WorldWideScience

Sample records for underlie voltage-dependent calcium

  1. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  2. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  3. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  4. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  5. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  6. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef

    2009-01-01

    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  7. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  8. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  9. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  10. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  11. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  12. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  13. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  14. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  15. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  16. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  17. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  18. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  19. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  20. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  1. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  2. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  3. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  4. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  5. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  6. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  7. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  8. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  9. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  10. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  11. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  12. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  13. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  14. Calcium

    Science.gov (United States)

    ... You can get decent amounts of calcium from baked beans, navy beans, white beans, and others. Canned fish. You're in luck if you like sardines and canned salmon with bones. Almond milk. Working Calcium Into Your ...

  15. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  16. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  17. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  18. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  19. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  20. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  1. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  2. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  3. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  4. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  5. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  6. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  7. Inhibition of large conductance calcium-dependent potassium ...

    African Journals Online (AJOL)

    conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

  8. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  9. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  10. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  11. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  12. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  13. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  14. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  15. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  16. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  17. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  18. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  19. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  20. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  1. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  2. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  3. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  4. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  5. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  6. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  7. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  8. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  9. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  10. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  11. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  12. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  13. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  15. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  16. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  17. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  18. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  19. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  1. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  2. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  3. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  4. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  5. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  6. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  7. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  8. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  9. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  10. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  12. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  13. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Bone morphogenetic protein 4 inhibits insulin secretion from rodent beta cells through regulation of calbindin1 expression and reduced voltage-dependent calcium currents

    DEFF Research Database (Denmark)

    Christensen, Gitte L.; Jacobsen, Maria L. B.; Wendt, Anna

    2015-01-01

    AIMS/HYPOTHESIS: Type 2 diabetes is characterised by progressive loss of pancreatic beta cell mass and function. Therefore, it is of therapeutic interest to identify factors with the potential to improve beta cell proliferation and insulin secretion. Bone morphogenetic protein 4 (BMP4) expression...

  15. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  16. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  17. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  18. Blood flow patterns underlie developmental heart defects.

    Science.gov (United States)

    Midgett, Madeline; Thornburg, Kent; Rugonyi, Sandra

    2017-03-01

    Although cardiac malformations at birth are typically associated with genetic anomalies, blood flow dynamics also play a crucial role in heart formation. However, the relationship between blood flow patterns in the early embryo and later cardiovascular malformation has not been determined. We used the chicken embryo model to quantify the extent to which anomalous blood flow patterns predict cardiac defects that resemble those in humans and found that restricting either the inflow to the heart or the outflow led to reproducible abnormalities with a dose-response type relationship between blood flow stimuli and the expression of cardiac phenotypes. Constricting the outflow tract by 10-35% led predominantly to ventricular septal defects, whereas constricting by 35-60% most often led to double outlet right ventricle. Ligation of the vitelline vein caused mostly pharyngeal arch artery malformations. We show that both cardiac inflow reduction and graded outflow constriction strongly influence the development of specific and persistent abnormal cardiac structure and function. Moreover, the hemodynamic-associated cardiac defects recapitulate those caused by genetic disorders. Thus our data demonstrate the importance of investigating embryonic blood flow conditions to understand the root causes of congenital heart disease as a prerequisite to future prevention and treatment. NEW & NOTEWORTHY Congenital heart defects result from genetic anomalies, teratogen exposure, and altered blood flow during embryonic development. We show here a novel "dose-response" type relationship between the level of blood flow alteration and manifestation of specific cardiac phenotypes. We speculate that abnormal blood flow may frequently underlie congenital heart defects. Copyright © 2017 the American Physiological Society.

  19. Calcium supplements

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007477.htm Calcium supplements To use the sharing features on this page, please enable JavaScript. WHO SHOULD TAKE CALCIUM SUPPLEMENTS? Calcium is an important mineral for the ...

  20. The effect of calcium on auxin depletion-induced tomato ...

    African Journals Online (AJOL)

    Indole-3-acetic acid (IAA) and calcium are the most important factors that instigate plant organ abscission. This study aimed to elucidate the mechanisms that underlie the effects of IAA and calcium on delayed abscission in tomato. The results showed a clear trend towards reduced abscission rates with increased ...

  1. Calcium absorption

    International Nuclear Information System (INIS)

    Carlmark, B.; Reizenstein, P.; Dudley, R.A.

    1976-01-01

    The methods most commonly used to measure the absorption and retention of orally administered calcium are reviewed. Nearly all make use of calcium radioisotopes. The magnitude of calcium absorption and retention depends upon the chemical form and amount of calcium administered, and the clinical and nutritional status of the subject; these influences are briefly surveyed. (author)

  2. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  3. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  4. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  5. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  6. Calcium - ionized

    Science.gov (United States)

    ... diuretics Thrombocytosis (high platelet count) Tumors Vitamin A excess Vitamin D excess Lower-than-normal levels may be due to: Hypoparathyroidism Malabsorption Osteomalacia Pancreatitis Renal failure Rickets Vitamin D deficiency Alternative Names Free calcium; Ionized calcium ...

  7. Calcium Carbonate

    Science.gov (United States)

    ... Calcium is needed by the body for healthy bones, muscles, nervous system, and heart. Calcium carbonate also ... to your pharmacist or contact your local garbage/recycling department to learn about take-back programs in ...

  8. Calcium regulates caveolin-1 expression at the transcriptional level

    International Nuclear Information System (INIS)

    Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

    2012-01-01

    Highlights: ► Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. ► An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. ► Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. ► Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca 2+ /calcineurin/NFAT.

  9. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  11. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  13. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  14. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  15. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  16. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  17. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  18. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  19. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  20. The distribution of free calcium ions in the cholesteatoma epithelium

    DEFF Research Database (Denmark)

    Svane-Knudsen, Viggo; Rasmussen, Gurli; Ottosen, Peter D

    2005-01-01

    The distribution of free calcium ions in normal skin and cholesteatoma epithelium was investigated using the oxalate precipitation method. In agreement with previous observations, we could demonstrate a calcium ion gradient in normal epidermis where the cells in stratum basale and spinosum reside...... appeared where oblong accumulations of free calcium ions were found basally in the stratum. These findings provide evidence that fluctuations in epidermal calcium in cholesteatoma epithelium may underlie the abnormal desquamation, may contribute to the formation of an abnormal permeability barrier and may...

  1. Calcium waves.

    Science.gov (United States)

    Jaffe, Lionel F

    2008-04-12

    Waves through living systems are best characterized by their speeds at 20 degrees C. These speeds vary from those of calcium action potentials to those of ultraslow ones which move at 1-10 and/or 10-20 nm s(-1). All such waves are known or inferred to be calcium waves. The two classes of calcium waves which include ones with important morphogenetic effects are slow waves that move at 0.2-2 microm s(-1) and ultraslow ones. Both may be propagated by cycles in which the entry of calcium through the plasma membrane induces subsurface contraction. This contraction opens nearby stretch-sensitive calcium channels. Calcium entry through these channels propagates the calcium wave. Many slow waves are seen as waves of indentation. Some are considered to act via cellular peristalsis; for example, those which seem to drive the germ plasm to the vegetal pole of the Xenopus egg. Other good examples of morphogenetic slow waves are ones through fertilizing maize eggs, through developing barnacle eggs and through axolotl embryos during neural induction. Good examples of ultraslow morphogenetic waves are ones during inversion in developing Volvox embryos and across developing Drosophila eye discs. Morphogenetic waves may be best pursued by imaging their calcium with aequorins.

  2. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  3. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  4. Regulation of granule cell excitability by a low-threshold calcium spike in turtle olfactory bulb

    DEFF Research Database (Denmark)

    Pinato, Giulietta; Midtgaard, Jens

    2003-01-01

    of the cell usually increased their amplitude so that they more easily boosted Na spike initiation. The LTS persisted in the presence of TTX but was antagonized by blockers of T-type calcium channels. The voltage dependence, kinetics, and inactivation properties of the LTS were characteristic of a low......-threshold calcium spike. The threshold of the LTS was slightly above the resting potential but well below the Na spike threshold, and the LTS was often evoked in isolation in normal medium. Tetraethylammonium (TEA) and 4-aminopyridine (4-AP) had only minimal effects on the LTS but revealed the presence of a high...

  5. Calcium Electroporation

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; Gibot, Laure; Madi, Moinecha

    2015-01-01

    BACKGROUND: Calcium electroporation describes the use of high voltage electric pulses to introduce supraphysiological calcium concentrations into cells. This promising method is currently in clinical trial as an anti-cancer treatment. One very important issue is the relation between tumor cell kill...... efficacy-and normal cell sensitivity. METHODS: Using a 3D spheroid cell culture model we have tested the effect of calcium electroporation and electrochemotherapy using bleomycin on three different human cancer cell lines: a colorectal adenocarcinoma (HT29), a bladder transitional cell carcinoma (SW780......), and a breast adenocarcinoma (MDA-MB231), as well as on primary normal human dermal fibroblasts (HDF-n). RESULTS: The results showed a clear reduction in spheroid size in all three cancer cell spheroids three days after treatment with respectively calcium electroporation (p

  6. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  7. Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro

    International Nuclear Information System (INIS)

    Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.

    1989-01-01

    The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)

  8. Get Enough Calcium

    Science.gov (United States)

    ... Calcium Print This Topic En español Get Enough Calcium Browse Sections The Basics Overview Foods and Vitamins ... women, don't get enough calcium. How much calcium do I need every day? Women: If you ...

  9. Calcium - urine

    Science.gov (United States)

    ... Female urinary tract Male urinary tract Calcium urine test References Bringhurst FR, Demay MB, Kronenberg HM. Hormones and disorders of mineral metabolism. In: Melmed S, Polonsky KS, Larsen PR, Kronenberg HM, eds. Williams Textbook of Endocrinology . 13th ed. Philadelphia, PA: Elsevier; ...

  10. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  11. Neural Tuning Functions Underlie Both Generalization and Interference.

    Directory of Open Access Journals (Sweden)

    Ian S Howard

    Full Text Available In sports, the role of backswing is considered critical for generating a good shot, even though it plays no direct role in hitting the ball. We recently demonstrated the scientific basis of this phenomenon by showing that immediate past movement affects the learning and recall of motor memories. This effect occurred regardless of whether the past contextual movement was performed actively, passively, or shown visually. In force field studies, it has been shown that motor memories generalize locally and that the level of compensation decays as a function of movement angle away from the trained movement. Here we examine if the contextual effect of past movement exhibits similar patterns of generalization and whether it can explain behavior seen in interference studies. Using a single force-field learning task, the directional tuning curves of both the prior contextual movement and the subsequent force field adaptive movements were measured. The adaptation movement direction showed strong directional tuning, decaying to zero by 90° relative to the training direction. The contextual movement direction exhibited a similar directional tuning, although the effect was always above 60%. We then investigated the directional tuning of the passive contextual movement using interference tasks, where the contextual movements that uniquely specified the force field direction were separated by ±15° or ±45°. Both groups showed a pronounced tuning effect, which could be well explained by the directional tuning functions for single force fields. Our results show that contextual effect of past movement influences predictive force compensation, even when adaptation does not require contextual information. However, when such past movement contextual information is crucial to the task, such as in an interference study, it plays a strong role in motor memory learning and recall. This work demonstrates that similar tuning responses underlie both generalization of

  12. Kv4 channels underlie the subthreshold-operating A-type K+-current in nociceptive dorsal root ganglion neurons

    Directory of Open Access Journals (Sweden)

    Thanawath R Na Phuket

    2009-07-01

    Full Text Available The dorsal root ganglion (DRG contains heterogeneous populations of sensory neurons including primary nociceptive neurons and C-fibers implicated in pain signaling.  Recent studies have demonstrated DRG hyperexcitability associated with downregulation of A-type K+ channels; however, the molecular correlate of the corresponding A-type K+ current (IA has remained hypothetical.  Kv4 channels may underlie the IA in DRG neurons.  We combined electrophysiology, molecular biology (whole-tissue and single-cell RT-PCR and immunohistochemistry to investigate the molecular basis of the IA in acutely dissociated DRG neurons from 7-8 day-old rats.  Whole-cell recordings demonstrate a robust tetraethylammonium-resistant (20 mM and 4-aminopyridine-sensitive (5 mM IA.  Matching Kv4 channel properties, activation and inactivation of this IA occur in the subthreshold range of membrane potentials and the rate of recovery from inactivation is rapid and voltage-dependent.  Among Kv4 transcripts, the DRG expresses significant levels of Kv4.1 and Kv4.3 mRNAs.  Also, single small-medium diameter DRG neurons (~30 mm exhibit correlated frequent expression of mRNAs encoding Kv4.1 and Nav1.8, a known nociceptor marker.  In contrast, the expressions of Kv1.4 and Kv4.2 mRNAs at the whole-tissue and single-cell levels are relatively low and infrequent.  Kv4 protein expression in nociceptive DRG neurons was confirmed by immunohistochemistry, which demonstrates colocalization of Kv4.3 and Nav1.8, and negligible expression of Kv4.2.  Furthermore, specific dominant-negative suppression and overexpression strategies confirmed the contribution of Kv4 channels to IA in DRG neurons.  Contrasting the expression patterns of Kv4 channels in the central and peripheral nervous systems, we discuss possible functional roles of these channels in primary sensory neurons.

  13. Calcium paradox and calcium entry blockers

    NARCIS (Netherlands)

    Ruigrok, T.J.C.; Slade, A.M.; Nayler, W.G.; Meijler, F.L.

    1984-01-01

    Reperfusion of isolated hearts with calcium-containing solution after a short period of calcium-free perfusion results in irreversible cell damage (calcium paradox). This phenomenon is characterized by an excessive influx of calcium into the cells, the rapid onset of myocardial contracture,

  14. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  15. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  16. Calcium blood test

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003477.htm Calcium blood test To use the sharing features on this page, please enable JavaScript. The calcium blood test measures the level of calcium in the blood. ...

  17. Calcium source (image)

    Science.gov (United States)

    Getting enough calcium to keep bones from thinning throughout a person's life may be made more difficult if that person has ... as a tendency toward kidney stones, for avoiding calcium-rich food sources. Calcium deficiency also effects the ...

  18. Calcium Pyrophosphate Deposition (CPPD)

    Science.gov (United States)

    ... Patient / Caregiver Diseases & Conditions Calcium Pyrophosphate Deposition (CPPD) Calcium Pyrophosphate Deposition (CPPD) Fast Facts The risk of ... young people, too. Proper diagnosis depends on detecting calcium pyrophosphate crystals in the fluid of an affected ...

  19. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Products that contain calcium carbonate are certain: Antacids (Tums, Chooz) Mineral supplements Hand lotions Vitamin and mineral supplements Other products may also contain ...

  20. Calcium and bones (image)

    Science.gov (United States)

    Calcium is one of the most important minerals for the growth, maintenance, and reproduction of the human ... body, are continually being re-formed and incorporate calcium into their structure. Calcium is essential for the ...

  1. Calcium hydroxide poisoning

    Science.gov (United States)

    Hydrate - calcium; Lime milk; Slaked lime ... Calcium hydroxide ... These products contain calcium hydroxide: Cement Limewater Many industrial solvents and cleaners (hundreds to thousands of construction products, flooring strippers, brick cleaners, cement ...

  2. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  3. Calcium in Urine Test

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Calcium, Serum; Calcium and Phosphates, Urine; ...

  4. Transcellular transport of calcium

    Energy Technology Data Exchange (ETDEWEB)

    Terepka, A R; Coleman, J R; Armbrecht, H J; Gunter, T E

    1976-01-01

    Studies of two calcium transporting epithelia, embryonic chick chorioallantoic membrane and the small intestine of rat and chick, have strongly suggested that the transfer of calcium across a cell involves processes distinctly different from intracellular calcium ion regulation. In the proposed model, transcellular calcium transport is considered as a specialized process developed only by certain cells in those tissues charged with bulk transfer of calcium. The overall effect of the endocytotic mechanism is bulk calcium movement across a cell, protection of mitochondria from exposure to high concentrations of calcium, and the avoidance of wide and potentially toxic fluctuations in cytosol ionic calcium levels. (MFB)

  5. Activation of a cGMP-sensitive calcium-dependent chloride channel may cause transition from calcium waves to whole-cell oscillations in smooth muscle cells

    DEFF Research Database (Denmark)

    Jacobsen, Jens Christian; Aalkjær, Christian; Nilsson, Holger

    2007-01-01

    waves sweeping through the cytoplasm when the SR is stimulated to release calcium. A rise in cyclic guanosine monophosphate (cGMP) leads to the experimentally observed transition from waves to whole-cell calcium oscillations. At the same time membrane potential starts to oscillate and the frequency...... approximately doubles. In this transition, the simulated results point to a key role for a recently discovered cGMP-sensitive calcium-dependent chloride channel. This channel depolarizes the membrane in response to calcium released from the SR. In turn, depolarization causes uniform opening of L-type calcium...... onset of oscillations in membrane potential within the individual cell may underlie sudden intercellular synchronization and the appearance of vasomotion. Key words: Vasomotion, Chloride channel, cGMP, Mathematical model, Calcium waves....

  6. Calcium sensing in exocytosis

    DEFF Research Database (Denmark)

    Gustavsson, Natalia; Wu, Bingbing; Han, Weiping

    2012-01-01

    an increase in intracellular calcium levels. Besides the triggering role, calcium signaling modulates the precise amount and kinetics of vesicle release. Thus, it is a central question to understand the molecular machineries responsible for calcium sensing in exocytosis. Here we provide an overview of our...... current understanding of calcium sensing in neurotransmitter release and hormone secretion....

  7. Calcium fluoride

    International Nuclear Information System (INIS)

    King, C.W.; Nestor, O.H.

    1989-01-01

    A new process for producing large, single, oriented crystals of calcium fluoride (CaF 2 ) has been developed which overcomes the limitations of current growing methods. This process has been reduced to practice and has yielded oriented crystals 17.5 x 17.5 x 5 cm 3 . Currently nearing completion is a system for producing 35 x 35 x 7.5 cm 3 single crystals. A scale up to one-meter-square is considered feasible. This crystal growing process makes possible the fabrication of very large CaF 2 windows. Suitability for very high power lasers, however, requires attention to properties beyond mere size. A process to generate higher purity growth stock (starting material) was also developed. The additional purification of the growth stock contributes to lower bulk absorption, the absence of color centers and increased radiation hardness. Also identified were several specific impurities which correlate with radiation hardness. A correlation was found between color centers induced by laser radiation and ionizing radiation. Other CaF 2 crystal properties such as tensile strength, absorption and laser damage thresholds were studied and are discussed

  8. Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

    Science.gov (United States)

    Naranjo, David; Wen, Hua; Brehm, Paul

    2015-01-01

    The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

  9. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

    Science.gov (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

    2017-05-01

    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  10. Autonomous and Non-autonomous Defects Underlie Hypertrophic Cardiomyopathy in BRAF-Mutant hiPSC-Derived Cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Rebecca Josowitz

    2016-09-01

    Full Text Available Germline mutations in BRAF cause cardio-facio-cutaneous syndrome (CFCS, whereby 40% of patients develop hypertrophic cardiomyopathy (HCM. As the role of the RAS/MAPK pathway in HCM pathogenesis is unclear, we generated a human induced pluripotent stem cell (hiPSC model for CFCS from three patients with activating BRAF mutations. By cell sorting for SIRPα and CD90, we generated a method to examine hiPSC-derived cell type-specific phenotypes and cellular interactions underpinning HCM. BRAF-mutant SIRPα+/CD90− cardiomyocytes displayed cellular hypertrophy, pro-hypertrophic gene expression, and intrinsic calcium-handling defects. BRAF-mutant SIRPα−/CD90+ cells, which were fibroblast-like, exhibited a pro-fibrotic phenotype and partially modulated cardiomyocyte hypertrophy through transforming growth factor β (TGFβ paracrine signaling. Inhibition of TGFβ or RAS/MAPK signaling rescued the hypertrophic phenotype. Thus, cell autonomous and non-autonomous defects underlie HCM due to BRAF mutations. TGFβ inhibition may be a useful therapeutic option for patients with HCM due to RASopathies or other etiologies.

  11. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  12. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  13. Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro

    DEFF Research Database (Denmark)

    Rekling, J C; Feldman, J L

    1997-01-01

    Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro. J. Neurophysiol. 78: 2483-2492, 1997. The nucleus ambiguus contains vagal and glossopharyngeal motoneurons and preganglionic neurons involved in respiration, swallowing, vocalization......-stimulus orthodromic activation, using an electrode placed in the dorsomedial slice near the nucleus tractus solitarius, evoked single excitatory postsynaptic potentials (EPSPs) or short trains of EPSPs (500 ms to 1 s). However, tetanic stimulation (5 pulses, 10 Hz) induced voltage-dependent afterdepolarizations...

  14. Calcium and magnesium determination

    International Nuclear Information System (INIS)

    Bhattacharya, S.K.

    1982-01-01

    The roles of calcium and magnesium in human health and disease have been extensively studied. Calcium and magnesium have been determined in biological specimens by atomic absorption spectroscopy using stiochiometric nitrous oxide-acetylene flame

  15. Fenoprofen calcium overdose

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002649.htm Fenoprofen calcium overdose To use the sharing features on this page, please enable JavaScript. Fenoprofen calcium is a type of medicine called a nonsteroidal ...

  16. Calcium channel blocker overdose

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002580.htm Calcium-channel blocker overdose To use the sharing features on this page, please enable JavaScript. Calcium-channel blockers are a type of medicine used ...

  17. Calcium and Mitosis

    Science.gov (United States)

    Hepler, P.

    1983-01-01

    Although the mechanism of calcium regulation is not understood, there is evidence that calcium plays a role in mitosis. Experiments conducted show that: (1) the spindle apparatus contains a highly developed membrane system that has many characteristics of sarcoplasmic reticulum of muscle; (2) this membrane system contains calcium; and (3) there are ionic fluxes occurring during mitosis which can be seen by a variety of fluorescence probes. Whether the process of mitosis can be modulated by experimentally modulating calcium is discussed.

  18. Calcium en cardioplegie

    NARCIS (Netherlands)

    Ruigrok, T.J.C.; Meijler, F.L.

    1985-01-01

    Coronary perfusion with a calcium-free solution, followed by reperfusion with a calcium containing solution, may result in acute myocardial cell death and in irreversible loss of the e1ectrical and mechanical activity of the heart. This phenomenon is known as the calcium paradox. A number of

  19. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Calcium absorption and achlorhydria

    International Nuclear Information System (INIS)

    Recker, R.R.

    1985-01-01

    Defective absorption of calcium has been thought to exist in patients with achlorhydria. The author compared absorption of calcium in its carbonate form with that in a pH-adjusted citrate form in a group of 11 fasting patients with achlorhydria and in 9 fasting normal subjects. Fractional calcium absorption was measured by a modified double-isotope procedure with 0.25 g of calcium used as the carrier. Mean calcium absorption (+/- S.D.) in the patients with achlorhydria was 0.452 +/- 0.125 for citrate and 0.042 +/- 0.021 for carbonate (P less than 0.0001). Fractional calcium absorption in the normal subjects was 0.243 +/- 0.049 for citrate and 0.225 +/- 0.108 for carbonate (not significant). Absorption of calcium from carbonate in patients with achlorhydria was significantly lower than in the normal subjects and was lower than absorption from citrate in either group; absorption from citrate in those with achlorhydria was significantly higher than in the normal subjects, as well as higher than absorption from carbonate in either group. Administration of calcium carbonate as part of a normal breakfast resulted in completely normal absorption in the achlorhydric subjects. These results indicate that calcium absorption from carbonate is impaired in achlorhydria under fasting conditions. Since achlorhydria is common in older persons, calcium carbonate may not be the ideal dietary supplement

  1. Calcium channel blocker poisoning

    Directory of Open Access Journals (Sweden)

    Miran Brvar

    2005-04-01

    Full Text Available Background: Calcium channel blockers act at L-type calcium channels in cardiac and vascular smooth muscles by preventing calcium influx into cells with resultant decrease in vascular tone and cardiac inotropy, chronotropy and dromotropy. Poisoning with calcium channel blockers results in reduced cardiac output, bradycardia, atrioventricular block, hypotension and shock. The findings of hypotension and bradycardia should suggest poisoning with calcium channel blockers.Conclusions: Treatment includes immediate gastric lavage and whole-bowel irrigation in case of ingestion of sustainedrelease products. All patients should receive an activated charcoal orally. Specific treatment includes calcium, glucagone and insulin, which proved especially useful in shocked patients. Supportive care including the use of catecholamines is not always effective. In the setting of failure of pharmacological therapy transvenous pacing, balloon pump and cardiopulmonary by-pass may be necessary.

  2. The Marine Guanidine Alkaloid Crambescidin 816 Induces Calcium Influx and Cytotoxicity in Primary Cultures of Cortical Neurons through Glutamate Receptors.

    Science.gov (United States)

    Mendez, Aida G; Juncal, Andrea Boente; Silva, Siguara B L; Thomas, Olivier P; Martín Vázquez, Víctor; Alfonso, Amparo; Vieytes, Mercedes R; Vale, Carmen; Botana, Luís M

    2017-07-19

    Crambescidin 816 is a guanidine alkaloid produced by the sponge Crambe crambe with known antitumoral activity. While the information describing the effects of this alkaloid in central neurons is scarce, Cramb816 is known to block voltage dependent calcium channels being selective for L-type channels. Moreover, Cramb816 reduced neuronal viability through an unknown mechanism. Here, we aimed to describe the toxic activity of Cramb816 in cortical neurons. Since calcium influx is considered the main mechanism responsible for neuronal cell death, the effects of Cramb816 in the cytosolic calcium concentration of cortical neurons were studied. The alkaloid decreased neuronal viability and induced a dose-dependent increase in cytosolic calcium that was also related to the presence of calcium in the extracellular media. The increase in calcium influx was age dependent, being higher in younger neurons. Moreover, this effect was prevented by glutamate receptor antagonists, which did not fully block the cytotoxic effect of Cramb816 after 24 h of treatment but completely prevented Cramb816 cytotoxicity after 10 min exposure. Therefore, the findings presented herein provide new insights into the cytotoxic effect of Cramb816 in cortical neurons.

  3. Dengue and Calcium

    OpenAIRE

    Shivanthan, Mitrakrishnan C; Rajapakse, Senaka

    2014-01-01

    Dengue is potentially fatal unless managed appropriately. No specific treatment is available and the mainstay of treatment is fluid management with careful monitoring, organ support, and correction of metabolic derangement. Evidence with regards to the role of calcium homeostasis in dengue is limited. Low blood calcium levels have been demonstrated in dengue infection and hypocalcemia maybe more pronounced in more severe forms. The cause of hypocalcemia is likely to be multifactorial. Calcium...

  4. Calcium Channel Blockers

    Science.gov (United States)

    ... Certain calcium channel blockers interact with grapefruit products. Kaplan NM, et al. Treatment of hypertension: Drug therapy. In: Kaplan's Clinical Hypertension. 11th ed. Philadelphia, Pa.: Wolters Kluwer ...

  5. Effect of HeNe laser on calcium signals in sperm cells

    Science.gov (United States)

    Lubart, Rachel; Friedmann, Harry; Cohen, Natalie; Brietbart, Haim

    1998-12-01

    Irradiation of mouse spermatozoa by 630 nm HeNe laser was found to enhance calcium transport in these cells. The change in Ca transport was investigated through two approaches, the first employing the fluorescent Ca indicator, Fluo-3 AM and a fluorescence microscopic system, and the second the radiolabeled Ca uptake. In both approaches the effect of light on Ca transport was abrogated in the absence of Ca during the irradiation time, indicating that the effect of light is Ca-dependent. The stimulatory effect of light on Ca uptake was inhibited by treatment with catalase, suggesting H2O2 to be involved in light stimulated Ca2+ uptake. The stimulatory effect of light on Ca uptake was abolished in the presence of a voltage-dependent Ca-channel inhibitor, nifedipine, indicating the involvement of a plasma membrane, voltage- dependent Ca-channel. In contrast, addition of nifedipine prior to the HeNe laser irradiation did not affect the light-induced rise in intracellular Ca levels, as measured with Fluo-3 loaded sperm cells. Therefore, it can be concluded that this Ca influx occurs via a voltage- insensitive Ca-channel. The stimulatory effect of light on Ca uptake was almost completely abolished by the mitochondrial uncoupler FCCP. These data imply that light affects the mitochondrial Ca transport mechanisms. It is well known that Ca influx from an extracellular environment is an essential component of a signaling cascade leading to fertilization.

  6. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    Science.gov (United States)

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  7. Acidosis and Urinary Calcium Excretion

    DEFF Research Database (Denmark)

    Alexander, R Todd; Cordat, Emmanuelle; Chambrey, Régine

    2016-01-01

    Metabolic acidosis is associated with increased urinary calcium excretion and related sequelae, including nephrocalcinosis and nephrolithiasis. The increased urinary calcium excretion induced by metabolic acidosis predominantly results from increased mobilization of calcium out of bone and inhibi...

  8. Calcium D-saccharate

    DEFF Research Database (Denmark)

    Garcia, André Castilho; Hedegaard, Martina Vavrusova; Skibsted, Leif Horsfelt

    2016-01-01

    Molar conductivity of saturated aqueous solutions of calcium d-saccharate, used as a stabilizer of beverages fortified with calcium d-gluconate, increases strongly upon dilution, indicating complex formation between calcium and d-saccharate ions, for which, at 25 °C, Kassoc = 1032 ± 80, ΔHassoc......° = -34 ± 6 kJ mol-1, and ΔSassoc° = -55 ± 9 J mol-1 K-1, were determined electrochemically. Calcium d-saccharate is sparingly soluble, with a solubility product, Ksp, of (6.17 ± 0.32) × 10-7 at 25 °C, only moderately increasing with the temperature: ΔHsol° = 48 ± 2 kJ mol-1, and ΔSassoc° = 42 ± 7 J mol-1...... K-1. Equilibria in supersaturated solutions of calcium d-saccharate seem only to adjust slowly, as seen from calcium activity measurements in calcium d-saccharate solutions made supersaturated by cooling. Solutions formed by isothermal dissolution of calcium d-gluconate in aqueous potassium d...

  9. Calcium metabolism in birds.

    Science.gov (United States)

    de Matos, Ricardo

    2008-01-01

    Calcium is one of the most important plasma constituents in mammals and birds. It provides structural strength and support (bones and eggshell) and plays vital roles in many of the biochemical reactions in the body. The control of calcium metabolism in birds is highly efficient and closely regulated in a number of tissues, primarily parathyroid gland, intestine, kidney, and bone. The hormones with the greatest involvement in calcium regulation in birds are parathyroid hormone, 1,25-dihydroxyvitamin D(3) (calcitriol), and estrogen, with calcitonin playing a minor and uncertain role. The special characteristics of calcium metabolism in birds, mainly associated with egg production, are discussed, along with common clinical disorders secondary to derangements in calcium homeostasis.

  10. Acute Cocaine Exposure elicits rises in calcium in Arousal Related Laterodorsal Tegmental Neurons

    DEFF Research Database (Denmark)

    Lambert, Mads; Ipsen, Theis; Kohlmeier, Kristi Anne

    2017-01-01

    Cocaine has strong reinforcing properties, which underlie its high addiction potential. Reinforcement of use of addictive drugs is associated with rises in dopamine (DA) in mesoaccumbal circuitry. Excitatory afferent input to mesoaccumbal circuitry sources from the laterodorsal tegmental nucleus...... (LDT). Chronic, systemic cocaine exposure has been shown to have cellular effects on LDT cells, but acute actions of local application have never been demonstrated. Using calcium imaging, we show that acute application of cocaine to mouse brain slices induces calcium spiking in cells of the LDT....... Spiking was attenuated by tetrodotoxin (TTX) and low calcium solutions, and abolished by prior exhaustion of intracellular calcium stores. Further, DA receptor antagonists reduced these transients, whereas DA induced rises with similar spiking kinetics. Amphetamine, which also results in elevated levels...

  11. HYPERTHERMIA, INTRACELLULAR FREE CALCIUM AND CALCIUM IONOPHORES

    NARCIS (Netherlands)

    STEGE, GJJ; WIERENGA, PK; KAMPINGA, HH; KONINGS, AWT

    1993-01-01

    It is shown that heat-induced increase of intracellular calcium does not correlate with hyperthermic cell killing. Six different cell lines were investigated; in four (EAT, HeLa S3, L5178Y-R and L5178Y-S) heat treatments killing 90% of the cells did not affect the levels of intracellular free

  12. Recreational stimulants, herbal, and spice cannabis: The core psychobiological processes that underlie their damaging effects.

    Science.gov (United States)

    Parrott, Andrew C; Hayley, Amie C; Downey, Luke A

    2017-05-01

    Recreational drugs are taken for their positive mood effects, yet their regular usage damages well-being. The psychobiological mechanisms underlying these damaging effects will be debated. The empirical literature on recreational cannabinoids and stimulant drugs is reviewed. A theoretical explanation for how they cause similar types of damage is outlined. All psychoactive drugs cause moods and psychological states to fluctuate. The acute mood gains underlie their recreational usage, while the mood deficits on withdrawal explain their addictiveness. Cyclical mood changes are found with every central nervous system stimulant and also occur with cannabis. These mood state changes provide a surface index for more profound psychobiological fluctuations. Homeostatic balance is altered, with repetitive disturbances of the hypothalamic-pituitary-adrenal axis, and disrupted cortisol-neurohormonal secretions. Hence, these drugs cause increased stress, disturbed sleep, neurocognitive impairments, altered brain activity, and psychiatric vulnerability. Equivalent deficits occur with novel psychoactive stimulants such as mephedrone and artificial "spice" cannabinoids. These psychobiological fluctuations underlie drug dependency and make cessation difficult. Psychobiological stability and homeostatic balance are optimally restored by quitting psychoactive drugs. Recreational stimulants such as cocaine or MDMA (3.4-methylenedioxymethamphetamine) and sedative drugs such as cannabis damage human homeostasis and well-being through similar core psychobiological mechanisms. Copyright © 2017 John Wiley & Sons, Ltd.

  13. DIHYDROPYRIDINE CALCIUM- CHANNELBLOCKERSFOR ...

    African Journals Online (AJOL)

    Furthermore, the controversy over the role of calci~-channel blockers as first-line ..... group trials while fully accounting for placebo effects as well as interindividual ..... Reducing calcium overload in the ischemic brain. N Engl JMed. 1999; 341 ...

  14. Calcium and Your Child

    Science.gov (United States)

    ... calcium-set tofu edamame (soybeans) broccoli, collard greens, kale, chard, Chinese cabbage, and other leafy greens almonds ... more dark green, leafy vegetables (such as broccoli, kale, collard greens, or Chinese cabbage) with meals. Kids ...

  15. Calcium binding by dietary fibre

    International Nuclear Information System (INIS)

    James, W.P.T.; Branch, W.J.; Southgate, D.A.T.

    1978-01-01

    Dietary fibre from plants low in phytate bound calcium in proportion to its uronic-acid content. This binding by the non-cellulosic fraction of fibre reduces the availability of calcium for small-intestinal absorption, but the colonic microbial digestion of uronic acids liberates the calcium. Thus the ability to maintain calcium balance on high-fibre diets may depend on the adaptive capacity on the colon for calcium. (author)

  16. A model of propagating calcium-induced calcium release mediated by calcium diffusion

    NARCIS (Netherlands)

    Backx, P. H.; de Tombe, P. P.; van Deen, J. H.; Mulder, B. J.; ter Keurs, H. E.

    1989-01-01

    The effect of sudden local fluctuations of the free sarcoplasmic [Ca++]i in cardiac cells on calcium release and calcium uptake by the sarcoplasmic reticulum (SR) was calculated with the aid of a simplified model of SR calcium handling. The model was used to evaluate whether propagation of calcium

  17. [Calcium suppletion for patients who use gastric acid inhibitors: calcium citrate or calcium carbonate?].

    NARCIS (Netherlands)

    Jonge, H.J. de; Gans, R.O.; Huls, G.A.

    2012-01-01

    Various calcium supplements are available for patients who have an indication for calcium suppletion. American guidelines and UpToDate recommend prescribing calcium citrate to patients who use antacids The rationale for this advice is that water-insoluble calcium carbonate needs acid for adequate

  18. Receptor model for the molecular basis of tissue selectivity of 1,4-dihydropyridine calcium channel drugs

    Science.gov (United States)

    Langs, David A.; Strong, Phyllis D.; Triggle, David J.

    1990-09-01

    Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.

  19. Calcium in plant cells

    Directory of Open Access Journals (Sweden)

    V. V. Schwartau

    2014-04-01

    Full Text Available The paper gives the review on the role of calcium in many physiological processes of plant organisms, including growth and development, protection from pathogenic influences, response to changing environmental factors, and many other aspects of plant physiology. Initial intake of calcium ions is carried out by Ca2+-channels of plasma membrane and they are further transported by the xylem owing to auxins’ attractive ability. The level of intake and selectivity of calcium transport to ove-ground parts of the plant is controlled by a symplast. Ca2+enters to the cytoplasm of endoderm cells through calcium channels on the cortical side of Kaspary bands, and is redistributed inside the stele by the symplast, with the use of Ca2+-АТPases and Ca2+/Н+-antiports. Owing to regulated expression and activity of these calcium transporters, calclum can be selectively delivered to the xylem. Important role in supporting calcium homeostasis is given to the vacuole which is the largest depo of calcium. Regulated quantity of calcium movement through the tonoplast is provided by a number of potential-, ligand-gated active transporters and channels, like Ca2+-ATPase and Ca2+/H+ exchanger. They are actively involved in the inactivation of the calcium signal by pumping Ca2+ to the depo of cells. Calcium ATPases are high affinity pumps that efficiently transfer calcium ions against the concentration gradient in their presence in the solution in nanomolar concentrations. Calcium exchangers are low affinity, high capacity Ca2+ transporters that are effectively transporting calcium after raising its concentration in the cell cytosol through the use of protons gradients. Maintaining constant concentration and participation in the response to stimuli of different types also involves EPR, plastids, mitochondria, and cell wall. Calcium binding proteins contain several conserved sequences that provide sensitivity to changes in the concentration of Ca2+ and when you

  20. Sensorimotor simulations underlie conceptual representations: modality-specific effects of prior activation.

    Science.gov (United States)

    Pecher, Diane; Zeelenberg, René; Barsalou, Lawrence W

    2004-02-01

    According to the perceptual symbols theory (Barsalou, 1999), sensorimotor simulations underlie the representation of concepts. Simulations are componential in the sense that they vary with the context in which the concept is presented. In the present study, we investigated whether representations are affected by recent experiences with a concept. Concept names (e.g., APPLE) were presented twice in a property verification task with a different property on each occasion. The two properties were either from the same perceptual modality (e.g., green, shiny) or from different modalities (e.g., tart, shiny). All stimuli were words. There was a lag of several intervening trials between the first and second presentation. Verification times and error rates for the second presentation of the concept were higher if the properties were from different modalities than if they were from the same modality.

