DEFF Research Database (Denmark)
Timmermann, D B; Lund, Trine Meldgaard; Belhage, B
2001-01-01
The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
Energy Technology Data Exchange (ETDEWEB)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2001-01-01
The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...
Directory of Open Access Journals (Sweden)
Erin K Purcell
Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah
2012-01-01
The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav
2006-01-01
Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Inhibition of large conductance calcium-dependent potassium ...
African Journals Online (AJOL)
conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.
Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M
1993-01-01
A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from
Voltage-Gated Calcium Channels
Zamponi, Gerald Werner
Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.
Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H
2017-10-01
Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav
2007-01-01
Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
New Role of P/Q-type Voltage-gated Calcium Channels
DEFF Research Database (Denmark)
Hansen, Pernille B L
2015-01-01
Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various calcium channel subtypes, and the functional contribution from P/Q-type channels as compared with L-type should be considered. Confirming the presence of P/Q-type voltage...
Minor, Daniel L; Findeisen, Felix
2010-01-01
Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.
Findeisen, Felix; Minor, Daniel L
2009-03-01
Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.
International Nuclear Information System (INIS)
Gear, A.R.L.; Hallam, T.J.
1986-01-01
Interest in phosphatidylinositol metabolism has been greatly stimulated by the findings that diglyceride and inositol phosphates may serve as second messengers in modulating cellular function. Formation of 1,4,5-inositol trisphosphate (IP 3 ), in particular, has been linked to mobilization of intracellular calcium in a number of cell types. The authors have examined the ability of IP 3 to mobilize calcium in human platelets permeabilized by either saponin or high-voltage discharge. Saponin at 15 μg/ml effectively permeabilized platelets to exogenous inositol 1,4,5-trisphosphate which released bound [ 45 Ca] within 1 min and with a Ka of 7.4 +/- 4.1 μM. A small (25%) azide-sensitive pool was also responsive to inositol trisphosphate. The calcium pools were completely discharged by A-23187 and the ATP-dependent uptake was prevented by dinitrophenol. In contrast to the result with saponin, platelets accessed by high-voltage discharge were insensitive to challenge by inositol 1,4,5-trisphosphate. The data suggest that while inositol 1,4,5-trisphosphate can rapidly mobilize platelet calcium, the ability to demonstrate this depends on the method of permeabilization
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
DEFF Research Database (Denmark)
Jacobsen, Jens Christian; Aalkjær, Christian; Nilsson, Holger
2007-01-01
waves sweeping through the cytoplasm when the SR is stimulated to release calcium. A rise in cyclic guanosine monophosphate (cGMP) leads to the experimentally observed transition from waves to whole-cell calcium oscillations. At the same time membrane potential starts to oscillate and the frequency...... approximately doubles. In this transition, the simulated results point to a key role for a recently discovered cGMP-sensitive calcium-dependent chloride channel. This channel depolarizes the membrane in response to calcium released from the SR. In turn, depolarization causes uniform opening of L-type calcium...... onset of oscillations in membrane potential within the individual cell may underlie sudden intercellular synchronization and the appearance of vasomotion. Key words: Vasomotion, Chloride channel, cGMP, Mathematical model, Calcium waves....
Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide
International Nuclear Information System (INIS)
Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf
2007-01-01
The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel
Directory of Open Access Journals (Sweden)
Lei Zhu
Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.
Expression of voltage-activated calcium channels in the early zebrafish embryo.
Sanhueza, Dayán; Montoya, Andro; Sierralta, Jimena; Kukuljan, Manuel
2009-05-01
Increases in cytosolic calcium concentrations regulate many cellular processes, including aspects of early development. Calcium release from intracellular stores and calcium entry through non-voltage-gated channels account for signalling in non-excitable cells, whereas voltage-gated calcium channels (CaV) are important in excitable cells. We report the expression of multiple transcripts of CaV, identified by its homology to other species, in the early embryo of the zebrafish, Danio rerio, at stages prior to the differentiation of excitable cells. CaV mRNAs and proteins were detected as early as the 2-cell stages, which indicate that they arise from both maternal and zygotic transcription. Exposure of embryos to pharmacological blockers of CaV does not perturb early development significantly, although late effects are appreciable. These results suggest that CaV may have a role in calcium homeostasis and control of cellular process during early embryonic development.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D
2017-05-01
Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Conotoxins as Tools to Understand the Physiological Function of Voltage-Gated Calcium (CaV Channels
Directory of Open Access Journals (Sweden)
David Ramírez
2017-10-01
Full Text Available Voltage-gated calcium (CaV channels are widely expressed and are essential for the completion of multiple physiological processes. Close regulation of their activity by specific inhibitors and agonists become fundamental to understand their role in cellular homeostasis as well as in human tissues and organs. CaV channels are divided into two groups depending on the membrane potential required to activate them: High-voltage activated (HVA, CaV1.1–1.4; CaV2.1–2.3 and Low-voltage activated (LVA, CaV3.1–3.3. HVA channels are highly expressed in brain (neurons, heart, and adrenal medulla (chromaffin cells, among others, and are also classified into subtypes which can be distinguished using pharmacological approaches. Cone snails are marine gastropods that capture their prey by injecting venom, “conopeptides”, which cause paralysis in a few seconds. A subset of conopeptides called conotoxins are relatively small polypeptides, rich in disulfide bonds, that target ion channels, transporters and receptors localized at the neuromuscular system of the animal target. In this review, we describe the structure and properties of conotoxins that selectively block HVA calcium channels. We compare their potency on several HVA channel subtypes, emphasizing neuronal calcium channels. Lastly, we analyze recent advances in the therapeutic use of conotoxins for medical treatments.
Glycosylation of voltage-gated calcium channels in health and disease
Czech Academy of Sciences Publication Activity Database
Lazniewska, Joanna; Weiss, Norbert
2017-01-01
Roč. 1859, č. 5 (2017), s. 662-668 ISSN 0005-2736 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channels * voltage-gated calcium channels * N-glycosylation * ancillary subunit * trafficking * stability Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.498, year: 2016
Functional Importance of L- and P/Q-Type Voltage-Gated Calcium Channels in Human Renal Vasculature
DEFF Research Database (Denmark)
Hansen, Pernille B; Poulsen, Christian B; Walter, Steen
2011-01-01
Calcium channel blockers are widely used for treatment of hypertension, because they decrease peripheral vascular resistance through inhibition of voltage-gated calcium channels. Animal studies of renal vasculature have shown expression of several types of calcium channels that are involved......-type subtype (Ca(v) 3.1 and Ca(v) 3.2) voltage-gated calcium channels (Ca(v)s), and quantitative PCR showed highest expression of L-type channels in renal arteries and variable expression between patients of subtypes of calcium channels in intrarenal vessels. Immunohistochemical labeling of kidney sections...
Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L
1993-03-01
The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.
Lin, Eric; Craig, Calvin; Lamothe, Marcel; Sarunic, Marinko V.; Beg, Mirza Faisal
2015-01-01
Zebrafish are increasingly being used as a model of vertebrate cardiology due to mammalian-like cardiac properties in many respects. The size and fecundity of zebrafish make them suitable for large-scale genetic and pharmacological screening. In larger mammalian hearts, optical mapping is often used to investigate the interplay between voltage and calcium dynamics and to investigate their respective roles in arrhythmogenesis. This report outlines the construction of an optical mapping system for use with zebrafish hearts, using the voltage-sensitive dye RH 237 and the calcium indicator dye Rhod-2 using two industrial-level CCD cameras. With the use of economical cameras and a common 532-nm diode laser for excitation, the rate dependence of voltage and calcium dynamics within the atrial and ventricular compartments can be simultaneously determined. At 140 beats/min, the atrial action potential duration was 36 ms and the transient duration was 53 ms. With the use of a programmable electrical stimulator, a shallow rate dependence of 3 and 4 ms per 100 beats/min was observed, respectively. In the ventricle the action potential duration was 109 ms and the transient duration was 124 ms, with a steeper rate dependence of 12 and 16 ms per 100 beats/min. Synchronous electrocardiograms and optical mapping recordings were recorded, in which the P-wave aligns with the atrial voltage peak and R-wave aligns with the ventricular peak. A simple optical pathway and imaging chamber are detailed along with schematics for the in-house construction of the electrocardiogram amplifier and electrical stimulator. Laboratory procedures necessary for zebrafish heart isolation, cannulation, and loading are also presented. PMID:25740339
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Directory of Open Access Journals (Sweden)
José Joaquín Merino
Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Directory of Open Access Journals (Sweden)
Adela Banciu
2018-05-01
Full Text Available Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1, estrogen receptors (ESR1, ESR2, GPR30, and nuclear receptor coactivator 3 (NCOA3. Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM antagonized the effect of BAY K8644 (2.5 or 5 µM in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant
Banciu, Adela; Banciu, Daniel Dumitru; Mustaciosu, Cosmin Catalin; Radu, Mihai; Cretoiu, Dragos; Xiao, Junjie; Cretoiu, Sanda Maria; Suciu, Nicolae; Radu, Beatrice Mihaela
2018-05-09
Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs) contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1), estrogen receptors (ESR1, ESR2, GPR30), and nuclear receptor coactivator 3 (NCOA3). Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM) downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM) antagonized the effect of BAY K8644 (2.5 or 5 µM) in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant human uterine
T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles
DEFF Research Database (Denmark)
Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L
2011-01-01
Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
Intracellular calcium modulation of voltage-gated sodium channels in ventricular myocytes
Casini, Simona; Verkerk, Arie O.; van Borren, Marcel M. G. J.; van Ginneken, Antoni C. G.; Veldkamp, Marieke W.; de Bakker, Jacques M. T.; Tan, Hanno L.
2009-01-01
AIMS: Cardiac voltage-gated sodium channels control action potential (AP) upstroke and cell excitability. Intracellular calcium (Ca(i)(2+)) regulates AP properties by modulating various ion channels. Whether Ca(i)(2+) modulates sodium channels in ventricular myocytes, is unresolved. We studied
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Thorpe, Andrew J; Offord, James
2010-07-01
Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.
Directory of Open Access Journals (Sweden)
Alan eNeely
2014-06-01
Full Text Available Openings of high-voltage-activated calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, high-voltage-activated calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1 associated with four additional polypeptide chains β, α2, δ and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of high-voltage-activated calcium channels.
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
International Nuclear Information System (INIS)
Grasso, P.; Reichert, L.E. Jr.
1989-01-01
We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-[3-thiotriphosphate]) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L
2013-09-09
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
DEFF Research Database (Denmark)
Rekling, J C; Feldman, J L
1997-01-01
Calcium-dependent plateau potentials in rostral ambiguus neurons in the newborn mouse brain stem in vitro. J. Neurophysiol. 78: 2483-2492, 1997. The nucleus ambiguus contains vagal and glossopharyngeal motoneurons and preganglionic neurons involved in respiration, swallowing, vocalization......-stimulus orthodromic activation, using an electrode placed in the dorsomedial slice near the nucleus tractus solitarius, evoked single excitatory postsynaptic potentials (EPSPs) or short trains of EPSPs (500 ms to 1 s). However, tetanic stimulation (5 pulses, 10 Hz) induced voltage-dependent afterdepolarizations...
Calcium-dependent but calmodulin-independent protein kinase from soybean
International Nuclear Information System (INIS)
Harmon, A.C.; Putnam-Evans, C.; Cormier, M.J.
1987-01-01
A calcium-dependent protein kinase activity from suspension-cultured soybean cells (Glycine max L. Wayne) was shown to be dependent on calcium but not calmodulin. The concentrations of free calcium required for half-maximal histone H1 phosphorylation and autophosphorylation were similar (≥ 2 micromolar). The protein kinase activity was stimulated 100-fold by ≥ 10 micromolar-free calcium. When exogenous soybean or bovine brain calmodulin was added in high concentration (1 micromolar) to the purified kinase, calcium-dependent and -independent activities were weakly stimulated (≤ 2-fold). Bovine serum albumin had a similar effect on both activities. The kinase was separated from a small amount of contaminating calmodulin by sodium dodecyl sulfate polyacrylamide gel electrophoresis. After renaturation the protein kinase autophosphorylated and phosphorylated histone H1 in a calcium-dependent manner. Following electroblotting onto nitrocellulose, the kinase bound 45 Ca 2+ in the presence of KCl and MgCl 2 , which indicated that the kinase itself is a high-affinity calcium-binding protein. Also, the mobility of one of two kinase bands in SDS gels was dependent on the presence of calcium. Autophosphorylation of the calmodulin-free kinase was inhibited by the calmodulin-binding compound N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide (W-7), showing that the inhibition of activity by W-7 is independent of calmodulin. These results show that soybean calcium-dependent protein kinase represents a new class of protein kinase which requires calcium but not calmodulin for activity
Benhassine, Narimane; Berger, Thomas
2005-02-01
Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.
Voltage-Gated Calcium Channel Antagonists and Traumatic Brain Injury
Directory of Open Access Journals (Sweden)
Bruce Lyeth
2013-06-01
Full Text Available Traumatic brain injury (TBI is a leading cause of death and disability in the United States. Despite more than 30 years of research, no pharmacological agents have been identified that improve neurological function following TBI. However, several lines of research described in this review provide support for further development of voltage gated calcium channel (VGCC antagonists as potential therapeutic agents. Following TBI, neurons and astrocytes experience a rapid and sometimes enduring increase in intracellular calcium ([Ca2+]i. These fluxes in [Ca2+]i drive not only apoptotic and necrotic cell death, but also can lead to long-term cell dysfunction in surviving cells. In a limited number of in vitro experiments, both L-type and N-type VGCC antagonists successfully reduced calcium loads as well as neuronal and astrocytic cell death following mechanical injury. In rodent models of TBI, administration of VGCC antagonists reduced cell death and improved cognitive function. It is clear that there is a critical need to find effective therapeutics and rational drug delivery strategies for the management and treatment of TBI, and we believe that further investigation of VGCC antagonists should be pursued before ruling out the possibility of successful translation to the clinic.
Wang, Meng; Jiang, Chunlei; Zhang, Songquan; Song, Xiaohe; Tang, Yongbing; Cheng, Hui-Ming
2018-06-01
Calcium-ion batteries (CIBs) are attractive candidates for energy storage because Ca2+ has low polarization and a reduction potential (-2.87 V versus standard hydrogen electrode, SHE) close to that of Li+ (-3.04 V versus SHE), promising a wide voltage window for a full battery. However, their development is limited by difficulties such as the lack of proper cathode/anode materials for reversible Ca2+ intercalation/de-intercalation, low working voltages (performance. Here, we report a CIB that can work stably at room temperature in a new cell configuration using graphite as the cathode and tin foils as the anode as well as the current collector. This CIB operates on a highly reversible electrochemical reaction that combines hexafluorophosphate intercalation/de-intercalation at the cathode and a Ca-involved alloying/de-alloying reaction at the anode. An optimized CIB exhibits a working voltage of up to 4.45 V with capacity retention of 95% after 350 cycles.
Electrical stimulation induces calcium-dependent release of NGF from cultured Schwann cells.
Huang, Jinghui; Ye, Zhengxu; Hu, Xueyu; Lu, Lei; Luo, Zhuojing
2010-04-01
Production of nerve growth factor (NGF) from Schwann cells (SCs) progressively declines in the distal stump, if axonal regeneration is staggered across the suture site after peripheral nerve injuries. This may be an important factor limiting the outcome of nerve injury repair. Thus far, extensive efforts are devoted to modulating NGF production in cultured SCs, but little has been achieved. In the present in vitro study, electrical stimulation (ES) was attempted to stimulate cultured SCs to release NGF. Our data showed that ES was capable of enhancing NGF release from cultured SCs. An electrical field (1 Hz, 5 V/cm) caused a 4.1-fold increase in NGF release from cultured SCs. The ES-induced NGF release is calcium dependent. Depletion of extracellular or/and intracellular calcium partially/ completely abolished the ES-induced NGF release. Further pharmacological interventions showed that ES induces calcium influx through T-type voltage-gated calcium channels and mobilizes calcium from 1, 4, 5-trisphosphate-sensitive stores and caffeine/ryanodine-sensitive stores, both of which contributed to the enhanced NGF release induced by ES. In addition, a calcium-triggered exocytosis mechanism was involved in the ES-induced NGF release from cultured SCs. These findings show the feasibility of using ES in stimulating SCs to release NGF, which holds great potential in promoting nerve regeneration by enhancing survival and outgrowth of damaged nerves, and is of great significance in nerve injury repair and neuronal tissue engineering.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
Directory of Open Access Journals (Sweden)
Andreas Totzeck
2016-09-01
Full Text Available Neuromuscular junction disorders affect the pre- or postsynaptic nerve to muscle transmission due to autoimmune antibodies. Members of the group like myasthenia gravis and Lambert-Eaton syndrome have pathophysiologically distinct characteristics. However, in practice, distinction may be difficult. We present a series of three patients with a myasthenic syndrome, dropped-head syndrome, bulbar and respiratory muscle weakness and positive testing for anti-N-type voltage-gated calcium channel antibodies. In two cases anti-acetylcholin receptor antibodies were elevated, anti-P/Q-type voltage-gated calcium channel antibodies were negative. All patients initially responded to pyridostigmine with a non-response in the course of the disease. While one patient recovered well after treatment with intravenous immunoglobulins, 3,4-diaminopyridine, steroids and later on immunosuppression with mycophenolate mofetil, a second died after restriction of treatment due to unfavorable cancer diagnosis, the third patient declined treatment. Although new antibodies causing neuromuscular disorders were discovered, clinical distinction has not yet been made. Our patients showed features of pre- and postsynaptic myasthenic syndrome as well as severe dropped-head syndrome and bulbar and axial muscle weakness, but only anti-N-type voltage-gated calcium channel antibodies were positive. When administered, one patient benefited from 3,4-diaminopyridine. We suggest that this overlap-syndrome should be considered especially in patients with assumed seronegative myasthenia gravis and lack of improvement under standard therapy.
Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.
Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L
2017-08-01
POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
DEFF Research Database (Denmark)
Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V
2010-01-01
In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...
Directory of Open Access Journals (Sweden)
Jennifer H Hou
2014-09-01
Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.
Cardiac voltage gated calcium channels and their regulation by β-adrenergic signaling.
Kumari, Neema; Gaur, Himanshu; Bhargava, Anamika
2018-02-01
Voltage-gated calcium channels (VGCCs) are the predominant source of calcium influx in the heart leading to calcium-induced calcium release and ultimately excitation-contraction coupling. In the heart, VGCCs are modulated by the β-adrenergic signaling. Signaling through β-adrenergic receptors (βARs) and modulation of VGCCs by β-adrenergic signaling in the heart are critical signaling and changes to these have been significantly implicated in heart failure. However, data related to calcium channel dysfunction in heart failure is divergent and contradictory ranging from reduced function to no change in the calcium current. Many recent studies have highlighted the importance of functional and spatial microdomains in the heart and that may be the key to answer several puzzling questions. In this review, we have briefly discussed the types of VGCCs found in heart tissues, their structure, and significance in the normal and pathological condition of the heart. More importantly, we have reviewed the modulation of VGCCs by βARs in normal and pathological conditions incorporating functional and structural aspects. There are different types of βARs, each having their own significance in the functioning of the heart. Finally, we emphasize the importance of location of proteins as it relates to their function and modulation by co-signaling molecules. Its implication on the studies of heart failure is speculated. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)
2010-09-21
Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.
Rozanski, Gabriela M; Nath, Arup R; Adams, Michael E; Stanley, Elise F
2013-11-15
A subpopulation of dorsal root ganglion (DRG) neurons are intimately attached in pairs and separated solely by thin satellite glial cell membrane septa. Stimulation of one neuron leads to transglial activation of its pair by a bi-, purinergic/glutamatergic synaptic pathway, a transmission mechanism that we term sandwich synapse (SS) transmission. Release of ATP from the stimulated neuron can be attributed to a classical mechanism involving Ca(2+) entry via voltage-gated calcium channels (CaV) but via an unknown channel type. Specific blockers and toxins ruled out CaV1, 2.1 and 2.2. Transmission was, however, blocked by a moderate depolarization (-50 mV) or low-concentration Ni(2+) (0.1 mM). Transmission persisted using a voltage pulse to -40 mV from a holding potential of -80 mV, confirming the involvement of a low voltage-activated channel type and limiting the candidate channel type to either CaV3.2 or a subpopulation of inactivation- and Ni(2+)-sensitive CaV2.3 channels. Resistance of the neuron calcium current and SS transmission to SNX482 argue against the latter. Hence, we conclude that inter-somatic transmission at the DRG SS is gated by CaV3.2 type calcium channels. The use of CaV3 family channels to gate transmission has important implications for the biological function of the DRG SS as information transfer would be predicted to occur not only in response to action potentials but also to sub-threshold membrane voltage oscillations. Thus, the SS synapse may serve as a homeostatic signalling mechanism between select neurons in the DRG and could play a role in abnormal sensation such as neuropathic pain.
Calcium Signaling in Taste Cells
Medler, Kathryn F.
2014-01-01
The sense of taste is a common ability shared by all organisms and is used to detect nutrients as well as potentially harmful compounds. Thus taste is critical to survival. Despite its importance, surprisingly little is known about the mechanisms generating and regulating responses to taste stimuli. All taste responses depend on calcium signals to generate appropriate responses which are relayed to the brain. Some taste cells have conventional synapses and rely on calcium influx through voltage-gated calcium channels. Other taste cells lack these synapses and depend on calcium release to formulate an output signal through a hemichannel. Beyond establishing these characteristics, few studies have focused on understanding how these calcium signals are formed. We identified multiple calcium clearance mechanisms that regulate calcium levels in taste cells as well as a calcium influx that contributes to maintaining appropriate calcium homeostasis in these cells. Multiple factors regulate the evoked taste signals with varying roles in different cell populations. Clearly, calcium signaling is a dynamic process in taste cells and is more complex than has previously been appreciated. PMID:25450977
DEFF Research Database (Denmark)
Coomber, S J; Bartels, E M; Elliott, G F
2011-01-01
contracts and breaks the microelectrode. Therefore the rigor state was studied. There is no reason to suppose a priori that a similar voltage switch does not occur during contraction, however. Calcium dependence is still apparent in muscles stretched beyond overlap (sarcomere length>3.8 μm) and is also seen...... in the gap filaments between the A- and I-band ends; further stretching abolishes the dependence. These experiments strongly suggest that calcium dependence is controlled initially by the titin component, and that this control is lost when titin filaments break. We suppose that that effect is mediated...
Protein kinase C interaction with calcium: a phospholipid-dependent process.
LENUS (Irish Health Repository)
Bazzi, M D
1990-08-21
The calcium-binding properties of calcium- and phospholipid-dependent protein kinase C (PKC) were investigated by equilibrium dialysis in the presence and the absence of phospholipids. Calcium binding to PKC displayed striking and unexpected behavior; the free proteins bound virtually no calcium at intracellular calcium concentrations and bound limited calcium (about 1 mol\\/mol of PKC) at 200 microM calcium. However, in the presence of membranes containing acidic phospholipids, PKC bound at least eight calcium ions per protein. The presence of 1 microM phorbol dibutyrate (PDBu) in the dialysis buffer had little effect on these calcium-binding properties. Analysis of PKC-calcium binding by gel filtration under equilibrium conditions gave similar results; only membrane-associated PKC bound significant amounts of calcium. Consequently, PKC is a member of what may be a large group of proteins that bind calcium in a phospholipid-dependent manner. The calcium concentrations needed to induce PKC-membrane binding were similar to those needed for calcium binding (about 40 microM calcium at the midpoint). However, the calcium concentration required for PKC-membrane binding was strongly influenced by the phosphatidylserine composition of the membranes. Membranes with higher percentages of phosphatidylserine required lower concentrations of calcium. These properties suggested that the calcium sites may be generated at the interface between PKC and the membrane. Calcium may function as a bridge between PKC and phospholipids. These studies also suggested that calcium-dependent PKC-membrane binding and PKC function could be regulated by a number of factors in addition to calcium levels and diacylglycerol content of the membrane.
Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.
2013-01-01
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Enhanced expression of a calcium-dependent protein kinase
Indian Academy of Sciences (India)
Among the downstream targets of calcium in plants, calcium-dependent protein kinases (CDPKs) form an interesting class of kinases which are activated by calcium binding. They have been implicated in a diverse array of responses to hormonal and environmental stimuli. In order to dissect the role of CDPKs in the moss ...
DEFF Research Database (Denmark)
Hansen, P B L
2013-01-01
Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L......-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular...... vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore...
Intracellular calcium levels can regulate Importin-dependent nuclear import
International Nuclear Information System (INIS)
Kaur, Gurpreet; Ly-Huynh, Jennifer D.; Jans, David A.
2014-01-01
Highlights: • High intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import. • The effect of Ca 2+ on nuclear import does not relate to changes in the nuclear pore. • High intracellular calcium can result in mislocalisation of Impβ1, Ran and RCC1. - Abstract: We previously showed that increased intracellular calcium can modulate Importin (Imp)β1-dependent nuclear import of SRY-related chromatin remodeling proteins. Here we extend this work to show for the first time that high intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import generally. The basis of this relates to the mislocalisation of the transport factors Impβ1 and Ran, which show significantly higher nuclear localization in contrast to various other factors, and RCC1, which shows altered subnuclear localisation. The results here establish for the first time that intracellular calcium modulates conventional nuclear import through direct effects on the nuclear transport machinery
Intracellular calcium levels can regulate Importin-dependent nuclear import
Energy Technology Data Exchange (ETDEWEB)
Kaur, Gurpreet; Ly-Huynh, Jennifer D.; Jans, David A., E-mail: David.Jans@monash.edu
2014-07-18
Highlights: • High intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import. • The effect of Ca{sup 2+} on nuclear import does not relate to changes in the nuclear pore. • High intracellular calcium can result in mislocalisation of Impβ1, Ran and RCC1. - Abstract: We previously showed that increased intracellular calcium can modulate Importin (Imp)β1-dependent nuclear import of SRY-related chromatin remodeling proteins. Here we extend this work to show for the first time that high intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import generally. The basis of this relates to the mislocalisation of the transport factors Impβ1 and Ran, which show significantly higher nuclear localization in contrast to various other factors, and RCC1, which shows altered subnuclear localisation. The results here establish for the first time that intracellular calcium modulates conventional nuclear import through direct effects on the nuclear transport machinery.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Kwon, Seok-Kyu; Sando, Richard; Lewis, Tommy L; Hirabayashi, Yusuke; Maximov, Anton; Polleux, Franck
2016-07-01
Individual synapses vary significantly in their neurotransmitter release properties, which underlie complex information processing in neural circuits. Presynaptic Ca2+ homeostasis plays a critical role in specifying neurotransmitter release properties, but the mechanisms regulating synapse-specific Ca2+ homeostasis in the mammalian brain are still poorly understood. Using electrophysiology and genetically encoded Ca2+ sensors targeted to the mitochondrial matrix or to presynaptic boutons of cortical pyramidal neurons, we demonstrate that the presence or absence of mitochondria at presynaptic boutons dictates neurotransmitter release properties through Mitochondrial Calcium Uniporter (MCU)-dependent Ca2+ clearance. We demonstrate that the serine/threonine kinase LKB1 regulates MCU expression, mitochondria-dependent Ca2+ clearance, and thereby, presynaptic release properties. Re-establishment of MCU-dependent mitochondrial Ca2+ uptake at glutamatergic synapses rescues the altered neurotransmitter release properties characterizing LKB1-null cortical axons. Our results provide novel insights into the cellular and molecular mechanisms whereby mitochondria control neurotransmitter release properties in a bouton-specific way through presynaptic Ca2+ clearance.
Neely, Alan; Hidalgo, Patricia
2014-01-01
Openings of high-voltage-activated (HVA) calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, HVA calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1) associated with four additional polypeptide chains β, α2, δ, and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of HVA calcium channels. PMID:24917826
Directory of Open Access Journals (Sweden)
János Brunner
2014-03-01
Full Text Available Backpropagating action potentials (bAPs and local calcium signals that they trigger are fundamental for dendritic functions. Here we addressed the question what extent the changes of local dendritic membrane properties can contribute to the shaping of the coupling between dendritic action potentials and the local calcium responses. Using a combination of in vitro electrophysiological and confocal imaging techniques we found that activation of dendritic GIRK channels via mGlu2 or GABAB receptors enhanced the bAP¬-triggered calcium signals in the dendrites of dentate gyrus granule cells (GCs. The enhancement of calcium signals was significant only in those dendritic regions, where these receptors are predominantly expressed. Similarly to GIRK channel activation, somatic hyperpolarization by DC current injection (from -64 mV to -77 mV, significantly increased bAP-associated calcium signals in the proximal dendrites. The hyperpolarization was associated with a decrease in the input resistance due to the rectification of the membrane potential of GCs. The effect of hyperpolarization on the calcium signals was maintained when T-type calcium currents were blocked but it decreased when GIRK channels were inhibited. Simultaneous dual somato-dendritic recordings from GCs showed that somatic hyperpolarization accelerated the repolarization phase of dendritic bAP in the proximal region whereas the rising phase and peak amplitude was not affected. We hypothesize that the larger driving force for calcium ions during the faster repolarization can contribute to the increasing in calcium signals. Employment of previously recorded dendritic bAP waveforms from hyperpolarized membrane potential as voltage command evoked larger calcium currents in nucleated patches compared to bAP waveform from the same recording at depolarized membrane potential. Furthermore, addition of native, high-voltage activated, inactivating potassium conductance by somatic dynamic clamp
DEFF Research Database (Denmark)
Kurtz, A; Skott, O; Chegini, S
1990-01-01
in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...
DEFF Research Database (Denmark)
Jørgensen, Niklas Rye; Teilmann, Stefan Cuoni; Henriksen, Zanne
2003-01-01
The propagation of mechanically induced intercellular calcium waves (ICW) among osteoblastic cells occurs both by activation of P2Y (purinergic) receptors by extracellular nucleotides, resulting in "fast" ICW, and by gap junctional communication in cells that express connexin43 (Cx43), resulting...... in "slow" ICW. Human osteoblastic cells transmit intercellular calcium signals by both of these mechanisms. In the current studies we have examined the mechanism of slow gap junction-dependent ICW in osteoblastic cells. In ROS rat osteoblastic cells, gap junction-dependent ICW were inhibited by removal...... of extracellular calcium, plasma membrane depolarization by high extracellular potassium, and the L-type voltage-operated calcium channel inhibitor, nifedipine. In contrast, all these treatments enhanced the spread of P2 receptor-mediated ICW in UMR rat osteoblastic cells. Using UMR cells transfected to express Cx...
ATP-dependent calcium transport across basal plasma membranes of human placental trophoblast
International Nuclear Information System (INIS)
Fisher, G.J.; Kelley, L.K.; Smith, C.H.
1987-01-01
As a first step in understanding the cellular basis of maternal-fetal calcium transfer, the authors examined the characteristics of calcium uptake by a highly purified preparation of the syncytiotrophoblast basal (fetal facing) plasma membrane. In the presence of nanomolar concentrations of free calcium, basal membranes demonstrated substantial ATP-dependent calcium uptake. This uptake required magnesium, was not significantly affected by Na + or K + (50 mM), or sodium azide (10 mM). Intravesicular calcium was rapidly and completely released by the calcium ionophore rapidly and completely released by the calcium ionophore A23187. Calcium transport was significantly stimulated by the calcium-dependent regulatory protein calmodulin. Placental membrane fractions enriched in endoplasmic reticulum (ER) and mitochondria also demonstrated ATP-dependent calcium uptake. In contrast to basal membrane, mitochondrial calcium uptake was completely inhibited by azide. The rate of calcium uptake was completely inhibited by azide. The rate of calcium uptake by the ER was only 20% of that of basal membranes. They conclude that the placental basal plasma membrane possesses a high-affinity calcium transport system similar to that found in plasma membranes of a variety of cell types. This transporter is situated to permit it to function in vivo in maternal-fetal calcium transfer
Calcium ion binding properties of Medicago truncatula calcium/calmodulin-dependent protein kinase.
Swainsbury, David J K; Zhou, Liang; Oldroyd, Giles E D; Bornemann, Stephen
2012-09-04
A calcium/calmodulin-dependent protein kinase (CCaMK) is essential in the interpretation of calcium oscillations in plant root cells for the establishment of symbiotic relationships with rhizobia and mycorrhizal fungi. Some of its properties have been studied in detail, but its calcium ion binding properties and subsequent conformational change have not. A biophysical approach was taken with constructs comprising either the visinin-like domain of Medicago truncatula CCaMK, which contains EF-hand motifs, or this domain together with the autoinhibitory domain. The visinin-like domain binds three calcium ions, leading to a conformational change involving the exposure of hydrophobic surfaces and a change in tertiary but not net secondary or quaternary structure. The affinity for calcium ions of visinin-like domain EF-hands 1 and 2 (K(d) = 200 ± 50 nM) was appropriate for the interpretation of calcium oscillations (~125-850 nM), while that of EF-hand 3 (K(d) ≤ 20 nM) implied occupancy at basal calcium ion levels. Calcium dissociation rate constants were determined for the visinin-like domain of CCaMK, M. truncatula calmodulin 1, and the complex between these two proteins (the slowest of which was 0.123 ± 0.002 s(-1)), suggesting the corresponding calcium association rate constants were at or near the diffusion-limited rate. In addition, the dissociation of calmodulin from the protein complex was shown to be on the same time scale as the dissociation of calcium ions. These observations suggest that the formation and dissociation of the complex between calmodulin and CCaMK would substantially mirror calcium oscillations, which typically have a 90 s periodicity.
Directory of Open Access Journals (Sweden)
Zhi-Yong Li
2013-01-01
Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Findeisen, Felix; Minor, Daniel L.
2010-01-01
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (CaVs) with unusual properties. CaBP1 inhibits CaV1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit CaV1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF-hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the CaV1.2 IQ domain at a site that overlaps with the Ca2+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates CaVs. PMID:21134641
Findeisen, Felix; Minor, Daniel L
2010-12-08
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (Ca(V)s) with unusual properties. CaBP1 inhibits Ca(V)1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit Ca(V)1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the Ca(V)1.2 IQ domain at a site that overlaps with the Ca²+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates Ca(V)s. Copyright © 2010 Elsevier Ltd. All rights reserved.
Impaired control of L-type voltage-dependent calcium channels in experimental hypertension
Czech Academy of Sciences Publication Activity Database
Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef
2009-01-01
Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009
Vector spin modeling for magnetic tunnel junctions with voltage dependent effects
International Nuclear Information System (INIS)
Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.
2014-01-01
Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
DEFF Research Database (Denmark)
Hansen, Gert Helge; Belhage, B; Schousboe, A
1992-01-01
Using cerebellar granule neurons in culture it was demonstrated that exposure of the cells to the GABAA receptor agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) leads to an increase in the number of voltage-gated calcium channels as revealed by quantitative preembedding indirect imm...
