assumed as a continuous loading process with possible discontinuous events, which are caused by various operating conditions. The damage in a material is due to a cumulative degradation process. The damaging process is then represented either by rain-flow matrices or by a fatigue damage function which is derived using some hypothesis of a fatigue failure criterion. Presented theoretical procedure enables a very effective estimation of a service life and/or reliable evaluation of residual life of any structures under various types of loading and environmental conditions. This approach creates a good basis for powerful expert systems in structural and mechanical engineering. The aim of the paper is to present briefly some results of analysis of load-bearing steel structure loads of special railway crane PKP 25/20i which was utilized in some specific ad relatively hard operating conditions. Virtual models of the structure were being used in an analysis of acting working dynamics loads influence to be able to forecast fatigue life of load-bearing of the crane jib.

  17. Neural mechanisms underlying the induction and relief of perceptual curiosity

    Directory of Open Access Journals (Sweden)

    Marieke eJepma

    2012-02-01

    Full Text Available Curiosity is one of the most basic biological drives in both animals and humans, and has been identified as a key motive for learning and discovery. Despite the importance of curiosity and related behaviors, the topic has been largely neglected in human neuroscience; hence little is known about the neurobiological mechanisms underlying curiosity. We used functional magnetic resonance imaging (fMRI to investigate what happens in our brain during the induction and subsequent relief of perceptual curiosity. Our core findings were that (i the induction of perceptual curiosity, through the presentation of ambiguous visual input, activated the anterior insula and anterior cingulate cortex, brain regions sensitive to conflict and arousal; (ii the relief of perceptual curiosity, through visual disambiguation, activated regions of the striatum that have been related to reward processing; and (iii the relief of perceptual curiosity was associated with hippocampal activation and enhanced incidental memory. These findings provide the first demonstration of the neural basis of human perceptual curiosity. Our results provide neurobiological support for a classic psychological theory of curiosity, which holds that curiosity is an aversive condition of increased arousal whose termination is rewarding and facilitates memory.

  18. Spread of Epidemic on Complex Networks Under Voluntary Vaccination Mechanism

    Science.gov (United States)

    Xue, Shengjun; Ruan, Feng; Yin, Chuanyang; Zhang, Haifeng; Wang, Binghong

    Under the assumption that the decision of vaccination is a voluntary behavior, in this paper, we use two forms of risk functions to characterize how susceptible individuals estimate the perceived risk of infection. One is uniform case, where each susceptible individual estimates the perceived risk of infection only based on the density of infection at each time step, so the risk function is only a function of the density of infection; another is preferential case, where each susceptible individual estimates the perceived risk of infection not only based on the density of infection but only related to its own activities/immediate neighbors (in network terminology, the activity or the number of immediate neighbors is the degree of node), so the risk function is a function of the density of infection and the degree of individuals. By investigating two different ways of estimating the risk of infection for susceptible individuals on complex network, we find that, for the preferential case, the spread of epidemic can be effectively controlled; yet, for the uniform case, voluntary vaccination mechanism is almost invalid in controlling the spread of epidemic on networks. Furthermore, given the temporality of some vaccines, the waves of epidemic for two cases are also different. Therefore, our work insight that the way of estimating the perceived risk of infection determines the decision on vaccination options, and then determines the success or failure of control strategy.

  19. Mechanisms underlying the antihypertensive effects of garlic bioactives.

    Science.gov (United States)

    Shouk, Reem; Abdou, Aya; Shetty, Kalidas; Sarkar, Dipayan; Eid, Ali H

    2014-02-01

    Cardiovascular disease remains the leading cause of death worldwide with hypertension being a major contributing factor to cardiovascular disease-associated mortality. On a population level, non-pharmacological approaches, such as alternative/complementary medicine, including phytochemicals, have the potential to ameliorate cardiovascular risk factors, including high blood pressure. Several epidemiological studies suggest an antihypertensive effect of garlic (Allium sativum) and of many its bioactive components. The aim of this review is to present an in-depth discussion regarding the molecular, biochemical and cellular rationale underlying the antihypertensive properties of garlic and its bioactive constituents with a primary focus on S-allyl cysteine and allicin. Key studies, largely from PubMed, were selected and screened to develop a comprehensive understanding of the specific role of garlic and its bioactive constituents in the management of hypertension. We also reviewed recent advances focusing on the role of garlic bioactives, S-allyl cysteine and allicin, in modulating various parameters implicated in the pathogenesis of hypertension. These parameters include oxidative stress, nitric oxide bioavailability, hydrogen sulfide production, angiotensin converting enzyme activity, expression of nuclear factor-κB and the proliferation of vascular smooth muscle cells. This review suggests that garlic and garlic derived bioactives have significant medicinal properties with the potential for ameliorating hypertension and associated morbidity; however, further clinical and epidemiological studies are required to determine completely the specific physiological and biochemical mechanisms involved in disease prevention and management. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Flexibility in the structure of spiral flowers and its underlying mechanisms.

    Science.gov (United States)

    Wang, Peipei; Liao, Hong; Zhang, Wengen; Yu, Xianxian; Zhang, Rui; Shan, Hongyan; Duan, Xiaoshan; Yao, Xu; Kong, Hongzhi

    2015-12-07

    Spiral flowers usually bear a variable number of organs, suggestive of the flexibility in structure. The mechanisms underlying the flexibility, however, remain unclear. Here we show that in Nigella damascena, a species with spiral flowers, different types of floral organs show different ranges of variation in number. We also show that the total number of organs per flower is largely dependent on the initial size of the floral meristem, whereas the respective numbers of different types of floral organs are determined by the functional domains of corresponding genetic programmes. By conducting extensive expression and functional studies, we further elucidate the genetic programmes that specify the identities of different types of floral organs. Notably, the AGL6-lineage member NdAGL6, rather than the AP1-lineage members NdFL1/2, is an A-function gene, whereas petaloidy of sepals is not controlled by AP3- or PI-lineage members. Moreover, owing to the formation of a regulatory network, some floral organ identity genes also regulate the boundaries between different types of floral organs. On the basis of these results, we propose that the floral organ identity determination programme is highly dynamic and shows considerable flexibility. Transitions from spiral to whorled flowers, therefore, may be explained by evolution of the mechanisms that reduce the flexibility.

  1. Allergic contact dermatitis: epidemiology, molecular mechanisms, in vitro methods and regulatory aspects

    OpenAIRE

    Peiser, M.; Tralau, T.; Heidler, J.; Api, A.; Arts, J.; Basketter, D.; English, J.; Diepgen, T.; Fuhlbrigge, R.; Gaspari, A.; Johansen, J.; Karlberg, A.; Kimber, I.; Lepoittevin, J.; Liebsch, M.

    2012-01-01

    Contact allergies are complex diseases, and one of the important challenges for public health and immunology. The German ‘Federal Institute for Risk Assessment’ hosted an ‘International Workshop on Contact Dermatitis’. The scope of the workshop was to discuss new discoveries and developments in the field of contact dermatitis. This included the epidemiology and molecular biology of contact allergy, as well as the development of new in vitro methods. Furthermore, it considered regulatory aspec...

  2. On the evolution of the regulatory guidance for seismic qualification of electric and active mechanical equipment for nuclear power plants

    International Nuclear Information System (INIS)

    Ng, Ching Hang; Chen, Pei-Ying

    2009-01-01

    All electric and active mechanical equipment important to safety for nuclear power plants must be seismically qualified by testing, analysis, or combined analysis and testing. The general requirements for seismic qualification of electric and active mechanical equipment in nuclear power plants are delineated in Appendix S, 'Earthquake Engineering Criteria for Nuclear Power Plants,' to Title 10, Part 50, 'Domestic Licensing of Production and Utilization Facilities,' of the Code of Federal Regulations (10 CFR Part 50), item 52.47(20) of 10 CFR 52.47, 'Contents of Applications; Technical Information,' and Appendix A, 'Seismic and Geologic Siting Criteria for Nuclear Power Plants,' to 10 CFR Part 100, 'Reactor Site Criteria.' The United States Nuclear Regulatory Commission (NRC) issued Revision 2 of Regulatory Guide (RG) 1.100, 'Seismic Qualification of Electric and Mechanical for Nuclear Power Plants' in 1988, which endorsed, with restrictions, exceptions, and clarifications, Institute of Electrical and Electronics Engineers (IEEE) Standard 344-1987 'IEEE Recommended Practice for Seismic Qualification of Class 1E Equipment for Nuclear Power Generating Stations,' for use in seismic qualification of both electric and mechanical equipment. In 2008, the staff at the NRC drafted Revision 3 of RG 1.100 to endorse, with restrictions, exceptions, and clarifications, the IEEE Std 344-2004 and the American Society of Mechanical Engineers (ASME) QME-1-2007 'Qualification of Active Mechanical Equipment Used in Nuclear Power Plants.' IEEE Std 344-2004 was an update of Std 344-1987 and ASME QME-1-2007 was an update of QME-1-2002. The major changes in IEEE Std 344-2004 and ASME QME-1-2007 include the update and expansion of criteria and procedures describing the use of experience data as a method for seismic qualification of Class 1E electric equipment (including I and C components) as well as active mechanical equipment. In this paper, the staff will compare the draft Revision 3 to

  3. Procedural Justice for ‘Weaker Parties’ in Cross-Border Litigation under the EU Regulatory Scheme

    Directory of Open Access Journals (Sweden)

    Vesna Lazić

    2014-11-01

    Full Text Available This article discusses how procedural justice for consumers, employees and insurance policy holders or other beneficiaries under insurance contracts has been ensured in the legal instruments of the EU legislator. The analysis focuses on the Brussels Jurisdiction Regulation, both under the current regulatory scheme and in its recently revised version. Thereby, the rules on jurisdiction, the enforcement of judgments in civil and commercial matters, as well as instruments that unify certain rules of civil procedure have been analysed. Within the context of the rules on jurisdiction, the relevance of the EU legislation for the validity and enforceability of jurisdictional clauses against weaker parties is addressed. Thereby express provisions in EU legislation, as well as relevant case law of the CJEU, have been the subject of the analysis. The changes introduced by the revised Regulation are discussed in great detail.

  4. Mechanism of crack initiation and crack growth under thermal and mechanical fatigue loading

    International Nuclear Information System (INIS)

    Utz, S.; Soppa, E.; Silcher, H.; Kohler, C.

    2013-01-01

    The present contribution is focused on the experimental investigations and numerical simulations of the deformation behaviour and crack development in the austenitic stainless steel X6CrNiNb18-10 under thermal and mechanical cyclic loading in HCF and LCF regimes. The main objective of this research is the understanding of the basic mechanisms of fatigue damage and the development of simulation methods, which can be applied further in safety evaluations of nuclear power plant components. In this context the modelling of crack initiation and crack growth inside the material structure induced by varying thermal or mechanical loads are of particular interest. The mechanisms of crack initiation depend among other things on the type of loading, microstructure, material properties and temperature. The Nb-stabilized austenitic stainless steel in the solution-annealed condition was chosen for the investigations. Experiments with two kinds of cyclic loading - pure thermal and pure mechanical - were carried out and simulated. The fatigue behaviour of the steel X6CrNiNb18-10 under thermal loading was studied within the framework of the joint research project [4]. Interrupted thermal cyclic tests in the temperature range of 150 C to 300 C combined with non-destructive residual stress measurements (XRD) and various microscopic investigations, e.g. in SEM (Scanning Electron Microscope), were used to study the effects of thermal cyclic loading on the material. This thermal cyclic loading leads to thermal induced stresses and strains. As a result intrusions and extrusions appear inside the grains (at the surface), at which microcracks arise and evolve to a dominant crack. Finally, these microcracks cause a continuous and significant decrease of residual stresses. The fatigue behaviour of the steel X6CrNiNb18-10 under mechanical loading at room temperature was studied within the framework of the research project [5], [8]. With a combination of interrupted LCF tests and EBSD

  5. Mechanism of crack initiation and crack growth under thermal and mechanical fatigue loading

    Energy Technology Data Exchange (ETDEWEB)

    Utz, S.; Soppa, E.; Silcher, H.; Kohler, C. [Stuttgart Univ. (Germany). Materials Testing Inst.

    2013-07-01

    The present contribution is focused on the experimental investigations and numerical simulations of the deformation behaviour and crack development in the austenitic stainless steel X6CrNiNb18-10 under thermal and mechanical cyclic loading in HCF and LCF regimes. The main objective of this research is the understanding of the basic mechanisms of fatigue damage and the development of simulation methods, which can be applied further in safety evaluations of nuclear power plant components. In this context the modelling of crack initiation and crack growth inside the material structure induced by varying thermal or mechanical loads are of particular interest. The mechanisms of crack initiation depend among other things on the type of loading, microstructure, material properties and temperature. The Nb-stabilized austenitic stainless steel in the solution-annealed condition was chosen for the investigations. Experiments with two kinds of cyclic loading - pure thermal and pure mechanical - were carried out and simulated. The fatigue behaviour of the steel X6CrNiNb18-10 under thermal loading was studied within the framework of the joint research project [4]. Interrupted thermal cyclic tests in the temperature range of 150 C to 300 C combined with non-destructive residual stress measurements (XRD) and various microscopic investigations, e.g. in SEM (Scanning Electron Microscope), were used to study the effects of thermal cyclic loading on the material. This thermal cyclic loading leads to thermal induced stresses and strains. As a result intrusions and extrusions appear inside the grains (at the surface), at which microcracks arise and evolve to a dominant crack. Finally, these microcracks cause a continuous and significant decrease of residual stresses. The fatigue behaviour of the steel X6CrNiNb18-10 under mechanical loading at room temperature was studied within the framework of the research project [5], [8]. With a combination of interrupted LCF tests and EBSD

  6. Mechanisms underlying the antihypertensive properties of Urtica dioica.

    Science.gov (United States)

    Qayyum, Rahila; Qamar, Hafiz Misbah-Ud-Din; Khan, Shamim; Salma, Umme; Khan, Taous; Shah, Abdul Jabbar

    2016-09-01

    Urtica dioica has traditionally been used in the management of cardiovascular disorders especially hypertension. The aim of this study was to explore pharmacological base of its use in hypertension. Crude methanolic extract of U. dioica (Ud.Cr) and its fractions (Ud.EtAc, Ud.nHex, Ud.Chl and Ud.Aq) were tested in vivo on normotensive and hypertensive rats under anesthesia for blood pressure lowering effect. In-vitro experiments on rat and rabbit aortae were employed to probe the vasorelaxation mechanism(s). The responses were measured using pressure and force transducers connected to PowerLab Data Acquisition System. Ud.Cr and fractions were found more effective antihypertensive in hypertensive rats than normotensive with remarkable potency exhibited by the ethyl acetate fraction. The effect was same in the presence of atropine. In isolated rat aortic rings, Ud.Cr and all its fractions exhibited L-NAME sensitive endothelium-dependent vasodilator effect and also inhibit K(+) (80 mM)-induced pre-contractions. In isolated rabbit thoracic aortic rings Ud.Cr and its fractions induced relaxation with more potency against K(+) (80 mM) than phenylephrine (1 µM) like verapamil, showing Ud.EtAc fraction the most potent one. Pre-incubation of aortic rings with Ud.Cr and its fractions exhibited Ca(2+) channel blocking activity comparable with verapamil by shifting Ca(2+) concentration response curves to the right. Ud.Cr and its fractions also ablated the intracellular Ca(2+) release by suppressing PE peak formation in Ca(2+) free medium. When tested on basal tension, the crude extract and all fractions were devoid of any vasoconstrictor effect. These data indicate that crude methanolic extract and its fractions possess antihypertensive effect. Identification of NO-mediated vasorelaxation and calcium channel blocking effects explain the antihypertensive potential of U. dioica and provide a potential pharmacological base to its medicinal use in the management of hypertension.

  7. Antioxidant Property of Jobelyn as the Possible Mechanism Underlying

    Directory of Open Access Journals (Sweden)

    Solomon Umukoro

    2013-01-01

    Full Text Available   Introduction: Amnesia or loss of memory is the cardinal hallmark of Alzheimer’s disease (AD, a progressive neurodegenerative disorder associated with ageing process. Although, AD had been discovered over a century ago, drugs which could cure or halt the progression of the disease are yet to see the light of the day. However, there has been a growing interest in the use of phytomedicines with multipronged mechanisms of action that could target various aspects of the pathologies of AD. Jobelyn (JB is a potent antioxidant African polyherbal formulation with active components that have been acclaimed to show neuroprotection. T his investigation was carried out to evaluate whether JB has anti-amnesic and antioxidant activities.   Methods: The alteration of alternation behavior in the Y-maze paradigm was utilized as the test for memory function in mice. The effect of JB on a cetylcholinesterase (AChE activity, malondialdehyde (MDA level and the concentrations of glutathione (GSH in the frontal cortex and hippocampus were assessed in rats as means of providing insight into the mechanism underlying its anti-amnesic activity. The animals were given JB (1, 2.5 or 5mg/kg, i.p. daily for 7 days before the biochemical assays or test for memory functions were carried out.   Results: JB was found to produce a significant increase in the level of alternation behavior compared with the control, suggesting anti-amnesic activity. Also, JB reversed the memory impairment induced by scopolamine, which further indicates anti-amnesic property. Furthermore, JB demonstrated a significant inhibition of MDA formation in the frontal cortex and hippocampus of rats, indicating antioxidant property. In addition, it increased the defense armory of the brain tissues, as it significantly increased the concentrations of GSH in the frontal cortex and hippocampus of rats. However, JB did not demonstrate any inhibitory effect against AChE activity in the frontal cortex and

  8. Bronchopulmonary dysplasia: understanding of the underlying pathological mechanisms

    Directory of Open Access Journals (Sweden)

    Daniela Fanni

    2014-06-01

    better understanding of the underlying pathological mechanisms of BPD might provide insight into development of new therapeutic and preventive strategies.  Proceedings of the International Course on Perinatal Pathology (part of the 10th International Workshop on Neonatology · October 22nd-25th, 2014 · Cagliari (Italy · October 25th, 2014 · The role of the clinical pathological dialogue in problem solving Guest Editors: Gavino Faa, Vassilios Fanos, Peter Van Eyken

  9. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    Science.gov (United States)

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  10. Alteration mechanisms of UOX spent fuel under water

    International Nuclear Information System (INIS)

    Muzeau, B.

    2008-06-01

    The mechanisms of spent fuel alteration in aqueous media need to be understood on the assumption of a direct disposal of the assemblies in a geological formation or for long duration storage in pool. This work is a contribution to the study of the effects of the alpha and/or beta/gamma radiolysis of water on the oxidation and the dissolution of the UO 2 matrix of UOX spent fuel. The effects of the alpha radiolysis, predominant in geological disposal conditions, were quantified by using samples of UO 2 doped with plutonium. The leaching experiments highlighted two types of control for the matrix alteration according to the alpha activity. The first is based on the radiolytic oxidation of the surface and leads to a continuous release of uranium in solution whereas the second is based on a control by the solubility of uranium. An activity threshold, between 18 MBq.g -1 and 33 MBq.g -1 , was defined in a carbonated water. The value of this threshold is dependent on the experimental conditions and the presence or not of electro-active species such as hydrogen in the system. The effects of the alpha/beta/gamma radiolysis in relation with the storage conditions were also quantified. The experimental data obtained on spent fuel indicate that the alteration rate of the matrix based on the behaviour of tracer elements (caesium and strontium) reached a maximum value of some mg.m -2 .d -1 , even under very oxidizing conditions. The solubility of uranium and the nature of the secondary phases depend however on the extent of the oxidizing conditions. (author)

  11. Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure

    Directory of Open Access Journals (Sweden)

    Wouter A. A. de Steenhuijsen Piters

    2016-03-01

    Full Text Available The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem—also called “microbiome”—is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1:e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting.

  12. Cognitive mechanisms underlying instructed choice exploration of small city maps

    Directory of Open Access Journals (Sweden)

    Sofia eSakellaridi

    2015-03-01

    Full Text Available We investigated the cognitive mechanisms underlying the exploration and decision-making in realistic and novel environments. Twelve human subjects were shown small circular U.S. city maps with two locations highlighted on the circumference, as possible choices for a post office (targets. At the beginning of a trial, subjects fixated a spot at the center of the map and ultimately chose one of the two locations. A space syntax analysis of the map paths (from the center to each target revealed that the chosen location was associated with the less convoluted path, as if subjects navigated mentally the paths in an ant’s way, i.e. by staying within street boundaries, and ultimately choosing the target that could be reached from the center in the shortest way, and the fewest turns and intersections. The subjects’ strategy for map exploration and decision making was investigated by monitoring eye position during the task. This revealed a restricted exploration of the map delimited by the location of the two alternative options and the center of the map. Specifically, subjects explored the areas around the two target options by repeatedly looking at them before deciding which one to choose, presumably implementing an evaluation and decision-making process. The ultimate selection of a specific target was significantly associated with the time spent exploring the area around that target. Finally, an analysis of the sequence of eye fixations revealed that subjects tended to look systematically towards the target ultimately chosen even from the beginning of the trial. This finding indicates an early cognitive selection bias for the ensuing decision process.

  13. Plant-insect interactions under bacterial influence: ecological implications and underlying mechanisms.

    Science.gov (United States)

    Sugio, Akiko; Dubreuil, Géraldine; Giron, David; Simon, Jean-Christophe

    2015-02-01

    Plants and insects have been co-existing for more than 400 million years, leading to intimate and complex relationships. Throughout their own evolutionary history, plants and insects have also established intricate and very diverse relationships with microbial associates. Studies in recent years have revealed plant- or insect-associated microbes to be instrumental in plant-insect interactions, with important implications for plant defences and plant utilization by insects. Microbial communities associated with plants are rich in diversity, and their structure greatly differs between below- and above-ground levels. Microbial communities associated with insect herbivores generally present a lower diversity and can reside in different body parts of their hosts including bacteriocytes, haemolymph, gut, and salivary glands. Acquisition of microbial communities by vertical or horizontal transmission and possible genetic exchanges through lateral transfer could strongly impact on the host insect or plant fitness by conferring adaptations to new habitats. Recent developments in sequencing technologies and molecular tools have dramatically enhanced opportunities to characterize the microbial diversity associated with plants and insects and have unveiled some of the mechanisms by which symbionts modulate plant-insect interactions. Here, we focus on the diversity and ecological consequences of bacterial communities associated with plants and herbivorous insects. We also highlight the known mechanisms by which these microbes interfere with plant-insect interactions. Revealing such mechanisms in model systems under controlled environments but also in more natural ecological settings will help us to understand the evolution of complex multitrophic interactions in which plants, herbivorous insects, and micro-organisms are inserted. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions

  14. Latent homology and convergent regulatory evolution underlies the repeated emergence of yeasts

    NARCIS (Netherlands)

    Nagy, László G; Ohm, Robin A; Kovács, Gábor M; Floudas, Dimitrios; Riley, Robert; Gácser, Attila; Sipiczki, Mátyás; Davis, John M; Doty, Sharon L; de Hoog, G Sybren; Lang, B Franz; Spatafora, Joseph W; Martin, Francis M; Grigoriev, Igor V; Hibbett, David S

    Convergent evolution is common throughout the tree of life, but the molecular mechanisms causing similar phenotypes to appear repeatedly are obscure. Yeasts have arisen in multiple fungal clades, but the genetic causes and consequences of their evolutionary origins are unknown. Here we show that the

  15. Latent homology and convergent regulatory evolution underlies the repeated emergence of yeasts

    NARCIS (Netherlands)

    Nagy, L.G.; Ohm, R.A.; Kovács, G.M.; Floudas, D.; Riley, R.; Gácser, A.; Sipiczki, M.; Davis, J.M.; Doty, S.L.; de Hoog, G.S.; Lang, B.F.; Spatafora, J.W.; Martin, F.M.; Grigoriev, I.V.; Hibbett, D.S.

    2014-01-01

    Convergent evolution is common throughout the tree of life, but the molecular mechanisms causing similar phenotypes to appear repeatedly are obscure. Yeasts have arisen in multiple fungal clades, but the genetic causes and consequences of their evolutionary origins are unknown. Here we show that the

  16. Mechanism of constitutive phosphoinositide 3-kinase activation by oncogenic mutants of the p85 regulatory subunit.

    Science.gov (United States)

    Shekar, S Chandra; Wu, Haiyan; Fu, Zheng; Yip, Shu-Chin; Nagajyothi; Cahill, Sean M; Girvin, Mark E; Backer, Jonathan M

    2005-07-29

    p85/p110 phosphoinositide 3-kinases regulate multiple cell functions and are frequently mutated in human cancer. The p85 regulatory subunit stabilizes and inhibits the p110 catalytic subunit. The minimal fragment of p85 capable of regulating p110 is the N-terminal SH2 domain linked to the coiled-coil iSH2 domain (referred to as p85ni). We have previously proposed that the conformationally rigid iSH2 domain tethers p110 to p85, facilitating regulatory interactions between p110 and the p85 nSH2 domain. In an oncogenic mutant of murine p85, truncation at residue 571 leads to constitutively increased phosphoinositide 3-kinase activity, which has been proposed to result from either loss of an inhibitory Ser-608 autophosphorylation site or altered interactions with cellular regulatory factors. We have examined this mutant (referred to as p65) in vitro and find that p65 binds but does not inhibit p110, leading to constitutive p110 activity. This activated phenotype is observed with recombinant proteins in the absence of cellular factors. Importantly, this effect is also produced by truncating p85ni at residue 571. Thus, the phenotype is not because of loss of the Ser-608 inhibitory autophosphorylation site, which is not present in p85ni. To determine the structural basis for the phenotype of p65, we used a broadly applicable spin label/NMR approach to define the positioning of the nSH2 domain relative to the iSH2 domain. We found that one face of the nSH2 domain packs against the 581-593 region of the iSH2 domain. The loss of this interaction in the truncated p65 would remove the orienting constraints on the nSH2 domain, leading to a loss of p110 regulation by the nSH2. Based on these findings, we propose a general model for oncogenic mutants of p85 and p110 in which disruption of nSH2-p110 regulatory contacts leads to constitutive p110 activity.

  17. Standard format and content of financial assurance mechanisms required for decommissioning under 10 CFR parts 30, 40, 70, and 72

    International Nuclear Information System (INIS)

    1990-06-01

    The purpose of this regulatory guide, ''Standard Format and Content of Financial Assurance Mechanisms Required for Decommissioning Under 10 CFR Parts 30, 40, 70, and 72,'' is to provide guidance acceptable to the NRC staff on the information to be provided for establishing financial assurance for decommissioning and to establish a standard format for presenting the information. Use of the standard format will help ensure that the financial instruments contain the information required by 10 CFR Parts 30, 40, 70, and 72; aid the applicant and NRC staff in ensuring that the information is complete; and help persons reading the financial instruments to locate information. This guide address financial assurance for decommissioning of facilities under materials licenses granted under Parts 30, 40, 70, and 72. These parts include licensees in the following categories: Part 30, Byproduct Material; Part 40, Source Material; Part 70, Special Nuclear Material; and Part 72, Independent Spent Fuel Storage Installations

  18. 78 FR 42484 - Small Entity Size Standards Under the Regulatory Flexibility Act

    Science.gov (United States)

    2013-07-16

    ... Administration. This action will not significantly affect either the quality of the human environment or the... promulgated regulations that clarify the term ``small business'' by industry, using number of employees or annual income as criteria. Under these regulations, line-haul railroads with 1,500 or fewer employees and...

  19. 7 CFR 2.22 - Under Secretary for Marketing and Regulatory Programs.

    Science.gov (United States)

    2010-01-01

    ... Nutrition Education Act (7 U.S.C. 3401-3417), except as delegated to the Under Secretary for Farm and... Agricultural Services in § 2.16(a)(3)(x); and (WW) The Fresh Cut Flowers and Fresh Cut Greens Promotion and...)); (xiii) Appoint members of the PromoFlor Council established by section 5(b) of the Fresh Cut Flowers and...

  20. Forum of Nuclear Regulatory Bodies in Africa: A Peer Review Mechanism

    International Nuclear Information System (INIS)

    Elegba, S.B.

    2010-01-01

    Uses of Radiation Sources in Africa has Safety and Security Implications that include exposure of workers in all and exposure of Patients in Medical Application. The Safety Principle is primarily: the prevention of harm and protection of health, safety and the environment. The Security Principle recognizes the importance of preventing diversion or malicious acts. Security of Radioactive Sources during use, storage, transportation and Disposal of radioactive waste is of great concern. IAEA Model Project on the “Establishment of Radiation Protection Infrastructure” in Member Sates started in 1995. During the 49. General Conference Statements made by several African Member States revealed the desire of the various Member States to embark on nuclear power for electricity generation. This development thus expanded the original scope of the discussion from radiation protection to now include nuclear safety and nuclear security. During the 50. General Conference of September 2006 Special Event entitled “New Framework for the Utilization of Nuclear Energy in the 21. Century: Assurances of Nuclear Supply and Non-Proliferation was established. Basic Safety Fundamentals SF-1, 2006 shows those basic safety principles for nuclear safety, radiation protection; Waste management and transport safety are similar. Regional Cooperation formed an organization to be known as the Forum of Nuclear Regulatory Bodies in Africa (FNRBA) to provide for the enhancement, strengthening and harmonization of the radiation protection, nuclear safety and security regulatory infrastructure and framework among the members of FNRBA

  1. Regulatory mechanism controlling stomatal behavior conserved across 400 million years of land plant evolution.

    Science.gov (United States)

    Chater, Caspar; Kamisugi, Yasuko; Movahedi, Mahsa; Fleming, Andrew; Cuming, Andrew C; Gray, Julie E; Beerling, David J

    2011-06-21

    Stomatal pores evolved more than 410 million years ago [1, 2] and allowed vascular plants to regulate transpirational water loss during the uptake of CO(2) for photosynthesis [3]. Here, we show that stomata on the sporophytes of the moss Physcomitrella patens [2] respond to environmental signals in a similar way to those of flowering plants [4] and that a homolog of a key signaling component in the vascular plant drought hormone abscisic acid (ABA) response [5] is involved in stomatal control in mosses. Cross-species complementation experiments reveal that the stomatal ABA response of a flowering plant (Arabidopsis thaliana) mutant, lacking the ABA-regulatory protein kinase OPEN STOMATA 1 (OST1) [6], is rescued by substitution with the moss P. patens homolog, PpOST1-1, which evolved more than 400 million years earlier. We further demonstrate through the targeted knockout of the PpOST1-1 gene in P. patens that its role in guard cell closure is conserved, with stomata of mutant mosses exhibiting a significantly attenuated ABA response. Our analyses indicate that core regulatory components involved in guard cell ABA signaling of flowering plants are operational in mosses and likely originated in the last common ancestor of these lineages more than 400 million years ago [7], prior to the evolution of ferns [8, 9]. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Potential novel mechanism for Axenfeld-Rieger syndrome: deletion of a distant region containing regulatory elements of PITX2.

    Science.gov (United States)

    Volkmann, Bethany A; Zinkevich, Natalya S; Mustonen, Aki; Schilter, Kala F; Bosenko, Dmitry V; Reis, Linda M; Broeckel, Ulrich; Link, Brian A; Semina, Elena V

    2011-03-01

    Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion.

  3. Molecular Mechanics: The Method and Its Underlying Philosophy.

    Science.gov (United States)

    Boyd, Donald B.; Lipkowitz, Kenny B.

    1982-01-01

    Molecular mechanics is a nonquantum mechanical method for solving problems concerning molecular geometries and energy. Methodology based on: the principle of combining potential energy functions of all structural features of a particular molecule into a total force field; derivation of basic equations; and use of available computer programs is…

  4. Potential Mechanisms Underlying Centralized Pain and Emerging Therapeutic Interventions

    Directory of Open Access Journals (Sweden)

    Olivia C. Eller-Smith

    2018-02-01

    Full Text Available Centralized pain syndromes are associated with changes within the central nervous system that amplify peripheral input and/or generate the perception of pain in the absence of a noxious stimulus. Examples of idiopathic functional disorders that are often categorized as centralized pain syndromes include fibromyalgia, chronic pelvic pain syndromes, migraine, and temporomandibular disorder. Patients often suffer from widespread pain, associated with more than one specific syndrome, and report fatigue, mood and sleep disturbances, and poor quality of life. The high degree of symptom comorbidity and a lack of definitive underlying etiology make these syndromes notoriously difficult to treat. The main purpose of this review article is to discuss potential mechanisms of centrally-driven pain amplification and how they may contribute to increased comorbidity, poorer pain outcomes, and decreased quality of life in patients diagnosed with centralized pain syndromes, as well as discuss emerging non-pharmacological therapies that improve symptomology associated with these syndromes. Abnormal regulation and output of the hypothalamic-pituitary-adrenal (HPA axis is commonly associated with centralized pain disorders. The HPA axis is the primary stress response system and its activation results in downstream production of cortisol and a dampening of the immune response. Patients with centralized pain syndromes often present with hyper- or hypocortisolism and evidence of altered downstream signaling from the HPA axis including increased Mast cell (MC infiltration and activation, which can lead to sensitization of nearby nociceptive afferents. Increased peripheral input via nociceptor activation can lead to “hyperalgesic priming” and/or “wind-up” and eventually to central sensitization through long term potentiation in the central nervous system. Other evidence of central modifications has been observed through brain imaging studies of functional

  5. [Study on main pharmacodynamics and underlying mechanisms of 999 Ganmaoling].

    Science.gov (United States)

    Xu, Qi-Hua; He, Rong; Peng, Bo; Ye, Zu-Guang; Li, Jian-Rong; Zhang, Yue-Fei; Dai, Zhi

    2016-04-01

    To observe synergistic effects of 999 Ganmaoling (GML) and its Chinese/Western materia medica (CMM and WMM) on pharmacodynamic action and to study underlying mechanisms, their anti-inflammatory, antipyretic effects were compared by assaying the increased capillary permeability induced by glacial acetic acid in mice, ear swelling induced by Xylene in mice, non-specific pleurisy induced by carrageenan in rats, and yeast induced fever in rats. Crystal violet (CV) and microbial activity (XTT) assay were used to evaluate the inhibition of GML and its CMM and WMM on KPN biofilm formation, and scanning electron microscopy (SEM) was applied for observing KPN biofilm morphology changes. The results showed that compared with control group, GML could reduce exudation amount of Evans-Blue and the degree of Ear swelling significantly, and CMM and WMM have no significant effects. The concentration of TNF-α and IL-1β of rat pleural effusion in GML, CMM and WMM group decreased significantly. The concentration of TNF-α, IL-1β and IL-8 in GML group, TNF-α, IL-8 in WMM group and IL-8 in CMM in rats serum decreased significantly. The body temperature in rats decreased significantly in GML and WMM group after 4-8 h of administration. CMM group showed no significant difference in rat body temperature compare with control. Compared with control group, GML (55-13.75 g•L⁻¹) could inhibit KPN biofilm formation and reduce number of viable cells in the KPN biofilm. CMM (45-22.5 g•L⁻¹) and WMM (10 g•L⁻¹) could also inhibit KPN biofilm formation and reduce number of viable cells (P<0.01). Result of SEM also showed that GML (55 g•L⁻¹) and its CMM (45 g•L⁻¹) and WMM (10 g•L⁻¹) could interfere the bacterial arrangement of KPN biofilm and extracellular matrix. GML and its CMM & WMM could inhibit the formation of KPN biofilm, CMM & WMM in GML showed synergism and complementation in inhibit KPN biofilm. Results showed that GML had obvious anti-inflammatory and

  6. Dormancy behaviors and underlying regulatory mechanisms: from perspective of pathways to epigenetic regulation

    Science.gov (United States)

    Temperate perennials exploit dormancy as one strategy to survive long term environmental stresses. As the current trend in global warming continues, many regions are experiencing warmer winters that fail to provide sufficient chilling temperature for dormancy release, impacting fruit tree productiv...