  1. Opponent appetitive-aversive neural processes underlie predictive learning of pain relief.

    Science.gov (United States)

    Seymour, Ben; O'Doherty, John P; Koltzenburg, Martin; Wiech, Katja; Frackowiak, Richard; Friston, Karl; Dolan, Raymond

    2005-09-01

    Termination of a painful or unpleasant event can be rewarding. However, whether the brain treats relief in a similar way as it treats natural reward is unclear, and the neural processes that underlie its representation as a motivational goal remain poorly understood. We used fMRI (functional magnetic resonance imaging) to investigate how humans learn to generate expectations of pain relief. Using a pavlovian conditioning procedure, we show that subjects experiencing prolonged experimentally induced pain can be conditioned to predict pain relief. This proceeds in a manner consistent with contemporary reward-learning theory (average reward/loss reinforcement learning), reflected by neural activity in the amygdala and midbrain. Furthermore, these reward-like learning signals are mirrored by opposite aversion-like signals in lateral orbitofrontal cortex and anterior cingulate cortex. This dual coding has parallels to 'opponent process' theories in psychology and promotes a formal account of prediction and expectation during pain.

  2. Protecting the Innocence of Youth: Moral Sanctity Values Underlie Censorship From Young Children.

    Science.gov (United States)

    Anderson, Rajen A; Masicampo, E J

    2017-11-01

    Three studies examined the relationship between people's moral values (drawing on moral foundations theory) and their willingness to censor immoral acts from children. Results revealed that diverse moral values did not predict censorship judgments. It was not the case that participants who valued loyalty and authority, respectively, sought to censor depictions of disloyal and disobedient acts. Rather, censorship intentions were predicted by a single moral value-sanctity. The more people valued sanctity, the more willing they were to censor from children, regardless of the types of violations depicted (impurity, disloyalty, disobedience, etc.). Furthermore, people who valued sanctity objected to indecent exposure only to apparently innocent and pure children-those who were relatively young and who had not been previously exposed to immoral acts. These data suggest that sanctity, purity, and the preservation of innocence underlie intentions to censor from young children.

  3. Activity of the anterior cingulate cortex and ventral hippocampus underlie increases in contextual fear generalization.

    Science.gov (United States)

    Cullen, Patrick K; Gilman, T Lee; Winiecki, Patrick; Riccio, David C; Jasnow, Aaron M

    2015-10-01

    Memories for context become less specific with time resulting in animals generalizing fear from training contexts to novel contexts. Though much attention has been given to the neural structures that underlie the long-term consolidation of a context fear memory, very little is known about the mechanisms responsible for the increase in fear generalization that occurs as the memory ages. Here, we examine the neural pattern of activation underlying the expression of a generalized context fear memory in male C57BL/6J mice. Animals were context fear conditioned and tested for fear in either the training context or a novel context at recent and remote time points. Animals were sacrificed and fluorescent in situ hybridization was performed to assay neural activation. Our results demonstrate activity of the prelimbic, infralimbic, and anterior cingulate (ACC) cortices as well as the ventral hippocampus (vHPC) underlie expression of a generalized fear memory. To verify the involvement of the ACC and vHPC in the expression of a generalized fear memory, animals were context fear conditioned and infused with 4% lidocaine into the ACC, dHPC, or vHPC prior to retrieval to temporarily inactivate these structures. The results demonstrate that activity of the ACC and vHPC is required for the expression of a generalized fear memory, as inactivation of these regions returned the memory to a contextually precise form. Current theories of time-dependent generalization of contextual memories do not predict involvement of the vHPC. Our data suggest a novel role of this region in generalized memory, which should be incorporated into current theories of time-dependent memory generalization. We also show that the dorsal hippocampus plays a prolonged role in contextually precise memories. Our findings suggest a possible interaction between the ACC and vHPC controls the expression of fear generalization. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Interactions of calcium homeostasis, acetylcholine metabolism, behavior and 3, 4-diaminopyridine during aging

    International Nuclear Information System (INIS)

    Gibson, G.E.; Peterson, C.

    1986-01-01

    Acetylcholine synthesis declines with aging in both whole brain and in various brain regions. Since neither enzyme activities nor acetylcholine concentrations, accurately reflect the dynamics of the cholinergic system, in vivo acetylcholine formation was measured. Incorporation of U-C 14-glucose of 2 H 4 choline into whole brain acetylcholine decreases from 100% (3 months) in two strains of mice. The diminished synthesis is apparently not due to a lack of precursor availability because U- C 14-glucose and 2 H 4 choline entry into the brain is similar at all ages. It is shown that altered brain calcium homeostasis during aging may underlie the deficits in acetylcholine metabolism, as well as those in behavior. Diminished calcium uptake during aging parallels the decline in the calcium dependent release of acetylcholine

  5. Calcium ferrite formation from the thermolysis of calcium tris (maleato)

    Indian Academy of Sciences (India)

    For preparing calcium ferrite, calcium tris (maleato) ferrate(III) precursor was prepared by mixing aqueous solutions of iron(III) maleate, calcium maleate and maleic acid. Various physico-chemical techniques i.e. TG, DTG, DTA, Mössbauer, XRD, IR etc have been used to study the decomposition behaviour from ambient to ...

  6. A sensor for calcium uptake

    Science.gov (United States)

    Collins, Sean; Meyer, Tobias

    2011-01-01

    Mitochondria — the cell’s power plants — increase their energy production in response to calcium signals in the cytoplasm. A regulator of the elusive mitochondrial calcium channel has now been identified. PMID:20844529

  7. Children's Bone Health and Calcium

    Science.gov (United States)

    ... Twitter Pinterest Email Print Children's Bone Health and Calcium: Condition Information What is bone health and how ... straight, walk, run, and lead an active life. Calcium is one of the key dietary building blocks ...

  8. Calcium – how and why?

    Indian Academy of Sciences (India)

    Unknown

    biological processes because of its unusual physical and chemical properties. 1. History of calcium ... cellular roles of calcium has established the importance of this ion ..... Ca2+ ion, for example in regulating enzyme activity (Price. 1975 ...

  9. Solar Imagery - Chromosphere - Calcium

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset consists of full-disk images of the sun in Calcium (Ca) II K wavelength (393.4 nm). Ca II K imagery reveal magnetic structures of the sun from about 500...

  10. Antenatal calcium intake in Malaysia.

    Science.gov (United States)

    Mahdy, Zaleha Abdullah; Basri, Hashimah; Md Isa, Zaleha; Ahmad, Shuhaila; Shamsuddin, Khadijah; Mohd Amin, Rahmah

    2014-04-01

    To determine the adequacy of antenatal calcium intake in Malaysia, and the influencing factors. A cross-sectional study was conducted among postnatal women who delivered in two tertiary hospitals. Data were collected from antenatal cards, hospital documents and diet recall on daily milk and calcium intake during pregnancy. SPSS version 19.0 was used for statistical analyses. A total of 150 women were studied. The total daily calcium intake was 834 ± 43 mg (mean ± standard error of the mean), but the calcium intake distribution curve was skewed to the right with a median intake of 725 mg daily. When calcium intake from milk and calcium supplements was excluded, the daily dietary calcium intake was only 478 ± 25 mg. Even with inclusion of milk and calcium supplements, more than a third (n=55 or 36.7%) of the women consumed less than 600 mg calcium in their daily diet. The adequacy of daily calcium intake was not influenced by maternal age, ethnicity, income or maternal job or educational status as well as parity. The daily dietary calcium intake of the Malaysian antenatal population is far from adequate without the addition of calcium supplements and milk. © 2013 The Authors. Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology.

  11. The Plasma Membrane Calcium Pump

    Science.gov (United States)

    Rasmussen, H.

    1983-01-01

    Three aspect of cellular calcium metabolism in animal cells was discussed including the importance of the plasma membrane in calcium homeostasis, experiments dealing with the actual mechanism of the calcium pump, and the function of the pump in relationship to the mitochondria and to the function of calmodulin in the intact cell.

  12. Planning-related motor processes underlie mental practice and imitation learning.

    Science.gov (United States)

    Bach, Patric; Allami, Bassem Khalaf; Tucker, Mike; Ellis, Rob

    2014-06-01

    It is still controversial whether mental practice-the internal rehearsal of movements to improve later performance-relies on processes engaged during physical motor performance and, if so, which processes these are. We report data from 5 experiments, in which participants mentally practiced complex rhythms with either feet or hands while using the same or different body parts to respond to unrelated sounds. We found that responses were impaired for those body parts that were concurrently used in mental practice, suggesting a binding of body-part-specific motor processes to action plans. This result was found when participants mentally trained to memorize the rhythms, to merely improve their performance, when mental practice and execution directly followed one another and when separated by a different task. Finally, it was found irrespective of whether participants practiced on the basis of a symbolic rhythm description and when they practiced by watching somebody perform the rhythms (imitation learning). The effect was eliminated only when the requirement for mental practice was eliminated from the task while keeping visual stimulation identical. These data link mental practice not to execution but planning related motor processes and reveal that these planning processes underlie both mental practice and imitation learning. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  13. Distinct neural and neuromuscular strategies underlie independent evolution of simplified advertisement calls.

    Science.gov (United States)

    Leininger, Elizabeth C; Kelley, Darcy B

    2013-04-07

    Independent or convergent evolution can underlie phenotypic similarity of derived behavioural characters. Determining the underlying neural and neuromuscular mechanisms sheds light on how these characters arose. One example of evolutionarily derived characters is a temporally simple advertisement call of male African clawed frogs (Xenopus) that arose at least twice independently from a more complex ancestral pattern. How did simplification occur in the vocal circuit? To distinguish shared from divergent mechanisms, we examined activity from the calling brain and vocal organ (larynx) in two species that independently evolved simplified calls. We find that each species uses distinct neural and neuromuscular strategies to produce the simplified calls. Isolated Xenopus borealis brains produce fictive vocal patterns that match temporal patterns of actual male calls; the larynx converts nerve activity faithfully into muscle contractions and single clicks. In contrast, fictive patterns from isolated Xenopus boumbaensis brains are short bursts of nerve activity; the isolated larynx requires stimulus bursts to produce a single click of sound. Thus, unlike X. borealis, the output of the X. boumbaensis hindbrain vocal pattern generator is an ancestral burst-type pattern, transformed by the larynx into single clicks. Temporally simple advertisement calls in genetically distant species of Xenopus have thus arisen independently via reconfigurations of central and peripheral vocal neuroeffectors.

  14. Rat hippocampal alterations could underlie behavioral abnormalities induced by exposure to moderate noise levels.

    Science.gov (United States)

    Uran, S L; Aon-Bertolino, M L; Caceres, L G; Capani, F; Guelman, L R

    2012-08-30

    Noise exposure is known to affect auditory structures in living organisms. However, it should not be ignored that many of the effects of noise are extra-auditory. Previous findings of our laboratory demonstrated that noise was able to induce behavioral alterations that are mainly related to the cerebellum (CE) and the hippocampus (HC). Therefore, the aim of this work was to reveal new data about the vulnerability of developing rat HC to moderate noise levels through the assessment of potential histological changes and hippocampal-related behavioral alterations. Male Wistar rats were exposed to noise (95-97 dB SPL, 2h daily) either for 1 day (acute noise exposure, ANE) or between postnatal days 15 and 30 (sub-acute noise exposure, SANE). Hippocampal histological evaluation as well as short (ST) and long term (LT) habituation and recognition memory assessments were performed. Results showed a mild disruption in the different hippocampal regions after ANE and SANE schemes, along with significant behavioral abnormalities. These data suggest that exposure of developing rats to noise levels of moderate intensity is able to trigger changes in the HC, an extra-auditory structure of the Central Nervous System (CNS), that could underlie the observed behavioral effects. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Co-Option and De Novo Gene Evolution Underlie Molluscan Shell Diversity

    Science.gov (United States)

    Aguilera, Felipe; McDougall, Carmel

    2017-01-01

    Abstract Molluscs fabricate shells of incredible diversity and complexity by localized secretions from the dorsal epithelium of the mantle. Although distantly related molluscs express remarkably different secreted gene products, it remains unclear if the evolution of shell structure and pattern is underpinned by the differential co-option of conserved genes or the integration of lineage-specific genes into the mantle regulatory program. To address this, we compare the mantle transcriptomes of 11 bivalves and gastropods of varying relatedness. We find that each species, including four Pinctada (pearl oyster) species that diverged within the last 20 Ma, expresses a unique mantle secretome. Lineage- or species-specific genes comprise a large proportion of each species’ mantle secretome. A majority of these secreted proteins have unique domain architectures that include repetitive, low complexity domains (RLCDs), which evolve rapidly, and have a proclivity to expand, contract and rearrange in the genome. There are also a large number of secretome genes expressed in the mantle that arose before the origin of gastropods and bivalves. Each species expresses a unique set of these more ancient genes consistent with their independent co-option into these mantle gene regulatory networks. From this analysis, we infer lineage-specific secretomes underlie shell diversity, and include both rapidly evolving RLCD-containing proteins, and the continual recruitment and loss of both ancient and recently evolved genes into the periphery of the regulatory network controlling gene expression in the mantle epithelium. PMID:28053006

  16. Genetic Defects Underlie the Non-syndromic Autosomal Recessive Intellectual Disability (NS-ARID

    Directory of Open Access Journals (Sweden)

    Saleha Shamim

    2017-05-01

    Full Text Available Intellectual disability (ID is a neurodevelopmental disorder which appears frequently as the result of genetic mutations and may be syndromic (S-ID or non-syndromic (NS-ID. ID causes an important economic burden, for patient's family, health systems, and society. Identifying genes that cause S-ID can easily be evaluated due to the clinical symptoms or physical anomalies. However, in the case of NS-ID due to the absence of co-morbid features, the latest molecular genetic techniques can be used to understand the genetic defects that underlie it. Recent studies have shown that non-syndromic autosomal recessive (NS-ARID is extremely heterogeneous and contributes much more than X-linked ID. However, very little is known about the genes and loci involved in NS-ARID relative to X-linked ID, and whose complete genetic etiology remains obscure. In this review article, the known genetic etiology of NS-ARID and possible relationships between genes and the associated molecular pathways of their encoded proteins has been reviewed which will enhance our understanding about the underlying genes and mechanisms in NS-ARID.

  17. Abnormal Brain Dynamics Underlie Speech Production in Children with Autism Spectrum Disorder.

    Science.gov (United States)

    Pang, Elizabeth W; Valica, Tatiana; MacDonald, Matt J; Taylor, Margot J; Brian, Jessica; Lerch, Jason P; Anagnostou, Evdokia

    2016-02-01

    A large proportion of children with autism spectrum disorder (ASD) have speech and/or language difficulties. While a number of structural and functional neuroimaging methods have been used to explore the brain differences in ASD with regards to speech and language comprehension and production, the neurobiology of basic speech function in ASD has not been examined. Magnetoencephalography (MEG) is a neuroimaging modality with high spatial and temporal resolution that can be applied to the examination of brain dynamics underlying speech as it can capture the fast responses fundamental to this function. We acquired MEG from 21 children with high-functioning autism (mean age: 11.43 years) and 21 age- and sex-matched controls as they performed a simple oromotor task, a phoneme production task and a phonemic sequencing task. Results showed significant differences in activation magnitude and peak latencies in primary motor cortex (Brodmann Area 4), motor planning areas (BA 6), temporal sequencing and sensorimotor integration areas (BA 22/13) and executive control areas (BA 9). Our findings of significant functional brain differences between these two groups on these simple oromotor and phonemic tasks suggest that these deficits may be foundational and could underlie the language deficits seen in ASD. © 2015 The Authors Autism Research published by Wiley Periodicals, Inc. on behalf of International Society for Autism Research.

  18. Brain mechanisms that underlie the effects of motivational audiovisual stimuli on psychophysiological responses during exercise.

    Science.gov (United States)

    Bigliassi, Marcelo; Silva, Vinícius B; Karageorghis, Costas I; Bird, Jonathan M; Santos, Priscila C; Altimari, Leandro R

    2016-05-01

    Motivational audiovisual stimuli such as music and video have been widely used in the realm of exercise and sport as a means by which to increase situational motivation and enhance performance. The present study addressed the mechanisms that underlie the effects of motivational stimuli on psychophysiological responses and exercise performance. Twenty-two participants completed fatiguing isometric handgrip-squeezing tasks under two experimental conditions (motivational audiovisual condition and neutral audiovisual condition) and a control condition. Electrical activity in the brain and working muscles was analyzed by use of electroencephalography and electromyography, respectively. Participants were asked to squeeze the dynamometer maximally for 30s. A single-item motivation scale was administered after each squeeze. Results indicated that task performance and situational motivational were superior under the influence of motivational stimuli when compared to the other two conditions (~20% and ~25%, respectively). The motivational stimulus downregulated the predominance of low-frequency waves (theta) in the right frontal regions of the cortex (F8), and upregulated high-frequency waves (beta) in the central areas (C3 and C4). It is suggested that motivational sensory cues serve to readjust electrical activity in the brain; a mechanism by which the detrimental effects of fatigue on the efferent control of working muscles is ameliorated. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Caffeine-Induced Suppression of GABAergic Inhibition and Calcium-Independent Metaplasticity

    Directory of Open Access Journals (Sweden)

    Masako Isokawa

    2016-01-01

    Full Text Available GABAergic inhibition plays a critical role in the regulation of neuron excitability; thus, it is subject to modulations by many factors. Recent evidence suggests the elevation of intracellular calcium ([Ca2+]i and calcium-dependent signaling molecules underlie the modulations. Caffeine induces a release of calcium from intracellular stores. We tested whether caffeine modulated GABAergic transmission by increasing [Ca2+]i. A brief local puff-application of caffeine to hippocampal CA1 pyramidal cells transiently suppressed GABAergic inhibitory postsynaptic currents (IPSCs by 73.2 ± 6.98%. Time course of suppression and the subsequent recovery of IPSCs resembled DSI (depolarization-induced suppression of inhibition, mediated by endogenous cannabinoids that require a [Ca2+]i rise. However, unlike DSI, caffeine-induced suppression of IPSCs (CSI persisted in the absence of a [Ca2+]i rise. Intracellular applications of BAPTA and ryanodine (which blocks caffeine-induced calcium release from intracellular stores failed to prevent the generation of CSI. Surprisingly, ruthenium red, an inhibitor of multiple calcium permeable/release channels including those of stores, induced metaplasticity by amplifying the magnitude of CSI independently of calcium. This metaplasticity was accompanied with the generation of a large inward current. Although ionic basis of this inward current is undetermined, the present result demonstrates that caffeine has a robust Ca2+-independent inhibitory action on GABAergic inhibition and causes metaplasticity by opening plasma membrane channels.

  20. 5-HT modulation of hyperpolarization-activated inward current and calcium- dependent outward current in a crustacean motor neuron

    DEFF Research Database (Denmark)

    Kiehn, O.; Harris-Warrick, R. M.

    1992-01-01

    1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...

  1. Long-Term Synaptic Changes in Two Input Pathways into the Lateral Nucleus of the Amygdala Underlie Fear Extinction

    Science.gov (United States)

    Park, Junchol; Choi, June-Seek

    2010-01-01

    Plasticity in two input pathways into the lateral nucleus of the amygdala (LA), the medial prefrontal cortex (mPFC) and the sensory thalamus, have been suggested to underlie extinction, suppression of a previously acquired conditioned response (CR) following repeated presentations of the conditioned stimulus (CS). However, little is known about…

  2. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  3. Different evolutionary pathways underlie the morphology of wrist bones in hominoids.

    Science.gov (United States)

    Kivell, Tracy L; Barros, Anna P; Smaers, Jeroen B

    2013-10-23

    The hominoid wrist has been a focus of numerous morphological analyses that aim to better understand long-standing questions about the evolution of human and hominoid hand use. However, these same analyses also suggest various scenarios of complex and mosaic patterns of morphological evolution within the wrist and potentially multiple instances of homoplasy that would benefit from require formal analysis within a phylogenetic context.We identify morphological features that principally characterize primate - and, in particular, hominoid (apes, including humans) - wrist evolution and reveal the rate, process and evolutionary timing of patterns of morphological change on individual branches of the primate tree of life. Linear morphological variables of five wrist bones - the scaphoid, lunate, triquetrum, capitate and hamate - are analyzed in a diverse sample of extant hominoids (12 species, 332 specimens), Old World (8 species, 43 specimens) and New World (4 species, 26 specimens) monkeys, fossil Miocene apes (8 species, 20 specimens) and Plio-Pleistocene hominins (8 species, 18 specimens). Results reveal a combination of parallel and synapomorphic morphology within haplorrhines, and especially within hominoids, across individual wrist bones. Similar morphology of some wrist bones reflects locomotor behaviour shared between clades (scaphoid, triquetrum and capitate) while others (lunate and hamate) indicate clade-specific synapomorphic morphology. Overall, hominoids show increased variation in wrist bone morphology compared with other primate clades, supporting previous analyses, and demonstrate several occurrences of parallel evolution, particularly between orangutans and hylobatids, and among hominines (extant African apes, humans and fossil hominins). Our analyses indicate that different evolutionary processes can underlie the evolution of a single anatomical unit (the wrist) to produce diversity in functional and morphological adaptations across individual wrist

  4. X-y interactions underlie sperm head abnormality in hybrid male house mice.

    Science.gov (United States)

    Campbell, Polly; Nachman, Michael W

    2014-04-01

    The genetic basis of hybrid male sterility in house mice is complex, highly polygenic, and strongly X linked. Previous work suggested that there might be interactions between the Mus musculus musculus X and the M. m. domesticus Y with a large negative effect on sperm head morphology in hybrid males with an F1 autosomal background. To test this, we introgressed the M. m. domesticus Y onto a M. m. musculus background and measured the change in sperm morphology, testis weight, and sperm count across early backcross generations and in 11th generation backcross males in which the opportunity for X-autosome incompatibilities is effectively eliminated. We found that abnormality in sperm morphology persists in M. m. domesticus Y introgression males, and that this phenotype is rescued by M. m. domesticus introgressions on the X chromosome. In contrast, the severe reductions in testis weight and sperm count that characterize F1 males were eliminated after one generation of backcrossing. These results indicate that X-Y incompatibilities contribute specifically to sperm morphology. In contrast, X-autosome incompatibilities contribute to low testis weight, low sperm count, and sperm morphology. Restoration of normal testis weight and sperm count in first generation backcross males suggests that a small number of complex incompatibilities between loci on the M. m. musculus X and the M. m. domesticus autosomes underlie F1 male sterility. Together, these results provide insight into the genetic architecture of F1 male sterility and help to explain genome-wide patterns of introgression across the house mouse hybrid zone.

  5. Calcium, essential for health

    Science.gov (United States)

    Martínez de Victoria, Emilio

    2016-07-12

    Calcium (Ca) is the most abundant mineral element in our body. It accounts for about 2% of body weight. The functions of calcium are: a) functions skeletal and b) regulatory functions. Bone consists of a protein matrix that mineralizes mainly with calcium (the most abundant), phosphate and magnesium, for it is essential an adequate dietary intake of Ca, phosphorus and vitamin D. The ionic Ca (Ca2+) is essential to maintain and / or perform different specialized functions of, virtually, all body cells cellular. Because of its important functions Ca2+ must be closely regulated, keeping plasma concentrations within narrow ranges. For this reason there is an accurate response against hypocalcemia or hypercalcemia in which the parathormone, calcitriol, calcitonin and vitamin K are involved. Ca intakes in the Spanish population are low in a significant percentage of the older adult’s population, especially in women. The main source of Ca in the diet is milk and milk derivatives. Green leafy vegetables, fruits and legumes can be important sources of Ca in a Mediterranean dietary pattern. The bioavailability of dietary Ca depends on physiological and dietary factors. Physiological include age, physiological status (gestation and lactation) Ca and vitamin D status and disease. Several studies relate Ca intake in the diet and various diseases, such as osteoporosis, cancer, cardiovascular disease and obesity.

  6. Models of calcium signalling

    CERN Document Server

    Dupont, Geneviève; Kirk, Vivien; Sneyd, James

    2016-01-01

    This book discusses the ways in which mathematical, computational, and modelling methods can be used to help understand the dynamics of intracellular calcium. The concentration of free intracellular calcium is vital for controlling a wide range of cellular processes, and is thus of great physiological importance. However, because of the complex ways in which the calcium concentration varies, it is also of great mathematical interest.This book presents the general modelling theory as well as a large number of specific case examples, to show how mathematical modelling can interact with experimental approaches, in an interdisciplinary and multifaceted approach to the study of an important physiological control mechanism. Geneviève Dupont is FNRS Research Director at the Unit of Theoretical Chronobiology of the Université Libre de Bruxelles;Martin Falcke is head of the Mathematical Cell Physiology group at the Max Delbrück Center for Molecular Medicine, Berlin;Vivien Kirk is an Associate Professor in the Depar...

  7. Distinctive hippocampal and amygdalar cytoarchitectural changes underlie specific patterns of behavioral disruption following stress exposure in an animal model of PTSD.

    Science.gov (United States)

    Cohen, Hagit; Kozlovsky, Nitsan; Matar, Michael A; Zohar, Joseph; Kaplan, Zeev

    2014-12-01

    Alterations in cytoarchitecture and molecular signaling have been observed in adaptive and maladaptive responses to stress and presumably underlie the physiological and behavioral changes observed. The relationship between behavioral responses to stress exposure and changes in cytoarchitecture of subregions of the hippocampus and amygdala was investigated in an animal model of PTSD. Behaviors in elevated plus-maze and acoustic startle response tests were assessed in rats 7 days after exposure to predator scent stress. Brains were harvested 24h later. Neurons from CA1, CA3, and dentate gyrus subregions and basolateral amygdala were reconstructed and subjected to Sholl analysis and spine density estimation. Glucocorticoid receptor, brain-derived neurotrophic factor, phospho-NR1-Ser-889, phospho-GluR1-Ser-845, phospho-calcium/calmodulin dependent protein kinase II-Thy-286, post-synaptic density protein 95 and phospho-CREB-Ser-133 were evaluated in the hippocampus. Data were analyzed by retrospective classification of individual rats into three behavioral response groups. The extent and distribution of changes in the morphology of hippocampal and amygdalar dendrites was significantly associated with stress-induced behavioral response classification. Extreme (PTSD-like) behavioral disruption was associated with extensive neuronal retraction in the hippocampus and proliferation in the amygdala. Neither structure displayed such changes in minimal behavioral responders. Partial behavioral response was associated with identical changes in the hippocampus only. Patterns of change in requisite molecular signaling genes and endophenotypic markers corresponded to the structural and behavioral responses. The extent and distribution of changes in the cytoarchitecture of hippocampal and amygdalar subregions is directly related to the pattern of behavioral response of the individual to stress exposure. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

  8. Determination of percent calcium carbonate in calcium chromate

    International Nuclear Information System (INIS)

    Middleton, H.W.

    1979-01-01

    The precision, accuracy and reliability of the macro-combustion method is superior to the Knorr alkalimetric method, and it is faster. It also significantly reduces the calcium chromate waste accrual problem. The macro-combustion method has been adopted as the official method for determination of percent calcium carbonate in thermal battery grade anhydrous calcium chromate and percent calcium carbonate in quicklime used in the production of calcium chromate. The apparatus and procedure can be used to measure the percent carbonate in inorganic materials other than calcium chromate. With simple modifications in the basic apparatus and procedure, the percent carbon and hydrogen can be measured in many organic material, including polymers and polymeric formulations. 5 figures, 5 tables

  9. Calcium oxalate stone and gout.

    Science.gov (United States)

    Marickar, Y M Fazil

    2009-12-01

    Gout is well known to be produced by increased uric acid level in blood. The objective of this paper is to assess the relationship between gout and calcium oxalate stone formation in the humans. 48 patients with combination of gout and calcium oxalate stone problem were included. The biochemical values of this group were compared with 38 randomly selected uric acid stone patients with gout, 43 stone patients with gout alone, 100 calcium oxalate stone patients without gout and 30 controls, making a total of 259 patients. Various biochemical parameters, namely serum calcium, phosphorus and uric acid and 24-h urine calcium, phosphorus, uric acid, oxalate, citrate and magnesium were analysed. ANOVA and Duncan's multiple-range tests were performed to assess statistical significance of the variations. The promoters of stone formation, namely serum calcium (P stone patients and gouty calcium oxalate stone patients compared to the non-gouty patients and controls. Urine oxalate (P stones patients. The inhibitor urine citrate (P stone gouty patients, followed by the gouty uric acid stone formers and gouty calcium oxalate stone patients. The high values of promoters, namely uric acid and calcium in the gouty stone patients indicate the tendency for urinary stone formation in the gouty stone patients. There is probably a correlation between gout and calcium oxalate urinary stone. We presume this mechanism is achieved through the uric acid metabolism. The findings point to the summation effect of metabolic changes in development of stone disease.

  10. Calcium Signaling in Taste Cells

    Science.gov (United States)

    Medler, Kathryn F.

    2014-01-01

    The sense of taste is a common ability shared by all organisms and is used to detect nutrients as well as potentially harmful compounds. Thus taste is critical to survival. Despite its importance, surprisingly little is known about the mechanisms generating and regulating responses to taste stimuli. All taste responses depend on calcium signals to generate appropriate responses which are relayed to the brain. Some taste cells have conventional synapses and rely on calcium influx through voltage-gated calcium channels. Other taste cells lack these synapses and depend on calcium release to formulate an output signal through a hemichannel. Beyond establishing these characteristics, few studies have focused on understanding how these calcium signals are formed. We identified multiple calcium clearance mechanisms that regulate calcium levels in taste cells as well as a calcium influx that contributes to maintaining appropriate calcium homeostasis in these cells. Multiple factors regulate the evoked taste signals with varying roles in different cell populations. Clearly, calcium signaling is a dynamic process in taste cells and is more complex than has previously been appreciated. PMID:25450977

  11. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

    Science.gov (United States)

    Minor, Daniel L; Findeisen, Felix

    2010-01-01

    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  12. [Methodological aspects of the reconstitution and evaluation of the behavioral theories that underlie population policy].

    Science.gov (United States)

    Leeuw, F

    1991-09-01

    This work discusses methodological aspects of the articulation and evaluation of behavioral theories underlying demographic policies. Such theories, called "policy theories" among other terms, may be defined as a group of hypotheses explicitly translated into predictions about behavior that underlie policy measures and that concern the relations between the measure and the objective to be attained. Interest in policy theories has been reflected in the writings of such demographers as D. Bogue, J. Blake, and T. Burch, and of researchers from other social science disciplines. 2 examples of policy theories from the Netherlands are presented to illustrate the discussion, 1 describing family planning communication programs that were intended to reduce the number of unwanted and unplanned pregnancies, and the other describing measures to increase availability of child care services in order to facilitate labor force participation of women and ultimately to increase the birth rate. Both theories are found to be comprised of 2 main parallel theories and several related hypotheses. Because political authorities do not usually make explicit the hypotheses that support political measures, their hypotheses must be articulated and reconstituted through attention to debates, written communications, interviews, and other means. The reconstitution must be done as objectively as possible, which implies the need to follow some methodologic rules. Examples are cited of principles advanced by researchers in management science, market research, and political science. 7 methodological rules or steps are then suggested for articulating policy theories: 1) identify statements relative to the political problem, such as excessive or inadequate fertility rates; 2) use the sources to identify reasons for undertaking concrete policy measures; 3) describe the role of the official in the political process; 4) inventory all declarations concerning the relationship between the objective and the

  13. Cardiovascular Effects of Calcium Supplements

    Directory of Open Access Journals (Sweden)

    Ian R. Reid

    2013-07-01

    Full Text Available Calcium supplements reduce bone turnover and slow the rate of bone loss. However, few studies have demonstrated reduced fracture incidence with calcium supplements, and meta-analyses show only a 10% decrease in fractures, which is of borderline statistical and clinical significance. Trials in normal older women and in patients with renal impairment suggest that calcium supplements increase the risk of cardiovascular disease. To further assess their safety, we recently conducted a meta-analysis of trials of calcium supplements, and found a 27%–31% increase in risk of myocardial infarction, and a 12%–20% increase in risk of stroke. These findings are robust because they are based on pre-specified analyses of randomized, placebo-controlled trials and are consistent across the trials. Co-administration of vitamin D with calcium does not lessen these adverse effects. The increased cardiovascular risk with calcium supplements is consistent with epidemiological data relating higher circulating calcium concentrations to cardiovascular disease in normal populations. There are several possible pathophysiological mechanisms for these effects, including effects on vascular calcification, vascular cells, blood coagulation and calcium-sensing receptors. Thus, the non-skeletal risks of calcium supplements appear to outweigh any skeletal benefits, and are they appear to be unnecessary for the efficacy of other osteoporosis treatments.

  14. SR calcium handling and calcium after-transients in a rabbit model of heart failure

    NARCIS (Netherlands)

    Baartscheer, Antonius; Schumacher, Cees A.; Belterman, Charly N. W.; Coronel, Ruben; Fiolet, Jan W. T.

    2003-01-01

    Objective: After-depolarization associated arrhythmias are frequently observed in heart failure and associated with spontaneous calcium release from sarcoplasmic reticulum (SR), calcium after-transients. We hypothesize that disturbed SR calcium handling underlies calcium after-transients in heart

  15. 21 CFR 573.240 - Calcium periodate.

    Science.gov (United States)

    2010-04-01

    ... with calcium hydroxide or calcium oxide to form a substance consisting of not less than 60 percent by... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium periodate. 573.240 Section 573.240 Food... Additive Listing § 573.240 Calcium periodate. The food additive calcium periodate may be safely used in...

  16. 21 CFR 573.260 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium silicate. 573.260 Section 573.260 Food and... Listing § 573.260 Calcium silicate. Calcium silicate, including synthetic calcium silicate, may be safely used as an anticaking agent in animal feed, provided that the amount of calcium silicate does not...

  17. Impairment of mitochondrial calcium handling in a mtSOD1 cell culture model of motoneuron disease

    Directory of Open Access Journals (Sweden)

    Zippelius Annette

    2009-06-01

    Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons (MN in the brain stem and spinal cord. Intracellular disruptions of cytosolic and mitochondrial calcium have been associated with selective MN degeneration, but the underlying mechanisms are not well understood. The present evidence supports a hypothesis that mitochondria are a target of mutant SOD1-mediated toxicity in familial amyotrophic lateral sclerosis (fALS and intracellular alterations of cytosolic and mitochondrial calcium might aggravate the course of this neurodegenerative disease. In this study, we used a fluorescence charged cool device (CCD imaging system to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations in individual cells in an established cellular model of ALS. Results To gain insights into the molecular mechanisms of SOD1G93A associated motor neuron disease, we simultaneously monitored cytosolic and mitochondrial calcium concentrations in individual cells. Voltage – dependent cytosolic Ca2+ elevations and mitochondria – controlled calcium release mechanisms were monitored after loading cells with fluorescent dyes fura-2 and rhod-2. Interestingly, comparable voltage-dependent cytosolic Ca2+ elevations in WT (SH-SY5YWT and G93A (SH-SY5YG93A expressing cells were observed. In contrast, mitochondrial intracellular Ca2+ release responses evoked by bath application of the mitochondrial toxin FCCP were significantly smaller in G93A expressing cells, suggesting impaired calcium stores. Pharmacological experiments further supported the concept that the presence of G93A severely disrupts mitochondrial Ca2+ regulation. Conclusion In this study, by fluorescence measurement of cytosolic calcium and using simultaneous [Ca2+]i and [Ca2+]mito measurements, we are able to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations

  18. Presynaptic muscarinic receptors, calcium channels, and protein kinase C modulate the functional disconnection of weak inputs at polyinnervated neonatal neuromuscular synapses.

    Science.gov (United States)

    Santafe, M M; Garcia, N; Lanuza, M A; Tomàs, M; Besalduch, N; Tomàs, J

    2009-04-01

    We studied the relation among calcium inflows, voltage-dependent calcium channels (VDCC), presynaptic muscarinic acetylcholine receptors (mAChRs), and protein kinase C (PKC) activity in the modulation of synapse elimination. We used intracellular recording to determine the synaptic efficacy in dually innervated endplates of the levator auris longus muscle of newborn rats during axonal competition in the postnatal synaptic elimination period. In these dual junctions, the weak nerve terminal was potentiated by partially reducing calcium entry (P/Q-, N-, or L-type VDCC-specific block or 500 muM magnesium ions), M1- or M4-type selective mAChR block, or PKC block. Moreover, reducing calcium entry or blocking PKC or mAChRs results in unmasking functionally silent nerve endings that now recover neurotransmitter release. Our results show interactions between these molecules and indicate that there is a release inhibition mechanism based on an mAChR-PKC-VDCC intracellular cascade. When it is fully active in certain weak motor axons, it can depress ACh release and even disconnect synapses. We suggest that this mechanism plays a central role in the elimination of redundant neonatal synapses, because functional axonal withdrawal can indeed be reversed by mAChRs, VDCCs, or PKC block.

  19. 21 CFR 172.330 - Calcium pantothenate, calcium chloride double salt.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium pantothenate, calcium chloride double salt... FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.330 Calcium pantothenate, calcium chloride double salt. The food additive calcium chloride double salt of calcium pantothenate may...

  20. The Effects of Dietary Calcium and/or Iron Deficiency upon Murine Intestinal Calcium Binding Protein Activity and Calcium Absorption

    OpenAIRE

    McDonald, Catherine M.

    1980-01-01

    Iron deficiency has been shown to impair calcium absorption, leading to decreased bone mass. Vitamin D3-dependent calcium binding protein (CaBP) has been demonstrated to be necessary for the active transport of calcium in the intestine of numerous species. Iron deficiency might affect the activity of the calcium binding protein. Four experimental diets were formulated as follows: Diet 1, iron adequate, calcium adequate; Diet 2, iron deficient, calcium adequate; Diet 3, iron adequate, calci...

  1. Disconnection and hyper-connectivity underlie reorganization after TBI: A rodent functional connectomic analysis.

    Science.gov (United States)

    Harris, N G; Verley, D R; Gutman, B A; Thompson, P M; Yeh, H J; Brown, J A

    2016-03-01

    predicted by the structural deficits, not only within the primary sensorimotor injury site and pericontused regions, but the normally connected homotopic cortex, as well as subcortical regions, all of which persisted chronically. Especially novel in this study is the unanticipated finding of widespread increases in connection strength that dwarf both the degree and extent of the functional disconnections, and which persist chronically in some sensorimotor and subcortically connected regions. Exploratory global network analysis showed changes in network parameters indicative of possible acutely increased random connectivity and temporary reductions in modularity that were matched by local increases in connectedness and increased efficiency among more weakly connected regions. The global network parameters: shortest path-length, clustering coefficient and modularity that were most affected by trauma also scaled with the severity of injury, so that the corresponding regional measures were correlated to the injury severity most notably at 7 and 14 days and especially within, but not limited to, the contralateral cortex. These changes in functional network parameters are discussed in relation to the known time-course of physiologic and anatomic data that underlie structural and functional reorganization in this experiment model of TBI. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Calcium, vitamin D, and your bones

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000490.htm Calcium, vitamin D, and your bones To use the sharing ... and maintain strong bones. How Much Calcium and Vitamin D do I Need? Amounts of calcium are ...