A kinetic model of dopamine- and calcium-dependent striatal synaptic plasticity.
Directory of Open Access Journals (Sweden)
Takashi Nakano
2010-02-01
Full Text Available Corticostriatal synapse plasticity of medium spiny neurons is regulated by glutamate input from the cortex and dopamine input from the substantia nigra. While cortical stimulation alone results in long-term depression (LTD, the combination with dopamine switches LTD to long-term potentiation (LTP, which is known as dopamine-dependent plasticity. LTP is also induced by cortical stimulation in magnesium-free solution, which leads to massive calcium influx through NMDA-type receptors and is regarded as calcium-dependent plasticity. Signaling cascades in the corticostriatal spines are currently under investigation. However, because of the existence of multiple excitatory and inhibitory pathways with loops, the mechanisms regulating the two types of plasticity remain poorly understood. A signaling pathway model of spines that express D1-type dopamine receptors was constructed to analyze the dynamic mechanisms of dopamine- and calcium-dependent plasticity. The model incorporated all major signaling molecules, including dopamine- and cyclic AMP-regulated phosphoprotein with a molecular weight of 32 kDa (DARPP32, as well as AMPA receptor trafficking in the post-synaptic membrane. Simulations with dopamine and calcium inputs reproduced dopamine- and calcium-dependent plasticity. Further in silico experiments revealed that the positive feedback loop consisted of protein kinase A (PKA, protein phosphatase 2A (PP2A, and the phosphorylation site at threonine 75 of DARPP-32 (Thr75 served as the major switch for inducing LTD and LTP. Calcium input modulated this loop through the PP2B (phosphatase 2B-CK1 (casein kinase 1-Cdk5 (cyclin-dependent kinase 5-Thr75 pathway and PP2A, whereas calcium and dopamine input activated the loop via PKA activation by cyclic AMP (cAMP. The positive feedback loop displayed robust bi-stable responses following changes in the reaction parameters. Increased basal dopamine levels disrupted this dopamine-dependent plasticity. The
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Modulation of voltage-gated channel currents by harmaline and harmane.
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2005-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Sun, Jianli; Moenter, Suzanne M
2010-11-01
GnRH neurons are central regulators of fertility, and their activity is modulated by steroid feedback. In normal females, GnRH secretion is regulated by estradiol and progesterone (P). Excess androgens present in hyperandrogenemic fertility disorders may disrupt communication of negative feedback signals from P and/or independently stimulate GnRH release. Voltage-gated calcium channels (VGCCs) are important in regulating excitability and hormone release. Estradiol alters VGCCs in a time-of-day-dependent manner. To further elucidate ovarian steroid modulation of GnRH neuron VGCCs, we studied the effects of dihydrotestosterone (DHT) and P. Adult mice were ovariectomized (OVX) or OVX and treated with implants containing DHT (OVXD), estradiol (OVXE), estradiol and DHT (OVXED), estradiol and P (OVXEP), or estradiol, DHT, and P (OVXEDP). Macroscopic calcium current (I(Ca)) was recorded in the morning or afternoon 8-12 d after surgery using whole-cell voltage-clamp. I(Ca) was increased in afternoon vs. morning in GnRH neurons from OVXE mice but this increase was abolished in cells from OVXEP mice. I(Ca) in cells from OVXD mice was increased regardless of time of day; there was no additional effect in OVXED mice. P reduced N-type and DHT potentiated N- and R-type VGCCs; P blocked the DHT potentiation of N-type-mediated current. These data suggest P and DHT have opposing actions on VGCCs in GnRH neurons, but in the presence of both steroids, P dominates. VGCCs are targets of ovarian steroid feedback modulation of GnRH neuron activity and, more specifically, a potential mechanism whereby androgens could activate GnRH neuronal function.
Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava
2014-04-03
Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.
L-Type Calcium Channels Modulation by Estradiol.
Vega-Vela, Nelson E; Osorio, Daniel; Avila-Rodriguez, Marco; Gonzalez, Janneth; García-Segura, Luis Miguel; Echeverria, Valentina; Barreto, George E
2017-09-01
Voltage-gated calcium channels are key regulators of brain function, and their dysfunction has been associated with multiple conditions and neurodegenerative diseases because they couple membrane depolarization to the influx of calcium-and other processes such as gene expression-in excitable cells. L-type calcium channels, one of the three major classes and probably the best characterized of the voltage-gated calcium channels, act as an essential calcium binding proteins with a significant biological relevance. It is well known that estradiol can activate rapidly brain signaling pathways and modulatory/regulatory proteins through non-genomic (or non-transcriptional) mechanisms, which lead to an increase of intracellular calcium that activate multiple kinases and signaling cascades, in the same way as L-type calcium channels responses. In this context, estrogens-L-type calcium channels signaling raises intracellular calcium levels and activates the same signaling cascades in the brain probably through estrogen receptor-independent modulatory mechanisms. In this review, we discuss the available literature on this area, which seems to suggest that estradiol exerts dual effects/modulation on these channels in a concentration-dependent manner (as a potentiator of these channels in pM concentrations and as an inhibitor in nM concentrations). Indeed, estradiol may orchestrate multiple neurotrophic responses, which open a new avenue for the development of novel estrogen-based therapies to alleviate different neuropathologies. We also highlight that it is essential to determine through computational and/or experimental approaches the interaction between estradiol and L-type calcium channels to assist these developments, which is an interesting area of research that deserves a closer look in future biomedical research.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Directory of Open Access Journals (Sweden)
Rami Shinnawi
2015-10-01
Full Text Available The advent of the human-induced pluripotent stem cell (hiPSC technology has transformed biomedical research, providing new tools for human disease modeling, drug development, and regenerative medicine. To fulfill its unique potential in the cardiovascular field, efficient methods should be developed for high-resolution, large-scale, long-term, and serial functional cellular phenotyping of hiPSC-derived cardiomyocytes (hiPSC-CMs. To achieve this goal, we combined the hiPSC technology with genetically encoded voltage (ArcLight and calcium (GCaMP5G fluorescent indicators. Expression of ArcLight and GCaMP5G in hiPSC-CMs permitted to reliably follow changes in transmembrane potential and intracellular calcium levels, respectively. This allowed monitoring short- and long-term changes in action-potential and calcium-handling properties and the development of arrhythmias in response to several pharmaceutical agents and in hiPSC-CMs derived from patients with different inherited arrhythmogenic syndromes. Combining genetically encoded fluorescent reporters with hiPSC-CMs may bring a unique value to the study of inherited disorders, developmental biology, and drug development and testing.
Calcium-dependent binding of Escherichia coli alpha-hemolysin to erythrocytes
International Nuclear Information System (INIS)
Boehm, D.F.
1989-01-01
Alpha hemolysin (AH), a protein secreted by certain strains of Escherichia coli, causes lysis of erythrocytes (RBCs) and is cytotoxic for other cells. The primary structure of AH contains an eight amino acid sequence tandemly repeated 13 times near the C-terminus. These repeated sequences are essential for hemolytic activity. AH also requires an unknown modification by an accessory protein, Hly C, for hemolytic activity. The role of calcium in the interaction of Ah with RBCs was investigated using recombinant strains which produced active and inactive forms of the toxin. Hemolytic activity was calcium-dependent. Osmotic protection experiments and immunoblots of SDS-PAGE separated proteins from washed, toxin-treated RBCs showed that the binding of active AH to RBCs was calcium-dependent. Binding of active AH to RBCs increased the calcium permeability of RBC membranes and resulted in changes in membrane protein profiles. The changes in membrane proteins did not cause the lysis of the cells. These results were consistent with a mechanism of lysis involving the formation of cation-selective pores in the membranes of target cells. 45 Ca-autoradiography of the recombinant hemolysins separated by SDS-PAGE and transferred to nitrocellulose showed that active AH bound calcium. The domain involved in binding calcium was identified as the tandemly repeated sequences since a deletion hemolysin missing 11 of the 13 repeated sequences did not bind calcium. This deletion hemolysin was non-hemolytic and did not bind to RBC membranes. Hemolysin lacking the Hly C modification was also non-hemolytic and did not bind to RBC membranes. This unmodified AH contained the repeated sequences and bound calcium as efficiently as active AH
Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function
Nicholson, Graham M.; Lewis, Richard J.
2006-01-01
Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.
Hansen, P B L
2013-04-01
Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore, by different mechanisms, T-type channels may contribute to both constriction and dilation of the arterioles. Finally, P-/Q-type channels are involved in the regulation of human intrarenal arterial contractility. The calcium blockers used in the clinic affect not only L-type but also P-/Q- and T-type channels. Therefore, the distinct effect obtained by inhibiting a given subtype or set of channels under experimental settings should be considered when choosing a calcium blocker for treatment. T-type channels seem to be crucial for regulating the GFR and the filtration fraction. Use of blockers is expected to lead to preferential efferent vasodilation, reduction of glomerular pressure and proteinuria. Therefore, renovascular T-type channels might provide novel therapeutic targets, and may have superior renoprotective effects compared to conventional calcium blockers. Acta Physiologica © 2013 Scandinavian Physiological Society.
Qu, Liang; Wang, Yuan; Zhang, Hai-Tao; Li, Nan; Wang, Qiang; Yang, Qian; Gao, Guo-Dong; Wang, Xue-Lian
2014-07-11
Voltage gated calcium channels (VGCC) are sensitive to oxidative stress, and their activation or inactivation can impact cell death. Although these channels have been extensively studied in expression systems, their role in the brain, particularly in the substantia nigra pars compacta (SNc), remain controversial. In this study, we assessed 6-hydroxydopamine (6-OHDA) induced transformation of firing pattern and functional changes of calcium channels in SNc dopaminergic neurons. Application of 6-OHDA (0.5-2mM) evoked a dose-dependent, desensitizing inward current and intracellular free calcium concentration ([Ca(2+)]i) rise. In voltage clamp, ω-conotoxin-sensitive Ca(2+) current modulation mediated by 6-OHDA reflected an altered sensitivity. Furthermore, we found that 6-OHDA modulated Ca(2+) currents through PKA pathway. These results provided evidence for the potential role of VGCCs and PKA involved in oxidative stress in degeneration of SNc neurons in Parkinson's disease (PD). Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat
2016-02-01
In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Calcium binding properties of calcium dependent protein kinase 1 (CaCDPK1) from Cicer arietinum.
Dixit, Ajay Kumar; Jayabaskaran, Chelliah
2015-05-01
Calcium plays a crucial role as a secondary messenger in all aspects of plant growth, development and survival. Calcium dependent protein kinases (CDPKs) are the major calcium decoders, which couple the changes in calcium level to an appropriate physiological response. The mechanism by which calcium regulates CDPK protein is not well understood. In this study, we investigated the interactions of Ca(2+) ions with the CDPK1 isoform of Cicer arietinum (CaCDPK1) using a combination of biophysical tools. CaCDPK1 has four different EF hands as predicted by protein sequence analysis. The fluorescence emission spectrum of CaCDPK1 showed quenching with a 5 nm red shift upon addition of calcium, indicating conformational changes in the tertiary structure. The plot of changes in intensity against calcium concentrations showed a biphasic curve with binding constants of 1.29 μM and 120 μM indicating two kinds of binding sites. Isothermal calorimetric (ITC) titration with CaCl2 also showed a biphasic curve with two binding constants of 0.027 μM and 1.7 μM. Circular dichroism (CD) spectra showed two prominent peaks at 208 and 222 nm indicating that CaCDPK1 is a α-helical rich protein. Calcium binding further increased the α-helical content of CaCDPK1 from 75 to 81%. Addition of calcium to CaCDPK1 also increased fluorescence of 8-anilinonaphthalene-1-sulfonic acid (ANS) indicating exposure of hydrophobic surfaces. Thus, on the whole this study provides evidence for calcium induced conformational changes, exposure of hydrophobic surfaces and heterogeneity of EF hands in CaCDPK1. Copyright © 2015 Elsevier GmbH. All rights reserved.
DEFF Research Database (Denmark)
Hansen, Emilie Louise; Sozer, Esin Bengisu; Romeo, Stefania
2015-01-01
death and could be a novel cancer treatment. This study aims at understanding the relationship between applied electric field, calcium concentration, ATP depletion and efficacy. METHODS: In three human cell lines--H69 (small-cell lung cancer), SW780 (bladder cancer), and U937 (leukaemia), viability...... was observed with fluorescence confocal microscopy of quinacrine-labelled U937 cells. RESULTS: Both H69 and SW780 cells showed dose-dependent (calcium concentration and electric field) decrease in intracellular ATP (p...-dependently reduced cell survival and intracellular ATP. Increasing extracellular calcium allows the use of a lower electric field. GENERAL SIGNIFICANCE: This study supports the use of calcium electroporation for treatment of cancer and possibly lowering the applied electric field in future trials....
International Nuclear Information System (INIS)
Gibson, G.E.; Peterson, C.
1986-01-01
Acetylcholine synthesis declines with aging in both whole brain and in various brain regions. Since neither enzyme activities nor acetylcholine concentrations, accurately reflect the dynamics of the cholinergic system, in vivo acetylcholine formation was measured. Incorporation of U-C 14-glucose of 2 H 4 choline into whole brain acetylcholine decreases from 100% (3 months) in two strains of mice. The diminished synthesis is apparently not due to a lack of precursor availability because U- C 14-glucose and 2 H 4 choline entry into the brain is similar at all ages. It is shown that altered brain calcium homeostasis during aging may underlie the deficits in acetylcholine metabolism, as well as those in behavior. Diminished calcium uptake during aging parallels the decline in the calcium dependent release of acetylcholine
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
LRRK2 regulates voltage-gated calcium channel function.
Directory of Open Access Journals (Sweden)
Cade eBedford
2016-05-01
Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how
The effect of calcium on auxin depletion-induced tomato ...
African Journals Online (AJOL)
Indole-3-acetic acid (IAA) and calcium are the most important factors that instigate plant organ abscission. This study aimed to elucidate the mechanisms that underlie the effects of IAA and calcium on delayed abscission in tomato. The results showed a clear trend towards reduced abscission rates with increased ...
International Nuclear Information System (INIS)
Curtis, B.M.
1986-01-01
Treatment with digitonin solubilized the calcium antagonist receptor as a stable complex with [ 3 H]nitrendipine from rat brain membranes. The solubilized complex retains allosteric coupling to binding sites for diltiazem, verapamil, and inorganic calcium antagonist sites. The calcium antagonist receptor from cardiac sarcolemma and the transverse-tubule membrane of skeletal muscle is also efficiently solubilized with digitonin and the receptor in all three tissues is a large glycoprotein with a sedimentation coefficient of 20 S. The T-tubule calcium antagonist receptor complex was extensively purified by a combination of chromatography on WGA-Sepharose, ion exchange chromatography, and sedimentation on sucrose gradients to yield preparations estimated to be 41% homogeneous by specific activity and 63% homogeneous by SDS gel electrophoresis. Analysis of SDS gels detect three polypeptides termed α(Mr 135,000), β(Mr 50,000), and γ(Mr 32,000) as noncovalently associated subunits of the calcium antagonist receptor. The α and γ subunits are glycosylated polypeptides, and the molecular weight of the core polypeptides are 108,000 and 24,000 respectively. The calcium antagonist receptor was reconstituted into a phospholipid bilayer by adding CHAPS and exogeneous lipid to the purified receptor followed by rapid detergent removal. This procedure resulted in the incorporation of 45% of the calcium antagonist receptor into closed phospholipid vesicles. Data suggests that the α, β, and γ subunits of the T-tubule calcium antagonist receptor are sufficient to form a functional calcium channel
Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function
Directory of Open Access Journals (Sweden)
Richard J. Lewis
2006-04-01
Full Text Available Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission
Naranjo, David; Wen, Hua; Brehm, Paul
2015-01-01
The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925
Monitoring operating temperature and supply voltage in achieving high system dependability
Khan, M.A.; Kerkhoff, Hans G.
2013-01-01
System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability
Tuluc, Petronel; Flucher, Bernhard E
2011-12-01
Voltage-gated calcium channels are multi-subunit protein complexes that specifically allow calcium ions to enter the cell in response to membrane depolarization. But, for many years it seemed that the skeletal muscle calcium channel Ca(V)1.1 is the exception. The classical splice variant Ca(V)1.1a activates slowly, has a very small current amplitude and poor voltage sensitivity. In fact adult muscle fibers work perfectly well even in the absence of calcium influx. Recently a new splice variant of the skeletal muscle calcium channel Ca(V)1.1e has been characterized. The lack of the 19 amino acid exon 29 in this splice variant results in a rapidly activating calcium channel with high current amplitude and good voltage sensitivity. Ca(V)1.1e is the dominant channel in embryonic muscle, where the expression of this high calcium-conducting Ca(V)1.1 isoform readily explains developmental processes depending on L-type calcium currents. Moreover, the availability of these two structurally similar but functionally distinct channel variants facilitates the analysis of the molecular mechanisms underlying the unique current properties of the classical Ca(V)1.1a channel.
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas
2014-01-01
Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
Dual Regulation of Voltage-Sensitive Ion Channels by PIP2
Directory of Open Access Journals (Sweden)
Aldo A Rodríguez Menchaca
2012-09-01
Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.
DEFF Research Database (Denmark)
Kiehn, O.; Harris-Warrick, R. M.
1992-01-01
1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...
A recently published review (Soderlund et al., 2002, Toxicology 171, 3-59.) of the mechanisms of acute neurotoxicity of pyrethroid compounds postulated that voltage-sensitive calcium channels (VSCC) may be a target of some pyrethroid compounds and that effects on VSCC may contrib...
The distribution of free calcium ions in the cholesteatoma epithelium
DEFF Research Database (Denmark)
Svane-Knudsen, Viggo; Rasmussen, Gurli; Ottosen, Peter D
2005-01-01
The distribution of free calcium ions in normal skin and cholesteatoma epithelium was investigated using the oxalate precipitation method. In agreement with previous observations, we could demonstrate a calcium ion gradient in normal epidermis where the cells in stratum basale and spinosum reside...... appeared where oblong accumulations of free calcium ions were found basally in the stratum. These findings provide evidence that fluctuations in epidermal calcium in cholesteatoma epithelium may underlie the abnormal desquamation, may contribute to the formation of an abnormal permeability barrier and may...
Voltage-dependent amplification of synaptic inputs in respiratory motoneurones
Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A
2012-01-01
The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582
Antibodies to voltage-gated potassium and calcium channels in epilepsy.
Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela
2006-10-01
To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
International Nuclear Information System (INIS)
Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika
2006-01-01
An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)
Alcohol and the calcium-dependent potassium transport of human erythrocytes
International Nuclear Information System (INIS)
Harris, R.A.; Caldwell, K.K.
1985-01-01
In vitro exposure of human red blood cells to ethanol (100 and 400 mM) was found to increase the initial rate of calcium-dependent potassium efflux through the red cell membrane. This effect of ethanol was apparently not due to an elevation of the intracellular free calcium but rather to a direct action of the drug on the transport process as, (1) intracellular calcium concentrations were tightly buffered with EGTA, (2) ethanol did not alter the efflux of 45 Ca from the cells, and (3) dantrolene, which has been proposed to counteract the effect of ethanol on intracellular calcium levels in the erythrocyte, did not inhibit the stimulatory action of ethanol. The efflux of potassium from erythrocytes obtained from chronic alcoholics was not different from that of erythrocytes from non-alcoholic individuals. The relationship of these findings to neuronal potassium transport is discussed
Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R
2003-03-01
The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.
International Nuclear Information System (INIS)
Yamacli, Serhan; Avci, Mutlu
2009-01-01
In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.
Valentijn, K; Tranchand Bunel, D; Vaudry, H
1992-07-01
The rat thyrotropin-releasing hormone (TRH) precursor (prepro-TRH) contains five copies of the TRH progenitor sequence linked together by intervening sequences. Recently, we have shown that the connecting peptides prepro-TRH-(160-169) (Ps4) and prepro-TRH-(178-199) (Ps5) are released from rat hypothalamic neurones in response to elevated potassium concentrations, in a calcium-dependent manner. In the present study, the role of voltage-operated calcium channels in potassium-induced release of Ps4 and Ps5 was investigated, using a perifusion system for rat hypothalamic slices. The release of Ps4 and Ps5 stimulated by potassium (70 mM) was blocked by the inorganic ions Co2+ (2.6 mM) and Ni2+ (5 mM). In contrast, the stimulatory effect of KCl was insensitive to Cd2+ (100 microM). The dihydropyridine antagonist nifedipine (10 microM) had no effect on K(+)-evoked release of Ps4 and Ps5. Furthermore, the response to KCl was not affected by nifedipine (10 microM) in combination with diltiazem (1 microM), a benzothiazepine which increases the affinity of dihydropyridine antagonists for their receptor. The dihydropyridine agonist BAY K 8644, at concentrations as high as 1 mM, did not stimulate the basal secretion of Ps4 and Ps5. In addition, BAY K 8644 had no potentiating effect on K(+)-induced release of Ps4 and Ps5. The marine cone snail toxin omega-conotoxin, a blocker of both L- and N-type calcium channels had no effect on the release of Ps4 and Ps5 stimulated by potassium. Similarly, the omega-conopeptide SNX-111, a selective blocker of N-type calcium channels, did not inhibit the stimulatory effect of potassium. The release of Ps4 and Ps5 evoked by high K+ was insensitive to the non-selective calcium channel blocker verapamil (20 microM). Amiloride (1 microM), a putative blocker of T-type calcium channels, did not affect KCl-induced secretion of the two connecting peptides. Taken together, these results indicate that two connecting peptides derived from the pro-TRH, Ps
Directory of Open Access Journals (Sweden)
Sheyda R Frolova
Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.
New Conotoxin SO-3 Targeting N-type Voltage-Sensitive Calcium Channels
Directory of Open Access Journals (Sweden)
Lei Wen
2006-04-01
Full Text Available Selective blockers of the N-type voltage-sensitive calcium (CaV channels are useful in the management of severe chronic pain. Here, the structure and function characteristics of a novel N-type CaV channel blocker, SO-3, are reviewed. SO-3 is a 25-amino acid conopeptide originally derived from the venom of Conus striatus, and contains the same 4-loop, 6-cysteine framework (C-C-CC-C-C as O-superfamily conotoxins. The synthetic SO-3 has high analgesic activity similar to É-conotoxin MVIIA (MVIIA, a selective N-type CaV channel blocker approved in the USA and Europe for the alleviation of persistent pain states. In electrophysiological studies, SO-3 shows more selectivity towards the N-type CaV channels than MVIIA. The dissimilarity between SO-3 and MVIIA in the primary and tertiary structures is further discussed in an attempt to illustrate the difference in selectivity of SO-3 and MVIIA towards N-type CaV channels.
Caffeine-Induced Suppression of GABAergic Inhibition and Calcium-Independent Metaplasticity
Directory of Open Access Journals (Sweden)
Masako Isokawa
2016-01-01
Full Text Available GABAergic inhibition plays a critical role in the regulation of neuron excitability; thus, it is subject to modulations by many factors. Recent evidence suggests the elevation of intracellular calcium ([Ca2+]i and calcium-dependent signaling molecules underlie the modulations. Caffeine induces a release of calcium from intracellular stores. We tested whether caffeine modulated GABAergic transmission by increasing [Ca2+]i. A brief local puff-application of caffeine to hippocampal CA1 pyramidal cells transiently suppressed GABAergic inhibitory postsynaptic currents (IPSCs by 73.2 ± 6.98%. Time course of suppression and the subsequent recovery of IPSCs resembled DSI (depolarization-induced suppression of inhibition, mediated by endogenous cannabinoids that require a [Ca2+]i rise. However, unlike DSI, caffeine-induced suppression of IPSCs (CSI persisted in the absence of a [Ca2+]i rise. Intracellular applications of BAPTA and ryanodine (which blocks caffeine-induced calcium release from intracellular stores failed to prevent the generation of CSI. Surprisingly, ruthenium red, an inhibitor of multiple calcium permeable/release channels including those of stores, induced metaplasticity by amplifying the magnitude of CSI independently of calcium. This metaplasticity was accompanied with the generation of a large inward current. Although ionic basis of this inward current is undetermined, the present result demonstrates that caffeine has a robust Ca2+-independent inhibitory action on GABAergic inhibition and causes metaplasticity by opening plasma membrane channels.
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Calcium signaling properties of a thyrotroph cell line, mouse TαT1 cells.
Tomić, Melanija; Bargi-Souza, Paula; Leiva-Salcedo, Elias; Nunes, Maria Tereza; Stojilkovic, Stanko S
2015-12-01
TαT1 cells are mouse thyrotroph cell line frequently used for studies on thyroid-stimulating hormone beta subunit gene expression and other cellular functions. Here we have characterized calcium-signaling pathways in TαT1 cells, an issue not previously addressed in these cells and incompletely described in native thyrotrophs. TαT1 cells are excitable and fire action potentials spontaneously and in response to application of thyrotropin-releasing hormone (TRH), the native hypothalamic agonist for thyrotrophs. Spontaneous electrical activity is coupled to small amplitude fluctuations in intracellular calcium, whereas TRH stimulates both calcium mobilization from intracellular pools and calcium influx. Non-receptor-mediated depletion of intracellular pool also leads to a prominent facilitation of calcium influx. Both receptor and non-receptor stimulated calcium influx is substantially attenuated but not completely abolished by inhibition of voltage-gated calcium channels, suggesting that depletion of intracellular calcium pool in these cells provides a signal for both voltage-independent and -dependent calcium influx, the latter by facilitating the pacemaking activity. These cells also express purinergic P2Y1 receptors and their activation by extracellular ATP mimics TRH action on calcium mobilization and influx. The thyroid hormone triiodothyronine prolongs duration of TRH-induced calcium spikes during 30-min exposure. These data indicate that TαT1 cells are capable of responding to natively feed-forward TRH signaling and intrapituitary ATP signaling with acute calcium mobilization and sustained calcium influx. Amplification of TRH-induced calcium signaling by triiodothyronine further suggests the existence of a pathway for positive feedback effects of thyroid hormones probably in a non-genomic manner. Published by Elsevier Ltd.
PKA Controls Calcium Influx into Motor Neurons during a Rhythmic Behavior
Wang, Han; Sieburth, Derek
2013-01-01
Cyclic adenosine monophosphate (cAMP) has been implicated in the execution of diverse rhythmic behaviors, but how cAMP functions in neurons to generate behavioral outputs remains unclear. During the defecation motor program in C. elegans, a peptide released from the pacemaker (the intestine) rhythmically excites the GABAergic neurons that control enteric muscle contractions by activating a G protein-coupled receptor (GPCR) signaling pathway that is dependent on cAMP. Here, we show that the C. elegans PKA catalytic subunit, KIN-1, is the sole cAMP target in this pathway and that PKA is essential for enteric muscle contractions. Genetic analysis using cell-specific expression of dominant negative or constitutively active PKA transgenes reveals that knockdown of PKA activity in the GABAergic neurons blocks enteric muscle contractions, whereas constitutive PKA activation restores enteric muscle contractions to mutants defective in the peptidergic signaling pathway. Using real-time, in vivo calcium imaging, we find that PKA activity in the GABAergic neurons is essential for the generation of synaptic calcium transients that drive GABA release. In addition, constitutively active PKA increases the duration of calcium transients and causes ectopic calcium transients that can trigger out-of-phase enteric muscle contractions. Finally, we show that the voltage-gated calcium channels UNC-2 and EGL-19, but not CCA-1 function downstream of PKA to promote enteric muscle contractions and rhythmic calcium influx in the GABAergic neurons. Thus, our results suggest that PKA activates neurons during a rhythmic behavior by promoting presynaptic calcium influx through specific voltage-gated calcium channels. PMID:24086161
PKA controls calcium influx into motor neurons during a rhythmic behavior.
Directory of Open Access Journals (Sweden)
Han Wang
Full Text Available Cyclic adenosine monophosphate (cAMP has been implicated in the execution of diverse rhythmic behaviors, but how cAMP functions in neurons to generate behavioral outputs remains unclear. During the defecation motor program in C. elegans, a peptide released from the pacemaker (the intestine rhythmically excites the GABAergic neurons that control enteric muscle contractions by activating a G protein-coupled receptor (GPCR signaling pathway that is dependent on cAMP. Here, we show that the C. elegans PKA catalytic subunit, KIN-1, is the sole cAMP target in this pathway and that PKA is essential for enteric muscle contractions. Genetic analysis using cell-specific expression of dominant negative or constitutively active PKA transgenes reveals that knockdown of PKA activity in the GABAergic neurons blocks enteric muscle contractions, whereas constitutive PKA activation restores enteric muscle contractions to mutants defective in the peptidergic signaling pathway. Using real-time, in vivo calcium imaging, we find that PKA activity in the GABAergic neurons is essential for the generation of synaptic calcium transients that drive GABA release. In addition, constitutively active PKA increases the duration of calcium transients and causes ectopic calcium transients that can trigger out-of-phase enteric muscle contractions. Finally, we show that the voltage-gated calcium channels UNC-2 and EGL-19, but not CCA-1 function downstream of PKA to promote enteric muscle contractions and rhythmic calcium influx in the GABAergic neurons. Thus, our results suggest that PKA activates neurons during a rhythmic behavior by promoting presynaptic calcium influx through specific voltage-gated calcium channels.
Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel
International Nuclear Information System (INIS)
Barchi, R.L.; Tanaka, J.C.
1984-01-01
In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab
González, Alberto; Cabrera, M de Los Ángeles; Henríquez, M Josefa; Contreras, Rodrigo A; Morales, Bernardo; Moenne, Alejandra
2012-03-01
To analyze the copper-induced cross talk among calcium, nitric oxide (NO), and hydrogen peroxide (H(2)O(2)) and the calcium-dependent activation of gene expression, the marine alga Ulva compressa was treated with the inhibitors of calcium channels, ned-19, ryanodine, and xestospongin C, of chloroplasts and mitochondrial electron transport chains, 3-(3,4-dichlorophenyl)-1,1-dimethylurea and antimycin A, of pyruvate dehydrogenase, moniliformin, of calmodulins, N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide, and of calcium-dependent protein kinases, staurosporine, as well as with the scavengers of NO, 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, and of H(2)O(2), ascorbate, and exposed to a sublethal concentration of copper (10 μm) for 24 h. The level of NO increased at 2 and 12 h. The first peak was inhibited by ned-19 and 3-(2,3-dichlorophenyl)-1,1-dimethylurea and the second peak by ned-19 and antimycin A, indicating that NO synthesis is dependent on calcium release and occurs in organelles. The level of H(2)O(2) increased at 2, 3, and 12 h and was inhibited by ned-19, ryanodine, xestospongin C, and moniliformin, indicating that H(2)O(2) accumulation is dependent on calcium release and Krebs cycle activity. In addition, pyruvate dehydrogenase, 2-oxoxglutarate dehydrogenase, and isocitrate dehydrogenase activities of the Krebs cycle increased at 2, 3, 12, and/or 14 h, and these increases were inhibited in vitro by EGTA, a calcium chelating agent. Calcium release at 2, 3, and 12 h was inhibited by 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide and ascorbate, indicating activation by NO and H(2)O(2). In addition, the level of antioxidant protein gene transcripts decreased with N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide and staurosporine. Thus, there is a copper-induced cross talk among calcium, H(2)O(2), and NO and a calcium-dependent activation of gene expression involving calmodulins and calcium-dependent protein
A role for barley calcium-dependent protein kinase CPK2a in the response to drought
Directory of Open Access Journals (Sweden)
Agata Cieśla
2016-10-01
Full Text Available Increasing the drought tolerance of crops is one of the most challenging goals in plant breeding. To improve crop productivity during periods of water deficit, it is essential to understand the complex regulatory pathways that adapt plant metabolism to environmental conditions. Among various plant hormones and second messengers, calcium ions are known to be involved in drought stress perception and signaling. Plants have developed specific calcium-dependent protein kinases that convert calcium signals into phosphorylation events. In this study we attempted to elucidate the role of a calcium-dependent protein kinase in the drought stress response of barley (Hordeum vulgare L., one of the most economically important crops worldwide. The ongoing barley genome project has provided useful information about genes potentially involved in the drought stress response, but information on the role of calcium-dependent kinases is still limited. We found that the gene encoding the calcium-dependent protein kinase HvCPK2a was significantly upregulated in response to drought. To better understand the role of HvCPK2a in drought stress signaling, we generated transgenic Arabidopsis plants that overexpressed the corresponding coding sequence. Overexpressing lines displayed drought sensitivity, reduced nitrogen balance index, an increase in total chlorophyll content and decreased relative water content. In addition, in vitro kinase assay experiments combined with mass spectrometry allowed HvCPK2a autophosphorylation sites to be identified. Our results suggest that HvCPK2a is a dual-specificity calcium-dependent protein kinase that functions as a negative regulator of the drought stress response in barley.
Chronic alcohol feeding potentiates hormone-induced calcium signalling in hepatocytes.
Bartlett, Paula J; Antony, Anil Noronha; Agarwal, Amit; Hilly, Mauricette; Prince, Victoria L; Combettes, Laurent; Hoek, Jan B; Gaspers, Lawrence D
2017-05-15
Chronic alcohol consumption causes a spectrum of liver diseases, but the pathogenic mechanisms driving the onset and progression of disease are not clearly defined. We show that chronic alcohol feeding sensitizes rat hepatocytes to Ca 2+ -mobilizing hormones resulting in a leftward shift in the concentration-response relationship and the transition from oscillatory to more sustained and prolonged Ca 2+ increases. Our data demonstrate that alcohol-dependent adaptation in the Ca 2+ signalling pathway occurs at the level of hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) production and does not involve changes in the sensitivity of the IP 3 receptor or size of internal Ca 2+ stores. We suggest that prolonged and aberrant hormone-evoked Ca 2+ increases may stimulate the production of mitochondrial reactive oxygen species and contribute to alcohol-induced hepatocyte injury. ABSTRACT: 'Adaptive' responses of the liver to chronic alcohol consumption may underlie the development of cell and tissue injury. Alcohol administration can perturb multiple signalling pathways including phosphoinositide-dependent cytosolic calcium ([Ca 2+ ] i ) increases, which can adversely affect mitochondrial Ca 2+ levels, reactive oxygen species production and energy metabolism. Our data indicate that chronic alcohol feeding induces a leftward shift in the dose-response for Ca 2+ -mobilizing hormones resulting in more sustained and prolonged [Ca 2+ ] i increases in both cultured hepatocytes and hepatocytes within the intact perfused liver. Ca 2+ increases were initiated at lower hormone concentrations, and intercellular calcium wave propagation rates were faster in alcoholics compared to controls. Acute alcohol treatment (25 mm) completely inhibited hormone-induced calcium increases in control livers, but not after chronic alcohol-feeding, suggesting desensitization to the inhibitory actions of ethanol. Hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) accumulation and phospholipase C
Directory of Open Access Journals (Sweden)
Seong-Ho Ok
2013-01-01
Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
Murali, Swetha S; Napier, Ian A; Mohammadi, Sarasa A; Alewood, Paul F; Lewis, Richard J; Christie, MacDonald J
2015-03-01
Changes in ion channel function and expression are characteristic of neuropathic pain. Voltage-gated calcium channels (VGCCs) are integral for neurotransmission and membrane excitability, but relatively little is known about changes in their expression after nerve injury. In this study, we investigate whether peripheral nerve ligation is followed by changes in the density and proportion of high-voltage-activated (HVA) VGCC current subtypes in dorsal root ganglion (DRG) neurons, the contribution of presynaptic N-type calcium channels in evoked excitatory postsynaptic currents (EPSCs) recorded from dorsal horn neurons in the spinal cord, and the changes in expression of mRNA encoding VGCC subunits in DRG neurons. Using C57BL/6 mice [8- to 11-wk-old males (n = 91)] for partial sciatic nerve ligation or sham surgery, we performed whole cell patch-clamp recordings on isolated DRG neurons and dorsal horn neurons and measured the expression of all VGCC subunits with RT-PCR in DRG neurons. After nerve injury, the density of P/Q-type current was reduced overall in DRG neurons. There was an increase in the percentage of N-type and a decrease in that of P/Q-type current in medium- to large-diameter neurons. No changes were found in the contribution of presynaptic N-type calcium channels in evoked EPSCs recorded from dorsal horn neurons. The α2δ-1 subunit was upregulated by 1.7-fold and γ-3, γ-2, and β-4 subunits were all downregulated 1.7-fold in injured neurons compared with sham-operated neurons. This comprehensive characterization of HVA VGCC subtypes in mouse DRG neurons after nerve injury revealed changes in N- and P/Q-type current proportions only in medium- to large-diameter neurons. Copyright © 2015 the American Physiological Society.