  7. Mechanisms and pharmacogenetic signals underlying thiazide diuretics blood pressure response.

    Science.gov (United States)

    Shahin, Mohamed H; Johnson, Julie A

    2016-04-01

    Thiazide (TZD) diuretics are among the most commonly prescribed antihypertensives globally; however their chronic blood pressure (BP) lowering mechanism remains unclear. Herein we discuss the current evidence regarding specific mechanisms regulating the antihypertensive effects of TZDs, suggesting that TZDs act via multiple complex and interacting mechanisms, including natriuresis with short term use and direct vasodilatory effects chronically. Additionally, we review pharmacogenomics signals that have been associated with TZDs BP-response in several cohorts (i.e. NEDD4L, PRKCA, EDNRA-GNAS, and YEATS4) and discuss how these genes might be related to TZD BP-response mechanism. Understanding the association between these genes and TZD BP mechanism might facilitate the development of new drugs and therapeutic approaches based on a deeper understanding of the determinants of BP-response. Copyright © 2016. Published by Elsevier Ltd.

  8. Vanadate stimulates adenylate cyclase via the guanine nucleotide regulatory protein by a mechanism differing from that of fluoride.

    Science.gov (United States)

    Krawietz, W; Downs, R W; Spiegel, A M; Aurbach, G D

    1982-03-01

    Vanadate stimulates adenylate cyclase activity in turkey erythrocyte membranes. The maximal stimulation is 7-fold over basal at 3 mM vanadate; higher concentrations are inhibitory. A suboptimal concentration of fluoride (1 mM) together with vanadate (3 mM) activates adenylate cyclase in a non-additive manner; cyclase activation by optimal fluoride (10 mM) is inhibited by vanadate (3 mM). There is no stimulation by vanadate of adenylate cyclase activity (measured either with Mg2+ or Mn2+) in CYC- S49 lymphoma cell membranes. Vanadate (3 mM) shows no effect on binding of Beta-adrenergic agonists or antagonists to the [3H] (-)-dihydroalprenolol binding site in turkey erythrocyte membranes. These results suggest that the effect of vanadate on Adenylate cyclase is mediated through the nucleotide regulatory protein and may act by a mechanism similar to fluoride. However, in cholera toxic-treated membranes as well as in GDP-beta-S plus isoproterenol-treated membranes, fluoride-stimulated adenylate cyclase activity is significantly reduced, but vanadate stimulation is not. Our results suggest that although the actions of vanadate and fluoride in adenylate cyclase may each involve the nucleotide regulatory unit, the exact mechanisms of activation by the two anions differ.

  9. 10 CFR 40.11 - Persons using source material under certain Department of Energy and Nuclear Regulatory...

    Science.gov (United States)

    2010-01-01

    ... Energy and Nuclear Regulatory Commission contracts. 40.11 Section 40.11 Energy NUCLEAR REGULATORY... certain Department of Energy and Nuclear Regulatory Commission contracts. Except to the extent that... the work thereunder can be accomplished without undue risk to the public health and safety. [40 FR...

  10. Muscle and neural isoforms of agrin increase utrophin expression in cultured myotubes via a transcriptional regulatory mechanism.

    Science.gov (United States)

    Gramolini, A O; Burton, E A; Tinsley, J M; Ferns, M J; Cartaud, A; Cartaud, J; Davies, K E; Lunde, J A; Jasmin, B J

    1998-01-09

    Duchenne muscular dystrophy is a prevalent X-linked neuromuscular disease for which there is currently no cure. Recently, it was demonstrated in a transgenic mouse model that utrophin could functionally compensate for the lack of dystrophin and alleviate the muscle pathology (Tinsley, J. M., Potter, A. C., Phelps, S. R., Fisher, R., Trickett, J. I., and Davies, K. E. (1996) Nature 384, 349-353). In this context, it thus becomes essential to determine the cellular and molecular mechanisms presiding over utrophin expression in attempts to overexpress the endogenous gene product throughout skeletal muscle fibers. In a recent study, we showed that the nerve exerts a profound influence on utrophin gene expression and postulated that nerve-derived trophic factors mediate the local transcriptional activation of the utrophin gene within nuclei located in the postsynaptic sarcoplasm (Gramolini, A. O., Dennis, C. L., Tinsley, J. M., Robertson, G. S., Davies, K. E, Cartaud, J., and Jasmin, B. J. (1997) J. Biol. Chem. 272, 8117-8120). In the present study, we have therefore focused on the effect of agrin on utrophin expression in cultured C2 myotubes. In response to Torpedo-, muscle-, or nerve-derived agrin, we observed a significant 2-fold increase in utrophin mRNAs. By contrast, CGRP treatment failed to affect expression of utrophin transcripts. Western blotting experiments also revealed that the increase in utrophin mRNAs was accompanied by an increase in the levels of utrophin. To determine whether these changes were caused by parallel increases in the transcriptional activity of the utrophin gene, we transfected muscle cells with a 1. 3-kilobase pair utrophin promoter-reporter (nlsLacZ) gene construct and treated them with agrin for 24-48 h. Under these conditions, both muscle- and nerve-derived agrin increased the activity of beta-galactosidase, indicating that agrin treatment led, directly or indirectly, to the transcriptional activation of the utrophin gene

  11. Mechanical response of collagen molecule under hydrostatic compression

    International Nuclear Information System (INIS)

    Saini, Karanvir; Kumar, Navin

    2015-01-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

  12. The regulatory role of endogenous iron on greenhouse gas emissions under intensive nitrogen fertilization in subtropical soils of China.

    Science.gov (United States)

    Han, Jiangpei; Shi, Liangsheng; Wang, Yakun; Chen, Zhuowei; Wu, Laosheng

    2018-03-10

    Anaerobic batch experiments were conducted to study the regulatory role of endogenous iron in greenhouse gas emissions under intensive nitrogen fertilization in subtropical soils of China. Fe 2+ , Fe 3+ , and NO 3 - -N dynamics and N 2 O, CH 4 , and CO 2 emissions, as well as the relationships between N fertilizer, endogenous iron, and greenhouse gas emissions were investigated. The emissions of N 2 O increased to different extents from all the test soils by N1 (260 mg N kg -1 ) application compared with N0. After 24 days of anaerobic incubation, the cumulative emissions of N 2 O from red soils in De'an (DR) were significantly higher than that from paddy soils in De'an (DP) and Qujialing (QP) under N1. However, N application enhanced CH 4 and CO 2 emissions from the red soils slightly but inhibited the emissions from paddy soils. The maximal CH 4 and CO 2 emission fluxes occurred in DP soil without N input. Pearson's correlation analysis showed that there were significant correlations (P endogenous iron played a regulatory role in greenhouse gas emissions mainly through the involvement in denitrification. The proportion of the electrons donated by Fe 2+ used for N 2 O production in denitrification in DP soil was approximately 37.53%. Moreover, positive correlations between Fe 2+ and CH 4 , CO 2 were found in both DR and QP soils, suggesting that endogenous iron might regulate the anaerobic decomposition of organic carbon to CH 4 and CO 2 in the two soils. Soil pH was also an important factor controlling greenhouse gas emissions by affecting endogenous iron availability and C and N transformation processes.

  13. Mechanical Characterization of Anion Exchange Membranes Under Controlled Environmental Conditions

    Science.gov (United States)

    2015-05-11

    supporting textiles and test the mechanical properties. Even though their films were only 10 microns, the SER fixture was used by applying double stick tape...aramid and stainless steel. The authors conclude that supporting textile has a large impact on mechanical properties due to the difference in...Elongation) are depicted. 2.2 Conductivity Ionic conductivity was measured by electrochemical impedance spectroscopy using a four- electrode in-plane

  14. Features wear nodes mechanization wing aircraft operating under dynamic loads

    Directory of Open Access Journals (Sweden)

    А.М. Хімко

    2009-03-01

    Full Text Available  The conducted researches of titanic alloy ВТ-22 at dynamic loading with cycled sliding and dynamic loading in conditions of rolling with slipping. It is established that roller jamming in the carriage increases wear of rod of mechanization of a wing to twenty times. The optimum covering for strengthening wearied sites and restoration of working surfaces of wing’s mechanization rod is defined.

  15. Insights into soybean transcriptome reconfiguration under hypoxic stress: Functional, regulatory, structural, and compositional characterization

    Science.gov (United States)

    Rodrigues, Fabiana A.; Neumaier, Norman; Marcolino-Gomes, Juliana; Molinari, Hugo B. C.; Santiago, Thaís R.; Formighieri, Eduardo F.; Basso, Marcos F.; Farias, José R. B.; Emygdio, Beatriz M.; de Oliveira, Ana C. B.; Campos, Ângela D.; Borém, Aluízio; Harmon, Frank G.; Mertz-Henning, Liliane M.; Nepomuceno, Alexandre L.

    2017-01-01

    Soybean (Glycine max) is one of the major crops worldwide and flooding stress affects the production and expansion of cultivated areas. Oxygen is essential for mitochondrial aerobic respiration to supply the energy demand of plant cells. Because oxygen diffusion in water is 10,000 times lower than in air, partial (hypoxic) or total (anoxic) oxygen deficiency is important component of flooding. Even when oxygen is externally available, oxygen deficiency frequently occurs in bulky, dense or metabolically active tissues such as phloem, meristems, seeds, and fruits. In this study, we analyzed conserved and divergent root transcriptional responses between flood-tolerant Embrapa 45 and flood-sensitive BR 4 soybean cultivars under hypoxic stress conditions with RNA-seq. To understand how soybean genes evolve and respond to hypoxia, stable and differentially expressed genes were characterized structurally and compositionally comparing its mechanistic relationship. Between cultivars, Embrapa 45 showed less up- and more down-regulated genes, and stronger induction of phosphoglucomutase (Glyma05g34790), unknown protein related to N-terminal protein myristoylation (Glyma06g03430), protein suppressor of phyA-105 (Glyma06g37080), and fibrillin (Glyma10g32620). RNA-seq and qRT-PCR analysis of non-symbiotic hemoglobin (Glyma11g12980) indicated divergence in gene structure between cultivars. Transcriptional changes for genes in amino acids and derivative metabolic process suggest involvement of amino acids metabolism in tRNA modifications, translation accuracy/efficiency, and endoplasmic reticulum stress in both cultivars under hypoxia. Gene groups differed in promoter TATA box, ABREs (ABA-responsive elements), and CRT/DREs (C-repeat/dehydration-responsive elements) frequency. Gene groups also differed in structure, composition, and codon usage, indicating biological significances. Additional data suggests that cis-acting ABRE elements can mediate gene expression independent of ABA

  16. Synthetic oligorotaxanes exert high forces when folding under mechanical load

    Science.gov (United States)

    Sluysmans, Damien; Hubert, Sandrine; Bruns, Carson J.; Zhu, Zhixue; Stoddart, J. Fraser; Duwez, Anne-Sophie

    2018-01-01

    Folding is a ubiquitous process that nature uses to control the conformations of its molecular machines, allowing them to perform chemical and mechanical tasks. Over the years, chemists have synthesized foldamers that adopt well-defined and stable folded architectures, mimicking the control expressed by natural systems1,2. Mechanically interlocked molecules, such as rotaxanes and catenanes, are prototypical molecular machines that enable the controlled movement and positioning of their component parts3-5. Recently, combining the exquisite complexity of these two classes of molecules, donor-acceptor oligorotaxane foldamers have been synthesized, in which interactions between the mechanically interlocked component parts dictate the single-molecule assembly into a folded secondary structure6-8. Here we report on the mechanochemical properties of these molecules. We use atomic force microscopy-based single-molecule force spectroscopy to mechanically unfold oligorotaxanes, made of oligomeric dumbbells incorporating 1,5-dioxynaphthalene units encircled by cyclobis(paraquat-p-phenylene) rings. Real-time capture of fluctuations between unfolded and folded states reveals that the molecules exert forces of up to 50 pN against a mechanical load of up to 150 pN, and displays transition times of less than 10 μs. While the folding is at least as fast as that observed in proteins, it is remarkably more robust, thanks to the mechanically interlocked structure. Our results show that synthetic oligorotaxanes have the potential to exceed the performance of natural folding proteins.

  17. WrpA Is an Atypical Flavodoxin Family Protein under Regulatory Control of the Brucella abortus General Stress Response System.

    Science.gov (United States)

    Herrou, Julien; Czyż, Daniel M; Willett, Jonathan W; Kim, Hye-Sook; Chhor, Gekleng; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean

    2016-04-01

    The general stress response (GSR) system of the intracellular pathogen Brucella abortus controls the transcription of approximately 100 genes in response to a range of stress cues. The core genetic regulatory components of the GSR are required for B. abortus survival under nonoptimal growth conditions in vitro and for maintenance of chronic infection in an in vivo mouse model. The functions of the majority of the genes in the GSR transcriptional regulon remain undefined. bab1_1070 is among the most highly regulated genes in this regulon: its transcription is activated 20- to 30-fold by the GSR system under oxidative conditions in vitro. We have solved crystal structures of Bab1_1070 and demonstrate that it forms a homotetrameric complex that resembles those of WrbA-type NADH:quinone oxidoreductases, which are members of the flavodoxin protein family. However, B. abortus WrbA-related protein (WrpA) does not bind flavin cofactors with a high affinity and does not function as an NADH:quinone oxidoreductase in vitro. Soaking crystals with flavin mononucleotide (FMN) revealed a likely low-affinity binding site adjacent to the canonical WrbA flavin binding site. Deletion of wrpA (ΔwrpA) does not compromise cell survival under acute oxidative stress in vitro or attenuate infection in cell-based or mouse models. However, a ΔwrpA strain does elicit increased splenomegaly in a mouse model, suggesting that WrpA modulates B. abortus interaction with its mammalian host. Despite high structural homology with canonical WrbA proteins, we propose that B. abortus WrpA represents a functionally distinct member of the diverse flavodoxin family. Brucella abortus is an etiological agent of brucellosis, which is among the most common zoonotic diseases worldwide. The general stress response (GSR) regulatory system of B. abortus controls the transcription of approximately 100 genes and is required for maintenance of chronic infection in a murine model; the majority of GSR-regulated genes

  18. Mechanism and kinetics of mineral weathering under acid conditions

    NARCIS (Netherlands)

    Anbeek, C.

    1994-01-01

    This study deals with the relationships between crystal structure, grain diameter, surface morphology and dissolution kinetics for feldspar and quartz under acid conditions.

    Intensively ground samples from large, naturally weathered mineral fragments are frequently used in

  19. Performance of multifilamentary Nb3Sn under mechanical load

    International Nuclear Information System (INIS)

    Easton, D.S.; Schwall, R.E.

    1976-01-01

    The critical current of a commercial multifilamentary Nb 3 Sn conductor has been measured under the application of uniaxial tension at 4.2 K and following bending at room temperature. Significant reductions in J/subc/ are observed under uniaxial loading. Results are presented for a monolithic conductor manufactured by the bronze diffusion technique and for cable conductors formed by the tin-dip technique

  20. Decentralized control mechanism underlying interlimb coordination of millipedes.

    Science.gov (United States)

    Kano, Takeshi; Sakai, Kazuhiko; Yasui, Kotaro; Owaki, Dai; Ishiguro, Akio

    2017-04-04

    Legged animals exhibit adaptive and resilient locomotion through interlimb coordination. The long-term goal of this study is to clarify the relationship between the number of legs and the inherent decentralized control mechanism for interlimb coordination. As a preliminary step, the study focuses on millipedes as they represent the species with the greatest number of legs among various animal species. A decentralized control mechanism involving local force feedback was proposed based on the qualitative findings of behavioural experiments in which responses to the removal of part of the terrain and leg amputation were observed. The proposed mechanism was implemented in a developed millipede-like robot to demonstrate that the robot can adapt to the removal of the part of the terrain and leg amputation in a manner similar to that in behavioural experiments.

  1. Advanced waterflooding in chalk reservoirs: Understanding of underlying mechanisms

    DEFF Research Database (Denmark)

    Zahid, Adeel; Sandersen, Sara Bülow; Stenby, Erling Halfdan

    2011-01-01

    Over the last decade, a number of studies have shown SO42−, Ca2+ and Mg2+ to be potential determining ions, which may be added to the injected brine for improving oil recovery during waterflooding in chalk reservoirs. However the understanding of the mechanism leading to an increase in oil recove...... of a microemulsion phase could be the possible reasons for the observed increase in oil recovery with sulfate ions at high temperature in chalk reservoirs besides the mechanism of the rock wettability alteration, which has been reported in most previous studies.......Over the last decade, a number of studies have shown SO42−, Ca2+ and Mg2+ to be potential determining ions, which may be added to the injected brine for improving oil recovery during waterflooding in chalk reservoirs. However the understanding of the mechanism leading to an increase in oil recovery...

  2. Epigenetic mechanisms underlying the pathogenesis of neurogenetic diseases.

    Science.gov (United States)

    Qureshi, Irfan A; Mehler, Mark F

    2014-10-01

    There have been considerable advances in uncovering the complex genetic mechanisms that underlie nervous system disease pathogenesis, particularly with the advent of exome and whole genome sequencing techniques. The emerging field of epigenetics is also providing further insights into these mechanisms. Here, we discuss our understanding of the interplay that exists between genetic and epigenetic mechanisms in these disorders, highlighting the nascent field of epigenetic epidemiology-which focuses on analyzing relationships between the epigenome and environmental exposures, development and aging, other health-related phenotypes, and disease states-and next-generation research tools (i.e., those leveraging synthetic and chemical biology and optogenetics) for examining precisely how epigenetic modifications at specific genomic sites affect disease processes.

  3. Structure reveals regulatory mechanisms of a MaoC-like hydratase from Phytophthora capsici involved in biosynthesis of polyhydroxyalkanoates (PHAs.

    Directory of Open Access Journals (Sweden)

    Huizheng Wang

    Full Text Available Polyhydroxyalkanoates (PHAs have attracted increasing attention as "green plastic" due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC, which belongs to (R-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic.We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC.The data in our study reveal the regulatory mechanism of an (R-hydratase, providing information on enzyme engineering to produce low cost PHAs.

  4. Vision from next generation sequencing: multi-dimensional genome-wide analysis for producing gene regulatory networks underlying retinal development, aging and disease.

    Science.gov (United States)

    Yang, Hyun-Jin; Ratnapriya, Rinki; Cogliati, Tiziana; Kim, Jung-Woong; Swaroop, Anand

    2015-05-01

    Genomics and genetics have invaded all aspects of biology and medicine, opening uncharted territory for scientific exploration. The definition of "gene" itself has become ambiguous, and the central dogma is continuously being revised and expanded. Computational biology and computational medicine are no longer intellectual domains of the chosen few. Next generation sequencing (NGS) technology, together with novel methods of pattern recognition and network analyses, has revolutionized the way we think about fundamental biological mechanisms and cellular pathways. In this review, we discuss NGS-based genome-wide approaches that can provide deeper insights into retinal development, aging and disease pathogenesis. We first focus on gene regulatory networks (GRNs) that govern the differentiation of retinal photoreceptors and modulate adaptive response during aging. Then, we discuss NGS technology in the context of retinal disease and develop a vision for therapies based on network biology. We should emphasize that basic strategies for network construction and analyses can be transported to any tissue or cell type. We believe that specific and uniform guidelines are required for generation of genome, transcriptome and epigenome data to facilitate comparative analysis and integration of multi-dimensional data sets, and for constructing networks underlying complex biological processes. As cellular homeostasis and organismal survival are dependent on gene-gene and gene-environment interactions, we believe that network-based biology will provide the foundation for deciphering disease mechanisms and discovering novel drug targets for retinal neurodegenerative diseases. Published by Elsevier Ltd.

  5. A review of mechanisms underlying anticarcinogenicity by brassica vegetables

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Verhagen, H.; Goldbohm, R.A.; Brandt, P.A. van den; Poppel, G. van

    1997-01-01

    The mechanisms by which brassica vegetables might decrease the risk of cancer are reviewed in this paper. Brassicas, including all types of cabbages, broccoli, cauliflower and Brussels sprouts, may be protective against cancer due to their relatively high glucosinolate content. Glucosinolates are

  6. Peer influence: neural mechanisms underlying in-group conformity

    NARCIS (Netherlands)

    Stallen, M.; Smidts, A.; Sanfey, A.G.

    2013-01-01

    People often conform to the behavior of others with whom they identify. However, it is unclear what fundamental mechanisms underlie this type of conformity. Here, we investigate the processes mediating in-group conformity by using functional magnetic resonance imaging (fMRI). Participants completed

  7. Peer influence: Neural mechanisms underlying in-group conformity

    NARCIS (Netherlands)

    M. Stallen (Mirre); A. Smidts (Ale); A.G. Sanfey (Alan)

    2013-01-01

    textabstractPeople often conform to the behavior of others with whom they identify. However, it is unclear what fundamental mechanisms underlie this type of conformity. Here, we investigate the processes mediating in-group conformity by using functional magnetic resonance imaging (fMRI).

  8. Underlying mechanisms of transient luminous events: a review

    Directory of Open Access Journals (Sweden)

    V. V. Surkov

    2012-08-01

    Full Text Available Transient luminous events (TLEs occasionally observed above a strong thunderstorm system have been the subject of a great deal of research during recent years. The main goal of this review is to introduce readers to recent theories of electrodynamics processes associated with TLEs. We examine the simplest versions of these theories in order to make their physics as transparent as possible. The study is begun with the conventional mechanism for air breakdown at stratospheric and mesospheric altitudes. An electron impact ionization and dissociative attachment to neutrals are discussed. A streamer size and mobility of electrons as a function of altitude in the atmosphere are estimated on the basis of similarity law. An alternative mechanism of air breakdown, runaway electron mechanism, is discussed. In this section we focus on a runaway breakdown field, characteristic length to increase avalanche of runaway electrons and on the role played by fast seed electrons in generation of the runaway breakdown. An effect of thunderclouds charge distribution on initiation of blue jets and gigantic jets is examined. A model in which the blue jet is treated as upward-propagating positive leader with a streamer zone/corona on the top is discussed. Sprite models based on streamer-like mechanism of air breakdown in the presence of atmospheric conductivity are reviewed. To analyze conditions for sprite generation, thunderstorm electric field arising just after positive cloud-to-ground stroke is compared with the thresholds for propagation of positively/negatively charged streamers and with runway breakdown. Our own estimate of tendril's length at the bottom of sprite is obtained to demonstrate that the runaway breakdown can trigger the streamer formation. In conclusion we discuss physical mechanisms of VLF (very low frequency and ELF (extremely low frequency phenomena associated with sprites.

  9. Do regulatory mechanisms promote competition and mitigate market power? Evidence from Spanish electricity market

    International Nuclear Information System (INIS)

    Moutinho, Victor; Moreira, António C.; Mota, Jorge

    2014-01-01

    This paper estimates the relationships between bidding quantities, marginal cost and market power measures in the Spanish wholesale electricity market for two different regulatory periods: 2002–2005 and 2006–2007. Using panel econometric techniques we find differences in the impacts on bidding strategies for both periods. Hence, the marginal cost and the market power measures affect bid and net quantities. The market power measures also suggest that the coefficient is consistently positive and highly significant for both periods. Moreover, the market power and marginal costs have mixed effects according to the models proposed for both periods. In addition, our results point to the effectiveness of the different effects of mitigating the market power in the Spanish electricity market. For the 2006–2007 period, the proposed causal relationships are partially validated by the cointegration results, which assumes there is a significant causality between the Lerner Index and the marginal cost. - Highlights: • Competition and regulation in the Spanish electricity market. • Net supplier and net demander behavior in the spot market. • Panel cointegration methods used: FMOLS, PMG, MG, DFE and DOLS. • The price cap regulation is effective in mitigating market power. • Market power and marginal cost have positive effects on bidding strategies

  10. Effects of radiation on T regulatory cells in normal states and cancer: mechanisms and clinical implications.

    Science.gov (United States)

    Liu, Shu; Sun, Xiangdong; Luo, Jinhua; Zhu, Hongcheng; Yang, Xi; Guo, Qing; Song, Yaqi; Sun, Xinchen

    2015-01-01

    Radiation remains an important component of cancer treatment. In addition to inducing tumor cell death through direct cytotoxic effects, radiation can also promote the regression of tumor via augment of immune response. Regulatory T cells (Tregs) are a unique subpopulation of CD4 positive cells, which are characterized by expression of the forkhead box P3 (Foxp3) transcription factor and high levels of CD25. Mounting evidence has shown that Tregs are implicated in the development and progression of various types of cancer, which makes Tregs an important target in cancer therapeutics. Generally, lymphocytes are regarded as radiosensitive. However, Tregs have been demonstrated to be relatively resistant to radiotherapy, which is partly mediated by downregulation of pro-apoptotic proteins and upregulation of anti-apoptotic proteins. Moreover, radiotherapy can increase the production of Tregs and the recruitment of Tregs to local tumor microenvironment. Tregs can attenuate radiation-induced tumor death, which cause the resistance of tumor to radiotherapy. Recent experimental studies and clinical trails have demonstrated that the combination of radiation with medications that target Tregs is promising in the treatment of several types of neoplasms. In this review, we discussed the effect of radiation on Tregs in physiological states and cancer. Further, we presented an overview of therapies that target Tregs to enhance the efficacy of radiation in cancer therapeutics.

  11. The mechanisms shaping the repertoire of CD4+  Foxp3+ regulatory T cells.

    Science.gov (United States)

    Kraj, Piotr; Ignatowicz, Leszek

    2018-03-01

    Regulatory T (Treg) cells expressing Foxp3 transcription factor control homeostasis of the immune system, antigenic responses to commensal and pathogenic microbiota, and immune responses to self and tumour antigens. The Treg cells differentiate in the thymus, along with conventional CD4 + T cells, in processes of positive and negative selection. Another class of Treg cells is generated in peripheral tissues by inducing Foxp3 expression in conventional CD4 + T cells in response to antigenic stimulation. Both thymic and peripheral generation of Treg cells depends on recognition of peptide/MHC ligands by the T-cell receptors (TCR) expressed on thymic Treg precursors or peripheral conventional CD4 + T cells. This review surveys reports describing how thymus Treg cell generation depends on the selecting peptide/MHC ligands and how this process impacts the TCR repertoire expressed by Treg cells. We also describe how Treg cells depend on sustained signalling through the TCR and how they are further regulated by Foxp3 enhancer sequences. Finally, we review the impact of microbiota-derived antigens on the maintenance and functionality of the peripheral pool of Treg cells. © 2017 John Wiley & Sons Ltd.

  12. Major gene-regulatory mechanisms operating in ribosomally synthesized and post-translationally modified peptide (RiPP) biosynthesis.

    Science.gov (United States)

    Bartholomae, Maike; Buivydas, Andrius; Viel, Jakob H; Montalbán-López, Manuel; Kuipers, Oscar P

    2017-10-01

    Post-translationally modified peptides commonly display antimicrobial activity, but can also aid the development of bacterial colonies, giving a competitive advantage in the ecological niche. The production of post-translationally modified peptides by bacteria is a complex and energetically costly process that is strictly orchestrated in the cell. The onset of peptide production is linked to the different enzymes that take part during maturation, the transporters and the immunity determinants (if required). Thus, the population can make optimal use of available resources and obtain the benefits of production at an advantageous moment during growth, avoiding toxicity to itself. The timing and level of expression of the different operons is controlled by diverse (complex) regulatory pathways in response to environmental changes, stress or master regulators during specific growth transition phases. In this review, we highlight the basic principles and mechanisms of regulation of expression of post-translationally modified peptides and the relationship with the overall culture developmental processes and/or cellular differentiation. We also discuss the biotechnological consequences derived from the understanding of regulatory networks involved in the biosynthesis of these natural products. © 2017 John Wiley & Sons Ltd.

  13. A risk analysis for gas transport network planning expansion under regulatory uncertainty in Western Europe

    International Nuclear Information System (INIS)

    Pelletier, C.; Wortmann, J.C.

    2009-01-01

    The natural gas industry in Western Europe went through drastic changes induced by the unbundling of the national companies, followed by the liberalization of gas trade and the regulation of gas transmission. Natural gas transmission is operated through a network of interconnected grids, and is capacity constrained. Each of the grids is locally regulated in terms of price limits on transportation services. Local tariff differences may induce unnatural gas routing within a network, creating congestion in some part of it. This phenomena is referred to as the Jepma effect. Following Jepma [2001. Gaslevering onder druk. Stichting JIN. Available at: (www.jiqweb.org) (52pp) (in Dutch)] this may lead to misguided investment decisions. In this paper a multi-stage linear program is used to simulate the repartition of the natural gas flow in an interconnected grid system on a succession of contracting periods. By this simulation, the risk linked to infrastructure investment is assessed. The risk measured can be seen as the probability of a negative present net value for the investment. The model is applied on an example of two grids that are on alternative routes serving same destinations. When applied to a specific situation of North-West Europe (Germany and The Netherlands), the model clearly demonstrates that the risks turn out to be too high to invest: there are hardly any scenarios under which an acceptable ROI will be realized. Given the current tariff policy and current publicly available forecasts of demand and supply, it is unlikely that market forces will attract additional investments in transportation capacity. This reluctance to invest can be prohibitive for further growth of supply if the demand would increase significantly

  14. Likelihood for transcriptions in a genetic regulatory system under asymmetric stable Lévy noise

    Science.gov (United States)

    Wang, Hui; Cheng, Xiujun; Duan, Jinqiao; Kurths, Jürgen; Li, Xiaofan

    2018-01-01

    This work is devoted to investigating the evolution of concentration in a genetic regulation system, when the synthesis reaction rate is under additive and multiplicative asymmetric stable Lévy fluctuations. By focusing on the impact of skewness (i.e., non-symmetry) in the probability distributions of noise, we find that via examining the mean first exit time (MFET) and the first escape probability (FEP), the asymmetric fluctuations, interacting with nonlinearity in the system, lead to peculiar likelihood for transcription. This includes, in the additive noise case, realizing higher likelihood of transcription for larger positive skewness (i.e., asymmetry) index β, causing a stochastic bifurcation at the non-Gaussianity index value α = 1 (i.e., it is a separating point or line for the likelihood for transcription), and achieving a turning point at the threshold value β≈-0.5 (i.e., beyond which the likelihood for transcription suddenly reversed for α values). The stochastic bifurcation and turning point phenomena do not occur in the symmetric noise case (β = 0). While in the multiplicative noise case, non-Gaussianity index value α = 1 is a separating point or line for both the MFET and the FEP. We also investigate the noise enhanced stability phenomenon. Additionally, we are able to specify the regions in the whole parameter space for the asymmetric noise, in which we attain desired likelihood for transcription. We have conducted a series of numerical experiments in "regulating" the likelihood of gene transcription by tuning asymmetric stable Lévy noise indexes. This work offers insights for possible ways of achieving gene regulation in experimental research.

  15. Mechanisms underlying social inequality in post-menopausal breast cancer.

    Science.gov (United States)

    Hvidtfeldt, Ulla Arthur

    2014-10-01

    This thesis is based on studies conducted in the period 2010-2014 at Department of Public Health, University of Copenhagen and at Department of Epidemiology and Population Health, Albert Einstein College of Medicine, New York. The results are presented in three scientific papers and a synopsis. The main objective of the thesis was to determine mechanisms underlying social inequality (defined by educational level) in postmenopausal breast cancer (BC) by addressing mediating effects through hormone therapy (HT) use, BMI, lifestyle and reproductive factors. The results of previous studies suggest that the higher risk of postmenopausal BC among women of high socioeconomic position (SEP) may be explained by reproductive factors and health behaviors. Women of higher SEP generally have fewer children and give birth at older ages than women of low SEP, and these factors have been found to affect the risk of BC - probably through altered hormone levels. Adverse effects on BC risk have also been documented for modifiable health behaviors that may affect hormone levels, such as alcohol consumption, high BMI, physical inactivity, and HT use. Alcohol consumption and HT use are likewise more common among women of higher SEP. The analyses were based on the Social Inequality in Cancer (SIC) cohort and a subsample of the Women's Health Initiative Observational Study (WHI-OS). The SIC cohort was derived by pooling 6 individual studies from the Copenhagen area including 33,562 women (1,733 BC cases) aged 50-70 years at baseline. The subsample of WHI-OS consisted of two case-cohort studies with measurements of endogenous estradiol (N = 1,601) and insulin (N = 791). Assessment of mediation often relies on comparing multiplicative models with and without the potential mediator. Such approaches provide potentially biased results, because they do not account for mediator-outcome confounding, exposure-dependent mediator-outcome confounding, exposure-mediator interaction and interactions

  16. Putative molecular mechanism underlying sperm chromatin remodelling is regulated by reproductive hormones

    Directory of Open Access Journals (Sweden)

    Gill-Sharma Manjeet Kaur

    2012-12-01

    Full Text Available Abstract Background The putative regulatory role of the male reproductive hormones in the molecular mechanism underlying chromatin condensation remains poorly understood. In the past decade, we developed two adult male rat models wherein functional deficits of testosterone or FSH, produced after treatments with 20 mg/Kg/d of cyproterone acetate (CPA per os, for a period of 15 days or 3 mg/Kg/d of fluphenazine decanoate (FD subcutaneously, for a period of 60 days, respectively, affected the rate of sperm chromatin decondensation in vitro. These rat models have been used in the current study in order to delineate the putative roles of testosterone and FSH in the molecular mechanism underlying remodelling of sperm chromatin. Results We report that deficits of both testosterone and FSH affected the turnover of polyubiquitylated histones and led to their accumulation in the testis. Functional deficits of testosterone reduced expression of MIWI, the 5-methyl cap binding RNA-binding protein (PIWIlike murine homologue of the Drosophila protein PIWI/P-element induced wimpy testis containing a PAZ/Piwi-Argonaut-Zwille domain and levels of histone deacetylase1 (HDAC1, ubiquitin ligating enzyme (URE-B1/E3, 20S proteasome α1 concomitant with reduced expression of ubiquitin activating enzyme (ube1, conjugating enzyme (ube2d2, chromodomain Y like protein (cdyl, bromodomain testis specific protein (brdt, hdac6 (histone deacetylase6, androgen-dependent homeobox placentae embryonic protein (pem/RhoX5, histones h2b and th3 (testis-specific h3. Functional deficits of FSH reduced the expression of cdyl and brdt genes in the testis, affected turnover of ubiquitylated histones, stalled the physiological DNA repair mechanism and culminated in spermiation of DNA damaged sperm. Conclusions We aver that deficits of both testosterone and FSH differentially affected the process of sperm chromatin remodelling through subtle changes in the ‘chromatin condensation

  17. The effects of intrinsic noise on the behaviour of bistable cell regulatory systems under quasi-steady state conditions

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, Roberto; Alarcón, Tomás de la [Centre de Recerca Matemàtica. Edifici C, Campus de Bellaterra, 08193 Bellaterra (Barcelona) (Spain); Departament de Matemàtiques, Universitat Autònoma de Barcelona, 08193 Bellaterra (Barcelona) (Spain); Guerrero, Pilar [Department of Mathematics, University College London, Gower Street, London WC1E 6BT (United Kingdom); Spill, Fabian [Department of Biomedical Engineering, Boston University, 44 Cummington Street, Boston, Massachusetts 02215 (United States); Department of Mechanical Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)

    2015-08-21

    We analyse the effect of intrinsic fluctuations on the properties of bistable stochastic systems with time scale separation operating under quasi-steady state conditions. We first formulate a stochastic generalisation of the quasi-steady state approximation based on the semi-classical approximation of the partial differential equation for the generating function associated with the chemical master equation. Such approximation proceeds by optimising an action functional whose associated set of Euler-Lagrange (Hamilton) equations provides the most likely fluctuation path. We show that, under appropriate conditions granting time scale separation, the Hamiltonian can be re-scaled so that the set of Hamilton equations splits up into slow and fast variables, whereby the quasi-steady state approximation can be applied. We analyse two particular examples of systems whose mean-field limit has been shown to exhibit bi-stability: an enzyme-catalysed system of two mutually inhibitory proteins and a gene regulatory circuit with self-activation. Our theory establishes that the number of molecules of the conserved species is order parameters whose variation regulates bistable behaviour in the associated systems beyond the predictions of the mean-field theory. This prediction is fully confirmed by direct numerical simulations using the stochastic simulation algorithm. This result allows us to propose strategies whereby, by varying the number of molecules of the three conserved chemical species, cell properties associated to bistable behaviour (phenotype, cell-cycle status, etc.) can be controlled.