  3. Calcium Supplements: Do Men Need Them Too?

    Science.gov (United States)

    ... Lifestyle Nutrition and healthy eating Should men take calcium supplements? Answers from Katherine Zeratsky, R.D., L. ... Most healthy men don't need to take calcium supplements. Calcium is important for men for optimal ...

  4. Calcium transport in turtle bladder

    International Nuclear Information System (INIS)

    Sabatini, S.; Kurtzman, N.A.

    1987-01-01

    Unidirectional 45 Ca fluxes were measured in the turtle bladder under open-circuit and short-circuit conditions. In the open-circuited state net calcium flux (J net Ca ) was secretory (serosa to mucosa). Ouabain reversed J net Ca to an absorptive flux. Amiloride reduced both fluxes such that J net Ca was not significantly different from zero. Removal of mucosal sodium caused net calcium absorption; removal of serosal sodium caused calcium secretion. When bladders were short circuited, J net Ca decreased to approximately one-third of control value but remained secretory. When ouabain was added under short-circuit conditions, J net Ca was similar in magnitude and direction to ouabain under open-circuited conditions (i.e., absorptive). Tissue 45 Ca content was ≅30-fold lower when the isotope was placed in the mucosal bath, suggesting that the apical membrane is the resistance barrier to calcium transport. The results obtained in this study are best explained by postulating a Ca 2+ -ATPase on the serosa of the turtle bladder epithelium and a sodium-calcium antiporter on the mucosa. In this model, the energy for calcium movement would be supplied, in large part, by the Na + -K + -ATPase. By increasing cell sodium, ouabain would decrease the activity of the mucosal sodium-calcium exchanger (or reverse it), uncovering active calcium transport across the serosa

  5. Calcium chromate process related investigations

    International Nuclear Information System (INIS)

    Dillard, B.M.

    1979-01-01

    A pilot plant for production of calcium chromate has been scaled up to a small production facility at the General Electric Neutron Devices Department. In preparation for this scale-up, the process and final product were studied in order to evaluate problems not considered previously. The variables and processes studied included: (1) the determination of optimum drying temperature and time for product analysis; (2) the effect of the grade of lime used as the precipitating agent on the purity of the calcium chromate; (3) product purity when calcium chromate is precipitated by the addition of ammonium chromate to slaked lime; (4) the reagents best suited for cleaning calcium chromate spills; and (5) methods for determining hydroxide ion concentration in calcium chromate. The optimum drying time for the product before analysis is four hours at 600 0 C. Gases evolved at various temperatures during the drying process were carbon dioxide and water vapor. Technical grade lime produced calcium chromate of the highest purity. Both nitric and acetic acids were efficient dissolvers of calcium chromate spills. Direct titration of hydroxide ion with sulfuric acid gave an average recovery of 93% for samples spiked with calcium hydroxide. 1 figure, 17 tables

  6. Calcium addition in straw gasification

    DEFF Research Database (Denmark)

    Risnes, H.; Fjellerup, Jan Søren; Henriksen, Ulrik Birk

    2003-01-01

    The present work focuses on the influence of calcium addition in gasification. The inorganic¿organic element interaction as well as the detailed inorganic¿inorganic elements interaction has been studied. The effect of calcium addition as calcium sugar/molasses solutions to straw significantly...... affected the ash chemistry and the ash sintering tendency but much less the char reactivity. Thermo balance test are made and high-temperature X-ray diffraction measurements are performed, the experimental results indicate that with calcium addition major inorganic¿inorganic reactions take place very late...... in the char conversion process. Comprehensive global equilibrium calculations predicted important characteristics of the inorganic ash residue. Equilibrium calculations predict the formation of liquid salt if sufficient amounts of Ca are added and according to experiments as well as calculations calcium binds...

  7. Distinctive changes in plasma membrane phosphoinositides underlie differential regulation of TRPV1 in nociceptive neurons.

    Science.gov (United States)

    Lukacs, Viktor; Yudin, Yevgen; Hammond, Gerald R; Sharma, Esseim; Fukami, Kiyoko; Rohacs, Tibor

    2013-07-10

    Transient Receptor Potential Vanilloid 1 (TRPV1) is a polymodal, Ca(2+)-permeable cation channel crucial to regulation of nociceptor responsiveness. Sensitization of TRPV1 by G-protein coupled receptor (GPCR) agonists to its endogenous activators, such as low pH and noxious heat, is a key factor in hyperalgesia during tissue injury as well as pathological pain syndromes. Conversely, chronic pharmacological activation of TRPV1 by capsaicin leads to calcium influx-induced adaptation of the channel. Paradoxically, both conditions entail activation of phospholipase C (PLC) enzymes, which hydrolyze phosphoinositides. We found that in sensory neurons PLCβ activation by bradykinin led to a moderate decrease in phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2), but no sustained change in the levels of its precursor PI(4)P. Preventing this selective decrease in PI(4,5)P2 inhibited TRPV1 sensitization, while selectively decreasing PI(4,5)P2 independently of PLC potentiated the sensitizing effect of protein kinase C (PKC) on the channel, thereby inducing increased TRPV1 responsiveness. Maximal pharmacological TRPV1 stimulation led to a robust decrease of both PI(4,5)P2 and its precursor PI(4)P in sensory neurons. Attenuating the decrease of either lipid significantly reduced desensitization, and simultaneous reduction of PI(4,5)P2 and PI(4)P independently of PLC inhibited TRPV1. We found that, on the mRNA level, the dominant highly Ca(2+)-sensitive PLC isoform in dorsal root ganglia is PLCδ4. Capsaicin-induced desensitization of TRPV1 currents was significantly reduced, whereas capsaicin-induced nerve impulses in the skin-nerve preparation increased in mice lacking this isoform. We propose a comprehensive model in which differential changes in phosphoinositide levels mediated by distinct PLC isoforms result in opposing changes in TRPV1 activity.

  8. Evolution of the Calcium Paradigm: The Relation between Vitamin D, Serum Calcium and Calcium Absorption

    Directory of Open Access Journals (Sweden)

    Borje E. Christopher Nordin

    2010-09-01

    Full Text Available Osteoporosis is the index disease for calcium deficiency, just as rickets/osteomalacia is the index disease for vitamin D deficiency, but there is considerable overlap between them. The common explanation for this overlap is that hypovitaminosis D causes malabsorption of calcium which then causes secondary hyperparathyroidism and is effectively the same thing as calcium deficiency. This paradigm is incorrect. Hypovitaminosis D causes secondary hyperparathyroidism at serum calcidiol levels lower than 60 nmol/L long before it causes malabsorption of calcium because serum calcitriol (which controls calcium absorption is maintained until serum calcidiol falls below 20 nmol/L. This secondary hyperparathyroidism, probably due to loss of a “calcaemic” action of vitamin D on bone first described in 1957, destroys bone and explains why vitamin D insufficiency is a risk factor for osteoporosis. Vitamin D thus plays a central role in the maintenance of the serum (ionised calcium, which is more important to the organism than the preservation of the skeleton. Bone is sacrificed when absorbed dietary calcium does not match excretion through the skin, kidneys and bowel which is why calcium deficiency causes osteoporosis in experimental animals and, by implication, in humans.

  9. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  10. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  11. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  14. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  15. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  16. Calcium and Calcium Supplements: Achieving the Right Balance

    Science.gov (United States)

    ... may have on heart attack risk. A similar controversy surrounds calcium and prostate cancer. Some studies have ... your agreement to the Terms and Conditions and Privacy Policy linked below. Terms and Conditions Privacy Policy ...

  17. Calcium signals in olfactory neurons.

    Science.gov (United States)

    Tareilus, E; Noé, J; Breer, H

    1995-11-09

    Laser scanning confocal microscopy in combination with the fluorescent calcium indicators Fluo-3 and Fura-Red was employed to estimate the intracellular concentration of free calcium ions in individual olfactory receptor neurons and to monitor temporal and spatial changes in the Ca(2+)-level upon stimulation. The chemosensory cells responded to odorants with a significant increase in the calcium concentration, preferentially in the dendritic knob. Applying various stimulation paradigma, it was found that in a population of isolated cells, subsets of receptor neurons display distinct patterns of responsiveness.

  18. Why Calcium? How Calcium Became the Best Communicator*

    OpenAIRE

    Carafoli, Ernesto; Krebs, Joachim

    2016-01-01

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations,...

  19. Isomorfic Substitutions of Calcium by Strontium in Calcium Hydroxyapatite

    International Nuclear Information System (INIS)

    Christensen, Hilbert

    1962-12-01

    By means of homogeneous precipitation it has been possible to synthesize crystalline solid solutions of calcium strontium hydroxyapatite from aqueous solutions. The lattice constants for the solid solutions were measured in the range Ca 9 Sr(PO 4 ) 6 (OH) 2 - CaSr 9 (PO 4 ) 6 (OH) 2 . The investigations show that the discrimination of strontium against calcium is considerably smaller than reported elsewhere (1). Strontium is preferentially built into the c-axis direction of the apatite lattice

  20. Influence of dietary calcium on bone calcium utilization

    International Nuclear Information System (INIS)

    Farmer, M.; Roland, D.A. Sr.; Clark, A.J.

    1986-01-01

    In Experiment 1, 10 microCi 45 Ca/day were administered to 125 hens for 10 days. Hens were then allocated to five treatments with calcium levels ranging from .08 to 3.75% of the diet. In Experiment 2, hens with morning oviposition times were randomly allocated to 11 treatments that were periods of time postoviposition ranging from 6 hr to 24 hr, in 2-hr increments (Experiment 2). At the end of each 2-hr period, eggs from 25 hens were removed from the uterus. The 18-, 20-, and 22-hr treatments were replicated three times. In Experiment 3, hens were fed either ad libitum or feed was withheld the last 5 or 6 hr before oviposition. In Experiment 4, hens were fed 10 microCi of 45 Ca for 15 days to label skeletal calcium. Hens were divided into two groups and fed a .08 or 3.75% calcium diet for 2 days. On the second day, 25 hens fed the 3.75% calcium diet were intubated with 7 g of the same diet containing .5 g calcium at 1700, 2100, 0100, 0500, and 0700 hr. The measurements used were egg weight, shell weight, and 45 Ca content of the egg shell. Results indicated a significant linear or quadratic regression of dietary calcium levels on 45 Ca accumulation in eggshells and eggshell weight (Experiment 1). As the calcium level of the diet increased, eggshell weight increased and 45 Ca recovery decreased. Utilization of skeletal calcium for shell formation ranged from 28 to 96%. In Experiment 2, the rate of shell calcification was not constant throughout the calcification process but varied significantly

  1. Gynura procumbens Merr. decreases blood pressure in rats by vasodilatation via inhibition of calcium channels

    Directory of Open Access Journals (Sweden)

    See-Ziau Hoe

    2011-01-01

    Full Text Available INTRODUCTION: Gynura procumbens has been shown to decrease blood pressure via inhibition of the angiotensinconverting enzyme. However, other mechanisms that may contribute to the hypotensive effect have not been studied. OBJECTIVES: To investigate the cardiovascular effects of a butanolic fraction of Gynura procumbens in rats. METHODS: Anaesthetized rats were given intravenous bolus injections of butanolic fraction at doses of 2.5-20 mg/kg in vivo. The effect of butanolic fraction on vascular reactivity was recorded in isolated rat aortic rings in vitro. RESULTS: Intravenous administrations of butanolic fraction elicited significant (p<0.001 and dose-dependent decreases in the mean arterial pressure. However, a significant (p<0.05 decrease in the heart rate was observed only at the higher doses (10 and 20 mg/kg. In isolated preparations of rat aortic rings, phenylephrine (1×10-6 M- or potassium chloride (8×10-2 M-precontracted endothelium-intact and -denuded tissue; butanolic fraction (1×10-6-1×10-1 g/ml induced similar concentration-dependent relaxation of the vessels. In the presence of 2.5×10-3 and 5.0×10-3 g/ml butanolic fraction, the contractions induced by phenylephrine (1×10-9-3×10-5 M and potassium chloride (1×10-2-8×10-2 M were significantly antagonized. The calcium-induced vasocontractions (1×10-4-1×10-2 M were antagonized by butanolic fraction concentration-dependently in calcium-free and high potassium (6×10-2 M medium, as well as in calcium- and potassium-free medium containing 1×10-6 M phenylephrine. However, the contractions induced by noradrenaline (1×10-6 M and caffeine (4.5×10-2 M were not affected by butanolic fraction. CONCLUSION: Butanolic fraction contains putative hypotensive compounds that appear to inhibit calcium influx via receptor-operated and/or voltage-dependent calcium channels to cause vasodilation and a consequent fall in blood pressure.

  2. Differential calcium sensitivity in NaV 1.5 mixed syndrome mutants.

    Science.gov (United States)

    Abdelsayed, Mena; Baruteau, Alban-Elouen; Gibbs, Karen; Sanatani, Shubhayan; Krahn, Andrew D; Probst, Vincent; Ruben, Peter C

    2017-09-15

    SCN5a mutations may express gain-of-function (Long QT Syndrome-3), loss-of-function (Brugada Syndrome 1) or both (mixed syndromes), depending on the mutation and environmental triggers. One such trigger may be an increase in cytosolic calcium, accompanying exercise. Many mixed syndromes mutants, including ∆KPQ, E1784K, 1795insD and Q1909R, are found in calcium-sensitive regions. Elevated cytosolic calcium attenuates gain-of-function properties in ∆KPQ, 1795insD and Q1909R, but not in E1784K. By contrast, elevated cytosolic calcium further exacerbates gain-of-function in E1784K by destabilizing slow inactivation. Action potential modelling, using a modified O'Hara Rudy model, suggests that elevated heart rate rescues action potential duration in ∆KPQ, 1795insD and Q1909R, but not in E1784K. Action potential simulations suggest that E1784K carriers have an increased intracellular sodium-to-calcium ratio under bradycardia and tachycardia conditions. Elevated cytosolic calcium, which is common during high heart rates, ameliorates or exacerbates the mixed syndrome phenotype depending on the genetic signature. Inherited arrhythmias may arise from mutations in the gene for SCN5a, which encodes the cardiac voltage-gated sodium channel, Na V 1.5. Mutants in Na V 1.5 result in Brugada Syndrome (BrS1), Long-QT Syndrome (LQT3) or mixed syndromes (an overlap of BrS1/LQT3). Exercise is a potential arrhythmogenic trigger in mixed syndromes. We aimed to determine the effects of elevated cytosolic calcium, which is common during exercise, in mixed syndrome Na V 1.5 mutants. We used whole-cell patch clamp to assess the biophysical properties of Na V 1.5 wild-type (WT), ∆KPQ, E1784K, 1795insD and Q1909R mutants in human embryonic kidney 293 cells transiently transfected with the Na V 1.5 α subunit (WT or mutants), β1 subunit and enhanced green fluorescent protein. Voltage-dependence and kinetics were measured at cytosolic calcium levels of approximately 0, 500 and 2500

  3. Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.

    Science.gov (United States)

    Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L

    2017-08-01

    POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.

  4. 21 CFR 172.410 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium silicate. 172.410 Section 172.410 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Agents § 172.410 Calcium silicate. Calcium silicate, including synthetic calcium silicate, may be safely...

  5. A Crash Course in Calcium Channels.

    Science.gov (United States)

    Zamponi, Gerald W

    2017-12-20

    Much progress has been made in understanding the molecular physiology and pharmacology of calcium channels. Recently, there have been tremendous advances in learning about calcium channel structure and function through crystallography and cryo-electron microscopy studies. Here, I will give an overview of our knowledge about calcium channels, and highlight two recent studies that give important insights into calcium channel structure.

  6. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  7. Calcium-sensing beyond neurotransmitters

    DEFF Research Database (Denmark)

    Gustavsson, Natalia; Han, Weiping

    2009-01-01

    Neurotransmitters, neuropeptides and hormones are released through the regulated exocytosis of SVs (synaptic vesicles) and LDCVs (large dense-core vesicles), a process that is controlled by calcium. Synaptotagmins are a family of type 1 membrane proteins that share a common domain structure. Most....... Also, we discuss potential roles of synaptotagmins in non-traditional endocrine systems....... synaptotagmins are located in brain and endocrine cells, and some of these synaptotagmins bind to phospholipids and calcium at levels that trigger regulated exocytosis of SVs and LDCVs. This led to the proposed synaptotagmin-calcium-sensor paradigm, that is, members of the synaptotagmin family function...... as calcium sensors for the regulated exocytosis of neurotransmitters, neuropeptides and hormones. Here, we provide an overview of the synaptotagmin family, and review the recent mouse genetic studies aimed at understanding the functions of synaptotagmins in neurotransmission and endocrine-hormone secretion...

  8. Calcium phosphates for biomedical applications

    Directory of Open Access Journals (Sweden)

    Maria Canillas

    2017-05-01

    Full Text Available The history of calcium phosphates in the medicine field starts in 1769 when the first evidence of its existence in the bone tissue is discovered. Since then, the interest for calcium phosphates has increased among the scientific community. Their study has been developed in parallel with new advances in materials sciences, medicine or tissue engineering areas. Bone tissue engineering is the field where calcium phosphates have had a great importance. While the first bioceramics are selected according to bioinert, biocompatibility and mechanical properties with the aim to replace bone tissue damaged, calcium phosphates open the way to the bone tissue regeneration challenge. Nowadays, they are present in the majority of commercial products directed to repair or regenerate damaged bone tissue. Finally, in the last few decades, they have been suggested and studied as drug delivering devices and as vehicles of DNA and RNA for the future generation therapies.

  9. Functions of vitamin D / Calcium

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Excitation-contraction coupling,. Cardiac functions. Hormonal secretion. Control of enzymatic reactions. Mitotic division. Maintenance of cell integrity. Ciliary motility. Notes: Calcium is a vital second messenger.

  10. Calcium signals in planetary embryos

    Science.gov (United States)

    Morbidelli, Alessandro

    2018-03-01

    The calcium-isotope composition of planetary bodies in the inner Solar System correlates with the masses of such objects. This finding could have implications for our understanding of how the Solar System formed.

  11. Calcium homeostasis in diabetes mellitus.

    Science.gov (United States)

    Ahn, Changhwan; Kang, Ji-Houn; Jeung, Eui-Bae

    2017-09-30

    Diabetes mellitus (DM) is becoming a lifestyle-related pandemic disease. Diabetic patients frequently develop electrolyte disorders, especially diabetic ketoacidosis or nonketotic hyperglycemic hyperosmolar syndrome. Such patients show characteristic potassium, magnesium, phosphate, and calcium depletion. In this review, we discuss a homeostatic mechanism that links calcium and DM. We also provide a synthesis of the evidence in favor or against this linking mechanism by presenting recent clinical indications, mainly from veterinary research. There are consistent results supporting the use of calcium and vitamin D supplementation to reduce the risk of DM. Clinical trials support a marginal reduction in circulating lipids, and some meta-analyses support an increase in insulin sensitivity, following vitamin D supplementation. This review provides an overview of the calcium and vitamin D disturbances occurring in DM and describes the underlying mechanisms. Such elucidation will help indicate potential pathophysiology-based precautionary and therapeutic approaches and contribute to lowering the incidence of DM.

  12. Calcium phosphates for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Canillas, M.; Pena, P.; Aza, A.H. de; Rodriguez, M.A.

    2017-07-01

    The history of calcium phosphates in the medicine field starts in 1769 when the first evidence of its existence in the bone tissue is discovered. Since then, the interest for calcium phosphates has increased among the scientific community. Their study has been developed in parallel with new advances in materials sciences, medicine or tissue engineering areas. Bone tissue engineering is the field where calcium phosphates have had a great importance. While the first bioceramics are selected according to bioinert, biocompatibility and mechanical properties with the aim to replace bone tissue damaged, calcium phosphates open the way to the bone tissue regeneration challenge. Nowadays, they are present in the majority of commercial products directed to repair or regenerate damaged bone tissue. Finally, in the last few decades, they have been suggested and studied as drug delivering devices and as vehicles of DNA and RNA for the future generation therapies. (Author)

  13. Calcium signaling in liver.

    Science.gov (United States)

    Gaspers, Lawrence D; Thomas, Andrew P

    2005-01-01

    In hepatocytes, hormones linked to the formation of the second messenger inositol 1,4,5-trisphosphate (InsP3) evoke transient increases or spikes in cytosolic free calcium ([Ca2+]i), that increase in frequency with the agonist concentration. These oscillatory Ca2+ signals are thought to transmit the information encoded in the extracellular stimulus to down-stream Ca2+-sensitive metabolic processes. We have utilized both confocal and wide field fluorescence microscopy techniques to study the InsP3-dependent signaling pathway at the cellular and subcellular levels in the intact perfused liver. Typically InsP3-dependent [Ca2+]i spikes manifest as Ca2+ waves that propagate throughout the entire cytoplasm and nucleus, and in the intact liver these [Ca2+]i increases are conveyed through gap junctions to encompass entire lobular units. The translobular movement of Ca2+ provides a means to coordinate the function of metabolic zones of the lobule and thus, liver function. In this article, we describe the characteristics of agonist-evoked [Ca2+]i signals in the liver and discuss possible mechanisms to explain the propagation of intercellular Ca2+ waves in the intact organ.

  14. Does calcium influx regulate melatonin production through the circadian pacemaker in chick pineal cells? Effects of nitrendipine, Bay K 8644, Co2+, Mn2+, and low external Ca2+.

    Science.gov (United States)

    Zatz, M; Mullen, D A

    1988-11-01

    We have recently described a system, using dispersed chick pineal cells in static culture, which displays a persistent, photosensitive, circadian rhythm of melatonin production and release. Here, we describe the effects of nitrendipine (NTR) (a dihydropyridine 'antagonist' of L-type calcium channels), Bay K 8644 (BK) (a dihydropyridine calcium channel 'agonist'), cobalt and manganese ions (both inorganic calcium channel blockers), and low external calcium concentrations, on the melatonin rhythm. NTR inhibited and BK stimulated melatonin output; they were potent and effective. Co2+, Mn2+, and low external Ca2+ markedly inhibited melatonin output. These results support a role for calcium influx through voltage-dependent calcium channels (L-type) in the regulation of melatonin production. Four or 8 h pulses of white light or darkness, in otherwise constant red light, cause, in addition to acute effects, phase-dependent phase shifts of the melatonin rhythm in subsequent cycles. Such phase shifts indicate an effect on (proximal to) the pacemaker generating the rhythm. Four or 8 h pulses of NTR, BK, Co2+, or low Ca2+, however, did not appreciably alter the phase of subsequent melatonin cycles. Neither did BK interfere with phase shifts induced by light pulses. Mn2+ pulses did induce phase-dependent phase shifts, but, unlike those evoked by light or dark pulses, these were all delays. Such effects of Mn2+ in other systems have been attributed to, and are characteristic of, 'metabolic inhibitors'. On balance, the results fail to support a prominent role for calcium influx in regulating the pacemaker underlying the circadian rhythm in chick pineal cells. Rather, calcium influx appears to regulate melatonin production primarily by acting on the melatonin-synthesizing apparatus, distal to the pacemaker.

  15. Effects of diphosphonate on kidney calcium content and duodenal absorption of 45calcium

    International Nuclear Information System (INIS)

    Goulding, A.; Cameron, V.

    1978-01-01

    In rats the relationships between EHDP-induced changes in serum calcium concentration, kidney calcium content and duodenal transport of 45 calcium were studied. Body weights and kidney weights were similar in all groups. EHDP administration was associated with an increase in serum calcium concentration and kidney calcium content, and a decrease in duodenal 45 calcium transport. In the EHDP-treated rats, there was a significant negative correlation between kidney calcium concentration and duodenal 45 calcium transport but no correlation between either kidney calcium content and serum calcium concentration (r = 0.116) or between serum calcium concentration and duodenal 45 calcium transport (r = 0.02). Further experiments will be needed to determine whether the demonstrated increase in kidney calcium content induced by EHDP administration was the cause of, or was secondary to, inhibition of 1, 25(OH) 2 D 3 synthesis. (orig./AJ) [de

  16. Research of calcium oxide hydration in calcium nitrate solutions

    Directory of Open Access Journals (Sweden)

    M.A. Oliynyk

    2016-09-01

    Full Text Available Mineral fertilizers are one of the important factors of agriculture intensification and increasing of food products quantity. The volume of fertilizers production and its domestic consumption in Ukraine indicate that nitrogen fertilizer using only comes nearer to the required number of science-based. One of the most widespread artificial fertilizers is the calcium nitrate. Aim: The aim is to study and theoretically substantiate the processes occurring in the preparation of suspensions of calcium hydroxide Са(ОН2 in solution of calcium nitrate Ca(NО32. Materials and Methods: The technical calcium oxide (quicklime DSTU BV.2.7-90-99, solutions of calcium nitrate of 15, 20, 25, 30, 35 and 40% Ca(NО32 concentrations were used in the work. The content of lime in the preparation of a suspension in the solution changed (in terms of calcium oxide CaO from 150 g/dm3 to the maximum possible. Each of these solutions saturated at 40°С in lime to maximum concentration. Suitable for use in these experiments and in the technology of calcium nitrate obtaining are considered the solutions (suspensions that within 12 hours did not lose their mobility (transportability. Results: The experimental results show that increasing of the concentration of calcium nitrate in solution within the range 15...40%, the amount of lime that you can put into the solution without loss of transportability decreases. Further increasing of lime quantity in solutions concentrations causes to its solidifying, loss of mobility (transportability. Calculations showed that in the presence of calcium nitrate the solubility of Са(ОН2 is reduced nearly by order that can lead to the formation of calcium oxide CaO the solid phase Са(ОН2 on the surface, which also can form hydrogen bonds with the components of the solution. As the probability of formation of hydrogen bonds in solutions is high, there is a possibility of formation of clusters.

  17. Calcium Signals from the Vacuole

    Directory of Open Access Journals (Sweden)

    Gerald Schönknecht

    2013-10-01

    Full Text Available The vacuole is by far the largest intracellular Ca2+ store in most plant cells. Here, the current knowledge about the molecular mechanisms of vacuolar Ca2+ release and Ca2+ uptake is summarized, and how different vacuolar Ca2+ channels and Ca2+ pumps may contribute to Ca2+ signaling in plant cells is discussed. To provide a phylogenetic perspective, the distribution of potential vacuolar Ca2+ transporters is compared for different clades of photosynthetic eukaryotes. There are several candidates for vacuolar Ca2+ channels that could elicit cytosolic [Ca2+] transients. Typical second messengers, such as InsP3 and cADPR, seem to trigger vacuolar Ca2+ release, but the molecular mechanism of this Ca2+ release still awaits elucidation. Some vacuolar Ca2+ channels have been identified on a molecular level, the voltage-dependent SV/TPC1 channel, and recently two cyclic-nucleotide-gated cation channels. However, their function in Ca2+ signaling still has to be demonstrated. Ca2+ pumps in addition to establishing long-term Ca2+ homeostasis can shape cytosolic [Ca2+] transients by limiting their amplitude and duration, and may thus affect Ca2+ signaling.

  18. Calcium Orthophosphate Cements and Concretes

    Directory of Open Access Journals (Sweden)

    Sergey V. Dorozhkin

    2009-03-01

    Full Text Available In early 1980s, researchers discovered self-setting calcium orthophosphate cements, which are a bioactive and biodegradable grafting material in the form of a powder and a liquid. Both phases form after mixing a viscous paste that after being implanted, sets and hardens within the body as either a non-stoichiometric calcium deficient hydroxyapatite (CDHA or brushite, sometimes blended with unreacted particles and other phases. As both CDHA and brushite are remarkably biocompartible and bioresorbable (therefore, in vivo they can be replaced with newly forming bone, calcium orthophosphate cements represent a good correction technique for non-weight-bearing bone fractures or defects and appear to be very promising materials for bone grafting applications. Besides, these cements possess an excellent osteoconductivity, molding capabilities and easy manipulation. Furthermore, reinforced cement formulations are available, which in a certain sense might be described as calcium orthophosphate concretes. The concepts established by calcium orthophosphate cement pioneers in the early 1980s were used as a platform to initiate a new generation of bone substitute materials for commercialization. Since then, advances have been made in the composition, performance and manufacturing; several beneficial formulations have already been introduced as a result. Many other compositions are in experimental stages. In this review, an insight into calcium orthophosphate cements and concretes, as excellent biomaterials suitable for both dental and bone grafting application, has been provided.

  19. 21 CFR 184.1207 - Calcium lactate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium lactate. 184.1207 Section 184.1207 Food and... Substances Affirmed as GRAS § 184.1207 Calcium lactate. (a) Calcium lactate (C6H10CaO6.xH2O, where x is any... calcium carbonate or calcium hydroxide. (b) The ingredient meets the specifications of the Food Chemicals...

  20. Control of local intracellular calcium concentration with dynamic-clamp controlled 2-photon uncaging.

    Directory of Open Access Journals (Sweden)

    Erwin Idoux

    Full Text Available The variations of the intracellular concentration of calcium ion ([Ca(2+](i are at the heart of intracellular signaling, and their imaging is therefore of enormous interest. However, passive [Ca(2+](i imaging provides no control over these variations, meaning that a full exploration of the functional consequences of [Ca(2+](i changes is difficult to attain. The tools designed so far to modify [Ca(2+](i, even qualitatively, suffer drawbacks that undermine their widespread use. Here, we describe an electro-optical technique to quantitatively set [Ca(2+](i, in real time and with sub-cellular resolution, using two-photon Ca(2+ uncaging and dynamic-clamp. We experimentally demonstrate, on neurons from acute olfactory bulb slices of Long Evans rats, various capabilities of this technique previously difficult to achieve, such as the independent control of the membrane potential and [Ca(2+](i variations, the functional knocking-in of user-defined virtual voltage-dependent Ca(2+ channels, and the standardization of [Ca(2+](i patterns across different cells. Our goal is to lay the groundwork for this technique and establish it as a new and versatile tool for the study of cell signaling.

  1. Why Calcium? How Calcium Became the Best Communicator*

    Science.gov (United States)

    Carafoli, Ernesto; Krebs, Joachim

    2016-01-01

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations, e.g. magnesium. Its free concentration within cells can thus be maintained at the very low levels demanded by the signaling function. A large cadre of proteins has evolved to bind or transport calcium. They all contribute to buffer it within cells, but a number of them also decode its message for the benefit of the target. The most important of these “calcium sensors” are the EF-hand proteins. Calcium is an ambivalent messenger. Although essential to the correct functioning of cell processes, if not carefully controlled spatially and temporally within cells, it generates variously severe cell dysfunctions, and even cell death. PMID:27462077

  2. Why Calcium? How Calcium Became the Best Communicator.

    Science.gov (United States)

    Carafoli, Ernesto; Krebs, Joachim

    2016-09-30

    Calcium carries messages to virtually all important functions of cells. Although it was already active in unicellular organisms, its role became universally important after the transition to multicellular life. In this Minireview, we explore how calcium ended up in this privileged position. Most likely its unique coordination chemistry was a decisive factor as it makes its binding by complex molecules particularly easy even in the presence of large excesses of other cations, e.g. magnesium. Its free concentration within cells can thus be maintained at the very low levels demanded by the signaling function. A large cadre of proteins has evolved to bind or transport calcium. They all contribute to buffer it within cells, but a number of them also decode its message for the benefit of the target. The most important of these "calcium sensors" are the EF-hand proteins. Calcium is an ambivalent messenger. Although essential to the correct functioning of cell processes, if not carefully controlled spatially and temporally within cells, it generates variously severe cell dysfunctions, and even cell death. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Testosterone increases urinary calcium excretion and inhibits expression of renal calcium transport proteins.

    NARCIS (Netherlands)

    Hsu, Y.J.; Dimke, H.; Schoeber, J.P.H.; Hsu, S.C.; Lin, S.H.; Chu, P.; Hoenderop, J.G.J.; Bindels, R.J.M.

    2010-01-01

    Although gender differences in the renal handling of calcium have been reported, the overall contribution of androgens to these differences remains uncertain. We determined here whether testosterone affects active renal calcium reabsorption by regulating calcium transport proteins. Male mice had

  4. Calcium: the molecular basis of calcium action in biology and medicine

    National Research Council Canada - National Science Library

    Pochet, Roland; Donato, Rosario

    2000-01-01

    ... of Calcium Calcium Signalling in Excitable Cells Ca2+ Release in Muscle Cells by N. Macrez and J. Mironneau Calcium Signalling in Neurons Exemplified by Rat Sympathetic Ganglion Cells by S.J. M...

  5. Stochastic Simulation of Cardiac Ventricular Myocyte Calcium Dynamics and Waves

    OpenAIRE

    Tuan, Hoang-Trong Minh; Williams, George S. B.; Chikando, Aristide C.; Sobie, Eric A.; Lederer, W. Jonathan; Jafri, M. Saleet

    2011-01-01

    A three dimensional model of calcium dynamics in the rat ventricular myocyte was developed to study the mechanism of calcium homeostasis and pathological calcium dynamics during calcium overload. The model contains 20,000 calcium release units (CRUs) each containing 49 ryanodine receptors. The model simulates calcium sparks with a realistic spontaneous calcium spark rate. It suggests that in addition to the calcium spark-based leak, there is an invisible calcium leak caused by the stochastic ...

  6. Extensive molecular differences between anterior- and posterior-half-sclerotomes underlie somite polarity and spinal nerve segmentation

    Directory of Open Access Journals (Sweden)

    Keynes Roger J

    2009-05-01

    Full Text Available Abstract Background The polarization of somite-derived sclerotomes into anterior and posterior halves underlies vertebral morphogenesis and spinal nerve segmentation. To characterize the full extent of molecular differences that underlie this polarity, we have undertaken a systematic comparison of gene expression between the two sclerotome halves in the mouse embryo. Results Several hundred genes are differentially-expressed between the two sclerotome halves, showing that a marked degree of molecular heterogeneity underpins the development of somite polarity. Conclusion We have identified a set of genes that warrant further investigation as regulators of somite polarity and vertebral morphogenesis, as well as repellents of spinal axon growth. Moreover the results indicate that, unlike the posterior half-sclerotome, the central region of the anterior-half-sclerotome does not contribute bone and cartilage to the vertebral column, being associated instead with the development of the segmented spinal nerves.

  7. Lead in calcium supplements (abstract)

    International Nuclear Information System (INIS)

    Rehman, S.; Khalid, N.

    2011-01-01

    Lead present in calcium supplements is of grave concern as some lead levels have been measured up to the extent of regulatory limit set by the United States. Calcium supplements inevitably get contaminated with lead as both are naturally occurring elements. Therefore, it is imperative to indicate its level in these supplements in order to create awareness among consumers. In this study, a sophisticated analytical technique, atomic absorption spectrometry was used to analyze Pb contents in 27 commonly consumed Ca supplements manufactured by different national and multinational companies. The daily intake of lead through these supplements was calculated. Only 10% of the calcium supplements analyzed met the criteria of acceptable Pb levels (1.5 mu g/daily dose) in supplements/consumer products set by the United States. It was also found that Pb intake was highest in chelated calcium supplements 28.5 mu g/daily dose, whereas lowest 0.47 mu g/daily dose through calcium supplements with vitamin D formulation. In order to validate our results from the study conducted, IAEA-certified reference material (animal bone, H-5) was analyzed for its Pb levels. The levels of Pb determined were quite in good agreement with the certified values. (author)

  8. Isomorfic Substitutions of Calcium by Strontium in Calcium Hydroxyapatite

    Energy Technology Data Exchange (ETDEWEB)

    Christensen, Hilbert

    1962-12-15

    By means of homogeneous precipitation it has been possible to synthesize crystalline solid solutions of calcium strontium hydroxyapatite from aqueous solutions. The lattice constants for the solid solutions were measured in the range Ca{sub 9}Sr(PO{sub 4}){sub 6}(OH){sub 2} - CaSr{sub 9}(PO{sub 4}){sub 6}(OH){sub 2}. The investigations show that the discrimination of strontium against calcium is considerably smaller than reported elsewhere (1). Strontium is preferentially built into the c-axis direction of the apatite lattice.

  9. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  10. Computational model based approach to analysis ventricular arrhythmias: Effects of dysfunction calcium channels

    Science.gov (United States)

    Gulothungan, G.; Malathi, R.

    2018-04-01

    Disturbed sodium (Na+) and calcium (Ca2+) handling is known to be a major predisposing factor for life-threatening cardiac arrhythmias. Cardiac contractility in ventricular tissue is prominent by Ca2+ channels like voltage dependent Ca2+ channels, sodium-calcium exchanger (Na+-Ca2+x) and sacroplasmicrecticulum (SR) Ca2+ pump and leakage channels. Experimental and clinical possibilities for studying cardiac arrhythmias in human ventricular myocardium are very limited. Therefore, the use of alternative methods such as computer simulations is of great importance. Our aim of this article is to study the impact on action potential (AP) generation and propagation in single ventricular myocyte and ventricular tissue under different dysfunction Ca2+ channels condition. In enhanced activity of Na+-Ca2+x, single myocyte produces AP duration (APD90) and APD50 is significantly smaller (266 ms and 235 ms). Its Na+-Ca2+x current at depolarization is increases 60% from its normal level and repolarization current goes more negative (nonfailing= -0.28 pA/pF and failing= -0.47 pA/pF). Similarly, same enhanced activity of Na+-Ca2+x in 10 mm region of ventricular sheet, raises the plateau potential abruptly, which ultimately affects the diastolic repolarization. Compare with normal ventricular sheet region of 10 mm, 10% of ventricular sheet resting state is reduces and ventricular sheet at time 250 ms is goes to resting state very early. In hypertrophy condition, single myocyte produces APD90 and APD50 is worthy of attention smaller (232 mS and 198 ms). Its sodium-potassium (Na+-K+) pump current is 75% reduces from its control conditions (0.13 pA/pF). Hypertrophy condition, 50% of ventricular sheet is reduces to minimum plateau potential state, that starts the repolarization process very early and reduces the APD. In a single failing SR Ca2+ channels myocyte, recovery of Ca2+ concentration level in SR reduces upto 15% from its control myocytes. At time 290 ms, 70% of ventricular sheet

  11. Electrophysical properties of calcium vanadates

    International Nuclear Information System (INIS)

    Krasnenko, T.I.; Fotiev, A.A.