Benhassine, Narimane; Berger, Thomas
2009-03-01
Large-conductance calcium-dependent potassium channels (BK channels) are homogeneously distributed along the somatodendritic axis of layer 5 pyramidal neurons of the rat somatosensory cortex. The relevance of this conductance for dendritic calcium electrogenesis was studied in acute brain slices using somatodendritic patch clamp recordings and calcium imaging. BK channel activation reduces the occurrence of dendritic calcium spikes. This is reflected in an increased critical frequency of somatic spikes necessary to activate the distal initiation zone. Whilst BK channels repolarise the somatic spike, they dampen it only in the distal dendrite. Their activation reduces dendritic calcium influx via glutamate receptors. Furthermore, they prevent dendritic calcium electrogenesis and subsequent somatic burst discharges. However, the time window for coincident somatic action potential and dendritic input to elicit dendritic calcium events is not influenced by BK channels. Thus, BK channel activation in layer 5 pyramidal neurons affects cellular excitability primarily by establishing a high threshold at the distal action potential initiation zone.
Voltage imaging to understand connections and functions of neuronal circuits
Antic, Srdjan D.; Empson, Ruth M.
2016-01-01
Understanding of the cellular mechanisms underlying brain functions such as cognition and emotions requires monitoring of membrane voltage at the cellular, circuit, and system levels. Seminal voltage-sensitive dye and calcium-sensitive dye imaging studies have demonstrated parallel detection of electrical activity across populations of interconnected neurons in a variety of preparations. A game-changing advance made in recent years has been the conceptualization and development of optogenetic tools, including genetically encoded indicators of voltage (GEVIs) or calcium (GECIs) and genetically encoded light-gated ion channels (actuators, e.g., channelrhodopsin2). Compared with low-molecular-weight calcium and voltage indicators (dyes), the optogenetic imaging approaches are 1) cell type specific, 2) less invasive, 3) able to relate activity and anatomy, and 4) facilitate long-term recordings of individual cells' activities over weeks, thereby allowing direct monitoring of the emergence of learned behaviors and underlying circuit mechanisms. We highlight the potential of novel approaches based on GEVIs and compare those to calcium imaging approaches. We also discuss how novel approaches based on GEVIs (and GECIs) coupled with genetically encoded actuators will promote progress in our knowledge of brain circuits and systems. PMID:27075539
Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.
2002-01-01
Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes
High Dose Oral Calcium Treatment in Patients with Vitamin D-dependent Rickets Type II
Directory of Open Access Journals (Sweden)
R Vakili
2017-02-01
Full Text Available BACKGROUND AND OBJECTIVE: Vitamin D-dependent rickets type II (VDDR2 is a rare genetic disorder caused by mutations in vitamin D receptor (VDR and leads to resistance to biological effects of calcitriol. Based on the type of mutation, this disease is resistant to calcitriol even at high doses of calcitriol and successful treatment of these patients requires hypocalcemic modification through administration of high doses of calcium and bypassing the intestinal defect in VDR signaling. In addition to the need for frequent hospitalization and high costs, intravenous administration of calcium is associated with complications and problems such as arrhythmia and sepsis, venous catheter infection and hypercalciuria. This study aims to report the positive treatment effects of high doses of oral calcium in 4 patients with vitamin D-dependent rickets type II. CASE REPORT: In this study, 4 patients with vitamin D-dependent rickets type II, diagnosed based on clinical and biochemical symptoms of rickets with alopecia, underwent therapy using high doses of oral calcium (300 mg/kg/day in pediatric endocrinology and metabolism center of Imam Reza hospital. After a short period, increased growth rate in height, strength and elasticity of muscles was observed in addition to biochemical improvements without serious side effects and even one patient started walking independently within the first week of therapy for the first time. Patients were regularly followed up in terms of height and weight, growth rate and biochemical factors including calcium, phosphorus and alkaline phosphatase every 3 months for one year. CONCLUSION: Regardless of the type of mutation in vitamin D receptor, it is suggested that a 3-6 months trial of high dose oral calcium be started in each patient with vitamin D-dependent rickets type II, particularly for patients whose disease was diagnosed at lower ages.
Modeling motoneuron firing properties: dependency on size and calcium dynamics
van der Heyden, M. J.; Hilgevoord, A. A.; Bour, L. J.; Ongerboer de Visser, B. W.
1994-01-01
The origin of functional differences between motoneurons of varying size was investigated by employing a one-compartmental motoneuron model containing a slow K+ conductance dependent on the intracellular calcium concentration. The size of the cell was included as an explicit parameter. Simulations
DEFF Research Database (Denmark)
Frandsen, Stine Krog; Gibot, Laure; Madi, Moinecha
2015-01-01
BACKGROUND: Calcium electroporation describes the use of high voltage electric pulses to introduce supraphysiological calcium concentrations into cells. This promising method is currently in clinical trial as an anti-cancer treatment. One very important issue is the relation between tumor cell kill...... efficacy-and normal cell sensitivity. METHODS: Using a 3D spheroid cell culture model we have tested the effect of calcium electroporation and electrochemotherapy using bleomycin on three different human cancer cell lines: a colorectal adenocarcinoma (HT29), a bladder transitional cell carcinoma (SW780......), and a breast adenocarcinoma (MDA-MB231), as well as on primary normal human dermal fibroblasts (HDF-n). RESULTS: The results showed a clear reduction in spheroid size in all three cancer cell spheroids three days after treatment with respectively calcium electroporation (p
Temme, Stephanie J.; Murphy, Geoffrey G.
2017-01-01
L-type voltage-gated calcium channels (LVGCCs) have been implicated in both the formation and the reduction of fear through Pavlovian fear conditioning and extinction. Despite the implication of LVGCCs in fear learning and extinction, studies of the individual LVGCC subtypes, Ca[subscript V]1.2 and Ca[subscript V] 1.3, using transgenic mice have…
Energy Technology Data Exchange (ETDEWEB)
Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)
2014-03-31
This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.
Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity
Directory of Open Access Journals (Sweden)
Xiquan Gao
2014-03-01
Full Text Available An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP, which is called PAMP-triggered immunity (PTI. The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI. Calcium (Ca2+ signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response.
Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity
Gao, Xiquan; Cox, Kevin L.; He, Ping
2014-01-01
An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Taft, William C.; Delorenzo, Robert J.
1984-05-01
Benzodiazepines in micromolar concentrations significantly inhibit depolarization-sensitive Ca2+ uptake in intact nerve-terminal preparations. Benzodiazepine inhibition of Ca2+ uptake is concentration dependent and stereospecific. Micromolar-affinity benzodiazepine receptors have been identified and characterized in brain membrane and shown to be distinct from nanomolar-affinity benzodiazepine receptors. Evidence is presented that micromolar, and not nanomolar, benzodiazepine binding sites mediate benzodiazepine inhibition of Ca2+ uptake. Irreversible binding to micromolar benzodiazepine binding sites also irreversibly blocked depolarization-dependent Ca2+ uptake in synaptosomes, indicating that these compounds may represent a useful marker for identifying the molecular components of Ca2+ channels in brain. Characterization of benzodiazepine inhibition of Ca2+ uptake demonstrates that these drugs function as Ca2+ channel antagonists, because benzodiazepines effectively blocked voltage-sensitive Ca2+ uptake inhibited by Mn2+, Co2+, verapamil, nitrendipine, and nimodipine. These results indicate that micromolar benzodiazepine binding sites regulate voltage-sensitive Ca2+ channels in brain membrane and suggest that some of the neuronal stabilizing effects of micromolar benzodiazepine receptors may be mediated by the regulation of Ca2+ conductance.
Rojas, Alejandra; Torres, Mónica; Rojas, J Isela; Feregrino, Angélica; Heimer-de la Cotera, Edgar P
2002-06-01
In the present paper, we describe the results obtained from a preliminary pharmacological and biochemical study of the fire coral Millepora complanata, a regular component of coral reefs in the Mexican Caribbean. The protein-containing crude extract obtained from M. complanata (tested from 0.001 to 1000 microg protein/ml) caused a concentration-dependent stimulation of spontaneous contractions of the guinea pig ileum. The extract (EC(50)=11.55+/-2.36 microg/ml) was approximately 12-fold less potent than ionomycin (EC(50)=0.876+/-0.25 microg/ml) and its maximum induced contraction (1mg protein/ml) was equivalent to 68% of the response to 60mM KCl. FPLC size exclusion chromatography of the M. complanta extract afforded 12 primary fractions, of which only FV (containing proteins with molecular weights ranging from 17 to 44 kDa) and FVIII (consisting of peptides with molecular weights lesser than 1.8k Da) elicited an excitatory effect when tested at the EC(50) of the original extract. After incubation in Ca(2+)-free medium, the ileal response to FV and FVIII was significantly reduced. Blockage of L-type Ca(2+) channels with nifedipine (1 microM) inhibited FV and FVIII-evoked contractions. Cd(2+) (10 microM), an unspecific blocker of voltage-activated calcium channels, also antagonized FV and FVIII-induced effects, whereas the Na(+) channel blocker tetrodotoxin (10nM) did not significantly affect FV and FVIII responses. These results suggest that the contractions induced by the bioactive fractions obtained from the crude extract of M. complanata are caused mainly by a direct action on smooth muscle cells, via an increase in Ca(2+) permeability that occurs, at least partly, through L-type voltage-dependent Ca(2+) channels found in the cell membrane of smooth muscle. Copright 2002 Elsevier Science Ltd.
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
Directory of Open Access Journals (Sweden)
Weiping Zhang
Full Text Available Calcium-activated chloride channels of the anoctamin (alias TMEM16 protein family fulfill critical functions in epithelial fluid transport, smooth muscle contraction and sensory signal processing. Little is known, however, about their contribution to information processing in the central nervous system. Here we examined the recent finding that a calcium-dependent chloride conductance impacts on GABAergic synaptic inhibition in Purkinje cells of the cerebellum. We asked whether anoctamin channels may underlie this chloride conductance. We identified two anoctamin channel proteins, ANO1 and ANO2, in the cerebellar cortex. ANO1 was expressed in inhibitory interneurons of the molecular layer and the granule cell layer. Both channels were expressed in Purkinje cells but, while ANO1 appeared to be retained in the cell body, ANO2 was targeted to the dendritic tree. Functional studies confirmed that ANO2 was involved in a calcium-dependent mode of ionic plasticity that reduces the efficacy of GABAergic synapses. ANO2 channels attenuated GABAergic transmission by increasing the postsynaptic chloride concentration, hence reducing the driving force for chloride influx. Our data suggest that ANO2 channels are involved in a Ca2+-dependent regulation of synaptic weight in GABAergic inhibition. Thus, in balance with the chloride extrusion mechanism via the co-transporter KCC2, ANO2 appears to regulate ionic plasticity in the cerebellum.
Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.
1997-01-01
A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.
Evidence for a possible calcium flux dependent cardiomyopathy in hyperthyroidism
International Nuclear Information System (INIS)
Barat, J.L.; Wicker, P.; Manley, W.
1985-01-01
This study was designed to test the hypothesis that the impaired functional cardiac reserve to exercise in hyperthyroidism is related to alterations in the regulation of calcium transport. In 2l hyperthyroid patients, the left ventricular ejection fraction (LVEF) was measured using equilibrium gated radionuclide angiocardiography at rest and during supine dynamic exercise. After a recovery period, the patients performed a second exercise study after random administration of Verapamil, a calcium entry blocker (11 pts), or propanolol, a beta adrenergic antagonist (10 pts) for comparison. The results showed i) normal resting LVEF with no significant change during exercise before any medication, ii) resting LVEF significantly decreased after Propanolol, and no significantly changed after Verapamil, iii) during exercise, significant increase of LVEF after Verapamil, and no significant change after Propanolol. These results are consistent with previous studies showing that abnormal change in LVEF during exercise in hyperthyroidism seems independent of beta adrenergic activation, and suggest a reversible functional cardiomyopathy dependent of calcium transporting systems
Evidence for a possible calcium flux dependent cardiomyopathy in hyperthyroidism
Energy Technology Data Exchange (ETDEWEB)
Barat, J.L.; Wicker, P.; Manley, W.; Brendel, A.J.; Lefort, G.; San Galli, F.; Commenges-Ducos, M.; Latapie, J.L.; Riviere, J.; Ducassou, D.
1985-05-01
This study was designed to test the hypothesis that the impaired functional cardiac reserve to exercise in hyperthyroidism is related to alterations in the regulation of calcium transport. In 2l hyperthyroid patients, the left ventricular ejection fraction (LVEF) was measured using equilibrium gated radionuclide angiocardiography at rest and during supine dynamic exercise. After a recovery period, the patients performed a second exercise study after random administration of Verapamil, a calcium entry blocker (11 pts), or propanolol, a beta adrenergic antagonist (10 pts) for comparison. The results showed i) normal resting LVEF with no significant change during exercise before any medication, ii) resting LVEF significantly decreased after Propanolol, and no significantly changed after Verapamil, iii) during exercise, significant increase of LVEF after Verapamil, and no significant change after Propanolol. These results are consistent with previous studies showing that abnormal change in LVEF during exercise in hyperthyroidism seems independent of beta adrenergic activation, and suggest a reversible functional cardiomyopathy dependent of calcium transporting systems.
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Queisser, Gillian; Wiegert, Simon; Bading, Hilmar
2011-01-01
Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons.
Regulation of KV channel voltage-dependent activation by transmembrane β subunits
Directory of Open Access Journals (Sweden)
Xiaohui eSun
2012-04-01
Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Directory of Open Access Journals (Sweden)
Dolphin Annette C
2003-09-01
Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those
Energy Technology Data Exchange (ETDEWEB)
Chuan, Lee Te, E-mail: gd130079@siswa.uthm.edu.my; Rathi, Muhammad Fareez Mohamad, E-mail: cd110238@siswa.uthm.edu.my; Abidin, Muhamad Yusuf Zainal, E-mail: cd110221@siswa.uthm.edu.my; Abdullah, Hasan Zuhudi, E-mail: hasan@uthm.edu.my; Idris, Maizlinda Izwana, E-mail: izwana@uthm.edu.my [Faculty of Mechanical and Manufacturing Engineering, Universiti Tun Hussein Onn Malaysia, 86400 Parit Raja, Batu Pahat, Johor (Malaysia)
2015-07-22
Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm{sup −2}) at room temperature. Surface oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.
Directory of Open Access Journals (Sweden)
Xuejun Tian
2015-03-01
Full Text Available Autophagy helps deliver sequestered intracellular cargo to lysosomes for proteolytic degradation and thereby maintains cellular homeostasis by preventing accumulation of toxic substances in cells. In a forward mosaic screen in Drosophila designed to identify genes required for neuronal function and maintenance, we identified multiple cacophony (cac mutant alleles. They exhibit an age-dependent accumulation of autophagic vacuoles (AVs in photoreceptor terminals and eventually a degeneration of the terminals and surrounding glia. cac encodes an α1 subunit of a Drosophila voltage-gated calcium channel (VGCC that is required for synaptic vesicle fusion with the plasma membrane and neurotransmitter release. Here, we show that cac mutant photoreceptor terminals accumulate AV-lysosomal fusion intermediates, suggesting that Cac is necessary for the fusion of AVs with lysosomes, a poorly defined process. Loss of another subunit of the VGCC, α2δ or straightjacket (stj, causes phenotypes very similar to those caused by the loss of cac, indicating that the VGCC is required for AV-lysosomal fusion. The role of VGCC in AV-lysosomal fusion is evolutionarily conserved, as the loss of the mouse homologues, Cacna1a and Cacna2d2, also leads to autophagic defects in mice. Moreover, we find that CACNA1A is localized to the lysosomes and that loss of lysosomal Cacna1a in cerebellar cultured neurons leads to a failure of lysosomes to fuse with endosomes and autophagosomes. Finally, we show that the lysosomal CACNA1A but not the plasma-membrane resident CACNA1A is required for lysosomal fusion. In summary, we present a model in which the VGCC plays a role in autophagy by regulating the fusion of AVs with lysosomes through its calcium channel activity and hence functions in maintaining neuronal homeostasis.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
DEFF Research Database (Denmark)
Jacobsen, Jens Christian; Aalkjær, Christian; Nilsson, Holger
2007-01-01
approximately doubles. In this transition, the simulated results point to a key role for a recently discovered cGMP-sensitive calcium-dependent chloride channel. This channel depolarizes the membrane in response to calcium released from the SR. In turn, depolarization causes uniform opening of L-type calcium...... channels on the cell surface stimulating synchronized release of SR-calcium and inducing the shift from waves to whole-cell oscillations. The effect of the channel is therefore to couple the processes of the SR with those of the membrane. We hypothesize that the shift in oscillatory mode and the associated...
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
Directory of Open Access Journals (Sweden)
Mohamad Khairul Anuar
2017-01-01
Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.
Inhibition of parathyroid hormone release by maitotoxin, a calcium channel activator
International Nuclear Information System (INIS)
Fitzpatrick, L.A.; Yasumoto, T.; Aurbach, G.D.
1989-01-01
Maitotoxin, a toxin derived from a marine dinoflagellate, is a potent activator of voltage-sensitive calcium channels. To further test the hypothesis that inhibition of PTH secretion by calcium is mediated via a calcium channel we studied the effect of maitotoxin on dispersed bovine parathyroid cells. Maitotoxin inhibited PTH release in a dose-dependent fashion, and inhibition was maximal at 1 ng/ml. Chelation of extracellular calcium by EGTA blocked the inhibition of PTH by maitotoxin. Maitotoxin enhanced the effects of the dihydropyridine calcium channel agonist (+)202-791 and increased the rate of radiocalcium uptake in parathyroid cells. Pertussis toxin, which ADP-ribosylates and inactivates a guanine nucleotide regulatory protein that interacts with calcium channels in the parathyroid cell, did not affect the inhibition of PTH secretion by maitotoxin. Maitotoxin, by its action on calcium channels allows entry of extracellular calcium and inhibits PTH release. Our results suggest that calcium channels are involved in the release of PTH. Inhibition of PTH release by maitotoxin is not sensitive to pertussis toxin, suggesting that maitotoxin may act distal to the site interacting with a guanine nucleotide regulatory protein, or maitotoxin could interact with other ions or second messengers to inhibit PTH release
Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie
2018-05-01
Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.
Differential calcium sensitivity in NaV 1.5 mixed syndrome mutants.
Abdelsayed, Mena; Baruteau, Alban-Elouen; Gibbs, Karen; Sanatani, Shubhayan; Krahn, Andrew D; Probst, Vincent; Ruben, Peter C
2017-09-15
SCN5a mutations may express gain-of-function (Long QT Syndrome-3), loss-of-function (Brugada Syndrome 1) or both (mixed syndromes), depending on the mutation and environmental triggers. One such trigger may be an increase in cytosolic calcium, accompanying exercise. Many mixed syndromes mutants, including ∆KPQ, E1784K, 1795insD and Q1909R, are found in calcium-sensitive regions. Elevated cytosolic calcium attenuates gain-of-function properties in ∆KPQ, 1795insD and Q1909R, but not in E1784K. By contrast, elevated cytosolic calcium further exacerbates gain-of-function in E1784K by destabilizing slow inactivation. Action potential modelling, using a modified O'Hara Rudy model, suggests that elevated heart rate rescues action potential duration in ∆KPQ, 1795insD and Q1909R, but not in E1784K. Action potential simulations suggest that E1784K carriers have an increased intracellular sodium-to-calcium ratio under bradycardia and tachycardia conditions. Elevated cytosolic calcium, which is common during high heart rates, ameliorates or exacerbates the mixed syndrome phenotype depending on the genetic signature. Inherited arrhythmias may arise from mutations in the gene for SCN5a, which encodes the cardiac voltage-gated sodium channel, Na V 1.5. Mutants in Na V 1.5 result in Brugada Syndrome (BrS1), Long-QT Syndrome (LQT3) or mixed syndromes (an overlap of BrS1/LQT3). Exercise is a potential arrhythmogenic trigger in mixed syndromes. We aimed to determine the effects of elevated cytosolic calcium, which is common during exercise, in mixed syndrome Na V 1.5 mutants. We used whole-cell patch clamp to assess the biophysical properties of Na V 1.5 wild-type (WT), ∆KPQ, E1784K, 1795insD and Q1909R mutants in human embryonic kidney 293 cells transiently transfected with the Na V 1.5 α subunit (WT or mutants), β1 subunit and enhanced green fluorescent protein. Voltage-dependence and kinetics were measured at cytosolic calcium levels of approximately 0, 500 and 2500
Calcium regulates caveolin-1 expression at the transcriptional level
International Nuclear Information System (INIS)
Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya
2012-01-01
Highlights: ► Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. ► An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. ► Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. ► Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca 2+ /calcineurin/NFAT.
Williams, Steven E; Linton, Nick; O'Neill, Louisa; Harrison, James; Whitaker, John; Mukherjee, Rahul; Rinaldi, Christopher A; Gill, Jaswinder; Niederer, Steven; Wright, Matthew; O'Neill, Mark
2017-09-01
Bipolar voltage is used during electroanatomic mapping to define abnormal myocardium, but the effect of activation rate on bipolar voltage is not known. We hypothesized that bipolar voltage may change in response to activation rate. By examining corresponding unipolar signals we sought to determine the mechanisms of such changes. LA extrastimulus mapping was performed during CS pacing in 10 patients undergoing first time paroxysmal atrial fibrillation ablation. Bipolar and unipolar electrograms were recorded using a PentaRay catheter (4-4-4 spacing) and indifferent IVC electrode, respectively. An S1S2 pacing protocol was delivered with extrastimulus coupling interval reducing from 350 to 200 milliseconds. At each recording site (119 ± 37 per LA), bipolar peak-to-peak voltage, unipolar peak to peak voltage and activation delay between unipole pairs was measured. Four patterns of bipolar voltage/extrastimulus coupling interval curves were seen: voltage attenuation with plateau voltage >1 mV (48 ± 15%) or voltage unaffected by coupling interval with plateau voltage >1 mV (17 ± 10%) or voltage attenuation were associated with significantly greater unipolar voltage attenuation at low (25 ± 28 mV/s vs. 9 ± 11 mV/s) and high (23 ± 29 mV/s vs. 6 ± 12 mV/s) plateau voltage sites (P voltage attenuation (P = 0.026). Bipolar electrogram voltage is dependent on activation rate at a significant proportion of sites. Changes in unipolar voltage and timing underlie these effects. These observations have important implications for use of voltage mapping to delineate abnormal atrial substrate. © 2017 The Authors. Journal of Cardiovascular Electrophysiology published by Wiley Periodicals, Inc.
Mittal, Monica; Hasan, Mahmudul; Balagunaseelan, Navisraj; Fauland, Alexander; Wheelock, Craig; Rådmark, Olof; Haeggström, Jesper Z; Rinaldo-Matthis, Agnes
2017-08-01
A 12-lipoxygenase in zebra fish (zf12-LOX) was found to be required for normal embryonic development and LOXs are of great interest for targeted drug designing. In this study, we investigate the structural-functional aspects of zf12-LOX in response to calcium. A soluble version of zf12-LOX was created by mutagenesis. Based on multiple sequence alignment, we mutated the putative calcium-responsive amino acids in N-PLAT domain of soluble zf12-LOX. Using a series of biophysical methods, we ascertained the oligomeric state, stability, structural integrity and conformational changes of zf12-LOX in response to calcium. We also compared the biophysical properties of soluble zf12-LOX with the mutant in the absence and presence of calcium. Here we provide a detailed characterization of soluble zf12-LOX and the mutant. Both proteins exist as compact monomers in solution, however the enzyme activity of soluble zf12-LOX is significantly increased in presence of calcium. We find that the stimulatory effect of calcium on zf12-LOX is related to a change in protein structure as observed by SAXS, adopting an open-state. In contrast, enzyme with a mutated calcium regulatory site has reduced activity-response to calcium and restricted large re-modeling, suggesting that it retains a closed-state in response to calcium. Taken together, our study suggests that Ca 2+ -dependent regulation is associated with different domain conformation(s) that might change the accessibility to substrate-binding site in response to calcium. The study can be broadly implicated in better understanding the mode(s) of action of LOXs, and the enzymes regulated by calcium in general. Copyright © 2017 Elsevier B.V. All rights reserved.
Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification
Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo
2013-01-01
In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
Estimating the biophysical properties of neurons with intracellular calcium dynamics.
Ye, Jingxin; Rozdeba, Paul J; Morone, Uriel I; Daou, Arij; Abarbanel, Henry D I
2014-06-01
We investigate the dynamics of a conductance-based neuron model coupled to a model of intracellular calcium uptake and release by the endoplasmic reticulum. The intracellular calcium dynamics occur on a time scale that is orders of magnitude slower than voltage spiking behavior. Coupling these mechanisms sets the stage for the appearance of chaotic dynamics, which we observe within certain ranges of model parameter values. We then explore the question of whether one can, using observed voltage data alone, estimate the states and parameters of the voltage plus calcium (V+Ca) dynamics model. We find the answer is negative. Indeed, we show that voltage plus another observed quantity must be known to allow the estimation to be accurate. We show that observing both the voltage time course V(t) and the intracellular Ca time course will permit accurate estimation, and from the estimated model state, accurate prediction after observations are completed. This sets the stage for how one will be able to use a more detailed model of V+Ca dynamics in neuron activity in the analysis of experimental data on individual neurons as well as functional networks in which the nodes (neurons) have these biophysical properties.
Macková, Katarina; Zahradníková, Alexandra; Hoťka, Matej; Hoffmannová, Barbora; Zahradník, Ivan; Zahradníková, Alexandra
2017-12-01
Developing cardiac myocytes undergo substantial structural and functional changes transforming the mechanism of excitation-contraction coupling from the embryonic form, based on calcium influx through sarcolemmal DHPR calcium channels, to the adult form, relying on local calcium release through RYR calcium channels of sarcoplasmic reticulum stimulated by calcium influx. We characterized day-by-day the postnatal development of the structure of sarcolemma, using techniques of confocal fluorescence microscopy, and the development of the calcium current, measured by the whole-cell patch-clamp in isolated rat ventricular myocytes. We characterized the appearance and expansion of the t-tubule system and compared it with the appearance and progress of the calcium current inactivation induced by the release of calcium ions from sarcoplasmic reticulum as structural and functional measures of direct DHPR-RYR interaction. The release-dependent inactivation of calcium current preceded the development of the t-tubular system by several days, indicating formation of the first DHPR-RYR couplons at the surface sarcolemma and their later spreading close to contractile myofibrils with the growing t-tubules. Large variability of both of the measured parameters among individual myocytes indicates uneven maturation of myocytes within the growing myocardium.
Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro
International Nuclear Information System (INIS)
Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.
1989-01-01
The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)
Mendez, Aida G; Juncal, Andrea Boente; Silva, Siguara B L; Thomas, Olivier P; Martín Vázquez, Víctor; Alfonso, Amparo; Vieytes, Mercedes R; Vale, Carmen; Botana, Luís M
2017-07-19
Crambescidin 816 is a guanidine alkaloid produced by the sponge Crambe crambe with known antitumoral activity. While the information describing the effects of this alkaloid in central neurons is scarce, Cramb816 is known to block voltage dependent calcium channels being selective for L-type channels. Moreover, Cramb816 reduced neuronal viability through an unknown mechanism. Here, we aimed to describe the toxic activity of Cramb816 in cortical neurons. Since calcium influx is considered the main mechanism responsible for neuronal cell death, the effects of Cramb816 in the cytosolic calcium concentration of cortical neurons were studied. The alkaloid decreased neuronal viability and induced a dose-dependent increase in cytosolic calcium that was also related to the presence of calcium in the extracellular media. The increase in calcium influx was age dependent, being higher in younger neurons. Moreover, this effect was prevented by glutamate receptor antagonists, which did not fully block the cytotoxic effect of Cramb816 after 24 h of treatment but completely prevented Cramb816 cytotoxicity after 10 min exposure. Therefore, the findings presented herein provide new insights into the cytotoxic effect of Cramb816 in cortical neurons.
Pan, Zhi; Avila, Andrew; Gollahon, Lauren
2014-01-01
Previously, we reported that endoplasmic reticulum calcium stores were a direct target for paclitaxel initiation of apoptosis. Furthermore, the actions of paclitaxel attenuated Bcl-2 resistance to apoptosis through endoplasmic reticulum-mediated calcium release. To better understand the calcium-regulated mechanisms of paclitaxel-induced apoptosis in breast cancer cells, we investigated the role of extracellular calcium, specifically; whether influx of extracellular calcium contributed to and/or was necessary for paclitaxel-induced apoptosis. Our results demonstrated that paclitaxel induced extracellular calcium influx. This mobilization of extracellular calcium contributed to subsequent cytosolic calcium elevation differently, depending on dosage. Under normal extracellular calcium conditions, high dose paclitaxel induced apoptosis-promoting calcium influx, which did not occur in calcium-free conditions. In the absence of extracellular calcium an “Enhanced Calcium Efflux” mechanism in which high dose paclitaxel stimulated calcium efflux immediately, leading to dramatic cytosolic calcium decrease, was observed. In the absence of extracellular calcium, high dose paclitaxel’s stimulatory effects on capacitative calcium entry and apoptosis could not be completely restored. Thus, normal extracellular calcium concentrations are critical for high dose paclitaxel-induced apoptosis. In contrast, low dose paclitaxel mirrored controls, indicating that it occurs independent of extracellular calcium. Thus, extracellular calcium conditions only affect efficacy of high dose paclitaxel-induced apoptosis. PMID:24549172
Rudolph, Stephanie; Hull, Court; Regehr, Wade G
2015-11-25
Interneurons are essential to controlling excitability, timing, and synaptic integration in neuronal networks. Golgi cells (GoCs) serve these roles at the input layer of the cerebellar cortex by releasing GABA to inhibit granule cells (grcs). GoCs are excited by mossy fibers (MFs) and grcs and provide feedforward and feedback inhibition to grcs. Here we investigate two important aspects of GoC physiology: the properties of GoC dendrites and the role of calcium signaling in regulating GoC spontaneous activity. Although GoC dendrites are extensive, previous studies concluded they are devoid of voltage-gated ion channels. Hence, the current view holds that somatic voltage signals decay passively within GoC dendrites, and grc synapses onto distal dendrites are not amplified and are therefore ineffective at firing GoCs because of strong passive attenuation. Using whole-cell recording and calcium imaging in rat slices, we find that dendritic voltage-gated sodium channels allow somatic action potentials to activate voltage-gated calcium channels (VGCCs) along the entire dendritic length, with R-type and T-type VGCCs preferentially located distally. We show that R- and T-type VGCCs located in the dendrites can boost distal synaptic inputs and promote burst firing. Active dendrites are thus critical to the regulation of GoC activity, and consequently, to the processing of input to the cerebellar cortex. In contrast, we find that N-type channels are preferentially located near the soma, and control the frequency and pattern of spontaneous firing through their close association with calcium-activated potassium (KCa) channels. Thus, VGCC types are differentially distributed and serve specialized functions within GoCs. Interneurons are essential to neural processing because they modulate excitability, timing, and synaptic integration within circuits. At the input layer of the cerebellar cortex, a single type of interneuron, the Golgi cell (GoC), carries these functions. The
Fang, Ton; Kasbi, Kamillia; Rothe, Stephanie; Aziz, Wajeeha; Giese, K Peter
2017-09-01
The hippocampus and amygdala are essential brain regions responsible for contextual fear conditioning (CFC). The autophosphorylation of alpha calcium-calmodulin kinase II (αCaMKII) at threonine-286 (T286) is a critical step implicated in long-term potentiation (LTP), learning and memory. However, the changes in αCaMKII levels with aging and training in associated brain regions are not fully understood. Here, we studied how aging and training affect the levels of phosphorylated (T286) and proportion of phosphorylated:total αCaMKII in the hippocampus and amygdala. Young and aged mice, naïve (untrained) and trained in CFC, were analysed by immunohistochemistry for the levels of total and phosphorylated αCaMKII in the hippocampus and amygdala. We found that two hours after CFC training, young mice exhibited a higher level of phosphorylated and increased ratio of phosphorylated:total αCaMKII in hippocampal CA3 stratum radiatum. Furthermore, aged untrained mice showed a higher ratio of phosphorylated:total αCaMKII in the CA3 region of the hippocampus when compared to the young untrained group. No effect of training or aging were seen in the central, lateral and basolateral amygdala regions, for both phosphorylated and ratio of phosphorylated:total αCaMKII. These results show that aging impairs the training-induced upregulation of autophosphorylated (T286) αCaMKII in the CA3 stratum radiatum of the hippocampus. This indicates that distinct age-related mechanisms underlie CFC that may rely more heavily on NMDA receptor-dependent plasticity in young age. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Calcium electrotransfer for termination of transgene expression in muscle
DEFF Research Database (Denmark)
Hojman, Pernille; Spanggaard, Iben; Olsen, Caroline Holkman
2011-01-01
Gene electrotransfer is expanding in clinical use, thus we have searched for an emergency procedure to stop transgene expression in case of serious adverse events. Calcium is cytotoxic at high intracellular levels, so we tested effects of calcium electrotransfer on transgene expression in muscle....... A clinical grade calcium solution (20 μl, 168 mM) was injected into transfected mouse or rat tibialis cranialis muscle. Ca(2+) uptake was quantified using calcium 45 ((45)Ca), and voltage and time between injection and pulsation were varied. Extinction of transgene expression was investigated by using both...... voltage pulses of 1000 V/cm. Using these parameters, in vivo imaging showed that transgene expression significantly decreased 4 hr after Ca(2+) electrotransfer and was eliminated within 24 hr. Similarly, serum erythropoietin was reduced by 46% at 4 hr and to control levels at 2 days. Histological analyses...