  18. The effects of intrinsic noise on the behaviour of bistable cell regulatory systems under quasi-steady state conditions.

    Science.gov (United States)

    de la Cruz, Roberto; Guerrero, Pilar; Spill, Fabian; Alarcón, Tomás

    2015-08-21

    We analyse the effect of intrinsic fluctuations on the properties of bistable stochastic systems with time scale separation operating under quasi-steady state conditions. We first formulate a stochastic generalisation of the quasi-steady state approximation based on the semi-classical approximation of the partial differential equation for the generating function associated with the chemical master equation. Such approximation proceeds by optimising an action functional whose associated set of Euler-Lagrange (Hamilton) equations provides the most likely fluctuation path. We show that, under appropriate conditions granting time scale separation, the Hamiltonian can be re-scaled so that the set of Hamilton equations splits up into slow and fast variables, whereby the quasi-steady state approximation can be applied. We analyse two particular examples of systems whose mean-field limit has been shown to exhibit bi-stability: an enzyme-catalysed system of two mutually inhibitory proteins and a gene regulatory circuit with self-activation. Our theory establishes that the number of molecules of the conserved species is order parameters whose variation regulates bistable behaviour in the associated systems beyond the predictions of the mean-field theory. This prediction is fully confirmed by direct numerical simulations using the stochastic simulation algorithm. This result allows us to propose strategies whereby, by varying the number of molecules of the three conserved chemical species, cell properties associated to bistable behaviour (phenotype, cell-cycle status, etc.) can be controlled.

  19. Transcription factor retention on mitotic chromosomes: regulatory mechanisms and impact on cell fate decisions.

    Science.gov (United States)

    Raccaud, Mahé; Suter, David M

    2017-09-01

    During mitosis, gene transcription stops, and the bulk of DNA-binding proteins are excluded from condensed chromosomes. While most gene-specific transcription factors are largely evicted from mitotic chromosomes, a subset remains bound to specific and non-specific DNA sites. Here, we review the current knowledge on the mechanisms leading to the retention of a subset of transcription factors on mitotic chromosomes and discuss the implications in gene expression regulation and their potential as an epigenetic mechanism controlling stem cell self-renewal and differentiation. © 2017 Federation of European Biochemical Societies.

  20. Mechanical response of human female breast skin under uniaxial stretching.

    Science.gov (United States)

    Kumaraswamy, N; Khatam, Hamed; Reece, Gregory P; Fingeret, Michelle C; Markey, Mia K; Ravi-Chandar, Krishnaswamy

    2017-10-01

    Skin is a complex material covering the entire surface of the human body. Studying the mechanical properties of skin to calibrate a constitutive model is of great importance to many applications such as plastic or cosmetic surgery and treatment of skin-based diseases like decubitus ulcers. The main objective of the present study was to identify and calibrate an appropriate material constitutive model for skin and establish certain universal properties that are independent of patient-specific variability. We performed uniaxial tests performed on breast skin specimens freshly harvested during mastectomy. Two different constitutive models - one phenomenological and another microstructurally inspired - were used to interpret the mechanical responses observed in the experiments. Remarkably, we found that the model parameters that characterize dependence on previous maximum stretch (or preconditioning) exhibited specimen-independent universal behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Peer influence: Neural mechanisms underlying in-group conformity

    Directory of Open Access Journals (Sweden)

    Mirre eStallen

    2013-03-01

    Full Text Available People often conform to the behavior of others with whom they identify. However, it is unclear what fundamental mechanisms underlie this type of conformity. Here, we investigate the processes mediating in-group conformity by using functional magnetic resonance imaging (fMRI. Participants completed a perceptual decision-making task while undergoing fMRI, during which they were exposed to the judgments of both in-group and out-group members. Our data suggest that conformity to the in-group is mediated by both positive affect as well as the cognitive capacity of perspective taking. Examining the processes that drive in-group conformity by utilizing a basic decision-making paradigm combined with neuroimaging methods provides important insights into the potential mechanisms of conformity. These results may provide an integral step in developing more effective campaigns using group conformity as a tool for behavioral change.

  2. Peer influence: neural mechanisms underlying in-group conformity.

    Science.gov (United States)

    Stallen, Mirre; Smidts, Ale; Sanfey, Alan G

    2013-01-01

    People often conform to the behavior of others with whom they identify. However, it is unclear what fundamental mechanisms underlie this type of conformity. Here, we investigate the processes mediating in-group conformity by using functional magnetic resonance imaging (fMRI). Participants completed a perceptual decision-making task while undergoing fMRI, during which they were exposed to the judgments of both in-group and out-group members. Our data suggest that conformity to the in-group is mediated by both positive affect as well as the cognitive capacity of perspective taking. Examining the processes that drive in-group conformity by utilizing a basic decision-making paradigm combined with neuroimaging methods provides important insights into the potential mechanisms of conformity. These results may provide an integral step in developing more effective campaigns using group conformity as a tool for behavioral change.

  3. Molecular Mechanism Underlying Lymphatic Metastasis in Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Zhiwen Xiao

    2014-01-01

    Full Text Available As the most challenging human malignancies, pancreatic cancer is characterized by its insidious symptoms, low rate of surgical resection, high risk of local invasion, metastasis and recurrence, and overall dismal prognosis. Lymphatic metastasis, above all, is recognized as an early adverse event in progression of pancreatic cancer and has been described to be an independent poor prognostic factor. It should be noted that the occurrence of lymphatic metastasis is not a casual or stochastic but an ineluctable and designed event. Increasing evidences suggest that metastasis-initiating cells (MICs and the microenvironments may act as a double-reed style in this crime. However, the exact mechanisms on how they function synergistically for this dismal clinical course remain largely elusive. Therefore, a better understanding of its molecular and cellular mechanisms involved in pancreatic lymphatic metastasis is urgently required. In this review, we will summarize the latest advances on lymphatic metastasis in pancreatic cancer.

  4. Mental imagery in music performance: underlying mechanisms and potential benefits.

    Science.gov (United States)

    Keller, Peter E

    2012-04-01

    This paper examines the role of mental imagery in music performance. Self-reports by musicians, and various other sources of anecdotal evidence, suggest that covert auditory, motor, and/or visual imagery facilitate multiple aspects of music performance. The cognitive and motor mechanisms that underlie such imagery include working memory, action simulation, and internal models. Together these mechanisms support the generation of anticipatory images that enable thorough action planning and movement execution that is characterized by efficiency, temporal precision, and biomechanical economy. In ensemble performance, anticipatory imagery may facilitate interpersonal coordination by enhancing online predictions about others' action timing. Overlap in brain regions subserving auditory imagery and temporal prediction is consistent with this view. It is concluded that individual differences in anticipatory imagery may be a source of variation in expressive performance excellence and the quality of ensemble cohesion. Engaging in effortful musical imagery is therefore justified when artistic perfection is the goal. © 2012 New York Academy of Sciences.

  5. Neural mechanisms underlying context-dependent shifts in risk preferences

    NARCIS (Netherlands)

    Losecaat Vermeer, A.B.; Boksem, M.A.S.; Sanfey, A.G.

    2014-01-01

    Studies of risky decision-making have demonstrated that humans typically prefer risky options after incurring a financial loss, while generally preferring safer options after a monetary gain. Here, we examined the neural processes underlying these inconsistent risk preferences by investigating the

  6. [Mechanisms underlying glucocorticoid resistance in chronic rhinosinusitis with nasal polyps].

    Science.gov (United States)

    Zhang, Y Y; Lou, H F; Wang, C S; Zhang, L

    2018-02-07

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is a chronic inflammatory disease that occurs in the nasal and sinus mucosa, which is a common disease in otorhinolaryngology. At present, CRSwNP can be effectively treated by glucocorticoids (GC). GC binds to GC receptors in the nasal mucosa, affects the expression of inflammatory genes, inhibits the activation and action of eosinophils, T cell-associated inflammatory responses in nasal polyps, as well as tissue remodeling. However, there are some patients fall reponse to GC, so called GC resistance. The study suggests that the possible mechanism of CRSwNP GC resistance is mainly related to GC receptor abnormal, the role of cytokines and transcription factors, such as Th cells and IL-8. In addition, MAPK-related kinases and histone deacetylase in the GC signaling pathway also play important roles in the GC resistance process. This paper reviews the mechanism of GC treatment of CRSwNP, the mechanism of GC resistance and alternative treatment of GC.

  7. The Survival Advantage: Underlying Mechanisms and Extant Limitations

    Directory of Open Access Journals (Sweden)

    Stephanie A. Kazanas

    2015-04-01

    Full Text Available Recently, researchers have begun to investigate the function of memory in our evolutionary history. According to Nairne and colleagues (e.g., Nairne, Pandeirada, and Thompson, 2008; Nairne, Thompson, and Pandeirada, 2007, the best mnemonic strategy for learning lists of unrelated words may be one that addresses the same problems that our Pleistocene ancestors faced: fitness-relevant problems including securing food and water, as well as protecting themselves from predators. Survival processing has been shown to promote better recall and recognition memory than many well-known mnemonic strategies (e.g., pleasantness ratings, imagery, generation, etc.. However, the survival advantage does not extend to all types of stimuli and tasks. The current review presents research that has replicated Nairne et al.'s (2007 original findings, in addition to the research designs that fail to replicate the survival advantage. In other words, there are specific manipulations in which survival processing does not appear to benefit memory any more than other strategies. Potential mechanisms for the survival advantage are described, with an emphasis on those that are the most plausible. These proximate mechanisms outline the memory processes that may contribute to the advantage, although the ultimate mechanism may be the congruity between the survival scenario and Pleistocene problem-solving.

  8. Passive and active response of bacteria under mechanical compression

    Science.gov (United States)

    Garces, Renata; Miller, Samantha; Schmidt, Christoph F.; Byophysics Team; Institute of Medical Sciences Collaboration

    Bacteria display simple but fascinating cellular structures and geometries. Their shapes are the result of the interplay between osmotic pressure and cell wall construction. Typically, bacteria maintain a high difference of osmotic pressure (on the order of 1 atm) to the environment. This pressure difference (turgor pressure) is supported by the cell envelope, a composite of lipid membranes and a rigid cell wall. The response of the cell envelope to mechanical perturbations such as geometrical confinements is important for the cells survival. Another key property of bacteria is the ability to regulate turgor pressure after abrupt changes of external osmotic conditions. This response relies on the activity of mechanosensitive (MS) channels: membrane proteins that release solutes in response to excessive stress in the cell envelope. We here present experimental data on the mechanical response of the cell envelope and on turgor regulation of bacteria subjected to compressive forces. We indent living cells with micron-sized beads attached to the cantilever of an atomic force microscope (AFM). This approach ensures global deformation of the cell. We show that such mechanical loading is sufficient to gate mechanosensitive channels in isosmotic conditions.

  9. The mechanisms of low nitrogen induced weakened photosynthesis in summer maize (Zea mays L.) under field conditions.

    Science.gov (United States)

    Wei, Shanshan; Wang, Xiangyu; Shi, Deyang; Li, Yanhong; Zhang, Jiwang; Liu, Peng; Zhao, Bin; Dong, Shuting

    2016-08-01

    Soil nitrogen (N) shortage is a problem which affects many developing nations. Crops grown with low soil N levels show a marked decrease in the rate of photosynthesis and this deficiency reduces crop yield significantly. Therefore, developing a better understanding of the mechanisms by which low N levels cause decreased photosynthesis is crucial for maize agriculture. To better understand this process, we assessed the responses of photosynthesis traits and enzymatic activities in the summer maize cultivar Denghai 618 under field conditions with and without the use of N fertilisers. We measured photosynthesis parameters, and compared proteome compositions to identify the mechanisms of physiological and biochemical adaptations to N deficiency in maize. We observed that parameters that indicated the rate of photosynthesis decreased significantly under N deficiency, and this response was associated with leaf senescence. Moreover, we identified 37 proteins involved in leaf photosynthesis, and found that N deficiency significantly affected light-dependent and light-independent reactions in maize leaf photosynthesis. Although further analysis is required to fully elucidate the roles of these proteins in the response to N deficiency, our study identified candidate proteins which may be involved in the regulatory mechanisms involved in reduced photosynthesis under low N conditions in maize. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  10. Phosphorene under strain:electronic, mechanical and piezoelectric responses

    Science.gov (United States)

    Drissi, L. B.; Sadki, S.; Sadki, K.

    2018-01-01

    Structural, electronic, elastic and piezoelectric properties of pure phosphorene under in-plane strain are investigated using first-principles calculations based on density functional theory. The two critical yielding points are determined along armchair and zigzag directions. It is shown that the buckling, the band gap and the charge transfer can be controlled under strains. A semiconductor to metallic transition is observed in metastable region. Polar plots of Young's modulus, Poisson ratio, sound velocities and Debye temperature exhibit evident anisotropic feature of phosphorene and indicate auxetic behavior for some angles θ. Our calculations show also that phosphorene has both in-plane and out-of-plane piezoelectric responses comparable to known 2D materials. The findings of this work reveal the great potential of pure phosphorene in nanomechanical applications.

  11. Electronic, mechanical and dielectric properties of silicane under tensile strain

    Energy Technology Data Exchange (ETDEWEB)

    Jamdagni, Pooja, E-mail: j.poojaa1228@gmail.com; Sharma, Munish; Ahluwalia, P. K. [Physics Department, Himachal Pradesh University, Shimla, Himachal Pradesh, India 171005 (India); Kumar, Ashok [Physics Department, Panjab University, Chandigarh, India, 160014 (India); Thakur, Anil [Physics Department, Govt. Collage Solan, Himachal Pradesh, India,173212 (India)

    2015-05-15

    The electronic, mechanical and dielectric properties of fully hydrogenated silicene i.e. silicane in stable configuration are studied by means of density functional theory based calculations. The band gap of silicane monolayer can be flexibly reduced to zero when subjected to bi-axial tensile strain, leading to semi-conducting to metallic transition, whereas the static dielectric constant for in-plane polarization increases monotonically with increasing strain. Also the EEL function show the red shift in resonance peak with tensile strain. Our results offer useful insight for the application of silicane monolayer in nano-optical and electronics devices.

  12. Electronic, mechanical and dielectric properties of silicane under tensile strain

    International Nuclear Information System (INIS)

    Jamdagni, Pooja; Sharma, Munish; Ahluwalia, P. K.; Kumar, Ashok; Thakur, Anil

    2015-01-01

    The electronic, mechanical and dielectric properties of fully hydrogenated silicene i.e. silicane in stable configuration are studied by means of density functional theory based calculations. The band gap of silicane monolayer can be flexibly reduced to zero when subjected to bi-axial tensile strain, leading to semi-conducting to metallic transition, whereas the static dielectric constant for in-plane polarization increases monotonically with increasing strain. Also the EEL function show the red shift in resonance peak with tensile strain. Our results offer useful insight for the application of silicane monolayer in nano-optical and electronics devices

  13. Studies on Molecular Mechanisms Underlying Spinocerebellar Ataxia Type 3

    DEFF Research Database (Denmark)

    Kristensen, Line Vildbrad

    The polyglutamine (polyQ) disorders comprise nine diseases characterized by an expanded polyQ tract within the respective proteins. These disorders are rare but include the well-known Huntington’s disease, and several spinocerebellar ataxias (SCAs). The diseases usually strike midlife and progress....... Even though a range of mechanisms contributing to polyQ diseases have been uncovered, there is still no treatment available. One of the more common polyQ diseases is SCA3, which is caused by a polyQ expansion in the ataxin-3 protein that normally functions as a deubiquitinating enzyme involved...

  14. Ethanol Neurotoxicity in the Developing Cerebellum: Underlying Mechanisms and Implications

    Directory of Open Access Journals (Sweden)

    Ambrish Kumar

    2013-06-01

    Full Text Available Ethanol is the main constituent of alcoholic beverages that exerts toxicity to neuronal development. Ethanol affects synaptogenesis and prevents proper brain development. In humans, synaptogenesis takes place during the third trimester of pregnancy, and in rodents this period corresponds to the initial few weeks of postnatal development. In this period neuronal maturation and differentiation begin and neuronal cells start migrating to their ultimate destinations. Although the neuronal development of all areas of the brain is affected, the cerebellum and cerebellar neurons are more susceptible to the damaging effects of ethanol. Ethanol’s harmful effects include neuronal cell death, impaired differentiation, reduction of neuronal numbers, and weakening of neuronal plasticity. Neuronal development requires many hormones and growth factors such as retinoic acid, nerve growth factors, and cytokines. These factors regulate development and differentiation of neurons by acting through various receptors and their signaling pathways. Ethanol exposure during development impairs neuronal signaling mechanisms mediated by the N-methyl-d-aspartate (NMDA receptors, the retinoic acid receptors, and by growth factors such as brain-derived neurotrophic factor (BDNF, insulin-like growth factor 1 (IGF-I, and basic fibroblast growth factor (bFGF. In combination, these ethanol effects disrupt cellular homeostasis, reduce the survival and migration of neurons, and lead to various developmental defects in the brain. Here we review the signaling mechanisms that are required for proper neuronal development, and how these processes are impaired by ethanol resulting in harmful consequences to brain development.

  15. Conserved regulatory mechanism controls the development of cells with rooting functions in land plants

    OpenAIRE

    Tam, Thomas Ho Yuen; Catarino, Bruno; Dolan, Liam

    2015-01-01

    This work describes the discovery of an ancient genetic mechanism that was used to build rooting systems when plants colonized the relatively dry continental surfaces >470 million years ago. We demonstrate that a group of basic helix–loop–helix transcription factors—the LOTUS JAPONICUS ROOTHAIRLESS1-LIKE proteins—is part of a conserved auxin-regulated gene network that controls the development of tip-growing cells with rooting functions among extant land plants. This result suggests that this...

  16. Standard format and content of financial assurance mechanisms required for decommissioning under 10 CFR parts 30, 40, 70, and 72

    International Nuclear Information System (INIS)

    1990-01-01

    The Nuclear Regulatory Commission (NRC) has established technical and financial regulations for decommissioning licensed nuclear facilities (53 FR 24018, June 27, 1988). The regulations address decommissioning planning needs, timing, funding methods, and environmental review requirements for public and private facilities holding licenses under 10 CFR Parts 30, 40, 50, 70, and 72, with the exception of uranium mills. The intent of the regulations is to ensure that the decommissioning of all licensed facilities will be accomplished in a safe and timely manner and that licensees will provide adequate funds to cover all costs associated with decommissioning. The purpose of this regulatory guide, ''Standard Format and Content of Financial Assurance Mechanisms Required for Decommissioning Under 10 CFR Parts 30, 40, 70, and 72,'' is to provide guidance acceptable to the NRC staff on the information to be provided for establishing financial assurance for decommissioning and to establish a standard format for presenting the information. Use of the standard format will (1) help ensure that the financial instruments contain the information required by 10 CFR Parts 30, 40, 70, and 72, (2) aid the applicant and NRC staff in ensuring that the information is complete, and (3) help persons reading the financial instruments to locate information. 5 refs., 13 figs

  17. Seed maturation associated transcriptional programs and regulatory networks underlying genotypic difference in seed dormancy and size/weight in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Yamasaki, Yuji; Gao, Feng; Jordan, Mark C; Ayele, Belay T

    2017-09-16

    Maturation forms one of the critical seed developmental phases and it is characterized mainly by programmed cell death, dormancy and desiccation, however, the transcriptional programs and regulatory networks underlying acquisition of dormancy and deposition of storage reserves during the maturation phase of seed development are poorly understood in wheat. The present study performed comparative spatiotemporal transcriptomic analysis of seed maturation in two wheat genotypes with contrasting seed weight/size and dormancy phenotype. The embryo and endosperm tissues of maturing seeds appeared to exhibit genotype-specific temporal shifts in gene expression profile that might contribute to the seed phenotypic variations. Functional annotations of gene clusters suggest that the two tissues exhibit distinct but genotypically overlapping molecular functions. Motif enrichment predicts genotypically distinct abscisic acid (ABA) and gibberellin (GA) regulated transcriptional networks contribute to the contrasting seed weight/size and dormancy phenotypes between the two genotypes. While other ABA responsive element (ABRE) motifs are enriched in both genotypes, the prevalence of G-box-like motif specifically in tissues of the dormant genotype suggests distinct ABA mediated transcriptional mechanisms control the establishment of dormancy during seed maturation. In agreement with this, the bZIP transcription factors that co-express with ABRE enriched embryonic genes differ with genotype. The enrichment of SITEIIATCYTC motif specifically in embryo clusters of maturing seeds irrespective of genotype predicts a tissue specific role for the respective TCP transcription factors with no or minimal contribution to the variations in seed dormancy. The results of this study advance our understanding of the seed maturation associated molecular mechanisms underlying variation in dormancy and weight/size in wheat seeds, which is a critical step towards the designing of molecular strategies

  18. Internal insulation failure mechanisms of HV equipment under service conditions

    Energy Technology Data Exchange (ETDEWEB)

    Lokhanin, A.K.; Morozova, T.I. [All-Russian Electrochemical Inst. (Russian Federation); Shneider, G.Y. [Electrozavod Holding Company (Russian Federation); Sokolov, V.V. [Scientific and Engineering Centre, ZTZ Service Research Inst. (Russian Federation); Chornogotsky, V.M. [Ukrainian Transformer Research Inst. (Ukraine)

    2005-09-01

    Failure mechanisms in oil-barrier transformer insulation and oil-paper condenser type insulation of transformers and HV bushing were discussed with reference to typical defects and failure modes of oil-barrier insulation of transformers, shunt reactor, condenser type bushing and instrument current transformers. It was noted that insulation problems predominantly involve the impairment of insulation, and that the relative rate of major failures in shunt reactors is about 1 per cent. It was suggested that bushings can cause about 45 per cent of major transformer failures, with aged mode failure occurring most frequently. The failure rate of 220-500 kV CTs accounts for more than 60 per cent of total instrument transformer failures. Two failure modes were observed: ionisation-mode and aging-mode failures. The reduction of switching surge breakdown voltage due to deposit of insoluble aging products was discussed. A long-term dielectric strength test revealed the following 2 mechanisms of insulation breakdown: accidental breakdown during the first period of aging and wearing mode breakdown due to degradation of materials at the last stage of the calculated terms of aging. Issues concerning the mechanism of the incipient irreversible failure in oil-barrier insulation were discussed, as well as issues concerning creeping discharge and large failures during normal operating conditions. It was suggested that the occurrence of surface discharge is associated with increased voltage due to oil breakdown progressing into insulation destruction and surface discharge as a self-firing phenomenon. Failure modes induced by peculiar oil and staining of internal porcelain were reviewed. It was noted that the discharges across the inner part of the transformer and porcelain were the out-come of a typical aging-mode phenomenon in the bushing. In addition, failure modes induced by staining the outer surface of bottom porcelain were discussed, as well as failure of oil-filled paper

  19. Parametric study of control mechanism of cortical bone remodeling under mechanical stimulus

    Science.gov (United States)

    Wang, Yanan; Qin, Qing-Hua

    2010-03-01

    The control mechanism of mechanical bone remodeling at cellular level was investigated by means of an extensive parametric study on a theoretical model described in this paper. From a perspective of control mechanism, it was found that there are several control mechanisms working simultaneously in bone remodeling which is a complex process. Typically, an extensive parametric study was carried out for investigating model parameter space related to cell differentiation and apoptosis which can describe the fundamental cell lineage behaviors. After analyzing all the combinations of 728 permutations in six model parameters, we have identified a small number of parameter combinations that can lead to physiologically realistic responses which are similar to theoretically idealized physiological responses. The results presented in the work enhanced our understanding on mechanical bone remodeling and the identified control mechanisms can help researchers to develop combined pharmacological-mechanical therapies to treat bone loss diseases such as osteoporosis.

  20. Mechanisms Underlying Profibrotic Epithelial Phenotype and Epithelial-Mesenchymal Crosstalk

    DEFF Research Database (Denmark)

    Bialik, Janne Folke

    , their roles in epithelial reprogramming are unclear. The aim of this thesis was to elucidate (i) the mechanism of TGFβ-induced TAZ expression in kidney fibrosis, (ii) the roles of MRTF and TAZ in PEP, (iii) how MRTF and TAZ regulate the oxidative state of the epithelium, and (iv) if the ensuing ROS production...... and TAZ prevented this, linking the cytoskeleton to the oxidative state of the cell. In Paper II TGFβ-induced increase in TAZ expression was investigated. Using pharmacological inhibition we show that non-canonical signaling via p38 and its downstream target MK2 mediates this upregulation. Furthermore......, MRTF regulates TAZ expression in a translocation-independent manner. Pharmacological inhibition of Nox4, a known activator of p38, resulted in decreased TAZ, suggesting a feedback loop in which Nox4 regulates TAZ and MRTF, which in turn regulates Nox4. In Paper III we investigated cytokine expression...

  1. Mechanisms underlying rapid aldosterone effects in the kidney.

    LENUS (Irish Health Repository)

    Thomas, Warren

    2012-02-01

    The steroid hormone aldosterone is a key regulator of electrolyte transport in the kidney and contributes to both homeostatic whole-body electrolyte balance and the development of renal and cardiovascular pathologies. Aldosterone exerts its action principally through the mineralocorticoid receptor (MR), which acts as a ligand-dependent transcription factor in target tissues. Aldosterone also stimulates the activation of protein kinases and secondary messenger signaling cascades that act independently on specific molecular targets in the cell membrane and also modulate the transcriptional action of aldosterone through MR. This review describes current knowledge regarding the mechanisms and targets of rapid aldosterone action in the nephron and how aldosterone integrates these responses into the regulation of renal physiology.

  2. Mechanisms underlying rapid aldosterone effects in the kidney.

    LENUS (Irish Health Repository)

    Thomas, Warren

    2011-03-17

    The steroid hormone aldosterone is a key regulator of electrolyte transport in the kidney and contributes to both homeostatic whole-body electrolyte balance and the development of renal and cardiovascular pathologies. Aldosterone exerts its action principally through the mineralocorticoid receptor (MR), which acts as a ligand-dependent transcription factor in target tissues. Aldosterone also stimulates the activation of protein kinases and secondary messenger signaling cascades that act independently on specific molecular targets in the cell membrane and also modulate the transcriptional action of aldosterone through MR. This review describes current knowledge regarding the mechanisms and targets of rapid aldosterone action in the nephron and how aldosterone integrates these responses into the regulation of renal physiology.

  3. Molecular mechanisms underlying the development of hepatocellular carcinoma.

    Science.gov (United States)

    Bergsland, E K

    2001-10-01

    Hepatocellular carcinoma (HCC) is a disease that is extremely difficult to manage and is markedly increasing in incidence. Malignant transformation generally occurs in the setting of liver dysfunction related to a number of different diseases, including viral hepatitis, alcoholic liver disease, and aflatoxin exposure. Short of surgical or ablative approaches, no standard therapy exists for HCC and the prognosis is poor. Perhaps our best hope is that further elucidation of the specific molecular features underlying the disease will translate into innovative, and potentially disease-specific strategies to manage this difficult cancer. Exposure to aflatoxin is associated with a specific mutation in the tumor-suppressor gene p53. The exact molecular events underlying hepatocarcinogenesis in the setting of viral infection have yet to be elucidated, although there is evidence to suggest that virus-encoded proteins contribute to malignant transformation. Both hepatitis B X antigen and hepatitis C core protein appear to interact with a variety of cellular proteins leading to alterations in signal transduction and transcriptional activity. These events presumably cooperate to facilitate malignant progression by promoting extended hepatocyte survival, evasion of the immune response, and acquisition of mutations through genomic instability. Copyright 2001 by W.B. Saunders Company.

  4. Neural mechanisms underlying neurooptometric rehabilitation following traumatic brain injury

    Directory of Open Access Journals (Sweden)

    Hudac CM

    2012-01-01

    Full Text Available Caitlin M Hudac1, Srinivas Kota1, James L Nedrow2, Dennis L Molfese1,31Department of Psychology, University of Nebraska-Lincoln, 2Oculi Vision Rehabilitation, 3Center for Brain, Biology, and Behavior, University of Nebraska-Lincoln, Lincoln, NEAbstract: Mild to severe traumatic brain injuries have lasting effects on everyday functioning. Issues relating to sensory problems are often overlooked or not addressed until well after the onset of the injury. In particular, vision problems related to ambient vision and the magnocellular pathway often result in posttrauma vision syndrome or visual midline shift syndrome. Symptoms from these syndromes are not restricted to the visual domain. Patients commonly experience proprioceptive, kinesthetic, vestibular, cognitive, and language problems. Neurooptometric rehabilitation often entails the use of corrective lenses, prisms, and binasal occlusion to accommodate the unstable magnocellular system. However, little is known regarding the neural mechanisms engaged during neurooptometric rehabilitation, nor how these mechanisms impact other domains. Event-related potentials from noninvasive electrophysiological recordings can be used to assess rehabilitation progress in patients. In this case report, high-density visual event-related potentials were recorded from one patient with posttrauma vision syndrome and secondary visual midline shift syndrome during a pattern reversal task, both with and without prisms. Results indicate that two factors occurring during the end portion of the P148 component (168–256 milliseconds poststimulus onset map onto two separate neural systems that were engaged with and without neurooptometric rehabilitation. Without prisms, neural sources within somatosensory, language, and executive brain regions engage inefficient magnocellular system processing. However, when corrective prisms were worn, primary visual areas were appropriately engaged. The impact of using early

  5. Mechanical characterization of stomach tissue under uniaxial tensile action.

    Science.gov (United States)

    Jia, Z G; Li, W; Zhou, Z R

    2015-02-26

    In this article, the tensile properties of gastric wall were investigated by using biomechanical test and theoretical analysis. The samples of porcine stomach strips from smaller and greater curvature of the stomach were cut in longitudinal and circumferential direction, respectively. The loading-unloading, stress relaxation, strain creep, tensile fracture tests were performed at mucosa-submucosa, serosa-muscle and intact layer, respectively. Results showed that the biomechanical properties of the porcine stomach depended on the layers, orientations and locations of the gastric wall and presented typical viscoelastic, nonlinear and anisotropic mechanical properties. During loading-unloading test, the stress of serosa-muscle layer in the longitudinal direction was 15-20% more than that in the circumferential direction at 12% stretch ratio, while it could reach about 40% for the intact layer and 50% for the mucosa-submucosa layer. The results of stress relaxation and strain creep showed that the variation degree was obviously faster in the circumferential direction than that in the longitudinal direction, and the ultimate residual values were also different for the different layers, orientations and locations. In the process of fracture test, the serosa-muscle layer fractured firstly followed by the mucosa-submucosa layer when the intact layer was tested, the longitudinal strips firstly began to fracture and the required stress value was about twice as much as that in the circumferential strips. The anisotropy and heterogeneity of mechanical characterization of the porcine stomach were related to its complicated geometry, structure and functions. The results would help us to understand the biomechanics of soft organ tissue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Mechanisms underlying probucol-induced hERG-channel deficiency

    Directory of Open Access Journals (Sweden)

    Shi YQ

    2015-07-01

    Full Text Available Yuan-Qi Shi,1,* Cai-Chuan Yan,1,* Xiao Zhang,1 Meng Yan,1 Li-Rong Liu,1 Huai-Ze Geng,1 Lin Lv,1 Bao-Xin Li1,21Department of Pharmacology, Harbin Medical University, 2State-Province Key Laboratory of Biopharmaceutical Engineering, Harbin, Heilongjiang, People’s Republic of China*These authors contributed equally to this workAbstract: The hERG gene encodes the pore-forming α-subunit of the rapidly activating delayed rectifier potassium channel (IKr, which is important for cardiac repolarization. Reduction of IhERG due to genetic mutations or drug interferences causes long QT syndrome, leading to life-threatening cardiac arrhythmias (torsades de pointes or sudden death. Probucol is a cholesterol-lowering drug that could reduce hERG current by decreasing plasma membrane hERG protein expression and eventually cause long QT syndrome. Here, we investigated the mechanisms of probucol effects on IhERG and hERG-channel expression. Our data demonstrated that probucol reduces SGK1 expression, known as SGK isoform, in a concentration-dependent manner, resulting in downregulation of phosphorylated E3 ubiquitin ligase Nedd4-2 expression, but not the total level of Nedd4-2. As a result, the hERG protein reduces, due to the enhanced ubiquitination level. On the contrary, carbachol could enhance the phosphorylation level of Nedd4-2 as an alternative to SGK1, and thus rescue the ubiquitin-mediated degradation of hERG channels caused by probucol. These discoveries provide a novel mechanism of probucol-induced hERG-channel deficiency, and imply that carbachol or its analog may serve as potential therapeutic compounds for the handling of probucol cardiotoxicity.Keywords: long QT, hERG potassium channels, probucol, SGK1, Nedd4-2

  7. S-nitrosylation/denitrosylation as a regulatory mechanism of salt stress sensing in sunflower seedlings.

    Science.gov (United States)

    Jain, Prachi; von Toerne, Christine; Lindermayr, Christian; Bhatla, Satish C

    2018-01-01

    Nitric oxide (NO) and various reactive nitrogen species produced in cells in normal growth conditions, and their enhanced production under stress conditions are responsible for a variety of biochemical aberrations. The present findings demonstrate that sunflower seedling roots exhibit high sensitivity to salt stress in terms of nitrite accumulation. A significant reduction in S-nitrosoglutathione reductase (GSNOR) activity is evident in response to salt stress. Restoration of GSNOR activity with dithioerythritol shows that the enzyme is reversibly inhibited under conditions of 120 mM NaCl. Salt stress-mediated S-nitrosylation of cytosolic proteins was analyzed in roots and cotyledons using biotin-switch assay. LC-MS/MS analysis revealed opposite patterns of S-nitrosylation in seedling cotyledons and roots. Salt stress enhances S-nitrosylation of proteins in cotyledons, whereas roots exhibit denitrosylation of proteins. Highest number of proteins having undergone S-nitrosylation belonged to the category of carbohydrate metabolism followed by other metabolic proteins. Of the total 61 proteins observed to be regulated by S-nitrosylation, 17 are unique to cotyledons, 4 are unique to roots whereas 40 are common to both. Eighteen S-nitrosylated proteins are being reported for the first time in plant systems, including pectinesterase, phospholipase d-alpha and calmodulin. Further physiological analysis of glyceraldehyde-3-phosphate dehydrogenase and monodehydroascorbate reductase showed that salt stress leads to a reversible inhibition of both these enzymes in cotyledons. However, seedling roots exhibit enhanced enzyme activity under salinity stress. These observations implicate the role of S-nitrosylation and denitrosylation in NO signaling thereby regulating various enzyme activities under salinity stress in sunflower seedlings. © 2017 Scandinavian Plant Physiology Society.