    1983-01-01

    Electrophysical properties of calcium vanadates are studied for the case of alteration of external parameters of the medium (PO 2 , T). It is lshown that structural transformations bring about changes in the nature of electrophysical properties of Ca 2 V 2 O 7 , Ca 3 (VO 4 ) 2 , this being the reason for charge redistribution in anion groupings. It is obvious, that the general conductivity of calcium methavanadate is mainly caused by ion transport. Ca(VO 3 ) 2 possesses amphoteric character of semiconducting properties: the type of conductivity changes from ''p'' to ''n'' with temperature increase. Polytherms of conductivity and sums of ion numbers of Ca 2 V 2 O 7 transition are given. It is established that calcium pyrovanadate has a mixed electron-ion conductivity

  12. Preparation of calcium phosphate paste

    International Nuclear Information System (INIS)

    Mohd Reusmaazran Yusof; Norzita Yaacob; Idris Besar; Che Seman Mahmood; Rusnah Mustafa

    2010-01-01

    Calcium phosphate paste were prepared by mixing between calcium sodium potassium phosphate, Ca 2 NaK (PO 4 ) 2 (CSPP) and monocalcium phosphate monohydrate, Ca(H 2 PO 4 ) 2 .H 2 O (MCPM). CSPP were obtained by reaction between calcium hydrogen phosphate (CaHPO 4 ), potassium carbonate (K 2 CO 3 ) and sodium carbonate (Na 2 CO 3 ) in solid state sintering process followed by quenching in air at 1000 degree Celsius. The paste was aging in simulated body fluid (SBF) for 0.5, 1, 3, 6, 12, 24, 48 hrs, 3, 7 and 14 days. The morphological investigation indicated the formation of apatite crystal were first growth after 24 hours. The obvious growth of apatite crystal was shown at 3 days. The obvious growth of apatite crystal was shown in 7 and 14 days indicated the prediction of paste would have rapid reaction with bone after implantation. (author)

  13. Uptake of radiactive calcium by groundnut (Arachis hypogaea L. ) and efficiency of utilisation of applied calcium

    Energy Technology Data Exchange (ETDEWEB)

    Loganathan, S; Krishnamoorthy, K K [Tamil Nadu Agricultural Univ., Coimbatore (India). Dept. of Soil Science and Agricultural Chemistry

    1977-04-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium.

  14. Uptake of radiactive calcium by groundnut (Arachis hypogaea L.) and efficiency of utilisation of applied calcium

    International Nuclear Information System (INIS)

    Loganathan, S.; Krishnamoorthy, K.K.

    1977-01-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium

  15. The effect of habitat geology on calcium intake and calcium status of wild rodents.

    Science.gov (United States)

    Shore, R F; Balment, R J; Yalden, D W

    1991-12-01

    Calcium is essential for normal physiological function, reproduction and growth in mammals but its distribution in the natural environment is heterogeneous. Spatial variation in calcium soil content is especially marked in the Peak District, United Kingdom, where both calcium-rich limestone and calcium-poor gritstone rock types occur. Wood mice Apodemus sylvaticus (L) and bank voles Clethrionomys glareolus (Schreber 1780) from limestone areas had significantly higher calcium concentrations in stomach contents and in faeces compared with their counterparts from gritstone areas. Calcium status was assessed from serum calcium concentration, femur weight, ash content of the body, calcium concentration in the femur and body ash. There was no significant difference in serum calcium concentration, femur calcium concentration and body ash calcium concentration between animals from the limestone and the gritstone. However, on the limestone, bank voles, but not wood mice, had significantly heavier femora and a greater proportion of ash in the body compared with their gritstone counterparts.

  16. Calcium and Bone Metabolism Indices.

    Science.gov (United States)

    Song, Lu

    2017-01-01

    Calcium and inorganic phosphate are of critical importance for many body functions, thus the regulations of their plasma concentrations are tightly controlled by the concerted actions of reabsorption/excretion in the kidney, absorption in the intestines, and exchange from bone, the major reservoir for calcium and phosphate in the body. Parathyroid hormone (PTH) and 1,25-dihydroxyvitamin D (1,25(OH) 2 D) control calcium homeostasis, whereas PTH, 1,25(OH) 2 D, and bone-derived fibroblast growth factor 23 (FGF 23) control phosphate homeostasis. Hypoparathyroidism can cause hypocalcemia and hyperphosphatemia, whereas deficient vitamin D actions can cause osteomalacia in adults and rickets in children. Hyperparathyroidism, alternatively, can cause hypercalcemia and hypophosphatemia. Laboratory tests of calcium, phosphate, PTH, and 25-hydroxyvitamin D are very useful in the diagnosis of abnormalities associated with calcium and/or phosphate metabolisms. Bone is constantly remodeled throughout life in response to mechanical stress and a need for calcium in extracellular fluids. Metabolic bone diseases such as osteoporosis, osteomalacia in adults or rickets in children, and renal osteodystrophy develop when bone resorption exceeds bone formation. Bone turnover markers (BTM) such as serum N-terminal propeptide of type I procollagen (P1NP) and C-terminal collagen cross-link (CTX) may be useful in predicting future fracture risk or monitoring the response to anti-resorptive therapy. There is a need to standardize sample collection protocols because certain BTMs exhibit large circadian variations and tend to be influenced by food intakes. In the United States, a project to standardize BTM sample collection protocols and to establish the reference intervals for serum P1NP and serum CTX is ongoing. We anticipate the outcome of this project to shine lights on the standardization of BTM assays, sample collection protocols, reference intervals in relation to age, sex, and ethnic

  17. Magnetically responsive calcium carbonate microcrystals.

    Science.gov (United States)

    Fakhrullin, Rawil F; Bikmullin, Aidar G; Nurgaliev, Danis K

    2009-09-01

    Here we report the fabrication of magnetically responsive calcium carbonate microcrystals produced by coprecipitation of calcium carbonate in the presence of citrate-stabilized iron oxide nanoparticles. We demonstrate that the calcite microcrystals obtained possess superparamagnetic properties due to incorporated magnetite nanoparticles and can be manipulated by an external magnetic field. The microcrystals doped with magnetic nanoparticles were utilized as templates for the fabrication of hollow polyelectrolyte microcapsules, which retain the magnetic properties of the sacrificial cores and might be spatially manipulated using a permanent magnet, thus providing the magnetic-field-facilitated delivery and separation of materials templated on magnetically responsive calcite microcrystals.

  18. Calcium channel blockers ameliorate iron overload-associated hepatic fibrosis by altering iron transport and stellate cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ying [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Department of Pathology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Chinese Medicine Research on Cardio-Cerebrovascular Disease, Shijiazhuang 050200, Hebei (China); Zhao, Xin [Department of Hepatobiliary Surgery, The Third Hospital of Hebei Medical University, Shijiazhuang 050051, Hebei (China); Chang, Yanzhong [Laboratory of Molecular Iron Metabolism, College of Life Science, Hebei Normal University, Shijiazhuang 050024, Hebei (China); Zhang, Yuanyuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Xi [Department of Pharmacy, The Forth Hospital of Hebei Medical University, Shijiazhuang 050011, Hebei (China); Zhang, Xuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Liu, Zhenyi; Guo, Hui [Department of Medicinal Chemistry, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Wang, Na [Department of Physiology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Gao, Yonggang [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Zhang, Jianping, E-mail: zhangjianping14@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Li, E-mail: chuli0614@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Integrative Medicine on Liver-Kidney Patterns, Shijiazhuang 050200, Hebei (China)

    2016-06-15

    Liver fibrosis is the principal cause of morbidity and mortality in patients with iron overload. Calcium channel blockers (CCBs) can antagonize divalent cation entry into renal and myocardial cells and inhibit fibrogenic gene expression. We investigated the potential of CCBs to resolve iron overload-associated hepatic fibrosis. Kunming mice were assigned to nine groups (n = 8 per group): control, iron overload, deferoxamine, high and low dose verapamil, high and low dose nimodipine, and high and low dose diltiazem. Iron deposition and hepatic fibrosis were measured in mouse livers. Expression levels of molecules associated with transmembrane iron transport were determined by molecular biology approaches. In vitro HSC-T6 cells were randomized into nine groups (the same groups as the mice). Changes in proliferation, apoptosis, and metalloproteinase expression in cells were detected to assess the anti-fibrotic effects of CCBs during iron overload conditions. We found that CCBs reduced hepatic iron content, intracellular iron deposition, the number of hepatic fibrotic areas, collagen expression levels, and hydroxyproline content. CCBs rescued abnormal expression of α1C protein in L-type voltage-dependent calcium channel (LVDCC) and down-regulated divalent metal transporter-1 (DMT-1) expression in mouse livers. In iron-overloaded HSC-T6 cells, CCBs reduced iron deposition, inhibited proliferation, induced apoptosis, and elevated expression of matrix metalloproteinase-13 (MMP-13) and tissue inhibitor of metalloproteinase-1 (TIMP-1). CCBs are potential therapeutic agents that can be used to address hepatic fibrosis during iron overload. They resolve hepatic fibrosis probably correlated with regulating transmembrane iron transport and inhibiting HSC growth. - Highlights: • Calcium channel blockers (CCBs) reduced hepatic iron content. • CCBs decreased hepatic fibrotic areas and collagen expression levels. • CCBs resolve fibrosis by regulating iron transport and

  19. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes.

    Science.gov (United States)

    Samigullin, Dmitry; Fatikhov, Nijaz; Khaziev, Eduard; Skorinkin, Andrey; Nikolsky, Eugeny; Bukharaeva, Ellya

    2014-01-01

    At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers-which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal-has hitherto been technically impossible. With the aim of quantifying both Ca(2+) currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 pA and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 μM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  20. Estimation of presynaptic calcium currents and endogenous calcium buffers at the frog neuromuscular junction with two different calcium fluorescent dyes

    Directory of Open Access Journals (Sweden)

    Dmitry eSamigullin

    2015-01-01

    Full Text Available At the frog neuromuscular junction, under physiological conditions, the direct measurement of calcium currents and of the concentration of intracellular calcium buffers—which determine the kinetics of calcium concentration and neurotransmitter release from the nerve terminal—has hitherto been technically impossible. With the aim of quantifying both Ca2+ currents and the intracellular calcium buffers, we measured fluorescence signals from nerve terminals loaded with the low-affinity calcium dye Magnesium Green or the high-affinity dye Oregon Green BAPTA-1, simultaneously with microelectrode recordings of nerve-action potentials and end-plate currents. The action-potential-induced fluorescence signals in the nerve terminals developed much more slowly than the postsynaptic response. To clarify the reasons for this observation and to define a spatiotemporal profile of intracellular calcium and of the concentration of mobile and fixed calcium buffers, mathematical modeling was employed. The best approximations of the experimental calcium transients for both calcium dyes were obtained when the calcium current had an amplitude of 1.6 ± 0.08 рА and a half-decay time of 1.2 ± 0.06 ms, and when the concentrations of mobile and fixed calcium buffers were 250 ± 13 µM and 8 ± 0.4 mM, respectively. High concentrations of endogenous buffers define the time course of calcium transients after an action potential in the axoplasm, and may modify synaptic plasticity.

  1. Calcium electroporation in three cell lines; a comparison of bleomycin and calcium, calcium compounds, and pulsing conditions

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; Gissel, Hanne; Hojman, Pernille

    2013-01-01

    offers several advantages over standard treatment options: calcium is inexpensive and may readily be applied without special precautions, as is the case with cytostatic drugs. Therefore, details on the use of calcium electroporation are essential for carrying out clinical trials comparing calcium...

  2. Calcium fertilization increases the concentration of calcium in sapwood and calcium oxalate in foliage of red spruce

    Science.gov (United States)

    Kevin T. Smith; Walter C. Shortle; Jon H. Connolly; Rakesh Minocha; Jody Jellison

    2009-01-01

    Calcium cycling plays a key role in the health and productivity of red spruce forests in the northeastern US. A portion of the flowpath of calcium within forests includes translocation as Ca2+ in sapwood and accumulation as crystals of calcium oxalate in foliage. Concentrations of Ca in these tree tissues have been used as markers of...

  3. Vitamin D, Calcium, and Bone Health

    Science.gov (United States)

    ... Bone Health Featured Resource Find an Endocrinologist Search Vitamin D, Calcium, and Bone Health Download PDFs English ... also helps keep your bones strong. Why are vitamin D and calcium important to bone health? Vitamin ...

  4. Complex formation ions calcium with macromolecules pectin

    International Nuclear Information System (INIS)

    Khalikova, M.D.; Avloev, Kh.Kh.; Muhiddinov, Z.K.

    2005-01-01

    In clause the mechanism of sorption of ions of calcium by macromolecules of pectin is opened. Is shown, that the linkage of ions of calcium descends on acid bunches of pectin, and process carries cooperative character

  5. Atomic layer deposition of calcium oxide and calcium hafnium oxide films using calcium cyclopentadienyl precursor

    International Nuclear Information System (INIS)

    Kukli, Kaupo; Ritala, Mikko; Sajavaara, Timo; Haenninen, Timo; Leskelae, Markku

    2006-01-01

    Calcium oxide and calcium hafnium oxide thin films were grown by atomic layer deposition on borosilicate glass and silicon substrates in the temperature range of 205-300 o C. The calcium oxide films were grown from novel calcium cyclopentadienyl precursor and water. Calcium oxide films possessed refractive index 1.75-1.80. Calcium oxide films grown without Al 2 O 3 capping layer occurred hygroscopic and converted to Ca(OH) 2 after exposure to air. As-deposited CaO films were (200)-oriented. CaO covered with Al 2 O 3 capping layers contained relatively low amounts of hydrogen and re-oriented into (111) direction upon annealing at 900 o C. In order to examine the application of CaO in high-permittivity dielectric layers, mixtures of Ca and Hf oxides were grown by alternate CaO and HfO 2 growth cycles at 230 and 300 o C. HfCl 4 was used as a hafnium precursor. When grown at 230 o C, the films were amorphous with equal amounts of Ca and Hf constituents (15 at.%). These films crystallized upon annealing at 750 o C, showing X-ray diffraction peaks characteristic of hafnium-rich phases such as Ca 2 Hf 7 O 16 or Ca 6 Hf 19 O 44 . At 300 o C, the relative Ca content remained below 8 at.%. The crystallized phase well matched with rhombohedral Ca 2 Hf 7 O 16 . The dielectric films grown on Si(100) substrates possessed effective permittivity values in the range of 12.8-14.2

  6. Kinetics of calcium sulfoaluminate formation from tricalcium aluminate, calcium sulfate and calcium oxide

    International Nuclear Information System (INIS)

    Li, Xuerun; Zhang, Yu; Shen, Xiaodong; Wang, Qianqian; Pan, Zhigang

    2014-01-01

    The formation kinetics of tricalcium aluminate (C 3 A) and calcium sulfate yielding calcium sulfoaluminate (C 4 A 3 $) and the decomposition kinetics of calcium sulfoaluminate were investigated by sintering a mixture of synthetic C 3 A and gypsum. The quantitative analysis of the phase composition was performed by X-ray powder diffraction analysis using the Rietveld method. The results showed that the formation reaction 3Ca 3 Al 2 O 6 + CaSO 4 → Ca 4 Al 6 O 12 (SO 4 ) + 6CaO was the primary reaction 4 Al 6 O 12 (SO 4 ) + 10CaO → 6Ca 3 Al 2 O 6 + 2SO 2 ↑ + O 2 ↑ primarily occurred beyond 1350 °C with an activation energy of 792 ± 64 kJ/mol. The optimal formation region for C 4 A 3 $ was from 1150 °C to 1350 °C and from 6 h to 1 h, which could provide useful information on the formation of C 4 A 3 $ containing clinkers. The Jander diffusion model was feasible for the formation and decomposition of calcium sulfoaluminate. Ca 2+ and SO 4 2− were the diffusive species in both the formation and decomposition reactions. -- Highlights: •Formation and decomposition of calcium sulphoaluminate were studied. •Decomposition of calcium sulphoaluminate combined CaO and yielded C 3 A. •Activation energy for formation was 231 ± 42 kJ/mol. •Activation energy for decomposition was 792 ± 64 kJ/mol. •Both the formation and decomposition were controlled by diffusion

  7. Calcium channel blockers and Alzheimer's disease★

    Science.gov (United States)

    Tan, Yi; Deng, Yulin; Qing, Hong

    2012-01-01

    Alzheimer's disease is characterized by two pathological hallmarks: amyloid plaques and neurofibrillary tangles. In addition, calcium homeostasis is disrupted in the course of human aging. Recent research shows that dense plaques can cause functional alteration of calcium signals in mice with Alzheimer's disease. Calcium channel blockers are effective therapeutics for treating Alzheimer's disease. This review provides an overview of the current research of calcium channel blockers involved in Alzheimer's disease therapy. PMID:25767489

  8. 21 CFR 184.1210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium oxide. 184.1210 Section 184.1210 Food and... Substances Affirmed as GRAS § 184.1210 Calcium oxide. (a) Calcium oxide (CaO, CAS Reg. No. 1305-78-8) is also known as lime, quick lime, burnt lime, or calx. It is produced from calcium carbonate, limestone, or...

  9. Oxalic acid decreases calcium absorption in rats

    International Nuclear Information System (INIS)

    Weaver, C.M.; Martin, B.R.; Ebner, J.S.; Krueger, C.A.

    1987-01-01

    Calcium absorption from salts and foods intrinsically labeled with 45 Ca was determined in the rat model. Calcium bioavailability was nearly 10 times greater for low oxalate kale, CaCO 3 and CaCl 2 than from CaC 2 O 4 (calcium oxalate) and spinach (high in oxalates). Extrinsic and intrinsic labeling techniques gave a similar assessment of calcium bioavailability from kale but not from spinach

  10. Calcium and Nuclear Signaling in Prostate Cancer

    OpenAIRE

    Ivan V. Maly; Wilma A. Hofmann

    2018-01-01

    Recently, there have been a number of developments in the fields of calcium and nuclear signaling that point to new avenues for a more effective diagnosis and treatment of prostate cancer. An example is the discovery of new classes of molecules involved in calcium-regulated nuclear import and nuclear calcium signaling, from the G protein-coupled receptor (GPCR) and myosin families. This review surveys the new state of the calcium and nuclear signaling fields with the aim of identifying the un...

  11. 21 CFR 184.1195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium citrate. 184.1195 Section 184.1195 Food and... Substances Affirmed as GRAS § 184.1195 Calcium citrate. (a) Calcium citrate (Ca3(C6H5O7)2·4H2O, CAS Reg. No. 813-0994-095) is the calcium salt of citric acid. It is prepared by neutralizing citric acid with...

  12. 21 CFR 184.1185 - Calcium acetate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium acetate. 184.1185 Section 184.1185 Food and... Substances Affirmed as GRAS § 184.1185 Calcium acetate. (a) Calcium acetate (Ca (C2H3O2)2, CAS Reg. No. 62-54-4), also known as acetate of lime or vinegar salts, is the calcium salt of acetic acid. It may be...

  13. 21 CFR 184.1229 - Calcium stearate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium stearate. 184.1229 Section 184.1229 Food... Specific Substances Affirmed as GRAS § 184.1229 Calcium stearate. (a) Calcium stearate (Ca(C17H35COO)2, CAS Reg. No. 1529-23-0) is the calcium salt of stearic acid derived from edible sources. It is prepared as...

  14. Calcium Balance in Chronic Kidney Disease.

    Science.gov (United States)

    Hill Gallant, Kathleen M; Spiegel, David M

    2017-06-01

    The kidneys play a critical role in the balance between the internal milieu and external environment. Kidney failure is known to disrupt a number of homeostatic mechanisms that control serum calcium and normal bone metabolism. However, our understanding of calcium balance throughout the stages of chronic kidney disease is limited and the concept of balance itself, especially with a cation as complex as calcium, is often misunderstood. Both negative and positive calcium balance have important implications in patients with chronic kidney disease, where negative balance may increase risk of osteoporosis and fracture and positive balance may increase risk of vascular calcification and cardiovascular events. Here, we examine the state of current knowledge about calcium balance in adults throughout the stages of chronic kidney disease and discuss recommendations for clinical strategies to maintain balance as well as future research needs in this area. Recent calcium balance studies in adult patients with chronic kidney disease show that neutral calcium balance is achieved with calcium intake near the recommended daily allowance. Increases in calcium through diet or supplements cause high positive calcium balance, which may put patients at risk for vascular calcification. However, heterogeneity in calcium balance exists among these patients. Given the available calcium balance data in this population, it appears clinically prudent to aim for recommended calcium intakes around 1000 mg/day to achieve neutral calcium balance and avoid adverse effects of either negative or positive calcium balance. Assessment of patients' dietary calcium intake could further equip clinicians to make individualized recommendations for meeting recommended intakes.

  15. 21 CFR 184.1193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium chloride. 184.1193 Section 184.1193 Food... Specific Substances Affirmed as GRAS § 184.1193 Calcium chloride. (a) Calcium chloride (CaCl2·2H2O, CAS Reg. No. 10035-04-8) or anhydrous calcium chloride (CaCl2, CAS Reg. No. 10043-52-4) may be commercially...

  16. The Electronic Structure of Calcium

    DEFF Research Database (Denmark)

    Jan, J.-P.; Skriver, Hans Lomholt

    1981-01-01

    The electronic structure of calcium under pressure is re-examined by means of self-consistent energy band calculations based on the local density approximation and using the linear muffin-tin orbitals (LMTO) method with corrections to the atomic sphere approximation included. At zero pressure...

  17. The impact of calcium assay change on a local adjusted calcium equation.

    Science.gov (United States)

    Davies, Sarah L; Hill, Charlotte; Bailey, Lisa M; Davison, Andrew S; Milan, Anna M

    2016-03-01

    Deriving and validating local adjusted calcium equations is important for ensuring appropriate calcium status classification. We investigated the impact on our local adjusted calcium equation of a change in calcium method by the manufacturer from cresolphthalein complexone to NM-BAPTA. Calcium and albumin results from general practice requests were extracted from the Laboratory Information Management system for a three-month period. Results for which there was evidence of disturbance in calcium homeostasis were excluded leaving 13,482 sets of results for analysis. The adjusted calcium equation was derived following least squares regression analysis of total calcium on albumin and normalized to the mean calcium concentration of the data-set. The revised equation (NM-BAPTA calcium method) was compared with the previous equation (cresolphthalein complexone calcium method). The switch in calcium assay resulted in a small change in the adjusted calcium equation but was not considered to be clinically significant. The calcium reference interval differed from that proposed by Pathology Harmony in the UK. Local adjusted calcium equations should be re-assessed following changes in the calcium method. A locally derived reference interval may differ from the consensus harmonized reference interval. © The Author(s) 2015.

  18. Absorbability of calcium from calcium-bound phosphoryl oligosaccharides in comparison with that from various calcium compounds in the rat ligated jejunum loop.

    Science.gov (United States)

    To-o, Kenji; Kamasaka, Hiroshi; Nishimura, Takahisa; Kuriki, Takashi; Saeki, Shigeru; Nakabou, Yukihiro

    2003-08-01

    Calcium-bound phosphoryl oligosaccharides (POs-Ca) were prepared from potato starch. Their solubility and in situ absorbability as a calcium source were investigated by comparing with the soluble calcium compounds, calcium chloride and calcium lactate, or insoluble calcium compounds, calcium carbonate and dibasic calcium phosphate. The solubility of POs-Ca was as high as that of calcium chloride and about 3-fold higher than that of calcium lactate. An in situ experiment showed that the intestinal calcium absorption rate of POs-Ca was almost comparable with that of the soluble calcium compounds, and was significantly higher (pcalcium groups. Moreover, the total absorption rate of a 1:1 mixture of the calcium from POs-Ca and a whey mineral complex (WMC) was significantly higher (psoluble calcium source with relatively high absorption in the intestinal tract.

  19. Anoctamin Calcium-Activated Chloride Channels May Modulate Inhibitory Transmission in the Cerebellar Cortex.

    Directory of Open Access Journals (Sweden)

    Weiping Zhang

    Full Text Available Calcium-activated chloride channels of the anoctamin (alias TMEM16 protein family fulfill critical functions in epithelial fluid transport, smooth muscle contraction and sensory signal processing. Little is known, however, about their contribution to information processing in the central nervous system. Here we examined the recent finding that a calcium-dependent chloride conductance impacts on GABAergic synaptic inhibition in Purkinje cells of the cerebellum. We asked whether anoctamin channels may underlie this chloride conductance. We identified two anoctamin channel proteins, ANO1 and ANO2, in the cerebellar cortex. ANO1 was expressed in inhibitory interneurons of the molecular layer and the granule cell layer. Both channels were expressed in Purkinje cells but, while ANO1 appeared to be retained in the cell body, ANO2 was targeted to the dendritic tree. Functional studies confirmed that ANO2 was involved in a calcium-dependent mode of ionic plasticity that reduces the efficacy of GABAergic synapses. ANO2 channels attenuated GABAergic transmission by increasing the postsynaptic chloride concentration, hence reducing the driving force for chloride influx. Our data suggest that ANO2 channels are involved in a Ca2+-dependent regulation of synaptic weight in GABAergic inhibition. Thus, in balance with the chloride extrusion mechanism via the co-transporter KCC2, ANO2 appears to regulate ionic plasticity in the cerebellum.

  20. 21 CFR 582.1210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium oxide. 582.1210 Section 582.1210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS....1210 Calcium oxide. (a) Product. Calcium oxide. (b) Conditions of use. This substance is generally...

  1. 21 CFR 582.5210 - Calcium oxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium oxide. 582.5210 Section 582.5210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS... 1 § 582.5210 Calcium oxide. (a) Product. Calcium oxide. (b) Conditions of use. This substance is...

  2. Lactulose stimulates calcium absorption in postmenopausal women

    NARCIS (Netherlands)

    Heuvel, E.G.H.M. van den; Muijs, T.; Dokkum, W. van; Schaafsma, G.

    1999-01-01

    Animal studies have indicated that calcium absorption is increased by lactulose, a synthetic disaccharide. Therefore, the influence of lactulose on calcium absorption was measured in postmenopausal women who may benefit from the possible enhancing effect of lactulose on calcium absorption. Twelve

  3. 21 CFR 182.3225 - Calcium sorbate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium sorbate. 182.3225 Section 182.3225 Food and... CONSUMPTION (CONTINUED) SUBSTANCES GENERALLY RECOGNIZED AS SAFE Chemical Preservatives § 182.3225 Calcium sorbate. (a) Product. Calcium sorbate. (b) Conditions of use. This substance is generally recognized as...

  4. 21 CFR 582.5230 - Calcium sulfate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium sulfate. 582.5230 Section 582.5230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5230 Calcium sulfate. (a) Product. Calcium sulfate. (b) Conditions of use. This substance...

  5. 21 CFR 582.6185 - Calcium acetate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium acetate. 582.6185 Section 582.6185 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium acetate. (a) Product. Calcium acetate. (b) Conditions of use. This substance is generally...

  6. 21 CFR 582.5195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.5195 Section 582.5195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5195 Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance...

  7. 21 CFR 582.3225 - Calcium sorbate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium sorbate. 582.3225 Section 582.3225 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL....3225 Calcium sorbate. (a) Product. Calcium sorbate. (b) Conditions of use. This substance is generally...

  8. 21 CFR 582.6195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.6195 Section 582.6195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance is generally...

  9. 21 CFR 582.6219 - Calcium phytate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium phytate. 582.6219 Section 582.6219 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium phytate. (a) Product. Calcium phytate. (b) Conditions of use. This substance is generally...

  10. 21 CFR 582.1207 - Calcium lactate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium lactate. 582.1207 Section 582.1207 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1207 Calcium lactate. (a) Product. Calcium lactate. (b) Conditions of use. This substance is...

  11. 21 CFR 182.2227 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium silicate. 182.2227 Section 182.2227 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Calcium silicate. (a) Product. Calcium silicate. (b) Tolerance. 2 percent and 5 percent. (c) Limitations...

  12. 21 CFR 582.1195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium citrate. 582.1195 Section 582.1195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1195 Calcium citrate. (a) Product. Calcium citrate. (b) Conditions of use. This substance is...

  13. 21 CFR 582.7187 - Calcium alginate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium alginate. 582.7187 Section 582.7187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium alginate. (a) Product. Calcium alginate. (b) Conditions of use. This substance is generally...

  14. 21 CFR 582.2227 - Calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium silicate. 582.2227 Section 582.2227 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium silicate. (a) Product. Calcium silicate. (b) Tolerance. 2 percent and 5 percent. (c) Limitations...

  15. Mechanism of store-operated calcium entry

    Indian Academy of Sciences (India)

    Activation of receptors coupled to the phospholipase C/IP3 signalling pathway results in a rapid release of calcium from its intracellular stores, eventually leading to depletion of these stores. Calcium store depletion triggers an influx of extracellular calcium across the plasma membrane, a mechanism known as the ...

  16. 21 CFR 201.70 - Calcium labeling.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Calcium labeling. 201.70 Section 201.70 Food and... LABELING Labeling Requirements for Over-the-Counter Drugs § 201.70 Calcium labeling. (a) The labeling of over-the-counter (OTC) drug products intended for oral ingestion shall contain the calcium content per...

  17. Preparation and properties of calcium zirconate

    International Nuclear Information System (INIS)

    Dudek, M.; Bucko, M.; Rog, G.

    2001-01-01

    Dense samples of calcium zirconate were prepared. Electrical conductivity of the samples were measured in the temperature range 873 - 1273 K by both the d.c. four probe and the impedance spectroscopy methods. Calcium zirconate with small excess of calcium oxide appeared to be oxygen ion conductor. It was applied as an electrolyte in solid-state galvanic cells. (author)

  18. Calcium dynamics in vascular smooth muscle

    OpenAIRE

    Amberg, Gregory C.; Navedo, Manuel F.

    2013-01-01

    Smooth muscle cells are ultimately responsible for determining vascular luminal diameter and blood flow. Dynamic changes in intracellular calcium are a critical mechanism regulating vascular smooth muscle contractility. Processes influencing intracellular calcium are therefore important regulators of vascular function with physiological and pathophysiological consequences. In this review we discuss the major dynamic calcium signals identified and characterized in vascular smooth muscle cells....

  19. 21 CFR 582.6193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium chloride. 582.6193 Section 582.6193 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Calcium chloride. (a) Product. Calcium chloride. (b) Conditions of use. This substance is generally...

  20. 21 CFR 582.1193 - Calcium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium chloride. 582.1193 Section 582.1193 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1193 Calcium chloride. (a) Product. Calcium chloride. (b) Conditions of use. This substance...

  1. 7 CFR 58.434 - Calcium chloride.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Calcium chloride. 58.434 Section 58.434 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... Material § 58.434 Calcium chloride. Calcium chloride, when used, shall meet the requirements of the Food...

  2. Mammary-Specific Ablation of the Calcium-Sensing Receptor During Lactation Alters Maternal Calcium Metabolism, Milk Calcium Transport, and Neonatal Calcium Accrual

    Science.gov (United States)

    Mamillapalli, Ramanaiah; VanHouten, Joshua; Dann, Pamela; Bikle, Daniel; Chang, Wenhan; Brown, Edward

    2013-01-01

    To meet the demands for milk calcium, the lactating mother adjusts systemic calcium and bone metabolism by increasing dietary calcium intake, increasing bone resorption, and reducing renal calcium excretion. As part of this adaptation, the lactating mammary gland secretes PTHrP into the maternal circulation to increase bone turnover and mobilize skeletal calcium stores. Previous data have suggested that, during lactation, the breast relies on the calcium-sensing receptor (CaSR) to coordinate PTHrP secretion and milk calcium transport with calcium availability. To test this idea genetically, we bred BLG-Cre mice with CaSR-floxed mice to ablate the CaSR specifically from mammary epithelial cells only at the onset of lactation (CaSR-cKO mice). Loss of the CaSR in the lactating mammary gland did not disrupt alveolar differentiation or milk production. However, it did increase the secretion of PTHrP into milk and decreased the transport of calcium from the circulation into milk. CaSR-cKO mice did not show accelerated bone resorption, but they did have a decrease in bone formation. Loss of the mammary gland CaSR resulted in hypercalcemia, decreased PTH secretion, and increased renal calcium excretion in lactating mothers. Finally, loss of the mammary gland CaSR resulted in decreased calcium accrual by suckling neonates, likely due to the combination of increased milk PTHrP and decreased milk calcium. These results demonstrate that the mammary gland CaSR coordinates maternal bone and calcium metabolism, calcium transport into milk, and neonatal calcium accrual during lactation. PMID:23782944

  3. Effect of anions or foods on absolute bioavailability of calcium from calcium salts in mice by pharmacokinetics

    OpenAIRE

    Zenei Taira, Zenei; Ueda,Yukari

    2013-01-01

    Yukari Ueda, Zenei TairaFaculty of Pharmaceutical Sciences, Tokushima Bunri University, Tokushima, JapanAbstract: We studied the absolute bioavailability of calcium from calcium L-lactate in mice using pharmacokinetics, and reviewed the absolute bioavailability of calcium from three other calcium salts in mice previously studied: calcium chloride, calcium acetate, and calcium ascorbate. The results showed that calcium metabolism is linear between intravenous administration of 15 mg/kg and 30 ...

  4. Mutation mechanisms that underlie turnover of a human telomere-adjacent segmental duplication containing an unstable minisatellite.

    Science.gov (United States)

    Hills, Mark; Jeyapalan, Jennie N; Foxon, Jennifer L; Royle, Nicola J

    2007-04-01

    Subterminal regions, juxtaposed to telomeres on human chromosomes, contain a high density of segmental duplications, but relatively little is known about the evolutionary processes that underlie sequence turnover in these regions. We have characterized a segmental duplication adjacent to the Xp/Yp telomere, each copy containing a hypervariable array of the DXYS14 minisatellite. Both DXYS14 repeat arrays mutate at a high rate (0.3 and 0.2% per gamete) but linkage disequilibrium analysis across 27 SNPs and a direct crossover assay show that recombination during meiosis is suppressed. Therefore instability at DXYS14a and b is dominated by intra-allelic processes or possibly conversion limited to the repeat arrays. Furthermore some chromosomes (14%) carry only one copy of the duplicon, including one DXYS14 repeat array that is also highly mutable (1.2% per gamete). To explain these and other observations, we propose there is another low-rate mutation process that causes copy number change in part or all of the duplicon.

  5. The relationship between female brooding and male nestling provisioning: does climate underlie geographic variation in sex roles?

    Science.gov (United States)

    Yoon, Jongmin; Sofaer, Helen R.; Sillett, T. Scott; Morrison, Scott A.; Ghalambor, Cameron K.

    2017-01-01

    Comparative studies of populations occupying different environments can provide insights into the ecological conditions affecting differences in parental strategies, including the relative contributions of males and females. Male and female parental strategies reflect the interplay between ecological conditions, the contributions of the social mate, and the needs of offspring. Climate is expected to underlie geographic variation in incubation and brooding behavior, and can thereby affect both the absolute and relative contributions of each sex to other aspects of parental care such as offspring provisioning. However, geographic variation in brooding behavior has received much less attention than variation in incubation attentiveness or provisioning rates. We compared parental behavior during the nestling period in populations of orange-crowned warblers Oreothlypis celata near the northern (64°N) and southern (33°N) boundaries of the breeding range. In Alaska, we found that males were responsible for the majority of food delivery whereas the sexes contributed equally to provisioning in California. Higher male provisioning in Alaska appeared to facilitate a higher proportion of time females spent brooding the nestlings. Surprisingly, differences in brooding between populations could not be explained by variation in ambient temperature, which was similar between populations during the nestling period. While these results represent a single population contrast, they suggest additional hypotheses for the ecological correlates and evolutionary drivers of geographic variation in brooding behavior, and the factors that shape the contributions of each sex.

  6. Left insular cortex and left SFG underlie prismatic adaptation effects on time perception: evidence from fMRI.

    Science.gov (United States)

    Magnani, Barbara; Frassinetti, Francesca; Ditye, Thomas; Oliveri, Massimiliano; Costantini, Marcello; Walsh, Vincent

    2014-05-15

    Prismatic adaptation (PA) has been shown to affect left-to-right spatial representations of temporal durations. A leftward aftereffect usually distorts time representation toward an underestimation, while rightward aftereffect usually results in an overestimation of temporal durations. Here, we used functional magnetic resonance imaging (fMRI) to study the neural mechanisms that underlie PA effects on time perception. Additionally, we investigated whether the effect of PA on time is transient or stable and, in the case of stability, which cortical areas are responsible of its maintenance. Functional brain images were acquired while participants (n=17) performed a time reproduction task and a control-task before, immediately after and 30 min after PA inducing a leftward aftereffect, administered outside the scanner. The leftward aftereffect induced an underestimation of time intervals that lasted for at least 30 min. The left anterior insula and the left superior frontal gyrus showed increased functional activation immediately after versus before PA in the time versus the control-task, suggesting these brain areas to be involved in the executive spatial manipulation of the representation of time. The left middle frontal gyrus showed an increase of activation after 30 min with respect to before PA. This suggests that this brain region may play a key role in the maintenance of the PA effect over time. Copyright © 2014. Published by Elsevier Inc.

  7. Radioisotope 45Ca labeling four calcium chemical compounds and tracing calcium bioavailability

    International Nuclear Information System (INIS)

    Zheng Hui; Zhen Rong; Niu Huisheng; Li Huaifen

    2004-01-01

    Objective: To build up a new method of the radioisotope 45 Ca labeling four calcium chemical compounds, observe and tracing bioavailability change of calcium labeled with radioisotope 45 Ca. Methods: The calcium gluconate (Ca-Glu), calcium citrate (Ca-Cit), calcium carbonate (Ca-Car) and calcium L-threonate (Ca-Thr)were labeled by radioisotope 45 Ca. Four calcium chemical compounds of 45 Ca labeling were used of calcium content 200 mg/kg in the rats and measure the absorption content and bioavailability of calcium in tissue of heart, lever spleen, stomach, kidney, brain, intestine, whole blood, urine, faeces. Results: 1) Radioisotope 45 Ca labeling calcium chemical compound has high radio intensity, more steady standard curve and recover rate. 2) The absorption of organic calcium chemical compounds is higher than the inorganic calcium chemical compound in the study of calcium bioavailability. Conclusion: The method of tracing with radioisotope 45 Ca labeling calcium chemical compounds has the characteristic of the sensitive, objective, accurate and steady in the study of calcium bioavailability

  8. Calcium regulation and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Deepthi Rapaka

    2014-09-01

    Full Text Available Activation of the neuron induces transient fluctuations in [Ca2+]i. This transient rise in [Ca2+]i is dependent on calcium entry via calcium channels and release of calcium from intracellular stores, finally resulting in increase in calcium levels, which activates calcium regulatory proteins to restore the resting calcium levels by binding to the calcium-binding proteins, sequestration into the endoplasmic reticulum and the mitochondria, and finally extrusion of calcium spike potential from the cell by adenosine triphosphate-driven Ca2+ pumps and the Na+/Ca2+ exchanger. Improper regulation of calcium signaling, sequentially, likely contributes to synaptic dysfunction and excitotoxic and/or apoptotic death of the vulnerable neuronal populations. The cognitive decline associated with normal aging is not only due to neuronal loss, but is fairly the result of synaptic connectivity. Many evidences support that Ca2+ dyshomeostasis is implicated in normal brain aging. Thus the chief factor associated with Alzheimer’s disease was found to be increase in the levels of free intracellular calcium, demonstrating that the excessive levels might lead to cell death, which provides a key target for the calcium channel blockers might be used as the neuroprotective agents in Alzheimer’s disease.