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage
Directory of Open Access Journals (Sweden)
RAMÓN LATORRE
2006-01-01
Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.
Regulation of granule cell excitability by a low-threshold calcium spike in turtle olfactory bulb
DEFF Research Database (Denmark)
Pinato, Giulietta; Midtgaard, Jens
2003-01-01
of the cell usually increased their amplitude so that they more easily boosted Na spike initiation. The LTS persisted in the presence of TTX but was antagonized by blockers of T-type calcium channels. The voltage dependence, kinetics, and inactivation properties of the LTS were characteristic of a low......-threshold calcium spike. The threshold of the LTS was slightly above the resting potential but well below the Na spike threshold, and the LTS was often evoked in isolation in normal medium. Tetraethylammonium (TEA) and 4-aminopyridine (4-AP) had only minimal effects on the LTS but revealed the presence of a high...
Depolarization-stimulated 42K+ efflux in rat aorta is calcium- and cellular volume-dependent
International Nuclear Information System (INIS)
Magliola, L.; Jones, A.W.
1987-01-01
The purpose of this study was to investigate the factors controlling membrane permeability to potassium of smooth muscle cells from rat aorta stimulated by depolarization. The increase 42 K+ efflux (change in the rate constant) induced by depolarization (application of high concentrations of potassium chloride) was inhibited significantly by the calcium antagonists diltiazem and nisoldipine. Parallel inhibitory effects on contraction were observed. Diltiazem also inhibited potassium-stimulated 36 Cl- efflux. The addition of 25-150 mM KCl to normal physiologic solution stimulated 42 K+ efflux in a concentration-dependent manner. Diltiazem suppressed potassium-stimulated 42 K+ efflux approximately 90% at 25 mM KCl and approximately 40% at 150 mM KCl. The ability of nisoldipine to inhibit 42 K+ efflux also diminished as the potassium chloride concentration was elevated. The component of efflux that was resistant to calcium antagonists probably resulted from a decrease in the electrochemical gradient for potassium. Cellular water did not change during potassium addition. Substitution of 80 and 150 mM KCl for sodium chloride produced cellular swelling and enhanced potassium-stimulated 42 K+ efflux compared with potassium chloride addition. The addition of sucrose to prevent cellular swelling reduced efflux response to potassium substitution toward that of potassium addition. A hypoosmolar physiologic solution produced an increase in the 42 K+ efflux and a contracture that were both prevented by the addition of sucrose. We concluded that the depolarization-mediated 42 K+ efflux has three components: one is calcium dependent; a second is dependent on cellular volume; and a third is resistant to inhibition by calcium antagonists
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
Kantserova, N. P.; Krylov, V. V.; Lysenko, L. A.; Ushakova, N. V.; Nemova, N. N.
2017-12-01
The effects of hypomagnetic conditions and the reversal of the geomagnetic field (GMF) on intracellular Ca2+-dependent proteases (calpains) of fish and invertebrates have been studied in vivo and in vitro. It is found that the intravital exposure of examined animals to hypomagnetic conditions leads to a significant decrease in its calpain activity. The activity of preparations of calcium-dependent proteases was tested in separate experiments. It is shown that preparations of Ca2+-dependent proteases from invertebrates and fish are also inactivated substantially under effect of hypomagnetic conditions. The ambiguous results obtained in the experiments with a reversed GMF do not make it possible to discuss the biological response of calcium-dependent proteases to the reversal of the GMF.
The old is new again: asparagine oxidation in calcium-dependent antibiotic biosynthesis.
Worthington, Andrew S; Burkart, Michael D
2007-03-20
Non-ribosomal peptides are built from both proteinogenic and non-proteinogenic amino acids. The latter resemble amino acids but contain modifications not found in proteins. The recent characterization of a non-heme Fe(2+) and alpha-ketoglutarate-dependent oxygenase that stereospecifically generates beta-hydroxyasparagine, an unnatural amino acid building block for the biosynthesis of calcium-dependent antibiotic, a lipopeptide antibiotic. This work improves our understanding of how these non-proteinogenic amino acids are synthesized.
Zhang, Baochun; Crankshaw, Will; Nesemeier, Ryan; Patel, Jay; Nweze, Ikenna; Lakshmanan, Jaganathan; Harbrecht, Brian G
2015-02-01
Induced nitric oxide synthase (iNOS) is induced in hepatocytes by shock and inflammatory stimuli. Excessive NO from iNOS mediates shock-induced hepatic injury and death, so understanding the regulation of iNOS will help elucidate the pathophysiology of septic shock. In vitro, cytokines induce iNOS expression through activation of signaling pathways including mitogen-activated protein kinases and nuclear factor κB. Cytokines also induce calcium (Ca(2+)) mobilization and activate calcium-mediated intracellular signaling pathways, typically through activation of calmodulin-dependent kinases (CaMK). Calcium regulates NO production in macrophages but the role of calcium and calcium-mediated signaling in hepatocyte iNOS expression has not been defined. Primary rat hepatocytes were isolated, cultured, and induced to produce NO with proinflammatory cytokines. Calcium mobilization and Ca(2+)-mediated signaling were altered with ionophore, Ca(2+) channel blockers, and inhibitors of CaMK. The Ca(2+) ionophore A23187 suppressed cytokine-stimulated NO production, whereas Ethylene glycol tetraacetic acid and nifedipine increased NO production, iNOS messenger RNA, and iNOS protein expression. Inhibition of CaMK with KN93 and CBD increased NO production but the calcineurin inhibitor FK 506 decreased iNOS expression. These data demonstrate that calcium-mediated signaling regulates hepatocyte iNOS expression and does so through a mechanism independent of calcineurin. Changes in intracellular calcium levels may regulate iNOS expression during hepatic inflammation induced by proinflammatory cytokines. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wei Xia
2015-01-01
Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.
International Nuclear Information System (INIS)
Carlmark, B.; Reizenstein, P.; Dudley, R.A.
1976-01-01
The methods most commonly used to measure the absorption and retention of orally administered calcium are reviewed. Nearly all make use of calcium radioisotopes. The magnitude of calcium absorption and retention depends upon the chemical form and amount of calcium administered, and the clinical and nutritional status of the subject; these influences are briefly surveyed. (author)
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
Acute Cocaine Exposure elicits rises in calcium in Arousal Related Laterodorsal Tegmental Neurons
DEFF Research Database (Denmark)
Lambert, Mads; Ipsen, Theis; Kohlmeier, Kristi Anne
2017-01-01
Cocaine has strong reinforcing properties, which underlie its high addiction potential. Reinforcement of use of addictive drugs is associated with rises in dopamine (DA) in mesoaccumbal circuitry. Excitatory afferent input to mesoaccumbal circuitry sources from the laterodorsal tegmental nucleus...... (LDT). Chronic, systemic cocaine exposure has been shown to have cellular effects on LDT cells, but acute actions of local application have never been demonstrated. Using calcium imaging, we show that acute application of cocaine to mouse brain slices induces calcium spiking in cells of the LDT....... Spiking was attenuated by tetrodotoxin (TTX) and low calcium solutions, and abolished by prior exhaustion of intracellular calcium stores. Further, DA receptor antagonists reduced these transients, whereas DA induced rises with similar spiking kinetics. Amphetamine, which also results in elevated levels...
Directory of Open Access Journals (Sweden)
Li-Rong Shao
2018-06-01
Full Text Available Manipulation of metabolic pathways (e.g., ketogenic diet (KD, glycolytic inhibition alters neural excitability and represents a novel strategy for treatment of drug-refractory seizures. We have previously shown that inhibition of glycolysis suppresses epileptiform activity in hippocampal slices. In the present study, we aimed to examine the role of a “branching” metabolic pathway stemming off glycolysis (i.e., the pentose-phosphate pathway, PPP in regulating seizure activity, by using a potent PPP stimulator and glycolytic intermediate, fructose-1,6-bisphosphate (F1,6BP. Employing electrophysiological approaches, we investigated the action of F1,6BP on epileptiform population bursts, intrinsic neuronal firing, glutamatergic and GABAergic synaptic transmission and voltage-activated calcium currents (ICa in the CA3 area of hippocampal slices. Bath application of F1,6BP (2.5–5 mM blocked epileptiform population bursts induced in Mg2+-free medium containing 4-aminopyridine, in ~2/3 of the slices. The blockade occurred relatively rapidly (~4 min, suggesting an extracellular mechanism. However, F1,6BP did not block spontaneous intrinsic firing of the CA3 neurons (when synaptic transmission was eliminated with DNQX, AP-5 and SR95531, nor did it significantly reduce AMPA or NMDA receptor-mediated excitatory postsynaptic currents (EPSCAMPA and EPSCNMDA. In contrast, F1,6BP caused moderate reduction (~50% in GABAA receptor-mediated current, suggesting it affects excitatory and inhibitory synapses differently. Finally and unexpectedly, F1,6BP consistently attenuated ICa by ~40% without altering channel activation or inactivation kinetics, which may explain its anticonvulsant action, at least in this in vitro seizure model. Consistent with these results, epileptiform population bursts in CA3 were readily blocked by the nonspecific Ca2+ channel blocker, CdCl2 (20 μM, suggesting that these bursts are calcium dependent. Altogether, these data
Langs, David A.; Strong, Phyllis D.; Triggle, David J.
1990-09-01
Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.
Purali, Nuhan
2017-09-01
In the present study, cytosolic calcium concentration changes were recorded in response to various forms of excitations, using the fluorescent calcium indicator dye OG-BAPTA1 together with the current or voltage clamp methods in stretch receptor neurons of crayfish. A single action potential evoked a rise in the resting calcium level in the axon and axonal hillock, whereas an impulse train or a large saturating current injection would be required to evoke an equivalent response in the dendrite region. Under voltage clamp conditions, amplitude differences between axon and dendrite responses vanished completely. The fast activation time and the modulation of the response by extracellular calcium concentration changes indicated that the evoked calcium transients might be mediated by calcium entry into the cytosol through a voltage-gated calcium channel. The decay of the responses was slow and sensitive to extracellular sodium and calcium concentrations as well as exposure to 1-10 mM NiCl 2 and 10-500 µM lanthanum. Thus, a sodium calcium exchanger and a calcium ATPase might be responsible for calcium extrusion from the cytosol. Present results indicate that the calcium indicator OG-BAPTA1 might be an efficient but indirect way of monitoring regional membrane potential differences in a single neuron.
Directory of Open Access Journals (Sweden)
Thomas Nebl
2011-09-01
Full Text Available Apicomplexan parasites depend on the invasion of host cells for survival and proliferation. Calcium-dependent signaling pathways appear to be essential for micronemal release and gliding motility, yet the target of activated kinases remains largely unknown. We have characterized calcium-dependent phosphorylation events during Toxoplasma host cell invasion. Stimulation of live tachyzoites with Ca²⁺-mobilizing drugs leads to phosphorylation of numerous parasite proteins, as shown by differential 2-DE display of ³²[P]-labeled protein extracts. Multi-dimensional Protein Identification Technology (MudPIT identified ∼546 phosphorylation sites on over 300 Toxoplasma proteins, including 10 sites on the actomyosin invasion motor. Using a Stable Isotope of Amino Acids in Culture (SILAC-based quantitative LC-MS/MS analyses we monitored changes in the abundance and phosphorylation of the invasion motor complex and defined Ca²⁺-dependent phosphorylation patterns on three of its components--GAP45, MLC1 and MyoA. Furthermore, calcium-dependent phosphorylation of six residues across GAP45, MLC1 and MyoA is correlated with invasion motor activity. By analyzing proteins that appear to associate more strongly with the invasion motor upon calcium stimulation we have also identified a novel 15-kDa Calmodulin-like protein that likely represents the MyoA Essential Light Chain of the Toxoplasma invasion motor. This suggests that invasion motor activity could be regulated not only by phosphorylation but also by the direct binding of calcium ions to this new component.
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Li, Congcong; Bo, Liyan; Liu, Qingqing; Liu, Wei; Chen, Xiangjun; Xu, Dunquan; Jin, Faguang
2016-03-01
Calcium is an important second messenger and it is widely recognized that acute lung injury (ALI) is often caused by oscillations of cytosolic free Ca2+. Previous studies have indicated that the activation of transient receptor potential‑vanilloid (TRPV) channels and subsequent Ca2+ entry initiates an acute calcium‑dependent permeability increase during ALI. However, whether seawater exposure induces such an effect through the activation of TRPV channels remains unknown. In the current study, the effect of calcium, a component of seawater, on the inflammatory reactions that occur during seawater drowning‑induced ALI, was examined. The results demonstrated that a high concentration of calcium ions in seawater increased lung tissue myeloperoxidase activity and the secretion of inflammatory mediators, such as tumor necrosis factor‑α (TNF‑α) and interleukin (IL)‑1β and IL‑6. Further study demonstrated that the seawater challenge elevated cytosolic Ca2+ concentration, indicated by [Ca2+]c, by inducing calcium influx from the extracellular medium via TRPV1 channels. The elevated [Ca2+c] may have resulted in the increased release of TNF‑α and IL‑1β via increased phosphorylation of nuclear factor‑κB (NF‑κB). It was concluded that a high concentration of calcium in seawater exacerbated lung injury, and TRPV1 channels were notable mediators of the calcium increase initiated by the seawater challenge. Calcium influx through TRPV1 may have led to greater phosphorylation of NF‑κB and increased release of TNF‑α and IL‑1β.
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Energy Technology Data Exchange (ETDEWEB)
Arora, N D
1987-05-01
A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.
Li, Dong; Zhang, Shu-Zhuo; Yao, Yu-Hong; Xiang, Yun; Ma, Xiao-Yun; Wei, Xiao-Li; Yan, Hai-Tao; Liu, Xiao-Yan
2017-12-01
Sigma-1 receptors (Sig-1Rs) are unique endoplasmic reticulum proteins that have been implicated in both neurodegenerative and ischemic diseases, such as Alzheimer's disease and stroke. Accumulating evidence has suggested that Sig-1R plays a role in neuroprotection and axon outgrowth. The underlying mechanisms of Sig-1R-mediated neuroprotection have been well elucidated. However, the mechanisms underlying the effects of Sig-1R on axon outgrowth are not fully understood. To clarify this issue, we utilized immunofluorescence to compare the axon lengths of cultured naïve hippocampal neurons before and after the application of the Sig-1R agonist, SA4503. Then, electrophysiology and immunofluorescence were used to examine voltage-gated calcium ion channel (VGCCs) currents in the cell membranes and growth cones. We found that Sig-1R activation dramatically enhanced the axonal length of the naïve hippocampal neurons. Application of the Sig-1R antagonist NE100 and gene knockdown techniques both demonstrated the effects of Sig-1R. The growth-promoting effect of SA4503 was accompanied by the inhibition of voltage-gated Ca 2+ influx and was recapitulated by incubating the neurons with the L-type, N-type, and P/Q-type VGCC blockers, nimodipine, MVIIA and ω-agatoxin IVA, respectively. This effect was unrelated to glial cells. The application of SA4503 transformed the growth cone morphologies from complicated to simple, which favored axon outgrowth. Sig-1R activation can enhance axon outgrowth and may have a substantial influence on neurogenesis and neurodegenerative diseases. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Kia J Jackson
Full Text Available The influx of Ca(2+ through calcium-permeable nicotinic acetylcholine receptors (nAChRs leads to activation of various downstream processes that may be relevant to nicotine-mediated behaviors. The calcium activated protein, calcium/calmodulin-dependent protein kinase IV (CaMKIV phosphorylates the downstream transcription factor cyclic AMP response element binding protein (CREB, which mediates nicotine responses; however the role of CaMKIV in nicotine dependence is unknown. Given the proposed role of CaMKIV in CREB activation, we hypothesized that CaMKIV might be a crucial molecular component in the development of nicotine dependence. Using male CaMKIV genetically modified mice, we found that nicotine reward is attenuated in CaMKIV knockout (-/- mice, but cocaine reward is enhanced in these mice. CaMKIV protein levels were also increased in the nucleus accumbens of C57Bl/6 mice after nicotine reward. In a nicotine withdrawal assessment, anxiety-related behavior, but not somatic signs or the hyperalgesia response are attenuated in CaMKIV -/- mice. To complement our animal studies, we also conducted a human genetic association analysis and found that variants in the CaMKIV gene are associated with a protective effect against nicotine dependence. Taken together, our results support an important role for CaMKIV in nicotine reward, and suggest that CaMKIV has opposing roles in nicotine and cocaine reward. Further, CaMKIV mediates affective, but not physical nicotine withdrawal signs, and has a protective effect against nicotine dependence in human genetic association studies. These findings further indicate the importance of calcium-dependent mechanisms in mediating behaviors associated with drugs of abuse.
McDonald, Catherine M.
1980-01-01
Iron deficiency has been shown to impair calcium absorption, leading to decreased bone mass. Vitamin D3-dependent calcium binding protein (CaBP) has been demonstrated to be necessary for the active transport of calcium in the intestine of numerous species. Iron deficiency might affect the activity of the calcium binding protein. Four experimental diets were formulated as follows: Diet 1, iron adequate, calcium adequate; Diet 2, iron deficient, calcium adequate; Diet 3, iron adequate, calci...
Impairment of mitochondrial calcium handling in a mtSOD1 cell culture model of motoneuron disease
Directory of Open Access Journals (Sweden)
Zippelius Annette
2009-06-01
Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons (MN in the brain stem and spinal cord. Intracellular disruptions of cytosolic and mitochondrial calcium have been associated with selective MN degeneration, but the underlying mechanisms are not well understood. The present evidence supports a hypothesis that mitochondria are a target of mutant SOD1-mediated toxicity in familial amyotrophic lateral sclerosis (fALS and intracellular alterations of cytosolic and mitochondrial calcium might aggravate the course of this neurodegenerative disease. In this study, we used a fluorescence charged cool device (CCD imaging system to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations in individual cells in an established cellular model of ALS. Results To gain insights into the molecular mechanisms of SOD1G93A associated motor neuron disease, we simultaneously monitored cytosolic and mitochondrial calcium concentrations in individual cells. Voltage – dependent cytosolic Ca2+ elevations and mitochondria – controlled calcium release mechanisms were monitored after loading cells with fluorescent dyes fura-2 and rhod-2. Interestingly, comparable voltage-dependent cytosolic Ca2+ elevations in WT (SH-SY5YWT and G93A (SH-SY5YG93A expressing cells were observed. In contrast, mitochondrial intracellular Ca2+ release responses evoked by bath application of the mitochondrial toxin FCCP were significantly smaller in G93A expressing cells, suggesting impaired calcium stores. Pharmacological experiments further supported the concept that the presence of G93A severely disrupts mitochondrial Ca2+ regulation. Conclusion In this study, by fluorescence measurement of cytosolic calcium and using simultaneous [Ca2+]i and [Ca2+]mito measurements, we are able to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations
Film size-dependent voltage-modulated magnetism in multiferroic heterostructures
Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.
2014-01-01
The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375
Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors
Directory of Open Access Journals (Sweden)
Salmela Iikka
2012-08-01
Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.
The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.
Directory of Open Access Journals (Sweden)
Ting-Feng Lin
Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.
Discovery and Development of Calcium Channel Blockers
Directory of Open Access Journals (Sweden)
Théophile Godfraind
2017-05-01
Full Text Available In the mid 1960s, experimental work on molecules under screening as coronary dilators allowed the discovery of the mechanism of calcium entry blockade by drugs later named calcium channel blockers. This paper summarizes scientific research on these small molecules interacting directly with L-type voltage-operated calcium channels. It also reports on experimental approaches translated into understanding of their therapeutic actions. The importance of calcium in muscle contraction was discovered by Sidney Ringer who reported this fact in 1883. Interest in the intracellular role of calcium arose 60 years later out of Kamada (Japan and Heibrunn (USA experiments in the early 1940s. Studies on pharmacology of calcium function were initiated in the mid 1960s and their therapeutic applications globally occurred in the the 1980s. The first part of this report deals with basic pharmacology in the cardiovascular system particularly in isolated arteries. In the section entitled from calcium antagonists to calcium channel blockers, it is recalled that drugs of a series of diphenylpiperazines screened in vivo on coronary bed precontracted by angiotensin were initially named calcium antagonists on the basis of their effect in depolarized arteries contracted by calcium. Studies on arteries contracted by catecholamines showed that the vasorelaxation resulted from blockade of calcium entry. Radiochemical and electrophysiological studies performed with dihydropyridines allowed their cellular targets to be identified with L-type voltage-operated calcium channels. The modulated receptor theory helped the understanding of their variation in affinity dependent on arterial cell membrane potential and promoted the terminology calcium channel blocker (CCB of which the various chemical families are introduced in the paper. In the section entitled tissue selectivity of CCBs, it is shown that characteristics of the drug, properties of the tissue, and of the stimuli are
DEFF Research Database (Denmark)
Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia
2016-01-01
This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...
Lazcano-Pérez, Fernando; Castro, Héctor; Arenas, Isabel; García, David E; González-Muñoz, Ricardo; Arreguín-Espinosa, Roberto
2016-05-05
The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7), voltage-gated calcium channel (CaV2.2), the A-type transient outward (IA) and delayed rectifier (IDR) currents of KV channels of the superior cervical ganglion (SCG) neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.
ACCURATUM: improved calcium volume scoring using a mesh-based algorithm - a phantom study
International Nuclear Information System (INIS)
Saur, Stefan C.; Szekely, Gabor; Alkadhi, Hatem; Desbiolles, Lotus; Cattin, Philippe C.
2009-01-01
To overcome the limitations of the classical volume scoring method for quantifying coronary calcifications, including accuracy, variability between examinations, and dependency on plaque density and acquisition parameters, a mesh-based volume measurement method has been developed. It was evaluated and compared with the classical volume scoring method for accuracy, i.e., the normalized volume (measured volume/ground-truthed volume), and for variability between examinations (standard deviation of accuracy). A cardiac computed-tomography (CT) phantom containing various cylindrical calcifications was scanned using different tube voltages and reconstruction kernels, at various positions and orientations on the CT table and using different slice thicknesses. Mean accuracy for all plaques was significantly higher (p<0.0001) for the proposed method (1.220±0.507) than for the classical volume score (1.896±1.095). In contrast to the classical volume score, plaque density (p=0.84), reconstruction kernel (p=0.19), and tube voltage (p=0.27) had no impact on the accuracy of the developed method. In conclusion, the method presented herein is more accurate than classical calcium scoring and is less dependent on tube voltage, reconstruction kernel, and plaque density. (orig.)
Directory of Open Access Journals (Sweden)
Jessica A Hennessey
Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of
Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.
Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming
2015-01-01
The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.
DEFF Research Database (Denmark)
Kuhre, Rune Ehrenreich; Bechmann, Louise Ellegaard; Hartmann, Bolette
2015-01-01
of secretion. Luminal glucose (20% wt/vol) stimulated secretion but vascular glucose (5, 10, or 15 mmol/l) was without effect. The underlying mechanisms depend on membrane depolarization and calcium influx, since the voltage-gated calcium channel inhibitor nifedipine and the KATP channel opener diazoxide......, suggesting that glucose stimulates secretion by initial uptake by this transporter. However, secretion was also sensitive to GLUT2 inhibition (by phloretin) and blockage of oxidative phosphorylation (2-4-dinitrophenol). Direct KATP channel closure by sulfonylureas stimulated secretion. Therefore, glucose...
Energy Technology Data Exchange (ETDEWEB)
Boschek, Curt B; Jones, Terry E; Squier, Thomas C; Bigelow, Diana J
2007-08-01
Calmodulin (CaM) regulates calcium release from intracellular stores in skeletal muscle through its association with the ryanodine receptor (RyR1) calcium release channel, where CaM association enhances channel opening at resting calcium levels and its closing at micromolar calcium levels associated with muscle contraction. A high-affinity CaM-binding sequence (RyRp) has been identified in RyR1, which corresponds to a 30-residue sequence (i.e., K3614 – N3643) located within the central portion of the primary sequence. However, it is currently unclear whether the identified CaM-binding sequence a) senses calcium over the physiological range of calcium-concentrations associated with RyR1 regulation or b) plays a structural role unrelated to the calcium-dependent modulation of RyR1 function. Therefore, we have measured the calcium-dependent activation of the individual domains of CaM in association with RyRp and their relationship to the CaM-dependent regulation of RyR1. These measurements utilize an engineered CaM, permitting the site-specific incorporation of N-(1-pyrene) maleimide at either T34C (PyN-CaM) or T110C (PyC-CaM) in the N- and C-domains, respectively. Consistent with prior measurements, we observe a high-affinity association between both apo- and calcium-activated CaM and RyRp. Upon association with RyRp, fluorescence changes in PyN-CaM or PyC-CaM permit the measurement of the calcium-activation of these individual domains. Fluorescence changes upon calcium-activation of PyC-CaM in association with RyRp are indicative of high-affinity calcium-dependent activation of the C-terminal domain of CaM bound to RyRp at resting calcium levels and the activation of the N-terminal domain at levels of calcium associated cellular activation. In comparison, occupancy of calcium-binding sites in the N-domain of CaM mirrors the calcium-dependence of RyR1 inhibition observed at activating calcium levels, where [Ca]1/2 = 4.3 0.4 μM, suggesting a direct regulation of Ry
Mechanisms of pyrethroid insecticide-induced stimulation of calcium influx in neocortical neurons
Pyrethroid insecticides bind to voltage-gated sodium channels (VGSCs) and modify their gating kinetics, thereby disrupting neuronal function. Pyrethroids have also been reported to alter the function of other channel types, including activation of voltage-gated Ca2+ calcium chann...
International Nuclear Information System (INIS)
Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.
2008-01-01
Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Calcium Pyrophosphate Deposition (CPPD)
... Patient / Caregiver Diseases & Conditions Calcium Pyrophosphate Deposition (CPPD) Calcium Pyrophosphate Deposition (CPPD) Fast Facts The risk of ... young people, too. Proper diagnosis depends on detecting calcium pyrophosphate crystals in the fluid of an affected ...
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
International Nuclear Information System (INIS)
Miah, M. Idrish
2008-01-01
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed
Directory of Open Access Journals (Sweden)
Ana Laura Sanchez-Sandoval
Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
International Nuclear Information System (INIS)
Fernsebner, M.
1981-01-01
It was the goal of this work to evaluate quantitatively the suitability of the radiation quality of tungsten, copper, titanium and scandium anodes for the generation of contrastful microradiographs and thus to increase the detection sensitivity of calcium. Halfwidth determinations were made with aluminium absorbers in air to characterize the different X-ray radiation qualities. Furthermore the dependence of the dose load of the absorber width and the type of the tube was determined in the radiation field for 20 kV anode voltage. Reference step-models were established in order to transfer these results to the calcium detection in microradiograph technology. (orig./HBR) [de
Thioredoxin h regulates calcium dependent protein kinases in plasma membranes.
Ueoka-Nakanishi, Hanayo; Sazuka, Takashi; Nakanishi, Yoichi; Maeshima, Masayoshi; Mori, Hitoshi; Hisabori, Toru
2013-07-01
Thioredoxin (Trx) is a key player in redox homeostasis in various cells, modulating the functions of target proteins by catalyzing a thiol-disulfide exchange reaction. Target proteins of cytosolic Trx-h of higher plants were studied, particularly in the plasma membrane, because plant plasma membranes include various functionally important protein molecules such as transporters and signal receptors. Plasma membrane proteins from Arabidopsis thaliana cell cultures were screened using a resin Trx-h1 mutant-immobilized, and a total of 48 candidate proteins obtained. These included two calcium-sensing proteins: a phosphoinositide-specific phospholipase 2 (AtPLC2) and a calcium-dependent protein kinase 21 (AtCPK21). A redox-dependent change in AtCPK21 kinase activity was demonstrated in vitro. Oxidation of AtCPK21 resulted in a decrease in kinase activity to 19% of that of untreated AtCPK21, but Trx-h1 effectively restored the activity to 90%. An intramolecular disulfide bond (Cys97-Cys108) that is responsible for this redox modulation was then identified. In addition, endogenous AtCPK21 was shown to be oxidized in vivo when the culture cells were treated with H2 O2 . These results suggest that redox regulation of AtCPK21 by Trx-h in response to external stimuli is important for appropriate cellular responses. The relationship between the redox regulation system and Ca(2+) signaling pathways is discussed. © 2013 The Authors. FEBS Journal published by John Wiley & Sons Ltd on behalf of FEBS.
Calcium carbonate scaling kinetics determined from radiotracer experiments with calcium-47
International Nuclear Information System (INIS)
Turner, C.W.; Smith, D.W.
1998-01-01
The deposition rate of calcium carbonate on a heat-transfer surface has been measured using a calcium-47 radiotracer and compared to the measured rate of thermal fouling. The crystalline phase of calcium carbonate that precipitates depends on the degree of supersaturation at the heat-transfer surface, with aragonite precipitating at higher supersaturations and calcite precipitating at lower supersaturations. Whereas the mass deposition rates were constant with time, the thermal fouling rates decreased throughout the course of each experiment as a result of densification of the deposit. It is proposed that the densification was driven by the temperature gradient across the deposit together with the retrograde solubility of calcium carbonate. The temperature dependence of the deposition rate yielded an activation energy of 79 ± 4 kJ/mol for the precipitation of calcium carbonate on a heat-transfer surface. (author)
Directory of Open Access Journals (Sweden)
Fernando Lazcano-Pérez
2016-05-01
Full Text Available The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7, voltage-gated calcium channel (CaV2.2, the A-type transient outward (IA and delayed rectifier (IDR currents of KV channels of the superior cervical ganglion (SCG neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.
Dharia, Sameera; Rabbitt, Richard D.
2011-01-01
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...
Tracy, Matthew E; Tesic, Vesna; Stamenic, Tamara Timic; Joksimovic, Srdjan M; Busquet, Nicolas; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M
2018-03-23
Recent data have implicated voltage-gated calcium channels in the regulation of the excitability of neurons within the mesolimbic reward system. While the attention of most research has centered on high voltage L-type calcium channel activity, the presence and role of the low voltage-gated T-type calcium channel (T-channels) has not been well explored. Hence, we investigated T-channel properties in the neurons of the ventral tegmental area (VTA) utilizing wild-type (WT) rats and mice, Ca V 3.1 knock-out (KO) mice, and TH-eGFP knock-in (KI) rats in acute horizontal brain slices of adolescent animals. In voltage-clamp experiments, we first assessed T-channel activity in WT rats with characteristic properties of voltage-dependent activation and inactivation, as well as characteristic crisscrossing patterns of macroscopic current kinetics. T-current kinetics were similar in WT mice and WT rats but T-currents were abolished in Ca V 3.1 KO mice. In ensuing current-clamp experiments, we observed the presence of hyperpolarization-induced rebound burst firing in a subset of neurons in WT rats, as well as dopaminergic and non-dopaminergic neurons in TH-eGFP KI rats. Following the application of a pan-selective T-channel blocker TTA-P2, rebound bursting was significantly inhibited in all tested cells. In a behavioral assessment, the acute locomotor increase induced by a MK-801 (Dizocilpine) injection in WT mice was abolished in Ca V 3.1 KO mice, suggesting a tangible role for 3.1 T-type channels in drug response. We conclude that pharmacological targeting of Ca V 3.1 isoform of T-channels may be a novel approach for the treatment of disorders of mesolimbic reward system. Copyright © 2018. Published by Elsevier Ltd.
Effect of HeNe laser on calcium signals in sperm cells
Lubart, Rachel; Friedmann, Harry; Cohen, Natalie; Brietbart, Haim
1998-12-01
Irradiation of mouse spermatozoa by 630 nm HeNe laser was found to enhance calcium transport in these cells. The change in Ca transport was investigated through two approaches, the first employing the fluorescent Ca indicator, Fluo-3 AM and a fluorescence microscopic system, and the second the radiolabeled Ca uptake. In both approaches the effect of light on Ca transport was abrogated in the absence of Ca during the irradiation time, indicating that the effect of light is Ca-dependent. The stimulatory effect of light on Ca uptake was inhibited by treatment with catalase, suggesting H2O2 to be involved in light stimulated Ca2+ uptake. The stimulatory effect of light on Ca uptake was abolished in the presence of a voltage-dependent Ca-channel inhibitor, nifedipine, indicating the involvement of a plasma membrane, voltage- dependent Ca-channel. In contrast, addition of nifedipine prior to the HeNe laser irradiation did not affect the light-induced rise in intracellular Ca levels, as measured with Fluo-3 loaded sperm cells. Therefore, it can be concluded that this Ca influx occurs via a voltage- insensitive Ca-channel. The stimulatory effect of light on Ca uptake was almost completely abolished by the mitochondrial uncoupler FCCP. These data imply that light affects the mitochondrial Ca transport mechanisms. It is well known that Ca influx from an extracellular environment is an essential component of a signaling cascade leading to fertilization.
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Directory of Open Access Journals (Sweden)
Urszula Krupa-Kozak
2017-07-01
Full Text Available In coeliac disease (CD, the risk of adverse calcium balance and reduced bone density is induced mainly by the disease, but also by a gluten-free diet (GFD, the only accepted CD therapy. Prebiotics through the beneficial impact on intestinal microbiota may stimulate calcium (Ca absorption. In the present study, we hypothesised that the dietary inulin in GFD would influence positively the intestinal microbiota, and by that will stimulate the absorption of calcium (Ca, especially in the conditions of Ca malnutrition. In a six-weeks nutritional experiment on growing a significant (p < 0.05 luminal acidification, decrease in ammonia concentration and stimulation of short chain fatty acids formation indicated inulin-mediated beneficial effects on the caecal microbiota. However, the effect of inulin on characteristics of intestinal microbiota and mineral utilization depended on the dietary Ca intake from GFDs. Inulin stimulated bifidobacteria, in particular B. animalis species, only if a recommended amount of Ca was provided. Most benefits to mineral utilization from inulin consumption were seen in rats fed Ca-restricted GFD where it increased the relative Ca absorption. Administration of inulin to a GFDs could be a promising dietary strategy for beneficial modulation of intestinal ecosystem and by that for the improvement the Ca absorption.