  8. Use of a regulatory mechanism of sex determination in pest insect ...

    Indian Academy of Sciences (India)

    2010-09-06

    Sep 6, 2010 ... 2005) and in Aedes ae- gypti (Phuc et al. 2007). In this system tTA acts not only as a transactivator but also as a lethal effector. Under restric- tive conditions; namely in the absence of tetracycline, tTA accumulates in both sexes of the transgenic insect to lev- els that are lethal to immature stages. One feature ...

  9. Algorithmic mechanisms for reliable crowdsourcing computation under collusion.

    Science.gov (United States)

    Fernández Anta, Antonio; Georgiou, Chryssis; Mosteiro, Miguel A; Pareja, Daniel

    2015-01-01

    We consider a computing system where a master processor assigns a task for execution to worker processors that may collude. We model the workers' decision of whether to comply (compute the task) or not (return a bogus result to save the computation cost) as a game among workers. That is, we assume that workers are rational in a game-theoretic sense. We identify analytically the parameter conditions for a unique Nash Equilibrium where the master obtains the correct result. We also evaluate experimentally mixed equilibria aiming to attain better reliability-profit trade-offs. For a wide range of parameter values that may be used in practice, our simulations show that, in fact, both master and workers are better off using a pure equilibrium where no worker cheats, even under collusion, and even for colluding behaviors that involve deviating from the game.

  10. Mechanisms of microstructural changes of fuel under irradiation

    International Nuclear Information System (INIS)

    Garcia, P.; Carlot, G.; Dorado, B.; Maillard, S.; Sabathier, C.; Martin, G.; Oh, J.Y.; Welland, M.J.

    2015-01-01

    Nuclear fuels are subjected to high levels of radiation damage mainly due to the slowing of fission fragments, which results in substantial modifications of the initial fuel microstructure. Microstructure changes alter practically all engineering fuel properties such as atomic transport or thermomechanical properties so understanding these changes is essential to predicting the performance of fuel elements. Also, with increasing burn-up, the fuel drifts away from its initial composition as the fission process produces new chemical elements. Because nuclear fuels operate at high temperature and usually under high-temperature gradients, damage annealing, foreign atom or defect clustering and migration occur on multiple time and length scales, which make long-term predictions difficult. The end result is a fuel microstructure which may show extensive differences on the scale of a single fuel pellet. The main challenge we are faced with is, therefore, to identify the phenomena occurring on the atom scale that are liable to have macroscopic effects that will determine the microstructure changes and ultimately the life-span of a fuel element. One step towards meeting this challenge is to develop and apply experimental or modelling methods capable of connecting events that occur over very short length and timescales to changes in the fuel microstructure over engineering length and timescales. In the first part of this chapter, we provide an overview of some of the more important microstructure modifications observed in nuclear fuels. The emphasis is placed on oxide fuels because of the extensive amount of data available in relation to these materials under neutron or ion irradiation. When possible and relevant, the specifics of other types of fuels such as metallic or carbide fuels are alluded to. Throughout this chapter but more specifically in the latter part, we attempt to give examples of how modelling and experimentation at various scales can provide us with

  11. Separable mechanisms underlying global feature-based attention.

    Science.gov (United States)

    Bondarenko, Rowena; Boehler, Carsten N; Stoppel, Christian M; Heinze, Hans-Jochen; Schoenfeld, Mircea A; Hopf, Jens-Max

    2012-10-31

    Feature-based attention is known to operate in a spatially global manner, in that the selection of attended features is not bound to the spatial focus of attention. Here we used electromagnetic recordings in human observers to characterize the spatiotemporal signature of such global selection of an orientation feature. Observers performed a simple orientation-discrimination task while ignoring task-irrelevant orientation probes outside the focus of attention. We observed that global feature-based selection, indexed by the brain response to unattended orientation probes, is composed of separable functional components. One such component reflects global selection based on the similarity of the probe with task-relevant orientation values ("template matching"), which is followed by a component reflecting selection based on the similarity of the probe with the orientation value under discrimination in the focus of attention ("discrimination matching"). Importantly, template matching occurs at ∼150 ms after stimulus onset, ∼80 ms before the onset of discrimination matching. Moreover, source activity underlying template matching and discrimination matching was found to originate from ventral extrastriate cortex, with the former being generated in more anterolateral and the latter in more posteromedial parts, suggesting template matching to occur in visual cortex higher up in the visual processing hierarchy than discrimination matching. We take these observations to indicate that the population-level signature of global feature-based selection reflects a sequence of hierarchically ordered operations in extrastriate visual cortex, in which the selection based on task relevance has temporal priority over the selection based on the sensory similarity between input representations.

  12. Neural mechanisms underlying melodic perception and memory for pitch.

    Science.gov (United States)

    Zatorre, R J; Evans, A C; Meyer, E

    1994-04-01

    The neural correlates of music perception were studied by measuring cerebral blood flow (CBF) changes with positron emission tomography (PET). Twelve volunteers were scanned using the bolus water method under four separate conditions: (1) listening to a sequence of noise bursts, (2) listening to unfamiliar tonal melodies, (3) comparing the pitch of the first two notes of the same set of melodies, and (4) comparing the pitch of the first and last notes of the melodies. The latter two conditions were designed to investigate short-term pitch retention under low or high memory load, respectively. Subtraction of the obtained PET images, superimposed on matched MRI scans, provides anatomical localization of CBF changes associated with specific cognitive functions. Listening to melodies, relative to acoustically matched noise sequences, resulted in CBF increases in the right superior temporal and right occipital cortices. Pitch judgments of the first two notes of each melody, relative to passive listening to the same stimuli, resulted in right frontal-lobe activation. Analysis of the high memory load condition relative to passive listening revealed the participation of a number of cortical and subcortical regions, notably in the right frontal and right temporal lobes, as well as in parietal and insular cortex. Both pitch judgment conditions also revealed CBF decreases within the left primary auditory cortex. We conclude that specialized neural systems in the right superior temporal cortex participate in perceptual analysis of melodies; pitch comparisons are effected via a neural network that includes right prefrontal cortex, but active retention of pitch involves the interaction of right temporal and frontal cortices.

  13. Analysis of regulatory mechanisms of an insulin-inducible SHARP-2 gene by (S)-Equol.

    Science.gov (United States)

    Haneishi, Ayumi; Takagi, Katsuhiro; Asano, Kosuke; Yamamoto, Taichi; Tanaka, Takashi; Nakamura, Soichiro; Noguchi, Tamio; Yamada, Kazuya

    2012-09-01

    Small compounds that activate the insulin-dependent signaling pathway have potential therapeutic applications in controlling type 2 diabetes mellitus. The rat enhancer of split- and hairy-related protein-2 (SHARP-2) is an insulin-inducible transcription factor that decreases expression of the phosphoenolpyruvate carboxykinase gene, a gluconeogenic enzyme gene. In this study, we screened for soybean isoflavones that can induce the rat SHARP-2 gene expression and analyzed their mechanism(s). Genistein and (S)-Equol, a metabolite of daidzein, induced rat SHARP-2 gene expression in H4IIE rat hepatoma cells. The (S)-Equol induction was mediated by both the phosphoinositide 3-kinase- and protein kinase C (PKC)-pathways. When a dominant negative form of atypical PKC lambda (aPKCλ) was expressed, the induction of SHARP-2 mRNA level by (S)-Equol was inhibited. In addition, Western blot analyses showed that (S)-Equol rapidly activated both aPKCλ and classical PKC alpha. Furthermore, the (S)-Equol induction was inhibited by treatment with a RNA polymerase inhibitor or a protein synthesis inhibitor. Finally, a reporter gene assay revealed that the transcriptional stimulation by (S)-Equol was mediated by nucleotide sequences located between -4687 and -4133 of the rat SHARP-2 gene. Thus, we conclude that (S)-Equol is an useful dietary supplement to control type 2 diabetes mellitus. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Comparative analysis reveals the underlying mechanism of vertebrate seasonal reproduction.

    Science.gov (United States)

    Ikegami, Keisuke; Yoshimura, Takashi

    2016-02-01

    Animals utilize photoperiodic changes as a calendar to regulate seasonal reproduction. Birds have highly sophisticated photoperiodic mechanisms and functional genomics analysis in quail uncovered the signal transduction pathway regulating avian seasonal reproduction. Birds detect light with deep brain photoreceptors. Long day (LD) stimulus induces secretion of thyroid-stimulating hormone (TSH) from the pars tuberalis (PT) of the pituitary gland. PT-derived TSH locally activates thyroid hormone (TH) in the hypothalamus, which induces gonadotropin-releasing hormone (GnRH) and hence gonadotropin secretion. However, during winter, low temperatures increase serum TH for adaptive thermogenesis, which accelerates germ cell apoptosis by activating the genes involved in metamorphosis. Therefore, TH has a dual role in the regulation of seasonal reproduction. Studies using TSH receptor knockout mice confirmed the involvement of PT-derived TSH in mammalian seasonal reproduction. In addition, studies in mice revealed that the tissue-specific glycosylation of TSH diversifies its function in the circulation to avoid crosstalk. In contrast to birds and mammals, one of the molecular machineries necessary for the seasonal reproduction of fish are localized in the saccus vasculosus from the photoreceptor to the neuroendocrine output. Thus, comparative analysis is a powerful tool to uncover the universality and diversity of fundamental properties in various organisms. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Mechanisms underlying the formation of induced pluripotent stem cells

    Science.gov (United States)

    González, Federico; Huangfu, Danwei

    2015-01-01

    Human pluripotent stem cells (hPSCs) offer unique opportunities for studying human biology, modeling diseases and for therapeutic applications. The simplest approach so far to generate human PSCs lines is through reprogramming of somatic cells from an individual by defined factors, referred to simply as reprogramming. Reprogramming circumvents the ethical issues associated with human embryonic stem cells (hESCs) and nuclear transfer hESCs (nt-hESCs), and the resulting induced pluripotent stem cells (hiPSCs) retain the same basic genetic makeup as the somatic cell used for reprogramming. Since the first report of iPSCs by Takahashi and Yamanaka, the molecular mechanisms of reprogramming have been extensively investigated. A better mechanistic understanding of reprogramming is fundamental not only to iPSC biology and improving the quality of iPSCs for therapeutic use, but also to our understanding of the molecular basis of cell identity, pluripotency and plasticity. Here we summarize the genetic, epigenetic and cellular events during reprogramming, and the roles of various factors identified thus far in the reprogramming process. PMID:26383234

  16. The neural sociometer: brain mechanisms underlying state self-esteem.

    Science.gov (United States)

    Eisenberger, Naomi I; Inagaki, Tristen K; Muscatell, Keely A; Byrne Haltom, Kate E; Leary, Mark R

    2011-11-01

    On the basis of the importance of social connection for survival, humans may have evolved a "sociometer"-a mechanism that translates perceptions of rejection or acceptance into state self-esteem. Here, we explored the neural underpinnings of the sociometer by examining whether neural regions responsive to rejection or acceptance were associated with state self-esteem. Participants underwent fMRI while viewing feedback words ("interesting," "boring") ostensibly chosen by another individual (confederate) to describe the participant's previously recorded interview. Participants rated their state self-esteem in response to each feedback word. Results demonstrated that greater activity in rejection-related neural regions (dorsal ACC, anterior insula) and mentalizing regions was associated with lower-state self-esteem. Additionally, participants whose self-esteem decreased from prescan to postscan versus those whose self-esteem did not showed greater medial prefrontal cortical activity, previously associated with self-referential processing, in response to negative feedback. Together, the results inform our understanding of the origin and nature of our feelings about ourselves.

  17. Raynaud's Phenomenon: A Brief Review of the Underlying Mechanisms.

    Science.gov (United States)

    Fardoun, Manal M; Nassif, Joseph; Issa, Khodr; Baydoun, Elias; Eid, Ali H

    2016-01-01

    Raynaud's phenomenon (RP) is characterized by exaggerated cold-induced vasoconstriction. This augmented vasoconstriction occurs by virtue of a reflex response to cooling via the sympathetic nervous system as well as by local activation of α 2C adrenoceptors (α 2C -AR). In a cold-initiated, mitochondrion-mediated mechanism involving reactive oxygen species and the Rho/ROCK pathway, cytoskeletal rearrangement in vascular smooth muscle cells orchestrates the translocation of α 2C -AR to the cell membrane, where this receptor readily interacts with its ligand. Different parameters are involved in this spatial and functional rescue of α 2C -AR. Of notable relevance is the female hormone, 17β-estradiol, or estrogen. This is consistent with the high prevalence of RP in premenopausal women compared to age-matched males. In addition to dissecting the role of these various players, the contribution of pollution as well as genetic background to the onset and prevalence of RP are also discussed. Different therapeutic approaches employed as treatment modalities for this disease are also highlighted and analyzed. The lack of an appropriate animal model for RP mandates that more efforts be undertaken in order to better understand and eventually treat this disease. Although several lines of treatment are utilized, it is important to note that precaution is often effective in reducing severity or frequency of RP attacks.

  18. Neural mechanisms underlying social conformity in an ultimatum game

    Directory of Open Access Journals (Sweden)

    Zhenyu eWei

    2013-12-01

    Full Text Available When individuals’ actions are incongruent with those of the group they belong to, they may change their initial behavior in order to conform to the group norm. This phenomenon is known as social conformity. In the present study, we used event-related functional magnetic resonance imaging (fMRI to investigate brain activity in response to group opinion during an ultimatum game. Results showed that participants changed their choices when these choices conflicted with the normative opinion of the group they were members of, especially in conditions of unfair treatment. The fMRI data revealed that a conflict with group norms activated the brain regions involved in norm violations and behavioral adjustment. Furthermore, in the reject-unfair condition, we observed that a conflict with group norms activated the medial frontal gyrus. These findings contribute to recent research examining neural mechanisms involved in detecting violations of social norms, and provide information regarding the neural representation of conformity behavior in an economic game.

  19. Adhesive wear mechanism under combined electric diamond grinding

    Directory of Open Access Journals (Sweden)

    Popov Vyacheslav

    2017-01-01

    Full Text Available The article provides a scientific substantiation of loading of metal-bond diamond grinding wheels and describes the mechanism of contact interaction (interlocking of wheels with tool steel as well as its general properties having an influence on combined electric diamond grinding efficiency. The study concluded that a loaded layer can be formed in a few stages different by nature. It is known, that one of the causes of grinding degradation is a continuous loading of active grits (abrasive grinding tool by workpiece chips. It all affects the diamond grinding wheels efficiency and grinding ability with a result in increase of tool pressure, contact temperature and wheels specific removal rate. Science has partially identified some various methods to minimize grinding wheel loading, however, as to loading of metal-bond diamond grinding wheels the search is still in progress. Therefore, research people have to state, that in spite of the fact that the wheels made of cubic boron nitride are of little use as applied to ceramic, ultrahard, hard-alloyed hard-to-machine and nano-materials of the time, but manufactures have to apply cubic boron nitride wheels wherein diamond ones preferable.

  20. Linking Pesticide Exposure with Pediatric Leukemia: Potential Underlying Mechanisms.

    Science.gov (United States)

    Hernández, Antonio F; Menéndez, Pablo

    2016-03-29

    Leukemia is the most common cancer in children, representing 30% of all childhood cancers. The disease arises from recurrent genetic insults that block differentiation of hematopoietic stem and/or progenitor cells (HSPCs) and drives uncontrolled proliferation and survival of the differentiation-blocked clone. Pediatric leukemia is phenotypically and genetically heterogeneous with an obscure etiology. The interaction between genetic factors and environmental agents represents a potential etiological driver. Although information is limited, the principal toxic mechanisms of potential leukemogenic agents (e.g., etoposide, benzene metabolites, bioflavonoids and some pesticides) include topoisomerase II inhibition and/or excessive generation of free radicals, which may induce DNA single- and double-strand breaks (DNA-DSBs) in early HSPCs. Chromosomal rearrangements (duplications, deletions and translocations) may occur if these lesions are not properly repaired. The initiating hit usually occurs in utero and commonly leads to the expression of oncogenic fusion proteins. Subsequent cooperating hits define the disease latency and occur after birth and may be of a genetic, epigenetic or immune nature (i.e., delayed infection-mediated immune deregulation). Here, we review the available experimental and epidemiological evidence linking pesticide exposure to infant and childhood leukemia and provide a mechanistic basis to support the association, focusing on early initiating molecular events.

  1. Raynaud's Phenomenon: a Brief Review of the Underlying Mechanisms

    Directory of Open Access Journals (Sweden)

    Manal Fardoun

    2016-11-01

    Full Text Available Raynaud's phenomenon (RP is characterized by exaggerated cold-induced vasoconstriction. This augmented vasoconstriction occurs by virtue of a reflex response to cooling via the sympathetic nervous system as well as by local activation of α2C adrenoceptors (α2C-AR. In a cold-initiated, mitochondrion-mediated mechanism involving reactive oxygen species and the Rho/ROCK pathway, cytoskeletal rearrangement in vascular smooth muscle cells (VSMCs orchestrates the translocation of α2C-AR to the cell membrane, where this receptor readily interacts with its ligand. Different parameters are involved in this spatial and functional rescue of α2C-AR. Of notable relevance is the female hormone, 17β-estradiol, or estrogen. This is consistent with the high prevalence of RP in pre-menopausal women compared to age-matched males. In addition to dissecting the role of these various players, the contribution of pollution as well as genetic background to the onset and prevalence of RP are also discussed. Different therapeutic approaches employed as treatment modalities for this disease are also highlighted and analyzed. The lack of an appropriate animal model for RP mandates that more efforts be undertaken in order to better understand and eventually treat this disease. Although several lines of treatment are utilized, it is important to note that precaution is often effective in reducing severity or frequency of RP attacks.

  2. Assessing mechanical vulnerability in water distribution networks under multiple failures

    Science.gov (United States)

    Berardi, Luigi; Ugarelli, Rita; Røstum, Jon; Giustolisi, Orazio

    2014-03-01

    Understanding mechanical vulnerability of water distribution networks (WDN) is of direct relevance for water utilities since it entails two different purposes. On the one hand, it might support the identification of severe failure scenarios due to external causes (e.g., natural or intentional events) which result into the most critical consequences on WDN supply capacity. On the other hand, it aims at figure out the WDN portions which are more prone to be affected by asset disruptions. The complexity of such analysis stems from the number of possible scenarios with single and multiple simultaneous shutdowns of asset elements leading to modifications of network topology and insufficient water supply to customers. In this work, the search for the most disruptive combinations of multiple asset failure events is formulated and solved as a multiobjective optimization problem. The higher vulnerability failure scenarios are detected as those causing the lower supplied demand due to the lower number of simultaneous failures. The automatic detection of WDN topology, subsequent to the detachments of failed elements, is combined with pressure-driven analysis. The methodology is demonstrated on a real water distribution network. Results show that, besides the failures causing the detachment of reservoirs, tanks, or pumps, there are other different topological modifications which may cause severe WDN service disruptions. Such information is of direct relevance to support planning asset enhancement works and improve the preparedness to extreme events.

  3. Obstructive sleep apnea and dyslipidemia: evidence and underlying mechanism.

    Science.gov (United States)

    Adedayo, Ajibola Monsur; Olafiranye, Oladipupo; Smith, David; Hill, Alethea; Zizi, Ferdinand; Brown, Clinton; Jean-Louis, Girardin

    2014-03-01

    Over the past half century, evidence has been accumulating on the emergence of obstructive sleep apnea (OSA), the most prevalent sleep-disordered breathing, as a major risk factor for cardiovascular disease. A significant body of research has been focused on elucidating the complex interplay between OSA and cardiovascular risk factors, including dyslipidemia, obesity, hypertension, and diabetes mellitus that portend increased morbidity and mortality in susceptible individuals. Although a clear causal relationship of OSA and dyslipidemia is yet to be demonstrated, there is increasing evidence that chronic intermittent hypoxia, a major component of OSA, is independently associated and possibly the root cause of the dyslipidemia via the generation of stearoyl-coenzyme A desaturase-1 and reactive oxygen species, peroxidation of lipids, and sympathetic system dysfunction. The aim of this review is to highlight the relationship between OSA and dyslipidemia in the development of atherosclerosis and present the pathophysiologic mechanisms linking its association to clinical disease. Issues relating to epidemiology, confounding factors, significant gaps in research and future directions are also discussed.

  4. WrpA Is an Atypical Flavodoxin Family Protein under Regulatory Control of the Brucella abortus General Stress Response System

    Energy Technology Data Exchange (ETDEWEB)

    Herrou, Julien; Czyż, Daniel M.; Willett, Jonathan W.; Kim, Hye-Sook; Chhor, Gekleng; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean; Stock, A. M.

    2016-02-08

    ABSTRACT

    The general stress response (GSR) system of the intracellular pathogenBrucella abortuscontrols the transcription of approximately 100 genes in response to a range of stress cues. The core genetic regulatory components of the GSR are required forB. abortussurvival under nonoptimal growth conditionsin vitroand for maintenance of chronic infection in anin vivomouse model. The functions of the majority of the genes in the GSR transcriptional regulon remain undefined.bab1_1070is among the most highly regulated genes in this regulon: its transcription is activated 20- to 30-fold by the GSR system under oxidative conditionsin vitro. We have solved crystal structures of Bab1_1070 and demonstrate that it forms a homotetrameric complex that resembles those of WrbA-type NADH:quinone oxidoreductases, which are members of the flavodoxin protein family. However,B. abortusWrbA-relatedprotein (WrpA) does not bind flavin cofactors with a high affinity and does not function as an NADH:quinone oxidoreductasein vitro. Soaking crystals with flavin mononucleotide (FMN) revealed a likely low-affinity binding site adjacent to the canonical WrbA flavin binding site. Deletion ofwrpAwrpA) does not compromise cell survival under acute oxidative stressin vitroor attenuate infection in cell-based or mouse models. However, a ΔwrpAstrain does elicit increased splenomegaly in a mouse model, suggesting that WrpA modulatesB. abortusinteraction with its mammalian host. Despite

  5. Dss1 interaction with Brh2 as a regulatory mechanism for recombinational repair

    DEFF Research Database (Denmark)

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin

    2007-01-01

    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus....... Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region...... overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism...

  6. Neural mechanism underlying autobiographical memory modulated by remoteness and emotion

    Science.gov (United States)

    Ge, Ruiyang; Fu, Yan; Wang, DaHua; Yao, Li; Long, Zhiying

    2012-03-01

    Autobiographical memory is the ability to recollect past events from one's own life. Both emotional tone and memory remoteness can influence autobiographical memory retrieval along the time axis of one's life. Although numerous studies have been performed to investigate brain regions involved in retrieving processes of autobiographical memory, the effect of emotional tone and memory age on autobiographical memory retrieval remains to be clarified. Moreover, whether the involvement of hippocampus in consolidation of autobiographical events is time dependent or independent has been controversial. In this study, we investigated the effect of memory remoteness (factor1: recent and remote) and emotional valence (factor2: positive and negative) on neural correlates underlying autobiographical memory by using functional magnetic resonance imaging (fMRI) technique. Although all four conditions activated some common regions known as "core" regions in autobiographical memory retrieval, there are some other regions showing significantly different activation for recent versus remote and positive versus negative memories. In particular, we found that bilateral hippocampal regions were activated in the four conditions regardless of memory remoteness and emotional valence. Thus, our study confirmed some findings of previous studies and provided further evidence to support the multi-trace theory which believes that the role of hippocampus involved in autobiographical memory retrieval is time-independent and permanent in memory consolidation.

  7. Molecular Mechanisms Underlying Origin and Diversification of the Angiosperm Flower

    Science.gov (United States)

    Theissen, Guenter; Melzer, Rainer

    2007-01-01

    Background Understanding the mode and mechanisms of the evolution of the angiosperm flower is a long-standing and central problem of evolutionary biology and botany. It has essentially remained unsolved, however. In contrast, considerable progress has recently been made in our understanding of the genetic basis of flower development in some extant model species. The knowledge that accumulated this way has been pulled together in two major hypotheses, termed the ‘ABC model’ and the ‘floral quartet model’. These models explain how the identity of the different types of floral organs is specified during flower development by homeotic selector genes encoding transcription factors. Scope We intend to explain how the ‘ABC model’ and the ‘floral quartet model’ are now guiding investigations that help to understand the origin and diversification of the angiosperm flower. Conclusions Investigation of orthologues of class B and class C floral homeotic genes in gymnosperms suggest that bisexuality was one of the first innovations during the origin of the flower. The transition from dimer to tetramer formation of floral homeotic proteins after establishment of class E proteins may have increased cooperativity of DNA binding of the transcription factors controlling reproductive growth. That way, we hypothesize, better ‘developmental switches’ originated that facilitated the early evolution of the flower. Expression studies of ABC genes in basally diverging angiosperm lineages, monocots and basal eudicots suggest that the ‘classical’ ABC system known from core eudicots originated from a more fuzzy system with fading borders of gene expression and gradual transitions in organ identity, by sharpening of ABC gene expression domains and organ borders. Shifting boundaries of ABC gene expression may have contributed to the diversification of the angiosperm flower many times independently, as may have changes in interactions between ABC genes and their target

  8. Enhancement of sleep slow waves: underlying mechanisms and practical consequences.

    Directory of Open Access Journals (Sweden)

    Michele eBellesi

    2014-10-01

    Full Text Available Even modest sleep restriction, especially the loss of sleep slow wave activity, is invariably associated with slower EEG activity during wake, the occurrence of local sleep in an otherwise awake brain, and impaired performance due to cognitive and memory deficits. Recent studies not only confirm the beneficial role of sleep in memory consolidation, but also point to a specific role for sleep slow waves. Thus, the implementation of methods to enhance sleep slow waves without unwanted arousals or lightening of sleep could have significant practical implications. Here we first review the evidence that it is possible to enhance sleep slow waves in humans using transcranial direct-current stimulation and transcranial magnetic stimulation. Since these methods are currently impractical and their safety is questionable, especially for chronic long-term exposure, we then discuss novel data suggesting that it is possible to enhance slow waves using sensory stimuli. We consider the physiology of the K-complex, a peripheral evoked slow wave, and show that, among different sensory modalities, acoustic stimulation is the most effective in increasing the magnitude of slow waves, likely through the activation of non-lemniscal ascending pathways to the thalamo-cortical system. In addition, we discuss how intensity and frequency of the acoustic stimuli, as well as exact timing and pattern of stimulation, affect sleep enhancement. Finally, we discuss automated algorithms that read the EEG and, in real-time, adjust the stimulation parameters in a closed-loop manner to obtain an increase in sleep slow waves and avoid undesirable arousals. In conclusion, while discussing the mechanisms that underlie the generation of sleep slow waves, we review the converging evidence showing that acoustic stimulation is safe and represents an ideal tool for slow wave sleep enhancement.

  9. Thin circular cylinder under axisymmetrical thermal and mechanical loading

    International Nuclear Information System (INIS)

    Arnaudeau, F.; Zarka, J.; Gerij, J.

    1977-01-01

    To assess structural integrity of components subjected to cyclic thermal loadings one must look at thermal ratchetting as a possible failure mode. Considering a thin circular cylinder subjected to constant internal pressure and cyclically varying thermal gradient through the thickness Bree, J. Strain Analysis 2 (1967) No.3, obtained a diagram that serves as a foundation for many design rules (e.g.: ASME code). The upper part of the french LMFBR main vessel is subjected to an axisymmetrical axial thermal loading and an axial load (own weight). Operation of the reactor leads to cyclic variations of the axial thermal loading. The question that arises is whether or not the Bree diagram is realistic for such loading conditions. A special purpose computer code (Ratch) was developed to analyse a thin circular cylinder subjected to axisymmetrical mechanical and thermal loadings. The Mendelson's approach of this problem is followed. Classical Kirchoff-Love hypothesis of thin shells is used and a state of plane stress is assumed. Space integrations are performed by Gaussian quadrature in the axial direction and by Simpson's one third rule throughout the thickness. Thermoelastic-plastic constitutive equations are solved with an implicit scheme (Nguyen). Thermovisco-plastic constitutive equations are solved with an explicit time integration scheme (Treanor's algorithm especially fitted). A Bree type diagram is obtained for an axial step of temperature which varies cyclically and a sustained constant axial load. The material behavior is assumed perfectly plastic and creep effect is not considered. Results show that the domain where no ratchetting occurs is reduced when compared with the domain predicted by the Bree diagram

  10. Compression under a mechanical counter pressure space suit glove

    Science.gov (United States)

    Waldie, James M A.; Tanaka, Kunihiko; Tourbier, Dietmar; Webb, Paul; Jarvis, Christine W.; Hargens, Alan R.

    2002-01-01

    Background: Current gas-pressurized space suits are bulky stiff shells severely limiting astronaut function and capability. A mechanical counter pressure (MCP) space suit in the form of a tight elastic garment could dramatically improve extravehicular activity (EVA) dexterity, but also be advantageous in safety, cost, mass and volume. The purpose of this study was to verify that a prototype MCP glove exerts the design compression of 200 mmHg, a pressure similar to the current NASA EVA suit. Methods: Seven male subjects donned a pressure measurement array and MCP glove on the right hand, which was placed into a partial vacuum chamber. Average compression was recorded on the palm, the bottom of the middle finger, the top of the middle finger and the dorsum of the hand at pressures of 760 (ambient), 660 and 580 mmHg. The vacuum chamber was used to simulate the pressure difference between the low breathing pressure of the current NASA space suits (approximately 200 mmHg) and an unprotected hand in space. Results: At ambient conditions, the MCP glove compressed the dorsum of the hand at 203.5 +/- 22.7 mmHg, the bottom of the middle finger at 179.4 +/- 16.0 mmHg, and the top of the middle finger at 183.8 +/- 22.6 mmHg. The palm compression was significantly lower (59.6 +/- 18.8 mmHg, pglove compression with the chamber pressure reductions. Conclusions: The MCP glove compressed the dorsum of the hand and middle finger at the design pressure.

  11. Neural mechanisms underlying cognitive inflexibility in Parkinson's disease.

    Science.gov (United States)

    Lange, Florian; Seer, Caroline; Loens, Sebastian; Wegner, Florian; Schrader, Christoph; Dressler, Dirk; Dengler, Reinhard; Kopp, Bruno

    2016-12-01

    Cognitive inflexibility is a hallmark of executive dysfunction in Parkinson's disease (PD). This deficit consistently manifests itself in a PD-related increase in the number of perseverative errors committed on the Wisconsin Card Sorting Test (WCST). However, the neural processes underlying perseverative WCST performance in PD are still largely unknown. The present study is the first to investigate the event-related potential (ERP) correlates of cognitive inflexibility on the WCST in PD patients. Thirty-two PD patients and 35 matched control participants completed a computerized version of the WCST while the electroencephalogram (EEG) was recorded. Behavioral results revealed the expected increase in perseverative errors in patients with PD. ERP analysis focused on two established indicators of executive processes: the fronto-central P3a as an index of attentional orienting and the sustained parietal positivity (SPP) as an index of set-shifting processes. In comparison to controls, P3a amplitudes were significantly attenuated in PD patients. Regression analysis further revealed that P3a and SPP amplitudes interactively contributed to the prediction of perseverative errors in PD patients: The number of perseverative errors was only increased when both ERP amplitudes were attenuated. Notably, the two ERP markers of executive processes accounted for more than 40% of the variance in perseverative errors in PD patients. We conclude that cognitive inflexibility in PD occurs when the neural bases of multiple executive processes are affected by the pathophysiology of PD. The combined measurement of P3a and SPP might yield an electrophysiological marker of cognitive inflexibility in PD. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Design principles and developmental mechanisms underlying retinal mosaics.

    Science.gov (United States)

    Reese, Benjamin E; Keeley, Patrick W

    2015-08-01

    Most structures within the central nervous system (CNS) are composed of different types of neuron that vary in both number and morphology, but relatively little is known about the interplay between these two features, i.e. about the population dynamics of a given cell type. How such arrays of neurons are distributed within a structure, and how they differentiate their dendrites relative to each other, are issues that have recently drawn attention in the invertebrate nervous system, where the genetic and molecular underpinnings of these organizing principles are being revealed in exquisite detail. The retina is one of the few locations where these principles have been extensively studied in the vertebrate CNS, indeed, where the design principles of 'mosaic regularity' and 'uniformity of coverage' were first explicitly defined, quantified, and related to each other. Recent studies have revealed a number of genes that influence the formation of these histotypical features in the retina, including homologues of those invertebrate genes, although close inspection reveals that they do not always mediate comparable developmental processes nor elucidate fundamental design principles. The present review considers just how pervasive these features of 'mosaic regularity' and 'uniform dendritic coverage' are within the mammalian retina, discussing the means by which such features can be assessed in the mature and developing nervous system and examining the limitations associated with those assessments. We then address the extent to which these two design principles co-exist within different populations of neurons, and how they are achieved during development. Finally, we consider the neural phenotypes obtained in mutant nervous systems, to address whether a prospective gene of interest underlies those very design principles. © 2014 The Authors. Biological Reviews © 2014 Cambridge Philosophical Society.

  13. Photodegradation kinetics, products and mechanism of timolol under simulated sunlight

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yong, E-mail: ychen@hust.edu.cn [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Liang, Qi; Zhou, Danna [College of Material Science and Chemical Engineering, China University of Geosciences, Wuhan 430074 (China); Wang, Zongping, E-mail: zongpingw@hust.edu.cn [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Tao, Tao [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Zuo, Yuegang [Department of Chemistry and Biochemistry, University of Massachusetts Dartmouth, 285 Old Westport Road, North Dartmouth, MA 02747 (United States)

    2013-05-15

    Highlights: ► The indirect degradation of timolol is first investigated in fulvic acid solution. ► {sup 3}FA{sup *} and {sup 1}O{sub 2} accounted for the degradation of timolol in the aerated FA solutions. ► The presence of halides inhibited the degradation in the order of Cl{sup −} < Br{sup −} < I{sup −}. ► The role of I{sup −} in the degradation was first found to be concentration-dependent. ► The photoproducts of timolol were identified by LC-DAD/ESI-MS/MS analysis. -- Abstract: The photodegradation of β-blocker timolol in fulvic acid (FA) solution was investigated under simulated sunlight. The triplet excited state of FA ({sup 3}FA{sup *}) and singlet oxygen ({sup 1}O{sub 2}) were the main reactive species responsible for the degradation of timolol in the aerated FA solutions. Both dissolved oxygen and iodide ions (I{sup −}) are the efficient quenchers of {sup 3}FA{sup *}. The photodegradation was drastically accelerated after removing the dissolved oxygen. The presence of I{sup −} inhibited the photosensitized degradation of timolol in the deoxygenated FA solutions, whereas the role of I{sup −} in the reaction was concentration-dependent in the aerated solutions. The other halide ions such as chloride (Cl{sup −}) and bromide (Br{sup −}) exhibited less effect on the photodegradation of timolol in both aerated and deoxygenated solutions. By LC-DAD/ESI-MS/MS analysis, the photoproducts of timolol in both aerated and deoxygenated FA solutions were identified. Electron transfer interaction occurred between {sup 3}FA{sup *} and amine moiety of timolol, leading to the cleavage of C–O bond in the side chain and oxidation of the hexatomic ring. These findings suggest the photosensitized degradation was a significant pathway for the elimination of timolol in natural waters.