  9. Hip mechanics underlie lower extremity power training-induced increase in old adults' fast gait velocity : The Potsdam Gait Study (POGS)

    NARCIS (Netherlands)

    Beijersbergen, Chantal M. I.; Granacher, Urs; Gäbler, Martijn; DeVita, Paul; Hortobagyi, Tibor

    Background: Aging is associated with slowed gait and old compared with young adults generally walk with greater positive hip work (H1) and reduced positive ankle work (A2). The role of exercise interventions on old adults' gait mechanics that underlie training-induced improvements in gait velocity

  10. Presynaptic calcium signalling in cerebellar mossy fibres

    DEFF Research Database (Denmark)

    Thomsen, Louiza Bohn; Jörntell, Henrik; Midtgaard, Jens

    2010-01-01

    Whole-cell recordings were obtained from mossy fibre terminals in adult turtles in order to characterize the basic membrane properties. Calcium imaging of presynaptic calcium signals was carried out in order to analyse calcium dynamics and presynaptic GABA B inhibition. A tetrodotoxin (TTX......)-sensitive fast Na(+) spike faithfully followed repetitive depolarizing pulses with little change in spike duration or amplitude, while a strong outward rectification dominated responses to long-lasting depolarizations. High-threshold calcium spikes were uncovered following addition of potassium channel blockers....... Calcium imaging using Calcium-Green dextran revealed a stimulus-evoked all-or-none TTX-sensitive calcium signal in simple and complex rosettes. All compartments of a complex rosette were activated during electrical activation of the mossy fibre, while individual simple and complex rosettes along an axon...

  11. Seasonal Variations in Mercury's Dayside Calcium Exosphere

    Science.gov (United States)

    Burger, Matthew H.; Killen, Rosemary M.; McClintock, William E.; Merkel, Aimee W.; Vervack, Ronald J., Jr.; Cassidy, Timothy A.; Sarantos, Menelaos

    2014-01-01

    The Mercury Atmospheric and Surface Composition Spectrometer on the MESSENGER spacecraft has observed calcium emission in Mercury's exosphere on a near-daily basis since March 2011. During MESSENGER's primary and first extended missions (March 2011 - March 2013) the dayside calcium exosphere was measured over eight Mercury years. We have simulated these data with a Monte Carlo model of exospheric source processes to show that (a) there is a persistent source of energetic calcium located in the dawn equatorial region, (b) there is a seasonal dependence in the calcium source rate, and (c) there are no obvious year-to-year variations in the near-surface dayside calcium exosphere. Although the precise mechanism responsible for ejecting the calcium has not yet been determined, the most likely process is the dissociation of Ca-bearing molecules produced in micrometeoroid impact plumes to form energetic, escaping calcium atoms.

  12. Intracellular sphingosine releases calcium from lysosomes.

    Science.gov (United States)

    Höglinger, Doris; Haberkant, Per; Aguilera-Romero, Auxiliadora; Riezman, Howard; Porter, Forbes D; Platt, Frances M; Galione, Antony; Schultz, Carsten

    2015-11-27

    To elucidate new functions of sphingosine (Sph), we demonstrate that the spontaneous elevation of intracellular Sph levels via caged Sph leads to a significant and transient calcium release from acidic stores that is independent of sphingosine 1-phosphate, extracellular and ER calcium levels. This photo-induced Sph-driven calcium release requires the two-pore channel 1 (TPC1) residing on endosomes and lysosomes. Further, uncaging of Sph leads to the translocation of the autophagy-relevant transcription factor EB (TFEB) to the nucleus specifically after lysosomal calcium release. We confirm that Sph accumulates in late endosomes and lysosomes of cells derived from Niemann-Pick disease type C (NPC) patients and demonstrate a greatly reduced calcium release upon Sph uncaging. We conclude that sphingosine is a positive regulator of calcium release from acidic stores and that understanding the interplay between Sph homeostasis, calcium signaling and autophagy will be crucial in developing new therapies for lipid storage disorders such as NPC.

  13. Effect of purines on calcium-independent acetylcholine release at the mouse neuromuscular junction.

    Science.gov (United States)

    Veggetti, M; Muchnik, S; Losavio, A

    2008-07-17

    At the mouse neuromuscular junction, activation of adenosine A(1) and P2Y receptors inhibits acetylcholine release by an effect on voltage dependent calcium channels related to spontaneous and evoked secretion. However, an effect of purines upon the neurotransmitter-releasing machinery downstream of Ca(2+) influx cannot be ruled out. An excellent tool to study neurotransmitter exocytosis in a Ca(2+)-independent step is the hypertonic response. Intracellular recordings were performed on diaphragm fibers of CF1 mice to determine the action of the specific adenosine A(1) receptor agonist 2-chloro-N(6)-cyclopentyl-adenosine (CCPA) and the P2Y(12-13) agonist 2-methylthio-adenosine 5'-diphosphate (2-MeSADP) on the hypertonic response. Both purines significantly decreased such response (peak and area under the curve), and their effect was prevented by specific antagonists of A(1) and P2Y(12-13) receptors, 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) and N-[2-(methylthioethyl)]-2-[3,3,3-trifluoropropyl]thio-5'-adenylic acid, monoanhydride with dichloromethylenebiphosphonic acid, tetrasodium salt (AR-C69931MX), respectively. Moreover, incubation of preparations only with the antagonists induced a higher response compared with controls, suggesting that endogenous ATP/ADP and adenosine are able to modulate the hypertonic response by activating their specific receptors. To search for the intracellular pathways involved in this effect, we studied the action of CCPA and 2-MeSADP in hypertonicity in the presence of inhibitors of several pathways. We found that the effect of CPPA was prevented by the calmodulin antagonist N-(6-aminohexil)-5-chloro-1-naphthalenesulfonamide hydrochloride (W-7) while that of 2-MeSADP was occluded by the protein kinase C antagonist chelerythrine and W-7. On the other hand, the inhibitors of protein kinase A (N-(2[pbromocinnamylamino]-ethyl)-5-isoquinolinesulfonamide, H-89) and phosphoinositide-3 kinase (PI3K) (2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran

  14. Exopolysaccharides regulate calcium flow in cariogenic biofilms

    Science.gov (United States)

    Varenganayil, Muth M.; Decho, Alan W.

    2017-01-01

    Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS) provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya’s agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC) by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR) spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC). Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries. PMID:29023506

  15. Exopolysaccharides regulate calcium flow in cariogenic biofilms.

    Directory of Open Access Journals (Sweden)

    Monika Astasov-Frauenhoffer

    Full Text Available Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya's agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC. Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries.

  16. Trafficking of neuronal calcium channels

    Czech Academy of Sciences Publication Activity Database

    Weiss, Norbert; Zamponi, G. W.

    2017-01-01

    Roč. 1, č. 1 (2017), č. článku NS20160003. ISSN 2059-6553 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channel * neuron * trafficing Subject RIV: ED - Physiology OBOR OECD: Physiology (including cytology) http://www.neuronalsignaling.org/content/1/1/NS20160003

  17. Constraining Calcium Production in Novae

    Science.gov (United States)

    Tiwari, Pranjal; C. Fry, C. Wrede Team; A. Chen, J. Liang Collaboration; S. Bishop, T. Faestermann, D. Seiler Collaboration; R. Hertenberger, H. Wirth Collaboration

    2017-09-01

    Calcium is an element that can be produced by thermonuclear reactions in the hottest classical novae. There are discrepancies between the abundance of Calcium observed in novae and expectations based on astrophysical models. Unbound states 1 MeV above the proton threshold affect the production of Calcium in nova models because they act as resonances in the 38 K(p , γ) 39 Ca reaction present. This work describes an experiment to measure the energies of the excited states of 39 Ca . We will bombard a thin target of 40 Ca with a beam of 22 MeV deuterons, resulting in tritons and 39Ca. We will use a Q3D magnetic spectrograph from the MLL in Garching, Germany to momenta analyze the tritons to observe the excitation energies of the resulting 39 Ca states. Simulations have been run to determine the optimal spectrograph settings. We decided to use a chemically stable target composed of CaF2 , doing so resulted in an extra contaminant, Fluorine, which is dealt with by measuring the background from a LiF target. These simulations have led to settings and targets that will result in the observation of the 39 Ca states of interest with minimal interference from contaminants. Preliminary results from this experiment will be presented. National Sciences and Engineering Research Council of Canada and U.S. National Science Foundation.

  18. Chronic alcohol feeding potentiates hormone-induced calcium signalling in hepatocytes.

    Science.gov (United States)

    Bartlett, Paula J; Antony, Anil Noronha; Agarwal, Amit; Hilly, Mauricette; Prince, Victoria L; Combettes, Laurent; Hoek, Jan B; Gaspers, Lawrence D

    2017-05-15

    Chronic alcohol consumption causes a spectrum of liver diseases, but the pathogenic mechanisms driving the onset and progression of disease are not clearly defined. We show that chronic alcohol feeding sensitizes rat hepatocytes to Ca 2+ -mobilizing hormones resulting in a leftward shift in the concentration-response relationship and the transition from oscillatory to more sustained and prolonged Ca 2+ increases. Our data demonstrate that alcohol-dependent adaptation in the Ca 2+ signalling pathway occurs at the level of hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) production and does not involve changes in the sensitivity of the IP 3 receptor or size of internal Ca 2+ stores. We suggest that prolonged and aberrant hormone-evoked Ca 2+ increases may stimulate the production of mitochondrial reactive oxygen species and contribute to alcohol-induced hepatocyte injury. ABSTRACT: 'Adaptive' responses of the liver to chronic alcohol consumption may underlie the development of cell and tissue injury. Alcohol administration can perturb multiple signalling pathways including phosphoinositide-dependent cytosolic calcium ([Ca 2+ ] i ) increases, which can adversely affect mitochondrial Ca 2+ levels, reactive oxygen species production and energy metabolism. Our data indicate that chronic alcohol feeding induces a leftward shift in the dose-response for Ca 2+ -mobilizing hormones resulting in more sustained and prolonged [Ca 2+ ] i increases in both cultured hepatocytes and hepatocytes within the intact perfused liver. Ca 2+ increases were initiated at lower hormone concentrations, and intercellular calcium wave propagation rates were faster in alcoholics compared to controls. Acute alcohol treatment (25 mm) completely inhibited hormone-induced calcium increases in control livers, but not after chronic alcohol-feeding, suggesting desensitization to the inhibitory actions of ethanol. Hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) accumulation and phospholipase C

  19. Distinct moieties underlie biphasic H+ gating of connexin43 channels, producing a pH optimum for intercellular communication

    Science.gov (United States)

    Garciarena, Carolina D.; Malik, Akif; Swietach, Pawel; Moreno, Alonso P.; Vaughan-Jones, Richard D.

    2018-01-01

    Most mammalian cells can intercommunicate via connexin-assembled, gap-junctional channels. To regulate signal transmission, connexin (Cx) channel permeability must respond dynamically to physiological and pathophysiological stimuli. One key stimulus is intracellular pH (pHi), which is modulated by a tissue’s metabolic and perfusion status. Our understanding of the molecular mechanism of H+ gating of Cx43 channels—the major isoform in the heart and brain—is incomplete. To interrogate the effects of acidic and alkaline pHi on Cx43 channels, we combined voltage-clamp electrophysiology with pHi imaging and photolytic H+ uncaging, performed over a range of pHi values. We demonstrate that Cx43 channels expressed in HeLa or N2a cell pairs are gated biphasically by pHi via a process that consists of activation by H+ ions at alkaline pHi and inhibition at more acidic pHi. For Cx43 channel–mediated solute/ion transmission, the ensemble of these effects produces a pHi optimum, near resting pHi. By using Cx43 mutants, we demonstrate that alkaline gating involves cysteine residues of the C terminus and is independent of motifs previously implicated in acidic gating. Thus, we present a molecular mechanism by which cytoplasmic acid–base chemistry fine tunes intercellular communication and establishes conditions for the optimal transmission of solutes and signals in tissues, such as the heart and brain.—Garciarena, C. D., Malik, A., Swietach, P., Moreno, A. P., Vaughan-Jones, R. D. Distinct moieties underlie biphasic H+ gating of connexin43 channels, producing a pH optimum for intercellular communication. PMID:29183963

  20. Rapid screening assay for calcium bioavailability studies

    International Nuclear Information System (INIS)

    Luhrsen, K.R.; Hudepohl, G.R.; Smith, K.T.

    1986-01-01

    Calcium bioavailability has been studied by numerous techniques. The authors report here the use of the gamma emitting isotope of calcium ( 47 Ca) in a whole body retention assay system. In this system, calcium sources are administered by oral gavage and subsequent counts are determined and corrected for isotopic decay. Unlike iron and zinc retention curves, which exhibit a 2-3 day equilibration period, calcium reaches equilibration after 24 hours. Autoradiographic analysis of the femurs indicate that the newly absorbed calcium is rapidly distributed to the skeletal system. Moreover, the isotope is distributed along the entire bone. Comparisons of calcium bioavailability were made using intrinsic/extrinsic labeled milk from two species i.e. rat and goat as well as CaCO 3 . In addition, extrinsic labeled cow milk was examined. In the rat, the extrinsic labeled calcium from milk was better absorbed than the intrinsic calcium. This was not the case in goat milk or the calcium carbonate which exhibited no significant differences. Chromatographic analysis of the labeled milk indicates a difference in distribution of the 47 Ca. From these data, the authors recommend the use of this assay system in calcium bioavailability studies. The labeling studies and comparisons indicate caution should be used, however, in labeling techniques and species milk comparison

  1. The Role of Calcium in Osteoporosis

    Science.gov (United States)

    Arnaud, C. D.; Sanchez, S. D.

    1991-01-01

    Calcium requirements may vary throughout the lifespan. During the growth years and up to age 25 to 30, it is important to maximize dietary intake of calcium to maintain positive calcium balance and achieve peak bone mass, thereby possibly decreasing the risk of fracture when bone is subsequently lost. Calcium intake need not be greater than 800 mg/day during the relatively short period of time between the end of bone building and the onset of bone loss (30 to 40 years). Starting at age 40 to 50, both men and women lose bone slowly, but women lose bone more rapidly around the menopause and for about 10 years after. Intestinal calcium absorption and the ability to adapt to low calcium diets are impaired in many postmenopausal women and elderly persons owing to a suspected functional or absolute decrease in the ability of the kidney to produce 1,25(OH)2D2. The bones then become more and more a source of calcium to maintain critical extracellular fluid calcium levels. Excessive dietary intake of protein and fiber may induce significant negative calcium balance and thus increase dietary calcium requirements. Generally, the strongest risk factors for osteoporosis are uncontrollable (e.g., sex, age, and race) or less controllable (e.g., disease and medications). However, several factors such as diet, physical activity, cigarette smoking, and alcohol use are lifestyle related and can be modified to help reduce the risk of osteoporosis.

  2. Vitamin E isomer δ-tocopherol enhances the efficiency of neural stem cell differentiation via L-type calcium channel.

    Science.gov (United States)

    Deng, Sihao; Hou, Guoqiang; Xue, Zhiqin; Zhang, Longmei; Zhou, Yuye; Liu, Chao; Liu, Yanqing; Li, Zhiyuan

    2015-01-12

    The effects of the vitamin E isomer δ-tocopherol on neural stem cell (NSC) differentiation have not been investigated until now. Here we investigated the effects of δ-tocopherol on NSC neural differentiation, maturation and its possible mechanisms. Neonatal rat NSCs were grown in suspended neurosphere cultures, and were identified by their expression of nestin protein and their capacity for self-renewal. Treatment with a low concentration of δ-tocopherol induced a significant increase in the percentage of β-III-tubulin-positive cells. δ-Tocopherol also stimulated morphological maturation of neurons in culture. We further observed that δ-tocopherol stimulation increased the expression of voltage-dependent Ca(2+) channels. Moreover, a L-type specific Ca(2+) channel blocker verapamil reduced the percentage of differentiated neurons after δ-tocopherol treatment, and blocked the effects of δ-tocopherol on NSC differentiation into neurons. Together, our study demonstrates that δ-tocopherol may act through elevation of L-type calcium channel activity to increase neuronal differentiation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. The Risks and Benefits of Calcium Supplementation

    Directory of Open Access Journals (Sweden)

    Chan Soo Shin

    2015-03-01

    Full Text Available The association between calcium supplementation and adverse cardiovascular events has recently become a topic of debate due to the publication of two epidemiological studies and one meta-analysis of randomized controlled clinical trials. The reports indicate that there is a significant increase in adverse cardiovascular events following supplementation with calcium; however, a number of experts have raised several issues with these reports such as inconsistencies in attempts to reproduce the findings in other populations and questions concerning the validity of the data due to low compliance, biases in case ascertainment, and/or a lack of adjustment. Additionally, the Auckland Calcium Study, the Women's Health Initiative, and many other studies included in the meta-analysis obtained data from calcium-replete subjects and it is not clear whether the same risk profile would be observed in populations with low calcium intakes. Dietary calcium intake varies widely throughout the world and it is especially low in East Asia, although the risk of cardiovascular events is less prominent in this region. Therefore, clarification is necessary regarding the occurrence of adverse cardiovascular events following calcium supplementation and whether this relationship can be generalized to populations with low calcium intakes. Additionally, the skeletal benefits from calcium supplementation are greater in subjects with low calcium intakes and, therefore, the risk-benefit ratio of calcium supplementation is likely to differ based on the dietary calcium intake and risks of osteoporosis and cardiovascular diseases of various populations. Further studies investigating the risk-benefit profiles of calcium supplementation in various populations are required to develop population-specific guidelines for individuals of different genders, ages, ethnicities, and risk profiles around the world.

  4. Calcium Channel Genes Associated with Bipolar Disorder Modulate Lithium's Amplification of Circadian Rhythms

    Science.gov (United States)

    McCarthy, Michael J.; LeRoux, Melissa; Wei, Heather; Beesley, Stephen; Kelsoe, John R.; Welsh, David K.

    2015-01-01

    Bipolar disorder (BD) is associated with mood episodes and low amplitude circadian rhythms. Previously, we demonstrated that fibroblasts grown from BD patients show weaker amplification of circadian rhythms by lithium compared to control cells. Since calcium signals impact upon the circadian clock, and L-type calcium channels (LTCC) have emerged as genetic risk factors for BD, we examined whether loss of function in LTCCs accounts for the attenuated response to lithium in BD cells. We used fluorescent dyes to measure Ca2+ changes in BD and control fibroblasts after lithium treatment, and bioluminescent reporters to measure Per2∷luc rhythms in fibroblasts from BD patients, human controls, and mice while pharmacologically or genetically manipulating calcium channels. Longitudinal expression of LTCC genes (CACNA1C, CACNA1D and CACNB3) was then measured over 12-24 hr in BD and control cells. Our results indicate that independently of LTCCs, lithium stimulated intracellular Ca2+ less effectively in BD vs. control fibroblasts. In longitudinal studies, pharmacological inhibition of LTCCs or knockdown of CACNA1A, CACNA1C, CACNA1D and CACNB3 altered circadian rhythm amplitude. Diltiazem and knockdown of CACNA1C or CACNA1D eliminated lithium's ability to amplify rhythms. Knockdown of CACNA1A or CACNB3 altered baseline rhythms, but did not affect rhythm amplification by lithium. In human fibroblasts, CACNA1C genotype predicted the amplitude response to lithium, and the expression profiles of CACNA1C, CACNA1D and CACNB3 were altered in BD vs. controls. We conclude that in cells from BD patients, calcium signaling is abnormal, and that LTCCs underlie the failure of lithium to amplify circadian rhythms. PMID:26476274

  5. Calcium signals can freely cross the nuclear envelope in hippocampal neurons: somatic calcium increases generate nuclear calcium transients

    Directory of Open Access Journals (Sweden)

    Bading Hilmar

    2007-07-01

    Full Text Available Abstract Background In hippocampal neurons, nuclear calcium signaling is important for learning- and neuronal survival-associated gene expression. However, it is unknown whether calcium signals generated by neuronal activity at the cell membrane and propagated to the soma can unrestrictedly cross the nuclear envelope to invade the nucleus. The nuclear envelope, which allows ion transit via the nuclear pore complex, may represent a barrier for calcium and has been suggested to insulate the nucleus from activity-induced cytoplasmic calcium transients in some cell types. Results Using laser-assisted uncaging of caged calcium compounds in defined sub-cellular domains, we show here that the nuclear compartment border does not represent a barrier for calcium signals in hippocampal neurons. Although passive diffusion of molecules between the cytosol and the nucleoplasm may be modulated through changes in conformational state of the nuclear pore complex, we found no evidence for a gating mechanism for calcium movement across the nuclear border. Conclusion Thus, the nuclear envelope does not spatially restrict calcium transients to the somatic cytosol but allows calcium signals to freely enter the cell nucleus to trigger genomic events.

  6. Calcium-dependent smooth muscle excitatory effect elicited by the venom of the hydrocoral Millepora complanata.

    Science.gov (United States)

    Rojas, Alejandra; Torres, Mónica; Rojas, J Isela; Feregrino, Angélica; Heimer-de la Cotera, Edgar P

    2002-06-01

    In the present paper, we describe the results obtained from a preliminary pharmacological and biochemical study of the fire coral Millepora complanata, a regular component of coral reefs in the Mexican Caribbean. The protein-containing crude extract obtained from M. complanata (tested from 0.001 to 1000 microg protein/ml) caused a concentration-dependent stimulation of spontaneous contractions of the guinea pig ileum. The extract (EC(50)=11.55+/-2.36 microg/ml) was approximately 12-fold less potent than ionomycin (EC(50)=0.876+/-0.25 microg/ml) and its maximum induced contraction (1mg protein/ml) was equivalent to 68% of the response to 60mM KCl. FPLC size exclusion chromatography of the M. complanta extract afforded 12 primary fractions, of which only FV (containing proteins with molecular weights ranging from 17 to 44 kDa) and FVIII (consisting of peptides with molecular weights lesser than 1.8k Da) elicited an excitatory effect when tested at the EC(50) of the original extract. After incubation in Ca(2+)-free medium, the ileal response to FV and FVIII was significantly reduced. Blockage of L-type Ca(2+) channels with nifedipine (1 microM) inhibited FV and FVIII-evoked contractions. Cd(2+) (10 microM), an unspecific blocker of voltage-activated calcium channels, also antagonized FV and FVIII-induced effects, whereas the Na(+) channel blocker tetrodotoxin (10nM) did not significantly affect FV and FVIII responses. These results suggest that the contractions induced by the bioactive fractions obtained from the crude extract of M. complanata are caused mainly by a direct action on smooth muscle cells, via an increase in Ca(2+) permeability that occurs, at least partly, through L-type voltage-dependent Ca(2+) channels found in the cell membrane of smooth muscle. Copright 2002 Elsevier Science Ltd.

  7. Brain calcium - Role in temperature regulation.

    Science.gov (United States)

    Hanegan, J. L.; Williams, B. A.

    1973-01-01

    Perfusion of the preoptic-anterior hypothalamus with excess calcium ion in ground squirrels produces a drop in core temperature. The magnitude of the drop is directly dependent on ambient temperature. Respiration, heart rate, and oxygen consumption are also reduced during perfusion of calcium ion. It is concluded that the depression of body temperature during calcium ion perfusion is due to generalized depression of the neurons of the preoptic-anterior hypothalamus.

  8. Familial hypocalciuric hypercalcemia and calcium sensing receptor

    DEFF Research Database (Denmark)

    Mrgan, Monija; Nielsen, Sanne; Brixen, Kim

    2014-01-01

    Familial hypocalciuric hypercalcemia (FHH) is a lifelong, benign autosomal dominant disease characterized by hypercalcemia, normal to increased parathyroid hormone level, and a relatively low renal calcium excretion. Inactivation of the calcium-sensing receptor in heterozygous patients results...... in FHH, while in homozygous patients as well as in compound heterozygous or dominant negative heterozygous patients, it may result in neonatal severe hyperparathyroidism (NSHPT). Parathyroid surgery is not indicated in FHH and does not lower plasma calcium unless total parathyroidectomy is performed...

  9. The total synthesis of calcium atorvastatin.

    Science.gov (United States)

    Dias, Luiz C; Vieira, Adriano S; Barreiro, Eliezer J

    2016-02-21

    A practical and convergent asymmetric route to calcium atorvastatin (1) is reported. The synthesis of calcium atorvastatin (1) was performed using the remote 1,5-anti asymmetric induction in the boron-mediated aldol reaction of β-alkoxy methylketone (4) with pyrrolic aldehyde (3) as a key step. Calcium atorvastatin was obtained from aldehyde (3) after 6 steps, with a 41% overall yield.

  10. 21 CFR 184.1206 - Calcium iodate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium iodate. 184.1206 Section 184.1206 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1206 Calcium iodate. (a) Calcium iodate [Ca(IO3)2·H2O, CAS Reg. No. 7789-80...

  11. Direct interaction of CaVβ with actin up-regulates L-type calcium currents in HL-1 cardiomyocytes.

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-02-20

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Direct Interaction of CaVβ with Actin Up-regulates L-type Calcium Currents in HL-1 Cardiomyocytes*

    Science.gov (United States)

    Stölting, Gabriel; de Oliveira, Regina Campos; Guzman, Raul E.; Miranda-Laferte, Erick; Conrad, Rachel; Jordan, Nadine; Schmidt, Silke; Hendriks, Johnny; Gensch, Thomas; Hidalgo, Patricia

    2015-01-01

    Expression of the β-subunit (CaVβ) is required for normal function of cardiac L-type calcium channels, and its up-regulation is associated with heart failure. CaVβ binds to the α1 pore-forming subunit of L-type channels and augments calcium current density by facilitating channel opening and increasing the number of channels in the plasma membrane, by a poorly understood mechanism. Actin, a key component of the intracellular trafficking machinery, interacts with Src homology 3 domains in different proteins. Although CaVβ encompasses a highly conserved Src homology 3 domain, association with actin has not yet been explored. Here, using co-sedimentation assays and FRET experiments, we uncover a direct interaction between CaVβ and actin filaments. Consistently, single-molecule localization analysis reveals streaklike structures composed by CaVβ2 that distribute over several micrometers along actin filaments in HL-1 cardiomyocytes. Overexpression of CaVβ2-N3 in HL-1 cells induces an increase in L-type current without altering voltage-dependent activation, thus reflecting an increased number of channels in the plasma membrane. CaVβ mediated L-type up-regulation, and CaVβ-actin association is prevented by disruption of the actin cytoskeleton with cytochalasin D. Our study reveals for the first time an interacting partner of CaVβ that is directly involved in vesicular trafficking. We propose a model in which CaVβ promotes anterograde trafficking of the L-type channels by anchoring them to actin filaments in their itinerary to the plasma membrane. PMID:25533460

  13. Calcium hydroxide isotope effect in calcium isotope enrichment by ion exchange

    International Nuclear Information System (INIS)

    Jepson, B.E.; Shockey, G.C.

    1984-01-01

    The enrichment of calcium isotopes has been observed in ion-exchange chromatography with an aqueous phase of calcium hydroxide and a solid phase of sulfonic acid resin. The band front was exceedingly sharp as a result of the acid-base reaction occuring at the front of the band. Single-stage separation coefficients were found to be epsilon( 44 Ca/ 40 Ca) = 11 x 10 -4 and epsilon( 48 Ca/ 40 Ca) = 18 x 10 -4 . The maximum column separation factors achieved were 1.05 for calcium-44 and 1.09 for calcium-48 with the heavy isotopes enriching in the fluid phase. The calcium isotope effect between fully hydrated aqueous calcium ions and undissociated aqueous calcium hydroxide was estimated. For the calcium-44/40 isotope pair the separation coefficient was 13 x 10 -4 . 20 references, 2 figures

  14. Calcium isotope fractionation between soft and mineralized tissues as a monitor of calcium use in vertebrates

    Science.gov (United States)

    Skulan, Joseph; DePaolo, Donald J.

    1999-01-01

    Calcium from bone and shell is isotopically lighter than calcium of soft tissue from the same organism and isotopically lighter than source (dietary) calcium. When measured as the 44Ca/40Ca isotopic ratio, the total range of variation observed is 5.5‰, and as much as 4‰ variation is found in a single organism. The observed intraorganismal calcium isotopic variations and the isotopic differences between tissues and diet indicate that isotopic fractionation occurs mainly as a result of mineralization. Soft tissue calcium becomes heavier or lighter than source calcium during periods when there is net gain or loss of mineral mass, respectively. These results suggest that variations of natural calcium isotope ratios in tissues may be useful for assessing the calcium and mineral balance of organisms without introducing isotopic tracers. PMID:10570137

  15. Calcium and magnesium silicate hydrates

    International Nuclear Information System (INIS)

    Lothenbach, B.; L'Hopital, E.; Nied, D.; Achiedo, G.; Dauzeres, A.

    2015-01-01

    Deep geological disposals are planed to discard long-lived intermediate-level and high-level radioactive wastes. Clay-based geological barriers are expected to limit the ingress of groundwater and to reduce the mobility of radioelements. In the interaction zone between the cement and the clay based material alteration can occur. Magnesium silicate hydrates (M-S-H) have been observed due to the reaction of magnesium sulfate containing groundwater with cements or in the interaction zone between low-pH type cement and clays. M-S-H samples synthesized in the laboratory showed that M-S-H has a variable composition within 0.7 ≤ Mg/Si ≤ 1.5. TEM/EDS analyses show an homogeneous gel with no defined structure. IR and 29 Si NMR data reveal a higher polymerization degree of the silica network in M-S-H compared to calcium silicate hydrates (C-S-H). The presence of mainly Q 3 silicate tetrahedrons in M-S-H indicates a sheet like or a triple-chain silica structure while C-S-H is characterised by single chain-structure. The clear difference in the silica structure and the larger ionic radius of Ca 2+ (1.1 Angstrom) compared to Mg 2+ (0.8 Angstrom) make the formation of an extended solid solution between M-S-H and C-S-H gel improbable. In fact, the analyses of synthetic samples containing both magnesium and calcium in various ratios indicate the formation of separate M-S-H and C-S-H gels with no or very little uptake of magnesium in CS-H or calcium in M-S-H

  16. Calcium carboorthovanadate - a new compound with the apa

    International Nuclear Information System (INIS)

    Slobodin, B.V.; Dmitrieva, O.I.; Fotiev, A.A.

    1977-01-01

    Data on calcium carboorthovanadate, Ca 10 (VO 4 ) 6 CO 3 , a new compound with an appatite structure based on calcium orthovanadate, are reported. The synthesis has been conducted in a stoichiometric mixture of finely ground calcium carbonate and calcium orthovanadate. It is found that calcium carboorthovanadate belongs to the hexagonal syngony and has an apatite structure. An analysis of the infrared spectra of initial compounds and calcium carboorthovanadate confirmed the presence of carbonate (CO 3 ) 2- and orthovanadate (VO 4 ) 3 groupings in the latter. On heating in air, beginning with 450 deg C calcium carboorthovanadate decomposes at a slow rate into calcium oxide, calcium orthovanadate, and carbon dioxide

  17. Regulation of cardiomyocyte autophagy by calcium.

    Science.gov (United States)

    Shaikh, Soni; Troncoso, Rodrigo; Criollo, Alfredo; Bravo-Sagua, Roberto; García, Lorena; Morselli, Eugenia; Cifuentes, Mariana; Quest, Andrew F G; Hill, Joseph A; Lavandero, Sergio

    2016-04-15

    Calcium signaling plays a crucial role in a multitude of events within the cardiomyocyte, including cell cycle control, growth, apoptosis, and autophagy. With respect to calcium-dependent regulation of autophagy, ion channels and exchangers, receptors, and intracellular mediators play fundamental roles. In this review, we discuss calcium-dependent regulation of cardiomyocyte autophagy, a lysosomal mechanism that is often cytoprotective, serving to defend against disease-related stress and nutrient insufficiency. We also highlight the importance of the subcellular distribution of calcium and related proteins, interorganelle communication, and other key signaling events that govern cardiomyocyte autophagy. Copyright © 2016 the American Physiological Society.

  18. How calcium makes endocytic receptors attractive

    DEFF Research Database (Denmark)

    Andersen, Christian B F; Moestrup, Søren K

    2014-01-01

    of the receptor. Endosomal acidification and calcium efflux lead to the essential ligand-receptor affinity switch and separation. Recent data, including crystal structures of receptor-ligand complexes, now reveal how calcium, in different types of domain scaffolds, functions in a common way as a removable...... 'lynchpin' that stabilizes favorable positioning of ligand-attractive receptor residues. In addition to explaining how calcium depletion can cause ligand-receptor dissociation, the new data add further insight into how acidification contributes to dissociation through structural changes that affect...... the receptor calcium sites....

  19. Diuretics and disorders of calcium homeostasis.

    Science.gov (United States)

    Grieff, Marvin; Bushinsky, David A

    2011-11-01

    Diuretics commonly are administered in disorders of sodium balance. Loop diuretics inhibit the Na-K-2Cl transporter and also increase calcium excretion. They are often used in the treatment of hypercalcemia. Thiazide diuretics block the thiazide-sensitive NaCl transporter in the distal convoluted tubule, and can decrease calcium excretion. They are often used in the treatment of nephrolithiasis. Carbonic anhydrase inhibitors decrease bicarbonate absorption and the resultant metabolic acidosis can increase calcium excretion. Their use can promote nephrocalcinosis and nephrolithiasis. This review will address the use of diuretics on disorders of calcium homeostasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Role of polyhydroxybutyrate in mitochondrial calcium uptake

    Science.gov (United States)

    Smithen, Matthew; Elustondo, Pia A.; Winkfein, Robert; Zakharian, Eleonora; Abramov, Andrey Y.; Pavlov, Evgeny

    2013-01-01

    Polyhydroxybutyrate (PHB) is a biological polymer which belongs to the class of polyesters and is ubiquitously present in all living organisms. Mammalian mitochondrial membranes contain PHB consisting of up to 120 hydroxybutyrate residues. Roles played by PHB in mammalian mitochondria remain obscure. It was previously demonstrated that PHB of the size similar to one found in mitochondria mediates calcium transport in lipid bilayer membranes. We hypothesized that the presence of PHB in mitochondrial membrane might play a significant role in mitochondrial calcium transport. To test this, we investigated how the induction of PHB hydrolysis affects mitochondrial calcium transport. Mitochondrial PHB was altered enzymatically by targeted expression of bacterial PHB hydrolyzing enzyme (PhaZ7) in mitochondria of mammalian cultured cells. The expression of PhaZ7 induced changes in mitochondrial metabolism resulting in decreased mitochondrial membrane potential in HepG2 but not in U87 and HeLa cells. Furthermore, it significantly inhibited mitochondrial calcium uptake in intact HepG2, U87 and HeLa cells stimulated by the ATP or by the application of increased concentrations of calcium to the digitonin permeabilized cells. Calcium uptake in PhaZ7 expressing cells was restored by mimicking calcium uniporter properties with natural electrogenic calcium ionophore - ferutinin. We propose that PHB is a previously unrecognized important component of the mitochondrial calcium uptake system. PMID:23702223

  1. Trace mineral interactions during elevated calcium consumption

    International Nuclear Information System (INIS)

    Smith, K.T.; Luhrsen, K.R.

    1986-01-01

    Elevated calcium consumption is reported to affect trace mineral bioavailability. The authors examined this phenomenon in both single dose radio-label test meals and an eight week feeding trial in rats. In the single dose studies, human milk, cows milk, and various calcium sources were examined in relation to radio-iron and radio-zinc retention. 59 Fe retention was greater from human milk than cows milk. However, when the calcium content of human milk was adjusted (with CaHPO 4 or CaCO 3 ) to equal the level in cows milk, iron retention was depressed. Similarly, when calcium sources (CaCO 3 , CaHPO 4 , hydroxy-apatite, bone meal) were examined at different calcium:metal molar ratios, the degree of inhibition on metal retention varied. In general, phosphate salts were more inhibiting than carbonates. In the feeding trial, calcium was fed in diets at normal (0.5%) or elevated (1.5%) levels. Serum, liver, kidney, and bone trace mineral profiles were obtained. In general, most trace elements showed decreased levels in the tissues. Zinc and iron were most striking, followed by magnesium with minor changes in copper. A high calcium:high mineral supplemented group was also fed. Mixed mineral supplementation prevented all calcium interactions. These data indicate the importance of calcium mineral interactions in bioavailability considerations in both milk sources and in mineral supplementation

  2. [Calcium hypothesis of Alzheimer disease].

    Science.gov (United States)

    Riazantseva, M A; Mozhaeva, G N; Kaznacheeva, E V

    2012-01-01

    Alzheimer's disease is the most common neurodegenerative disorder characterized by progressive memory and cognitive abilities loss. The etiology of Alzheimer's disease is poorly understood. In this regard, there is no effective treatment for the disease. Various hypotheses to explain the nature of the pathology of Alzheimer's disease led to the development of appropriate therapeutics. Despite of decades of research and clinical trials available therapeutics, at best, can only slow down the progression of the disease, but cannot cure it. This review dedicated to the one of modern hypotheses of Alzheimer's disease pathogenesis implied the impairment of calcium homeostasis as a key event for the development of neurodegenerative processes.

  3. Calcium

    Science.gov (United States)

    ... of new bone. People with lactose intolerance cannot digest this natural sugar found in milk and experience ... Disclaimer | FOIA | Información en español Download free Acrobat Reader Term Selected: Select the term below that you' ...

  4. Impaired body calcium metabolism with low bone density and compensatory colonic calcium absorption in cecectomized rats

    NARCIS (Netherlands)

    Jongwattanapisan, P.; Suntornsaratoon, P.; Wongdee, K.; Dorkkam, N.; Krishnamra, N.; Charoenphandhu, N.

    2012-01-01

    An earlier study reported that cecal calcium absorption contributes less than 10% of total calcium absorbed by the intestine, although the cecum has the highest calcium transport rate compared with other intestinal segments. Thus, the physiological significance of the cecum pertaining to body

  5. Effect of lowering dietary calcium intake on fractional whole body calcium retention

    International Nuclear Information System (INIS)

    Dawson-Hughes, B.; Stern, D.T.; Shipp, C.C.; Rasmussen, H.M.