Krupa-Kozak, Urszula; Markiewicz, Lidia H; Lamparski, Grzegorz; Juśkiewicz, Jerzy
2017-07-06
In coeliac disease (CD), the risk of adverse calcium balance and reduced bone density is induced mainly by the disease, but also by a gluten-free diet (GFD), the only accepted CD therapy. Prebiotics through the beneficial impact on intestinal microbiota may stimulate calcium (Ca) absorption. In the present study, we hypothesised that the dietary inulin in GFD would influence positively the intestinal microbiota, and by that will stimulate the absorption of calcium (Ca), especially in the conditions of Ca malnutrition. In a six-weeks nutritional experiment on growing a significant ( p < 0.05) luminal acidification, decrease in ammonia concentration and stimulation of short chain fatty acids formation indicated inulin-mediated beneficial effects on the caecal microbiota. However, the effect of inulin on characteristics of intestinal microbiota and mineral utilization depended on the dietary Ca intake from GFDs. Inulin stimulated bifidobacteria, in particular B. animalis species, only if a recommended amount of Ca was provided. Most benefits to mineral utilization from inulin consumption were seen in rats fed Ca-restricted GFD where it increased the relative Ca absorption. Administration of inulin to a GFDs could be a promising dietary strategy for beneficial modulation of intestinal ecosystem and by that for the improvement the Ca absorption.
Nanosecond electric pulses modulate skeletal muscle calcium dynamics and contraction
Valdez, Chris; Jirjis, Michael B.; Roth, Caleb C.; Barnes, Ronald A.; Ibey, Bennett L.
2017-02-01
Irreversible electroporation therapy is utilized to remove cancerous tissues thru the delivery of rapid (250Hz) and high voltage (V) (1,500V/cm) electric pulses across microsecond durations. Clinical research demonstrated that bipolar (BP) high voltage microsecond pulses opposed to monophasic waveforms relieve muscle contraction during electroporation treatment. Our group along with others discovered that nanosecond electric pulses (nsEP) can activate second messenger cascades, induce cytoskeletal rearrangement, and depending on the nsEP duration and frequency, initiate apoptotic pathways. Of high interest across in vivo and in vitro applications, is how nsEP affects muscle physiology, and if nuances exist in comparison to longer duration electroporation applications. To this end, we exposed mature skeletal muscle cells to monopolar (MP) and BP nsEP stimulation across a wide range of electric field amplitudes (1-20 kV/cm). From live confocal microscopy, we simultaneously monitored intracellular calcium dynamics along with nsEP-induced muscle movement on a single cell level. In addition, we also evaluated membrane permeability with Yo-PRO-1 and Propidium Iodide (PI) across various nsEP parameters. The results from our findings suggest that skeletal muscle calcium dynamics, and nsEP-induced contraction exhibit exclusive responses to both MP and BP nsEP exposure. Overall the results suggest in vivo nsEP application may elicit unique physiology and field applications compared to longer pulse duration electroporation.
Gordon, J A; Cioffi, D; Silva, A J; Stryker, M P
1996-09-01
The recent characterization of plasticity in the mouse visual cortex permits the use of mutant mice to investigate the cellular mechanisms underlying activity-dependent development. As calcium-dependent signaling pathways have been implicated in neuronal plasticity, we examined visual cortical plasticity in mice lacking the alpha-isoform of calcium/calmodulin-dependent protein kinase II (alpha CaMKII). In wild-type mice, brief occlusion of vision in one eye during a critical period reduces responses in the visual cortex. In half of the alpha CaMKII-deficient mice, visual cortical responses developed normally, but visual cortical plasticity was greatly diminished. After intensive training, spatial learning in the Morris water maze was severely impaired in a similar fraction of mutant animals. These data indicate that loss of alpha CaMKII results in a severe but variable defect in neuronal plasticity.
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
Energy Technology Data Exchange (ETDEWEB)
Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au
2008-10-15
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.
Peters, Thies; WILFFERT, B; VANHOUTTE, PM; VANZWIETEN, PA
1991-01-01
Recent investigations of calcium channels in brain cells by voltage-clamp techniques have revealed that, in spite of electrophysiological similarities, the pharmacological properties of these channels differ considerably from channels in peripheral tissues, e.g., heart and smooth muscle. Therefore,
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Cantrell, A R; Scheuer, T; Catterall, W A
1999-07-01
Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.
Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.
Directory of Open Access Journals (Sweden)
Zhibin Hao
Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.
Directory of Open Access Journals (Sweden)
Ewa Nogaj
2011-03-01
Full Text Available The characteristic of occurrence calcium content in pharyngeal tonsils from 60 girls and 90 boys living in 9 region of Upper Silesia is presented in this article. Analysis of content of Ca in pharyngheal tonsils was observed in four groups of children: girls and boys exposed to tobacco smoke and unexposed to tabacco smoke, influence parameters environments on contents Ca in tissue tonsil and the cross-correlation analysis between content of ion Ca and other metals Al, Cd, Cu, Ni, Pb, Zn, Mg, Ba, showed repeating co-dependences between Ca in girls from Cd, Al., Zn, Ni, Pb. In case of boys colective dependence was been dependence Ca in Mg, Cd, Zn. Arithmetic mean of calcium in pharyngeal tonsils from exposed girls was 1345.00 µg/g, in comparison to unexposed girls 1292.88 µg/g, in exposed to tobacco smoke boys- 1832.63 µg/g and unexposed boys 565.05 µg/g. It turned out that gender perform important part in absorbed calcium and here noticeable was been big ability to concentrate toxic metals in girls
International Nuclear Information System (INIS)
Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.
2005-01-01
The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning
COPRAY, JCVM; MANTINGHOTTER, IJ; BROUWER, N
1994-01-01
In this study we have examined the calcium-binding protein expression in rat embryonic (E16) dorsal root ganglia (DRG) neurons in vitro in the presence of neurotrophin-3 (NT-3). A comparison was made with the expression of calcium-binding proteins in DRG subpopulations that depended in vitro on
International Nuclear Information System (INIS)
Fischer, T.H.; Campbell, K.P.; White, G.C. II
1987-01-01
The platelet and skeletal sarcoplasmic reticulum calcium-dependent adenosinetriphosphatases (Ca 2+ -ATPases) were functionally compared with respect to substrate activation by steady-state kinetic methods using the inhibitors quercetin and calmidazolium. Quercetin inhibited platelet and sarcoplasmic reticulum Ca 2+ -ATPase activities in a dose-dependent manner with IC 50 values of 25 and 10 μM, respectively. Calmidazolium also inhibited platelet and sarcoplasmic reticulum Ca 2+ -ATPase activities, with half-maximal inhibition measured at 5 and 4 μM, respectively. Both inhibitors also affected the [ 45 Ca] calcium transport activity of intact platelet microsomes at concentrations similar to those which reduced Ca 2+ -ATPase activity. These inhibitors were then used to examine substrate ligation by the platelet and sarcoplasmic reticulum calcium pump proteins. For both Ca 2+ -ATPase proteins, quercetin has an affinity for the E-Ca 2 (fully ligated with respect to calcium at the exterior high-affinity calcium binding sites, unligated with respect to ATP) conformational state of the protein that is approximately 10-fold grater than for other conformational states in the hydrolytic cycle. Quercetin can thus be considered a competitive inhibitor of the calcium pump proteins with respect to ATP. In contrast to the effect of quercetin, calmidazolium interacts with the platelet and sarcoplasmic reticulum Ca 2+ -ATPases in an uncompetitive manner. The dissociation constants for this inhibitor for the different conformational states of the calcium pump proteins were similar, indicating that calmidazolium has equal affinity for all of the reaction intermediates probed. These observations indicate that the substrate ligation processes are similar for the two pump proteins. This supports the concept that the hydrolytic cycles of the two proteins are comparable
DEFF Research Database (Denmark)
Bennekou, P.; Barksmann, T. L.; Christophersen, P.
2006-01-01
The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...
Veklich, T O; Mazur, Iu Iu; Kosterin, S O
2015-01-01
Tight control of cytoplasm Ca2+ concentration is essential in cell functioning. Changing of Ca2+ concentration is thorough in smooth muscle cells, because it determines relaxation/constraint process. One of key proteins which control Ca2+ concentration in cytoplasm is Mg2+, ATP-dependent plasma membrane calcium pump. Thus, it is important to find compoumds which allowed one to change Mg2+, ATP-dependent plasma membrane calcium pump activity, as long as this topic is of current interest in biochemical research which regards energy and pharmacomechanical coupling mechanism of muscle excitation and contraction. In this article we generalized literatute and own data about properties of smooth muscle cell plasma membrane Ca(2+)-pump. Stuctural oganization, kinetical properties and molecular biology are considered.
Sarcocystis neurona is the most frequent cause of Equine Protozoal Myeloencephalitis (EPM), a debilitating neurologic disease of horses that can be difficult to treat. We identified SnCDPK1, the S. neurona homologue of calcium dependent protein kinase 1 (CDPK1), a validated drug target in Toxoplasma...
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Mathematical investigation of IP3-dependent calcium dynamics in astrocytes.
Handy, Gregory; Taheri, Marsa; White, John A; Borisyuk, Alla
2017-06-01
We study evoked calcium dynamics in astrocytes, a major cell type in the mammalian brain. Experimental evidence has shown that such dynamics are highly variable between different trials, cells, and cell subcompartments. Here we present a qualitative analysis of a recent mathematical model of astrocyte calcium responses. We show how the major response types are generated in the model as a result of the underlying bifurcation structure. By varying key channel parameters, mimicking blockers used by experimentalists, we manipulate this underlying bifurcation structure and predict how the distributions of responses can change. We find that store-operated calcium channels, plasma membrane bound channels with little activity during calcium transients, have a surprisingly strong effect, underscoring the importance of considering these channels in both experiments and mathematical settings. Variation in the maximum flow in different calcium channels is also shown to determine the range of stable oscillations, as well as set the range of frequencies of the oscillations. Further, by conducting a randomized search through the parameter space and recording the resulting calcium responses, we create a database that can be used by experimentalists to help estimate the underlying channel distribution of their cells.
Muñoz, Pablo; Humeres, Alexis; Elgueta, Claudio; Kirkwood, Alfredo; Hidalgo, Cecilia; Núñez, Marco T
2011-04-15
Iron deficiency hinders hippocampus-dependent learning processes and impairs cognitive performance, but current knowledge on the molecular mechanisms underlying the unique role of iron in neuronal function is sparse. Here, we investigated the participation of iron on calcium signal generation and ERK1/2 stimulation induced by the glutamate agonist N-methyl-D-aspartate (NMDA), and the effects of iron addition/chelation on hippocampal basal synaptic transmission and long-term potentiation (LTP). Addition of NMDA to primary hippocampal cultures elicited persistent calcium signals that required functional NMDA receptors and were independent of calcium influx through L-type calcium channels or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors; NMDA also promoted ERK1/2 phosphorylation and nuclear translocation. Iron chelation with desferrioxamine or inhibition of ryanodine receptor (RyR)-mediated calcium release with ryanodine-reduced calcium signal duration and prevented NMDA-induced ERK1/2 activation. Iron addition to hippocampal neurons readily increased the intracellular labile iron pool and stimulated reactive oxygen species production; the antioxidant N-acetylcysteine or the hydroxyl radical trapper MCI-186 prevented these responses. Iron addition to primary hippocampal cultures kept in calcium-free medium elicited calcium signals and stimulated ERK1/2 phosphorylation; RyR inhibition abolished these effects. Iron chelation decreased basal synaptic transmission in hippocampal slices, inhibited iron-induced synaptic stimulation, and impaired sustained LTP in hippocampal CA1 neurons induced by strong stimulation. In contrast, iron addition facilitated sustained LTP induction after suboptimal tetanic stimulation. Together, these results suggest that hippocampal neurons require iron to generate RyR-mediated calcium signals after NMDA receptor stimulation, which in turn promotes ERK1/2 activation, an essential step of sustained LTP.
Calcium currents in a fast-twitch skeletal muscle of the rat.
Donaldson, P L; Beam, K G
1983-10-01
Slow ionic currents were measured in the rat omohyoid muscle with the three-microelectrode voltage-clamp technique. Sodium and delayed rectifier potassium currents were blocked pharmacologically. Under these conditions, depolarizing test pulses elicited an early outward current, followed by a transient slow inward current, followed in turn by a late outward current. The early outward current appeared to be a residual delayed rectifier current. The slow inward current was identified as a calcium current on the basis that (a) its magnitude depended on extracellular calcium concentration, (b) it was blocked by the addition of the divalent cations cadmium or nickel, and reduced in magnitude by the addition of manganese or cobalt, and (c) barium was able to replace calcium as an inward current carrier. The threshold potential for inward calcium current was around -20 mV in 10mM extracellular calcium and about -35 mV in 2 mM calcium. Currents were net inward over part of their time course for potentials up to at least +30 mV. At temperatures of 20-26 degrees C, the peak inward current (at approximately 0 mV) was 139 +/- 14 microA/cm2 (mean +/- SD), increasing to 226 +/- 28 microA/cm2 at temperatures of 27-37 degrees C. The late outward current exhibited considerable fiber-to-fiber variability. In some fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it was primarily a time-independent, nonlinear leakage current. In other fibers it appeared to be the sum of both leak and a slowly activated outward current. The rate of activation of inward calcium current was strongly temperature dependent. For example, in a representative fiber, the time-to-peak inward current for a +10-mV test pulse decreased from approximately 250 ms at 20 degrees C to 100 ms at 30 degrees C. At 37 degrees C, the time-to-peak current was typically approximately 25 ms. The earliest phase of activation was difficult to quantify because the ionic current was partially
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Directory of Open Access Journals (Sweden)
Alicia Lundby
2008-06-01
Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Study of calcium chloride and calcium nitrate purification on inorganic sorbents
International Nuclear Information System (INIS)
Vasil'eva, L.V.; Knyazeva, A.N.; Fakeev, A.A.; Belyaeva, N.A.; Morozov, V.I.; Kucherova, V.V.
1986-01-01
Purification of calcium chloride and calcium nitrate from iron, chromium, manganese and cobalt impurities by sorption on some inorganic collectors are considered in this article. Study was conducted by means of radioactive-tracer technique at concurrent use of several γ-radioactive isotopes. As a collectors were used hydrated aluminium and zirconium oxides. Dependence of effectiveness of precipitation by collectors on ph-value of medium, quantity of collector, nature and concentration of components is studied. Optimal parameters of purification of calcium chloride and calcium nitrate are defined.
ATP- and gap junction-dependent intercellular calcium signaling in osteoblastic cells
DEFF Research Database (Denmark)
Jorgensen, N R; Geist, S T; Civitelli, R
1997-01-01
mechanically induced calcium waves in two rat osteosarcoma cell lines that differ in the gap junction proteins they express, in their ability to pass microinjected dye from cell to cell, and in their expression of P2Y2 (P2U) purinergic receptors. ROS 17/2.8 cells, which express the gap junction protein......Many cells coordinate their activities by transmitting rises in intracellular calcium from cell to cell. In nonexcitable cells, there are currently two models for intercellular calcium wave propagation, both of which involve release of inositol trisphosphate (IP3)- sensitive intracellular calcium...... stores. In one model, IP3 traverses gap junctions and initiates the release of intracellular calcium stores in neighboring cells. Alternatively, calcium waves may be mediated not by gap junctional communication, but rather by autocrine activity of secreted ATP on P2 purinergic receptors. We studied...
International Nuclear Information System (INIS)
Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei
2015-01-01
The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)
Voltage Controlled Dynamic Demand Response
DEFF Research Database (Denmark)
Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...
DEFF Research Database (Denmark)
Hedegaard, Martina Vavrusova; Danielsen, Bente Pia; Garcia, André Castilho
2018-01-01
The sparingly soluble calcium hydrogenphosphate dihydrate, co-dissolving in water during dissolution of freely soluble sodium hydrogencitrate sesquihydrate as caused by proton transfer from hydrogencitrate to hydrogenphosphate, was found to form homogenous solutions supersaturated by a factor up...... to 8 in calcium citrate tetrahydrate. A critical hydrogencitrate concentration for formation of homogeneous solutions was found to depend linearly on dissolved calcium hydrogenphosphate: [HCitr2-] = 14[CaHPO4] - 0.05 at 25 °C. The lag phase for precipitation of calcium citrate tetrahydrate......, as identified from FT-IR spectra, from these spontaneously formed supersaturated solutions was several hours, and the time to reach solubility equilibrium was several days. Initial calcium ion activity was found to be almost independent of the degree of supersaturation as determined electrochemically...
Calcium binding by dietary fibre
International Nuclear Information System (INIS)
James, W.P.T.; Branch, W.J.; Southgate, D.A.T.
1978-01-01
Dietary fibre from plants low in phytate bound calcium in proportion to its uronic-acid content. This binding by the non-cellulosic fraction of fibre reduces the availability of calcium for small-intestinal absorption, but the colonic microbial digestion of uronic acids liberates the calcium. Thus the ability to maintain calcium balance on high-fibre diets may depend on the adaptive capacity on the colon for calcium. (author)
Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W
2016-02-01
Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.
Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco
2013-01-23
Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.
Voltage-gated lipid ion channels
DEFF Research Database (Denmark)
Blicher, Andreas; Heimburg, Thomas Rainer
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...
DEFF Research Database (Denmark)
Thuesen, Anne D; Andersen, Henrik; Cardel, Majken
2014-01-01
Voltage-gated calcium channels (Cav) play an essential role in regulation of renal blood flow and GFR. Because T-type Cavs are differentially expressed in pre- and postglomerular vessels it was hypothesized that they impact renal blood flow and GFR differentially. The question was addressed by use...... of two T-type Cav knock-out mice strains. Continuous recordings of blood pressure and heart rate, and para-aminohippurate clearance (renal plasma flow) and inulin clearance (GFR) were performed in conscious, chronically catheterized, wild type and Cav 3.1-/- and Cav 3.2-/- mice. Contractility of afferent...... and efferent arterioles was determined in isolated perfused blood vessels. Efferent arterioles from Cav 3.2-/- mice constricted significantly more in response to a depolarization compared to Wt mice. GFR was increased in Cav 3.2-/- mice with no significant changes in renal plasma flow, heart rate and blood...
International Nuclear Information System (INIS)
Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu
2015-01-01
Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)
International Nuclear Information System (INIS)
Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming
2013-01-01
Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)
Directory of Open Access Journals (Sweden)
See-Ziau Hoe
2011-01-01
Full Text Available INTRODUCTION: Gynura procumbens has been shown to decrease blood pressure via inhibition of the angiotensinconverting enzyme. However, other mechanisms that may contribute to the hypotensive effect have not been studied. OBJECTIVES: To investigate the cardiovascular effects of a butanolic fraction of Gynura procumbens in rats. METHODS: Anaesthetized rats were given intravenous bolus injections of butanolic fraction at doses of 2.5-20 mg/kg in vivo. The effect of butanolic fraction on vascular reactivity was recorded in isolated rat aortic rings in vitro. RESULTS: Intravenous administrations of butanolic fraction elicited significant (p<0.001 and dose-dependent decreases in the mean arterial pressure. However, a significant (p<0.05 decrease in the heart rate was observed only at the higher doses (10 and 20 mg/kg. In isolated preparations of rat aortic rings, phenylephrine (1×10-6 M- or potassium chloride (8×10-2 M-precontracted endothelium-intact and -denuded tissue; butanolic fraction (1×10-6-1×10-1 g/ml induced similar concentration-dependent relaxation of the vessels. In the presence of 2.5×10-3 and 5.0×10-3 g/ml butanolic fraction, the contractions induced by phenylephrine (1×10-9-3×10-5 M and potassium chloride (1×10-2-8×10-2 M were significantly antagonized. The calcium-induced vasocontractions (1×10-4-1×10-2 M were antagonized by butanolic fraction concentration-dependently in calcium-free and high potassium (6×10-2 M medium, as well as in calcium- and potassium-free medium containing 1×10-6 M phenylephrine. However, the contractions induced by noradrenaline (1×10-6 M and caffeine (4.5×10-2 M were not affected by butanolic fraction. CONCLUSION: Butanolic fraction contains putative hypotensive compounds that appear to inhibit calcium influx via receptor-operated and/or voltage-dependent calcium channels to cause vasodilation and a consequent fall in blood pressure.
Spyridopoulos, I; Wischhusen, J; Rabenstein, B; Mayer, P; Axel, D I; Fröhlich, K U; Karsch, K R
2001-03-01
Controversy exists about the net effect of alcohol on atherogenesis. A protective effect is assumed, especially from the tannins and phenolic compounds in red wine, owing to their inhibition of low density lipoprotein (LDL) oxidation. However, increased atherogenesis occurs in subjects with moderate to heavy drinking habits. The purpose of this study was to investigate the influence of alcohol in combination with oxysterols on the endothelium. Cultured human arterial endothelial cells (HAECs) served as an in vitro model to test the cellular effects of various oxysterols. Oxysterols (7beta-hydroxycholesterol, 7-ketocholesterol, and cholesterol-5,6-epoxides), which are assumed to be the most toxic constituents of oxidized LDL, induced apoptosis in HAECs through calcium mobilization followed by activation of caspase-3. Ethanol, methanol, isopropanol, tert-butanol, and red wine all potentiated oxysterol-induced cell death up to 5-fold, paralleled by further induction of caspase-3. The alcohol effect occurred in a dose-dependent manner and reached a plateau at 0.05% concentration. Alcohol itself did not affect endothelial cell viability, nor did other solvents such as dimethyl sulfoxide mimic the alcohol effect. So far as the physiologically occurring oxysterols are concerned, this effect was apparent only for oxysterols oxidized at the steran ring. The possibility of alcohol facilitating the uptake of oxysterols into the cell was not supported by the data from an uptake study with radiolabeled compounds. Finally, alcohol in combination with oxysterols did cause a dramatic increase in cytosolic calcium influx. Blockage of calcium influx by the calcium channel blocker aurintricarboxylic acid or the calcium chelator ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid abrogated the alcohol-mediated enhancement of oxysterol toxicity. We describe for the first time a mechanistic concept explaining possible adverse effects of alcohol in conjunction with
Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells
International Nuclear Information System (INIS)
Diserbo, M.; Barbier, M.; Quignard, J.F.
1998-01-01
Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)
International Nuclear Information System (INIS)
Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.
1988-01-01
The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns
Pharmacological analysis of calcium antagonist receptors
International Nuclear Information System (INIS)
Reynolds, I.J.
1987-01-01
This work focuses on two aspects of the action of calcium antagonist drugs, namely, the interaction of drugs with receptors for verapamil-like calcium antagonists, and the interactions of drugs with voltage-sensitive calcium fluxes in rat brain synaptosomes. From binding studies I have found that the ligand of choice for labeling the verapamil receptor is (-)[ 3 H]desmethoxy-verapamil. This drug labels potently, reversibly and stereoselectively two receptors in membranes prepared from rat brain and rabbit skeletal muscle tissues. In equilibrium studies dihydropyridine calcium antagonists interact in a non-competitive fashion, while many non-DHPs are apparently competitive. In-depth kinetic studies in skeletal muscle membranes indicate that the two receptors are linked in a negative heterotropic fashion, and that low-affinity binding of (-) [ 3 H]desmethoxy-verapamil may be to the diltiazem receptor. However, these studies were not able to distinguish between the hypothesis that diltiazem binds to spatially separate, allosterically coupled receptors, and the hypothesis that diltiazem binds to a subsite of the verapamil receptor
Wang, M S; Kurokawa, K
1981-11-05
Effect of Ca2+ and parathyroid hormone (PTH) on 14 CO2 production from certain metabolic substrates by isolated glomeruli of rat kidney were examined. Increasing calcium concentration in the incubation medium inhibited 14CO2 production from 14C-labeled alpha-ketoglutarate and succinate, stimulated 14CO2 production from [1-14C]glucose and [1-14C]glutamate, but was without effect on that from [6-14C]glucose. PTH in the presence but not in the absence of Ca2+ inhibited 14CO2 production from labeled alpha-ketoglutarate and glutamate but not from labeled glucose. Additions of cyclic AMP as well as hormonal agents known to act directly on the glomureli, such as histamine, epinephrine, prostaglandin E2, vasopressin, angiotensin II and insulin, did not alter 14 CO2 production from labeled alpha-ketoglutarate. These data show the presence of calcium-dependent inhibitory actions on PTH on oxidation of alpha-ketoglutarate and glutamate which may be independent of cyclic AMP. These metabolic effects of PTH may underlie the alteration in the glomerular ultrafiltration coefficient and glomerular filtration induced by the hormone.
Meredith, Rhiannon M.; van Ooyen, Arjen
2012-01-01
CA1 pyramidal neurons receive hundreds of synaptic inputs at different distances from the soma. Distance-dependent synaptic scaling enables distal and proximal synapses to influence the somatic membrane equally, a phenomenon called “synaptic democracy”. How this is established is unclear. The backpropagating action potential (BAP) is hypothesised to provide distance-dependent information to synapses, allowing synaptic strengths to scale accordingly. Experimental measurements show that a BAP evoked by current injection at the soma causes calcium currents in the apical shaft whose amplitudes decay with distance from the soma. However, in vivo action potentials are not induced by somatic current injection but by synaptic inputs along the dendrites, which creates a different excitable state of the dendrites. Due to technical limitations, it is not possible to study experimentally whether distance information can also be provided by synaptically-evoked BAPs. Therefore we adapted a realistic morphological and electrophysiological model to measure BAP-induced voltage and calcium signals in spines after Schaffer collateral synapse stimulation. We show that peak calcium concentration is highly correlated with soma-synapse distance under a number of physiologically-realistic suprathreshold stimulation regimes and for a range of dendritic morphologies. Peak calcium levels also predicted the attenuation of the EPSP across the dendritic tree. Furthermore, we show that peak calcium can be used to set up a synaptic democracy in a homeostatic manner, whereby synapses regulate their synaptic strength on the basis of the difference between peak calcium and a uniform target value. We conclude that information derived from synaptically-generated BAPs can indicate synapse location and can subsequently be utilised to implement a synaptic democracy. PMID:22719238
Regulation of cardiomyocyte autophagy by calcium.
Shaikh, Soni; Troncoso, Rodrigo; Criollo, Alfredo; Bravo-Sagua, Roberto; García, Lorena; Morselli, Eugenia; Cifuentes, Mariana; Quest, Andrew F G; Hill, Joseph A; Lavandero, Sergio
2016-04-15
Calcium signaling plays a crucial role in a multitude of events within the cardiomyocyte, including cell cycle control, growth, apoptosis, and autophagy. With respect to calcium-dependent regulation of autophagy, ion channels and exchangers, receptors, and intracellular mediators play fundamental roles. In this review, we discuss calcium-dependent regulation of cardiomyocyte autophagy, a lysosomal mechanism that is often cytoprotective, serving to defend against disease-related stress and nutrient insufficiency. We also highlight the importance of the subcellular distribution of calcium and related proteins, interorganelle communication, and other key signaling events that govern cardiomyocyte autophagy. Copyright © 2016 the American Physiological Society.
Calcium dependence of eugenol tolerance and toxicity in Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Stephen K Roberts
Full Text Available Eugenol is a plant-derived phenolic compound which has recognised therapeutical potential as an antifungal agent. However little is known of either its fungicidal activity or the mechanisms employed by fungi to tolerate eugenol toxicity. A better exploitation of eugenol as a therapeutic agent will therefore depend on addressing this knowledge gap. Eugenol initiates increases in cytosolic Ca2+ in Saccharomyces cerevisiae which is partly dependent on the plasma membrane calcium channel, Cch1p. However, it is unclear whether a toxic cytosolic Ca2+elevation mediates the fungicidal activity of eugenol. In the present study, no significant difference in yeast survival was observed following transient eugenol treatment in the presence or absence of extracellular Ca2+. Furthermore, using yeast expressing apoaequorin to report cytosolic Ca2+ and a range of eugenol derivatives, antifungal activity did not appear to be coupled to Ca2+ influx or cytosolic Ca2+ elevation. Taken together, these results suggest that eugenol toxicity is not dependent on a toxic influx of Ca2+. In contrast, careful control of extracellular Ca2+ (using EGTA or BAPTA revealed that tolerance of yeast to eugenol depended on Ca2+ influx via Cch1p. These findings expose significant differences between the antifungal activity of eugenol and that of azoles, amiodarone and carvacrol. This study highlights the potential to use eugenol in combination with other antifungal agents that exhibit differing modes of action as antifungal agents to combat drug resistant infections.
Unusual Voltage-Gated Sodium Currents as Targets for Pain.
Barbosa, C; Cummins, T R
2016-01-01
Pain is a serious health problem that impacts the lives of many individuals. Hyperexcitability of peripheral sensory neurons contributes to both acute and chronic pain syndromes. Because voltage-gated sodium currents are crucial to the transmission of electrical signals in peripheral sensory neurons, the channels that underlie these currents are attractive targets for pain therapeutics. Sodium currents and channels in peripheral sensory neurons are complex. Multiple-channel isoforms contribute to the macroscopic currents in nociceptive sensory neurons. These different isoforms exhibit substantial variations in their kinetics and pharmacology. Furthermore, sodium current complexity is enhanced by an array of interacting proteins that can substantially modify the properties of voltage-gated sodium channels. Resurgent sodium currents, atypical currents that can enhance recovery from inactivation and neuronal firing, are increasingly being recognized as playing potentially important roles in sensory neuron hyperexcitability and pain sensations. Here we discuss unusual sodium channels and currents that have been identified in nociceptive sensory neurons, describe what is known about the molecular determinants of the complex sodium currents in these neurons. Finally, we provide an overview of therapeutic strategies to target voltage-gated sodium currents in nociceptive neurons. Copyright © 2016 Elsevier Inc. All rights reserved.
InterProScan Result: DC542598 [KAIKOcDNA[Archive
Lifescience Database Archive (English)
Full Text Available DC542598 DC542598_2_ORF1 06AFB093ECA81E59 PANTHER PTHR11824 VOLTAGE-DEPENDENT CALCI...UM CHANNEL BETA SUBUNIT 9.9e-74 T IPR000584 Voltage-dependent calcium channel, L-type, beta subunit Molecular Function: volt
Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi
2009-01-01
Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...
Pavolucci, Lucia; Giannini, Giulia; Giannoccaro, Maria Pia; Foschini, Maria Pia; Lang, Bethan; Avoni, Patrizia; Tinuper, Paolo; Vincent, Angela; Liguori, Rocco
2017-11-01
Merkel cell carcinoma is a rare cutaneous, aggressive tumor. Although it shares many neuroendocrine features with small cell lung carcinoma, it has only occasionally been reported with paraneoplastic neurological syndromes. A healthy 67-year-old man developed acute ataxia, vertigo, and nausea. Subsequently he also developed dysarthria, diplopia, xerostomia, fatigability and progressive anorexia. He underwent a full diagnostic workup and was found to have a high titer of voltage-gated calcium channel antibodies in serum and cerebrospinal fluid, neurophysiological findings compatible with Lambert-Eaton myasthenia and neurological signs compatible with cerebellar degeneration. A positron emission tomography study revealed a hypermetabolic lesion in the axilla, subsequently biopsied and consistent with Merkel cell carcinoma. In most previous reports, neurological symptoms preceded the Merkel cell carcinoma diagnosis, and the primary localization was in lymph nodes. This tumor should be considered in patients with paraneoplastic syndrome, and particularly Lambert-Eaton myasthenia after exclusion of small cell lung carcinoma. Muscle Nerve 56: 998-1000, 2017. © 2016 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Matchkov, Vladimir; Aalkjær, Christian; Nilsson, Holger
2004-01-01
We have previously demonstrated the presence of a cyclic GMP (cGMP)-dependent calcium-activated inward current in vascular smooth-muscle cells, and suggested this to be of importance in synchronizing smooth-muscle contraction. Here we demonstrate the characteristics of this current. Using......M) in the pipette solution. The current was found to be a calcium-activated chloride current with an absolute requirement for cyclic GMP (EC50 6.4 microM). The current could be activated by the constitutively active subunit of PKG. Current activation was blocked by the protein kinase G antagonist Rp-8-Br-PET-cGMP...... differed from those of the calcium-activated chloride current in pulmonary myocytes, which was cGMP-independent, exhibited a high sensitivity to inhibition by niflumic acid, was unaffected by zinc ions, and showed outward current rectification as has previously been reported for this current. Under...
InterProScan Result: CK564775 [KAIKOcDNA[Archive
Lifescience Database Archive (English)
Full Text Available CK564775 CK564775_2_ORF2 26DFD9502C5FAF5B PANTHER PTHR11824 VOLTAGE-DEPENDENT CALCI...UM CHANNEL BETA SUBUNIT 4.6e-14 T IPR000584 Voltage-dependent calcium channel, L-type, beta subunit Molecular Function: volt
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
Findeisen, Felix; Campiglio, Marta; Jo, Hyunil; Abderemane-Ali, Fayal; Rumpf, Christine H; Pope, Lianne; Rossen, Nathan D; Flucher, Bernhard E; DeGrado, William F; Minor, Daniel L
2017-06-21
For many voltage-gated ion channels (VGICs), creation of a properly functioning ion channel requires the formation of specific protein-protein interactions between the transmembrane pore-forming subunits and cystoplasmic accessory subunits. Despite the importance of such protein-protein interactions in VGIC function and assembly, their potential as sites for VGIC modulator development has been largely overlooked. Here, we develop meta-xylyl (m-xylyl) stapled peptides that target a prototypic VGIC high affinity protein-protein interaction, the interaction between the voltage-gated calcium channel (Ca V ) pore-forming subunit α-interaction domain (AID) and cytoplasmic β-subunit (Ca V β). We show using circular dichroism spectroscopy, X-ray crystallography, and isothermal titration calorimetry that the m-xylyl staples enhance AID helix formation are structurally compatible with native-like AID:Ca V β interactions and reduce the entropic penalty associated with AID binding to Ca V β. Importantly, electrophysiological studies reveal that stapled AID peptides act as effective inhibitors of the Ca V α 1 :Ca V β interaction that modulate Ca V function in an Ca V β isoform-selective manner. Together, our studies provide a proof-of-concept demonstration of the use of protein-protein interaction inhibitors to control VGIC function and point to strategies for improved AID-based Ca V modulator design.
Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing
Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.
2013-01-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram
DEFF Research Database (Denmark)
Nielsen, S.K.; Noat, Y.; Brandbyge, Mads
2003-01-01
The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...