  14. Regulatory mechanisms for iron transport across the blood-brain barrier.

    Science.gov (United States)

    Duck, Kari A; Simpson, Ian A; Connor, James R

    2017-12-09

    Many critical metabolic functions in the brain require adequate and timely delivery of iron. However, most studies when considering brain iron uptake have ignored the iron requirements of the endothelial cells that form the blood-brain barrier (BBB). Moreover, current models of BBB iron transport do not address regional regulation of brain iron uptake or how neurons, when adapting to metabolic demands, can acquire more iron. In this study, we demonstrate that both iron-poor transferrin (apo-Tf) and the iron chelator, deferoxamine, stimulate release of iron from iron-loaded endothelial cells in an in vitro BBB model. The role of the endosomal divalent metal transporter 1 (DMT1) in BBB iron acquisition and transport has been questioned. Here, we show that inhibition of DMT1 alters the transport of iron and Tf across the endothelial cells. These data support an endosome-mediated model of Tf-bound iron uptake into the brain and identifies mechanisms for local regional regulation of brain iron uptake. Moreover, our data provide an explanation for the disparity in the ratio of Tf to iron transport into the brain that has confounded the field. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. miRNA as a New Regulatory Mechanism of Estrogen Vascular Action

    Directory of Open Access Journals (Sweden)

    Daniel Pérez-Cremades

    2018-02-01

    Full Text Available The beneficial effects of estrogen on the cardiovascular system have been reported extensively. In fact, the incidence of cardiovascular diseases in women is lower than in age-matched men during their fertile stage of life, a benefit that disappears after menopause. These sex-related differences point to sexual hormones, mainly estrogen, as possible cardiovascular protective factors. The regulation of vascular function by estrogen is mainly related to the maintenance of normal endothelial function and is mediated by both direct and indirect gene transcription through the activity of specific estrogen receptors. Some of these mechanisms are known, but many remain to be elucidated. In recent years, microRNAs have been established as non-coding RNAs that regulate the expression of a high percentage of protein-coding genes in mammals and are related to the correct function of human physiology. Moreover, within the cardiovascular system, miRNAs have been related to physiological and pathological conditions. In this review, we address what is known about the role of estrogen-regulated miRNAs and their emerging involvement in vascular biology.

  16. Regulatory Mechanisms of a Highly Pectinolytic Mutant of Penicillium occitanis and Functional Analysis of a Candidate Gene in the Plant Pathogen Fusarium oxysporum

    Directory of Open Access Journals (Sweden)

    Gustavo Bravo-Ruiz

    2017-09-01

    Full Text Available Penicillium occitanis is a model system for enzymatic regulation. A mutant strain exhibiting constitutive overproduction of different pectinolytic enzymes both under inducing (pectin or repressing conditions (glucose was previously isolated after chemical mutagenesis. In order to identify the molecular basis of this regulatory mechanism, the genomes of the wild type and the derived mutant strain were sequenced and compared, providing the first reference genome for this species. We used a phylogenomic approach to compare P. occitanis with other pectinolytic fungi and to trace expansions of gene families involved in carbohydrate degradation. Genome comparison between wild type and mutant identified seven mutations associated with predicted proteins. The most likely candidate was a mutation in a highly conserved serine residue of a conserved fungal protein containing a GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain and a fungus-specific transcription factor regulatory middle homology region. To functionally characterize the role of this candidate gene, the mutation was recapitulated in the predicted orthologue Fusarium oxysporum, a vascular wilt pathogen which secretes a wide array of plant cell wall degrading enzymes, including polygalacturonases, pectate lyases, xylanases and proteases, all of which contribute to infection. However, neither the null mutant nor a mutant carrying the analogous point mutation exhibited a deregulation of pectinolytic enzymes. The availability, annotation and phylogenomic analysis of the P. occitanis genome sequence represents an important resource for understanding the evolution and biology of this species, and sets the basis for the discovery of new genes of biotechnological interest for the degradation of complex polysaccharides.

  17. Regulatory Mechanisms of a Highly Pectinolytic Mutant ofPenicillium occitanisand Functional Analysis of a Candidate Gene in the Plant PathogenFusarium oxysporum.

    Science.gov (United States)

    Bravo-Ruiz, Gustavo; Sassi, Azza Hadj; Marcet-Houben, Marina; Di Pietro, Antonio; Gargouri, Ali; Gabaldon, Toni; Roncero, M Isabel G

    2017-01-01

    Penicillium occitanis is a model system for enzymatic regulation. A mutant strain exhibiting constitutive overproduction of different pectinolytic enzymes both under inducing (pectin) or repressing conditions (glucose) was previously isolated after chemical mutagenesis. In order to identify the molecular basis of this regulatory mechanism, the genomes of the wild type and the derived mutant strain were sequenced and compared, providing the first reference genome for this species. We used a phylogenomic approach to compare P. occitanis with other pectinolytic fungi and to trace expansions of gene families involved in carbohydrate degradation. Genome comparison between wild type and mutant identified seven mutations associated with predicted proteins. The most likely candidate was a mutation in a highly conserved serine residue of a conserved fungal protein containing a GAL4-like Zn 2 Cys 6 binuclear cluster DNA-binding domain and a fungus-specific transcription factor regulatory middle homology region. To functionally characterize the role of this candidate gene, the mutation was recapitulated in the predicted orthologue Fusarium oxysporum , a vascular wilt pathogen which secretes a wide array of plant cell wall degrading enzymes, including polygalacturonases, pectate lyases, xylanases and proteases, all of which contribute to infection. However, neither the null mutant nor a mutant carrying the analogous point mutation exhibited a deregulation of pectinolytic enzymes. The availability, annotation and phylogenomic analysis of the P. occitanis genome sequence represents an important resource for understanding the evolution and biology of this species, and sets the basis for the discovery of new genes of biotechnological interest for the degradation of complex polysaccharides.

  18. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level

    Science.gov (United States)

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic–pituitary–gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone–gonadotropin–steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates. PMID:24782832

  19. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6 in Response to Salinity and Water Deficit Stresses.

    Directory of Open Access Journals (Sweden)

    Zeqin Li

    Full Text Available Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants.

  20. A system biology approach to identify regulatory pathways underlying the neuroendocrine control of female puberty in rats and nonhuman primates.

    Science.gov (United States)

    Lomniczi, Alejandro; Wright, Hollis; Castellano, Juan Manuel; Sonmez, Kemal; Ojeda, Sergio R

    2013-07-01

    This article is part of a Special Issue "Puberty and Adolescence". Puberty is a major developmental milestone controlled by the interaction of genetic factors and environmental cues of mostly metabolic and circadian nature. An increased pulsatile release of the decapeptide gonadotropin releasing hormone (GnRH) from hypothalamic neurosecretory neurons is required for both the initiation and progression of the pubertal process. This increase is brought about by coordinated changes that occur in neuronal and glial networks associated with GnRH neurons. These changes ultimately result in increased neuronal and glial stimulatory inputs to the GnRH neuronal network and a reduction of transsynaptic inhibitory influences. While some of the major players controlling pubertal GnRH secretion have been identified using gene-centric approaches, much less is known about the system-wide control of the overall process. Because the pubertal activation of GnRH release involves a diversity of cellular phenotypes, and a myriad of intracellular and cell-to-cell signaling molecules, it appears that the overall process is controlled by a highly coordinated and interactive regulatory system involving hundreds, if not thousands, of gene products. In this article we will discuss emerging evidence suggesting that these genes are arranged as functionally connected networks organized, both internally and across sub-networks, in a hierarchical fashion. According to this concept, the core of these networks is composed of transcriptional regulators that, by directing expression of downstream subordinate genes, provide both stability and coordination to the cellular networks involved in initiating the pubertal process. The integrative response of these gene networks to external inputs is postulated to be coordinated by epigenetic mechanisms. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Regulatory Governance

    DEFF Research Database (Denmark)

    Kjær, Poul F.; Vetterlein, Antje

    2018-01-01

    , legal and cultural, on a global scale. Against this background, this special issue sets out to explore the multifaceted meaning, potential and impact as well as the social praxis of regulatory governance. Under the notions rules, resistance and responsibility the special issue pins out three overall......Regulatory governance frameworks have become essential building blocks of world society. From supply chains to the regimes surrounding international organizations, extensive governance frameworks have emerged which structure and channel a variety of social exchanges, including economic, political...

  2. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    Directory of Open Access Journals (Sweden)

    Joana P Gonçalves

    Full Text Available Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1 apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2 ignore local patterns, abundant in most interesting cases of transcriptional activity; (3 neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4 limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots. Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in

  3. Fracture mechanics in new designed power module under thermo-mechanical loads

    Directory of Open Access Journals (Sweden)

    Durand Camille

    2014-06-01

    Full Text Available Thermo-mechanically induced failure is a major reliability issue in the microelectronic industry. On this account, a new type of Assembly Interconnected Technology used to connect MOSFETs in power modules has been developed. The reliability is increased by using a copper clip soldered on the top side of the chip, avoiding the use of aluminium wire bonds, often responsible for the failure of the device. Thus the new designed MOSFET package does not follow the same failure mechanisms as standard modules. Thermal and power cycling tests were performed on these new packages and resulting failures were analyzed. Thermo-mechanical simulations including cracks in the aluminium metallization and intermetallics (IMC were performed using Finite Element Analysis in order to better understand crack propagation and module behaviour.

  4. Regional disparities in medical equipment distribution in the Slovak Republic - a platform for a health policy regulatory mechanism.

    Science.gov (United States)

    Gavurová, Beáta; Kováč, Viliam; Fedačko, Ján

    2017-11-09

    This study aims to examine the localisation of selected parameters in the deployment and use of medical equipment in the Slovak Republic and to verify potential regional disparities. The study evaluates the benefits of an analytical platform for regulatory mechanisms in the healthcare system. The correspondence analysis is applied to the entire data set containing information regarding medical equipment distribution and mortality. The results highlight regional differences in the use of medical equipment throughout the analysed period from 2008 to 2014. The total amount of medical equipment increased slightly to 9192 devices during the time span. In 2014, there was a significant decrease of 16.44%. Disparities are found in the frequencies and structure of medical equipment. In some regions, medical equipment is not present or is present in low numbers. The results regarding regional disparities demonstrate the regional development of the amount of medical equipment. The deployment of medical equipment is not proportional, and not all of the analysed devices are available in each region. The tests also indicate the appropriateness of the amount of medical equipment and create a platform for further investigation. The results of the analysis suggest the unsuitable distribution of medical equipment throughout the Slovak regions, where there are significant regional disparities. These findings can serve as a monitoring platform to evaluate the accessibility and efficiency of medical equipment usage. No human participants were involved in the research.

  5. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang, E-mail: yhyang6812@scu.edu.cn

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. - Highlights: • ROS contributed to the rapid response of MC3T3-E1 cells for vibration stress. • Imbalance of mitochondrial dynamics were linked to the LMHFV-derived rapid response. • The role of ERK-Drp1 signal pathway in the LMHFV-derived osteoblast rapid response.

  6. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    Science.gov (United States)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.

    2017-02-01

    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  7. Cis and trans regulatory mechanisms control AP2-mediated B cell receptor endocytosis via select tyrosine-based motifs.

    Directory of Open Access Journals (Sweden)

    Kathleen Busman-Sahay

    Full Text Available Following antigen recognition, B cell receptor (BCR-mediated endocytosis is the first step of antigen processing and presentation to CD4+ T cells, a crucial component of the initiation and control of the humoral immune response. Despite this, the molecular mechanism of BCR internalization is poorly understood. Recently, studies of activated B cell-like diffuse large B cell lymphoma (ABC DLBCL have shown that mutations within the BCR subunit CD79b leads to increased BCR surface expression, suggesting that CD79b may control BCR internalization. Adaptor protein 2 (AP2 is the major mediator of receptor endocytosis via clathrin-coated pits. The BCR contains five putative AP2-binding YxxØ motifs, including four that are present within two immunoreceptor tyrosine-based activation motifs (ITAMs. Using a combination of in vitro and in situ approaches, we establish that the sole mediator of AP2-dependent BCR internalization is the membrane proximal ITAM YxxØ motif in CD79b, which is a major target of mutation in ABC DLBCL. In addition, we establish that BCR internalization can be regulated at a minimum of two different levels: regulation of YxxØ AP2 binding in cis by downstream ITAM-embedded DCSM and QTAT regulatory elements and regulation in trans by the partner cytoplasmic domain of the CD79 heterodimer. Beyond establishing the basic rules governing BCR internalization, these results illustrate an underappreciated role for ITAM residues in controlling clathrin-dependent endocytosis and highlight the complex mechanisms that control the activity of AP2 binding motifs in this receptor system.

  8. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    Science.gov (United States)

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  9. Improvements to the DOE low-level waste regulatory structure and process under recommendation 94-2 - progress to date

    International Nuclear Information System (INIS)

    Regnier, E.

    1995-01-01

    Among the concerns expressed by the Defense Nuclear Facility Safety Board (DNFSB) in its Recommendation 94-2 was the lack of a clearly defined and effective internal Department of Energy (DOE) regulatory oversight and enforcement process for ensuring that low-level radioactive waste management health, safety, and environmental requirements are met. Therefore, part of the response to the DNFSB concern is a task to clarify and strengthen the low-level waste management regulatory structure. This task is being conducted in two steps. First, consistent with the requirements of the current DOE waste management order and within the framework of the current organizational structure, interim clarification of a review process and the associated organizational responsibilities has been issued. Second, in coordination with the revision of the waste management order and consistent with the organizational responsibilities resulting from the strategic alignment of DOE, a rigorous, more independent regulatory oversight structure will be developed

  10. Improvements to the DOE low-level waste regulatory structure and process under recommendation 94-2 - progress to date

    Energy Technology Data Exchange (ETDEWEB)

    Regnier, E.

    1995-12-31

    Among the concerns expressed by the Defense Nuclear Facility Safety Board (DNFSB) in its Recommendation 94-2 was the lack of a clearly defined and effective internal Department of Energy (DOE) regulatory oversight and enforcement process for ensuring that low-level radioactive waste management health, safety, and environmental requirements are met. Therefore, part of the response to the DNFSB concern is a task to clarify and strengthen the low-level waste management regulatory structure. This task is being conducted in two steps. First, consistent with the requirements of the current DOE waste management order and within the framework of the current organizational structure, interim clarification of a review process and the associated organizational responsibilities has been issued. Second, in coordination with the revision of the waste management order and consistent with the organizational responsibilities resulting from the strategic alignment of DOE, a rigorous, more independent regulatory oversight structure will be developed.

  11. Resveratrol increases nucleus pulposus matrix synthesis through activating the PI3K/Akt signaling pathway under mechanical compression in a disc organ culture.

    Science.gov (United States)

    Han, Xiaorui; Leng, Xiaoming; Zhao, Man; Wu, Mei; Chen, Amei; Hong, Guoju; Sun, Ping

    2017-12-22

    Disc nucleus pulposus (NP) matrix homeostasis is important for normal disc function. Mechanical overloading seriously decreases matrix synthesis and increases matrix degradation. The present study aims to investigate the effects of resveratrol on disc NP matrix homeostasis under a relatively high-magnitude mechanical compression and the potential mechanism underlying this process. Porcine discs were perfusion-cultured and subjected to a relatively high-magnitude mechanical compression (1.3 MPa at a frequency of 1.0 Hz for 2 h once per day) for 7 days in a mechanically active bioreactor. The non-compressed discs were used as controls. Resveratrol was added along with culture medium to observe the effects of resveratrol on NP matrix synthesis under mechanical load respectively. NP matrix synthesis was evaluated by histology, biochemical content (glycosaminoglycan (GAG) and hydroxyproline (HYP)), and expression of matrix macromolecules (aggrecan and collagen II). Results showed that this high-magnitude mechanical compression significantly decreased NP matrix content, indicated by the decreased staining intensity of Alcian Blue and biochemical content (GAG and HYP), and the down-regulated expression of NP matrix macromolecules (aggrecan and collagen II). Further analysis indicated that resveratrol partly stimulated NP matrix synthesis and increased activity of the PI3K/Akt pathway in a dose-dependent manner under mechanical compression. Together, resveratrol is beneficial for disc NP matrix synthesis under mechanical overloading, and the activation of the PI3K/Akt pathway may participate in this regulatory process. Resveratrol may be promising to regenerate mechanical overloading-induced disc degeneration. © 2017 The Author(s).

  12. Interactivity effects in social media marketing on brand engagement: an investigation of underlying mechanisms

    NARCIS (Netherlands)

    Antheunis, M.L.; van Noort, G.; Eisend, M.; Langner, T.

    2011-01-01

    Although, SNS advertising spending increases, research on SNS campaigning is still underexposed. First, this study aims to investigate the effect of SNS campaign interactivity on the receivers brand engagement, taking four underlying mechanisms into account (brand identification, campaign

  13. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    Directory of Open Access Journals (Sweden)

    Hannah Verdin

    Full Text Available Genomic disorders are often caused by recurrent copy number variations (CNVs, with nonallelic homologous recombination (NAHR as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ, fork stalling and template switching (FoSTeS, microhomology-mediated break-induced replication (MMBIR, serial replication slippage (SRS, and break-induced SRS (BISRS--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32 or its regulatory domain (10, serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES, a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH, quantitative PCR (qPCR, long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  14. micro-mechanical experimental investigation and modelling of strain and damage of argillaceous rocks under combined hydric and mechanical loads

    International Nuclear Information System (INIS)

    Wang, L.

    2012-01-01

    The hydro-mechanical behavior of argillaceous rocks, which are possible host rocks for underground radioactive nuclear waste storage, is investigated by means of micro-mechanical experimental investigations and modellings. Strain fields at the micrometric scale of the composite structure of this rock, are measured by the combination of environmental scanning electron microscopy, in situ testing and digital image correlation technique. The evolution of argillaceous rocks under pure hydric loading is first investigated. The strain field is strongly heterogeneous and manifests anisotropy. The observed nonlinear deformation at high relative humidity (RH) is related not only to damage, but also to the nonlinear swelling of the clay mineral itself, controlled by different local mechanisms depending on RH. Irreversible deformations are observed during hydric cycles, as well as a network of microcracks located in the bulk of the clay matrix and/or at the inclusion-matrix interface. Second, the local deformation field of the material under combined hydric and mechanical loadings is quantified. Three types of deformation bands are evidenced under mechanical loading, either normal to stress direction (compaction), parallel (microcracking) or inclined (shear). Moreover, they are strongly controlled by the water content of the material: shear bands are in particular prone to appear at high RH states. In view of understanding the mechanical interactions a local scale, the material is modeled as a composite made of non-swelling elastic inclusions embedded in an elastic swelling clay matrix. The internal stress field induced by swelling strain incompatibilities between inclusions and matrix, as well as the overall deformation, is numerically computed at equilibrium but also during the transient stage associated with a moisture gradient. An analytical micro-mechanical model based on Eshelby's solution is proposed. In addition, 2D finite element computations are performed. Results

  15. Microbial Mechanisms Underlying Acidity-induced Reduction in Soil Respiration Under Nitrogen Fertilization

    Science.gov (United States)

    Niu, S.; Li, Y.

    2016-12-01

    Terrestrial ecosystems are receiving increasing amounts of reactive nitrogen (N) due to anthropogenic activities, which largely changes soil respiration and its feedback to climate change. N enrichment can not only increase N availability but also induce soil acidification, both may affect soil microbial activity and root growth with a consequent impact on soil respiration. However, it remains unclear whether elevated N availability or soil acidity has greater impact on soil respiration (Rs). We conducted a manipulative experiment to simulate N enrichment (10 g m-2 yr-1 NH4NO3) and soil acidity (0.552 mol H+ m-2 yr-1 sulfuric acid) and studied their effects on Rs and its components in a temperate forest. Our results showed that soil pH was reduced by 0.2 under N addition or acid addition treatment. Acid addition significantly decreased autotrophic respiration (Ra) and heterotrophic respiration (Rh) by 21.5% and 22.7% in 2014, 34.8% and 21.9% in 2015, respectively, resulting in a reduction of Rs by 22.2% in 2014 and 26.1% in 2015. Nitrogen enrichment reduced Ra, Rh, Rs by 21.9%, 16.2%, 18.6% in 2014 and 22.1%, 5.9%, 11.7% in 2015, respectively. The reductions of Rs and its components were attributable to decrease of fine root biomass, microbial biomass, and cellulose degrading enzymes. N addition did not change microbial community but acid addition increased both fungal and arbuscular mycorrhiza fungi PLFAs, and N plus acid addition significantly enhanced fungal to bacterial ratio. All the hydrolase enzymes were reduced more by soil acidity (43-50%) than nitrogen addition (30-39%). Structural equation model showed that soil acidity played more important role than N availability in reducing soil respiration mainly by changing microbial extracellular enzymes. We therefore suggest that N deposition induced indirect effect of soil acidification on microbial properties is critical and should be taken into account to better understand and predict ecosystem C cycling in

  16. The TCA Pathway is an Important Player in the Regulatory Network Governing Vibrio alginolyticus Adhesion Under Adversity.

    Science.gov (United States)

    Huang, Lixing; Huang, Li; Yan, Qingpi; Qin, Yingxue; Ma, Ying; Lin, Mao; Xu, Xiaojin; Zheng, Jiang

    2016-01-01

    Adhesion is a critical step in the initial stage of Vibrio alginolyticus infection; therefore, it is important to understand the underlying mechanisms governing the adhesion of V. alginolyticus and determine if environmental factors have any effect. A greater understanding of this process may assist in developing preventive measures for reducing infection. In our previous research, we presented the first RNA-seq data from V. alginolyticus cultured under stress conditions that resulted in reduced adhesion. Based on the RNA-seq data, we found that the Tricarboxylic acid cycle (TCA pathway) might be closely related to adhesion. Environmental interactions with the TCA pathway might alter adhesion. To validate this, bioinformatics analysis, quantitative Real-Time PCR (qPCR), RNAi, and in vitro adhesion assays were performed, while V. alginolyticus was treated with various stresses including temperature, pH, salinity, and starvation. The expression of genes involved in the TCA pathway was confirmed by qPCR, which reinforced the reliability of the sequencing data. Silencing of these genes was capable of reducing the adhesion ability of V. alginolyticus. Adhesion of V. alginolyticus is influenced substantially by environmental factors and the TCA pathway is sensitive to some environmental stresses, especially changes in pH and starvation. Our results indicated that (1) the TCA pathway plays a key role in V. alginolyticus adhesion: (2) the TCA pathway is sensitive to environmental stresses.

  17. The TCA pathway is an important player in the regulatory network governing Vibrio alginolyticus adhesion under adversity

    Directory of Open Access Journals (Sweden)

    Lixing eHuang

    2016-02-01

    Full Text Available Adhesion is a critical step in the initial stage of Vibrio alginolyticus infection; therefore, it is important to understand the underlying mechanisms governing the adhesion of V. alginolyticus and determine if environmental factors have any effect. A greater understanding of this process may assist in developing preventive measures for reducing infection. In our previous research, we presented the first RNA-seq data from V. alginolyticus cultured under stress conditions that resulted in reduced adhesion. Based on the RNA-seq data, we found that the Tricarboxylic acid cycle (TCA pathway might be closely related to adhesion. Environmental interactions with the TCA pathway might alter adhesion. To validate this, bioinformatics analysis, qPCR, RNAi and in vitro adhesion assays were performed, while V. alginolyticus was treated with various stresses including temperature, pH, salinity and starvation. The expression of genes involved in the TCA pathway was confirmed by qPCR, which reinforced the reliability of the sequencing data. Silencing of these genes was capable of reducing the adhesion ability of V. alginolyticus. Adhesion of V. alginolyticus is influenced substantially by environmental factors and the TCA pathway is sensitive to some environmental stresses, especially changes in pH and starvation. Our results indicated that 1 the TCA pathway plays a key role in V. alginolyticus adhesion: 2 the TCA pathway is sensitive to environmental stresses.

  18. Review: Regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH synthesis and release in photoperiodic animals

    Directory of Open Access Journals (Sweden)

    Kazuyoshi eTsutsui

    2013-04-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R, GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin and glucocorticoids, to control avian and mammalian reproduction.

  19. Cognitive mechanisms underlying disorganization of thought in a genetic syndrome (47,XXY)

    NARCIS (Netherlands)

    Van Rijn, Sophie; Aleman, Andre; De Sonneville, Leo; Swaab, Hanna

    Because of the risk for development of psychopathology such as psychotic symptoms, it has been suggested that studying men with the XXY karyotype may help in the search for underlying cognitive, neural and genetic mechanisms. The aim of this study was to identify cognitive mechanisms that may

  20. STATIC AND DYNAMIC ANALYSIS UNDER MECHANICAL AND THERMAL LOADS OF THE DOUBLE SCARA ROBOT

    Directory of Open Access Journals (Sweden)

    Iosif TEMPEA

    2016-05-01

    Full Text Available The paper presents a synthesis of the Double SCARA Robot modelling, leading to an optimal solution, from workspace point of view, as well as precision and stability of the endeffector in performing the planned trajectory. For the design of the final mechanism CATIA software has been used, as well as NASTRAN/PATRAN software, for the mechanism analysis under mechanical and thermal loads.

  1. The effects of different size gold nanoparticles on mechanical properties of vascular smooth muscle cells under mechanical stretching

    Science.gov (United States)

    Kieu, Tri Minh

    Nanotechnology is an emerging and promising frontier for medicine and biomedical research due to its potential for applications such as drug delivery, imaging enhancement, and cancer treatment. While these materials may possess significant possibilities, the effects of these particles in the body and how the particles affect the cells is not fully understood. In this study, vascular smooth muscle cells (VSMCs) will be exposed to 5 and 20 nm diameter citrate AuNPs under mechanical conditions. The cytotoxicity properties of these particles will be investigated using LDH and MTT assays. Atomic force microscopy will be used to study how the size of the nanoparticles affect the mechanical properties of the VSMCs. Immunofluorescence staining for alpha actin will also be performed to enhance understanding of the phenotypic shift. The LDH and MTT cytotoxicity assay results demonstrated that neither 5 nor 20 nm diameter nanoparticles are cytotoxic to the cells. However, the mechanical properties and cell morphology of the VSMCs was altered. Under static conditions, both AuNP treatments decreased the mechanical properties of the cells. The size of the nanoparticles had a softening effect on elastic modulus of the cell and sign of a synthetic phenotype was observed. The VSMCs subjected to mechanical stretching exhibited higher elastic modulus compared to the static experimental groups. Again, both AuNPs treatments decreased the mechanical properties of the cells and signs of more synthetic phenotype was seen. However, the size of the nanoparticles did not have any influence on cell's elastic modulus unlike the static treated cells. The mechanical testing condition provided a better look at how these particles would affect the cells in vivo. While the nanoparticles are not cytotoxic to the VSMCs, they are altering the mechanical properties and phenotype of the cell.

  2. Awareness of Federal Regulatory Mechanisms Relevant to Community-Engaged Research: Survey of Health Disparities-Oriented NIH-Funded Investigators.

    Science.gov (United States)

    Fullerton, Stephanie M; Anderson, Emily E; Cowan, Ketch; Malen, Rachel C; Brugge, Doug

    2015-02-01

    Few studies or investigators involved in community-engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the 10 National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community-engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. © The Author(s) 2014.

  3. Regulatory Architecture of the LβT2 Gonadotrope Cell Underlying the Response to Gonadotropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Frederique Ruf-Zamojski

    2018-02-01

    Full Text Available The LβT2 mouse pituitary cell line has many characteristics of a mature gonadotrope and is a widely used model system for studying the developmental processes and the response to gonadotropin-releasing hormone (GnRH. The global epigenetic landscape, which contributes to cell-specific gene regulatory mechanisms, and the single-cell transcriptome response variation of LβT2 cells have not been previously investigated. Here, we integrate the transcriptome and genome-wide chromatin accessibility state of LβT2 cells during GnRH stimulation. In addition, we examine cell-to-cell variability in the transcriptional response to GnRH using Gel bead-in-Emulsion Drop-seq technology. Analysis of a bulk RNA-seq data set obtained 45 min after exposure to either GnRH or vehicle identified 112 transcripts that were regulated >4-fold by GnRH (FDR < 0.05. The top regulated transcripts constitute, as determined by Bayesian massive public data integration analysis, a human pituitary-relevant coordinated gene program. Chromatin accessibility [assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq] data sets generated from GnRH-treated LβT2 cells identified more than 58,000 open chromatin regions, some containing notches consistent with bound transcription factor footprints. The study of the most prominent open regions showed that 75% were in transcriptionally active promoters or introns, supporting their involvement in active transcription. Lhb, Cga, and Egr1 showed significantly open chromatin over their promoters. While Fshb was closed over its promoter, several discrete significantly open regions were found at −40 to −90 kb, which may represent novel upstream enhancers. Chromatin accessibility determined by ATAC-seq was associated with high levels of gene expression determined by RNA-seq. We obtained high-quality single-cell Gel bead-in-Emulsion Drop-seq transcriptome data, with an average of >4,000 expressed genes

  4. Comparison of mechanical and thermodynamic properties of fcc and bcc titanium under high pressure

    Science.gov (United States)

    Zhang, Yongmei; Zhao, Yuhong; Hou, Hua; Wen, Zhiqin; Duan, Meiling

    2018-02-01

    The mechanical and thermodynamic properties of fcc and bcc Ti have been discussed based on the first-principles calculation combined with the quasi-harmonic Debye model. We find that the bulk modulus B, shear modulus G, Young’s modulus E of fcc Ti are larger, while Poisson’s ratio σ is smaller than that of bcc Ti under the same pressure, which indicates the better mechanical performance of fcc Ti compared with bcc Ti. The values of B/G and σ indicate that mechanically stable fcc structure is much less ductile than the bcc structure, while mechanically metastable fcc structure has better ductility than stable bcc structure under high pressure. The normalized volume, isothermal bulk modulus, heat capacity, volume thermal expansion coefficient and Debye temperature under pressure and temperature for fcc and bcc Ti are predicted.

  5. A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA.

    Science.gov (United States)

    O'Brown, Natasha M; Summers, Brian R; Jones, Felicity C; Brady, Shannon D; Kingsley, David M

    2015-01-28

    Armor plate changes in sticklebacks are a classic example of repeated adaptive evolution. Previous studies identified ectodysplasin (EDA) gene as the major locus controlling recurrent plate loss in freshwater fish, though the causative DNA alterations were not known. Here we show that freshwater EDA alleles have cis-acting regulatory changes that reduce expression in developing plates and spines. An identical T → G base pair change is found in EDA enhancers of divergent low-plated fish. Recreation of the T → G change in a marine enhancer strongly reduces expression in posterior armor plates. Bead implantation and cell culture experiments show that Wnt signaling strongly activates the marine EDA enhancer, and the freshwater T → G change reduces Wnt responsiveness. Thus parallel evolution of low-plated sticklebacks has occurred through a shared DNA regulatory change, which reduces the sensitivity of an EDA enhancer to Wnt signaling, and alters expression in developing armor plates while preserving expression in other tissues.

  6. Standard Review Plan for the review of financial assurance mechanisms for decommissioning under 10 CFR Parts 30, 40, 70, and 72

    International Nuclear Information System (INIS)

    1989-08-01

    Standard Review Plan (SRP) for the Review of Financial Assurance Mechanisms for Decommissioning under 10 CFR Parts 30, 40, 70 and 72, is prepared for the guidance of Nuclear Regulatory Commission staff reviewers in performing reviews of applications from material licensees affected by the decommissioning regulations established June 27, 1988 (53FR24018). The principal purpose of the SRP is to assure the quality and uniformity of staff reviews and to present a base from which to evaluate the financial assurance aspects of the applications. The SRP identifies who performs the review, the matters that are reviewed, the basis for the review, how the review is performed, and the conclusions that are sought

  7. Mechanical behaviour and microstructural evolution of alloy 800H under biaxial cyclic loading

    International Nuclear Information System (INIS)

    Dolabella Portella, P.; Feng Jiao; Oesterle, W.; Ziebs, J.

    1999-01-01

    The mechanical behaviour of alloy 800H under biaxial cyclic loading was investigated at room temperature and at 800 C. The low-cycle fatigue experiments were carried out using tubular specimens under axial and torsional loading with constant total equivalent strain amplitude following either proportional or nonproportional loading paths. The cyclic hardening observed under nonproportional loading was clearly higher than that under proportional loading. The extra hardening due to the nonproportional loading path was more pronounced at room temperature. The evolution of the dislocation structure was characterized by transmission electron microscopy of specimens after interrupted fatigue tests. The changes in the dislocation structure and the precipitation phenomena are in accordance with the observed mechanical behaviour of the specimens. Twinning was observed in very few grains of some specimens and does not influence the extra hardening under nonproportional loading, martensite was not detected in any specimen. (orig.)

  8. Combined chromatin and expression analysis reveals specific regulatory mechanisms within cytokine genes in the macrophage early immune response.

    Directory of Open Access Journals (Sweden)

    Maria Jesus Iglesias

    Full Text Available Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS.To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII, which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF, was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines, was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40% was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at

  9. An investigation of the mechanism underlying teacher aggression : Testing I3 theory and the General Aggression Model

    NARCIS (Netherlands)

    Montuoro, Paul; Mainhard, Tim

    2017-01-01

    Background: Considerable research has investigated the deleterious effects of teachers responding aggressively to students who misbehave, but the mechanism underlying this dysfunctional behaviour remains unknown. Aims: This study investigated whether the mechanism underlying teacher aggression

  10. Tensile mechanical behavior of hollow and filled carbon nanotubes under tension or combined tension-torsion

    Science.gov (United States)

    Jeong, Byeong-Woo; Lim, Jang-Keun; Sinnott, Susan B.

    2007-01-01

    The tensile mechanical behavior of hollow and filled single-walled carbon nanotubes under tension or combined tension-torsion is examined using classical molecular dynamics simulations. These simulations indicate that the tensile strength under combined tension-torsion can be increased by filling the carbon nanotubes, and the amount of this increase depends on the kind of filling material. They also predict that the tensile strength under combined tension-torsion decreases linearly under applied torsion. The tensile strength can be modified by adjusting the system temperature and through chemical functionalization to the carbon nanotube walls.

  11. Human ApoE ɛ2 Promotes Regulatory Mechanisms of Bioenergetic and Synaptic Function in Female Brain: A Focus on V-type H+-ATPase.