    1988-01-01

    Although fractional calcium absorption is known to vary inversely with calcium intake, the extent and timing of individual hormonal and calcium absorption responses to altered calcium intake have not been defined. We measured fractional whole body retention of orally ingested 47 Ca, an index of calcium absorption, in nine normal women after they had eaten a 2000-mg calcium diet for 8 weeks and a 300-mg calcium diet for 1, 2, 4, and 8 weeks. After the diet change, serum intact PTH (32.2% increase; P = 0.005), serum 1,25-dihydroxyvitamin D [1,25-(OH)2D; 43.8% increase; P = 0.003], and fractional whole body calcium retention (42.8% increase; P = 0.004) increased within 1 week. Although the PTH and calcium retention responses remained fairly constant throughout the low calcium intake period, serum 1,25-(OH)2D concentrations declined toward baseline after week 1. Thus, the late increase in calcium retention may have resulted from calcium absorption that was independent of 1,25-(OH)2D stimulation

  6. Short communication: Urinary oxalate and calcium excretion by dogs and cats diagnosed with calcium oxalate urolithiasis

    NARCIS (Netherlands)

    Dijcker, J.C.; Kummeling, A.; Hagen-Plantinga, E.A.; Hendriks, W.H.

    2012-01-01

    Introduction Urine concentrations of oxalate and calcium play an important role in calcium oxalate (CaOx) urolith formation in dogs and cats, with high excretions of both substances increasing the chance of CaOx urolithiasis. In 17 CaOx-forming dogs, urine calcium:creatinine ratio (Ca:Cr) was found

  7. An overview of techniques for the measurement of calcium distribution, calcium fluxes, and cytosolic free calcium in mammalian cells

    International Nuclear Information System (INIS)

    Borle, A.B.

    1990-01-01

    An array of techniques can be used to study cell calcium metabolism that comprises several calcium compartments and many types of transport systems such as ion channels, ATP-dependent pumps, and antiporters. The measurement of total call calcium brings little information of value since 60 to 80% of total cell calcium is actually bound to the extracellular glycocalyx. Cell fractionation and differential centrifugation have been used to study intracellular Ca 2+ compartmentalization, but the methods suffer from the possibility of Ca 2+ loss or redistribution among cell fractions. Steady-state kinetic analyses of 45 Ca uptake or desaturation curves have been used to study the distribution of Ca 2+ among various kinetic pools in living cells and their rate of Ca 2+ exchange, but the analyses are constrained by many limitations. Nonsteady-state tracer studies can provide information about rapid changes in calcium influx or efflux in and out of the cell. Zero-time kinetics of 45 Ca uptake can detect instantaneous changes in calcium influx, while 45 Ca fractional efflux ratio, can detect rapid stimulations or inhibitions of calcium efflux out of cells. The best strategy to study cell calcium metabolism is to use several different methods that focus on a specific problem from widely different angles

  8. Research applications of calcium-47

    International Nuclear Information System (INIS)

    1962-01-01

    The possibility of using the isotope calcium-47 for calcium metabolism investigation was discussed. It seemed particularly suited for this purpose since it has a half-life of only 4.7 days; it is, moreover, a strong gamma-emitter which permits easy detection of very small quantities from outside the body. It was, however, produced on an experimental basis only and at a price of US $1400 per mC which was beyond the financial possibilities of almost any medical research institution or hospital. In view of IAEA's mandate to promote isotope research in the fields of radiobiology and medicine the participants asked the Agency to carry out a programme of encouraging research that might lead to cheaper methods of producing this isotope and of assisting in its practical applications in diagnosis and clinical research. The Agency took up this suggestion and the way it has pursued the project might be considered characteristic of its methods of dealing with such problems on an international scale

  9. Research applications of calcium-47

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1962-04-15

    The possibility of using the isotope calcium-47 for calcium metabolism investigation was discussed. It seemed particularly suited for this purpose since it has a half-life of only 4.7 days; it is, moreover, a strong gamma-emitter which permits easy detection of very small quantities from outside the body. It was, however, produced on an experimental basis only and at a price of US $1400 per mC which was beyond the financial possibilities of almost any medical research institution or hospital. In view of IAEA's mandate to promote isotope research in the fields of radiobiology and medicine the participants asked the Agency to carry out a programme of encouraging research that might lead to cheaper methods of producing this isotope and of assisting in its practical applications in diagnosis and clinical research. The Agency took up this suggestion and the way it has pursued the project might be considered characteristic of its methods of dealing with such problems on an international scale

  10. Codissolution of calcium hydrogenphosphate and sodium hydrogencitrate in water. Spontaneous supersaturation of calcium citrate increasing calcium bioavailability

    DEFF Research Database (Denmark)

    Hedegaard, Martina Vavrusova; Danielsen, Bente Pia; Garcia, André Castilho

    2018-01-01

    The sparingly soluble calcium hydrogenphosphate dihydrate, co-dissolving in water during dissolution of freely soluble sodium hydrogencitrate sesquihydrate as caused by proton transfer from hydrogencitrate to hydrogenphosphate, was found to form homogenous solutions supersaturated by a factor up...... to 8 in calcium citrate tetrahydrate. A critical hydrogencitrate concentration for formation of homogeneous solutions was found to depend linearly on dissolved calcium hydrogenphosphate: [HCitr2-] = 14[CaHPO4] - 0.05 at 25 °C. The lag phase for precipitation of calcium citrate tetrahydrate......, as identified from FT-IR spectra, from these spontaneously formed supersaturated solutions was several hours, and the time to reach solubility equilibrium was several days. Initial calcium ion activity was found to be almost independent of the degree of supersaturation as determined electrochemically...

  11. Coupling between phosphate and calcium homeostasis: a mathematical model.

    Science.gov (United States)

    Granjon, David; Bonny, Olivier; Edwards, Aurélie

    2017-12-01

    We developed a mathematical model of calcium (Ca) and phosphate (PO 4 ) homeostasis in the rat to elucidate the hormonal mechanisms that underlie the regulation of Ca and PO 4 balance. The model represents the exchanges of Ca and PO 4 between the intestine, plasma, kidneys, bone, and the intracellular compartment, and the formation of Ca-PO 4 -fetuin-A complexes. It accounts for the regulation of these fluxes by parathyroid hormone (PTH), vitamin D 3 , fibroblast growth factor 23, and Ca 2+ -sensing receptors. Our results suggest that the Ca and PO 4 homeostatic systems are robust enough to handle small perturbations in the production rate of either PTH or vitamin D 3 The model predicts that large perturbations in PTH or vitamin D 3 synthesis have a greater impact on the plasma concentration of Ca 2+ ([Ca 2+ ] p ) than on that of PO 4 ([PO 4 ] p ); due to negative feedback loops, [PO 4 ] p does not consistently increase when the production rate of PTH or vitamin D 3 is decreased. Our results also suggest that, following a large PO 4 infusion, the rapidly exchangeable pool in bone acts as a fast, transient storage PO 4 compartment (on the order of minutes), whereas the intracellular pool is able to store greater amounts of PO 4 over several hours. Moreover, a large PO 4 infusion rapidly lowers [Ca 2+ ] p owing to the formation of CaPO 4 complexes. A large Ca infusion, however, has a small impact on [PO 4 ] p , since a significant fraction of Ca binds to albumin. This mathematical model is the first to include all major regulatory factors of Ca and PO 4 homeostasis. Copyright © 2017 the American Physiological Society.

  12. Inhibition of the alpha-ketoglutarate dehydrogenase complex alters mitochondrial function and cellular calcium regulation.

    Science.gov (United States)

    Huang, Hsueh-Meei; Zhang, Hui; Xu, Hui; Gibson, Gary E

    2003-01-20

    Mitochondrial dysfunction occurs in many neurodegenerative diseases. The alpha-ketoglutarate dehydrogenase complex (KGDHC) catalyzes a key and arguably rate-limiting step of the tricarboxylic acid cycle (TCA). A reduction in the activity of the KGDHC occurs in brains and cells of patients with many of these disorders and may underlie the abnormal mitochondrial function. Abnormalities in calcium homeostasis also occur in fibroblasts from Alzheimer's disease (AD) patients and in cells bearing mutations that lead to AD. Thus, the present studies test whether the reduction of KGDHC activity can lead to the alterations in mitochondrial function and calcium homeostasis. alpha-Keto-beta-methyl-n-valeric acid (KMV) inhibits KGDHC activity in living N2a cells in a dose- and time-dependent manner. Surprisingly, concentration of KMV that inhibit in situ KGDHC by 80% does not alter the mitochondrial membrane potential (MMP). However, similar concentrations of KMV induce the release of cytochrome c from mitochondria into the cytosol, reduce basal [Ca(2+)](i) by 23% (Pcalcium release from the endoplasmic reticulum (ER) by 46% (P<0.005). This result suggests that diminished KGDHC activities do not lead to the Ca(2+) abnormalities in fibroblasts from AD patients or cells bearing PS-1 mutations. The increased release of cytochrome c with diminished KGDHC activities will be expected to activate other pathways including cell death cascades. Reductions in this key mitochondrial enzyme will likely make the cells more vulnerable to metabolic insults that promote cell death.

  13. Effect of parathyroid hormone and calcium ions on substrate oxidation by isolated glomeruli of the rat.

    Science.gov (United States)

    Wang, M S; Kurokawa, K

    1981-11-05

    Effect of Ca2+ and parathyroid hormone (PTH) on 14 CO2 production from certain metabolic substrates by isolated glomeruli of rat kidney were examined. Increasing calcium concentration in the incubation medium inhibited 14CO2 production from 14C-labeled alpha-ketoglutarate and succinate, stimulated 14CO2 production from [1-14C]glucose and [1-14C]glutamate, but was without effect on that from [6-14C]glucose. PTH in the presence but not in the absence of Ca2+ inhibited 14CO2 production from labeled alpha-ketoglutarate and glutamate but not from labeled glucose. Additions of cyclic AMP as well as hormonal agents known to act directly on the glomureli, such as histamine, epinephrine, prostaglandin E2, vasopressin, angiotensin II and insulin, did not alter 14 CO2 production from labeled alpha-ketoglutarate. These data show the presence of calcium-dependent inhibitory actions on PTH on oxidation of alpha-ketoglutarate and glutamate which may be independent of cyclic AMP. These metabolic effects of PTH may underlie the alteration in the glomerular ultrafiltration coefficient and glomerular filtration induced by the hormone.

  14. Chapter 9: Model Systems for Formation and Dissolution of Calcium Phosphate Minerals

    Energy Technology Data Exchange (ETDEWEB)

    Orme, C A; Giocondi, J L

    2006-07-29

    Calcium phosphates are the mineral component of bones and teeth. As such there is great interest in understanding the physical mechanisms that underlie their growth, dissolution, and phase stability. Control is often achieved at the cellular level by the manipulation of solution states and the use of crystal growth modulators such as peptides or other organic molecules. This chapter begins with a discussion of solution speciation in body fluids and relates this to important crystal growth parameters such as the supersaturation, pH, ionic strength and the ratio of calcium to phosphate activities. We then discuss the use of scanning probe microscopy as a tool to measure surface kinetics of mineral surfaces evolving in simplified solutions. The two primary themes that we will touch on are the use of microenvironments that temporally evolve the solution state to control growth and dissolution; and the use of various growth modifiers that interact with the solution species or with mineral surfaces to shift growth away from the lowest energy facetted forms. The study of synthetic minerals in simplified solution lays the foundation for understand mineralization process in more complex environments found in the body.

  15. ALG-2, a multifunctional calcium binding protein?

    DEFF Research Database (Denmark)

    Tarabykina, Svetlana; Mollerup, Jens; Winding Gojkovic, P.

    2004-01-01

    ALG-2 was originally discovered as a pro-apoptotic protein in a genetic screen. Due to its ability to bind calcium with high affinity it was postulated to provide a link between the known effect of calcium in programmed cell death and the molecular death execution machinery. This review article...

  16. CALCIUM AND THE PREVENTION OF COLON CANCER

    NARCIS (Netherlands)

    WELBERG, JWM; KLEIBEUKER, JH; VANDERMEER, R; MULDER, NH; DEVRIES, EGE

    1991-01-01

    Diet is a major determinant of colon cancer risk. Calcium may protect against colon cancer, presumably by binding cytotoxic bile acids and fatty acids. Numerous studies support this proposition. In subjects at risk for colon cancer oral calcium supplementation has been shown to reduce rectal

  17. Comparison of Serum Calcium and Magnesium Between ...

    African Journals Online (AJOL)

    Background: Evidence suggests the involvement of calcium and magnesium metabolism in the pathophysiology of preeclampsia. However, findings from studies are heterogenous and inconsistent. Aim: The study aimed to compare the total serum calcium and magnesium levels in preeclamptic women with that of ...

  18. Fast kinetics of calcium dissociation from calsequestrin

    Directory of Open Access Journals (Sweden)

    MARIANELA BELTRÁN

    2006-01-01

    Full Text Available We measured the kinetics of calcium dissociation from calsequestrin in solution or forming part of isolated junctional sarcoplasmic reticulum membranes by mixing calsequestrin equilibrated with calcium with calcium-free solutions in a stopped-flow system. In parallel, we measured the kinetics of the intrinsic fluorescence changes that take place following calcium dissociation from calsequestrin. We found that at 25ºC calcium dissociation was 10-fold faster for calsequestrin attached to junctional membranes (k = 109 s-1 than in solution. These results imply that calcium dissociation from calsequestrin in vivo is not rate limiting during excitation-contraction coupling. In addition, we found that the intrinsic fluorescence decrease for calsequestrin in solution or forming part of junctional membranes was significantly slower than the rates of calcium dissociation. The kinetics of intrinsic fluorescence changes had two components for calsequestrin associated to junctional membranes and only one for calsequestrin in solution; the faster component was 8-fold faster (k = 54.1 s-1 than the slower component (k = 6.9 s-1, which had the same k value as for calsequestrin in solution. These combined results suggest that the presence of calsequestrin at high concentrations in a restricted space, such as when bound to the junctional membrane, accelerates calcium dissociation and the resulting structural changes, presumably as a result of cooperative molecular interactions.

  19. Calcium, snails, and birds: a case study

    Directory of Open Access Journals (Sweden)

    R. Mänd

    2000-10-01

    Full Text Available Recent studies have shown that wild birds breeding in acidified areas have difficulties with obtaining sufficient calcium for their eggshells, and that the cause of it is the shortage of land snails. Many birds have to search for Ca-rich snail shells on a daily basis during egg production. Molluscs depend on litter calcium, which has decreased due to acidification of the environment. Calcium limitation may be a widespread phenomenon also in non-acidified, naturally Ca-poor areas. The problem is that while in the latter areas the time for development of specific adaptations may have been sufficient, then in acidified areas, on the contrary, calcium shortage is a recent phenomenon. Therefore, since the extent of calcium limitation in non-acidified areas is hard to derive from observational data, experimental approach is needed. We provide experimental evidence that specific calcium deficit does affect reproductive traits also in the birds breeding in naturally base-poor habitats. Our study was conducted in a heterogeneous woodland area in Estonia containing deciduous forest patches as well as base-poor pine forest with low snail abundance. Ca supplementation, using snail shell and chicken eggshell fragments, was carried out for pied flycatchers and great tits. Extra calcium affected positively several reproductive traits like egg volume and eggshell thickness, start of breeding, and fledglings’ parameters. The negative relationship between calcium availability and lay-date suggests that birds adjust their breeding tactics to conditions of Ca deficiency, for example, by postponing laying.

  20. In vivo calcium metabolism by IRMS

    Science.gov (United States)

    Public policy initiatives related to enhancing the health of populations, increasingly seek to identify meaningful biological outcomes on which to determine age-related nutritional requirements. For calcium, the primary outcome of interest is the availability of calcium in the diet for bone formatio...

  1. 21 CFR 172.715 - Calcium lignosulfonate.

    Science.gov (United States)

    2010-04-01

    ... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Other Specific Usage Additives § 172.715 Calcium lignosulfonate. Calcium lignosulfonate may be...

  2. Sensory analysis of calcium-biofortified lettuce

    Science.gov (United States)

    Vegetables represent an attractive means of providing increased calcium nutrition to the public. In this study, it was demonstrated that lettuce expressing the deregulated Arabidopsis H(+)/Ca(2+) transporter sCAX1 (cation exchanger 1) contained 25-32% more calcium than controls. These biofortified l...

  3. 21 CFR 184.1187 - Calcium alginate.

    Science.gov (United States)

    2010-04-01

    ... ingredient is used in food only within the following specific limitations: Category of food Maximum level of... other food categories 0.3 Do. (d) Prior sanctions for calcium alginate different from the uses... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium alginate. 184.1187 Section 184.1187 Food...

  4. Calcium supplementation in osteoporosis: useful or harmful?

    Science.gov (United States)

    Chiodini, Iacopo; Bolland, Mark J

    2018-04-01

    Osteoporosis and fragility fractures are important social and economic problems worldwide and are due to both the loss of bone mineral density and sarcopenia. Indeed, fragility fractures are associated with increased disability, morbidity and mortality. It is known that a normal calcium balance together with a normal vitamin D status is important for maintaining well-balanced bone metabolism, and for many years, calcium and vitamin D have been considered crucial in the prevention and treatment of osteoporosis. However, recently, the usefulness of calcium supplementation (alone or with concomitant vitamin D) has been questioned, since some studies reported only weak efficacy of these supplementations in reducing fragility fracture risk. On the other hand, besides the gastrointestinal side effects of calcium supplements and the risk of kidney stones related to use of co-administered calcium and vitamin D supplements, other recent data suggested potential adverse cardiovascular effects from calcium supplementation. This debate article is focused on the evidence regarding both the possible usefulness for bone health and the potential harmful effects of calcium and/or calcium with vitamin D supplementation. © 2018 European Society of Endocrinology.

  5. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  6. Oligofructose stimulates calcium absorption in adolescents

    NARCIS (Netherlands)

    Heuvel, E.G.H.M. van den; Muys, T.; Dokkum, W. van; Schaafsma, G.

    1999-01-01

    Background: In rats, nondigestible oligosaccharides stimulate calcium absorption. Recently, this effect was also found in human subjects. Objective: The objective of the study was to investigate whether consumption of 15 g oligofructose/d stimulates calcium absorption in male adolescents. Design:

  7. Rates of calcium carbonate removal from soils.

    NARCIS (Netherlands)

    Breemen, van N.; Protz, R.

    1988-01-01

    Mean annual rates of calcium carbonate removal from soils in a subarctic climate estimated from data on two chronosequences of calcareous storm ridges, appeared to be relatively constant through time. Concentrations of dissolved calcium carbonate in the soil solution in the study sites calculated

  8. CaV3.1 isoform of T-type calcium channels supports excitability of rat and mouse ventral tegmental area neurons.

    Science.gov (United States)

    Tracy, Matthew E; Tesic, Vesna; Stamenic, Tamara Timic; Joksimovic, Srdjan M; Busquet, Nicolas; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M

    2018-03-23

    Recent data have implicated voltage-gated calcium channels in the regulation of the excitability of neurons within the mesolimbic reward system. While the attention of most research has centered on high voltage L-type calcium channel activity, the presence and role of the low voltage-gated T-type calcium channel (T-channels) has not been well explored. Hence, we investigated T-channel properties in the neurons of the ventral tegmental area (VTA) utilizing wild-type (WT) rats and mice, Ca V 3.1 knock-out (KO) mice, and TH-eGFP knock-in (KI) rats in acute horizontal brain slices of adolescent animals. In voltage-clamp experiments, we first assessed T-channel activity in WT rats with characteristic properties of voltage-dependent activation and inactivation, as well as characteristic crisscrossing patterns of macroscopic current kinetics. T-current kinetics were similar in WT mice and WT rats but T-currents were abolished in Ca V 3.1 KO mice. In ensuing current-clamp experiments, we observed the presence of hyperpolarization-induced rebound burst firing in a subset of neurons in WT rats, as well as dopaminergic and non-dopaminergic neurons in TH-eGFP KI rats. Following the application of a pan-selective T-channel blocker TTA-P2, rebound bursting was significantly inhibited in all tested cells. In a behavioral assessment, the acute locomotor increase induced by a MK-801 (Dizocilpine) injection in WT mice was abolished in Ca V 3.1 KO mice, suggesting a tangible role for 3.1 T-type channels in drug response. We conclude that pharmacological targeting of Ca V 3.1 isoform of T-channels may be a novel approach for the treatment of disorders of mesolimbic reward system. Copyright © 2018. Published by Elsevier Ltd.

  9. The calcium and vitamin D controversy

    DEFF Research Database (Denmark)

    Abrahamsen, Bo

    2017-01-01

    Areas of the world where vitamin D levels are low for months of the year and intakes of calcium are high have a high prevalence of osteoporosis and cardiovascular disease. This suggests a public health message of avoiding calcium supplements and increasing vitamin D intake. No message could be more...... welcome as vitamin D can be given as a bolus while calcium must be taken daily and may be poorly tolerated. This approach is based on no evidence from intervention studies. Randomized controlled trials (RCTs) suggest that vitamin D given with calcium elicits a small reduction in fracture risk and deaths....... This has not been demonstrated for D given alone. The cardiovascular safety of calcium and vitamin D (CaD) supplements is difficult to ascertain due to weaknesses in RCT designs and adjudication that cannot be remedied by subanalysis. Moreover, no major new RCTs are in process to provide better evidence...

  10. Application of Calcium Phosphate Materials in Dentistry

    Directory of Open Access Journals (Sweden)

    Jabr S. Al-Sanabani

    2013-01-01

    Full Text Available Calcium phosphate materials are similar to bone in composition and in having bioactive and osteoconductive properties. Calcium phosphate materials in different forms, as cements, composites, and coatings, are used in many medical and dental applications. This paper reviews the applications of these materials in dentistry. It presents a brief history, dental applications, and methods for improving their mechanical properties. Notable research is highlighted regarding (1 application of calcium phosphate into various fields in dentistry; (2 improving mechanical properties of calcium phosphate; (3 biomimetic process and functionally graded materials. This paper deals with most common types of the calcium phosphate materials such as hydroxyapatite and tricalcium phosphate which are currently used in dental and medical fields.

  11. Oral calcium carbonate affects calcium but not phosphorus balance in stage 3–4 chronic kidney disease

    Science.gov (United States)

    Hill, Kathleen M.; Martin, Berdine R.; Wastney, Meryl; McCabe, George P.; Moe, Sharon M.; Weaver, Connie M.; Peacock, Munro

    2014-01-01

    Chronic kidney disease (CKD) patients are given calcium carbonate to bind dietary phosphorus and reduce phosphorus retention, and to prevent negative calcium balance. Data are limited on calcium and phosphorus balance in CKD to support this. The aim of this study was to determine calcium and phosphorus balance and calcium kinetics with and without calcium carbonate in CKD patients. Eight stage 3/4 CKD patients, eGFR 36 mL/min, participated in two 3-week balances in a randomized placebo-controlled cross-over study of calcium carbonate (1500 mg/d calcium). Calcium and phosphorus balance were determined on a controlled diet. Oral and intravenous 45calcium with blood sampling and urine and fecal collections were used for calcium kinetics. Fasting blood and urine were collected at baseline and end of each week of each balance period for biochemical analyses. Results showed that patients were in neutral calcium and phosphorus balance while on placebo. Calcium carbonate produced positive calcium balance, did not affect phosphorus balance, and produced only a modest reduction in urine phosphorus excretion compared with placebo. Calcium kinetics demonstrated positive net bone balance but less than overall calcium balance suggesting tissue deposition. Fasting biochemistries of calcium and phosphate homeostasis were unaffected by calcium carbonate. If they can be extrapolated to effects of chronic therapy, these data caution against the use of calcium carbonate as a phosphate binder. PMID:23254903

  12. Calcium-sensitive immunoaffinity chromatography

    DEFF Research Database (Denmark)

    Henriksen, Maiken L; Lindhardt Madsen, Kirstine; Skjoedt, Karsten

    2014-01-01

    Immunoaffinity chromatography is a powerful fractionation technique that has become indispensable for protein purification and characterization. However, it is difficult to retrieve bound proteins without using harsh or denaturing elution conditions, and the purification of scarce antigens...... to homogeneity may be impossible due to contamination with abundant antigens. In this study, we purified the scarce, complement-associated plasma protein complex, collectin LK (CL-LK, complex of collectin liver 1 and kidney 1), by immunoaffinity chromatography using a calcium-sensitive anti-collectin-kidney-1 m...... chromatography was superior to the traditional immunoaffinity chromatographies and resulted in a nine-fold improvement of the purification factor. The technique is applicable for the purification of proteins in complex mixtures by single-step fractionation without the denaturation of eluted antigens...

  13. Non-calcium desulphurisation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Qian Zhu [IEA Clean Coal Centre, London (United Kingdom)

    2010-06-15

    Flue gas desulphurisation (FGD) is traditionally based on limestone/lime sorbent. The majority of the installed FGD systems worldwide use limestone or lime as sorbent. However, technologies are rapidly evolving that allow desulphurisation in regions where there are limited resources of lime or limestone. These technologies provide alternatives to limestone/lime scrubbers for efficient and cost effective control of SO{sub 2} emissions from coal combustion. This report reviews the existing and emerging non-calcium based FGD processes as well as FGD technologies currently under development that apply new concepts and different approaches. It looks at the fundamentals and features of these processes, the recent technical advances and their applications in coal-fired power plants. The capital and operating costs of the processes are evaluated where information available. 66 refs., 15 figs., 10 tabs.

  14. Oxalate: Effect on calcium absorbability

    International Nuclear Information System (INIS)

    Heaney, R.P.; Weaver, C.M.

    1989-01-01

    Absorption of calcium from intrinsically labeled Ca oxalate was measured in 18 normal women and compared with absorption of Ca from milk in these same subjects, both when the test substances were ingested in separate meals and when ingested together. Fractional Ca absorption from oxalate averaged 0.100 +/- 0.043 when ingested alone and 0.140 +/- 0.063 when ingested together with milk. Absorption was, as expected, substantially lower than absorption from milk (0.358 +/- 0.113). Nevertheless Ca oxalate absorbability in these women was higher than we had previously found for spinach Ca. When milk and Ca oxalate were ingested together, there was no interference of oxalate in milk Ca absorption and no evidence of tracer exchange between the two labeled Ca species

  15. Diagnosis and assessment of skeletal related disease using calcium 41

    Science.gov (United States)

    Hillegonds, Darren J [Oakland, CA; Vogel, John S [San Jose, CA; Fitzgerald, Robert L [Encinitas, CA; Deftos, Leonard J [Del Mar, CA; Herold, David [Del Mar, CA; Burton, Douglas W [San Diego, CA

    2012-05-15

    A method of determining calcium metabolism in a patient comprises the steps of administering radioactive calcium isotope .sup.41Ca to the patient, allowing a period of time to elapse sufficient for dissemination and reaction of the radioactive calcium isotope .sup.41Ca by the patient, obtaining a sample of the radioactive calcium isotope .sup.41Ca from the patient, isolating the calcium content of the sample in a form suitable for precise measurement of isotopic calcium concentrations, and measuring the calcium content to determine parameters of calcium metabolism in the patient.

  16. Calcium Blood Test: MedlinePlus Lab Test Information

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Calcium, Serum; Calcium and Phosphates, Urine; ...

  17. The Hepatitis B Virus X Protein Elevates Cytosolic Calcium Signals by Modulating Mitochondrial Calcium Uptake

    Science.gov (United States)

    Yang, Bei

    2012-01-01

    Chronic hepatitis B virus (HBV) infections are associated with the development of hepatocellular carcinoma (HCC). The HBV X protein (HBx) is thought to play an important role in the development of HBV-associated HCC. One fundamental HBx function is elevation of cytosolic calcium signals; this HBx activity has been linked to HBx stimulation of cell proliferation and transcription pathways, as well as HBV replication. Exactly how HBx elevates cytosolic calcium signals is not clear. The studies described here show that HBx stimulates calcium entry into cells, resulting in an increased plateau level of inositol 1,4,5-triphosphate (IP3)-linked calcium signals. This increased calcium plateau can be inhibited by blocking mitochondrial calcium uptake and store-operated calcium entry (SOCE). Blocking SOCE also reduced HBV replication. Finally, these studies also demonstrate that there is increased mitochondrial calcium uptake in HBx-expressing cells. Cumulatively, these studies suggest that HBx can increase mitochondrial calcium uptake and promote increased SOCE to sustain higher cytosolic calcium and stimulate HBV replication. PMID:22031934

  18. Production of precipitated calcium carbonate from calcium silicates and carbon dioxide

    International Nuclear Information System (INIS)

    Teir, Sebastian; Eloneva, Sanni; Zevenhoven, Ron

    2005-01-01

    The possibilities for reducing carbon dioxide emissions from the pulp and paper industry by calcium carbonation are presented. The current precipitated calcium carbonate (PCC) production uses mined, crushed calcium carbonate as raw materials. If calcium silicates were used instead, carbon dioxide emissions from the calcination of carbonates would be eliminated. In Finland, there could, thus, be a potential for eliminating 200 kt of carbon dioxide emissions per year, considering only the PCC used in the pulp and paper industry. A preliminary investigation of the feasibility to produce PCC from calcium silicates and the potential to replace calcium carbonate as the raw material was made. Calcium carbonate can be manufactured from calcium silicates by various methods, but only a few have been experimentally verified. The possibility and feasibility of these methods as a replacement for the current PCC production process was studied by thermodynamic equilibrium calculations using HSC software and process modelling using Aspen Plus[reg]. The results from the process modelling showed that a process that uses acetic acid for extraction of the calcium ions is a high potential option for sequestering carbon dioxide by mineral carbonation. The main obstacle seems to be the limited availability and relatively high price of wollastonite, which is a mineral with high calcium silicate content. An alternative is to use the more common, but also more complex, basalt rock instead

  19. Chapter 15. Measurement of the main calcium metabolism processes

    International Nuclear Information System (INIS)

    Milhaud, G.

    1975-01-01

    A method of measuring the chief calcium metabolism processes in man is described and is based on the following techniques and theory: intraveinous injection of 45 Ca; determination of the specific radioactivity of serum calcium, total radioactivity of urine and stools, ingested and excreted calcium; mathematical analysis of the specific radioactivity decay curve for serum calcium. The following data were obtained in this way: intestinal absorption fraction of calcium in the chemical state in which it is found in foods; quantity of calcium excreted by the intestin, as distinct from the non-absorbed fraction; physiological turnover rates in the skeleton by osteolysis and osteoblastosis; mass of rapidly exchangeable calcium in the organism, i.e. the calcium pool; rates of exchange with serum calcium of calcium from the different pool components, mass of bone calcium subjected to recrystallisation. Some applications of the method in man and the verification of the theory in rats are reported [fr

  20. Calcium phosphates: what is the evidence?

    Science.gov (United States)

    Larsson, Sune

    2010-03-01

    A number of different calcium phosphate compounds such as calcium phosphate cements and solid beta-tricalcium phosphate products have been introduced during the last decade. The chemical composition mimics the mineral phase of bone and as a result of this likeness, the materials seem to be remodeled as for normal bone through a cell-mediated process that involves osteoclastic activity. This is a major difference when compared with, for instance, calcium sulphate compounds that after implantation dissolve irrespective of the new bone formation rate. Calcium phosphates are highly biocompatible and in addition, they act as synthetic osteoconductive scaffolds after implantation in bone. When placed adjacent to bone, osteoid is formed directly on the surface of the calcium phosphate with no soft tissue interposed. Remodeling is slow and incomplete, but by adding more and larger pores, like in ultraporous beta-tricalcium phosphate, complete or nearly complete resorption can be achieved. The indications explored so far include filling of metaphyseal fracture voids or bone cysts, a volume expander in conjunction with inductive products, and as a carrier for various growth factors and antibiotics. Calcium phosphate compounds such as calcium phosphate cement and beta-tricalcium phosphate will most certainly be part of the future armamentarium when dealing with fracture treatment. It is reasonable to believe that we have so far only seen the beginning when it comes to clinical applications.

  1. Transgenic plants with increased calcium stores

    Science.gov (United States)

    Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

    2004-01-01

    The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

  2. Effect of calcium intake on urinary oxalate excretion in calcium stone-forming patients

    Directory of Open Access Journals (Sweden)

    Nishiura J.L.

    2002-01-01

    Full Text Available Dietary calcium lowers the risk of nephrolithiasis due to a decreased absorption of dietary oxalate that is bound by intestinal calcium. The aim of the present study was to evaluate oxaluria in normocalciuric and hypercalciuric lithiasic patients under different calcium intake. Fifty patients (26 females and 24 males, 41 ± 10 years old, whose 4-day dietary records revealed a regular low calcium intake (<=500 mg/day, received an oral calcium load (1 g/day for 7 days. A 24-h urine was obtained before and after load and according to the calciuria under both diets, patients were considered as normocalciuric (NC, N = 15, diet-dependent hypercalciuric (DDHC, N = 9 or diet-independent hypercalciuric (DIHC, N = 26. On regular diet, mean oxaluria was 30 ± 14 mg/24 h for all patients. The 7-day calcium load induced a significant decrease in mean oxaluria compared to the regular diet in NC and DIHC (20 ± 12 vs 26 ± 7 and 27 ± 18 vs 32 ± 15 mg/24 h, respectively, P<0.05 but not in DDHC patients (22 ± 10 vs 23 ± 5 mg/24 h. The lack of an oxalate decrease among DDHC patients after the calcium load might have been due to higher calcium absorption under higher calcium supply, with a consequent lower amount of calcium left in the intestine to bind with oxalate. These data suggest that a long-lasting regular calcium consumption <500 mg was not associated with high oxaluria and that a subpopulation of hypercalciuric patients who presented a higher intestinal calcium absorption (DDHC tended to hyperabsorb oxalate as well, so that oxaluria did not change under different calcium intake.

  3. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture*

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M.; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-01-01

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. PMID:26231212

  4. Nuclear Calcium Buffering Capacity Shapes Neuronal Architecture.

    Science.gov (United States)

    Mauceri, Daniela; Hagenston, Anna M; Schramm, Kathrin; Weiss, Ursula; Bading, Hilmar

    2015-09-18

    Calcium-binding proteins (CaBPs) such as parvalbumin are part of the cellular calcium buffering system that determines intracellular calcium diffusion and influences the spatiotemporal dynamics of calcium signals. In neurons, CaBPs are primarily localized to the cytosol and function, for example, in nerve terminals in short-term synaptic plasticity. However, CaBPs are also expressed in the cell nucleus, suggesting that they modulate nuclear calcium signals, which are key regulators of neuronal gene expression. Here we show that the calcium buffering capacity of the cell nucleus in mouse hippocampal neurons regulates neuronal architecture by modulating the expression levels of VEGFD and the complement factor C1q-c, two nuclear calcium-regulated genes that control dendrite geometry and spine density, respectively. Increasing the levels of nuclear calcium buffers by means of expression of a nuclearly targeted form of parvalbumin fused to mCherry (PV.NLS-mC) led to a reduction in VEGFD expression and, as a result, to a decrease in total dendritic length and complexity. In contrast, mRNA levels of the synapse pruning factor C1q-c were increased in neurons expressing PV.NLS-mC, causing a reduction in the density and size of dendritic spines. Our results establish a close link between nuclear calcium buffering capacity and the transcription of genes that determine neuronal structure. They suggest that the development of cognitive deficits observed in neurological conditions associated with CaBP deregulation may reflect the loss of necessary structural features of dendrites and spines. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Linking Cellular Mechanisms to Behavior: Entorhinal Persistent Spiking and Membrane Potential Oscillations May Underlie Path Integration, Grid Cell Firing, and Episodic Memory

    Directory of Open Access Journals (Sweden)

    Michael E. Hasselmo

    2008-01-01

    Full Text Available The entorhinal cortex plays an important role in spatial memory and episodic memory functions. These functions may result from cellular mechanisms for integration of the afferent input to entorhinal cortex. This article reviews physiological data on persistent spiking and membrane potential oscillations in entorhinal cortex then presents models showing how both these cellular mechanisms could contribute to properties observed during unit recording, including grid cell firing, and how they could underlie behavioural functions including path integration. The interaction of oscillations and persistent firing could contribute to encoding and retrieval of trajectories through space and time as a mechanism relevant to episodic memory.

  6. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    Energy Technology Data Exchange (ETDEWEB)

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

    2010-09-21

    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  7. Altered Elementary Calcium Release Events and Enhanced Calcium Release by Thymol in Rat Skeletal Muscle

    OpenAIRE

    Szentesi, Péter; Szappanos, Henrietta; Szegedi, Csaba; Gönczi, Monika; Jona, István; Cseri, Julianna; Kovács, László; Csernoch, László

    2004-01-01

    The effects of thymol on steps of excitation-contraction coupling were studied on fast-twitch muscles of rodents. Thymol was found to increase the depolarization-induced release of calcium from the sarcoplasmic reticulum, which could not be attributed to a decreased calcium-dependent inactivation of calcium release channels/ryanodine receptors or altered intramembrane charge movement, but rather to a more efficient coupling of depolarization to channel opening. Thymol increased ryanodine bind...

  8. Calcium absorption from fortified ice cream formulations compared with calcium absorption from milk.

    Science.gov (United States)

    van der Hee, Regine M; Miret, Silvia; Slettenaar, Marieke; Duchateau, Guus S M J E; Rietveld, Anton G; Wilkinson, Joy E; Quail, Patricia J; Berry, Mark J; Dainty, Jack R; Teucher, Birgit; Fairweather-Tait, Susan J

    2009-05-01

    Optimal bone mass in early adulthood is achieved through appropriate diet and lifestyle, thereby protecting against osteoporosis and risk of bone fracture in later life. Calcium and vitamin D are essential to build adequate bones, but calcium intakes of many population groups do not meet dietary reference values. In addition, changes in dietary patterns are exacerbating the problem, thereby emphasizing the important role of calcium-rich food products. We have designed a calcium-fortified ice cream formulation that is lower in fat than regular ice cream and could provide a useful source of additional dietary calcium. Calcium absorption from two different ice cream formulations was determined in young adults and compared with milk. Sixteen healthy volunteers (25 to 45 years of age), recruited from the general public of The Netherlands, participated in a randomized, reference-controlled, double-blind cross-over study in which two test products and milk were consumed with a light standard breakfast on three separate occasions: a standard portion of ice cream (60 g) fortified with milk minerals and containing a low level (3%) of butter fat, ice cream (60 g) fortified with milk minerals and containing a typical level (9%) of coconut oil, and reduced-fat milk (1.7% milk fat) (200 mL). Calcium absorption was measured by the dual-label stable isotope technique. Effects on calcium absorption were evaluated by analysis of variance. Fractional absorption of calcium from the 3% butterfat ice cream, 9% coconut oil ice cream, and milk was 26%+/-8%, 28%+/-5%, and 31%+/-9%, respectively, and did not differ significantly (P=0.159). Results indicate that calcium bioavailability in the two calcium-fortified ice cream formulations used in this study is as high as milk, indicating that ice cream may be a good vehicle for delivery of calcium.