Opposing Roles of Calcium and Intracellular ATP on Gating of the Purinergic P2X2 Receptor Channel
Directory of Open Access Journals (Sweden)
Milos B. Rokic
2018-04-01
Full Text Available P2X2 receptors (P2X2R exhibit a slow desensitization during the initial ATP application and a progressive, calcium-dependent increase in rates of desensitization during repetitive stimulation. This pattern is observed in whole-cell recordings from cells expressing recombinant and native P2X2R. However, desensitization is not observed in perforated-patched cells and in two-electrode voltage clamped oocytes. Addition of ATP, but not ATPγS or GTP, in the pipette solution also abolishes progressive desensitization, whereas intracellular injection of apyrase facilitates receptor desensitization. Experiments with injection of alkaline phosphatase or addition of staurosporine and ATP in the intracellular solution suggest a role for a phosphorylation-dephosphorylation in receptor desensitization. Mutation of residues that are potential phosphorylation sites identified a critical role of the S363 residue in the intracellular ATP action. These findings indicate that intracellular calcium and ATP have opposing effects on P2X2R gating: calcium allosterically facilitates receptor desensitization and ATP covalently prevents the action of calcium. Single cell measurements further revealed that intracellular calcium stays elevated after washout in P2X2R-expressing cells and the blockade of mitochondrial sodium/calcium exchanger lowers calcium concentrations during washout periods to basal levels, suggesting a role of mitochondria in this process. Therefore, the metabolic state of the cell can influence P2X2R gating.
Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R
2016-09-01
The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
Calcium-Dependent Protein Kinases in Phytohormone Signaling Pathways
Directory of Open Access Journals (Sweden)
Wuwu Xu
2017-11-01
Full Text Available Calcium-dependent protein kinases (CPKs/CDPKs are Ca2+-sensors that decode Ca2+ signals into specific physiological responses. Research has reported that CDPKs constitute a large multigene family in various plant species, and play diverse roles in plant growth, development, and stress responses. Although numerous CDPKs have been exhaustively studied, and many of them have been found to be involved in plant hormone biosynthesis and response mechanisms, a comprehensive overview of the manner in which CDPKs participate in phytohormone signaling pathways, regulating nearly all aspects of plant growth, has not yet been undertaken. In this article, we reviewed the structure of CDPKs and the mechanism of their subcellular localization. Some CDPKs were elucidated to influence the intracellular localization of their substrates. Since little work has been done on the interaction between CDPKs and cytokinin signaling pathways, or on newly defined phytohormones such as brassinosteroids, strigolactones and salicylic acid, this paper mainly focused on discussing the integral associations between CDPKs and five plant hormones: auxins, gibberellins, ethylene, jasmonates, and abscisic acid. A perspective on future work is provided at the end.
Garg, A; Bonanome, A; Grundy, S M; Unger, R H; Breslau, N A; Pak, C Y
1990-04-01
Transient hypercalciuria has been noted after high carbohydrate meals which is independent of dietary calcium and is probably due to impaired renal calcium reabsorption mediated by an increase in plasma insulin levels. Based on these observations, some investigators believe that long term intake of high carbohydrate diets may increase the risk of nephrolithiasis and possibly osteoporosis. Using a randomized cross-over design, we compared high carbohydrate diets (60% carbohydrate and 25% fat) with high fat diets (50% fat and 35% carbohydrate) for effects on metabolism of calcium and other minerals in eight normal subjects and eight euglycemic patients with noninsulin-dependent diabetes mellitus. All other dietary constituents, such as protein, fiber, fluid, minerals (including Ca, Mg, Na, K, and P), and caffeine intake, were kept constant. Despite higher daylong levels of plasma insulin on the high carbohydrate diets compared to the high fat diet in both normal and noninsulin-dependent diabetic subjects, no changes in daily urinary excretion of calcium or other constituents, associated with renal stone risk, were observed. Furthermore, there was no change in fractional intestinal 47Ca absorption. Although hypercalciuria may ensue transiently after high carbohydrate meals, we conclude that substitution of simple or complex carbohydrates for fats in an isocaloric manner for a longer duration does not result in significant urinary calcium loss, and therefore, high intakes of digestible carbohydrates may not increase the risk of nephrolithiasis or osteoporosis via this mechanism.
Stefano, G B; Prevot, V; Beauvillain, J C; Fimiani, C; Welters, I; Cadet, P; Breton, C; Pestel, J; Salzet, M; Bilfinger, T V
1999-10-01
We tested the hypothesis that estrogen acutely stimulates constitutive NO synthase (cNOS) activity in human peripheral monocytes by acting on an estrogen surface receptor. NO release was measured in real time with an amperometric probe. 17beta-estradiol exposure to monocytes stimulated NO release within seconds in a concentration-dependent manner, whereas 17alpha-estradiol had no effect. 17beta-estradiol conjugated to BSA (E2-BSA) also stimulated NO release, suggesting mediation by a membrane surface receptor. Tamoxifen, an estrogen receptor inhibitor, antagonized the action of both 17beta-estradiol and E2-BSA, whereas ICI 182,780, a selective inhibitor of the nuclear estrogen receptor, had no effect. We further showed, using a dual emission microfluorometry in a calcium-free medium, that the 17beta-estradiol-stimulated release of monocyte NO was dependent on the initial stimulation of intracellular calcium transients in a tamoxifen-sensitive process. Leeching out the intracellular calcium stores abolished the effect of 17beta-estradiol on NO release. RT-PCR analysis of RNA obtained from the cells revealed a strong estrogen receptor-alpha amplification signal and a weak beta signal. Taken together, a physiological dose of estrogen acutely stimulates NO release from human monocytes via the activation of an estrogen surface receptor that is coupled to increases in intracellular calcium.
Flunarizine suppresses endothelial Angiopoietin-2 in a calcium - dependent fashion in sepsis.
Retzlaff, Jennifer; Thamm, Kristina; Ghosh, Chandra C; Ziegler, Wolfgang; Haller, Hermann; Parikh, Samir M; David, Sascha
2017-03-09
Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to an infection leading to systemic inflammation and endothelial barrier breakdown. The vascular-destabilizing factor Angiopoietin-2 (Angpt-2) has been implicated in these processes in humans. Here we screened in an unbiased approach FDA-approved compounds with respect to Angpt-2 suppression in endothelial cells (ECs) in vitro. We identified Flunarizine - a well-known anti-migraine calcium channel (CC) blocker - being able to diminish intracellular Angpt-2 protein in a time- and dose-dependent fashion thereby indirectly reducing the released protein. Moreover, Flunarizine protected ECs from TNFα-induced increase in Angpt-2 transcription and vascular barrier breakdown. Mechanistically, we could exclude canonical Tie2 signalling being responsible but found that three structurally distinct T-type - but not L-type - CC blockers can suppress Angpt-2. Most importantly, experimental increase in intracellular calcium abolished Flunarizine's effect. Flunarizine was also able to block the injurious increase of Angpt-2 in murine endotoxemia in vivo. This resulted in reduced pulmonary adhesion molecule expression (intercellular adhesion molecule-1) and tissue infiltration of inflammatory cells (Gr-1). Our finding could have therapeutic implications as side effects of Flunarizine are low and specific sepsis therapeutics that target the dysregulated host response are highly desirable.
Voltage stability in low voltage microgrids in aspects of active and reactive power demand
Directory of Open Access Journals (Sweden)
Parol Mirosław
2016-03-01
Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.
International Nuclear Information System (INIS)
Pe, T.; McDonald, J.; Clem, J.R.
1995-01-01
The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section
The α2δ subunit and absence epilepsy: Beyond calcium channels?
Celli, R.; Santolini, I.; Guiducci, M.; Luijtelaar, E.L.J.M. van; Parisi, P.; Striano, P.; Gradini, R.; Battaglia, G.; Ngomba, R.T.; Nicoletti, F.
2017-01-01
Spike-wave discharges, underlying absence seizures, are generated within a cortico-thalamo-cortical network that involves the somatosensory cortex, the reticular thalamic nucleus, and the ventrobasal thalamic nuclei. Activation of T-type voltage-sensitive calcium channels (VSCCs) contributes to the
Effect of applied voltage on phase components of composite coatings prepared by micro-arc oxidation
Energy Technology Data Exchange (ETDEWEB)
Zhu, Wenjun [Department of Prosthodontics, Guanghua School of Stomatology, Sun Yat-sen University, Guangzhou 510055 (China); Fang, Yu-Jing [Department of Colorectal Surgery, State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center, Guangzhou 510060 (China); Zheng, Huade [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); Tan, Guoxin [Guangdong University of Technology, Guangdong Province 510006 (China); Cheng, Haimei [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); Ning, Chengyun, E-mail: imcyning@scut.edu.cn [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China)
2013-10-01
In this report, we present results from our experiments on composite coatings formed on biomedical titanium substrates by micro-arc oxidation (MAO) in constant-voltage mode. The coatings were prepared on the substrates in an aqueous electrolyte containing calcium acetate and β-glycerol phosphate disodium salt pentahydrate (β-GP). We analyzed the element distribution and phase components of the coatings prepared at different voltages by X-ray diffraction, thin-coating X-ray diffraction, electron-probe microanalysis, and Fourier-transform infrared spectroscopy. The results show that the composite coatings formed at 500 V consist of titania (TiO{sub 2}), hydroxylapatite (HA), and calcium carbonate (CaCO{sub 3}). Furthermore, the concentration of Ca, P, and Ti gradually changes with increasing applied voltage, and the phase components of the composite coatings gradually change from the bottom of the coating to the top: the bottom layer consists of TiO{sub 2}, the middle layer consists of TiO{sub 2} and HA, and the top layer consists of HA and a small amount of CaCO{sub 3}. The formation of HA directly on the coating surface by MAO technique can greatly enhance the surface bioactivity. - Highlights: • Coatings prepared on biomedical titanium substrate by micro-arc oxidation • Coatings composed of titania, hydroxyapatite and calcium carbonate • Hydroxyapatite on the coating surface can enhance the surface bioactivity.
International Nuclear Information System (INIS)
Borle, A.B.
1990-01-01
An array of techniques can be used to study cell calcium metabolism that comprises several calcium compartments and many types of transport systems such as ion channels, ATP-dependent pumps, and antiporters. The measurement of total call calcium brings little information of value since 60 to 80% of total cell calcium is actually bound to the extracellular glycocalyx. Cell fractionation and differential centrifugation have been used to study intracellular Ca 2+ compartmentalization, but the methods suffer from the possibility of Ca 2+ loss or redistribution among cell fractions. Steady-state kinetic analyses of 45 Ca uptake or desaturation curves have been used to study the distribution of Ca 2+ among various kinetic pools in living cells and their rate of Ca 2+ exchange, but the analyses are constrained by many limitations. Nonsteady-state tracer studies can provide information about rapid changes in calcium influx or efflux in and out of the cell. Zero-time kinetics of 45 Ca uptake can detect instantaneous changes in calcium influx, while 45 Ca fractional efflux ratio, can detect rapid stimulations or inhibitions of calcium efflux out of cells. The best strategy to study cell calcium metabolism is to use several different methods that focus on a specific problem from widely different angles
Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.
2016-03-01
Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.
International Nuclear Information System (INIS)
Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L
2016-01-01
Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)
Lu, Y. T.; Hidaka, H.; Feldman, L. J.
1996-01-01
Roots of many species respond to gravity (gravitropism) and grow downward only if illuminated. This light-regulated root gravitropism is phytochrome-dependent, mediated by calcium, and inhibited by KN-93, a specific inhibitor of calcium/calmodulin-dependent protein kinase II (CaMK II). A cDNA encoding MCK1, a maize homolog of mammalian CaMK, has been isolated from roots of maize (Zea mays L.). The MCK1 gene is expressed in root tips, the site of perception for both light and gravity. Using the [35S]CaM gel-overlay assay we showed that calmodulin-binding activity of the MCK1 is abolished by 50 microM KN-93, but binding is not affected by 5 microM KN-93, paralleling physiological findings that light-regulated root gravitropism is inhibited by 50 microM KN-93, but not by 5 microM KN-93. KN-93 inhibits light-regulated gravitropism by interrupting transduction of the light signal, not light perception, suggesting that MCK1 may play a role in transducing light. This is the first report suggesting a physiological function for a CaMK homolog in light signal transduction.
Child, Matthew A.; Garland, Megan; Foe, Ian; Madzelan, Peter; Treeck, Moritz; van der Linden, Wouter A.; Oresic Bender, Kristina; Weerapana, Eranthie; Wilson, Mark A.; Boothroyd, John C.; Reese, Michael L.
2017-01-01
ABSTRACT Human DJ-1 is a highly conserved and yet functionally enigmatic protein associated with a heritable form of Parkinson’s disease. It has been suggested to be a redox-dependent regulatory scaffold, binding to proteins to modulate their function. Here we present the X-ray crystal structure of the Toxoplasma orthologue Toxoplasma gondii DJ-1 (TgDJ-1) at 2.1-Å resolution and show that it directly associates with calcium-dependent protein kinase 1 (CDPK1). The TgDJ-1 structure identifies an orthologously conserved arginine dyad that acts as a phospho-gatekeeper motif to control complex formation. We determined that the binding of TgDJ-1 to CDPK1 is sensitive to oxidation and calcium, and that this interaction potentiates CDPK1 kinase activity. Finally, we show that genetic deletion of TgDJ-1 results in upregulation of CDPK1 expression and that disruption of the CDPK1/TgDJ-1 complex in vivo prevents normal exocytosis of parasite virulence-associated organelles called micronemes. Overall, our data suggest that TgDJ-1 functions as a noncanonical kinase-regulatory scaffold that integrates multiple intracellular signals to tune microneme exocytosis in T. gondii. PMID:28246362
Calcium channel-dependent molecular maturation of photoreceptor synapses.
Directory of Open Access Journals (Sweden)
Nawal Zabouri
Full Text Available Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V1.4(α(1F knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V1.4(α(1F knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.
Calcium channel-dependent molecular maturation of photoreceptor synapses.
Zabouri, Nawal; Haverkamp, Silke
2013-01-01
Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V)1.4(α(1F)) knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V)1.4(α(1F)) knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V)1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V)1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V)1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.
Resting Tension Affects eNOS Activity in a Calcium-Dependent Way in Airways
Directory of Open Access Journals (Sweden)
Paschalis-Adam Molyvdas
2007-03-01
Full Text Available The alteration of resting tension (RT from 0.5 g to 2.5 g increased significantly airway smooth muscle contractions induced by acetylcholine (ACh in rabbit trachea. The decrease in extracellular calcium concentration [Ca2+]o from 2 mM to 0.2 mM reduced ACh-induced contractions only at 2.5 g RT with no effect at 0.5 g RT. The nonselective inhibitor of nitric oxide synthase (NOS, NG-nitro-L-arginine methyl ester (L-NAME increased ACh-induced contractions at 2.5 g RT. The inhibitor of inducible NOS, S-methylsothiourea or neuronal NOS, 7-nitroindazole had no effect. At 2.5 g RT, the reduction of [Ca2+]o from 2 mM to 0.2 mM abolished the effect of L-NAME on ACh-induced contractions. The NO precursor L-arginine or the tyrosine kinase inhibitors erbstatin A and genistein had no effect on ACh-induced contractions obtained at 2.5 g RT. Our results suggest that in airways, RT affects ACh-induced contractions by modulating the activity of epithelial NOS in a calcium-dependent, tyrosine-phosphorylation-independent way.
A membrane model for cytosolic calcium oscillations. A study using Xenopus oocytes.
Jafri, M S; Vajda, S; Pasik, P; Gillo, B
1992-01-01
Cytosolic calcium oscillations occur in a wide variety of cells and are involved in different cellular functions. We describe these calcium oscillations by a mathematical model based on the putative electrophysiological properties of the endoplasmic reticulum (ER) membrane. The salient features of our membrane model are calcium-dependent calcium channels and calcium pumps in the ER membrane, constant entry of calcium into the cytosol, calcium dependent removal from the cytosol, and buffering ...
Szentesi, Péter; Szappanos, Henrietta; Szegedi, Csaba; Gönczi, Monika; Jona, István; Cseri, Julianna; Kovács, László; Csernoch, László
2004-01-01
The effects of thymol on steps of excitation-contraction coupling were studied on fast-twitch muscles of rodents. Thymol was found to increase the depolarization-induced release of calcium from the sarcoplasmic reticulum, which could not be attributed to a decreased calcium-dependent inactivation of calcium release channels/ryanodine receptors or altered intramembrane charge movement, but rather to a more efficient coupling of depolarization to channel opening. Thymol increased ryanodine bind...
Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid
Directory of Open Access Journals (Sweden)
Galyna Maleeva
2017-05-01
Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.
Calas-List, Delphine; List, Olivier; Quinchard, Sophie; Thany, Steeve H
2013-07-01
Clothianidin is a neonicotinoid insecticide developed in the early 2000s. We have recently demonstrated that it was a full agonist of α-bungarotoxin-sensitive and -insensitive nicotinic acetylcholine receptors expressed in the cockroach dorsal unpaired median neurons. Clothianidin was able to act as an agonist of imidacloprid-insensitive nAChR2 receptor and internal regulation of cAMP concentration modulated nAChR2 sensitivity to clothianidin. In the present study, we demonstrated that cAMP modulated the agonist action of clothianidin via α-bungarotoxin-sensitive and insensitive receptors. Clothianidin-induced current-voltage curves were dependent to clothianidin concentrations. At 10 μM clothianidin, increasing cAMP concentration induced a linear current-voltage curve. Clothianidin effects were blocked by 0.5 μM α-bungarotoxin suggesting that cAMP modulation occurred through α-bungarotoxin-sensitive receptors. At 1 mM clothianidin, cAMP effects were associated to α-bungarotoxin-insensitive receptors because clothianidin-induced currents were blocked by 5 μM mecamylamine and 20 μM d-tubocurarine. In addition, we found that application of 1mM clothianidin induced a strong increase of intracellular calcium concentration. These data reinforced the finding that calcium pathways including cAMP modulated clothianidin action on insect nicotinic acetylcholine receptors. We proposed that intracellular calcium pathways such as cAMP could be a target to modulate the mode of action of neonicotinoid insecticides. Copyright © 2013 Elsevier Inc. All rights reserved.
Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors
International Nuclear Information System (INIS)
Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.
1993-01-01
The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature
Energy Technology Data Exchange (ETDEWEB)
Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)
2017-01-01
Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.
Ataei, Negar; Sabzghabaee, Ali Mohammad; Movahedian, Ahmad
2015-01-01
Background: Long-term memory is based on synaptic plasticity, a series of biochemical mechanisms include changes in structure and proteins of brain's neurons. In this article, we systematically reviewed the studies that indicate calcium/calmodulin kinase II (CaMKII) is a ubiquitous molecule among different enzymes involved in human long-term memory and the main downstream signaling pathway of long-term memory. Methods: All of the observational, case–control and review studies were considered and evaluated by the search engines PubMed, Cochrane Central Register of Controlled Trials and ScienceDirect Scopus between 1990 and February 2015. We did not carry out meta-analysis. Results: At the first search, it was fined 1015 articles which included “synaptic plasticity” OR “neuronal plasticity” OR “synaptic density” AND memory AND “molecular mechanism” AND “calcium/calmodulin-dependent protein kinase II” OR CaMKII as the keywords. A total of 335 articles were duplicates in the databases and eliminated. A total of 680 title articles were evaluated. Finally, 40 articles were selected as reference. Conclusions: The studies have shown the most important intracellular signal of long-term memory is calcium-dependent signals. Calcium linked calmodulin can activate CaMKII. After receiving information for learning and memory, CaMKII is activated by Glutamate, the most important neurotransmitter for memory-related plasticity. Glutamate activates CaMKII and it plays some important roles in synaptic plasticity modification and long-term memory. PMID:26445635
Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.
Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf
2006-03-01
We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.
Charge movement and depolarization-contraction coupling in arthropod vs. vertebrate skeletal muscle.
Scheuer, T; Gilly, W F
1986-01-01
Voltage-dependent charge movement has been characterized in arthropod skeletal muscle. Charge movement in scorpion (Centuroides sculpturatus) muscle is distinguishable from that in vertebrate skeletal muscle by criteria of kinetics, voltage dependence, and pharmacology. The function of scorpion charge movement is gating of calcium channels in the sarcolemma, and depolarization-contraction coupling relies on calcium influx through these channels.
Effect of oral calcium and calcium + fluoride treatments on mouse bone properties during suspension
Simske, S. J.; Luttges, M. W.; Allen, K. A.; Spooner, B. S. (Principal Investigator)
1992-01-01
The bone effects of oral dosages of calcium chloride with or without supplementary sodium fluoride were assessed in antiorthostatically suspended mice. Two calcium dosages were used to replace half (3.1 mM) or all(6.3 mM) of the dietary calcium lost due to reduced food intake by the suspended mice. Two groups of 6.3 mM CaCl2-treated mice were additionally treated with 0.25 or 2.5 mM NaF. The results indicate that supplementation of the mouse drinking water with calcium salts prevents bone changes induced by short-term suspension, while calcium salts in combination with fluoride are less effective as fluoride dosage increases. However, the calcium supplements change the relationship between the femur mechanical properties and the mineral composition of the bone. Because of this, it appears that oral calcium supplements are effective through a mechanism other than simple dietary supplementation and may indicate a dependence of bone consistency on systemic and local fluid conditions.
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
Calcium-regulated in vivo protein phosphorylation in Zea mays L. root tips
Raghothama, K. G.; Reddy, A. S.; Friedmann, M.; Poovaiah, B. W.
1987-01-01
Calcium dependent protein phosphorylation was studied in corn (Zea mays L.) root tips. Prior to in vivo protein phosphorylation experiments, the effect of calcium, ethyleneglycol-bis-(beta-aminoethyl ether)-N-N' -tetraacetic acid (EGTA) and calcium ionophore (A-23187) on phosphorus uptake was studied. Calcium increased phosphorus uptake, whereas EGTA and A-23187 decreased it. Consequently, phosphorus concentration in the media was adjusted so as to attain similar uptake in different treatments. Phosphoproteins were analyzed by two-dimensional gel electrophoresis. Distinct changes in phosphorylation were observed following altered calcium levels. Calcium depletion in root tips with EGTA and A-23187 decreased protein phosphorylation. However, replenishment of calcium following EGTA and ionophore pretreatment enhanced phosphorylation of proteins. Preloading of the root tips with 32P in the presence of EGTA and A-23187 followed by a ten minute calcium treatment, resulted in increased phosphorylation indicating the involvement of calcium, calcium and calmodulin-dependent kinases. Calmodulin antagonist W-7 was effective in inhibiting calcium-promoted phosphorylation. These studies suggest a physiological role for calcium-dependent phosphorylation in calcium-mediated processes in plants.
Zatz, M; Mullen, D A
1988-11-01
We have recently described a system, using dispersed chick pineal cells in static culture, which displays a persistent, photosensitive, circadian rhythm of melatonin production and release. Here, we describe the effects of nitrendipine (NTR) (a dihydropyridine 'antagonist' of L-type calcium channels), Bay K 8644 (BK) (a dihydropyridine calcium channel 'agonist'), cobalt and manganese ions (both inorganic calcium channel blockers), and low external calcium concentrations, on the melatonin rhythm. NTR inhibited and BK stimulated melatonin output; they were potent and effective. Co2+, Mn2+, and low external Ca2+ markedly inhibited melatonin output. These results support a role for calcium influx through voltage-dependent calcium channels (L-type) in the regulation of melatonin production. Four or 8 h pulses of white light or darkness, in otherwise constant red light, cause, in addition to acute effects, phase-dependent phase shifts of the melatonin rhythm in subsequent cycles. Such phase shifts indicate an effect on (proximal to) the pacemaker generating the rhythm. Four or 8 h pulses of NTR, BK, Co2+, or low Ca2+, however, did not appreciably alter the phase of subsequent melatonin cycles. Neither did BK interfere with phase shifts induced by light pulses. Mn2+ pulses did induce phase-dependent phase shifts, but, unlike those evoked by light or dark pulses, these were all delays. Such effects of Mn2+ in other systems have been attributed to, and are characteristic of, 'metabolic inhibitors'. On balance, the results fail to support a prominent role for calcium influx in regulating the pacemaker underlying the circadian rhythm in chick pineal cells. Rather, calcium influx appears to regulate melatonin production primarily by acting on the melatonin-synthesizing apparatus, distal to the pacemaker.
Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A
2017-05-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.
Phagocytosis-induced /sup 45/calcium efflux in polymorphonuclear leucocytes
Energy Technology Data Exchange (ETDEWEB)
Barthelemy, A; Schell-Frederick, E [Brussels Univ. (Belgium). Institut de Recherche Interdisciplinaire; Paridaens, R [Brussels Univ. (Belgium). Faculte de Medicine
1977-10-15
The role of calcium ions in regulating the structure and function of non-muscle cells is a subject of intense study. Several lines of evidence that calcium may be essential in the function of polymorphonuclear leuocytes (PMNL) and an important control element in the process of phagocytosis. Direct studies of calcium distribution and fluxes have only recently been undertaken. To our knowledge, no report of calcium movements during normal phagocytosis has been published. In the context of an overall study of calcium dynamics in the PMNL, we report here initial studies on /sup 45/Ca efflux in prelabelled guinea pig PMNL. The results demonstrate the energy-dependence of resting calcium efflux and an increased efflux upon addition of phagocytic particles which is not dependent on particle internalization.
Requirement for nuclear calcium signaling in Drosophila long-term memory.
Weislogel, Jan-Marek; Bengtson, C Peter; Müller, Michaela K; Hörtzsch, Jan N; Bujard, Martina; Schuster, Christoph M; Bading, Hilmar
2013-05-07
Calcium is used throughout evolution as an intracellular signal transducer. In the mammalian central nervous system, calcium mediates the dialogue between the synapse and the nucleus that is required for transcription-dependent persistent neuronal adaptations. A role for nuclear calcium signaling in similar processes in the invertebrate brain has yet to be investigated. Here, we show by in vivo calcium imaging of adult brain neurons of the fruit fly Drosophila melanogaster, that electrical foot shocks used in olfactory avoidance conditioning evoked transient increases in cytosolic and nuclear calcium concentrations in neurons. These calcium signals were detected in Kenyon cells of the flies' mushroom bodies, which are sites of learning and memory related to smell. Acute blockade of nuclear calcium signaling during conditioning selectively and reversibly abolished the formation of long-term olfactory avoidance memory, whereas short-term, middle-term, or anesthesia-resistant olfactory memory remained unaffected. Thus, nuclear calcium signaling is required in flies for the progression of memories from labile to transcription-dependent long-lasting forms. These results identify nuclear calcium as an evolutionarily conserved signal needed in both invertebrate and vertebrate brains for transcription-dependent memory consolidation.
DEFF Research Database (Denmark)
Garau, Gianpiero; Magotti, Paola; Heine, Martin
2015-01-01
Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
G Protein Regulation of Neuronal Calcium Channels: Back to the Future
Czech Academy of Sciences Publication Activity Database
Proft, Juliane; Weiss, Norbert
2015-01-01
Roč. 87, č. 6 (2015), s. 890-906 ISSN 0026-895X R&D Projects: GA ČR GA15-13556S Institutional support: RVO:61388963 Keywords : voltage gated calcium channels Cav * G proteins * GPCR Subject RIV: CE - Biochemistry Impact factor: 3.931, year: 2015
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
Energy Technology Data Exchange (ETDEWEB)
Grasso, P.; Santa-Coloma, T.A.; Reichert, L.E. Jr. (Department of Biochemistry, Albany Medical College, New York, NY (USA))
1991-06-01
We have previously described FSH receptor-mediated influx of 45Ca++ in cultured Sertoli cells from immature rats and receptor-enriched proteoliposomes via activation of voltage-sensitive and voltage-independent calcium channels. We have further shown that this effect of FSH does not require cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding protein or activation of adenylate cyclase. In the present study, we have identified regions of human FSH-beta-subunit which appear to be involved in mediating calcium influx. We screened 11 overlapping peptide amides representing the entire primary structure of hFSH-beta-subunit for their effects on 45Ca++ flux in FSH receptor-enriched proteoliposomes. hFSH-beta-(1-15) and hFSH-beta-(51-65) induced uptake of 45Ca++ in a concentration-related manner. This effect of hFSH-beta-(1-15) and hFSH-beta-(51-65) was also observed in liposomes lacking incorporated FSH receptor. Reducing membrane fluidity by incubating liposomes (containing no receptor) with hFSH-beta-(1-15) or hFSH-beta-(51-65) at temperatures lower than the transition temperatures of their constituent phospholipids resulted in no significant (P greater than 0.05) difference in 45Ca++ uptake. The effectiveness of the calcium ionophore A23187, however, was abolished. Ruthenium red, a voltage-independent calcium channel antagonist, was able to completely block uptake of 45Ca++ induced by hFSH-beta-(1-15) and hFSH-beta-(51-65) whereas nifedipine, a calcium channel blocker specific for L-type voltage-sensitive calcium channels, was without effect. These results suggest that in addition to its effect on voltage-sensitive calcium channel activity, interaction of FSH with its receptor may induce formation of transmembrane aqueous channels which also facilitate influx of extracellular calcium.
Directory of Open Access Journals (Sweden)
Rebecca Josowitz
2016-09-01
Full Text Available Germline mutations in BRAF cause cardio-facio-cutaneous syndrome (CFCS, whereby 40% of patients develop hypertrophic cardiomyopathy (HCM. As the role of the RAS/MAPK pathway in HCM pathogenesis is unclear, we generated a human induced pluripotent stem cell (hiPSC model for CFCS from three patients with activating BRAF mutations. By cell sorting for SIRPα and CD90, we generated a method to examine hiPSC-derived cell type-specific phenotypes and cellular interactions underpinning HCM. BRAF-mutant SIRPα+/CD90− cardiomyocytes displayed cellular hypertrophy, pro-hypertrophic gene expression, and intrinsic calcium-handling defects. BRAF-mutant SIRPα−/CD90+ cells, which were fibroblast-like, exhibited a pro-fibrotic phenotype and partially modulated cardiomyocyte hypertrophy through transforming growth factor β (TGFβ paracrine signaling. Inhibition of TGFβ or RAS/MAPK signaling rescued the hypertrophic phenotype. Thus, cell autonomous and non-autonomous defects underlie HCM due to BRAF mutations. TGFβ inhibition may be a useful therapeutic option for patients with HCM due to RASopathies or other etiologies.
Effect of selected factors on the current flow and voltage loss at ...
African Journals Online (AJOL)
In this paper, laboratory scale study was conducted to investigate the current flow and voltage loss at the electrodes in the electrochemical treatment of a tropical laterite. Three different tests using calcium chloride (CC) as anolyte and sodium chloride (SC) as catholyte (NC); SC as anolyte and Phosphoric acid (PA) as ...
Induction of divalent cation permeability by heterologous expression of a voltage sensor domain.
Arima, Hiroki; Tsutsui, Hidekazu; Sakamoto, Ayako; Yoshida, Manabu; Okamura, Yasushi
2018-01-06
The voltage sensor domain (VSD) is a protein domain that confers sensitivity to membrane potential in voltage-gated ion channels as well as the voltage-sensing phosphatase. Although VSDs have long been considered to function as regulatory units acting on adjacent effectors, recent studies have revealed the existence of direct ion permeation paths in some mutated VSDs and in the voltage-gated proton channel. In this study, we show that calcium currents are evoked upon membrane hyperpolarization in cells expressing a VSD derived from an ascidian voltage-gated ion channel superfamily. Unlike the previously reported omega-pore in the Shaker K + channel and rNav1.4, mutations are not required. From electrophysiological experiments in heterologous expression systems, we found that the conductance is directly mediated by the VSD itself and is carried by both monovalent and divalent cations. This is the first report of divalent cation permeation through a VSD-like structure. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)
2015-01-15
In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.
Intact calcium signaling in adrenergic-deficient embryonic mouse hearts.
Peoples, Jessica N; Taylor, David G; Katchman, Alexander N; Ebert, Steven N
2018-01-22
Mouse embryos that lack the ability to produce the adrenergic hormones, norepinephrine (NE) and epinephrine (EPI), due to disruption of the dopamine beta-hydroxylase (Dbh -/- ) gene inevitably perish from heart failure during mid-gestation. Since adrenergic stimulation is well-known to enhance calcium signaling in developing as well as adult myocardium, and impairments in calcium signaling are typically associated with heart failure, we hypothesized that adrenergic-deficient embryonic hearts would display deficiencies in cardiac calcium signaling relative to adrenergic-competent controls at a developmental stage immediately preceding the onset of heart failure, which first appears beginning or shortly after mouse embryonic day 10.5 (E10.5). To test this hypothesis, we used ratiometric fluorescent calcium imaging techniques to measure cytosolic calcium transients, [Ca 2+ ] i in isolated E10.5 mouse hearts. Our results show that spontaneous [Ca 2+ ] i oscillations were intact and robustly responded to a variety of stimuli including extracellular calcium (5 mM), caffeine (5 mM), and NE (100 nM) in a manner that was indistinguishable from controls. Further, we show similar patterns of distribution (via immunofluorescent histochemical staining) and activity (via patch-clamp recording techniques) for the major voltage-gated plasma membrane calcium channel responsible for the L-type calcium current, I Ca,L , in adrenergic-deficient and control embryonic cardiac cells. These results demonstrate that despite the absence of vital adrenergic hormones that consistently leads to embryonic lethality in vivo, intracellular and extracellular calcium signaling remain essentially intact and functional in embryonic mouse hearts through E10.5. These findings suggest that adrenergic stimulation is not required for the development of intracellular calcium oscillations or extracellular calcium signaling through I Ca,L and that aberrant calcium signaling does not likely contribute
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
Myoga, Michael H.; Regehr, Wade G.
2011-01-01
R-type calcium channels in postsynaptic spines signal through functional calcium microdomains to regulate a calcium-calmodulin sensitive potassium channel that in turn regulates postsynaptic hippocampal LTP. Here we ask whether R-type calcium channels in presynaptic terminals also signal through calcium microdomains to control presynaptic LTP. We focus on presynaptic LTP at parallel fiber to Purkinje cell synapses in the cerebellum (PF-LTP), which is mediated by calcium/calmodulin-stimulated adenylyl cyclases. Although most presynaptic calcium influx is through N-type and P/Q-type calcium channels, blocking these channels does not disrupt PF-LTP, but blocking R-type calcium channels does. Moreover, global calcium signaling cannot account for the calcium dependence of PF-LTP because R-type channels contribute modestly to overall calcium entry. These findings indicate that within presynaptic terminals, R-type calcium channels produce calcium microdomains that evoke presynaptic LTP at moderate frequencies that do not greatly increase global calcium levels,. PMID:21471358
Brain calcium - Role in temperature regulation.
Hanegan, J. L.; Williams, B. A.
1973-01-01
Perfusion of the preoptic-anterior hypothalamus with excess calcium ion in ground squirrels produces a drop in core temperature. The magnitude of the drop is directly dependent on ambient temperature. Respiration, heart rate, and oxygen consumption are also reduced during perfusion of calcium ion. It is concluded that the depression of body temperature during calcium ion perfusion is due to generalized depression of the neurons of the preoptic-anterior hypothalamus.
Cellular Architecture Regulates Collective Calcium Signaling and Cell Contractility.