    Science.gov (United States)

    Woody, Sarah K; Zhou, Helen; Ibrahimi, Shaher; Dong, Yafeng; Zhao, Liqin

    2016-06-18

    Humans possess three major isoforms of the apolipoprotein E (ApoE) gene encoded by three alleles: ApoE ɛ2 (ApoE2), ApoE ɛ3 (ApoE3), and ApoE ɛ4 (ApoE4). It is established that the three ApoE isoforms confer differential susceptibility to Alzheimer's disease (AD); however, an in-depth molecular understanding of the underlying mechanisms is currently unavailable. In this study, we examined the cortical proteome differences among the three ApoE isoforms using 6-month-old female, human ApoE2, ApoE3, and ApoE4 gene-targeted replacement mice and two-dimensional proteomic analyses. The results reveal that the three ApoE brains differ primarily in two areas: cellular bioenergetics and synaptic transmission. Of particular significance, we show for the first time that the three ApoE brains differentially express a key component of the catalytic domain of the V-type H+-ATPase (Atp6v), a proton pump that mediates the concentration of neurotransmitters into synaptic vesicles and thus is crucial in synaptic transmission. Specifically, our data demonstrate that ApoE2 brain exhibits significantly higher levels of the B subunit of Atp6v (Atp6v1B2) when compared to both ApoE3 and ApoE4 brains, with ApoE4 brain exhibiting the lowest expression. Our additional analyses show that Atp6v1B2 is significantly impacted by aging and AD pathology and the data suggest that Atp6v1B2 deficiency could be involved in the progressive loss of synaptic integrity during early development of AD. Collectively, our findings indicate that human ApoE isoforms differentially modulate regulatory mechanisms of bioenergetic and synaptic function in female brain. A more efficient and robust status in both areas-in which Atp6v may play a role-could serve as a potential mechanism contributing to the neuroprotective and cognition-favoring properties associated with the ApoE2 genotype.

  12. Mathematical model of a telomerase transcriptional regulatory network developed by cell-based screening: analysis of inhibitor effects and telomerase expression mechanisms.

    Directory of Open Access Journals (Sweden)

    Alan E Bilsland

    2014-02-01

    Full Text Available Cancer cells depend on transcription of telomerase reverse transcriptase (TERT. Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3'-oxime (BIO predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several

  13. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    Science.gov (United States)

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  14. The air quality and regional climate effects of widespread solar power generation under a changing regulatory environment

    Science.gov (United States)

    Millstein, D.; Zhai, P.; Menon, S.

    2011-12-01

    Over the past decade significant reductions of NOx and SOx emissions from coal burning power plants in the U.S. have been achieved due to regulatory action and substitution of new generation towards natural gas and wind power. Low natural gas prices, ever decreasing solar generation costs, and proposed regulatory changes, such as to the Cross State Air Pollution Rule, promise further long-run coal power plant emission reductions. Reduced power plant emissions have the potential to affect ozone and particulate air quality and influence regional climate through aerosol cloud interactions and visibility effects. Here we investigate, on a national scale, the effects on future (~2030) air quality and regional climate of power plant emission regulations in contrast to and combination with policies designed to aggressively promote solar electricity generation. A sophisticated, economic and engineering based, hourly power generation dispatch model is developed to explore the integration of significant solar generation resources (>10% on an energy basis) at various regions across the county, providing detailed estimates of substitution of solar generation for fossil fuel generation resources. Future air pollutant emissions from all sectors of the economy are scaled based on the U.S. Environmental Protection Agency's National Emission Inventory to account for activity changes based on population and economic projections derived from county level U.S. Census data and the Energy Information Administration's Annual Energy Outlook. Further adjustments are made for technological and regulatory changes applicable within various sectors, for example, emission intensity adjustments to on-road diesel trucking due to exhaust treatment and improved engine design. The future year 2030 is selected for the emissions scenarios to allow for the development of significant solar generation resources. A regional climate and air quality model (Weather Research and Forecasting, WRF model) is

  15. How diagnostic tests help to disentangle the mechanisms underlying neuropathic pain symptoms in painful neuropathies.

    Science.gov (United States)

    Truini, Andrea; Cruccu, Giorgio

    2016-02-01

    Neuropathic pain, ie, pain arising directly from a lesion or disease affecting the somatosensory afferent pathway, manifests with various symptoms, the commonest being ongoing burning pain, electrical shock-like sensations, and dynamic mechanical allodynia. Reliable insights into the mechanisms underlying neuropathic pain symptoms come from diagnostic tests documenting and quantifying somatosensory afferent pathway damage in patients with painful neuropathies. Neurophysiological investigation and skin biopsy studies suggest that ongoing burning pain primarily reflects spontaneous activity in nociceptive-fiber pathways. Electrical shock-like sensations presumably arise from high-frequency ectopic bursts generated in demyelinated, nonnociceptive, Aβ fibers. Although the mechanisms underlying dynamic mechanical allodynia remain debatable, normally innocuous stimuli might cause pain by activating spared and sensitized nociceptive afferents. Extending the mechanistic approach to neuropathic pain symptoms might advance targeted therapy for the individual patient and improve testing for new drugs.

  16. Visualization of hot spot formation in energetic materials under periodic mechanical excitation using phosphor thermography

    Science.gov (United States)

    Casey, Alex; Fenoglio, Gabriel; Detrinidad, Humberto

    2017-06-01

    Under mechanical excitation, energy is known to localize within an energetic material resulting in `hot spot' formation. While many formation mechanisms have been proposed, additional insight to heat generation mechanisms, the effect of binder/crystal interfaces, and predication capabilities can be gained by quantifying the initiation and growth of the hot spots. Phosphor thermography is a well established temperature sensing technique wherein an object's temperature is obtained by collecting the temperature dependent luminescence of an optically excited phosphor. Herein, the phosphor thermography technique has been applied to Dow Corning Sylgard® 184/octahydro 1,3,5,7 tetranitro 1,3,5,7 tetrazocine (HMX) composite materials under mechanical excitation in order to visualize the evolution of the temperature field, and thus hot spot formation, within the binder. Funded by AFOSR. Supported by the Department of Defense (DoD) through the National Defense Science & Engineering Graduate Fellowship (NDSEG) Program.

  17. Evolution of variety-specific regulatory schema for expression of osa-miR408 in indica rice varieties under drought stress.

    Science.gov (United States)

    Mutum, Roseeta D; Balyan, Sonia C; Kansal, Shivani; Agarwal, Preeti; Kumar, Santosh; Kumar, Mukesh; Raghuvanshi, Saurabh

    2013-04-01

    Evolution of differential regulatory mechanisms can lead to quite distinct physiological attributes. In the present study, we have identified one such regulatory schema that regulates osa-miR408 and responds differentially in drought-sensitive and -tolerant indica rice varieties. A comparison of the drought stress response in drought-sensitive (Pusa Basmati 1 and IR64) and drought-tolerant (Nagina 22 and Vandana) indica rice varieties revealed that, during drought stress, levels of miR408 transcript decrease significantly in sensitive cultivars, whereas they remain elevated in the tolerant cultivars. The trend is reflected in young seedlings, as well as in flag leaf and spikelets of adult plants (heading stage). Members of the plastocyanin-like protein family targeted by miR408 also show the inverse expression profile and thus accumulate at a lower level in tolerant cultivars during drought. Interestingly, some members of this family are implicated in maintaining the cellular redox state and spikelet fertility in Arabidopsis. An investigation of miR408 loci (including promoter) in all four cultivars did not reveal any significant sequence variation indicating an involvement of the upstream regulatory schema. Indeed, a similar variety-specific stress response was found in the Oryza sativa squamosa promoter-binding-like 9 transcription factor that regulates miR408 expression. We further demonstrate that drought-mediated induction of miR408 in Nagina 22 is regulated by [Ca(2+)]cyt levels. However, [Ca(2+)]cyt does not appear to regulate miR408 levels in Pusa Basmati 1, suggesting a variety-specific evolution of regulatory schema in rice. © 2013 The Authors Journal compilation © 2013 FEBS.

  18. A Cross-Cultural Approach to Psychological Mechanisms Underlying Emotional Reactions to Music

    OpenAIRE

    Barradas, Gonçalo

    2017-01-01

    Music plays a crucial role in everyday life by enabling listeners to seek individual emotional experiences. To explain why such emotions occur, we must understand the underlying process that mediates between surface-level features of the music and aroused emotions. This thesis aimed to investigate how musical emotions are mediated by psychological mechanisms from a cross-cultural perspective. Study I manipulated four mechanisms by selecting ecologically valid pieces of music that featured inf...

  19. De novo assembly and characterization of stress transcriptome and regulatory networks under temperature, salt and hormone stresses in Lilium lancifolium.

    Science.gov (United States)

    Wang, Jingmao; Wang, Qing; Yang, Yang; Liu, Xiaohua; Gu, Jiahui; Li, Wenqi; Ma, Suliya; Lu, Yingmin

    2014-12-01

    Plants have continually confrontation with different abiotic stresses, including salt, low temperature, drought or hormone stress. The plants acclimate to the environmental stresses relating with the falls of the molecular mesh including the stress signal receiver, signal transcriptional regulation and the expression of functional and structure genes. Using the RNA-seq, we carried out a transcriptional analysis under cold treatment for investigating a profound comprehension of the signal network and molecular metabolisms reaction included in abiotic stress reaction for Lilium lancifolium. Our study identified 18,722 unigenes had demonstrated the resemblance to the known exact proteins in the Swiss-Prot protein database and classified them by Gene ontology into three primary kinds: cellular component, biological process, and molecular function, and then 15,898 unigenes aligned to existing sequences in the KEGG databases. Based on the transcriptome results of cold stress, more stress-related genes were identified and analyzed of their expressions in other abiotic stress treatments as 37 °C, ABA, JA and Na. Meanwhile, bioinformatics qRT-PCR analyses of stress genes as LlDREB1, LlAP2, LlNAC1, LlHOT, LlR2R3-MYB and LlCDPK revealed that novel candidate genes encoding ethylene responsive transporters and serine/threonine receptor-like kinases, which contributed to speculate the signal regulation pathway during the abiotic stresses; engineering genes could also boost the tolerance to stress, as protected and maintained the function and structure of cellular components. Our research conjectured the abiotic stress signal transduction pathway and identified the expected key ingredients regulating the stress tolerance in Lilium lancifolium, which would enable the in-depth molecular exploration of stress-tolerance mechanisms in lily.

  20. New insights into immune mechanisms underlying autoimmune diseases of the gastrointestinal tract.

    Science.gov (United States)

    Di Sabatino, Antonio; Lenti, Marco Vincenzo; Giuffrida, Paolo; Vanoli, Alessandro; Corazza, Gino Roberto

    2015-12-01

    Recent progresses in the immune mechanisms implicated in chronic inflammatory disorders have led to a more in-depth knowledge of the pathogenesis of autoimmune diseases of the gastrointestinal tract, including autoimmune atrophic gastritis, celiac disease, autoimmune enteropathy and ulcerative colitis. While the pathogenic role of specific circulating autoantibodies, i.e., respectively anti-parietal cell, anti-tissue transglutaminase, anti-enterocyte and anti-neutrophil cytoplasmic, is still controversial, some common T-cell mediated mechanisms for inflammation - increase in T helper cell type 1/type 17 pro-inflammatory cytokines- or losing self-tolerance-abnormal regulatory T cell function - are recognized as crucial mediators of the tissue damage causing atrophy of the stomach mucosa in autoimmune atrophic gastritis, villous flattening of the small bowel in celiac disease and autoimmune enteropathy, and mucosal ulceration of the colon in ulcerative colitis. This review deals with novel advances in the immunological bases of the aforementioned autoimmune gastrointestinal disorders, and it also highlights immune mechanisms of progression from chronic inflammation to cancer and implications for new therapeutic targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Nuclear power meets the 101st Congress, a open-quotes one-actclose quotes comedy: Regulation of Nuclear Regulatory Commission licensees under the Clean Air Act

    International Nuclear Information System (INIS)

    Goldsmith, R.

    1992-01-01

    In the Clean Air Act Amendments of 1977, Congress directed the Environmental Protection Agency (EPA) to regulate all radioactive pollutants, including those emitted from facilities licensed and regulated under the Atomic Energy Act (AEA) by the Nuclear Regulatory Commission (NRC). Thus began the era of so-called open-quotes dual regulation.close quotes Thirteen years later, that era ended with the passage of section 112(d)(9) of the Clean Air Act Amendments of 1990, which authorized the EPA to refrain from regulating any category of NRC-licensed facility if it found that NRC regulation was adequate to protect public health. This story of how Congress reversed regulatory policy is actually a story more about nuclear power than air pollution. Dual regulation was authorized in 1977 because of two concerns: fears about the public health risks associated with the nation's growing commitment to nuclear power and doubts about the integrity of nuclear regulation by the NRC. Although neither of these concerns had abated by 1990, the legislative process was so adroitly manipulated by the proponents of nuclear power that Congress, unwittingly, restored the NRC's regulatory monopoly

  2. Elucidation of the molecular mechanisms underlying adverse reactions associated with a kinase inhibitor using systems toxicology.

    Science.gov (United States)

    Amemiya, Takahiro; Honma, Masashi; Kariya, Yoshiaki; Ghosh, Samik; Kitano, Hiroaki; Kurachi, Yoshihisa; Fujita, Ken-Ichi; Sasaki, Yasutsuna; Homma, Yukio; Abernethy, Darrel R; Kume, Haruki; Suzuki, Hiroshi

    2015-01-01

    Targeted kinase inhibitors are an important class of agents in anticancer therapeutics, but their limited tolerability hampers their clinical performance. Identification of the molecular mechanisms underlying the development of adverse reactions will be helpful in establishing a rational method for the management of clinically adverse reactions. Here, we selected sunitinib as a model and demonstrated that the molecular mechanisms underlying the adverse reactions associated with kinase inhibitors can efficiently be identified using a systems toxicological approach. First, toxicological target candidates were short-listed by comparing the human kinase occupancy profiles of sunitinib and sorafenib, and the molecular mechanisms underlying adverse reactions were predicted by sequential simulations using publicly available mathematical models. Next, to evaluate the probability of these predictions, a clinical observation study was conducted in six patients treated with sunitinib. Finally, mouse experiments were performed for detailed confirmation of the hypothesized molecular mechanisms and to evaluate the efficacy of a proposed countermeasure against adverse reactions to sunitinib. In silico simulations indicated the possibility that sunitinib-mediated off-target inhibition of phosphorylase kinase leads to the generation of oxidative stress in various tissues. Clinical observations of patients and mouse experiments confirmed the validity of this prediction. The simulation further suggested that concomitant use of an antioxidant may prevent sunitinib-mediated adverse reactions, which was confirmed in mouse experiments. A systems toxicological approach successfully predicted the molecular mechanisms underlying clinically adverse reactions associated with sunitinib and was used to plan a rational method for the management of these adverse reactions.

  3. Mechanisms Underlying Stress Fracture and the Influence of Sex and Race/Ethnicity

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-16-1-0652 TITLE: Mechanisms Underlying Stress Fracture and the Influence of Sex and Race/Ethnicity PRINCIPAL INVESTIGATOR...5a. CONTRACT NUMBER W81XWH-16-1-0652 Mechanisms Underlying Stress Fracture and the Influence of Sex and Race/Ethnicity 5b. GRANT NUMBER W81XWH...Email addresses: mbouxsei@bidmc.harvard.edu; scaksa@mgh.harvard.edu; serudolph@mgh.harvard.edu ; kpopp@mgh.harvard.edu E-Mail: 5f. WORK UNIT NUMBER 7

  4. Comparative transcriptomic analysis reveals novel genes and regulatory mechanisms of Tetragenococcus halophilus in response to salt stress.

    Science.gov (United States)

    Liu, Licui; Si, Lifang; Meng, Xin; Luo, Lixin

    2015-04-01

    Tetragenococcus halophilus, a moderately halophilic Gram-positive bacterium, was isolated from Chinese style soy sauce. This species is a valuable resource for investigating salt tolerance mechanisms and improving salinity resistance in microorganisms. RNA-seq was used to sequence T. halophilus samples treated with 0 M (T1), 1 M (T2), and 3.5 M NaCl (T3). Comparative transcriptomic analyses of the different treatments were performed using gene ontology and Kyoto encyclopedia of genes and genome. The comparison of T1 and T2 by RNA-seq revealed that genes involved in transcription, translation, membrane system, and division were highly up-regulated under optimum salt condition. The comparison of T2 and T3 showed that genes related to heat shock proteins or the ATP-binding cassette transport systems were significantly up-regulated under maximum-salt condition. In addition, a considerable proportion of the significantly differently expressed genes identified in this study are novel. These data provide a crucial resource that may determine specific responses to salt stress in T. halophilus.

  5. Model test study of evaporation mechanism of sand under constant atmospheric condition

    OpenAIRE

    CUI, Yu Jun; DING, Wenqi; SONG, Weikang

    2014-01-01

    The evaporation mechanism of Fontainebleau sand using a large-scale model chamber is studied. First, the evaporation test on a layer of water above sand surface is performed under various atmospheric conditions, validating the performance of the chamber and the calculation method of actual evaporation rate by comparing the calculated and measured cumulative evaporations. Second,the evaporation test on sand without water layer is conducted under constant atmospheric condition. Both the evoluti...

  6. Mechanical behavior of confined self-compacting reinforced concrete circular columns under concentric axial loading

    OpenAIRE

    Khairallah, Fouad

    2013-01-01

    While there is abundant research information on ordinary confined concrete, there are little data on the behavior of Self-Compacting Concrete (SCC) under such condition. Due to higher shrinkage and lower coarse aggregate content of SCC compared to that of Normal Concrete (NC), its composite performance under confined conditions needs more investigation. This paper has been devoted to investigate and compare the mechanical behavior of confined concrete circular columns cast with SCC and NC und...

  7. Ultrastructural changes of cell walls under intense mechanical treatment of selective plant raw material

    International Nuclear Information System (INIS)

    Bychkov, Aleksey L.; Ryabchikova, E.I.; Korolev, K.G.; Lomovsky, O.I.

    2012-01-01

    Structural changes of cell walls under intense mechanical treatment of corn straw and oil-palm fibers were studied by electron and light microscopy. Differences in the character of destruction of plant biomass were revealed, and the dependence of destruction mechanisms on the structure of cell walls and lignin content was demonstrated. We suggest that the high reactivity of the particles of corn straw (about 18% of lignin) after intense mechanical treatment is related to disordering of cell walls and an increase of the surface area, while in the case of oil palm (10% of lignin) the major contribution into an increase in the reactivity is made by an increase of surface area. -- Highlights: ► Structure of cell walls determines the processes of plant materials' destruction. ► Ultrastructure of highly lignified materials strongly disordering by mechanical action. ► Ultrastructure of low-lignified materials is not disordering by mechanical action.

  8. Nonlinear Dynamic Analysis of Telescopic Mechanism for Truss Structure Bridge Inspection Vehicle Under Pedestrian Excitation

    Directory of Open Access Journals (Sweden)

    Wenwen Sui

    Full Text Available Abstract Nonlinear dynamic analysis of an axially moving telescopic mechanism for truss structure bridge inspection vehicle under pedestrian excitation is carried out. A biomechanically inspired inverted-pendulum model is utilized to simplify the pedestrian. The nonlinear equations of motion for the beam-pedestrian system are derived using the Hamilton's principle. The equations are transformed into two ordinary differential equations by applying the Galerkin's method at the first two orders. The solutions to the equations are acquired by using the Newmark-β method associated with the Newton-Raphson method. The time-dependent feature of the eigenfunctions for the two beams are taken into consideration in the solutions. Accordingly, the equations of motion for a simplified system, in which the pedestrian is regarded as moving cart, are given. In the numerical examples, dynamic responses of the telescopic mechanism in eight conditions of different beam-telescoping and pedestrian-moving directions are simulated. Comparisons between the vibrations of the beams under pedestrian excitation and corresponding moving cart are carried out to investigate the influence of the pedestrian excitation on the telescopic mechanism. The results show that the displacement of the telescopic mechanism under pedestrian excitation is smaller than that under moving cart especially when the pedestrian approaches the beams end. Additionally, compared with moving cart, the pedestrian excitation can effectively strengthen the vibration when the beam extension is small or when the pedestrian is close to the beams end.

  9. Mechanisms underlying prorenin actions on hypothalamic neurons implicated in cardiometabolic control

    Directory of Open Access Journals (Sweden)

    Soledad Pitra

    2016-10-01

    Conclusions: We identified novel neuronal targets and cellular mechanisms underlying PR/PRR actions in critical hypothalamic neurons involved in cardiometabolic regulation. This fundamental mechanistic information regarding central PR/PRR actions is essential for the development of novel RAS-based therapeutic targets for the treatment of cardiometabolic disorders in obesity and hypertension.

  10. Unraveling the mechanisms underlying postural instability in Parkinson's disease using dynamic posturography

    NARCIS (Netherlands)

    Nonnekes, J.H.; Kam, D. de; Geurts, A.C.; Weerdesteijn, V.G.M.; Bloem, B.R.

    2013-01-01

    Postural instability, one of the cardinal symptoms of Parkinson's disease (PD), has devastating consequences for affected patients. Better strategies to prevent falls are needed, but this calls for an improved understanding of the complex mechanisms underlying postural instability. We must also

  11. The Mediated MIMIC Model for Understanding the Underlying Mechanism of DIF

    Science.gov (United States)

    Cheng, Ying; Shao, Can; Lathrop, Quinn N.

    2016-01-01

    Due to its flexibility, the multiple-indicator, multiple-causes (MIMIC) model has become an increasingly popular method for the detection of differential item functioning (DIF). In this article, we propose the mediated MIMIC model method to uncover the underlying mechanism of DIF. This method extends the usual MIMIC model by including one variable…

  12. Deformation Microstructures and Creep Mechanisms in Advanced ZR-Based Cladding Under Biazal Loading

    Energy Technology Data Exchange (ETDEWEB)

    K. Linga (KL) Murty

    2008-08-11

    Investigate creep behavior of Zr-based cladding tubes with attention to basic creep mechanisms and transitions in them at low stresses and/or temperatures and study the dislocation microstructures of deformed samples for correlation with the underlying micromechanism of creep

  13. Cementogenesis is inhibited under a mechanical static compressive force via Piezo1.

    Science.gov (United States)

    Zhang, Ying-Ying; Huang, Yi-Ping; Zhao, Hua-Xiang; Zhang, Ting; Chen, Feng; Liu, Yan

    2017-07-01

    To investigate whether Piezo1, a mechanotransduction gene mediates the cementogenic activity of cementoblasts under a static mechanical compressive force. Murine cementoblasts (OCCM-30) were exposed to a 2.0 g/cm 2 static compressive force for 3, 6, 12, and 24 hours. Then the expression profile of Piezo1 and the cementogenic activity markers osteoprotegerin (Opg), osteopontin (Opn), osteocalcin (Oc), and protein tyrosine phosphataselike member A (Ptpla) were analyzed. Opg, Opn, Oc, and Ptpla expression was further measured after using siRNA to knock down Piezo1. Real-time PCR, Western blot, and cell proliferation assays were performed according to standard procedures. After mechanical stimulation, cell morphology and proliferation did not change significantly. The expression of Piezo1, Opg, Opn, Oc, and Ptpla was significantly decreased, with a high positive correlation between Opg and Piezo1 expression. After Piezo1 knockdown, the expression of Opg, Opn, Oc, and Ptpla was further decreased under mechanical stimulation. Cementogenic activity was inhibited in OCCM-30 cells under static mechanical force, a process that was partially mediated by the decrease of Piezo1. This study provides a new viewpoint of the pathogenesis mechanism of orthodontically induced root resorption and repair.

  14. Mechanism underlying the suppressor activity of retinoic acid on IL4-induced IgE synthesis and its physiological implication.

    Science.gov (United States)

    Seo, Goo-Young; Lee, Jeong-Min; Jang, Young-Saeng; Kang, Seung Goo; Yoon, Sung-Il; Ko, Hyun-Jeong; Lee, Geun-Shik; Park, Seok-Rae; Nagler, Cathryn R; Kim, Pyeung-Hyeun

    2017-12-01

    The present study extends an earlier report that retinoic acid (RA) down-regulates IgE Ab synthesis in vitro. Here, we show the suppressive activity of RA on IgE production in vivo and its underlying mechanisms. We found that RA down-regulated IgE class switching recombination (CSR) mainly through RA receptor α (RARα). Additionally, RA inhibited histone acetylation of germ-line ε (GL ε) promoter, leading to suppression of IgE CSR. Consistently, serum IgE levels were substantially elevated in vitamin A-deficient (VAD) mice and this was more dramatic in VAD-lecithin:retinol acyltransferase deficient (LRAT -/- ) mice. Further, serum mouse mast cell protease-1 (mMCP-1) level was elevated while frequency of intestinal regulatory T cells (Tregs) were diminished in VAD LRAT -/- mice, reflecting that deprivation of RA leads to allergic immune response. Taken together, our results reveal that RA has an IgE-repressive activity in vivo, which may ameliorate IgE-mediated allergic disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Local and systemic immune mechanisms underlying the anti-colitis effects of the dairy bacterium Lactobacillus delbrueckii.

    Directory of Open Access Journals (Sweden)

    Clarissa Santos Rocha

    Full Text Available Several probiotic bacteria have been proposed for treatment or prevention of inflammatory bowel diseases (IBD, showing a protective effect in animal models of experimental colitis and for some of them also in human clinical trials. While most of these probiotic bacteria are isolated from the digestive tract, we recently reported that a Lactobacillus strain isolated from cheese, L. delbrueckii subsp. lactis CNRZ327 (Lb CNRZ327, also possesses anti-inflammatory effects in vitro and in vivo, demonstrating that common dairy bacteria may be useful in the treatment or prevention of IBD. Here, we studied the mechanisms underlying the protective effects of Lb CNRZ327 in vivo, in a mouse dextran sodium sulfate (DSS colitis model. During colitis, Lb CNRZ327 modulated the production of TGF-β, IL-6, and IL-12 in colonic tissue and of TGF-β and IL-6 in the spleen, and caused an expansion of CD4+Foxp3+ regulatory T cells in the cecal lymph nodes. Moreover, a strong tendency to CD4+Foxp3+ expansion was also observed in the spleen. The results of this study for the first time show that orally administered dairy lactobacilli can not only modulate mucosal but also systemic immune responses and constitute an effective treatment of IBD.

  16. See the forest for the trees: Whole-plant allocation patterns and regulatory mechanisms in Norway spruce

    Science.gov (United States)

    Huang, Jianbei; Behrendt, Thomas; Hammerbacher, Almuth; Weinhold, Alexander; Hellén, Heidi; Reichelt, Michael; Wisthaler, Armin; Dam, Nicole; Trumbore, Susan; Hartmann, Henrik

    2017-04-01

    For more than 40 years plant carbon (C) allocation have been of central interest to plant scientists. Most studies on C allocation focus on either biomass partitioning (e.g., root:shoot ratios), particular fluxes (e.g., non-structural carbohydrate, NSC; biogenic emissions of volatile organic compounds, VOCs) or short-term proportional allocation patterns (e.g., pulse-chase studies using isotopic tracers). However, a thorough understanding of C allocation priorities, especially at the whole-plant level, requires assessing all of these aspects together. We investigated C allocation trade-off in Norway spruce (Picea abies) saplings by assessing whole-plant fluxes (assimilation, respiration and VOCs) and biomass partitioning (structural biomass; NSC; secondary metabolites, SMs). The study was carried out over 8 weeks and allowed us, by modifying atmospheric CO2 concentrations ([CO2]), manipulating plant carbon (C) availability. Treatments included control (400 ppm), carbon compensation (down to 120 ppm) and starvation (down to 50 ppm) C availability levels. Reductions in [CO2] aimed to reveal plant allocation strategies assuming that pools receiving more C than others under C limitation have a high allocation priority. Respiration was less sensitive to declining [CO2] compared to assimilation, NSC and SMs. Strong declines in NSC at low [CO2] suggest that respiration was maintained by using stored NSC. Furthermore, reduced NSC and SMs concentrations also indicate preferential C allocation to growth over NSC and SMs at low C availability. SMs decreased to a lesser extent than NSC in old needles, and remained relatively constant in branches until death from starvation. These results suggest that pools of stored NSC may serve as a buffer for respiration or growth under C limitation but also that SMs remain largely inaccessible for metabolism once they are stored in tissues. VOCs emissions, however, showed contrasting responses to [CO2]; oxygenated VOCs (methanol and

  17. Large Deflections Mechanical Analysis of a Suspended Single-Wall Carbon Nanotube under Thermoelectrical Loading

    Directory of Open Access Journals (Sweden)

    Assaf Ya'akobovitz

    2011-01-01

    Full Text Available Following the recent progress in integrating single-wall carbon nanotubes (SWCNTs into silicon-based micro-electromechanical systems (MEMS, new modeling tools are needed to predict their behavior under different loads, including thermal, electrical and mechanical. In the present study, the mechanical behavior of SWCNTs under thermoelectrical loading is analyzed using a large deflection geometrically nonlinear string model. The effect of the resistive heating was found to have a substantial influence on the SWCNTs behavior, including significant enhancement of the strain (up to the millistrains range and buckling due to the thermal expansion. The effect of local buckling sites was also studied and was found to enhance the local strain. The theoretical and numerical results obtained in the present study demonstrate the importance of resistive heating in the analysis of SWCNTs and provide an additional insight into the unique mechanics of suspended SWCNTs.

  18. Intercomparison of chemical mechanisms for air quality policy formulation and assessment under North American conditions.

    Science.gov (United States)

    Derwent, Richard

    2017-07-01

    The intercomparison of seven chemical mechanisms for their suitability for air quality policy formulation and assessment is described. Box modeling techniques were employed using 44 sets of background environmental conditions covering North America to constrain the chemical development of the longer lived species. The selected mechanisms were modified to enable an unbiased assessment of the adequacy of the parameterizations of photochemical ozone production from volatile organic compound (VOC) oxidation in the presence of NO x . Photochemical ozone production rates responded differently to 30% NO x and VOC reductions with the different mechanisms, despite the striking similarities between the base-case ozone production rates. The 30% reductions in NO x and VOCs also produced changes in OH. The responses in OH to 30% reductions in NO x and VOCs appeared to be more sensitive to mechanism choice, compared with the responses in the photochemical ozone production rates. Although 30% NO x reductions generally led to decreases in OH, 30% reductions in VOCs led to increases in OH, irrespective of mechanism choice and background environmental conditions. The different mechanisms therefore gave different OH responses to NO x and VOC reductions and so would give different responses in terms of changes in the fate and behavior of air toxics, acidification and eutrophication, and fine particle formation compared with others, in response to ozone control strategies. Policymakers need to understand that there are likely to be inherent differences in the responses to ozone control strategies between different mechanisms, depending on background environmental conditions and the extents of NO x and VOC reductions under consideration. The purpose of this paper is to compare predicted ozone responses to NO x and VOC reductions with seven chemical mechanisms under North American conditions. The good agreement found between the tested mechanisms should provide some support for their

  19. Growth and stress response mechanisms underlying post-feeding regenerative organ growth in the Burmese python.

    Science.gov (United States)

    Andrew, Audra L; Perry, Blair W; Card, Daren C; Schield, Drew R; Ruggiero, Robert P; McGaugh, Suzanne E; Choudhary, Amit; Secor, Stephen M; Castoe, Todd A

    2017-05-02

    Previous studies examining post-feeding organ regeneration in the Burmese python (Python molurus bivittatus) have identified thousands of genes that are significantly differentially regulated during this process. However, substantial gaps remain in our understanding of coherent mechanisms and specific growth pathways that underlie these rapid and extensive shifts in organ form and function. Here we addressed these gaps by comparing gene expression in the Burmese python heart, liver, kidney, and small intestine across pre- and post-feeding time points (fasted, one day post-feeding, and four days post-feeding), and by conducting detailed analyses of molecular pathways and predictions of upstream regulatory molecules across these organ systems. Identified enriched canonical pathways and upstream regulators indicate that while downstream transcriptional responses are fairly tissue specific, a suite of core pathways and upstream regulator molecules are shared among responsive tissues. Pathways such as mTOR signaling, PPAR/LXR/RXR signaling, and NRF2-mediated oxidative stress response are significantly differentially regulated in multiple tissues, indicative of cell growth and proliferation along with coordinated cell-protective stress responses. Upstream regulatory molecule analyses identify multiple growth factors, kinase receptors, and transmembrane receptors, both within individual organs and across separate tissues. Downstream transcription factors MYC and SREBF are induced in all tissues. These results suggest that largely divergent patterns of post-feeding gene regulation across tissues are mediated by a core set of higher-level signaling molecules. Consistent enrichment of the NRF2-mediated oxidative stress response indicates this pathway may be particularly important in mediating cellular stress during such extreme regenerative growth.

  20. Regulatory agencies and regulatory risk

    OpenAIRE

    Knieps, Günter; Weiß, Hans-Jörg

    2008-01-01

    The aim of this paper is to show that regulatory risk is due to the discretionary behaviour of regulatory agencies, caused by a too extensive regulatory mandate provided by the legislator. The normative point of reference and a behavioural model of regulatory agencies based on the positive theory of regulation are presented. Regulatory risk with regard to the future behaviour of regulatory agencies is modelled as the consequence of the ex ante uncertainty about the relative influence of inter...

  1. [Pathophysiology of neuropathic pain: molecular mechanisms underlying central sensitization in the dorsal horn in neuropathic pain].

    Science.gov (United States)

    Yamanaka, Hiroki; Noguchi, Koichi

    2012-11-01

    Neuropathic pain syndromes are clinically characterized by spontaneous pain and evoked pain (hyperalgesia and allodynia). The optimal treatment approach for neuropathic pain is still under development because of the complex pathological mechanisms underlying this type of pain. The spinal cord is an important gateway thorough which peripheral pain signals are transmitted to the brain, and sensitization of the spinal neurons is one of the important mechanisms underlying neuropathic pain. Central sensitization represents enhancement of the function of neuronal circuits in nociceptive pathways and is a manifestation of the remarkable plasticity of the somatosensory nervous system after nerve injury. This review highlights the pathological features of central sensitization, which develops because of (1) injury-induced abnormal inputs from primary afferents, (2) increase in the excitability of dorsal horn neurons, and (3) activated glial cell-derived signals.

  2. RMOD: a tool for regulatory motif detection in signaling network.

    Directory of Open Access Journals (Sweden)

    Jinki Kim

    Full Text Available Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: http://pks.kaist.ac.kr/rmod.

  3. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding.

    Directory of Open Access Journals (Sweden)

    Xin Xie

    2015-06-01

    Full Text Available The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3's function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression.

  4. Review of the damage mechanism in wind turbine gearbox bearings under rolling contact fatigue

    Science.gov (United States)

    Su, Yun-Shuai; Yu, Shu-Rong; Li, Shu-Xin; He, Yan-Ni

    2017-12-01

    Wind turbine gearbox bearings fail with the service life is much shorter than the designed life. Gearbox bearings are subjected to rolling contact fatigue (RCF) and they are observed to fail due to axial cracking, surface flaking, and the formation of white etching areas (WEAs). The current study reviewed these three typical failure modes. The underlying dominant mechanisms were discussed with emphasis on the formation mechanism of WEAs. Although numerous studies have been carried out, the formation of WEAs remains unclear. The prevailing mechanism of the rubbing of crack faces that generates WEAs was questioned by the authors. WEAs were compared with adiabatic shear bands (ASBs) generated in the high strain rate deformation in terms of microstructural compositions, grain refinement, and formation mechanism. Results indicate that a number of similarities exist between them. However, substantial evidence is required to verify whether or not WEAs and ASBs are the same matters.