  9. Does calcium constrain reproductive activity in insectivorous bats ...

    African Journals Online (AJOL)

    Insects are a poor source of dietary calcium and since they are seasonally abundant, it has been suggested that calcium availability may play a significant role in controlling the timing of reproduction in insectivorous bats. To assess the possible role of dietary calcium, we have measured bone calcium concentrations in ...

  10. Calcium and vitamin D for bone health in adults

    Science.gov (United States)

    The calcium intake requirement is challenging to determine, and the IOM recommendations are based largely on calcium balance studies. The IOM recommends a calcium intake of 1000-1200 mg per day for older adults to support the preservation of bone mass. Food sources of calcium are preferred because h...

  11. Calcium and Vitamin D Supplementation in Men

    Directory of Open Access Journals (Sweden)

    Evelien Gielen

    2011-01-01

    Full Text Available Calcium and vitamin D supplements reverse secondary hyperparathyroidism and are widely prescribed to prevent osteoporotic fractures, with proven antifracture efficacy when targeted to individuals with documented insufficiencies. Men who should particularly be considered for calcium and vitamin D supplements include elderly or institutionalized individuals, patients with documented osteoporosis on antiresorptive or anabolic medication, and individuals receiving glucocorticoids. Benefits are most apparent when a daily dose of 1000–1200 mg calcium is complemented with 800 IU vitamin D. Compliance is the key to optimizing clinical efficacy. While (conventionally dosed vitamin D has not been associated with safety concerns, recent meta-analytic data have provided evidence to suggest that calcium supplements (without coadministered vitamin D may potentially be associated with cardiovascular risks.

  12. Can atorvastatin calcium cause asymptomatic hypercalcemia?

    Science.gov (United States)

    Ipekçi, Süleyman Hilmi; Baldane, Süleyman; Sözen, Mehmet; Kebapçılar, Levent

    2014-10-01

    The use of statins may have unnatural effects. A 54-year-old woman was admitted to the hospital with an incidental finding of hypercalcemia (10.8 mg/dL). There was no disease other than hyperlipidemia, and the patient had been on a course of atorvastatin calcium 10 mg for 1.5 years. A workup investigation to diagnose the cause of hypercalcemia was completed. The investigation did not reveal any pathological diseases that may have caused the hypercalcemia. The hypercalcemia resolved after atorvastatin-calcium was stopped, and the patient developed hypercalcemia shortly after the initiation of the atorvastatin calcium. Here, we report a clinical case of recurrent hypercalcemia possibly induced by atorvastatin calcium administration.

  13. Obtainment of calcium carbonate from mussels shell

    International Nuclear Information System (INIS)

    Hamester, M.R.R.; Becker, D.

    2010-01-01

    The mussels and oyster shell are discarded at environment, and this accumulation is causing negative consequences to ecosystem. Calcium carbonate is main constituent of the shell chemical composition. Aiming to reduce environmental aggression and generate income to shellfish producer, there was the possibility of using these shells as an alternative to commercial calcium carbonate. For this physics, chemicals and thermal properties were evaluated, using X-ray fluorescence, thermogravimetric analysis, size distribution, abrasiveness and scanning electronic microscopy. The results indicate that mussels shells have an initial degradation temperature higher than commercial calcium carbonate e same lost weight behavior and 95% of shell chemical composition is calcium carbonate. The sample size distribution was influenced by grinding condition and time as well as its abrasiveness. (author)

  14. Isolation and characterization of biogenic calcium carbonate ...

    Indian Academy of Sciences (India)

    Biogenic calcium carbonate/phosphate were isolated and characterized from oral bacteria (CPOB). The crystalline nature ... XRD analysis revealed the cubic phase of ... subjected to identify upto genus level according to Bergey's. Manual of ...

  15. Separation of calcium isotopes with cryptand complexes

    International Nuclear Information System (INIS)

    Heumann, K.G.; Schiefer, H.P.

    1981-01-01

    The calcium isotope separation in the liquid-liquid extraction system H 2 O/CHCl 3 is investigated using and cryptands for complex formation as well as without complexing agent. An extraction procedure is used which allows the transfer of larger amounts of calcium in the H 2 O phase. Without complexing agent in the extraction system, enrichment of the lighter calcium isotopes is already evident in the CHCl 3 phase which is just the same as when using cryptand. In the case of cryptand as a complexing agent, the isotope separation is higher. The separation factor is calculated to be a = 1 + epsilon = 1.011 for 40 Ca/ 48 Ca without complexing agent or with cryptand and a = 1.015 in the system with cryptand. For 40 Ca/ 44 Ca the epsilon-value is smaller by nearly a factor of two. These separation factors are the highest which are determined in chemical systems for calcium isotopes. (orig.)

  16. Calcium antagonists for aneurysmal subarachnoid haemorrhage

    NARCIS (Netherlands)

    Dorhout Mees, S. M.; Rinkel, G. J. E.; Feigin, V. L.; Algra, A.; van den Bergh, W. M.; Vermeulen, M.; van Gijn, J.

    2007-01-01

    BACKGROUND: Secondary ischaemia is a frequent cause of poor outcome in patients with subarachnoid haemorrhage (SAH). Its pathogenesis has been incompletely elucidated, but vasospasm probably is a contributing factor. Experimental studies have suggested that calcium antagonists can prevent or reverse

  17. Study of calcium chloride and calcium nitrate purification on inorganic sorbents

    International Nuclear Information System (INIS)

    Vasil'eva, L.V.; Knyazeva, A.N.; Fakeev, A.A.; Belyaeva, N.A.; Morozov, V.I.; Kucherova, V.V.

    1986-01-01

    Purification of calcium chloride and calcium nitrate from iron, chromium, manganese and cobalt impurities by sorption on some inorganic collectors are considered in this article. Study was conducted by means of radioactive-tracer technique at concurrent use of several γ-radioactive isotopes. As a collectors were used hydrated aluminium and zirconium oxides. Dependence of effectiveness of precipitation by collectors on ph-value of medium, quantity of collector, nature and concentration of components is studied. Optimal parameters of purification of calcium chloride and calcium nitrate are defined.

  18. Live Imaging of Calcium Dynamics during Axon Degeneration Reveals Two Functionally Distinct Phases of Calcium Influx

    Science.gov (United States)

    Yamagishi, Yuya; Tessier-Lavigne, Marc

    2015-01-01

    Calcium is a key regulator of axon degeneration caused by trauma and disease, but its specific spatial and temporal dynamics in injured axons remain unclear. To clarify the function of calcium in axon degeneration, we observed calcium dynamics in single injured neurons in live zebrafish larvae and tested the temporal requirement for calcium in zebrafish neurons and cultured mouse DRG neurons. Using laser axotomy to induce Wallerian degeneration (WD) in zebrafish peripheral sensory axons, we monitored calcium dynamics from injury to fragmentation, revealing two stereotyped phases of axonal calcium influx. First, axotomy triggered a transient local calcium wave originating at the injury site. This initial calcium wave only disrupted mitochondria near the injury site and was not altered by expression of the protective WD slow (WldS) protein. Inducing multiple waves with additional axotomies did not change the kinetics of degeneration. In contrast, a second phase of calcium influx occurring minutes before fragmentation spread as a wave throughout the axon, entered mitochondria, and was abolished by WldS expression. In live zebrafish, chelating calcium after the first wave, but before the second wave, delayed the progress of fragmentation. In cultured DRG neurons, chelating calcium early in the process of WD did not alter degeneration, but chelating calcium late in WD delayed fragmentation. We propose that a terminal calcium wave is a key instructive component of the axon degeneration program. SIGNIFICANCE STATEMENT Axon degeneration resulting from trauma or neurodegenerative disease can cause devastating deficits in neural function. Understanding the molecular and cellular events that execute axon degeneration is essential for developing treatments to address these conditions. Calcium is known to contribute to axon degeneration, but its temporal requirements in this process have been unclear. Live calcium imaging in severed zebrafish neurons and temporally controlled

  19. Purification and reconstitution of the calcium antagonist receptor of the voltage-sensitive calcium channel

    International Nuclear Information System (INIS)

    Curtis, B.M.

    1986-01-01

    Treatment with digitonin solubilized the calcium antagonist receptor as a stable complex with [ 3 H]nitrendipine from rat brain membranes. The solubilized complex retains allosteric coupling to binding sites for diltiazem, verapamil, and inorganic calcium antagonist sites. The calcium antagonist receptor from cardiac sarcolemma and the transverse-tubule membrane of skeletal muscle is also efficiently solubilized with digitonin and the receptor in all three tissues is a large glycoprotein with a sedimentation coefficient of 20 S. The T-tubule calcium antagonist receptor complex was extensively purified by a combination of chromatography on WGA-Sepharose, ion exchange chromatography, and sedimentation on sucrose gradients to yield preparations estimated to be 41% homogeneous by specific activity and 63% homogeneous by SDS gel electrophoresis. Analysis of SDS gels detect three polypeptides termed α(Mr 135,000), β(Mr 50,000), and γ(Mr 32,000) as noncovalently associated subunits of the calcium antagonist receptor. The α and γ subunits are glycosylated polypeptides, and the molecular weight of the core polypeptides are 108,000 and 24,000 respectively. The calcium antagonist receptor was reconstituted into a phospholipid bilayer by adding CHAPS and exogeneous lipid to the purified receptor followed by rapid detergent removal. This procedure resulted in the incorporation of 45% of the calcium antagonist receptor into closed phospholipid vesicles. Data suggests that the α, β, and γ subunits of the T-tubule calcium antagonist receptor are sufficient to form a functional calcium channel

  20. CALCIUM-RICH GAP TRANSIENTS: SOLVING THE CALCIUM CONUNDRUM IN THE INTRACLUSTER MEDIUM

    International Nuclear Information System (INIS)

    Mulchaey, John S.; Kollmeier, Juna A.; Kasliwal, Mansi M.

    2014-01-01

    X-ray measurements suggest that the abundance of calcium in the intracluster medium is higher than can be explained using favored models for core-collapse and Type Ia supernovae alone. We investigate whether the ''calcium conundrum'' in the intracluster medium can be alleviated by including a contribution from the recently discovered subclass of supernovae known as calcium-rich gap transients. Although the calcium-rich gap transients make up only a small fraction of all supernovae events, we find that their high calcium yields are sufficient to reproduce the X-ray measurements found for nearby rich clusters. We find the χ 2 goodness-of-fit metric improves from 84 to 2 by including this new class. Moreover, calcium-rich supernovae preferentially occur in the outskirts of galaxies making it easier for the nucleosynthesis products of these events to be incorporated in the intracluster medium via ram-pressure stripping. The discovery of calcium-rich gap transients in clusters and groups far from any individual galaxy suggests that supernovae associated with intracluster stars may play an important role in enriching the intracluster medium. Calcium-rich gap transients may also help explain anomalous calcium abundances in many other astrophysical systems including individual stars in the Milky Way, the halos of nearby galaxies, and the circumgalactic medium. Our work highlights the importance of considering the diversity of supernovae types and corresponding yields when modeling the abundance of the intracluster medium and other gas reservoirs

  1. Synthesis of calcium hydroxyapatite from calcium carbonate and different orthophosphate sources: A comparative study

    International Nuclear Information System (INIS)

    Pham Minh, Doan; Lyczko, Nathalie; Sebei, Haroun; Nzihou, Ange; Sharrock, Patrick

    2012-01-01

    Highlights: ► Calcium hydroxyapatite was synthesized from CaCO 3 and four orthophosphates. ► Only H 3 PO 4 led to the complete precipitation of orthophosphate species. ► H 3 PO 4 was also the most efficient for calcium dissolution. ► Reaction pathway was dissolution-precipitation accompanied by agglomeration step. - Abstract: The synthesis of calcium hydroxyapatite (Ca-HA) starting from calcium carbonate and different orthophosphate sources, including orthophosphoric acid, potassium, sodium and ammonium dihydrogen orthophosphates, was investigated under ambient conditions. The reaction started with calcium carbonate dissolution in an acid medium, followed by rapid precipitation of calcium cations with orthophosphate species to form calcium phosphate based particles which were in the size range of 0.4–1 μm. These particles then agglomerated into much larger ones, up to 350 μm in diameter (aggregates). These aggregates possessed an unstable porous structure which was responsible for the porosity of the final products. The highest specific surface area and pore volume were obtained with potassium dihydrogen orthophosphate. On the other hand, orthophosphoric acid led to the highest dissolution of calcium carbonate and the complete precipitation of orthophosphate species. Under ambient conditions, calcium phosphate based solid products of low crystallinity were formed. Different intermediates were identified and a reaction pathway proposed.

  2. Understanding calcium dynamics experiments and theory

    CERN Document Server

    Malchow, Dieter

    2003-01-01

    Intracellular Calcium is an important messenger in living cells. Calcium dynamics display complex temporal and spatial structures created by the concentration patterns which are characteristic for a nonlinear system operating far from thermodynamic equilibrium. Written as a set of tutorial reviews on both experimental facts and theoretical modelling, this volume is intended as an introduction and modern reference in the field for graduate students and researchers in biophysics, biochemistry and applied mathematics.

  3. Synthesis and characterization of porous calcium phosphate

    International Nuclear Information System (INIS)

    Granados C, F.; Serrano G, J.; Bonifacio M, J.

    2007-01-01

    The porous calcium phosphate was prepared by the continuous precipitation method using Ca(NO 3 ) 2 .4H 2 O and NH 4 H 2 PO 4 salts. The synthesized material was structurally and superficially characterized using the XRD, BET, IR TGA and SEM techniques. The obtained inorganic material was identified as calcium phosphate that presents a great specific area for what can be efficiently used as adsorbent material for adsorption studies in the radioactive wastes treatment present in aqueous solution. (Author)

  4. [Pharmacotherapy for preventing calcium containing stone formation].

    Science.gov (United States)

    Nagata, Masao; Takayama, Tatsuya; Mugiya, Souichi; Ohzono, Seiichiro

    2011-10-01

    Many urinary tract stones consist of calcium, and has high relapse rate. Accordingly, it is very important to prevent calcium-containing stone formation. This paper describes about effects and mechanisms for Xanthine oxidase inhibitor, citrate formulation, magnesium formulation, thiazides, vitamin B(6), extract of Quercus salicina Blume and chorei-to (medical herb) . Recent new drugs and the elucidation of new metabolic pathways may lead to the development of prevention of urolithiasis.

  5. Modulation of intestinal absorption of calcium

    Energy Technology Data Exchange (ETDEWEB)

    Fournier, P; Dupuis, Y [Ecole Pratique des Hautes Etudes, 75 - Paris (France); Paris-11 Univ., 92 - Chatenay-Malabry (France))

    1975-01-01

    Absorption of ingested calcium (2ml of a 10mM CaCl/sub 2/ solution + /sup 45/Ca) by the adult rat was shown to be facilitated by the simultaneous ingestion of an active carbohydrate, L-arabinose. As the carbohydrate concentration is increased from 10 to 200mM, the absorption of calcium is maximised at a level corresponding to about twice the control absorption level. A similar doubling of calcium absorption is obtained when a 100mM concentration of any one of a number of other carbohydrates is ingested simultaneously with a 10mM CaCl/sub 2/ solution. Conversely, the simultaneous ingestion of increasing doses (10 to 100mM) of phosphate (NaH/sub 2/PO/sub 4/) with a 10mM CaCl/sub 2/ solution results in decreased /sup 45/Ca absorption and retention by the adult rat. The maximum inhibition of calcium absorption by phosphate is independent of the concentration of the ingested calcium solution (from 5 to 50mM CaCl/sub 2/). The simultaneous ingestion of CaCl/sub 2/ (10mM) with lactose and sodium phosphate (50 and 10mM respectively) shows that the activation effect of lactose upon /sup 45/Ca absorption may be partly dissimulated by the presence of phosphate. These various observations indicate that, within a large concentration range (2 to 50mM CaCl/sub 2/) calcium absorption appears to be a precisely modulated diffusion process. Calcium absorption varies (between minimum and maximum levels) as a function of the state of saturation by the activators (carbohydrates) and inhibitors (phosphate) of the calcium transport system.

  6. Solubility of calcium in CaO-CaCl2

    International Nuclear Information System (INIS)

    Perry, G.S.; Shaw, S.J.

    1991-06-01

    The Direct Oxide Reduction (DOR) process is well established as a process to produce plutonium metal from plutonium dioxide by reaction with calcium. Calcium chloride is added to dissolve the calcium oxide produced, allowing the metal to coalesce into a button. Since calcium metal melts at 840 0 C and DOR can take place successfully below this temperature, it is likely calcium dissolved in calcium chloride reacts with the plutonium dioxide. The solubility of calcium in calcium chloride is reasonably well established but the effect of the CaO formed during the DOR process on the solubility of calcium has not been previously determined. For this reason the solubility of calcium in CaCl 2 -CaO melts at 800 o C has been studied. The solubility decreases from 2.7 mol % in CaCl 2 to 0.4 mol % in 9 mol % CaO-CaCl 2 . (author)

  7. Calcium and Egg Activation in Drosophila

    Science.gov (United States)

    Sartain, Caroline V.; Wolfner, Mariana F.

    2012-01-01

    Summary In many animals, a rise in intracellular calcium levels is the trigger for egg activation, the process by which an arrested mature oocyte transitions to prepare for embryogenesis. In nearly all animals studied to date, this calcium rise, and thus egg activation, is triggered by the fertilizing sperm. However in the insects that have been examined, fertilization is not necessary to activate their oocytes. Rather, these insects’ eggs activate as they transit through the female’s reproductive tract, regardless of male contribution. Recent studies in Drosophila have shown that egg activation nevertheless requires calcium and that the downstream events and molecules of egg activation are also conserved, despite the difference in initial trigger. Genetic studies have uncovered essential roles for the calcium-dependent enzyme calcineurin and its regulator calcipressin, and have hinted at roles for calmodulin, in Drosophila egg activation. Physiological and in vitro studies have led to a model in which mechanical forces that impact the Drosophila oocyte as it moves through the reproductive tract triggers the influx of calcium from the external environment, thereby initiating egg activation. Future research will aim to test this model, as well as to determine the spatiotemporal dynamics of cytoplasmic calcium flux and mode of signal propagation in this unique system. PMID:23218670

  8. Thermoluminescence of calcium-based phosphors

    International Nuclear Information System (INIS)

    Sunta, C.M.

    1985-01-01

    The paper reviews the thermoluminescence (TL) properties of calcium fluoride, calcium sulphate and calcium carbonate phosphors. In the case of the calcium fluoride mineral phosphor the main emitter of TL is the cerium impurity. Based on the TL emission spectra, two types of Ce 3+ centres can be easily distinguished; those associated with O 2- compensating ion and those which have either no local compensators or are associated with F - interstitial ions at the adjacent vacant body centre position. The spectra undergo remarkable changes at high doses. Such changes are associated with the probabilities of charge trapping at different types of traps and also with the probabilities of recombination at different types of luminescent centres. Some of the traps and recombination centres are spatially associated while others are distributed randomly. In calcium carbonate mineral, Mn 2+ is invariably the emitting impurity. Mn 2+ can be used as an efficient dopant for TL emission in all the three calcium based TL phosphors. A co-dopant like Ce 3+ intensifies the luminescence yield from Mn 2+ . Models of different types of electron and hole trapping centres are given. (author)

  9. Calcium homeostasis in low and high calcium water acclimatized Oreochromis mossambicus exposed to ambient and dietary cadmium

    NARCIS (Netherlands)

    Pratap, H.B.; Wendelaar Bonga, S.E.

    2007-01-01

    The effects of cadmium administered via ambient water (10 mg/l) or food (10 mgCd/fish/day) on plasma calcium, corpuscles of Stannius and bony tissues of Oreochromis mossambicus acclimated to low calcium (0.2 mM) and high calcium (0.8 mM) water were studied for 2, 4, 14 and 35 days. In low calcium

  10. Factors to consider in the selection of a calcium supplement.

    OpenAIRE

    Shangraw, R F

    1989-01-01

    Calcium supplements are widely used, yet many questions remain as to the absorption of various calcium salts. Because the solubility of many calcium salts is dependent upon pH, the type of salt used, the condition of the patient, and the time of administration should be considered. Studies show that many calcium supplements on the market today do not meet standards of quality established in the "U.S. Pharmacopeia" (USP). Consumers must be discerning about the products they purchase. Calcium s...

  11. Estimation of ionized calcium, total calcium and albumin corrected calcium for the diagnosis of hypocalcaemia of malignancy

    International Nuclear Information System (INIS)

    Ijaz, A.; Mehmood, T.; Qureshi, A.H.; Anwar, M.; Dilawar, M.; Hussain, I.; Khan, F.A.; Khan, D.A.; Hussain, S.; Khan, I.A.

    2006-01-01

    Objective: To measure levels of ionized calcium, total calcium and albumin corrected calcium in patients with different malignant disorders for the diagnosis of hypercalcaemia of malignancy. Design: A case control comparative study. Place and Duration of Study: The study was carried out in the Department of Pathology, Army Medical College Rawalpindi, Armed Forces Institute of Pathology and Department of Oncology CMH, Rawalpindi from March 2003 to December 2003. Subjects and Methods: Ninety-seven patients of various malignant disorders, admitted in the Department of Oncology, CMH, Rawalpindi, and 39 age and gender-matched disease-free persons (as control) were included in the study. Blood ionized calcium (Ca/sup ++/), pH, sodium (Na/sup +/) and potassium (K/sup +/) were analysed by Ion selective electrode (ISE) on Easylyte> auto analyser. Other related parameters were measured by colorimetric methods. Results: Blood Ca/sup ++/ levels in patients suffering from malignant disorders were found significantly high (mean +- j 1.30+017 mmoV/L) as compared to control subjects (mean +- 1.23+0.03 mmoV/L) (p<0.001). The number of patients with hypercalcaemia of malignancy detected by Ca/sup ++/ estimation was significantly higher (38%) as compared to total calcium (8.4%) and albumin corrected calcium ACC (10.6%) (p<0.001). There was no statistically significant difference in other parameters e.g. phosphate, urea, creatinine, pH, Na/sup +/ and K/sup +/ levels in study subjects and controls. Conclusion: Detection of hypercalcaemia can be markedly improved if ionized calcium estimation is used in patients with malignant disorders. (author)

  12. Anodic Behavior of Alloy 22 in Calcium Chloride and in Calcium Chloride Plus Calcium Nitrate Brines

    International Nuclear Information System (INIS)

    Evans, K.J.; Day, S.D.; Ilevbare, G.O.; Whalen, M.T.; King, K.J.; Hust, G.A.; Wong, L.L.; Estill, J.C.; Rebak, R.B.

    2003-01-01

    Alloy 22 (UNS N60622) is a nickel-based alloy, which is extensively used in aggressive industrial applications, especially due to its resistance to localized corrosion and stress corrosion cracking in high chloride environments. The purpose of this work was to characterize the anodic behavior of Alloy 22 in concentrated calcium chloride (CaCl 2 ) brines and to evaluate the inhibitive effect of nitrate, especially to localized corrosion. Standard electrochemical tests such as polarization resistance and cyclic polarization were used. Results show that the corrosion potential of Alloy 22 was approximately -360 mV in the silver-silver chloride (SSC) scale and independent of the tested temperature. Cyclic polarization tests showed that Alloy 22 was mainly susceptible to localized attack in 5 M CaCl 2 at 75 C and higher temperatures. The addition of nitrate in a molar ratio of chloride to nitrate equal to 10 increased the onset of localized corrosion to approximately 105 C. The addition of nitrate to the solution also decreased the uniform corrosion rate and the passive current of the alloy

  13. Calcium ion binding properties of Medicago truncatula calcium/calmodulin-dependent protein kinase.

    Science.gov (United States)

    Swainsbury, David J K; Zhou, Liang; Oldroyd, Giles E D; Bornemann, Stephen

    2012-09-04

    A calcium/calmodulin-dependent protein kinase (CCaMK) is essential in the interpretation of calcium oscillations in plant root cells for the establishment of symbiotic relationships with rhizobia and mycorrhizal fungi. Some of its properties have been studied in detail, but its calcium ion binding properties and subsequent conformational change have not. A biophysical approach was taken with constructs comprising either the visinin-like domain of Medicago truncatula CCaMK, which contains EF-hand motifs, or this domain together with the autoinhibitory domain. The visinin-like domain binds three calcium ions, leading to a conformational change involving the exposure of hydrophobic surfaces and a change in tertiary but not net secondary or quaternary structure. The affinity for calcium ions of visinin-like domain EF-hands 1 and 2 (K(d) = 200 ± 50 nM) was appropriate for the interpretation of calcium oscillations (~125-850 nM), while that of EF-hand 3 (K(d) ≤ 20 nM) implied occupancy at basal calcium ion levels. Calcium dissociation rate constants were determined for the visinin-like domain of CCaMK, M. truncatula calmodulin 1, and the complex between these two proteins (the slowest of which was 0.123 ± 0.002 s(-1)), suggesting the corresponding calcium association rate constants were at or near the diffusion-limited rate. In addition, the dissociation of calmodulin from the protein complex was shown to be on the same time scale as the dissociation of calcium ions. These observations suggest that the formation and dissociation of the complex between calmodulin and CCaMK would substantially mirror calcium oscillations, which typically have a 90 s periodicity.

  14. Calcium response to vitamin D supplementation

    Directory of Open Access Journals (Sweden)

    Francisco R. Spivacow

    2018-01-01

    Full Text Available Several studies show the importance of serum vitamin D sufficient levels to prevent multiple chronic diseases. However, vitamin D supplementation and its effects on urine calcium excretion remain controversial. The objective of this prospective and interventional study was to evaluate urine calcium excretion in women with normal calciuria or hypercalciuria, once serum vitamin D sufficiency was achieved. We studied 63 women with idiopathic hypercalciuria, (9 with renal lithiasis and 50 normocalciuric women. Both groups had serum vitamin D levels low (deficiency or insufficiency. Baseline urine calcium excretion was measured before being supplemented with vitamin D2 or D3 weekly or vitamin D3 100.000 IU monthly. Once serum vitamin D levels were corrected achieving at least 30 ng/ml, a second urine calcium excretion was obtained. Although in the whole sample we did not observe significant changes in urine calcium excretion according to the way of supplementation, some of those with weekly supplementation had significant higher urine calcium excretion, 19% (n = 12 of hypercalciuric women and 12% (n = 6 of the normocalciuric group. Monthly doses, also showed higher urine calcium excretion in 40% of hypercalciuric women (n = 4/10 and in 44% (n = 4/9 of the renal lithiasis hypercalciuric patients. In conclusion, different ways of vitamin D supplementation and adequate serum levels are safe in most patients, although it should be taken into account a subgroup, mainly with monthly loading doses, that could increase the calciuria significantly eventually rising renal lithiasis risk or bone mass loss, if genetically predisposed.

  15. Relationship of calcium absorption with 25(OH)D and calcium intake in children with rickets

    Science.gov (United States)

    Nutritional rickets has long been considered a disease caused by vitamin D deficiency, but recent data indicate that inadequate dietary calcium intake is an important cause of rickets, particularly in tropical countries. Children with rickets due to calcium deficiency do not have very low 25(OH) D c...

  16. Calcium spikes and calcium plateaux evoked by differential polarization in dendrites of turtle motoneurones in vitro

    DEFF Research Database (Denmark)

    Hounsgaard, J; Kiehn, O

    1993-01-01

    The ability of dendrites in turtle motoneurones to support calcium spikes and calcium plateaux was investigated using differential polarization by applied electric fields. 2. Electric fields were generated by passing current through transverse slices of the turtle spinal cord between two plate......+ spikes and Ca2+ plateaux are present in dendrites of spinal motoneurones of the turtle....

  17. Relative biological activity of amorphous calcium and calcium-magnesium phosphates

    International Nuclear Information System (INIS)

    Silina, E.N.; Kunitsa, T.N.; Shuslikova, E.S.; Griggs, J.; Levchenko, L.V.; Karjaubaeva, R.A.; Sinyayev, V.A.

    2005-01-01

    Three amorphous calcium and calcium-magnesium phosphates that are close on composition to mineral basis of the bone tissues are compared on bioactivity in the given article. Properties of the hydrated substances produced from water solutions and their derivations, which are formed due to thermal treatment, are discussed here. As a detector of bioactivity was used microbial culture E-Coli. [author

  18. Interaction of bovine gallbladder mucin and calcium-binding protein: effects on calcium phosphate precipitation

    NARCIS (Netherlands)

    Afdhal, N. H.; Ostrow, J. D.; Koehler, R.; Niu, N.; Groen, A. K.; Veis, A.; Nunes, D. P.; Offner, G. D.

    1995-01-01

    Gallstones consist of calcium salts and cholesterol crystals, arrayed on a matrix of gallbladder mucin (GBM), and regulatory proteins like calcium-binding protein (CBP). To determine if interactions between CBP and GBM follow a biomineralization scheme, their mutual binding and effects on CaHPO4

  19. Eggshell powder, a comparable or better source of calcium than purified calcium carbonate: Piglet studies

    NARCIS (Netherlands)

    Schaafsma, A.; Beelen, G.M.

    1999-01-01

    Powdered chicken eggshells might be an interesting and widely available source of calcium. In two studies using piglets we determined the digestibility of calcium from different diets. The first study compared casein-based diets with CaCO3 (CasCC) or eggshell powder (CasES). The second study

  20. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  1. Effect of dietary calcium and phosphorus on intestinal calcium absorption and vitamin D metabolism

    International Nuclear Information System (INIS)

    Ribovich, M.L.; DeLuca, H.F.

    1978-01-01

    To understand better dietary regulation of intestinal calcium absorption, a quantitative assessment of the metabolites in plasma and duodenum of rats given daily doses of radioactive vitamin D 3 and diets differing in calcium and phosphorus content was made. All known vitamin D metabolites were ultimately identified by high-pressure liquid chromatography. In addition to the known metabolites (25-hydroxyvitamin D 3 , 24,25-dihydroxyvitamin D 3 , 1,25-dihydroxyvitamin D 3 , 25,26-dihydroxyvitamin D 3 , and 1,24,25-trihydroxyvitamin D 3 ), several new and unidentified metabolites were found. In addition to 1,25-dihydroxyvitamin D 3 and 1,24,25-trihydroxyvitamin D 3 , the levels of some of the unknown metabolites could be correlated with intestinal calcium transport. However, whether or not any of these metabolites plays a role in the stimulation of intestinal calcium absorption by low dietary calcium or low dietary phosphorus remains unknown

  2. Calcium carbonate scaling kinetics determined from radiotracer experiments with calcium-47

    International Nuclear Information System (INIS)

    Turner, C.W.; Smith, D.W.

    1998-01-01

    The deposition rate of calcium carbonate on a heat-transfer surface has been measured using a calcium-47 radiotracer and compared to the measured rate of thermal fouling. The crystalline phase of calcium carbonate that precipitates depends on the degree of supersaturation at the heat-transfer surface, with aragonite precipitating at higher supersaturations and calcite precipitating at lower supersaturations. Whereas the mass deposition rates were constant with time, the thermal fouling rates decreased throughout the course of each experiment as a result of densification of the deposit. It is proposed that the densification was driven by the temperature gradient across the deposit together with the retrograde solubility of calcium carbonate. The temperature dependence of the deposition rate yielded an activation energy of 79 ± 4 kJ/mol for the precipitation of calcium carbonate on a heat-transfer surface. (author)

  3. Discovery and Development of Calcium Channel Blockers

    Directory of Open Access Journals (Sweden)

    Théophile Godfraind

    2017-05-01

    Full Text Available In the mid 1960s, experimental work on molecules under screening as coronary dilators allowed the discovery of the mechanism of calcium entry blockade by drugs later named calcium channel blockers. This paper summarizes scientific research on these small molecules interacting directly with L-type voltage-operated calcium channels. It also reports on experimental approaches translated into understanding of their therapeutic actions. The importance of calcium in muscle contraction was discovered by Sidney Ringer who reported this fact in 1883. Interest in the intracellular role of calcium arose 60 years later out of Kamada (Japan and Heibrunn (USA experiments in the early 1940s. Studies on pharmacology of calcium function were initiated in the mid 1960s and their therapeutic applications globally occurred in the the 1980s. The first part of this report deals with basic pharmacology in the cardiovascular system particularly in isolated arteries. In the section entitled from calcium antagonists to calcium channel blockers, it is recalled that drugs of a series of diphenylpiperazines screened in vivo on coronary bed precontracted by angiotensin were initially named calcium antagonists on the basis of their effect in depolarized arteries contracted by calcium. Studies on arteries contracted by catecholamines showed that the vasorelaxation resulted from blockade of calcium entry. Radiochemical and electrophysiological studies performed with dihydropyridines allowed their cellular targets to be identified with L-type voltage-operated calcium channels. The modulated receptor theory helped the understanding of their variation in affinity dependent on arterial cell membrane potential and promoted the terminology calcium channel blocker (CCB of which the various chemical families are introduced in the paper. In the section entitled tissue selectivity of CCBs, it is shown that characteristics of the drug, properties of the tissue, and of the stimuli are

  4. Calcium binding properties of calcium dependent protein kinase 1 (CaCDPK1) from Cicer arietinum.

    Science.gov (United States)

    Dixit, Ajay Kumar; Jayabaskaran, Chelliah

    2015-05-01

    Calcium plays a crucial role as a secondary messenger in all aspects of plant growth, development and survival. Calcium dependent protein kinases (CDPKs) are the major calcium decoders, which couple the changes in calcium level to an appropriate physiological response. The mechanism by which calcium regulates CDPK protein is not well understood. In this study, we investigated the interactions of Ca(2+) ions with the CDPK1 isoform of Cicer arietinum (CaCDPK1) using a combination of biophysical tools. CaCDPK1 has four different EF hands as predicted by protein sequence analysis. The fluorescence emission spectrum of CaCDPK1 showed quenching with a 5 nm red shift upon addition of calcium, indicating conformational changes in the tertiary structure. The plot of changes in intensity against calcium concentrations showed a biphasic curve with binding constants of 1.29 μM and 120 μM indicating two kinds of binding sites. Isothermal calorimetric (ITC) titration with CaCl2 also showed a biphasic curve with two binding constants of 0.027 μM and 1.7 μM. Circular dichroism (CD) spectra showed two prominent peaks at 208 and 222 nm indicating that CaCDPK1 is a α-helical rich protein. Calcium binding further increased the α-helical content of CaCDPK1 from 75 to 81%. Addition of calcium to CaCDPK1 also increased fluorescence of 8-anilinonaphthalene-1-sulfonic acid (ANS) indicating exposure of hydrophobic surfaces. Thus, on the whole this study provides evidence for calcium induced conformational changes, exposure of hydrophobic surfaces and heterogeneity of EF hands in CaCDPK1. Copyright © 2015 Elsevier GmbH. All rights reserved.

  5. Calcium-Induced calcium release during action potential firing in developing inner hair cells.

    Science.gov (United States)

    Iosub, Radu; Avitabile, Daniele; Grant, Lisa; Tsaneva-Atanasova, Krasimira; Kennedy, Helen J

    2015-03-10

    In the mature auditory system, inner hair cells (IHCs) convert sound-induced vibrations into electrical signals that are relayed to the central nervous system via auditory afferents. Before the cochlea can respond to normal sound levels, developing IHCs fire calcium-based action potentials that disappear close to the onset of hearing. Action potential firing triggers transmitter release from the immature IHC that in turn generates experience-independent firing in auditory neurons. These early signaling events are thought to be essential for the organization and development of the auditory system and hair cells. A critical component of the action potential is the rise in intracellular calcium that activates both small conductance potassium channels essential during membrane repolarization, and triggers transmitter release from the cell. Whether this calcium signal is generated by calcium influx or requires calcium-induced calcium release (CICR) is not yet known. IHCs can generate CICR, but to date its physiological role has remained unclear. Here, we used high and low concentrations of ryanodine to block or enhance CICR to determine whether calcium release from intracellular stores affected action potential waveform, interspike interval, or changes in membrane capacitance during development of mouse IHCs. Blocking CICR resulted in mixed action potential waveforms with both brief and prolonged oscillations in membrane potential and intracellular calcium. This mixed behavior is captured well by our mathematical model of IHC electrical activity. We perform two-parameter bifurcation analysis of the model that predicts the dependence of IHCs firing patterns on the level of activation of two parameters, the SK2 channels activation and CICR rate. Our data show that CICR forms an important component of the calcium signal that shapes action potentials and regulates firing patterns, but is not involved directly in triggering exocytosis. These data provide important insights

  6. Calcium movements and the cellular basis of gravitropism

    Science.gov (United States)

    Roux, S. J.; Biro, R. L.; Hale, C. C.

    An early gravity-transduction event in oat coleoptiles which precedes any noticeable bending is the accumulation of calcium on their prospective slower-growing side. Sub-cellular calcium localization studies indicate that the gravity-stimulated redistribution of calcium results in an increased concentration of calcium in the walls of responding cells. Since calcium can inhibit the extension growth of plant cell walls, this selective accumulation of calcium in walls may play a role in inducing the asymmetry of growth which characterizes gravitropism. The active transport of calcium from cells into walls is performed by a calcium-dependent ATPase localized in the plasma membrane. Evidence is presented in support of the hypothesis that this calcium pump is regulated by a feed-back mechanism which includes the participation of calmodulin.

  7. Calcium Aluminate Cement Hydration Model

    Directory of Open Access Journals (Sweden)

    Matusinović, T.

    2011-01-01

    Full Text Available Calcium aluminate cement (AC is a very versatile special cement used for specific applications. As the hydration of AC is highly temperature dependent, yielding structurally different hydration products that continuously alter material properties, a good knowledge of thermal properties at early stages of hydration is essential. The kinetics of AC hydration is a complex process and the use of single mechanisms models cannot describe the rate of hydration during the whole stage.This paper examines the influence of temperature (ϑ=5–20 °C and water-to-cement mass ratio (mH /mAC = 0.4; 0.5 and 1.0 on hydration of commercial iron-rich AC ISTRA 40 (producer: Istra Cement, Pula, Croatia, which is a part of CALUCEM group, Figs 1–3. The flow rate of heat generation of cement pastes as a result of the hydration reactions was measured with differential microcalorimeter. Chemically bonded water in the hydrated cement samples was determined by thermo-gravimetry.Far less heat is liberated when cement and water come in contact for the first time, Fig. 1, than in the case for portland cement (PC. Higher water-to-cement ratio increases the heat evolved at later ages (Fig. 3 due to higher quantity of water available for hydration. A significant effect of the water-to-cement ratio on the hydration rate and hydration degree showed the importance of water as being the limiting reactant that slows down the reaction early. A simplified stoichiometric model of early age AC hydration (eq. (8 based on reaction schemes of principal minerals, nominally CA, C12A7 and C4AF (Table 1, was employed. Hydration kinetics after the induction period (ϑ < 20 °C had been successfully described (Fig. 4 and Table 2 by a proposed model (eq. (23 which simultaneously comprised three main mechanisms: nucleation and growth, interaction at phase boundary, and mass transfer. In the proposed kinetic model the nucleation and growth is proportional to the amount of reacted minerals (eq

  8. Contracture of Slow Striated Muscle during Calcium Deprivation

    Science.gov (United States)

    Irwin, Richard L.; Hein, Manfred M.