Directory of Open Access Journals (Sweden)
Jian Sun
2016-05-01
Full Text Available A key feature of multicellular systems is the ability of cells to function collectively in response to external stimuli. However, the mechanisms of intercellular cell signaling and their functional implications in diverse vascular structures are poorly understood. Using a combination of computational modeling and plasma lithography micropatterning, we investigate the roles of structural arrangement of endothelial cells in collective calcium signaling and cell contractility. Under histamine stimulation, endothelial cells in self-assembled and microengineered networks, but not individual cells and monolayers, exhibit calcium oscillations. Micropatterning, pharmacological inhibition, and computational modeling reveal that the calcium oscillation depends on the number of neighboring cells coupled via gap junctional intercellular communication, providing a mechanistic basis of the architecture-dependent calcium signaling. Furthermore, the calcium oscillation attenuates the histamine-induced cytoskeletal reorganization and cell contraction, resulting in differential cell responses in an architecture-dependent manner. Taken together, our results suggest that endothelial cells can sense and respond to chemical stimuli according to the vascular architecture via collective calcium signaling.
Vereb, G; Szöllösi, J; Mátyus, L; Balázs, M; Hyun, W C; Feuerstein, B G
1996-05-01
Calcium signaling in non-excitable cells is the consequence of calcium release from intracellular stores, at times followed by entry of extracellular calcium through the plasma membrane. To study whether entry of calcium depends upon the level of saturation of intracellular stores, we measured calcium channel opening in the plasma membrane of single confluent A172 glioblastoma cells stimulated with platelet derived growth factor (PDGF) and/or bradykinin (BK). We monitored the entry of extracellular calcium by measuring manganese quenching of Indo-1 fluorescence. PDGF raised intracellular calcium concentration ([Ca2+]i) after a dose-dependent delay (tdel) and then opened calcium channels after a dose-independent delay (tch). At higher doses (> 3 nM), BK increased [Ca2+]i after a tdel approximately 0 s, and tch decreased inversely with both dose and peak [Ca2+]i. Experiments with thapsigargin (TG), BK, and PDGF indicated that BK and PDGF share intracellular Ca2+ pools that are sensitive to TG. When these stores were depleted by treatment with BK and intracellular BAPTA, tdel did not change, but tch fell to almost 0 s in PDGF stimulated cells, indicating that depletion of calcium stores affects calcium channel opening in the plasma membrane. Our data support the capacitative model for calcium channel opening and the steady-state model describing quantal Ca2+ release from intracellular stores.
Two Dimensional Finite Element Model to Study Calcium Distribution in Oocytes
Naik, Parvaiz Ahmad; Pardasani, Kamal Raj
2015-06-01
Cytosolic free calcium concentration is a key regulatory factor and perhaps the most widely used means of controlling cellular function. Calcium can enter cells through different pathways which are activated by specific stimuli including membrane depolarization, chemical signals and calcium depletion of intracellular stores. One of the important components of oocyte maturation is differentiation of the Ca2+ signaling machinery which is essential for egg activation after fertilization. Eggs acquire the ability to produce the fertilization-specific calcium signal during oocyte maturation. The calcium concentration patterns required during different stages of oocyte maturation are still not completely known. Also the mechanisms involved in calcium dynamics in oocyte cell are still not well understood. In view of above a two dimensional FEM model has been proposed to study calcium distribution in an oocyte cell. The parameters such as buffers, ryanodine receptor, SERCA pump and voltage gated calcium channel are incorporated in the model. Based on the biophysical conditions the initial and boundary conditions have been framed. The model is transformed into variational form and Ritz finite element method has been employed to obtain the solution. A program has been developed in MATLAB 7.10 for the entire problem and executed to obtain numerical results. The numerical results have been used to study the effect of buffers, RyR, SERCA pump and VGCC on calcium distribution in an oocyte cell.
ПАНЧЕНКО, В В
2015-01-01
The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...
Menezes-Rodrigues, Francisco Sandro; Pires-Oliveira, Marcelo; Duarte, Thiago; Paredes-Gamero, Edgar Julian; Chiavegatti, Tiago; Godinho, Rosely Oliveira
2013-11-15
Skeletal muscle contraction is triggered by acetylcholine induced release of Ca(2+) from sarcoplasmic reticulum. Although this signaling pathway is independent of extracellular Ca(2+), L-type voltage-gated calcium channel (Cav) blockers have inotropic effects on frog skeletal muscles which occur by an unknown mechanism. Taking into account that skeletal muscle fiber expresses Ca(+2)-sensitive adenylyl cyclase (AC) isoforms and that cAMP is able to increase skeletal muscle contraction force, we investigated the role of Ca(2+) influx on mouse skeletal muscle contraction and the putative crosstalk between extracellular Ca(2+) and intracellular cAMP signaling pathways. The effects of Cav blockers (verapamil and nifedipine) and extracellular Ca(2+) chelator EGTA were evaluated on isometric contractility of mouse diaphragm muscle under direct electrical stimulus (supramaximal voltage, 2 ms, 0.1 Hz). Production of cAMP was evaluated by radiometric assay while Ca(2+) transients were assessed by confocal microscopy using L6 cells loaded with fluo-4/AM. Ca(2+) channel blockers verapamil and nifedipine had positive inotropic effect, which was mimicked by removal of extracellular Ca(+2) with EGTA or Ca(2+)-free Tyrode. While phosphodiesterase inhibitor IBMX potentiates verapamil positive inotropic effect, it was abolished by AC inhibitors SQ22536 and NYK80. Finally, the inotropic effect of verapamil was associated with increased intracellular cAMP content and mobilization of intracellular Ca(2+), indicating that positive inotropic effects of Ca(2+) blockers depend on cAMP formation. Together, our results show that extracellular Ca(2+) modulates skeletal muscle contraction, through inhibition of Ca(2+)-sensitive AC. The cross-talk between extracellular calcium and cAMP-dependent signaling pathways appears to regulate the extent of skeletal muscle contraction responses. © 2013 Published by Elsevier B.V.
Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.
2013-11-01
As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.
International Nuclear Information System (INIS)
Garcia-Rates, Sara; Camarasa, Jordi; Sanchez-Garcia, Ana I.; Gandia, Luis; Escubedo, Elena; Pubill, David
2010-01-01
Previous work by our group demonstrated that homomeric α7 nicotinic acetylcholine receptors (nAChR) play a role in the neurotoxicity induced by 3,4-methylenedioxymethamphetamine (MDMA), as well as the binding affinity of this drug to these receptors. Here we studied the effect of MDMA on the activation of nAChR subtypes, the consequent calcium mobilization, and calpain/caspase 3 activation because prolonged Ca 2+ increase could contribute to cytotoxicity. As techniques, we used fluorimetry in Fluo-4-loaded PC12 cells and electrophysiology in Xenopus oocytes. MDMA produced a rapid and sustained increase in calcium without reaching the maximum effect induced by ACh. It also concentration-dependently inhibited the response induced by ACh, nicotine, and the specific α7 agonist PNU 282987 with IC 50 values in the low micromolar range. Similarly, MDMA induced inward currents in Xenopus oocytes transfected with human α7 but not with α4β2 nAChR and inhibited ACh-induced currents in both receptors in a concentration-dependent manner. The calcium response was inhibited by methyllycaconitine (MLA) and α-bungarotoxin but not by dihydro-β-erythroidine. These results therefore indicate that MDMA acts as a partial agonist on α7 nAChRs and as an antagonist on the heteromeric subtypes. Subsequently, calcium-induced Ca 2+ release from the endoplasmic reticulum and entry through voltage-operated calcium channels are also implicated as proved using specific antagonists. In addition, treatment with MDMA for 24 h significantly increased basal Ca 2+ levels and induced an increase in α-spectrin breakdown products, which indicates that calpain and caspase 3 were activated. These effects were inhibited by pretreatment with MLA. Moreover, pretreatment with MDMA induced functional upregulation of calcium responses to specific agonists of both heteromeric and α7 nAChR. Sustained calcium entry and calpain activation could favor the activation of Ca 2+ -dependent enzymes such as
International Nuclear Information System (INIS)
Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing
2010-01-01
The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
Annunziata, Giuseppe; Lobo, Pamela; Carbuccia, Cristian
2017-11-27
BACKGROUND Autoimmune cerebellar ataxia can be paraneoplastic in nature or can occasionally present without evidence of an ongoing malignancy. The detection of specific autoantibodies has been statistically linked to different etiologies. CASE REPORT A 55-year-old African-American woman with hypertension and a past history of morbid obesity and uncontrolled diabetes status post gastric bypass four years prior to the visit (with significantly improved body mass index and hemoglobin A1c controlled at the time of the clinical encounter) presented to the office complaining of gradual onset of unsteadiness and recurrent falls for the past three years, as well as difficulties coordinating routine daily activities. The neurologic exam showed moderate dysarthria and ataxic gait with bilateral dysmetria and positive Romberg test. Routine laboratory test results were only remarkable for a mild elevation of erythrocyte sedimentation rate, and most laboratory and imaging tests for common causes of ataxia failed to demonstrate an etiology. Upon further workup, evidence of anti-voltage-gated calcium channel and anti-glutamic acid decarboxylase antibody was demonstrated. She was then treated with intravenous immunoglobulins with remarkable clinical improvement. CONCLUSIONS We present a case of antibody-mediated ataxia not associated with malignancy. While ataxia is rarely related to autoantibodies, in such cases it is critical to understand the etiology of this disabling condition in order to treat it correctly. Clinicians should be aware of the possible association with specific autoantibodies and the necessity to rule out an occult malignancy in such cases.
Directory of Open Access Journals (Sweden)
Anne-Kathrin Theis
2018-04-01
Full Text Available The majority of excitatory synapses are located on dendritic spines of cortical glutamatergic neurons. In spines, compartmentalized Ca2+ signals transduce electrical activity into specific long-term biochemical and structural changes. Action potentials (APs propagate back into the dendritic tree and activate voltage gated Ca2+ channels (VGCCs. For spines, this global mode of spine Ca2+ signaling is a direct biochemical feedback of suprathreshold neuronal activity. We previously demonstrated that backpropagating action potentials (bAPs result in long-term enhancement of spine VGCCs. This activity-dependent VGCC plasticity results in a large interspine variability of VGCC Ca2+ influx. Here, we investigate how spine VGCCs affect glutamatergic synaptic transmission. We combined electrophysiology, two-photon Ca2+ imaging and two-photon glutamate uncaging in acute brain slices from rats. T- and R-type VGCCs were the dominant depolarization-associated Ca2+conductances in dendritic spines of excitatory layer 2 neurons and do not affect synaptic excitatory postsynaptic potentials (EPSPs measured at the soma. Using two-photon glutamate uncaging, we compared the properties of glutamatergic synapses of single spines that express different levels of VGCCs. While VGCCs contributed to EPSP mediated Ca2+ influx, the amount of EPSP mediated Ca2+ influx is not determined by spine VGCC expression. On a longer timescale, the activation of VGCCs by bAP bursts results in downregulation of spine NMDAR function.
Directory of Open Access Journals (Sweden)
Jader Santos Cruz
2012-10-01
Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.
Effect of calcium intake on urinary oxalate excretion in calcium stone-forming patients
Directory of Open Access Journals (Sweden)
Nishiura J.L.
2002-01-01
Full Text Available Dietary calcium lowers the risk of nephrolithiasis due to a decreased absorption of dietary oxalate that is bound by intestinal calcium. The aim of the present study was to evaluate oxaluria in normocalciuric and hypercalciuric lithiasic patients under different calcium intake. Fifty patients (26 females and 24 males, 41 ± 10 years old, whose 4-day dietary records revealed a regular low calcium intake (<=500 mg/day, received an oral calcium load (1 g/day for 7 days. A 24-h urine was obtained before and after load and according to the calciuria under both diets, patients were considered as normocalciuric (NC, N = 15, diet-dependent hypercalciuric (DDHC, N = 9 or diet-independent hypercalciuric (DIHC, N = 26. On regular diet, mean oxaluria was 30 ± 14 mg/24 h for all patients. The 7-day calcium load induced a significant decrease in mean oxaluria compared to the regular diet in NC and DIHC (20 ± 12 vs 26 ± 7 and 27 ± 18 vs 32 ± 15 mg/24 h, respectively, P<0.05 but not in DDHC patients (22 ± 10 vs 23 ± 5 mg/24 h. The lack of an oxalate decrease among DDHC patients after the calcium load might have been due to higher calcium absorption under higher calcium supply, with a consequent lower amount of calcium left in the intestine to bind with oxalate. These data suggest that a long-lasting regular calcium consumption <500 mg was not associated with high oxaluria and that a subpopulation of hypercalciuric patients who presented a higher intestinal calcium absorption (DDHC tended to hyperabsorb oxalate as well, so that oxaluria did not change under different calcium intake.
Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom.
Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R
2018-01-01
The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels
Voltage Unbalance Compensation with Smart Three-phase Loads
DEFF Research Database (Denmark)
Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig
2016-01-01
unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....
Nanou, Evanthia; Lee, Amy; Catterall, William A
2018-05-02
Activity-dependent regulation controls the balance of synaptic excitation to inhibition in neural circuits, and disruption of this regulation impairs learning and memory and causes many neurological disorders. The molecular mechanisms underlying short-term synaptic plasticity are incompletely understood, and their role in inhibitory synapses remains uncertain. Here we show that regulation of voltage-gated calcium (Ca 2+ ) channel type 2.1 (Ca V 2.1) by neuronal Ca 2+ sensor (CaS) proteins controls synaptic plasticity and excitation/inhibition balance in a hippocampal circuit. Prevention of CaS protein regulation by introducing the IM-AA mutation in Ca V 2.1 channels in male and female mice impairs short-term synaptic facilitation at excitatory synapses of CA3 pyramidal neurons onto parvalbumin (PV)-expressing basket cells. In sharp contrast, the IM-AA mutation abolishes rapid synaptic depression in the inhibitory synapses of PV basket cells onto CA1 pyramidal neurons. These results show that CaS protein regulation of facilitation and inactivation of Ca V 2.1 channels controls the direction of short-term plasticity at these two synapses. Deletion of the CaS protein CaBP1/caldendrin also blocks rapid depression at PV-CA1 synapses, implicating its upregulation of inactivation of Ca V 2.1 channels in control of short-term synaptic plasticity at this inhibitory synapse. Studies of local-circuit function revealed reduced inhibition of CA1 pyramidal neurons by the disynaptic pathway from CA3 pyramidal cells via PV basket cells and greatly increased excitation/inhibition ratio of the direct excitatory input versus indirect inhibitory input from CA3 pyramidal neurons to CA1 pyramidal neurons. This striking defect in local-circuit function may contribute to the dramatic impairment of spatial learning and memory in IM-AA mice. SIGNIFICANCE STATEMENT Many forms of short-term synaptic plasticity in neuronal circuits rely on regulation of presynaptic voltage-gated Ca 2+ (Ca V
Calcium movements and the cellular basis of gravitropism
Roux, S. J.; Biro, R. L.; Hale, C. C.
An early gravity-transduction event in oat coleoptiles which precedes any noticeable bending is the accumulation of calcium on their prospective slower-growing side. Sub-cellular calcium localization studies indicate that the gravity-stimulated redistribution of calcium results in an increased concentration of calcium in the walls of responding cells. Since calcium can inhibit the extension growth of plant cell walls, this selective accumulation of calcium in walls may play a role in inducing the asymmetry of growth which characterizes gravitropism. The active transport of calcium from cells into walls is performed by a calcium-dependent ATPase localized in the plasma membrane. Evidence is presented in support of the hypothesis that this calcium pump is regulated by a feed-back mechanism which includes the participation of calmodulin.
Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik
2018-05-01
Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely
Effect of a calcium cathode on water-based nanoparticulate solar cells
Vaughan, Ben; Stapleton, Andrew; Xue, Bofei; Sesa, Elisa; Zhou, Xiaojing; Bryant, Glenn; Belcher, Warwick; Dastoor, Paul
2012-07-01
Water-based nanoparticulate (NP) and bulk heterojunction (BHJ) organic photovoltaic (OPV) devices based on blends of poly(9,9-dioctylfluorene-co-N,N-bis(4-butylphenyl)-N,Ndiphenyl-1,4-phenylenediamine) (PFB) and poly(9,9-dioctylfluorene-co-benzothiadiazole (F8BT) have been fabricated with aluminium and calcium/aluminium cathodes. The NP devices exhibit power conversion efficiencies (PCEs) that are double that of the corresponding BHJ device. Moreover, the addition of calcium into the cathode structure results in a dramatic increase in open circuit voltage and PCEs approaching 1% for water-based polyfluorene OPV devices.
Directory of Open Access Journals (Sweden)
M. R. Aghamohammadi
2011-06-01
Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.
Nakao, Akito; Miki, Takafumi; Shoji, Hirotaka; Nishi, Miyuki; Takeshima, Hiroshi; Miyakawa, Tsuyoshi; Mori, Yasuo
2015-01-01
Calcium (Ca2+) influx through voltage-gated Ca2+ channels (VGCCs) induces numerous intracellular events such as neuronal excitability, neurotransmitter release, synaptic plasticity, and gene regulation. It has been shown that genes related to Ca2+ signaling, such as the CACNA1C, CACNB2, and CACNA1I genes that encode VGCC subunits, are associated with schizophrenia and other psychiatric disorders. Recently, VGCC beta-anchoring and -regulatory protein (BARP) was identified as a novel regulator of VGCC activity via the interaction of VGCC β subunits. To examine the role of the BARP in higher brain functions, we generated BARP knockout (KO) mice and conducted a comprehensive battery of behavioral tests. BARP KO mice exhibited greatly reduced locomotor activity, as evidenced by decreased vertical activity, stereotypic counts in the open field test, and activity level in the home cage, and longer latency to complete a session in spontaneous T-maze alteration test, which reached “study-wide significance.” Acoustic startle response was also reduced in the mutants. Interestingly, they showed multiple behavioral phenotypes that are seemingly opposite to those seen in the mouse models of schizophrenia and its related disorders, including increased working memory, flexibility, prepulse inhibition, and social interaction, and decreased locomotor activity, though many of these phenotypes are statistically weak and require further replications. These results demonstrate that BARP is involved in the regulation of locomotor activity and, possibly, emotionality. The possibility was also suggested that BARP KO mice may serve as a unique tool for investigating the pathogenesis/pathophysiology of schizophrenia and related disorders. Further evaluation of the molecular and physiological phenotypes of the mutant mice would provide new insights into the role of BARP in higher brain functions. PMID:26136667
Mechanism of electromechanical coupling in voltage-gated potassium channels
Directory of Open Access Journals (Sweden)
Rikard eBlunck
2012-09-01
Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels
International Nuclear Information System (INIS)
Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.
1986-01-01
Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel
Huang, Hsueh-Meei; Zhang, Hui; Xu, Hui; Gibson, Gary E
2003-01-20
Mitochondrial dysfunction occurs in many neurodegenerative diseases. The alpha-ketoglutarate dehydrogenase complex (KGDHC) catalyzes a key and arguably rate-limiting step of the tricarboxylic acid cycle (TCA). A reduction in the activity of the KGDHC occurs in brains and cells of patients with many of these disorders and may underlie the abnormal mitochondrial function. Abnormalities in calcium homeostasis also occur in fibroblasts from Alzheimer's disease (AD) patients and in cells bearing mutations that lead to AD. Thus, the present studies test whether the reduction of KGDHC activity can lead to the alterations in mitochondrial function and calcium homeostasis. alpha-Keto-beta-methyl-n-valeric acid (KMV) inhibits KGDHC activity in living N2a cells in a dose- and time-dependent manner. Surprisingly, concentration of KMV that inhibit in situ KGDHC by 80% does not alter the mitochondrial membrane potential (MMP). However, similar concentrations of KMV induce the release of cytochrome c from mitochondria into the cytosol, reduce basal [Ca(2+)](i) by 23% (Pcalcium release from the endoplasmic reticulum (ER) by 46% (P<0.005). This result suggests that diminished KGDHC activities do not lead to the Ca(2+) abnormalities in fibroblasts from AD patients or cells bearing PS-1 mutations. The increased release of cytochrome c with diminished KGDHC activities will be expected to activate other pathways including cell death cascades. Reductions in this key mitochondrial enzyme will likely make the cells more vulnerable to metabolic insults that promote cell death.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Calcium regulation and Alzheimer’s disease
Directory of Open Access Journals (Sweden)
Deepthi Rapaka
2014-09-01
Full Text Available Activation of the neuron induces transient fluctuations in [Ca2+]i. This transient rise in [Ca2+]i is dependent on calcium entry via calcium channels and release of calcium from intracellular stores, finally resulting in increase in calcium levels, which activates calcium regulatory proteins to restore the resting calcium levels by binding to the calcium-binding proteins, sequestration into the endoplasmic reticulum and the mitochondria, and finally extrusion of calcium spike potential from the cell by adenosine triphosphate-driven Ca2+ pumps and the Na+/Ca2+ exchanger. Improper regulation of calcium signaling, sequentially, likely contributes to synaptic dysfunction and excitotoxic and/or apoptotic death of the vulnerable neuronal populations. The cognitive decline associated with normal aging is not only due to neuronal loss, but is fairly the result of synaptic connectivity. Many evidences support that Ca2+ dyshomeostasis is implicated in normal brain aging. Thus the chief factor associated with Alzheimer’s disease was found to be increase in the levels of free intracellular calcium, demonstrating that the excessive levels might lead to cell death, which provides a key target for the calcium channel blockers might be used as the neuroprotective agents in Alzheimer’s disease.
Calcium-Responsive Liposomes via a Synthetic Lipid Switch.
Lou, Jinchao; Carr, Adam J; Watson, Alexa J; Mattern-Schain, Samuel I; Best, Michael D
2018-03-07
Liposomal drug delivery would benefit from enhanced control over content release. Here, we report a novel avenue for triggering release driven by chemical composition using liposomes sensitized to calcium-a target chosen due to its key roles in biology and disease. To demonstrate this principle, we synthesized calcium-responsive lipid switch 1, designed to undergo conformational changes upon calcium binding. The conformational change perturbs membrane integrity, thereby promoting cargo release. This was shown through fluorescence-based release assays via dose-dependent response depending on the percentage of 1 in liposomes, with minimal background leakage in controls. DLS experiments indicated dramatic changes in particle size upon treatment of liposomes containing 1 with calcium. In a comparison of ten naturally occurring metal cations, calcium provided the greatest release. Finally, STEM images showed significant changes in liposome morphology upon treatment of liposomes containing 1 with calcium. These results showcase lipid switches driven by molecular recognition principles as an exciting avenue for controlling membrane properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Santafe, M M; Garcia, N; Lanuza, M A; Tomàs, M; Besalduch, N; Tomàs, J
2009-04-01
We studied the relation among calcium inflows, voltage-dependent calcium channels (VDCC), presynaptic muscarinic acetylcholine receptors (mAChRs), and protein kinase C (PKC) activity in the modulation of synapse elimination. We used intracellular recording to determine the synaptic efficacy in dually innervated endplates of the levator auris longus muscle of newborn rats during axonal competition in the postnatal synaptic elimination period. In these dual junctions, the weak nerve terminal was potentiated by partially reducing calcium entry (P/Q-, N-, or L-type VDCC-specific block or 500 muM magnesium ions), M1- or M4-type selective mAChR block, or PKC block. Moreover, reducing calcium entry or blocking PKC or mAChRs results in unmasking functionally silent nerve endings that now recover neurotransmitter release. Our results show interactions between these molecules and indicate that there is a release inhibition mechanism based on an mAChR-PKC-VDCC intracellular cascade. When it is fully active in certain weak motor axons, it can depress ACh release and even disconnect synapses. We suggest that this mechanism plays a central role in the elimination of redundant neonatal synapses, because functional axonal withdrawal can indeed be reversed by mAChRs, VDCCs, or PKC block.
Directory of Open Access Journals (Sweden)
Mehrdad Roghani
2006-03-01
Full Text Available Some ion channels like voltage-operated calcium channels (VOCC within the plasma membrane of vascular muscle cells from the walls of resistance arteries and arterioles play a central role in the regulation of vascular tone. On the basis of reports about the beneficial attenuating effect of fenugreek (Trigonella foenum-graecum L.; TFG on the contractile reactivity of aortic rings of diabetic rats, this study was carried out to evaluate the possible involvement of L-type voltage-operated calcium channels in the vascular effect of this medicinal plant. For this purpose, male Wistar rats were made diabetic using streptozotocin (STZ, 60 mg/Kg, i.p. The extract-treated control and diabetic rats received aqueous leaf extract of TFG (200 mg/Kg, i.p. every other day for two months. At the end of the study, contractile response of isolated aortic rings to KCl and noreadrenaline (NA was determined in the absence and presence of the calcium channel blocker nifedipine. The results showed that aortic rings from diabetic rats are more responsive to the effect of KCl and NA than those of controls, TFG extract treatment could attenuate the enhanced contractile response of aortic rings of diabetic rats, and nifedipine pretreatment could partially neutralize the beneficial effect of this extract. It is concluded that TFG extract attenuates the enhanced vascular reactivity in chronic diabetic rats and voltage-operated calcium channels are in part responsible for this effect of TFG extract.
Speciation-dependent studies on removal of arsenic by iron-doped calcium alginate beads
International Nuclear Information System (INIS)
Banerjee, Anupam; Nayak, Dalia; Lahiri, Susanta
2007-01-01
This work aims to study the differential attitude of Fe-doped calcium alginate (Fe-CA) beads towards As(III) and As(V) compounds so that speciation-dependent environmentally sustainable methodologies can be developed for removal of arsenic from contaminated water. Throughout the experiment, 76 As has been used as precursor of stable arsenic. The affinity of As(V) towards the Fe-CA beads is greater than that of As(III). Removal efficiency of Fe-CA beads for As(V) increases with increasing number of beads and longer shaking times. At pH 3, 30 Fe-CA beads remove As(V) completely from a solution containing 20 mg kg -1 As(V). The technique has been successfully applied to the ground water collected from an arsenic-contaminated area
Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer
DEFF Research Database (Denmark)
Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev
1999-01-01
bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...
Proteomic Analysis of Calcium- and Phosphorylation-dependentCalmodulin Complexes in Mammalian Cells
Energy Technology Data Exchange (ETDEWEB)
Jang, Deok-Jin; Wang, Daojing
2006-05-26
Protein conformational changes due to cofactor binding (e.g. metal ions, heme) and/or posttranslational modifications (e.g. phosphorylation) modulate dynamic protein complexes. Calmodulin (CaM) plays an essential role in regulating calcium (Ca{sup 2+}) signaling and homeostasis. No systematic approach on the identification of phosphorylation-dependent Ca{sup 2+}/CaM binding proteins has been published. Herein, we report a proteome-wide study of phosphorylation-dependent CaM binding proteins from mammalian cells. This method, termed 'Dynamic Phosphoprotein Complex Trapping', 'DPPC Trapping' for short, utilizes a combination of in vivo and in vitro assays. The basic strategy is to drastically shift the equilibrium towards endogenous phosphorylation of Ser, Thr, and Tyr at the global scale by inhibiting corresponding phosphatases in vivo. The phosphorylation-dependent calmodulin-binding proteins are then trapped in vitro in a Ca{sup 2+}-dependent manner by CaM-Sepharose chromatography. Finally, the isolated calmodulin-binding proteins are separated by SDS-PAGE and identified by LC/MS/MS. In parallel, the phosphorylation-dependent binding is visualized by silver staining and/or Western blotting. Using this method, we selectively identified over 120 CaM-associated proteins including many previously uncharacterized. We verified ubiquitin-protein ligase EDD1, inositol 1, 4, 5-triphosphate receptor type 1 (IP{sub 3}R1), and ATP-dependent RNA helicase DEAD box protein 3 (DDX3), as phosphorylation-dependent CaM binding proteins. To demonstrate the utilities of our method in understanding biological pathways, we showed that pSer/Thr of IP{sub 3}R1 in vivo by staurosporine-sensitive kinase(s), but not by PKA/PKG/PKC, significantly reduced the affinity of its Ca{sup 2+}-dependent CaM binding. However, pSer/Thr of IP{sub 3}R1 did not substantially affect its Ca{sup 2+}-independent CaM binding. We further showed that phosphatase PP1, but not PP2A or PP2B
Ferron, Laurent; Nieto-Rostro, Manuela; Cassidy, John S.; Dolphin, Annette C.
2014-04-01
Fragile X syndrome (FXS), the most common heritable form of mental retardation, is characterized by synaptic dysfunction. Synaptic transmission depends critically on presynaptic calcium entry via voltage-gated calcium (CaV) channels. Here we show that the functional expression of neuronal N-type CaV channels (CaV2.2) is regulated by fragile X mental retardation protein (FMRP). We find that FMRP knockdown in dorsal root ganglion neurons increases CaV channel density in somata and in presynaptic terminals. We then show that FMRP controls CaV2.2 surface expression by targeting the channels to the proteasome for degradation. The interaction between FMRP and CaV2.2 occurs between the carboxy-terminal domain of FMRP and domains of CaV2.2 known to interact with the neurotransmitter release machinery. Finally, we show that FMRP controls synaptic exocytosis via CaV2.2 channels. Our data indicate that FMRP is a potent regulator of presynaptic activity, and its loss is likely to contribute to synaptic dysfunction in FXS.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)
2016-03-07
We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.
Seasonal Variations in Mercury's Dayside Calcium Exosphere
Burger, Matthew H.; Killen, Rosemary M.; McClintock, William E.; Merkel, Aimee W.; Vervack, Ronald J., Jr.; Cassidy, Timothy A.; Sarantos, Menelaos
2014-01-01
The Mercury Atmospheric and Surface Composition Spectrometer on the MESSENGER spacecraft has observed calcium emission in Mercury's exosphere on a near-daily basis since March 2011. During MESSENGER's primary and first extended missions (March 2011 - March 2013) the dayside calcium exosphere was measured over eight Mercury years. We have simulated these data with a Monte Carlo model of exospheric source processes to show that (a) there is a persistent source of energetic calcium located in the dawn equatorial region, (b) there is a seasonal dependence in the calcium source rate, and (c) there are no obvious year-to-year variations in the near-surface dayside calcium exosphere. Although the precise mechanism responsible for ejecting the calcium has not yet been determined, the most likely process is the dissociation of Ca-bearing molecules produced in micrometeoroid impact plumes to form energetic, escaping calcium atoms.
Origin of the transition voltage in gold–vacuum–gold atomic junctions
International Nuclear Information System (INIS)
Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano
2013-01-01
The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)
A voltage-gated H+ channel underlying pH homeostasis in calcifying coccolithophores.
Directory of Open Access Journals (Sweden)
Alison R Taylor
2011-06-01
Full Text Available Marine coccolithophorid phytoplankton are major producers of biogenic calcite, playing a significant role in the global carbon cycle. Predicting the impacts of ocean acidification on coccolithophore calcification has received much recent attention and requires improved knowledge of cellular calcification mechanisms. Uniquely amongst calcifying organisms, coccolithophores produce calcified scales (coccoliths in an intracellular compartment and secrete them to the cell surface, requiring large transcellular ionic fluxes to support calcification. In particular, intracellular calcite precipitation using HCO₃⁻ as the substrate generates equimolar quantities of H+ that must be rapidly removed to prevent cytoplasmic acidification. We have used electrophysiological approaches to identify a plasma membrane voltage-gated H+ conductance in Coccolithus pelagicus ssp braarudii with remarkably similar biophysical and functional properties to those found in metazoans. We show that both C. pelagicus and Emiliania huxleyi possess homologues of metazoan H(v1 H+ channels, which function as voltage-gated H+ channels when expressed in heterologous systems. Homologues of the coccolithophore H+ channels were also identified in a diversity of eukaryotes, suggesting a wide range of cellular roles for the H(v1 class of proteins. Using single cell imaging, we demonstrate that the coccolithophore H+ conductance mediates rapid H+ efflux and plays an important role in pH homeostasis in calcifying cells. The results demonstrate a novel cellular role for voltage gated H+ channels and provide mechanistic insight into biomineralisation by establishing a direct link between pH homeostasis and calcification. As the coccolithophore H+ conductance is dependent on the trans-membrane H+ electrochemical gradient, this mechanism will be directly impacted by, and may underlie adaptation to, ocean acidification. The presence of this H+ efflux pathway suggests that there is no obligate
Voltage-gated calcium channels of Paramecium cilia.
Lodh, Sukanya; Yano, Junji; Valentine, Megan S; Van Houten, Judith L
2016-10-01
Paramecium cells swim by beating their cilia, and make turns by transiently reversing their power stroke. Reversal is caused by Ca 2+ entering the cilium through voltage-gated Ca 2+ (Ca V ) channels that are found exclusively in the cilia. As ciliary Ca 2+ levels return to normal, the cell pivots and swims forward in a new direction. Thus, the activation of the Ca V channels causes cells to make a turn in their swimming paths. For 45 years, the physiological characteristics of the Paramecium ciliary Ca V channels have been known, but the proteins were not identified until recently, when the P. tetraurelia ciliary membrane proteome was determined. Three Ca V α1 subunits that were identified among the proteins were cloned and confirmed to be expressed in the cilia. We demonstrate using RNA interference that these channels function as the ciliary Ca V channels that are responsible for the reversal of ciliary beating. Furthermore, we show that Pawn (pw) mutants of Paramecium that cannot swim backward for lack of Ca V channel activity do not express any of the three Ca V 1 channels in their ciliary membrane, until they are rescued from the mutant phenotype by expression of the wild-type PW gene. These results reinforce the correlation of the three Ca V channels with backward swimming through ciliary reversal. The PwB protein, found in endoplasmic reticulum fractions, co-immunoprecipitates with the Ca V 1c channel and perhaps functions in trafficking. The PwA protein does not appear to have an interaction with the channel proteins but affects their appearance in the cilia. © 2016. Published by The Company of Biologists Ltd.
Gabapentin Modulates HCN4 Channel Voltage-Dependence
Directory of Open Access Journals (Sweden)
Han-Shen Tae
2017-08-01
Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.
Enhanced expression of a calcium-dependent protein kinase from ...
Indian Academy of Sciences (India)
Unknown
low calcium medium; LNM, low nitrate medium; LPM, low phosphate medium; LSM, low sulphate medium; MMG, minimal medium with glucose; NR, nitrate reductase; ORF, open reading frame; PCR, polymerase chain reaction; SnRK, sucrose non fer- menting ..... amino acids in contrast to the usual number of 31 in other.
Current–voltage characteristics of manganite–titanite perovskite junctions
Directory of Open Access Journals (Sweden)
Benedikt Ifland
2015-07-01
Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers
Directory of Open Access Journals (Sweden)
J. Koton
2011-04-01
Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.
The calcium oxide influence on formation of manganese, calcium pyrovanadate solid solutions
International Nuclear Information System (INIS)
Vatolin, N.A.; Volkova, P.I.; Sapozhnikova, T.V.; Ovchinnikova, L.A.