  5. Transformational Leadership and Organizational Citizenship Behavior: A Meta-Analytic Test of Underlying Mechanisms.

    Science.gov (United States)

    Nohe, Christoph; Hertel, Guido

    2017-01-01

    Based on social exchange theory, we examined and contrasted attitudinal mediators (affective organizational commitment, job satisfaction) and relational mediators (trust in leader, leader-member exchange; LMX) of the positive relationship between transformational leadership and organizational citizenship behavior (OCB). Hypotheses were tested using meta-analytic path models with correlations from published meta-analyses (761 samples with 227,419 individuals overall). When testing single-mediator models, results supported our expectations that each of the mediators explained the relationship between transformational leadership and OCB. When testing a multi-mediator model, LMX was the strongest mediator. When testing a model with a latent attitudinal mechanism and a latent relational mechanism, the relational mechanism was the stronger mediator of the relationship between transformational leadership and OCB. Our findings help to better understand the underlying mechanisms of the relationship between transformational leadership and OCB.

  6. Effects of delaying transplanting on agronomic traits and grain yield of rice under mechanical transplantation pattern.

    Directory of Open Access Journals (Sweden)

    Qihua Liu

    Full Text Available A delay in the mechanical transplantation (MT of rice seedlings frequently occurs in Huanghuai wheat-rice rotation cropping districts of China, due to the late harvest of wheat, the poor weather conditions and the insufficiency of transplanters, missing the optimum transplanting time and causing seedlings to age. To identify how delaying transplanting rice affects the agronomic characteristics including the growth duration, photosynthetic productivity and dry matter remobilization efficiency and the grain yield under mechanical transplanting pattern, an experiment with a split-plot design was conducted over two consecutive years. The main plot includes two types of cultivation: mechanical transplanting and artificial transplanting (AT. The subplot comprises four japonica rice cultivars. The results indicate that the rice jointing, booting, heading and maturity stages were postponed under MT when using AT as a control. The tiller occurrence number, dry matter weight per tiller, accumulative dry matter for the population, leaf area index, crop growth rate, photosynthetic potential, and dry matter remobilization efficiency of the leaf under MT significantly decreased compared to those under AT. In contrast, the reduction rate of the leaf area during the heading-maturity stage was markedly enhanced under MT. The numbers of effective panicles and filled grains per panicle and the grain yield significantly decreased under MT. A significant correlation was observed between the dry matter production, remobilization and distribution characteristics and the grain yield. We infer that, as with rice from old seedlings, the decrease in the tiller occurrence, the photosynthetic productivity and the assimilate remobilization efficiency may be important agronomic traits that are responsible for the reduced grain yield under MT.

  7. Dynamic Response and Failure Mechanism of Brittle Rocks Under Combined Compression-Shear Loading Experiments

    Science.gov (United States)

    Xu, Yuan; Dai, Feng

    2018-03-01

    A novel method is developed for characterizing the mechanical response and failure mechanism of brittle rocks under dynamic compression-shear loading: an inclined cylinder specimen using a modified split Hopkinson pressure bar (SHPB) system. With the specimen axis inclining to the loading direction of SHPB, a shear component can be introduced into the specimen. Both static and dynamic experiments are conducted on sandstone specimens. Given carefully pulse shaping, the dynamic equilibrium of the inclined specimens can be satisfied, and thus the quasi-static data reduction is employed. The normal and shear stress-strain relationships of specimens are subsequently established. The progressive failure process of the specimen illustrated via high-speed photographs manifests a mixed failure mode accommodating both the shear-dominated failure and the localized tensile damage. The elastic and shear moduli exhibit certain loading-path dependence under quasi-static loading but loading-path insensitivity under high loading rates. Loading rate dependence is evidently demonstrated through the failure characteristics involving fragmentation, compression and shear strength and failure surfaces based on Drucker-Prager criterion. Our proposed method is convenient and reliable to study the dynamic response and failure mechanism of rocks under combined compression-shear loading.

  8. Inspection Mechanism and Experimental Study of Prestressed Reverse Tension Method under PC Beam Bridge Anchorage

    Science.gov (United States)

    Peng, Zhang

    2018-03-01

    the prestress under anchorage is directly related to the structural security and performance of PC beam bridge. The reverse tension method is a kind of inspection which confirms the prestress by exerting reversed tension load on the exposed prestressing tendon of beam bridge anchoring system. The thesis elaborately expounds the inspection mechanism and mechanical effect of reverse tension method, theoretically analyzes the influential elements of inspection like tool anchorage deformation, compression of conjuncture, device glide, friction of anchorage loop mouth and elastic compression of concrete, and then presents the following formula to calculate prestress under anchorage. On the basis of model experiment, the thesis systematically studies some key issues during the reverse tension process of PC beam bridge anchorage system like the formation of stress-elongation curve, influential factors, judgment method of prestress under anchorage, variation trend and compensation scale, verifies the accuracy of mechanism analysis and demonstrates: the prestress under anchorage is less than or equal to 75% of the ultimate strength of prestressing tendon, the error of inspect result is less than 1%, which can meet with the demands of construction. The research result has provided theoretical basis and technical foundation for the promotion and application of reverse tension in bridge construction.

  9. Mechanical and electronic properties of monolayer and bilayer phosphorene under uniaxial and isotropic strains.

    Science.gov (United States)

    Hu, Ting; Han, Yang; Dong, Jinming

    2014-11-14

    The mechanical and electronic properties of both the monolayer and bilayer phosphorenes under either isotropic or uniaxial strain have been systematically investigated using first-principles calculations. It is interesting to find that: 1) Under a large enough isotropic tensile strain, the monolayer phosphorene would lose its pucker structure and transform into a flat hexagonal plane, while two inner sublayers of the bilayer phosphorene could be bonded due to its interlayer distance contraction. 2) Under the uniaxial tensile strain along a zigzag direction, the pucker distance of each layer in the bilayer phosphorene can exhibit a specific negative Poisson's ratio. 3) The electronic properties of both the monolayer and bilayer phosphorenes are sensitive to the magnitude and direction of the applied strains. Their band gaps decrease more rapidly under isotropic compressive strain than under uniaxial strain. Also, their direct-indirect band gap transitions happen at the larger isotropic tensile strains compared with that under uniaxial strain. 4) Under the isotropic compressive strain, the bilayer phosphorene exhibits a transition from a direct-gap semiconductor to a metal. In contrast, the monolayer phosphorene initially has the direct-indirect transition and then transitions to a metal. However, under isotropic tensile strain, both the bilayer and monolayer phosphorene show the direct-indirect transition and, finally, the transition to a metal. Our numerical results may open new potential applications of phosphorene in nanoelectronics and nanomechanical devices by external isotropic strain or uniaxial strain along different directions.

  10. Asymmetric flexural behavior from bamboo's functionally graded hierarchical structure: underlying mechanisms.

    Science.gov (United States)

    Habibi, Meisam K; Samaei, Arash T; Gheshlaghi, Behnam; Lu, Jian; Lu, Yang

    2015-04-01

    As one of the most renewable resources on Earth, bamboo has recently attracted increasing interest for its promising applications in sustainable structural purposes. Its superior mechanical properties arising from the unique functionally-graded (FG) hierarchical structure also make bamboo an excellent candidate for bio-mimicking purposes in advanced material design. However, despite its well-documented, impressive mechanical characteristics, the intriguing asymmetry in flexural behavior of bamboo, alongside its underlying mechanisms, has not yet been fully understood. Here, we used multi-scale mechanical characterizations assisted with advanced environmental scanning electron microscopy (ESEM) to investigate the asymmetric flexural responses of natural bamboo (Phyllostachys edulis) strips under different loading configurations, during "elastic bending" and "fracture failure" stages, with their respective deformation mechanisms at microstructural level. Results showed that the gradient distribution of the vascular bundles along the thickness direction is mainly responsible for the exhibited asymmetry, whereas the hierarchical fiber/parenchyma cellular structure plays a critical role in alternating the dominant factors for determining the distinctly different failure mechanisms. A numerical model has been likewise adopted to validate the effective flexural moduli of bamboo strips as a function of their FG parameters, while additional experiments on uniaxial loading of bamboo specimens were performed to assess the tension-compression asymmetry, for further understanding of the microstructure evolution of bamboo's outer and innermost layers under different bending states. This work could provide insights to help the processing of novel bamboo-based composites and enable the bio-inspired design of advanced structural materials with desired flexural behavior. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  11. Oxidative Stress and Mitochondrial Activation as the Main Mechanisms Underlying Graphene Toxicity against Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Anna Jarosz

    2016-01-01

    Full Text Available Due to the development of nanotechnology graphene and graphene-based nanomaterials have attracted the most attention owing to their unique physical, chemical, and mechanical properties. Graphene can be applied in many fields among which biomedical applications especially diagnostics, cancer therapy, and drug delivery have been arousing a lot of interest. Therefore it is essential to understand better the graphene-cell interactions, especially toxicity and underlying mechanisms for proper use and development. This review presents the recent knowledge concerning graphene cytotoxicity and influence on different cancer cell lines.

  12. Mechanical failure of zigzag graphene nanoribbons under tensile strain induced by edge reconstruction

    KAUST Repository

    Cheng, Yingchun

    2012-10-01

    The structural and mechanical properties of graphene nanoribbons (GNRs) under uniaxial tensile strain are studied by density functional theory. The ideal strength of a zigzag GNR (120 GPa) is close to that of pristine graphene. However, for a GNR with both edges reconstructed to pentagon–heptagon pairs (from hexagon–hexagon pairs) it decreases to 94 GPa and the maximum tensile strain is reduced to 15%. Our results constitute a comprehensive picture of the edge structure effect on the mechanical properties of GNRs.

  13. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.

    Directory of Open Access Journals (Sweden)

    Mélanie Boeckstaens

    2015-07-01

    Full Text Available Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability.

  14. Reliability-based optimization of maintenance scheduling of mechanical components under fatigue.

    Science.gov (United States)

    Beaurepaire, P; Valdebenito, M A; Schuëller, G I; Jensen, H A

    2012-05-01

    This study presents the optimization of the maintenance scheduling of mechanical components under fatigue loading. The cracks of damaged structures may be detected during non-destructive inspection and subsequently repaired. Fatigue crack initiation and growth show inherent variability, and as well the outcome of inspection activities. The problem is addressed under the framework of reliability based optimization. The initiation and propagation of fatigue cracks are efficiently modeled using cohesive zone elements. The applicability of the method is demonstrated by a numerical example, which involves a plate with two holes subject to alternating stress.

  15. CISM course on mechanical behaviour of soils under environmentally induced cyclic loads

    CERN Document Server

    Wood, David; Mechanical Behaviour of Soils Under Environmentally Induced Cyclic Loads

    2012-01-01

    The book gives a comprehensive description of the mechanical response of soils (granular and cohesive materials) under cyclic loading. It provides the geotechnical engineer with the theoretical and analytical tools necessary for the evaluation of settlements developng with time under cyclic, einvironmentally idncued loads (such as wave motion, wind actions, water table level variation) and their consequences for the serviceability and durability of structures such as the shallow or deep foundations used in offshore engineering, caisson beakwaters, ballast and airport pavements and also to interpret monitoring data, obtained from both natural and artificial slopes and earth embankments, for the purposes of risk assessment and mitigation.

  16. Trends in E-Cigarette Awareness, Trial, and Use Under the Different Regulatory Environments of Australia and the United Kingdom.

    Science.gov (United States)

    Yong, Hua-Hie; Borland, Ron; Balmford, James; McNeill, Ann; Hitchman, Sara; Driezen, Pete; Thompson, Mary E; Fong, Geoffrey T; Cummings, K Michael

    2015-10-01

    E-cigarettes (ECs) have gained significant attention in recent years. They have been introduced in jurisdictions with divergent existing laws that affect their legality. This provides the opportunity for natural experiments to assess effects of such laws in some cases independent of any formulated government policy. We compare patterns of EC awareness and use over a 3 year period in Australia where laws severely restrict EC availability, with awareness and use in the United Kingdom where ECs are readily available. Data analyzed come from Waves 8 and 9 (collected in 2010 and 2013, respectively) of the International Tobacco Control surveys in Australia and the United Kingdom (approximately 1,500 respondents per wave per country). Across both waves, EC awareness, trial, and use among current and former smokers were significantly greater in the United Kingdom than in Australia, but all 3 of these measures increased significantly between 2010 and 2013 in both countries, and the rate of increase was equivalent between countries. Seventy-three percent of U.K. respondents reported that their current brands contained nicotine as did 43% in Australia even though sale, possession and/or use of nicotine-containing ECs without a permit are illegal in Australia. EC use was greater among smokers in both countries, at least in part due to less uptake by ex-smokers. EC awareness and use have risen rapidly between 2010 and 2013 among current and former smokers in both Australia and the United Kingdom despite different EC regulatory environments. Substantial numbers in both countries are using ECs that contain nicotine. © The Author 2014. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Scientific conception on mechanisms of calcium homeostasis disorders under low dose effect of ionizing radiation

    International Nuclear Information System (INIS)

    Abylaev, Zh.A.; Dospolova, Zh.G.

    1997-01-01

    Scientific conception of probable consequences of calcium homeostasis disorders in personals, exposed to low dose effect of ionizing radiation has been developed. Principle positions of the conception is that pathologic processes development have different ways of conducting. During predominance of low doses of external gamma-radiation there is leading pathologic mechanism (mechanism 1) of disorder neuroendocrine regulation of both the calcium and the phosphor. In this case sicks have disorders of both the vegetative tonus and the endocrine status. Under internal irradiation (mechanism 2) there is disfunction of organs and systems (bore changes and disorders of hormone status). These changes are considered as consequence of negative action on organism of incorporated long-living radionuclides. Radio-toxic factors action (mechanism 3) provokes the excess of hormones, which acting on bone tissue and could be cause of steroid osteoporosis. Influence of chronic stress factor (mechanism 4) enlarges and burden action on organism of low radiation doses. It is emphasized, that decisive role in development of pathologic processes has mechanism of disturbance of neuroendocrine regulation of calcium exchange

  18. Contact force and mechanical loss of multistage cable under tension and bending

    Science.gov (United States)

    Ru, Yanyun; Yong, Huadong; Zhou, Youhe

    2016-10-01

    A theoretical model for calculating the stress and strain states of cabling structures with different loadings has been developed in this paper. We solve the problem for the first- and second-stage cable with tensile or bending strain. The contact and friction forces between the strands are presented by two-dimensional contact model. Several theoretical models have been proposed to verify the results when the triplet subjected to the tensile strain, including contact force, contact stresses, and mechanical loss. It is found that loadings will affect the friction force and the mechanical loss of the triplet. The results show that the contact force and mechanical loss are dependent on the twist pitch. A shorter twist pitch can lead to higher contact force, while the trend of mechanical loss with twist pitch is complicated. The mechanical loss may be reduced by adjusting the twist pitch reasonably. The present model provides a simple analysis method to investigate the mechanical behaviors in multistage-structures under different loads.

  19. From Sound to Significance: Exploring the Mechanisms Underlying Emotional Reactions to Music.

    Science.gov (United States)

    Juslin, Patrik N; Barradas, Gonçalo; Eerola, Tuomas

    2015-01-01

    A common approach to studying emotional reactions to music is to attempt to obtain direct links between musical surface features such as tempo and a listener's responses. However, such an analysis ultimately fails to explain why emotions are aroused in the listener. In this article we explore an alternative approach, which aims to account for musical emotions in terms of a set of psychological mechanisms that are activated by different types of information in a musical event. This approach was tested in 4 experiments that manipulated 4 mechanisms (brain stem reflex, contagion, episodic memory, musical expectancy) by selecting existing musical pieces that featured information relevant for each mechanism. The excerpts were played to 60 listeners, who were asked to rate their felt emotions on 15 scales. Skin conductance levels and facial expressions were measured, and listeners reported subjective impressions of relevance to specific mechanisms. Results indicated that the target mechanism conditions evoked emotions largely as predicted by a multimechanism framework and that mostly similar effects occurred across the experiments that included different pieces of music. We conclude that a satisfactory account of musical emotions requires consideration of how musical features and responses are mediated by a range of underlying mechanisms.

  20. Exact solution for stresses/displacements in a multilayered hollow cylinder under thermo-mechanical loading

    International Nuclear Information System (INIS)

    Yeo, W.H.; Purbolaksono, J.; Aliabadi, M.H.; Ramesh, S.; Liew, H.L.

    2017-01-01

    In this study, a new analytical solution by the recursive method for evaluating stresses/displacements in multilayered hollow cylinder under thermo-mechanical loading was developed. The results for temperature distribution, displacements and stresses obtained by using the proposed solution were shown to be in good agreement with the FEM results. The proposed analytical solution was also found to produce more accurate results than those by the analytical solution reported in literature. - Highlights: • A new analytical solution for evaluating stresses in multilayered hollow cylinder under thermo-mechanical loading. • A simple computational procedure using a recursive method. • A promising technique for evaluating the operating axial and hoop stresses in pressurized composite vessels.

  1. Music and Memory in Alzheimer's Disease and The Potential Underlying Mechanisms.

    Science.gov (United States)

    Peck, Katlyn J; Girard, Todd A; Russo, Frank A; Fiocco, Alexandra J

    2016-01-01

    With population aging and a projected exponential expansion of persons diagnosed with Alzheimer's disease (AD), the development of treatment and prevention programs has become a fervent area of research and discovery. A growing body of evidence suggests that music exposure can enhance memory and emotional function in persons with AD. However, there is a paucity of research that aims to identify specific underlying neural mechanisms associated with music's beneficial effects in this particular population. As such, this paper reviews existing anecdotal and empirical evidence related to the enhancing effects of music exposure on cognitive function and further provides a discussion on the potential underlying mechanisms that may explain music's beneficial effect. Specifically, this paper will outline the potential role of the dopaminergic system, the autonomic nervous system, and the default network in explaining how music may enhance memory function in persons with AD.

  2. Behavioral Effects of Upper Respiratory Tract Illnesses: A Consideration of Possible Underlying Cognitive Mechanisms

    Directory of Open Access Journals (Sweden)

    Andrew P. Smith

    2012-03-01

    Full Text Available Previous research has shown that both experimentally induced upper respiratory tract illnesses (URTIs and naturally occurring URTIs influence mood and performance. The present study investigated possible cognitive mechanisms underlying the URTI-performance changes. Those who developed a cold (N = 47 had significantly faster, but less accurate, performance than those who remained healthy (N = 54. Illness had no effect on manipulations designed to influence encoding, response organisation (stimulus-response compatilibility or response preparation. Similarly, there was no evidence that different components of working memory were impaired. Overall, the present research confirms that URTIs can have an effect on performance efficiency. Further research is required to identify the physiological and behavioral mechanisms underlying these effects.

  3. Physiological mechanisms contributing to increased water-use efficiency in winter wheat under organic fertilization.

    Science.gov (United States)

    Wang, Linlin; Wang, Shiwen; Chen, Wei; Li, Hongbing; Deng, Xiping

    2017-01-01

    Improving the efficiency of resource utilization has received increasing research attention in recent years. In this study, we explored the potential physiological mechanisms underlying improved grain yield and water-use efficiency of winter wheat (Triticum aestivum L.) following organic fertilizer application. Two wheat cultivars, ChangHan58 (CH58) and XiNong9871 (XN9871), were grown under the same nitrogen (N) fertilizer rate (urea-N, CK; and manure plus urea-N, M) and under two watering regimes (WW, well-watered; and WS, water stress) imposed after anthesis. The M fertilizer treatment had a higher Pn and lower gs and Tr than CK under both water conditions, in particular, it significantly increased WRC and Ψw, and decreased EWLR and MDA under WS. Also, the M treatment increased post-anthesis N uptake by 81.4 and 16.4% under WS and WW, thus increasing post-anthesis photosynthetic capacity and delaying leaf senescence. Consequently, the M treatment increased post-anthesis DM accumulation under WS and WW by 51.5 and 29.6%, WUEB by 44.5 and 50.9%, grain number per plant by 11.5 and 12.2% and 1000-grain weight by 7.3 and 3.6%, respectively, compared with CK. The grain yield under M treatment increased by 23 and 15%, and water use efficiency (WUEg) by 25 and 23%, respectively. The increased WUE under organic fertilizer treatment was due to elevated photosynthesis and decreased Tr and gs. Our results suggest that the organic fertilizer treatment enabled plants to use water more efficiently under drought stress.

  4. Detecting method for crude oil price fluctuation mechanism under different periodic time series

    International Nuclear Information System (INIS)

    Gao, Xiangyun; Fang, Wei; An, Feng; Wang, Yue

    2017-01-01

    Highlights: • We proposed the concept of autoregressive modes to indicate the fluctuation patterns. • We constructed transmission networks for studying the fluctuation mechanism. • There are different fluctuation mechanism under different periodic time series. • Only a few types of autoregressive modes control the fluctuations in crude oil price. • There are cluster effects during the fluctuation mechanism of autoregressive modes. - Abstract: Current existing literatures can characterize the long-term fluctuation of crude oil price time series, however, it is difficult to detect the fluctuation mechanism specifically under short term. Because each fluctuation pattern for one short period contained in a long-term crude oil price time series have dynamic characteristics of diversity; in other words, there exhibit various fluctuation patterns in different short periods and transmit to each other, which reflects the reputedly complicate and chaotic oil market. Thus, we proposed an incorporated method to detect the fluctuation mechanism, which is the evolution of the different fluctuation patterns over time from the complex network perspective. We divided crude oil price time series into segments using sliding time windows, and defined autoregressive modes based on regression models to indicate the fluctuation patterns of each segment. Hence, the transmissions between different types of autoregressive modes over time form a transmission network that contains rich dynamic information. We then capture transmission characteristics of autoregressive modes under different periodic time series through the structure features of the transmission networks. The results indicate that there are various autoregressive modes with significantly different statistical characteristics under different periodic time series. However, only a few types of autoregressive modes and transmission patterns play a major role in the fluctuation mechanism of the crude oil price, and these

  5. Adverse Effects from Clenbuterol and Ractopamine on Nematode Caenorhabditis elegans and the Underlying Mechanism

    OpenAIRE

    Zhuang, Ziheng; Zhao, Yunli; Wu, Qiuli; Li, Min; Liu, Haicui; Sun, Lingmei; Gao, Wei; Wang, Dayong

    2014-01-01

    In the present study, we used Caenorhabditis elegans assay system to investigate in vivo toxicity from clentuberol and ractopamine and the possible underlying mechanism. Both acute and prolonged exposures to clentuberol or ractopamine decreased brood size and locomotion behavior, and induced intestinal autofluorescence and reactive oxygen species (ROS) production. Although acute exposure to the examined concentrations of clentuberol or ractopamine did not induce lethality, prolonged exposure ...

  6. Optimal Contract Design for Cooperative Relay Incentive Mechanism under Moral Hazard

    OpenAIRE

    Zhao, Nan; Wu, Minghu; Xiong, Wei; Liu, Cong

    2015-01-01

    Cooperative relay can effectively improve spectrum efficiency by exploiting the spatial diversity in the wireless networks. However, wireless nodes may acquire different network information with various users’ location and mobility, channels’ conditions, and other factors, which results in asymmetric information between the source and the relay nodes (RNs). In this paper, the relay incentive mechanism between relay nodes and the source is investigated under the asymmetric information. By mode...

  7. Mechanisms underlying reductant-induced reactive oxygen species formation by anticancer copper(II) compounds

    OpenAIRE

    Kowol, Christian R.; Heffeter, Petra; Miklos, Walter; Gille, Lars; Trondl, Robert; Cappellacci, Loredana; Berger, Walter; Keppler, Bernhard K.

    2011-01-01

    Intracellular generation of reactive oxygen species (ROS) via thiol-mediated reduction of copper(II) to copper(I) has been assumed as the major mechanism underlying the anticancer activity of copper(II) complexes. The aim of this study was to compare the anticancer potential of copper(II) complexes of Triapine (3-amino-pyridine-2-carboxaldehyde thiosemicarbazone; currently in phase II clinical trials) and its terminally dimethylated derivative with that of 2-formylpyridine thiosemicarbazone a...

  8. A fracture mechanics study of tungsten failure under high heat flux loads

    International Nuclear Information System (INIS)

    Li, Muyuan

    2015-01-01

    The performance of fusion devices is highly dependent on plasma-facing components. Tungsten is the most promising candidate material for armors in plasma-facing components in ITER and DEMO. However, the brittleness of tungsten below the ductile-to-brittle transition temperature is very critical to the reliability of plasma-facing components. In this work, thermo-mechanical and fracture behaviors of tungsten are predicted numerically under fusion relevant thermal loadings.

  9. The effects and underlying mechanisms of mirror therapy – literature review

    OpenAIRE

    Urška Puh; Sonja Hlebš

    2013-01-01

    Background: Mirror therapy is a relatively new therapeutic modality, where movement of the unaffected limb is used to facilitate performance of the affected limb. Literature review of clinical studies regarding the effectiveness of mirror therapy in different groups of patients was performed. The review focussed on randomised controlled trials and studies, which explore the underlying mechanisms of mirror therapy. Conclusions: The majority of randomised controlled ...

  10. The chemical and mechanical behaviors of polymer / reactive metal systems under high strain rates

    Science.gov (United States)

    Shen, Yubin

    As one category of energetic materials, impact-initiated reactive materials are able to release a high amount of stored chemical energy under high strain rate impact loading, and are used extensively in civil and military applications. In general, polymers are introduced as binder materials to trap the reactive metal powders inside, and also act as an oxidizing agent for the metal ingredient. Since critical attention has been paid on the metal / metal reaction, only a few types of polymer / reactive metal interactions have been studied in the literature. With the higher requirement of materials resistant to different thermal and mechanical environments, the understanding and characterization of polymer / reactive metal interactions are in great demand. In this study, PTFE (Polytetrafluoroethylene) 7A / Ti (Titanium) composites were studied under high strain rates by utilizing the Taylor impact and SHPB tests. Taylor impact tests with different impact velocities, sample dimensions and sample configurations were conducted on the composite, equipped with a high-speed camera for tracking transient images during the sudden process. SHPB and Instron tests were carried out to obtain the stress vs. strain curves of the composite under a wide range of strain rates, the result of which were also utilized for fitting the constitutive relations of the composite based on the modified Johnson-Cook strength model. Thermal analyses by DTA tests under different flow rates accompanied with XRD identification were conducted to study the reaction mechanism between PTFE 7A and Ti when only heat was provided. Numerical simulations on Taylor impact tests and microstructural deformations were also performed to validate the constitutive model built for the composite system, and to investigate the possible reaction mechanism between two components. The results obtained from the high strain rate tests, thermal analyses and numerical simulations were combined to provide a systematic study on

  11. Modulating Conscious Movement Intention by Noninvasive Brain Stimulation and the Underlying Neural Mechanisms

    OpenAIRE

    Douglas, Zachary H.; Maniscalco, Brian; Hallett, Mark; Wassermann, Eric M.; He, Biyu J.

    2015-01-01

    Conscious intention is a fundamental aspect of the human experience. Despite long-standing interest in the basis and implications of intention, its underlying neurobiological mechanisms remain poorly understood. Using high-definition transcranial DC stimulation (tDCS), we observed that enhancing spontaneous neuronal excitability in both the angular gyrus and the primary motor cortex caused the reported time of conscious movement intention to be ∼60–70 ms earlier. Slow brain waves recorded ∼2–...

  12. Diffuse and Focal Brain Injury in a Large Animal Model of PTE: Mechanisms Underlying Epileptogenesis

    Science.gov (United States)

    2017-10-01

    Conclusions: A) Contusion injury validation and neuropathology B) Grid electrode development and testing C) Wireless Large Animal Custom Enclosure...In addition, we will test the NF-L and GFAP immunoassay to begin quantification of this biomarkers, as well as collecting serum from the animals pre...AWARD NUMBER: W81XWH-16-1-0675 TITLE: Diffuse and Focal Brain Injury in a Large Animal Model of PTE: Mechanisms Underlying Epileptogenesis

  13. Different intra- and interspecific facilitation mechanisms between two Mediterranean trees under a climate change scenario.

    Science.gov (United States)

    Gimeno, Teresa E; Escudero, Adrián; Valladares, Fernando

    2015-01-01

    In harsh environments facilitation alleviates biotic and abiotic constraints on tree recruitment. Under ongoing drier climate change, we expect facilitation to increase as a driver of coexistence. However, this might not hold under extreme abiotic stress and when the outcome depends on the interaction with other drivers such as altered herbivore pressure due to land use change. We performed a field water-manipulation experiment to quantify the importance of facilitation in two coexisting Mediterranean trees (dominant Juniperus thurifera and coexisting Quercus ilex subsp. ballota) under a climate change scenario. Shifts in canopy dominance favouring Q. ilex could be based on the extension of heterospecific facilitation to the detriment of conspecific alleviation. We found that saplings of both species transplanted under the canopy of nurse trees had greater survival probability, growth and photochemical efficiency. Intra- and interspecific facilitation mechanisms differed: alleviation of abiotic stress benefited both species during summer and J. thurifera during winter, whereas browsing protection was relevant only for Q. ilex. Facilitation was greater under the dry treatment only for Q. ilex, which partially agreed with the predictions of the stress gradient hypothesis. We conclude that present rainfall availability limits neither J. thurifera nor Q. ilex establishment. Nevertheless, under current global change scenarios, imposing increasing abiotic stress together with altered herbivore browsing, nurse trees could differentially facilitate the establishment of Q. ilex due to species-specific traits, i.e. palatability; drought, heat and cold tolerance, underlying species differences in the facilitation mechanisms and eventually triggering a change from pure juniper woodlands to mixed formations.

  14. FInal Report: First Principles Modeling of Mechanisms Underlying Scintillator Non-Proportionality

    Energy Technology Data Exchange (ETDEWEB)

    Aberg, Daniel [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sadigh, Babak [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Zhou, Fei [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-01-01

    This final report presents work carried out on the project “First Principles Modeling of Mechanisms Underlying Scintillator Non-Proportionality” at Lawrence Livermore National Laboratory during 2013-2015. The scope of the work was to further the physical understanding of the microscopic mechanisms behind scintillator nonproportionality that effectively limits the achievable detector resolution. Thereby, crucial quantitative data for these processes as input to large-scale simulation codes has been provided. In particular, this project was divided into three tasks: (i) Quantum mechanical rates of non-radiative quenching, (ii) The thermodynamics of point defects and dopants, and (iii) Formation and migration of self-trapped polarons. The progress and results of each of these subtasks are detailed.

  15. Potential neural mechanisms underlying the effectiveness of early intervention for children with autism spectrum disorder

    Science.gov (United States)

    Sullivan, Katherine; Stone, Wendy L.; Dawson, Geraldine

    2014-01-01

    Although evidence supports the efficacy of early intervention for improving outcomes for children with autism spectrum disorder (ASD), the mechanisms underlying their effectiveness remain poorly understood. This paper reviews the research literature on the neural bases of the early core deficits in ASD and proposes three key features of early intervention related to the neural mechanisms that may contribute to its effectiveness in improving deficit areas. These features include (1) the early onset of intensive intervention which capitalizes on the experience-expectant plasticity of the immature brain, (2) the use of treatment strategies that address core deficits in social motivation through an emphasis on positive social engagement and arousal modulation, and (3) promotion of complex neural networks and connectivity through thematic, multi-sensory and multi-domain teaching approaches. Understanding the mechanisms of effective early intervention will enable us to identify common or foundational active ingredients for promoting optimal outcomes in children with ASD. PMID:25108609

  16. Contraction and elongation: Mechanics underlying cell boundary deformations in epithelial tissue.

    Science.gov (United States)

    Hara, Yusuke

    2017-06-01

    The cell-cell boundaries of epithelial cells form cellular frameworks at the apical side of tissues. Deformations in these boundaries, for example, boundary contraction and elongation, and the associated forces form the mechanical basis of epithelial tissue morphogenesis. In this review, using data from recent Drosophila studies on cell boundary contraction and elongation, I provide an overview of the mechanism underlying the bi-directional deformations in the epithelial cell boundary, that are sustained by biased accumulations of junctional and apico-medial non-muscle myosin II. Moreover, how the junctional tensions exist on cell boundaries in different boundary dynamics and morphologies are discussed. Finally, some future perspectives on how recent knowledge about single cell boundary-level mechanics will contribute to our understanding of epithelial tissue morphogenesis are discussed. © 2017 Japanese Society of Developmental Biologists.

  17. Compressive damage mechanism of GFRP composites under off-axis loading: Experimental and numerical investigations

    DEFF Research Database (Denmark)

    Zhou, H.W.; Li, H.Y.; Gui, L.L.

    2013-01-01

    Experimental and computational studies of the microscale mechanisms of damage formation and evolution in unidirectional glass fiber reinforced polymer composites (GFRP) under axial and off-axis compressive loading are carried out. A series of compressive testing of the composites with different...... the angle between the fiber direction and the loading vector goes from 0° to 45° (by 2.3–2.6 times), and then slightly increases (when the angle approaches 80–90°). At the low angles between the fiber and the loading vector, fiber buckling and kinking are the main mechanisms of fiber failure....... With increasing the angle between the fiber and applied loading, failure of glass fibers is mainly controlled by shear cracking. For the computational analysis of the damage mechanisms, 3D multifiber unit cell models of GFRP composites and X-FEM approach to the fracture modeling were used. The computational...

  18. [Progress of researches on mechanism of acupuncture therapy underlying improvement of acute cerebral hemorrhage].

    Science.gov (United States)

    Wang, Fan; Wang, Hai-qiao; Dong, Gui-rong

    2011-04-01

    In the present paper, the authors review the progress of researches on the mechanism of acupuncture therapy underlying improvement of acute cerebral hemorrhage from experimental studies and research methods. The effects of acupuncture intervention mainly involve (1) lessening inflammatory reactions, (2) reducing impairment of free radicals and excitatory amino acids on cerebral neurons, (3) balancing release of vascular bioactive substances to increase regional cerebral blood flow, and (4) promoting repair and regeneration of the neural tissue, etc. In regard to the research methods, many new biological techniques such as biological molecular approaches, neuro-cellular chemical methods, reverse transcription-polymerase chain reaction (RT-PCR) or quantitative real time-PCR, situ hybridization, western blotting, electron microscope, etc., have been extensively applied to researches on the underlying mechanism of acupuncture therapy for cerebral infarction. In addition, the authors also pointed out that in spite of achieving some bigger progresses in experimental studies, most of the results basically reflect static, isolated and regional changes rather than dynamic and whole body changes. For this reason, more vivo research techniques and noninvasive research methods are highly recommended to be used in the future research on the underlying mechanisms of acupuncture therapy for acute cerebral ischemia.

  19. Prevalence and Correlates of the Belief That Electronic Cigarettes are a Lot Less Harmful Than Conventional Cigarettes Under the Different Regulatory Environments of Australia and the United Kingdom.