    1963-01-01

    When deprived of calcium the slow striated muscle fibers of the frog develop reversible contractures in either hypertonic or isotonic solutions. While calcium deprivation continues because of a flowing calcium-free solution the muscles relax slowly and completely. Restoration of calcium during contracture relaxes the muscle promptly to initial tension. When relaxed during calcium lack the return of calcium does not change tension and the muscle stays relaxed. When contractures are induced by solutions containing small amounts of calcium relaxation does not occur or requires several hours. The rate of tension development depends upon the rate at which calcium moves outward since the contractures develop slower in low concentrations of calcium and are absent or greatly slowed in a stagnant calcium-free solution. Withdrawal of calcium prevents the contractile responses to ACh, KCl, or electrical stimulation through the nerve. Muscles return to their original excitability after calcium is restored. Origin of the contractures is unrelated to nerve activity since they are maximal during transmission failure from calcium lack, occur in denervated muscles, and are not blocked by high concentrations of d-tubocurarine, procaine, or atropine. The experiments also indicate that the contractures do not originate from repetitive activity of muscle membranes. The findings are most simply explained by relating the outward movement of calcium as a link for initiating contraction in slow type striated muscle. PMID:14065284

  9. Calcium and bone disorders in pregnancy

    Directory of Open Access Journals (Sweden)

    Shriraam Mahadevan

    2012-01-01

    Full Text Available Significant transplacental calcium transfer occurs during pregnancy, especially during the last trimester, to meet the demands of the rapidly mineralizing fetal skeleton. Similarly, there is an obligate loss of calcium in the breast milk during lactation. Both these result in considerable stress on the bone mineral homeostasis in the mother. The maternal adaptive mechanisms to conserve calcium are different in pregnancy and lactation. During pregnancy, increased intestinal absorption of calcium from the gut mainly due to higher generation of calcitriol (1,25 dihydroxy vitamin D helps in maintaining maternal calcium levels. On the other hand, during lactation, the main compensatory mechanism is skeletal resorption due to increased generation of parathormone related peptide (PTHrP from the breast. Previous studies suggest that in spite of considerable changes in bone mineral metabolism during pregnancy, parity and lactation are not significantly associated with future risk for osteoporosis. However, in India, the situation may not be the same as a significant proportion of pregnancies occur in the early twenties when peak bone mass is not yet achieved. Further, malnutrition, anemia and vitamin D deficiency are commonly encountered in this age group. This may have an impact on future bone health of the mother. It may also probably provide an opportunity for health care providers for prevention. Other metabolic bone diseases like hypoparathyroidism, hyperparathyroidism and pseudohypoparathyroidism are rarely encountered in pregnancy. Their clinical implications and management are also discussed.

  10. What factors underlie children's susceptibility to semantic and phonological false memories? investigating the roles of language skills and auditory short-term memory.

    Science.gov (United States)

    McGeown, Sarah P; Gray, Eleanor A; Robinson, Jamey L; Dewhurst, Stephen A

    2014-06-01

    Two experiments investigated the cognitive skills that underlie children's susceptibility to semantic and phonological false memories in the Deese/Roediger-McDermott procedure (Deese, 1959; Roediger & McDermott, 1995). In Experiment 1, performance on the Verbal Similarities subtest of the British Ability Scales (BAS) II (Elliott, Smith, & McCulloch, 1997) predicted correct and false recall of semantic lures. In Experiment 2, performance on the Yopp-Singer Test of Phonemic Segmentation (Yopp, 1988) did not predict correct recall, but inversely predicted the false recall of phonological lures. Auditory short-term memory was a negative predictor of false recall in Experiment 1, but not in Experiment 2. The findings are discussed in terms of the formation of gist and verbatim traces as proposed by fuzzy trace theory (Reyna & Brainerd, 1998) and the increasing automaticity of associations as proposed by associative activation theory (Howe, Wimmer, Gagnon, & Plumpton, 2009). Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Association of calcium sensing receptor polymorphisms at rs1801725 with circulating calcium in breast cancer patients.

    Science.gov (United States)

    Wang, Li; Widatalla, Sarrah E; Whalen, Diva S; Ochieng, Josiah; Sakwe, Amos M

    2017-08-02

    Breast cancer (BC) patients with late-stage and/or rapidly growing tumors are prone to develop high serum calcium levels which have been shown to be associated with larger and aggressive breast tumors in post and premenopausal women respectively. Given the pivotal role of the calcium sensing receptor (CaSR) in calcium homeostasis, we evaluated whether polymorphisms of the CASR gene at rs1801725 and rs1801726 SNPs in exon 7, are associated with circulating calcium levels in African American and Caucasian control subjects and BC cases. In this retrospective case-control study, we assessed the mean circulating calcium levels, the distribution of two inactivating CaSR SNPs at rs1801725 and rs1801726 in 199 cases and 384 age-matched controls, and used multivariable regression analysis to determine whether these SNPs are associated with circulating calcium in control subjects and BC cases. We found that the mean circulating calcium levels in African American subjects were higher than those in Caucasian subjects (p calcium levels were higher in BC cases compared to control subjects (p calcium levels in BC patients were independent of race. We also show that in BC cases and control subjects, the major alleles at rs1801725 (G/T, A986S) and at rs1801726 (C/G, Q1011E) were common among Caucasians and African Americans respectively. Compared to the wild type alleles, polymorphisms at the rs1801725 SNP were associated with higher calcium levels (p = 0.006) while those at rs1801726 were not. Using multivariable linear mixed-effects models and adjusting for age and race, we show that circulating calcium levels in BC cases were associated with tumor grade (p = 0.009), clinical stage (p = 0.003) and more importantly, with inactivating mutations of the CASR at the rs1801725 SNP (p = 0.038). These data suggest that decreased sensitivity of the CaSR to calcium due to inactivating polymorphisms at rs1801725, may predispose up to 20% of BC cases to high circulating calcium

  12. OSTEOPOROSIS IN CALCIUM PYROPHOSPHATE CRYSTAL DEPOSITION DISEASE

    Directory of Open Access Journals (Sweden)

    S A Vladimirov

    2013-01-01

    Full Text Available Objective: to study the incidence of osteoporosis (OP in patients with calcium pyrophosphate crystal deposition disease (CPCDD. Subjects and methods. Eighty patients with CPCDD were examined. Bone mineral density (BMD of the forearm, lumbar spine, and femoral neck was determined by dual-energy X-ray absorptiometry. Laboratory diagnosis involved determination of the blood levels of C-reactive protein, parathyroid hormone, calcium, magnesium, and phosphorus and the daily urinary excretion of calcium and phosphates. Results. The patients with OP were significantly older than those with normal BMD and osteopenia. Forearm bones were the most common isolated location of OP and osteopenia. Injuries in the history, traumatic fractures, and the intake of diuretics were somewhat more common in the patients diagnosed with OP. The incidence of hyperparathyroidism did not differ significantly in the groups.

  13. Purification method for calcium fluoride containing uranium

    International Nuclear Information System (INIS)

    Ogami, Takeshi

    1998-01-01

    Calcium fluoride (CaF 2 ) containing uranium is heated in an electrolytic bath having a cathode and an anode to form a molten salt, and the molten salt is electrolytically reduced to form metal uranium deposited on the surface of the cathode. The calcium fluoride molten salt separated by the deposition of generated metal uranium on the surface of the cathode is solidified by cooling. The solidified calcium fluoride is recovered. When metal uranium is deposited on the surface of the cathode by the electrolytic reduction of the molten salt, impurities such as plutonium and neptunium are also deposited on the surface of the anodes entrained by the metal uranium. Impurities having high vapor pressures such as americium and strontium are evaporated and removed from the molten salts. Then, nuclides such as uranium can thus be separated and recovered, and residual CaF 2 can be recovered in a state easily storable and reutilizable. (T.M.)

  14. Calcium concentration in the CAPD dialysate

    DEFF Research Database (Denmark)

    Bro, S; Brandi, L; Daugaard, H

    1998-01-01

    OBJECTIVE: To evaluate risk/benefit of various continuous ambulatory peritoneal dialysis (CAPD) dialysate calcium concentrations. DATA SOURCES: A review of the literature on the effects of various CAPD dialysate Ca concentrations on plasma Ca, plasma phosphate, plasma parathyroid hormone (PTH......), doses of calcium carbonate, doses of vitamin D analogs, and requirements of aluminum-containing phosphate binders. STUDY SELECTION: Eleven studies of nonselected CAPD patients, and 13 studies of CAPD patients with hypercalcemia were reviewed. RESULTS: In nonselected CAPD patients, treatment...... with a reduced dialysate Ca concentration (1.00, 1.25, or 1.35 mmol/L) improved the tolerance to calcium carbonate and/or vitamin D metabolites and reduced the need for Al-containing phosphate binders. When using dialysate Ca 1.25 or 1.35 mmol/L, the initial decrease of plasma Ca and increase of PTH could easily...

  15. Thermal expansion properties of calcium aluminate hydrates

    International Nuclear Information System (INIS)

    Song, Tae Woong

    1986-01-01

    In order to eliminate the effect of impurities and aggregates on the thermomechanical properties of the various calcium aluminate hydrates, and to prepare clinkers in which all calcium aluminates are mixed homogeneously, chemically pure CaO and Al 2 O 3 were weighed, blended and heated in various conditions. After quantitative X-ray diffractometry(QXRD), the synthesized clinker was hydrated and cured under the conditions of 30 deg C, W/C=0.5, relative humidity> 90% respectively during 24 hours. And then differential thermal analysis(DTA), thermogravimetry(TG), micro calorimetry, thermomechanical analysis(TMA) and scanning electron microanalysis(SEM) were applied to examine the thermal properties of samples containing, calcium aluminate hydrates in various quantity. (Author)

  16. Vitamin D with calcium reduces mortality

    DEFF Research Database (Denmark)

    Rejnmark, Lars; Avenell, Alison; Masud, Tahir

    2012-01-01

    Introduction: Vitamin D may affect multiple health outcomes. If so, an effect on mortality is to be expected. Using pooled data from randomized controlled trials, we performed individual patient data (IPD) and trial level meta-analyses to assess mortality among participants randomized to either...... vitamin D alone or vitamin D with calcium. Subjects and Methods: Through a systematic literature search, we identified 24 randomized controlled trials reporting data on mortality in which vitamin D was given either alone or with calcium. From a total of 13 trials with more than 1000 participants each......,528 randomized participants (86.8% females) with a median age of 70 (interquartile range, 62-77) yr. Vitamin D with or without calcium reduced mortality by 7% [hazard ratio, 0.93; 95% confidence interval (CI), 0.88-0.99]. However, vitamin D alone did not affect mortality, but risk of death was reduced if vitamin...

  17. Calcium levels and calcium: available phosphorus ratios in diets for white egg layers from 42 to 58 weeks of age

    Directory of Open Access Journals (Sweden)

    Silvana Marques Pastore

    2012-12-01

    Full Text Available The experiment was conducted to determine the nutritional requirement of calcium and the best calcium:available phosphorus ratio for commercial layers at the post-laying peak. A total of 324 Hy-Line W-36 laying hens were utilized in the period from 42 to 58 weeks of age, distributed in a completely randomized design in a 3 × 3 factorial arrangement, composed of three levels of calcium (39, 42 and 45 g/kg and three calcium:phosphorus ratios (12.12:1; 10.53:1; and 9.30:1, totaling nine treatments with six replications and six birds per experimental unit. There was no significant effect from the calcium levels × calcium:phosphorus ratio interaction for any of the variables studied. The calcium levels and the calcium:phosphorus ratios did not affect the variables performance or egg and bone quality. At the evaluation of the calcium:phosphorus balance, as the levels of calcium of the diet were raised, the intake of calcium and phosphorus and the contents of mineral matter and calcium in the excreta increased linearly, and the retention of calcium by birds decreased linearly. With the reduction of the calcium:phosphorus ratios of the diet, intake, retention and excretion of phosphorus by layers increased. Diets containing calcium at 39 g/kg and a calcium:phosphorus ratio of 12.12:1, corresponding to an increase in calcium of 3.51 g/bird/day and available phosphorus of 289 mg/bird/day, meet the requirements of calcium and available phosphorus of white egg layers in the period from 42 to 58 weeks of age.

  18. Hydrolytic conversion of amorphous calcium phosphate into apatite accompanied by sustained calcium and orthophosphate ions release

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Xufeng, E-mail: nxf@buaa.edu.cn [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China); BUAA Research Institute, Guangzhou 510530 (China); Research Institute of Beihang University in Shenzhen, Shenzhen 518057 (China); Chen, Siqian; Tian, Feng; Wang, Lizhen [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China); Feng, Qingling [State Key Laboratory of New Ceramic and Fine Processing, Tsinghua University, Beijing 100084 (China); Fan, Yubo, E-mail: yubofan@buaa.edu.cn [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China)

    2017-01-01

    The aim of this study is to investigate the calcium and orthophosphate ions release during the transformation of amorphous calcium phosphate (ACP) to hydroxyapatite (HA) in aqueous solution. The ACP is prepared by a wet chemical method and further immersed in the distilled water for various time points till 14 d. The release of calcium and orthophosphate ions is measured with calcium and phosphate colorimetric assay kits, respectively. The transition of ACP towards HA is detected by x-ray diffraction (XRD), transmission electron microscopy (TEM), and fourier transform infrared spectroscopy (FTIR). The results indicate that the morphological conversion of ACP to HA occurs within the first 9 h, whereas the calcium and orthophosphate ions releases last for over 7 d. Such sustained calcium and orthophosphate ions release is very useful for ACP as a candidate material for hard tissue regeneration. - Highlights: • ACP is prepared using a wet chemical method. • The conversion of crystal morphology and structure occurs mainly within the initial 9 h. • The calcium and orthophosphate ions release sustains over 14 d.

  19. Characterization of Calcium Compounds in Opuntia ficus indica as a Source of Calcium for Human Diet

    Directory of Open Access Journals (Sweden)

    Isela Rojas-Molina

    2015-01-01

    Full Text Available Analyses of calcium compounds in cladodes, soluble dietary fiber (SDF, and insoluble dietary fiber (IDF of Opuntia ficus indica are reported. The characterization of calcium compounds was performed by using Scanning Electron Microscopy, Energy Dispersive Spectrometry, X-ray diffraction, and infrared spectroscopy. Atomic Absorption Spectroscopy and titrimetric methods were used for quantification of total calcium and calcium compounds. Whewellite (CaC2O4·H2O, weddellite (CaC2O4·(H2O2.375, and calcite (CaCO3 were identified in all samples. Significant differences (P≤0.05 in the total calcium contents were detected between samples. CaC2O4·H2O content in cladodes and IDF was significantly higher (P≤0.05 in comparison to that observed in SDF, whereas minimum concentration of CaCO3 was detected in IDF with regard to CaCO3 contents observed in cladodes and SDF. Additionally, molar ratio oxalate : Ca2+ in all samples changed in a range from 0.03 to 0.23. These results support that calcium bioavailability in O. ficus indica modifies according to calcium compounds distribution.

  20. Effect of oral calcium and calcium + fluoride treatments on mouse bone properties during suspension

    Science.gov (United States)

    Simske, S. J.; Luttges, M. W.; Allen, K. A.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    The bone effects of oral dosages of calcium chloride with or without supplementary sodium fluoride were assessed in antiorthostatically suspended mice. Two calcium dosages were used to replace half (3.1 mM) or all(6.3 mM) of the dietary calcium lost due to reduced food intake by the suspended mice. Two groups of 6.3 mM CaCl2-treated mice were additionally treated with 0.25 or 2.5 mM NaF. The results indicate that supplementation of the mouse drinking water with calcium salts prevents bone changes induced by short-term suspension, while calcium salts in combination with fluoride are less effective as fluoride dosage increases. However, the calcium supplements change the relationship between the femur mechanical properties and the mineral composition of the bone. Because of this, it appears that oral calcium supplements are effective through a mechanism other than simple dietary supplementation and may indicate a dependence of bone consistency on systemic and local fluid conditions.

  1. Plasma concentration of ionized calcium in healthy iguanas.

    Science.gov (United States)

    Dennis, P M; Bennett, R A; Harr, K E; Lock, B A

    2001-08-01

    To measure plasma concentration of ionized calcium in healthy green iguanas. Prospective study. 9 juvenile and 21 (10 male, 11 female) adult iguanas. Blood samples were obtained from each iguana, and plasma calcium, glucose, phosphorus, uric acid, total protein, albumin, globulin, potassium, and ionized calcium concentrations, aspartate transaminase (AST) activity, and pH were measured. Heparinized blood was used for measurement of ionized calcium concentration and blood pH. A CBC was also performed to assess the health of the iguanas. Significant differences were not detected among the 3 groups (juveniles, males, and females) with regard to ionized calcium concentration. Mean ionized calcium concentration measured in blood was 1.47 +/- 0.105 mmol/L. Significant differences were detected between juveniles and adults for values of phosphorus, glucose, total protein, albumin, globulin, and AST activity. Ionized calcium concentration provides a clinical measurement of the physiologically active calcium in circulation. Evaluation of physiologically active calcium in animals with suspected calcium imbalance that have total plasma calcium concentrations within reference range or in gravid animals with considerably increased total plasma calcium concentrations is vital for determining a therapeutic plan. Accurate evaluation of calcium status will provide assistance in the diagnosis of renal disease and seizures and allow for better evaluation of the health status of gravid female iguanas.

  2. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Science.gov (United States)

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  3. Incidence and progression of aortic valve calcium in the Multi-ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Owens, David S; Katz, Ronit; Takasu, Junichiro; Kronmal, Richard; Budoff, Matthew J; O'Brien, Kevin D

    2010-03-01

    Aortic valve calcium (AVC) is common among older adults and shares epidemiologic and histopathologic similarities to atherosclerosis. However, prospective studies have failed to identify meaningful risk associations with incident ("new") AVC or its progression. In the present study, AVC was quantified from serial computed tomographic images from 5,880 participants (aged 45 to 84 years) in the Multi-Ethnic Study of Atherosclerosis, using the Agatston method. Multivariate backward selection modeling was used to identify the risk factors for incident AVC and AVC progression. During a mean follow-up of 2.4 +/- 0.9 years, 210 subjects (4.1%) developed incident AVC. The incidence rate (mean 1.7%/year) increased significantly with age (p AVC included age, male gender, body mass index, current smoking, and the use of lipid-lowering and antihypertensive medications. Among those with AVC at baseline, the median rate of AVC progression was 2 Agatston units/year (interquartile range -21 to 37). The baseline Agatston score was a strong, independent predictor of progression, especially among those with high calcium scores at baseline. In conclusion, in this ethnically diverse, preclinical cohort, the rate of incident AVC increased significantly with age. The incident AVC risk was associated with several traditional cardiovascular risk factors, specifically age, male gender, body mass index, current smoking, and the use of both antihypertensive and lipid-lowering medications. AVC progression risk was associated with male gender and the baseline Agatston score. Additional research is needed to determine whether age- and stage-specific mechanisms underlie the risk of AVC progression. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Effects of extracellular calcium on calcium transport during hyperthermia of tumor cells.

    Science.gov (United States)

    Anghileri, L J; Marcha, C; Crone-Escanyé, M C; Robert, J

    1985-08-01

    The effects of different concentrations of extracellular ion calcium on the transport of calcium by tumor cells have been studied by means of the uptake of radiocalcium. Tumor cells incubated at 45 degrees C take up 4-10 times the amount of radioactivity incorporated by cells incubated at 37 degrees C. The difference is still greater (up to 100 times) for the intracellular incorporation as assessed by elimination of the membrane-bound calcium by EGTA treatment. The possible mechanisms involved in this differential behavior are discussed.

  5. The formation reaction of calcium hexa-aluminate

    International Nuclear Information System (INIS)

    Tuganova, S.Kh.; Sirajiddinov, N.A.

    1990-01-01

    The formation reaction of CaAl 12 O 19 at interaction of calcium oxide and aluminium in solid form has been studied. Some physical-chemical characteristics of calcium hexa-aluminate are given. (author)

  6. Calcium phosphate saturation in seawater around the Andaman Island

    Digital Repository Service at National Institute of Oceanography (India)

    Naik, S.; Reddy, C.V.G.

    Ionic product (IP) of calcium phosphate is calculated at some stations around Andaman Island. The depthwise variations of the ionic product of calcium phosphate seem to follow a normal trend with maximum saturation value between 100 to 200 m. Using...

  7. Mucins and calcium phosphate precipitates additively stimulate cholesterol crystallization

    NARCIS (Netherlands)

    van den Berg, A. A.; van Buul, J. D.; Tytgat, G. N.; Groen, A. K.; Ostrow, J. D.

    1998-01-01

    Human biliary mucin and calcium binding protein (CBP) influence formation of both calcium salt precipitates and cholesterol crystals and colocalize in the center of cholesterol gallstones. We investigated how physiological concentrations of these proteins regulate cholesterol crystallization in

  8. The effect of farmyard manure and calcium ammonium nitrate ...

    African Journals Online (AJOL)

    The effect of farmyard manure and calcium ammonium nitrate fertilisers on micronutrient density (iron, zinc, manganese, calcium and potassium) and seed yields of solanium villosum (black nightshade) and cleome gynandra (cat whiskers) on uetric nitisol.

  9. Calcium and Vitamin D: Important at Every Age

    Science.gov (United States)

    ... need, see the Recommended Calcium Intakes (in milligrams) chart below. Recommended Calcium Intakes Life-stage group mg/ ... Child Health and Human Development National Institute of Dental and Craniofacial Research National Institute of Diabetes and ...

  10. Biphasic calcium phosphate–casein bone graft fortified with Cassia

    Indian Academy of Sciences (India)

    Biphasic calcium phosphate; bone graft; Cassia occidentalis; simulated body fluid; SaOS-2 cell line. ... The study investigates the efficacy of CO extract incorporated biphasic calcium phosphate as an osteoinductive material. ... Current Issue

  11. stabilization of ikpayongo laterite with cement and calcium carbide

    African Journals Online (AJOL)

    PROF EKWUEME

    Laterite obtained from Ikpayongo was stabilized with 2-10 % cement and 2-10 % Calcium Carbide waste, for use .... or open dumping which have effect on surface and ... Table 1: Chemical Composition of Calcium Carbide Waste and Cement.

  12. MESSENGER MASCS/UVVS Observations of Cold Exospheric Calcium

    Science.gov (United States)

    Cassidy, T. A.

    2018-05-01

    Exospheric calcium is primarily ejected by a high energy process on the dawn hemisphere. UVVS data also show a sporadic cold component at low altitudes. Its temperature is consistent with laboratory measurements of photodesorption of calcium sulfide.

  13. Calcium Supplements: Do They Interfere with Blood Pressure Drugs?

    Science.gov (United States)

    ... with blood pressure drugs? Is it true that calcium supplements may interact with blood pressure medications? Answers ... G. Sheps, M.D. Yes. In large amounts, calcium supplements may interact with some blood pressure medications. ...

  14. Calcium Supplements: A Risk Factor for Heart Attack?

    Science.gov (United States)

    ... factor for heart attack? I've read that calcium supplements may increase the risk of heart attack. ... D. Some doctors think it's possible that taking calcium supplements may increase your risk of a heart ...

  15. [The fasting calcium/creatinine ratio in patients with calcium stones and the relation with hypercalciuria and phosphocalcium metabolism].

    Science.gov (United States)

    Arrabal-Polo, Miguel Ángel; del Carmen Cano-García, María; Arrabal-Martín, Miguel

    2016-04-01

    To determine the importance of fasting calcium/creatinine ratio in patients with calcium stones and its relation with hypercalciuria and phospho-calcium metabolism. Cross-sectional study including 143 patients divided into two groups according to fasting calcium/creatinine. Group 1: 66 patients (calcium/ creatininecreatinine>0.11). A comparative study is performed between groups including phospho-calcium metabolism parameters and excretion of urinary lithogenic markers. Linear correlation studying calciuria and fasting calcium/ creatinine was performed. SPSS 17.0 statistical analysis software was used, considering p≤0.05. It is noteworthy that group 2 had increased 24 h urine calcium excretion in comparison to group 1 (229.3 vs 158.1; p=0.0001) and calcium/citrate (0.47 vs 0.34; p=0.001). There is a positive and significant correlation between calcium levels in 24 h urine and fasting calcium/creatinine (R=0.455; p=0.0001) and a cutoff is set at 0.127 (sensitivity 72%, specificity 66%) to determine hypercalciuria (>260 mg in 24 h). Increased fasting calcium/creatinine determines increased 24 hours calcium excretion, although the sensitivity and specificity to determine hypercalciuria is not high.

  16. Phenotypic variability in unicellular organisms: from calcium signalling to social behaviour.

    Science.gov (United States)

    Vogel, David; Nicolis, Stamatios C; Perez-Escudero, Alfonso; Nanjundiah, Vidyanand; Sumpter, David J T; Dussutour, Audrey

    2015-11-22

    Historically, research has focused on the mean and often neglected the variance. However, variability in nature is observable at all scales: among cells within an individual, among individuals within a population and among populations within a species. A fundamental quest in biology now is to find the mechanisms that underlie variability. Here, we investigated behavioural variability in a unique unicellular organism, Physarum polycephalum. We combined experiments and models to show that variability in cell signalling contributes to major differences in behaviour underpinning some aspects of social interactions. First, following thousands of cells under various contexts, we identified distinct behavioural phenotypes: 'slow-regular-social', 'fast-regular-social' and 'fast-irregular-asocial'. Second, coupling chemical analysis and behavioural assays we found that calcium signalling is responsible for these behavioural phenotypes. Finally, we show that differences in signalling and behaviour led to alternative social strategies. Our results have considerable implications for our understanding of the emergence of variability in living organisms. © 2015 The Author(s).

  17. 40 CFR 415.50 - Applicability; description of the calcium oxide production subcategory.

    Science.gov (United States)

    2010-07-01

    ... calcium oxide production subcategory. 415.50 Section 415.50 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Calcium Oxide Production Subcategory § 415.50 Applicability; description of the calcium... the production of calcium oxide. ...

  18. Calcium Intake in Elderly Australian Women Is Inadequate

    Directory of Open Access Journals (Sweden)

    Colin W. Binns

    2010-09-01

    Full Text Available The role of calcium in the prevention of bone loss in later life has been well established but little data exist on the adequacy of calcium intakes in elderly Australian women. The aim of this study was to compare the dietary intake including calcium of elderly Australian women with the Australian dietary recommendation, and to investigate the prevalence of calcium supplement use in this population. Community-dwelling women aged 70–80 years were randomly recruited using the Electoral Roll for a 2-year protein intervention study in Western Australia. Dietary intake was assessed at baseline by a 3-day weighed food record and analysed for energy, calcium and other nutrients. A total of 218 women were included in the analysis. Mean energy intake was 7,140 ± 1,518 kJ/day and protein provided 19 ± 4% of energy. Mean dietary calcium intake was 852 ± 298 mg/day, which is below Australian recommendations. Less than one quarter of women reported taking calcium supplements and only 3% reported taking vitamin D supplements. Calcium supplements by average provided calcium 122 ± 427 mg/day and when this was taken into account, total calcium intake increased to 955 ± 504 mg/day, which remained 13% lower than the Estimated Average Requirement (EAR, 1,100 mg/day for women of this age group. The women taking calcium supplements had a higher calcium intake (1501 ± 573 mg compared with the women on diet alone (813 ± 347 mg. The results of this study indicate that the majority of elderly women were not meeting their calcium requirements from diet alone. In order to achieve the recommended dietary calcium intake, better strategies for promoting increased calcium, from both diet and calcium supplements appears to be needed.

  19. Laterality of Symptomatic Recurrent Calcium Nephrolithiasis | Ketata ...

    African Journals Online (AJOL)

    Objective: Although it is presumed that both kidneys excrete similar urinary constituents, it is a general observation that the majority of patients present with unilateral stone disease. The aim of this work was to study the laterality of recurrence in calcium stone formers. Patients and Methods: In a retrospective study of 154 ...

  20. ORIGINAL ARTICLES Calcium supplementation to prevent pre ...

    African Journals Online (AJOL)

    During early pregnancy BP normally falls, climbing slowly ... Resource Centre for Randomised Trials, Institute of Health Sciences, Old Road. Headington, Oxford, UK ... Subgroup analyses were used to test whether these effects ..... Prevention of pregnancy-induced hypertension by calcium supplementation in angiotensin.

  1. Biocompatibility of bio based calcium carbonate nanocrystals ...

    African Journals Online (AJOL)

    Background: Currently, there has been extensive research interest for inorganic nanocrystals such as calcium phosphate, iron oxide, silicone, carbon nanotube and layered double hydroxide as a drug delivery system especially in cancer therapy. However, toxicological screening of such particles is paramount importance ...

  2. Effect of Ultrasound on Calcium Carbonate Crystallization

    NARCIS (Netherlands)

    Wagterveld, R.M.

    2013-01-01

    Scaling comprises the formation of hard mineral deposits on process or membrane equipment and calcium carbonate is the most common scaling salt. Especially in reverse osmosis (RO) membrane systems, scale formation has always been a serious limitation, causing flux decline, membrane degradation, loss

  3. Calcium Impact on Milk Gels Formation

    DEFF Research Database (Denmark)

    Koutina, Glykeria

    of temperature and pH may result in different final structure properties in dairy products such as cheese. A significant amount of calcium remained in the micelles between pH 4.8 and 4.6, this can contribute to the final strength of acid milk gels, such as in yogurt or in cream cheeses. After the gelation point...

  4. Calcium model for mammalian skeletal muscle

    NARCIS (Netherlands)

    Wallinga, W.; Boom, H.B.K.; Heijink, R.J.; van der Vliet, G.H.

    1981-01-01

    A model is presented describing quantitatively the events between excitation and force development in skeletal muscle. It consists of a calcium mediated activation model (c.m.a.m.) in series with a force generator model (f.g.m.). The c.m.a.m. was based on intracellular processes such as cisternal

  5. Calcium hydroxylapatite for jawline rejuvenation: consensus recommendations.

    Science.gov (United States)

    Dallara, Jean-Marie; Baspeyras, Martine; Bui, Patrick; Cartier, Hugues; Charavel, Marie-Hélène; Dumas, Laurent

    2014-03-01

    Age-associated volume loss is now known to play an important role in the structural changes of the aging face. In the lower face, this manifests as drooping of the corners of the mouth and jowl leading to a loss of the oval jawline of youth. Jawline reshaping by replacing volume has therefore become an indispensable component of modern facial rejuvenation. Calcium hydroxylapatite (CaHA; Radiesse® , Merz Pharmaceuticals GmbH, Frankfurt, Germany) is an injectable filler with a cosmetic indication for tissue augmentation. The ability of calcium hydroxylapatite to provide immediate and long-lasting volume enhancement makes it an ideal agent for restoring an oval jawline. This consensus statement has been developed to assist clinicians who would like to gain more experience in the use of volumizing agents to achieve an optimal outcome with this procedure. Using the recently developed Merz Aesthetics Scale® for jawline, the consensus provides a treatment protocol for individuals at each stage of oval loss and presents a series of before and after images to illustrate the improvements that can be achieved. Specific recommendations for calcium hydroxylapatite including type of anesthesia, injection techniques, volume for injection, use in combination with other procedures, and expected duration of corrections are provided. Techniques for minimizing and managing expected problems and potential complications are also described. Calcium hydroxylapatite is appropriate for treating patients at any stage of oval loss. © 2014 Wiley Periodicals, Inc.

  6. Drying and Rehydration of Calcium Alginate Gels

    NARCIS (Netherlands)

    Vreeker, R.; Li, L.; Fang, Y.; Appelqvist, I.; Mendes, E.

    2008-01-01

    In this paper, we study the rehydration properties of air-dried calcium alginate gel beads. Rehydration is shown to depend on alginate source (i.e. mannuronic to guluronic acid ratio) and the salt concentration in the rehydration medium. Rehydration curves are described adequately by the empirical

  7. Tetany: quantitative interrelationships between calcium and alkalosis.

    Science.gov (United States)

    Edmondson, J W; Brashear, R E; Li, T K

    1975-04-01

    Tetany occurs with hypocalcemia and alkalosis or both. The interrelationship of calcium and acid-base balance necessary for inducing tetany, the role of the central nervous system, and the rate of development of hypocalcemia have been investigated. Tetany occurred in less than 50 percent of one group of dogs made alkalotic by hyperventilation or made hypocalcemic by infusion of ethylene glycol-bis(beta-amino ethyl ether) N, N'-tetraacetate. In contrast, hypocalcemia combined with hypocapnic alkalosis always produced tetany. Slowly evolving hypocalcemia was achieved inanother group of dogs by thyroparathyroidectomy, and tetany was induced postoperatively by hypocapnic alkalosis. An identical relationship between serum calcium ion concentration and arterial pH or CO2 tension was found in both groups. Tetany could not be related to the cerebrospinal fluid (CSF) calcium ion content in either group. Hypocalcemia and alkalosis are therefore coparticipants in the development of tetany and are independent of the rate of development of hypocalcemia and of CSF calcium ion concentration. The importance of alkalosis in tetany with hypoparathyroidism is emphasized.

  8. Calcium and Nuclear Signaling in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Ivan V. Maly

    2018-04-01

    Full Text Available Recently, there have been a number of developments in the fields of calcium and nuclear signaling that point to new avenues for a more effective diagnosis and treatment of prostate cancer. An example is the discovery of new classes of molecules involved in calcium-regulated nuclear import and nuclear calcium signaling, from the G protein-coupled receptor (GPCR and myosin families. This review surveys the new state of the calcium and nuclear signaling fields with the aim of identifying the unifying themes that hold out promise in the context of the problems presented by prostate cancer. Genomic perturbations, kinase cascades, developmental pathways, and channels and transporters are covered, with an emphasis on nuclear transport and functions. Special attention is paid to the molecular mechanisms behind prostate cancer progression to the malignant forms and the unfavorable response to anti-androgen treatment. The survey leads to some new hypotheses that connect heretofore disparate results and may present a translational interest.

  9. Pharmacological analysis of calcium antagonist receptors

    International Nuclear Information System (INIS)

    Reynolds, I.J.

    1987-01-01

    This work focuses on two aspects of the action of calcium antagonist drugs, namely, the interaction of drugs with receptors for verapamil-like calcium antagonists, and the interactions of drugs with voltage-sensitive calcium fluxes in rat brain synaptosomes. From binding studies I have found that the ligand of choice for labeling the verapamil receptor is (-)[ 3 H]desmethoxy-verapamil. This drug labels potently, reversibly and stereoselectively two receptors in membranes prepared from rat brain and rabbit skeletal muscle tissues. In equilibrium studies dihydropyridine calcium antagonists interact in a non-competitive fashion, while many non-DHPs are apparently competitive. In-depth kinetic studies in skeletal muscle membranes indicate that the two receptors are linked in a negative heterotropic fashion, and that low-affinity binding of (-) [ 3 H]desmethoxy-verapamil may be to the diltiazem receptor. However, these studies were not able to distinguish between the hypothesis that diltiazem binds to spatially separate, allosterically coupled receptors, and the hypothesis that diltiazem binds to a subsite of the verapamil receptor

  10. Electrosprayed calcium phosphate coatings for biomedical purposes.

    NARCIS (Netherlands)

    Leeuwenburgh, S.C.G.

    2006-01-01

    In this thesis, the suitability of the Electrostatic Spray Deposition (ESD) technique was studied for biomedical purposes, i.e., deposition of calcium phosphate (CaP) coatings onto titanium substrates. Using ESD, which is a simple and cheap deposition method for inorganic and organic coatings, it

  11. An improved calcium chloride method preparation and ...

    African Journals Online (AJOL)

    Transformation is one of the fundamental and essential molecular cloning techniques. In this paper, we have reported a modified method for preparation and transformation of competent cells. This modified method, improved from a classical protocol, has made some modifications on the concentration of calcium chloride ...

  12. Serum Calcium, Inorganic Phosphates and some Haematological ...

    African Journals Online (AJOL)

    Objectives: Sickle cell disease has long been associated with bone deformities and pain. Mineral salts such as calcium and inorganic phosphate are critical in bone formation and metabolism. This investigation was designed to study the serum concentration of these minerals as well as some haematological parameters in ...

  13. Calcium Supplementation as Prophylaxis against Colon Cancer?

    NARCIS (Netherlands)

    Kleibeuker, JH; Cats, A; van der Meer, R; Lapré, JA; de Vries, EGE

    1994-01-01

    Dietary factors are major determinants of colorectal cancer risk. Especially a diet high in fat and low in fiber is recognized to be a risk factor. Dietary calcium has been suggested to be protective against colorectal cancer through the binding of intraluminal fatty acids and bile acids. Because of

  14. Enhanced expression of a calcium-dependent protein kinase

    Indian Academy of Sciences (India)

    Among the downstream targets of calcium in plants, calcium-dependent protein kinases (CDPKs) form an interesting class of kinases which are activated by calcium binding. They have been implicated in a diverse array of responses to hormonal and environmental stimuli. In order to dissect the role of CDPKs in the moss ...

  15. 21 CFR 872.3250 - Calcium hydroxide cavity liner.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Calcium hydroxide cavity liner. 872.3250 Section... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3250 Calcium hydroxide cavity liner. (a) Identification. A calcium hydroxide cavity liner is a device material intended to be applied to the interior of a...

  16. 21 CFR 582.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aluminum calcium silicate. 582.2122 Section 582.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent. (c...

  17. Effect of nutrient calcium on the cell wall composition and ...

    African Journals Online (AJOL)

    The effect of calcium in the nutrient medium on kikuyu grass (Pennisetum clandestinum Hochst), grown in a solution culture, was investigated. Calcium had no effect on the lignin content of leaf material, but decreased the lignin content per unit stem cell wall. Calcium appeared to have no significant effect on either the ...

  18. 21 CFR 182.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aluminum calcium silicate. 182.2122 Section 182.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent. (c...

  19. Calcium and energy: making the cake and eating it too?

    Science.gov (United States)

    Green, Douglas R; Wang, Ruoning

    2010-07-23

    Mitochondrial calcium ions promote a number of events that sustain ATP levels in the cell. Cardenas et al. (2010) now demonstrate that the inositol 1,4,5-triphosphate receptor at the endoplasmic reticulum constitutively provides calcium for mitochondria. In the absence of this calcium transfer, cells use autophagy to sustain survival. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Dietary calcium intake and sunlight exposure among children aged ...

    African Journals Online (AJOL)

    Nutritional rickets can be caused by either or both calcium and vitamin D deficiencies, and can frequently occur in Africa. In Ethiopia, limited evidence exists regarding the calcium intake of children and their sunlight exposure practices. The purpose of this study was to assess information regarding dietary calcium intake and ...