    Science.gov (United States)

    Yong, Hua-Hie; Borland, Ron; Balmford, James; Hitchman, Sara C; Cummings, K Michael; Driezen, Pete; Thompson, Mary E

    2017-02-01

    The rapid rise in electronic cigarettes (ECs) globally has stimulated much debate about the relative risk and public health impact of this new emerging product category as compared to conventional cigarettes. The sale and marketing of ECs containing nicotine are banned in many countries (eg, Australia) but are allowed in others (eg, United Kingdom). This study examined prevalence and correlates of the belief that ECs are a lot less harmful than conventional cigarettes under the different regulatory environments in Australia (ie, more restrictive) and the United Kingdom (ie, less restrictive). Australian and UK data from the 2013 survey of the International Tobacco Control Four-Country project were analyzed. More UK than Australian respondents (58.5% vs. 35.2%) believed that ECs are a lot less harmful than conventional cigarettes but more respondents in Australia than in the United Kingdom selected "Don't Know" (36.5% vs. 17.1%). The proportion that responded "A little less, equally or more harmful" did not differ between countries. Correlates of the belief that ECs are "A lot less harmful" differed between countries, while correlates of "Don't Know" response did not differ. Consistent with the less restrictive regulatory environment affecting the sale and marketing of ECs, smokers and recent ex-smokers in the United Kingdom were more likely to believe ECs were less harmful relative to conventional cigarettes compared to those in Australia. What this study adds: Among smokers and ex-smokers, this study found that the belief that ECs are (a lot) less harmful than conventional cigarettes was considerably higher in the United Kingdom than in Australia in 2013. The finding is consistent with the less restrictive regulatory environment for ECs in the United Kingdom, suggesting that the regulatory framework for ECs adopted by a country can affect smokers' perceptions about the relative harmfulness of ECs, the group that stands to gain the most from having an accurate

  20. Psychogenic non-epileptic seizures: so-called psychiatric comorbidity and underlying defense mechanisms.

    Science.gov (United States)

    Beghi, Massimiliano; Negrini, Paola Beffa; Perin, Cecilia; Peroni, Federica; Magaudda, Adriana; Cerri, Cesare; Cornaggia, Cesare Maria

    2015-01-01

    In Diagnostic and Statistical Manual of Mental Disorders, fifth edition, psychogenic non-epileptic seizures (PNES) do not have a unique classification as they can be found within different categories: conversion, dissociative, and somatization disorders. The ICD-10, instead, considers PNES within dissociative disorders, merging the dissociative disorders and conversion disorders, although the underlying defense mechanisms are different. The literature data show that PNES are associated with cluster B (mainly borderline) personality disorders and/or to people with depressive or anxiety disorders. Defense mechanisms in patients with PNES with a prevalence of anxious/depressive symptoms are of "neurotic" type; their goal is to lead to a "split", either vertical (dissociation) or horizontal (repression). The majority of patients with this type of PNES have alexithymia traits, meaning that they had difficulties in feeling or perceiving emotions. In subjects where PNES are associated with a borderline personality, in which the symbolic function is lost, the defense mechanisms are of a more archaic nature (denial). PNES with different underlying defense mechanisms have different prognoses (despite similar severity of PNES) and need usually a different treatment (pharmacological or psychological). Thus, it appears superfluous to talk about psychiatric comorbidity, since PNES are a different symptomatic expression of specific psychiatric disorders.

  1. Mechanisms underlying the nociceptive responses induced by platelet-activating factor (PAF) in the rat paw.

    Science.gov (United States)

    Marotta, Denise M; Costa, Robson; Motta, Emerson M; Fernandes, Elizabeth S; Medeiros, Rodrigo; Quintão, Nara L M; Campos, Maria M; Calixto, João B

    2009-04-01

    Platelet-activating factor (PAF) is an inflammatory mediator widely known to exert relevant pathophysiological functions. However, the relevance of PAF in nociception has received much less attention. Herein, we have investigated the mechanisms underlying PAF-induced spontaneous nociception and mechanical hypersensitivity in the rat paw. PAF injection (1- 30 nmol/paw) resulted in a dose-related overt nociception, whilst only the dose of 10 nmol/ paw produced a significant and time-related mechanical hypersensitivity. Local coinjection of PAF antagonist WEB2086 significantly inhibited both spontaneous nociception and mechanical hypersensitivity. Moreover, the coinjection of the natural IL-1beta receptor antagonist (IRA) notably prevented both PAF-induced nociceptive responses, whilst these responses were not altered by anti-TNFalpha coinjection. Interestingly, pretreatment with the ultrapotent vaniloid agonist resiniferotoxin, coinjection of the TRPV1 receptor antagonist SB366791, or mast cell depletion with compound 48/80 markedly prevented PAF-induced spontaneous nociception. Conversely, PAF-elicited mechanical hypersensitivity was strikingly susceptible to distinct antineutrophil-related strategies, namely the antineutrophil antibody, the selectin blocker fucoidin, the chemokine CXCR2 receptor antagonist SB225002, and the C5a receptor antibody anti-CD88. Notably, the same antineutrophil migration strategies significantly prevented the increase of myeloperoxidase activity induced by PAF. The mechanical hypersensitivity caused by PAF was also prevented by the cyclooxygenase inhibitors indomethacin or celecoxib, and by the selective beta(1) adrenergic receptor antagonist atenolol. Collectively, the present results provide consistent evidence indicating that distinct mechanisms are involved in the spontaneous nociception and mechanical hypersensitivity caused by PAF. They also support the concept that selective PAF receptor antagonists might constitute interesting

  2. The molecular mechanism underlying anthocyanin metabolism in apple using the MdMYB16 and MdbHLH33 genes.

    Science.gov (United States)

    Xu, Haifeng; Wang, Nan; Liu, Jingxuan; Qu, Changzhi; Wang, Yicheng; Jiang, Shenghui; Lu, Ninglin; Wang, Deyun; Zhang, Zongying; Chen, Xuesen

    2017-05-01

    MdMYB16 forms homodimers and directly inhibits anthocyanin synthesis via its C-terminal EAR repressor. It weakened the inhibitory effect of MdMYB16 on anthocyanin synthesis when overexpressing MdbHLH33 in callus overexpressing MdMYB16. MdMYB16 could interact with MdbHLH33. Anthocyanins are strong antioxidants that play a key role in the prevention of cardiovascular disease, cancer, and diabetes. The germplasm of Malus sieversii f. neidzwetzkyana is important for the study of anthocyanin metabolism. To date, only limited studies have examined the negative regulatory mechanisms underlying anthocyanin synthesis in apple. Here, we analyzed the relationship between anthocyanin levels and MdMYB16 expression in mature Red Crisp 1-5 apple (M. domestica) fruit, generated an evolutionary tree, and identified an EAR suppression sequence and a bHLH binding motif of the MdMYB16 protein using protein sequence analyses. Overexpression of MdMYB16 or MdMYB16 without bHLH binding sequence (LBSMdMYB16) in red-fleshed callus inhibited MdUFGT and MdANS expression and anthocyanin synthesis. However, overexpression of MdMYB16 without the EAR sequence (LESMdMYB16) in red-fleshed callus had no inhibitory effect on anthocyanin. The yeast one-hybrid assay showed that MdMYB16 and LESMdMYB16 interacted the promoters of MdANS and MdUFGT, respectively. Yeast two-hybrid, pull-down, and bimolecular fluorescence complementation assays showed that MdMYB16 formed homodimers and interacted with MdbHLH33, however, the LBSMdMYB16 could not interact with MdbHLH33. We overexpressed MdbHLH33 in callus overexpressing MdMYB16 and found that it weakened the inhibitory effect of MdMYB16 on anthocyanin synthesis. Together, these results suggested that MdMYB16 and MdbHLH33 may be important part of the regulatory network controlling the anthocyanin biosynthetic pathway.

  3. Transcriptional and epigenetic mechanisms underlying enhanced in vitro adipocyte differentiation by the brominated flame retardant BDE-47

    DEFF Research Database (Denmark)

    Kamstra, Jorke H; Hruba, Eva; Blumberg, Bruce

    2014-01-01

    . The mechanisms by which EDCs direct preadipocytes to form adipocytes are poorly understood. Here, we examined transcriptional and epigenetic mechanisms underlying the induction of in vitro adipocyte differentiation by BDE-47. Quantitative high content microscopy revealed concentration-dependent enhanced...

  4. Fracture mechanics study on stress corrosion cracking behavior under corrosive environment

    International Nuclear Information System (INIS)

    Fujii, Tomoyuki; Tohgo, Keiichiro; Shimamura, Yoshinobu; Ishizuka, Naohiro; Takanashi, Masahiro; Itabashi, Yu; Nakayama, Gen; Sakakibara, Yohei; Hirano, Takashi

    2013-01-01

    This paper deals with applicability of non-linear fracture mechanics to crack growth by stress corrosion cracking (SCC) under large-scale yielding and in a plastically deformed area. Crack growth test by compact tension specimen is carried out to evaluate crack growth rate under small-scale and large-scale yielding conditions. To evaluate the crack growth behavior from a crack initiated in a plastically deformed area, crack growth test is also carried out for a very short pre-crack in a plastically deformed four-point bending specimen. Conventional stress intensity factor (K) and equivalent stress intensity factor (K J ) defined by J integral are used as fracture mechanics parameters which characterize the crack growth rate. On da/dt-K diagram, a data band shows wide scatter, especially the crack growth rate in a plastically deformed area is higher than that under small-scale yielding condition. On the other hand, da/dt-K J diagram exhibits narrower scatter on a data band than da/dt-K diagram. The equivalent stress intensity factor is appropriate for characterization of crack growth rate by SCC under small-scale yielding through large scale yielding conditions and in a plastically deformed area. (author)

  5. Mechanical behavior of confined self-compacting reinforced concrete circular columns under concentric axial loading

    Directory of Open Access Journals (Sweden)

    Fouad Khairallah

    2013-12-01

    Full Text Available While there is abundant research information on ordinary confined concrete, there are little data on the behavior of Self-Compacting Concrete (SCC under such condition. Due to higher shrinkage and lower coarse aggregate content of SCC compared to that of Normal Concrete (NC, its composite performance under confined conditions needs more investigation. This paper has been devoted to investigate and compare the mechanical behavior of confined concrete circular columns cast with SCC and NC under concentric axial loading. The parameters affecting are including concrete compressive strength and confinement configuration. Twenty column specimens were casted and confined using four confinement techniques, CFRP wrap, FRP tube, GFRP wrap, and spiral steel hoops. The performance of the tested column specimens is evaluated based on mode of failure, load–displacement curve, stress–strain characteristics, ultimate strength, ductility, and degree of confinement.

  6. First-principles calculations of mechanical and electronic properties of silicene under strain

    Directory of Open Access Journals (Sweden)

    Rui Qin

    2012-06-01

    Full Text Available We perform first-principles calculations of mechanical and electronic properties of silicene under strains. The in-plane stiffness of silicene is much smaller than that of graphene. The yielding strain of silicene under uniform expansion in the ideal conditions is about 20%. The homogeneous strain can introduce a semimetal-metal transition. The semimetal state of silicene, in which the Dirac cone locates at the Fermi level, can only persist up to tensile strain of 7% with nearly invariant Fermi velocity. For larger strains, silicene changes into a conventional metal. The work function is found to change significantly under biaxial strain. Our calculations show that strain tuning is important for applications of silicene in nanoelectronics.

  7. Honeybee colony thermoregulation--regulatory mechanisms and contribution of individuals in dependence on age, location and thermal stress.

    Directory of Open Access Journals (Sweden)

    Anton Stabentheiner

    2010-01-01

    Full Text Available Honeybee larvae and pupae are extremely stenothermic, i.e. they strongly depend on accurate regulation of brood nest temperature for proper development (33-36 degrees C. Here we study the mechanisms of social thermoregulation of honeybee colonies under changing environmental temperatures concerning the contribution of individuals to colony temperature homeostasis. Beside migration activity within the nest, the main active process is "endothermy on demand" of adults. An increase of cold stress (cooling of the colony increases the intensity of heat production with thoracic flight muscles and the number of endothermic individuals, especially in the brood nest. As endothermy means hard work for bees, this eases much burden of nestmates which can stay ectothermic. Concerning the active reaction to cold stress by endothermy, age polyethism is reduced to only two physiologically predetermined task divisions, 0 to approximately 2 days and older. Endothermic heat production is the job of bees older than about two days. They are all similarly engaged in active heat production both in intensity and frequency. Their active heat production has an important reinforcement effect on passive heat production of the many ectothermic bees and of the brood. Ectothermy is most frequent in young bees (< approximately 2 days both outside and inside of brood nest cells. We suggest young bees visit warm brood nest cells not only to clean them but also to speed up flight muscle development for proper endothermy and foraging later in their life. Young bees inside brood nest cells mostly receive heat from the surrounding cell wall during cold stress, whereas older bees predominantly transfer heat from the thorax to the cell wall. Endothermic bees regulate brood comb temperature more accurately than local air temperature. They apply the heat as close to the brood as possible: workers heating cells from within have a higher probability of endothermy than those on the comb

  8. Modeling and numerical analysis of granite rock specimen under mechanical loading and fire

    Directory of Open Access Journals (Sweden)

    Luc Leroy Ngueyep. Mambou

    2015-02-01

    Full Text Available The effect of ISO 834 fire on the mechanical properties of granite rock specimen submitted to uniaxial loading is numerically investigated. Based on Newton's second law, the rate-equation model of granite rock specimen under mechanical load and fire is established. The effect of heat treatment on the mechanical performance of granite is analyzed at the center and the ends of specimen. At the free end of granite rock specimen, it is shown that from 20 °C to 500 °C, the internal stress and internal strain are weak; whereas above 500 °C, they start to increase rapidly, announcing the imminent collapse. At the center of specimen, the analysis of the internal stress and internal strain reveals that the fire reduces the mechanical performance of granite significantly. Moreover, it is found that after 3 min of exposure to fire, the mechanical energy necessary to fragment the granite can be reduced up to 80%.

  9. New developments on the neurobiological and pharmaco-genetic mechanisms underlying internet and videogame addiction.

    Science.gov (United States)

    Weinstein, Aviv; Lejoyeux, Michel

    2015-03-01

    There is emerging evidence that the psychobiological mechanisms underlying behavioral addictions such as internet and videogame addiction resemble those of addiction for substances of abuse. Review of brain imaging, treatment and genetic studies on videogame and internet addiction. Literature search of published articles between 2009 and 2013 in Pubmed using "internet addiction" and "videogame addiction" as the search word. Twenty-nine studies have been selected and evaluated under the criteria of brain imaging, treatment, and genetics. Brain imaging studies of the resting state have shown that long-term internet game playing affected brain regions responsible for reward, impulse control and sensory-motor coordination. Brain activation studies have shown that videogame playing involved changes in reward and loss of control and that gaming pictures have activated regions similarly to those activated by cue-exposure to drugs. Structural studies have shown alterations in the volume of the ventral striatum possible as result of changes in reward. Furthermore, videogame playing was associated with dopamine release similar in magnitude to those of drugs of abuse and that there were faulty inhibitory control and reward mechanisms videogame addicted individuals. Finally, treatment studies using fMRI have shown reduction in craving for videogames and reduced associated brain activity. Videogame playing may be supported by similar neural mechanisms underlying drug abuse. Similar to drug and alcohol abuse, internet addiction results in sub-sensitivity of dopamine reward mechanisms. Given the fact that this research is in its early stage it is premature to conclude that internet addiction is equivalent to substance addictions. © American Academy of Addiction Psychiatry.

  10. Microscale experimental investigation of deformation and damage of argillaceous rocks under cyclic hydric and mechanical loads

    International Nuclear Information System (INIS)

    Wang, Linlin; Yang, Diansen; Heripre, Eva; Chanchole, Serge; Bornert, Michel; Pouya, Ahmad; Halphen, Bernard

    2012-01-01

    Document available in abstract form only. Argillaceous rocks are possible host rocks for underground nuclear waste repositories. They exhibit complex coupled thermo-hydro-chemo-mechanical behavior, the description of which would strongly benefit from an improved experimental insight on their deformation and damage mechanisms at microscale. We present some recent observations of the evolution of these rocks at the scale of their composite microstructure, essentially made of a clay matrix with embedded carbonates and quartz particles with sizes ranging from a few to several tens of micrometers, when they are subjected to cyclic variations of relative humidity and mechanical loading. They are based on the combination of high definition and high resolution imaging in an environmental scanning electron microscope (ESEM), in situ hydro-mechanical loading of the samples, and digital image correlation techniques. Samples, several millimeters in diameter, are held at a constant temperature of 2 deg. Celsius while the vapor pressure in the ESEM chamber is varied from a few to several hundreds of Pascals, generating a relative humidity ranging from about 10% up to 90%. Results show a strongly heterogeneous deformation field at microscale, which is the result of complex hydro-mechanical interactions. In particular, it can be shown that local swelling incompatibilities can generate irreversible deformations in the clay matrix, even if the overall hydric deformations seem reversible. In addition, local damage can be generated, in the form of a network of microcracks, located in the bulk of the clay matrix and/or at the interface between clay and other mineral particles. The morphology of this network, described in terms of crack length, orientation and preferred location, has been observed to be dependent on the speed of the variation of the relative humidity, and is different in a saturation or desaturation process. Besides studying the deformation and damage under hydric

  11. Interactive evolution concept for analyzing a rock salt cavern under cyclic thermo-mechanical loading

    Science.gov (United States)

    König, Diethard; Mahmoudi, Elham; Khaledi, Kavan; von Blumenthal, Achim; Schanz, Tom

    2016-04-01

    The excess electricity produced by renewable energy sources available during off-peak periods of consumption can be used e.g. to produce and compress hydrogen or to compress air. Afterwards the pressurized gas is stored in the rock salt cavities. During this process, thermo-mechanical cyclic loading is applied to the rock salt surrounding the cavern. Compared to the operation of conventional storage caverns in rock salt the frequencies of filling and discharging cycles and therefore the thermo-mechanical loading cycles are much higher, e.g. daily or weekly compared to seasonally or yearly. The stress strain behavior of rock salt as well as the deformation behavior and the stability of caverns in rock salt under such loading conditions are unknown. To overcome this, existing experimental studies have to be supplemented by exploring the behavior of rock salt under combined thermo-mechanical cyclic loading. Existing constitutive relations have to be extended to cover degradation of rock salt under thermo-mechanical cyclic loading. At least the complex system of a cavern in rock salt under these loading conditions has to be analyzed by numerical modeling taking into account the uncertainties due to limited access in large depth to investigate material composition and properties. An interactive evolution concept is presented to link the different components of such a study - experimental modeling, constitutive modeling and numerical modeling. A triaxial experimental setup is designed to characterize the cyclic thermo-mechanical behavior of rock salt. The imposed boundary conditions in the experimental setup are assumed to be similar to the stress state obtained from a full-scale numerical simulation. The computational model relies primarily on the governing constitutive model for predicting the behavior of rock salt cavity. Hence, a sophisticated elasto-viscoplastic creep constitutive model is developed to take into account the dilatancy and damage progress, as well as

  12. Corporate debts ad credit performance under the new mechanism of reorganization of the Russian banks

    Directory of Open Access Journals (Sweden)

    Sergey A. Andryushin

    2017-09-01

    Full Text Available Objective to explore the dynamics and factors of formation of corporate debts the characteristics of low credit activity of the Russian banks and regulation of liquidity deficit of enterprises under the new reorganization mechanism in the Russian banking sector. Methods systematic approach to the cognition of economic phenomena which allows to study them in their dynamic development taking into account the influence of various environmental factors. The systematic approach determined selection of specific research methods empirical logical comparative and statistical. Results the article is devoted to the problems of declining credit activity of commercial banks under the conditions of economic activity revival as well as to assessing the impact of the new reorganization mechanism on this process. It is shown that in the recent years the nonfinancial sector faces the trend of optimizing the corporate debts and the liquidity deficit which reduced the demand for loans and as a consequence decreased the banksrsquo credit activity. To analyze the dynamics of deficitsurplus of liquidity in the corporate sector a new classification of liquidity deficitsurplus levels was introduced. Based on the proposed classification the risk factors were identified that influenced the dynamics of indebtedness in the corporate sector. The article also analyses the modern monetary mechanism of money supply in the economy and its transformation. It was determined that the main limitation of credit issuance by commercial banks is their capital not the reserve multiplier. The new mechanism of credit institutionsrsquo financial recovery and its impact on the banksrsquo credit activity was estimated. The conditions of liquidity deficiency reduction in the Russian companies were analyzed in the medium term. Scientific novelty for the first time on the basis of system analysis methods the growth factors of the corporate debt load were identified the peculiarities of low

  13. Theoretical modeling of mechanical homeostasis of a mammalian cell under gravity-directed vector.

    Science.gov (United States)

    Zhou, Lüwen; Zhang, Chen; Zhang, Fan; Lü, Shouqin; Sun, Shujin; Lü, Dongyuan; Long, Mian

    2018-02-01

    Translocation of dense nucleus along gravity vector initiates mechanical remodeling of a eukaryotic cell. In our previous experiments, we quantified the impact of gravity vector on cell remodeling by placing an MC3T3-E1 cell onto upward (U)-, downward (D)-, or edge-on (E)- orientated substrate. Our experimental data demonstrate that orientation dependence of nucleus longitudinal translocation is positively correlated with cytoskeletal (CSK) remodeling of their expressions and structures and also is associated with rearrangement of focal adhesion complex (FAC). However, the underlying mechanism how CSK network and FACs are reorganized in a mammalian cell remains unclear. In this paper, we developed a theoretical biomechanical model to integrate the mechanosensing of nucleus translocation with CSK remodeling and FAC reorganization induced by a gravity vector. The cell was simplified as a nucleated tensegrity structure in the model. The cell and CSK filaments were considered to be symmetrical. All elements of CSK filaments and cytomembrane that support the nucleus were simplified as springs. FACs were simplified as an adhesion cluster of parallel bonds with shared force. Our model proposed that gravity vector-directed translocation of the cell nucleus is mechanically balanced by CSK remodeling and FAC reorganization induced by a gravitational force. Under gravity, dense nucleus tends to translocate and exert additional compressive or stretching force on the cytoskeleton. Finally, changes of the tension force acting on talin by microfilament alter the size of FACs. Results from our model are in qualitative agreement with those from experiments.

  14. Mechanisms of Mining Seismicity under Large Scale Exploitation with Multikey Strata

    Directory of Open Access Journals (Sweden)

    Hu He

    2015-01-01

    Full Text Available The dynamic disasters are aggravating with the increase of exploitation scale and intensity in Chinese coal mines, to further understand this problem, we studied the mechanisms of mining tremors induced by key strata movement and instability under large scale exploitation. First the mechanisms were categorized into two groups that is main key strata fracture and movement as well as subkey strata instability again under adjacent mining activities. Based on the key strata theory in ground control we revealed three basic mechanisms of key strata destabilization that are rotary and sliding of low subkey strata, shear sliding of the high subkey strata, and the main key strata rupture and cave at limit span, respectively. The microseismic observing systems were applied to monitor the mining tremor events and verify the theoretical analysis in different coal mines. The characteristics of time-space evolution of tremors show that low inferior key strata causing the most, followed by the high inferior key strata and the main key strata least, however the released energy was just opposite.

  15. An investigation of the mechanical behavior of initially curved microplates under electrostatic actuation

    KAUST Repository

    Saghir, Shahid

    2018-03-28

    In this article, we investigate the mechanical behavior of initially curved microplates under electrostatic actuation. Microplates are essential components of many Micro-Electro-Mechanical System devices; however, they commonly undergo an initial curvature imperfection, due to the microfabrication process. Initial curvature imperfection significantly affects the mechanical behavior of microplates. In this work, we derive a dynamic analogue of the von Kármán governing equation for such plates. These equations are then used to develop a reduced order model based on the Galerkin procedure to simulate the static and dynamic behavior of the microplate. Two profiles of initial curvature commonly encountered in microfabricated structures are considered, where one assumes a variation in shape along one dimension of the plate only (cylindrical bending shape) while the other assumes a variation in shape along both dimensions of the plate. Their effects on both the static and dynamic responses of the microplates are examined and compared. We validate the reduced order model by comparing the calculated static behavior and the fundamental natural frequency with those computed by a finite element model over a range of the initial plate rise. The static behavior of the microplate is investigated when varying the DC voltage. Then, the dynamic behavior of the microplate is examined under the application of a harmonic AC voltage superimposed to a DC voltage.

  16. Music and literature: are there shared empathy and predictive mechanisms underlying their affective impact?

    Directory of Open Access Journals (Sweden)

    Diana eOmigie

    2015-08-01

    Full Text Available It has been suggested that music and language had a shared evolutionary precursor before becoming mainly responsible for the communication of emotive and referential meaning respectively. However, emphasis on potential differences between music and language may discourage a consideration of the commonalities that music and literature share. Indeed, one possibility is that common mechanisms underlie their affective impact, and the current paper carefully reviews relevant neuroscientific findings to examine such a prospect. First and foremost, it will be demonstrated that considerable evidence of a common role of empathy and predictive processes now exists for the two domains. However, it will also be noted that an important open question remains: namely, whether the mechanisms underlying the subjective experience of uncertainty differ between the two with respect to recruitment of phylogenetically ancient emotion areas. It will be concluded that a comparative approach may not only help to reveal general mechanisms underlying our responses to music and literature, but may also help us better understand any idiosyncrasies in their capacity for affective impact.

  17. The pathologic mechanisms underlying lumbar distraction spinal cord injury in rabbits.

    Science.gov (United States)

    Wu, Di; Zheng, Chao; Wu, Ji; Xue, Jing; Huang, Rongrong; Wu, Di; Song, Yueming

    2017-11-01

    A reliable experimental rabbit model of distraction spinal cord injury (SCI) was established to successfully simulate gradable and replicable distraction SCI. However, further research is needed to elucidate the pathologic mechanisms underlying distraction SCI. The aim of this study was to investigate the pathologic mechanisms underlying lumbar distraction SCI in rabbits. This is an animal laboratory study. Using a self-designed spine distractor, the experimental animals were divided into a control group and 10%, 20%, and 30% distraction groups. Pathologic changes to the spinal cord microvessels in the early stage of distraction SCI were identified by perfusion of the spinal cord vasculature with ink, production of transparent specimens, observation by light microscopy, and observation of corrosion casts of the spinal cord microvascular architecture by scanning electron microscopy. Malondialdehyde (MDA) and superoxide dismutase (SOD) concentrations in the injured spinal cord tissue were measured after 8 hours. With an increasing degree and duration of distraction, the spinal cord microvessels were only partially filled and had the appearance of spasm until rupture and hemorrhage were observed. The MDA concentration increased and the SOD concentration decreased in the spinal cord tissue. Changes to the internal and external spinal cord vessels led to spinal cord ischemia, which is a primary pathologic mechanism of distraction SCI. Lipid peroxidation mediated by free radicals took part in secondary pathologic damage of distraction SCI. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Linear Analytical Solutions of Mechanical Sensitivity in Large Deflection of Unsymmetrically Layered Piezoelectric Plate under Pretension

    Directory of Open Access Journals (Sweden)

    Chun-Fu Chen

    2014-03-01

    Full Text Available Linear analytical study on the mechanical sensitivity in large deflection of unsymmetrically layered and laterally loaded piezoelectric plate under pretension is conducted. von Karman plate theory for large deflection is utilized but extended to the case of an unsymmetrically layered plate embedded with a piezoelectric layer. The governing equations thus obtained are simplified by omitting the arising nonlinear terms, yielding a Bessel or modified Bessel equation for the lateral slope. Depending on the relative magnitude of the piezoelectric effect, for both cases, analytical solutions of various geometrical responses are developed and formulated via Bessel and modified Bessel functions. The associated ultimate radial stresses are further derived following lamina constitutive law to evaluate the mechanical sensitivity of the considered plate. For a nearly monolithic plate under a very low applied voltage, the results are in good agreement with those for a single-layered case due to pure mechanical load available in literature, and thus the present approach is checked. For a two-layered unsymmetric plate made of typical silicon-based materials, a sound piezoelectric effect is illustrated particularly in a low pretension condition.

  19. Cellular and deafness mechanisms underlying connexin mutation induced hearing loss – A common hereditary deafness

    Directory of Open Access Journals (Sweden)

    Jeffrey C Wingard

    2015-05-01

    Full Text Available Hearing loss due to mutations in the connexin gene family which encodes gap junctional proteins is a common form of hereditary deafness. In particular, connexin 26 (Cx26, GJB2 mutations are responsible for ~50% of nonsyndromic hearing loss, which is the highest incidence of genetic disease. In the clinic, Cx26 mutations cause various auditory phenotypes ranging from profound congenital deafness at birth to mild, progressive hearing loss in late childhood. Recent experiments demonstrate that congenital deafness mainly results from cochlear developmental disorders rather than hair cell degeneration and endocochlear potential (EP reduction, while late-onset hearing loss results from reduction of active cochlear amplification, even though cochlear hair cells have no connexin expression. Moreover, new experiments further demonstrate that the hypothesized K+-recycling disruption is not a principal deafness mechanism for connexin deficiency induced hearing loss. Additionally, there is no clear relationship between specific changes in connexin (channel functions and the phenotypes of mutation-induced hearing loss. Cx30, Cx29, Cx31, and Cx43 mutations can also cause hearing loss with distinct pathological changes in the cochlea. These new studies provide invaluable information about deafness mechanisms underlying connexin mutation induced hearing loss and also provide important information for developing new protective and therapeutic strategies for this common deafness. However, the detailed cellular mechanisms underlying these pathological changes and pathogeneses of specific-mutation induced hearing loss remain unclear. Finally, little information is available for humans. Further studies to address these deficiencies are urgently required.

  20. Mechanism Underlying the Spatial Pattern Formation of Dominant Tree Species in a Natural Secondary Forest.

    Directory of Open Access Journals (Sweden)

    Guodong Jia

    Full Text Available Studying the spatial pattern of plant species may provide significant insights into processes and mechanisms that maintain stand stability. To better understand the dynamics of naturally regenerated secondary forests, univariate and bivariate Ripley's L(r functions were employed to evaluate intra-/interspecific relationships of four dominant tree species (Populus davidiana, Betula platyphylla, Larix gmelinii and Acer mono and to distinguish the underlying mechanism of spatial distribution. The results showed that the distribution of soil, water and nutrients was not fragmented but presented clear gradients. An overall aggregated distribution existed at most distances. No correlation was found between the spatial pattern of soil conditions and that of trees. Both positive and negative intra- and interspecific relationships were found between different DBH classes at various distances. Large trees did not show systematic inhibition of the saplings. By contrast, the inhibition intensified as the height differences increased between the compared pairs. Except for Larix, universal inhibition of saplings by upper layer trees occurred among other species, and this reflected the vertical competition for light. Therefore, we believe that competition for light rather than soil nutrients underlies the mechanism driving the formation of stand spatial pattern in the rocky mountainous areas examined.

  1. Ablation characteristics and reaction mechanism of insulation materials under slag deposition condition

    Science.gov (United States)

    Guan, Yiwen; Li, Jiang; Liu, Yang

    2017-07-01

    Current understanding of the physical and chemical processes involved in the ablation of insulation materials by highly aluminized solid propellants is limited. The study on the heat transfer and ablation principle of ethylene propylene diene monomer (EPDM) materials under slag deposition condition is essential for future design or modification of large solid rocket motors (SRMs) for launch application. In this paper, the alumina liquid flow pattern and the deposition principle in full-scale SRM engines are discussed. The interaction mechanism between the alumina droplets and the wall are analyzed. Then, an experimental method was developed to simulate the insulation material ablation under slag deposition condition. Experimental study was conducted based on a laboratory-scale device. Meanwhile, from the analysis of the cross-sectional morphology and chemical composition of the charring layer after ablation, the reaction mechanism of the charring layer under deposition condition was discussed, and the main reaction equation was derived. The numerical simulation and experimental results show the following. (i) The alumina droplet flow in the deposition section of the laboratory-scale device is similar to that of a full-scale SRM. (ii) The charring layer of the EPDM insulator displays a porous tight/loose structure under high-temperature slag deposition condition. (iii) A seven-step carbothermal reduction in the alumina is derived and established under high-pressure and high-temperature environment in the SRM combustion chamber. (iv) The analysis using thermodynamic software indicates that the reaction of the alumina and charring layer initially forms Al4C3 during the operation. Then, Al element and Al2OC compound are subsequently produced with the reduction in the release of gas CO as well with continuous environmental heating.

  2. Neuronal mechanisms underlying differences in spatial resolution between darks and lights in human vision.

    Science.gov (United States)

    Pons, Carmen; Mazade, Reece; Jin, Jianzhong; Dul, Mitchell W; Zaidi, Qasim; Alonso, Jose-Manuel

    2017-12-01

    Artists and astronomers noticed centuries ago that humans perceive dark features in an image differently from light ones; however, the neuronal mechanisms underlying these dark/light asymmetries remained unknown. Based on computational modeling of neuronal responses, we have previously proposed that such perceptual dark/light asymmetries originate from a luminance/response saturation within the ON retinal pathway. Consistent with this prediction, here we show that stimulus conditions that increase ON luminance/response saturation (e.g., dark backgrounds) or its effect on light stimuli (e.g., optical blur) impair the perceptual discrimination and salience of light targets more than dark targets in human vision. We also show that, in cat visual cortex, the magnitude of the ON luminance/response saturation remains relatively constant under a wide range of luminance conditions that are common indoors, and only shifts away from the lowest luminance contrasts under low mesopic light. Finally, we show that the ON luminance/response saturation affects visual salience mostly when the high spatial frequencies of the image are reduced by poor illumination or optical blur. Because both low luminance and optical blur are risk factors in myopia, our results suggest a possible neuronal mechanism linking myopia progression with the function of the ON visual pathway.

  3. Mechanisms of weight maintenance under high- and low-protein, low-glycaemic index diets.

    Science.gov (United States)

    Rubio-Aliaga, Isabel; Marvin-Guy, Laure F; Wang, Ping; Wagniere, Sandrine; Mansourian, Robert; Fuerholz, Andreas; Saris, Wim H M; Astrup, Arne; Mariman, Edwin C M; Kussmann, Martin

    2011-11-01

    Weight maintenance after intended weight loss is a challenge in an obesogenic environment. In a large multicentre dietary intervention study (DiOGenes), it has recently been demonstrated that a high-protein/low-glycaemic index (HP/LGI) diet was slightly more efficient in maintaining weight loss than low-protein/LGI or high-GI (LP/LGI or HGI) diets. Here, we use a proteomic approach to assess the molecular mechanisms behind this positive effect. A subset of the most successful (weight loser, n=12) and unsuccessful (weight re-gainer, n=12) individuals consuming the LGI diets with either high- or low-protein content (HP or LP/LGI), following an initial calorie deficit run-in weight loss phase, were analyzed at the plasma protein level. Proteomic analysis revealed 18 proteins regulated after 6 months of the dietary weight maintenance phase. Furthermore, 12 proteins were significantly regulated as a function of success rate under an HP diet, arising as candidate biomarkers of mechanisms of successful weight maintenance under an HP/LGI diet. Pregnancy-zone protein (PZP) and protein S (PROS1) were revealed as novel biomarkers of weight maintenance showing opposite effects. Semantic network analysis of the 12 regulated proteins revealed that under an HP/LGI an anti-atherogenic effect and alterations of fat metabolism were associated with the success of maintaining the initial weight loss. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Mechanical properties and fracture behaviour of defective phosphorene nanotubes under uniaxial tension

    Science.gov (United States)

    Liu, Ping; Pei, Qing-Xiang; Huang, Wei; Zhang, Yong-Wei

    2017-12-01

    The easy formation of vacancy defects and the asymmetry in the two sublayers of phosphorene nanotubes (PNTs) may result in brand new mechanical properties and failure behaviour. Herein, we investigate the mechanical properties and fracture behaviour of defective PNTs under uniaxial tension using molecular dynamics simulations. Our simulation results show that atomic vacancies cause local stress concentration and thus significantly reduce the fracture strength and fracture strain of PNTs. More specifically, a 1% defect concentration is