1988-01-01
The X-ray graphic, derivatographic, microscopic and chemical methods are used to study solid solutions of manganese, calcium pyrovanadates containing 1-10 mass% CaO and the products of interaction of reprocessing charges of vanadium-containing converter slags intended for he formation of manganese and calcium pyrovanadates with additions of calcium oxide within 10-90 mass%. It is established that in the case of 1-6 mass% CaO content in manganese pyrovanadate solid interstitial solutions appear, while at 6-20 mass% CaO - solid substitution solutions form. The results of calculating elementary cell parameters as well as melting temperatures and pyrovanadate solid solution solubility depending on CaO content are presented. The best solubility of introduction solid solutions during vanadium extraction according to the lime technology is found
Stewart, James R; Ecay, Tom W; Heulin, Benoit
2009-08-01
Embryos of oviparous squamate reptiles typically obtain calcium from both yolk and eggshell but differ from other oviparous amniotes (turtles, birds and crocodilians) because they are heavily dependent on calcium-rich yolk. Eggs of viviparous squamates lack calcareous eggshells, and embryos receive calcium solely from yolk or from both yolk and placenta. The pattern of calcium mobilization by amniote embryos has been predicted to influence the evolution of viviparity if embryos are dependent on calcium from the eggshell and calcium placentotrophy evolves subsequent to viviparity. We studied the pattern of maternal provision and embryonic utilization of calcium of an oviparous and a viviparous population of the reproductively bimodal lizard Lacerta vivipara to test the hypotheses: (1) oviparous embryos are not dependent on eggshell calcium and (2) calcium content of viviparous hatchlings does not differ from oviparous hatchlings. Our findings do not support either of these hypotheses because oviparous females oviposited eggs with heavily calcified shells and calcium-poor yolk, and embryonic mobilization of shell calcium was greater than for other oviparous squamates. The calcium content of yolk from viviparous females did not differ from oviparous yolk, but viviparous eggs lacked calcareous eggshells. Uterine secretion by viviparous females compensated for the low calcium content of yolk, and placental calcium transfer was among the highest recorded for squamates. The pattern of calcium provision in these two populations suggests that dependence on uterine calcium, either stored temporarily in an eggshell or transferred directly across a placenta, did not constrain the evolution of reproductive mode in this lineage.
Parody, Nuria; Fuertes, Miguel Angel; Alonso, Carlos; Pico de Coaña, Yago
2013-01-01
The polcalcin family is one of the most epidemiologically relevant families of calcium-binding allergens. Polcalcins are potent plant allergens that contain one or several EF-hand motifs and their allergenicity is primarily associated with the Ca(2+)-bound form of the protein. Conformation, stability, as well as IgE recognition of calcium-binding allergens greatly depend on the presence of protein-bound calcium ions. We describe a protocol that uses three techniques (SDS-PAGE, circular dichroism spectroscopy, and ELISA) to describe the effects that calcium has on the structural changes in an allergen and its IgE binding properties.
Origin of the transition voltage in gold–vacuum–gold atomic junctions
Wu, Kunlin
2012-12-13
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays
International Nuclear Information System (INIS)
Hebboul, S.E.; Garland, J.C.
1993-01-01
We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations
C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.
Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer
2013-09-01
Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.
Masetto, Sergio; Zampini, Valeria; Zucca, Giampiero; Valli, Paolo
2005-11-01
Type I and Type II hair cells, and Type II hair cells located in different zones of the semicircular canal crista, express different patterns of voltage-dependent K channels, each one specifically shaping the hair cell receptor potential. We report here that, close to hatching, chicken embryo semicircular canal Type I and Type II hair cells express a similar voltage-dependent L-type calcium current (I(Ca)), whose main features are: activation above -60 mV, fast activation kinetics, and scarce inactivation. I(Ca) should be already active at rest in Zone 1 Type II hair cells, whose resting membrane potential was on average slightly less negative than -60 mV. Conversely, I(Ca) would not be active at rest in Type II hair cells from Zone 2 and 3, nor in Type I hair cells, since their resting membrane potential was significantly more negative than -60 mV. However, even small depolarising currents would activate I(Ca) steadily in Zone 2 and 3 Type II hair cells, but not in Type I hair cells because of the robust repolarising action of their specific array of K(+) currents. The implications of the present findings in the afferent discharge are discussed.
Directory of Open Access Journals (Sweden)
Chih-Yang Wang
Full Text Available Voltage-gated calcium channels (VGCCs are well documented to play roles in cell proliferation, migration, and apoptosis; however, whether VGCCs regulate the onset and progression of cancer is still under investigation. The VGCC family consists of five members, which are L-type, N-type, T-type, R-type and P/Q type. To date, no holistic approach has been used to screen VGCC family genes in different types of cancer. We analyzed the transcript expression of VGCCs in clinical cancer tissue samples by accessing ONCOMINE (www.oncomine.org, a web-based microarray database, to perform a systematic analysis. Every member of the VGCCs was examined across 21 different types of cancer by comparing mRNA expression in cancer to that in normal tissue. A previous study showed that altered expression of mRNA in cancer tissue may play an oncogenic role and promote tumor development; therefore, in the present findings, we focus only on the overexpression of VGCCs in different types of cancer. This bioinformatics analysis revealed that different subtypes of VGCCs (CACNA1C, CACNA1D, CACNA1B, CACNA1G, and CACNA1I are implicated in the development and progression of diverse types of cancer and show dramatic up-regulation in breast cancer. CACNA1F only showed high expression in testis cancer, whereas CACNA1A, CACNA1C, and CACNA1D were highly expressed in most types of cancer. The current analysis revealed that specific VGCCs likely play essential roles in specific types of cancer. Collectively, we identified several VGCC targets and classified them according to different cancer subtypes for prospective studies on the underlying carcinogenic mechanisms. The present findings suggest that VGCCs are possible targets for prospective investigation in cancer treatment.
Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.
Directory of Open Access Journals (Sweden)
Paula L Diaz-Sylvester
Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.
Simulation of forward dark current voltage characteristics of tandem solar cells
International Nuclear Information System (INIS)
Rubinelli, F.A.
2012-01-01
The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the
Directory of Open Access Journals (Sweden)
Kota Kasahara
Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.
Energy Technology Data Exchange (ETDEWEB)
Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)
2007-04-30
The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.
Role of T-type calcium channels in myogenic tone of skeletal muscle resistance arteries
DEFF Research Database (Denmark)
VanBavel, Ed; Sorop, Oana; Andreasen, Ditte
2002-01-01
T-type calcium channels may be involved in the maintenance of myogenic tone. We tested their role in isolated rat cremaster arterioles obtained after CO(2) anesthesia and decapitation. Total RNA was analyzed by RT-PCR and Southern blotting for calcium channel expression. We observed expression...... of voltage-operated calcium (Ca(V)) channels Ca(V)3.1 (T-type), Ca(V)3.2 (T-type), and Ca(V)1.2 (L-type) in cremaster arterioles (n = 3 rats). Amplification products were observed only in the presence of reverse transcriptase and cDNA. Concentration-response curves of the relatively specific L-type blocker......); K(+) -5.4 +/- 0.3 (n = 4); all log(IC(50)) P maintenance of myogenic tone in rat cremaster muscle arterioles....
Intermediate state trapping of a voltage sensor
DEFF Research Database (Denmark)
Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca
2012-01-01
Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...
Duicu, Oana M; Privistirescu, Andreea; Wolf, Adrian; Petruş, Alexandra; Dănilă, Maria D; Raţiu, Corina D; Muntean, Danina M; Sturza, Adrian
2017-11-01
Diabetic cardiomyopathy has been systematically associated with compromised mitochondrial energetics and increased generation of reactive oxygen species (ROS) that underlie its progression to heart failure. Methylene blue is a redox drug with reported protective effects mainly on brain mitochondria. The purpose of the present study was to characterize the effects of acute administration of methylene blue on mitochondrial respiration, H 2 O 2 production, and calcium sensitivity in rat heart mitochondria isolated from healthy and 2 months (streptozotocin-induced) diabetic rats. Mitochondrial respiratory function was assessed by high-resolution respirometry. H 2 O 2 production and calcium retention capacity were measured spectrofluorimetrically. The addition of methylene blue (0.1 μmol·L -1 ) elicited an increase in oxygen consumption of mitochondria energized with complex I and II substrates in both normal and diseased mitochondria. Interestingly, methylene blue elicited a significant increase in H 2 O 2 release in the presence of complex I substrates (glutamate and malate), but had an opposite effect in mitochondria energized with complex II substrate (succinate). No changes in the calcium retention capacity of healthy or diabetic mitochondria were found in the presence of methylene blue. In conclusion, in cardiac mitochondria isolated from diabetic and nondiabetic rat hearts, methylene blue improved respiratory function and elicited a dichotomic, substrate-dependent effect on ROS production.
Parrott, Andrew C; Hayley, Amie C; Downey, Luke A
2017-05-01
Recreational drugs are taken for their positive mood effects, yet their regular usage damages well-being. The psychobiological mechanisms underlying these damaging effects will be debated. The empirical literature on recreational cannabinoids and stimulant drugs is reviewed. A theoretical explanation for how they cause similar types of damage is outlined. All psychoactive drugs cause moods and psychological states to fluctuate. The acute mood gains underlie their recreational usage, while the mood deficits on withdrawal explain their addictiveness. Cyclical mood changes are found with every central nervous system stimulant and also occur with cannabis. These mood state changes provide a surface index for more profound psychobiological fluctuations. Homeostatic balance is altered, with repetitive disturbances of the hypothalamic-pituitary-adrenal axis, and disrupted cortisol-neurohormonal secretions. Hence, these drugs cause increased stress, disturbed sleep, neurocognitive impairments, altered brain activity, and psychiatric vulnerability. Equivalent deficits occur with novel psychoactive stimulants such as mephedrone and artificial "spice" cannabinoids. These psychobiological fluctuations underlie drug dependency and make cessation difficult. Psychobiological stability and homeostatic balance are optimally restored by quitting psychoactive drugs. Recreational stimulants such as cocaine or MDMA (3.4-methylenedioxymethamphetamine) and sedative drugs such as cannabis damage human homeostasis and well-being through similar core psychobiological mechanisms. Copyright © 2017 John Wiley & Sons, Ltd.
Lembke, Kayly M; Scudder, Charles; Morton, David B
2017-09-27
Defects in the RNA-binding protein, TDP-43, are known to cause a variety of neurodegenerative diseases, including amyotrophic lateral sclerosis and frontotemporal lobar dementia. A variety of experimental systems have shown that neurons are sensitive to TDP-43 expression levels, yet the specific functional defects resulting from TDP-43 dysregulation have not been well described. Using the Drosophila TDP-43 ortholog TBPH, we previously showed that TBPH-null animals display locomotion defects as third instar larvae. Furthermore, loss of TBPH caused a reduction in cacophony , a Type II voltage-gated calcium channel, expression and that genetically restoring cacophony in motor neurons in TBPH mutant animals was sufficient to rescue the locomotion defects. In the present study, we examined the relative contributions of neuromuscular junction physiology and the motor program to the locomotion defects and identified subsets of neurons that require cacophony expression to rescue the defects. At the neuromuscular junction, we showed mEPP amplitudes and frequency require TBPH. Cacophony expression in motor neurons rescued mEPP frequency but not mEPP amplitude. We also showed that TBPH mutants displayed reduced motor neuron bursting and coordination during crawling and restoring cacophony selectively in two pairs of cells located in the brain, the AVM001b/2b neurons, also rescued the locomotion and motor defects, but not the defects in neuromuscular junction physiology. These results suggest that the behavioral defects associated with loss of TBPH throughout the nervous system can be associated with defects in a small number of genes in a limited number of central neurons, rather than peripheral defects. SIGNIFICANCE STATEMENT TDP-43 dysfunction is a common feature in neurodegenerative diseases, including amyotrophic lateral sclerosis, frontotemporal lobar dementia, and Alzheimer's disease. Loss- and gain-of-function models have shown that neurons are sensitive to TDP-43
Factors to consider in the selection of a calcium supplement.
Shangraw, R F
1989-01-01
Calcium supplements are widely used, yet many questions remain as to the absorption of various calcium salts. Because the solubility of many calcium salts is dependent upon pH, the type of salt used, the condition of the patient, and the time of administration should be considered. Studies show that many calcium supplements on the market today do not meet standards of quality established in the "U.S. Pharmacopeia" (USP). Consumers must be discerning about the products they purchase. Calcium s...
Nonlinear electrokinetics at large voltages
Energy Technology Data Exchange (ETDEWEB)
Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu
2009-07-15
The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.
Directory of Open Access Journals (Sweden)
Makoto Takahashi
Full Text Available The human α1A voltage-dependent calcium channel (Cav2.1 is a pore-forming essential subunit embedded in the plasma membrane. Its cytoplasmic carboxyl(C-tail contains a small poly-glutamine (Q tract, whose length is normally 4∼19 Q, but when expanded up to 20∼33Q, the tract causes an autosomal-dominant neurodegenerative disorder, spinocerebellar ataxia type 6 (SCA6. A recent study has shown that a 75-kDa C-terminal fragment (CTF containing the polyQ tract remains soluble in normal brains, but becomes insoluble mainly in the cytoplasm with additional localization to the nuclei of human SCA6 Purkinje cells. However, the mechanism by which the CTF aggregation leads to neurodegeneration is completely elusive, particularly whether the CTF exerts more toxicity in the nucleus or in the cytoplasm. We tagged recombinant (rCTF with either nuclear-localization or nuclear-export signal, created doxycyclin-inducible rat pheochromocytoma (PC12 cell lines, and found that the CTF is more toxic in the cytoplasm than in the nucleus, the observations being more obvious with Q28 (disease range than with Q13 (normal-length. Surprisingly, the CTF aggregates co-localized both with cAMP response element-binding protein (CREB and phosphorylated-CREB (p-CREB in the cytoplasm, and Western blot analysis showed that the quantity of CREB and p-CREB were both decreased in the nucleus when the rCTF formed aggregates in the cytoplasm. In human brains, polyQ aggregates also co-localized with CREB in the cytoplasm of SCA6 Purkinje cells, but not in other conditions. Collectively, the cytoplasmic Cav2.1-CTF aggregates are sufficient to cause cell death, and one of the pathogenic mechanisms may be abnormal CREB trafficking in the cytoplasm and reduced CREB and p-CREB levels in the nuclei.
Takahashi, Makoto; Obayashi, Masato; Ishiguro, Taro; Sato, Nozomu; Niimi, Yusuke; Ozaki, Kokoro; Mogushi, Kaoru; Mahmut, Yasen; Tanaka, Hiroshi; Tsuruta, Fuminori; Dolmetsch, Ricardo; Yamada, Mitsunori; Takahashi, Hitoshi; Kato, Takeo; Mori, Osamu; Eishi, Yoshinobu; Mizusawa, Hidehiro; Ishikawa, Kinya
2013-01-01
The human α1A voltage-dependent calcium channel (Cav2.1) is a pore-forming essential subunit embedded in the plasma membrane. Its cytoplasmic carboxyl(C)-tail contains a small poly-glutamine (Q) tract, whose length is normally 4∼19 Q, but when expanded up to 20∼33Q, the tract causes an autosomal-dominant neurodegenerative disorder, spinocerebellar ataxia type 6 (SCA6). A recent study has shown that a 75-kDa C-terminal fragment (CTF) containing the polyQ tract remains soluble in normal brains, but becomes insoluble mainly in the cytoplasm with additional localization to the nuclei of human SCA6 Purkinje cells. However, the mechanism by which the CTF aggregation leads to neurodegeneration is completely elusive, particularly whether the CTF exerts more toxicity in the nucleus or in the cytoplasm. We tagged recombinant (r)CTF with either nuclear-localization or nuclear-export signal, created doxycyclin-inducible rat pheochromocytoma (PC12) cell lines, and found that the CTF is more toxic in the cytoplasm than in the nucleus, the observations being more obvious with Q28 (disease range) than with Q13 (normal-length). Surprisingly, the CTF aggregates co-localized both with cAMP response element-binding protein (CREB) and phosphorylated-CREB (p-CREB) in the cytoplasm, and Western blot analysis showed that the quantity of CREB and p-CREB were both decreased in the nucleus when the rCTF formed aggregates in the cytoplasm. In human brains, polyQ aggregates also co-localized with CREB in the cytoplasm of SCA6 Purkinje cells, but not in other conditions. Collectively, the cytoplasmic Cav2.1-CTF aggregates are sufficient to cause cell death, and one of the pathogenic mechanisms may be abnormal CREB trafficking in the cytoplasm and reduced CREB and p-CREB levels in the nuclei. PMID:23505410
Directory of Open Access Journals (Sweden)
Liang Ye
2015-03-01
Full Text Available Mutations in sorting nexin 10 (Snx10 have recently been found to account for roughly 4% of all human malignant osteopetrosis, some of them fatal. To study the disease pathogenesis, we investigated the expression of Snx10 and created mouse models in which Snx10 was knocked down globally or knocked out in osteoclasts. Endocytosis is severely defective in Snx10-deficient osteoclasts, as is extracellular acidification, ruffled border formation, and bone resorption. We also discovered that Snx10 is highly expressed in stomach epithelium, with mutations leading to high stomach pH and low calcium solubilization. Global Snx10-deficiency in mice results in a combined phenotype: osteopetrosis (due to osteoclast defect and rickets (due to high stomach pH and low calcium availability, resulting in impaired bone mineralization. Osteopetrorickets, the paradoxical association of insufficient mineralization in the context of a positive total body calcium balance, is thought to occur due to the inability of the osteoclasts to maintain normal calcium-phosphorus homeostasis. However, osteoclast-specific Snx10 knockout had no effect on calcium balance, and therefore led to severe osteopetrosis without rickets. Moreover, supplementation with calcium gluconate rescued mice from the rachitic phenotype and dramatically extended life span in global Snx10-deficient mice, suggesting that this may be a life-saving component of the clinical approach to Snx10-dependent human osteopetrosis that has previously gone unrecognized. We conclude that tissue-specific effects of Snx10 mutation need to be considered in clinical approaches to this disease entity. Reliance solely on hematopoietic stem cell transplantation can leave hypocalcemia uncorrected with sometimes fatal consequences. These studies established an essential role for Snx10 in bone homeostasis and underscore the importance of gastric acidification in calcium uptake.
Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution.
Shen, Huaizong; Zhou, Qiang; Pan, Xiaojing; Li, Zhangqiang; Wu, Jianping; Yan, Nieng
2017-03-03
Voltage-gated sodium (Na v ) channels are responsible for the initiation and propagation of action potentials. They are associated with a variety of channelopathies and are targeted by multiple pharmaceutical drugs and natural toxins. Here, we report the cryogenic electron microscopy structure of a putative Na v channel from American cockroach (designated Na v PaS) at 3.8 angstrom resolution. The voltage-sensing domains (VSDs) of the four repeats exhibit distinct conformations. The entrance to the asymmetric selectivity filter vestibule is guarded by heavily glycosylated and disulfide bond-stabilized extracellular loops. On the cytoplasmic side, a conserved amino-terminal domain is placed below VSD I , and a carboxy-terminal domain binds to the III-IV linker. The structure of Na v PaS establishes an important foundation for understanding function and disease mechanism of Na v and related voltage-gated calcium channels. Copyright © 2017, American Association for the Advancement of Science.
Directory of Open Access Journals (Sweden)
Jolene Atia
2016-04-01
Full Text Available Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the 'conductance repertoire' being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations.
Wind Power Plant Voltage Stability Evaluation: Preprint
Energy Technology Data Exchange (ETDEWEB)
Muljadi, E.; Zhang, Y. C.
2014-09-01
Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.
Deposition of strontium and calcium in snail shell
Energy Technology Data Exchange (ETDEWEB)
Rosenthal, Jr, G M; Nelson, D J; Gardiner, D A
1965-07-03
The relative effects of strontium and calcium concentrations in the environment on their uptake and incorporation into snail shell were investigated. /sup 45/Ca and /sup 85/Sr were used as tracers and specific activities were used to determine deposition. Data are presented in tables and graphs. Deposition of both calcium and strontium in the snail shell depended primarily on the respective concentrations of these elements in the immediate environment. A slight effect of strontium on calcium deposition was observed. There was found to be a minimum strontium deposition for various combinations of strontium and calcium in the environment. It was concluded that strontium uptake is more closely associated with environmental strontium concentrations than with calcium concentrations.
Calcium-Induced calcium release during action potential firing in developing inner hair cells.
Iosub, Radu; Avitabile, Daniele; Grant, Lisa; Tsaneva-Atanasova, Krasimira; Kennedy, Helen J
2015-03-10
In the mature auditory system, inner hair cells (IHCs) convert sound-induced vibrations into electrical signals that are relayed to the central nervous system via auditory afferents. Before the cochlea can respond to normal sound levels, developing IHCs fire calcium-based action potentials that disappear close to the onset of hearing. Action potential firing triggers transmitter release from the immature IHC that in turn generates experience-independent firing in auditory neurons. These early signaling events are thought to be essential for the organization and development of the auditory system and hair cells. A critical component of the action potential is the rise in intracellular calcium that activates both small conductance potassium channels essential during membrane repolarization, and triggers transmitter release from the cell. Whether this calcium signal is generated by calcium influx or requires calcium-induced calcium release (CICR) is not yet known. IHCs can generate CICR, but to date its physiological role has remained unclear. Here, we used high and low concentrations of ryanodine to block or enhance CICR to determine whether calcium release from intracellular stores affected action potential waveform, interspike interval, or changes in membrane capacitance during development of mouse IHCs. Blocking CICR resulted in mixed action potential waveforms with both brief and prolonged oscillations in membrane potential and intracellular calcium. This mixed behavior is captured well by our mathematical model of IHC electrical activity. We perform two-parameter bifurcation analysis of the model that predicts the dependence of IHCs firing patterns on the level of activation of two parameters, the SK2 channels activation and CICR rate. Our data show that CICR forms an important component of the calcium signal that shapes action potentials and regulates firing patterns, but is not involved directly in triggering exocytosis. These data provide important insights
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
Cytosolic calcium rises and related events in ergosterol-treated Nicotiana cells.
Vatsa, Parul; Chiltz, Annick; Luini, Estelle; Vandelle, Elodie; Pugin, Alain; Roblin, Gabriel
2011-07-01
The typical fungal membrane component ergosterol was previously shown to trigger defence responses and protect plants against pathogens. Most of the elicitors mobilize the second messenger calcium, to trigger plant defences. We checked the involvement of calcium in response to ergosterol using Nicotiana plumbaginifolia and Nicotiana tabacum cv Xanthi cells expressing apoaequorin in the cytosol. First, it was verified if ergosterol was efficient in these cells inducing modifications of proton fluxes and increased expression of defence-related genes. Then, it was shown that ergosterol induced a rapid and transient biphasic increase of free [Ca²⁺](cyt) which intensity depends on ergosterol concentration in the range 0.002-10 μM. Among sterols, this calcium mobilization was specific for ergosterol and, ergosterol-induced pH and [Ca²⁺](cyt) changes were specifically desensitized after two subsequent applications of ergosterol. Specific modulators allowed elucidating some events in the signalling pathway triggered by ergosterol. The action of BAPTA, LaCl₃, nifedipine, verapamil, neomycin, U73122 and ruthenium red suggested that the first phase was linked to calcium influx from external medium which subsequently triggered the second phase linked to calcium release from internal stores. The calcium influx and the [Ca²⁺](cyt) increase depended on upstream protein phosphorylation. The extracellular alkalinization and ROS production depended on calcium influx but, the ergosterol-induced MAPK activation was calcium-independent. ROS were not involved in cytosolic calcium rise as described in other models, indicating that ROS do not systematically participate in the amplification of calcium signalling. Interestingly, ergosterol-induced ROS production is not linked to cell death and ergosterol does not induce any calcium elevation in the nucleus. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
An expert protocol for immunofluorescent detection of calcium channels in tsA-201 cells.
Koch, Peter; Herzig, Stefan; Matthes, Jan
Pore-forming subunits of voltage gated calcium channels (VGCC) are large membrane proteins (260kDa) containing 24 transmembrane domains. Despite transfection with viral promoter driven vectors, biochemical analysis of VGCC is often hampered by rather low expression levels in heterologous systems rendering VGCC challenging targets. Especially in immunofluorescent detection, calcium channels are demanding proteins. We provide an expert step-by-step protocol with adapted conditions for handling procedures (tsA-201 cell culture, transient transfection, incubation time and temperature at 28°C or 37°C and immunostaining) to address the L-type calcium-channel pore Ca v 1.2 in an immunofluorescent approach. We performed immunocytochemical analysis of Ca v 1.2 expression at single-cell level in combination with detection of different markers for cellular organelles. We show confluency levels and shapes of tsA-201 cells at different time points during an experiment. Our experiments reveal sufficient levels of Ca v 1.2 protein and a correct Ca v 1.2 expression pattern in polygonal shaped cells already 12h after transfection. A sequence of elaborated protocol modifications allows subcellular localization analysis of Ca v 1.2 in an immunocytochemical approach. We provide a protocol that may be used to achieve insights into physiological and pathophysiological processes involving voltage gated calcium channels. Our protocol may be used for expression analysis of other challenging proteins and efficient overexpression may be exploited in related biochemical techniques requiring immunolabels. Copyright © 2016 Elsevier Inc. All rights reserved.
Calcium paradox and calcium entry blockers
Ruigrok, T.J.C.; Slade, A.M.; Nayler, W.G.; Meijler, F.L.
1984-01-01
Reperfusion of isolated hearts with calcium-containing solution after a short period of calcium-free perfusion results in irreversible cell damage (calcium paradox). This phenomenon is characterized by an excessive influx of calcium into the cells, the rapid onset of myocardial contracture,
Rahman, W; Patel, R; Dickenson, A H
2015-10-01
Osteoarthritis (OA) remains one of the greatest healthcare burdens in western society, with chronic debilitating pain-dominating clinical presentation yet therapeutic strategies are inadequate in many patients. Development of better analgesics is contingent on improved understanding of the molecular mechanisms mediating OA pain. Voltage-gated calcium channels 2.2 (Cav2.2) play a critical role in spinal nociceptive transmission, therefore blocking Cav2.2 activity represents an attractive opportunity for OA pain treatment, but the only available licensed Cav2.2 antagonist ziconitide (PrilatTM) is of limited use. TROX-1 is an orally available, use dependent and state-selective Cav2 antagonist, exerting its analgesic effect primarily via Cav2.2 blockade, with an improved therapeutic window compared with ziconitide. Using a rat model of monosodium iodoacetate (MIA), 2 mg, induced OA we used in vivo electrophysiology to assess the effects of spinal or systemic administration of TROX-1 on the evoked activity of wide dynamic range spinal dorsal horn neurons in response to electrical, natural mechanical (dynamic brush and von Frey 2, 8, 26 and 6 g) and thermal (40, 45 and 45 °C) stimuli applied to the peripheral receptive field. MIA injection into the knee joint resulted in mechanical hypersensitivity of the ipsilateral hind paw and weight-bearing asymmetry. Spinal administration of TROX-1 (0.1 and 1 μg/50 μl) produced a significant dose-related inhibition of dynamic brush, mechanical (von Frey filament (vF) 8, 26 and 60 g) and noxious thermal-(45 and 48 °C) evoked neuronal responses in MIA rats only. Systemic administration of TROX-1 produced a significant inhibition of the mechanical-(vF 8, 26 and 60 g) evoked neuronal responses in MIA rats. TROX-1 did not produce any significant effect on any neuronal measure in Sham controls. Our in vivo electrophysiological results demonstrate a pathological state-dependent effect of TROX-1, which suggests an increased functional
Contracture of Slow Striated Muscle during Calcium Deprivation
Irwin, Richard L.; Hein, Manfred M.
1963-01-01
When deprived of calcium the slow striated muscle fibers of the frog develop reversible contractures in either hypertonic or isotonic solutions. While calcium deprivation continues because of a flowing calcium-free solution the muscles relax slowly and completely. Restoration of calcium during contracture relaxes the muscle promptly to initial tension. When relaxed during calcium lack the return of calcium does not change tension and the muscle stays relaxed. When contractures are induced by solutions containing small amounts of calcium relaxation does not occur or requires several hours. The rate of tension development depends upon the rate at which calcium moves outward since the contractures develop slower in low concentrations of calcium and are absent or greatly slowed in a stagnant calcium-free solution. Withdrawal of calcium prevents the contractile responses to ACh, KCl, or electrical stimulation through the nerve. Muscles return to their original excitability after calcium is restored. Origin of the contractures is unrelated to nerve activity since they are maximal during transmission failure from calcium lack, occur in denervated muscles, and are not blocked by high concentrations of d-tubocurarine, procaine, or atropine. The experiments also indicate that the contractures do not originate from repetitive activity of muscle membranes. The findings are most simply explained by relating the outward movement of calcium as a link for initiating contraction in slow type striated muscle. PMID:14065284
Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter
Directory of Open Access Journals (Sweden)
Padalko D.A.
2017-12-01
Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.
International Nuclear Information System (INIS)
Molinuevo, Maria Silvina; Etcheverry, Susana Beatriz; Cortizo, Ana Maria
2005-01-01
Bone homeostasis is the result of a tight balance between bone resorption and bone formation where macrophage activation is believed to contribute to bone resorption. We have previously shown that a vanadyl(IV)-aspirin complex (VOAspi) regulates cell proliferation and differentiation of osteoblasts in culture. In this study, we assessed VOAspi and VO effects and their possible mechanism of action on a mouse macrophage cell line RAW 264.7. Both vanadium compounds inhibited cell proliferation in a dose-dependent manner. Nifedipine completely reversed the VOAspi-induced macrophage cytotoxicity, while it could not block the effect of VO. VOAspi also stimulated nitric oxide (NO) production, the oxidation of dihydrorhodamine 123 (DHR-123) and enhanced the expression of both constitutive and inducible isoforms of nitric oxide syntases (NOS). All these effects were abolished by nifedipine. Althogether our finding give evidence that VOAspi-induced macrophage cytotoxicity is dependent on L-type calcium channel and the generation of NO though the induction of eNOS and iNOS. Contrary, the parent compound VO exerted a cytotoxic effect by mechanisms independent of a calcium entry and the NO/NOS activation
Functional diversity of voltage-sensing phosphatases in two urodele amphibians.
Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi
2014-07-16
Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
SH Oxidation Stimulates Calcium Release Channels (Ryanodine Receptors From Excitable Cells
Directory of Open Access Journals (Sweden)
CECILIA HIDALGO
2000-01-01
Full Text Available The effects of redox reagents on the activity of the intracellular calcium release channels (ryanodine receptors of skeletal and cardiac muscle, or brain cortex neurons, was examined. In lipid bilayer experiments, oxidizing agents (2,2'-dithiodipyridine or thimerosal modified the calcium dependence of all single channels studied. After controlled oxidation channels became active at sub µM calcium concentrations and were not inhibited by increasing the calcium concentration to 0.5 mM. Subsequent reduction reversed these effects. Channels purified from amphibian skeletal muscle exhibited the same behavior, indicating that the SH groups responsible for modifying the calcium dependence belong to the channel protein. Parallel experiments that measured calcium release through these channels in sarcoplasmic reticulum vesicles showed that following oxidation, the channels were no longer inhibited by sub mM concentrations of Mg2+. It is proposed that channel redox state controls the high affinity sites responsible for calcium activation as well as the low affinity sites involved in Mg2+ inhibition of channel activity. The possible physiological and pathological implications of these results are discussed
A common pathway for charge transport through voltage-sensing domains.
Chanda, Baron; Bezanilla, Francisco
2008-02-07
Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.
Thermal voltage noise in layered superconductors
International Nuclear Information System (INIS)
Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.
1995-01-01
Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields
Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne
2010-10-01
The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.
Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong
2017-08-01
This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.
Ionized calcium measurements are influenced by albumin - should ionized calcium be corrected?
DEFF Research Database (Denmark)
Larsen, Trine R; Galthen-Sørensen, Mathias; Antonsen, Steen
2014-01-01
Abstract Measurement of ionized calcium (CaI) has been reported to be dependent on albumin concentration. We examined the correlation between albumin and CaI measured on different ion selective electrode analyzers and in different groups of patients in a large dataset, extracted from the laboratory...
Directory of Open Access Journals (Sweden)
S. Demirezen
Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase
Hyrc, Krzysztof L; Minta, Akwasi; Escamilla, P Rogelio; Chan, Patrick P L; Meshik, Xenia A; Goldberg, Mark P
2013-10-01
Although many synthetic calcium indicators are available, a search for compounds with improved characteristics continues. Here, we describe the synthesis and properties of Asante Calcium Red-1 (ACR-1) and its low affinity derivative (ACR-1-LA) created by linking BAPTA to seminaphthofluorescein. The indicators combine a visible light (450-540 nm) excitation with deep-red fluorescence (640 nm). Upon Ca2+ binding, the indicators raise their fluorescence with longer excitation wavelengths producing higher responses. Although the changes occur without any spectral shifts, it is possible to ratio Ca(2+)-dependent (640 nm) and quasi-independent (530 nm) emission when using visible (calcium indicators. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Piekarz Andrew D
2012-07-01
Full Text Available Abstract Background The ubiquity of protein-protein interactions in biological signaling offers ample opportunities for therapeutic intervention. We previously identified a peptide, designated CBD3, that suppressed inflammatory and neuropathic behavioral hypersensitivity in rodents by inhibiting the ability of collapsin response mediator protein 2 (CRMP-2 to bind to N-type voltage-activated calcium channels (CaV2.2 [Brittain et al. Nature Medicine 17:822–829 (2011]. Results and discussion Here, we utilized SPOTScan analysis to identify an optimized variation of the CBD3 peptide (CBD3A6K that bound with greater affinity to Ca2+ channels. Molecular dynamics simulations demonstrated that the CBD3A6K peptide was more stable and less prone to the unfolding observed with the parent CBD3 peptide. This mutant peptide, conjugated to the cell penetrating motif of the HIV transduction domain protein TAT, exhibited greater anti-nociception in a rodent model of AIDS therapy-induced peripheral neuropathy when compared to the parent TAT-CBD3 peptide. Remarkably, intraperitoneal administration of TAT-CBD3A6K produced none of the minor side effects (i.e. tail kinking, body contortion observed with the parent peptide. Interestingly, excitability of dissociated small diameter sensory neurons isolated from rats was also reduced by TAT-CBD3A6K peptide suggesting that suppression of excitability may be due to inhibition of T- and R-type Ca2+ channels. TAT-CBD3A6K had no effect on depolarization-evoked calcitonin gene related peptide (CGRP release compared to vehicle control. Conclusions Collectively, these results establish TAT-CBD3A6K as a peptide therapeutic with greater efficacy in an AIDS therapy-induced model of peripheral neuropathy than its parent peptide, TAT-CBD3. Structural modifications of the CBD3 scaffold peptide may result in peptides with selectivity against a particular subset of voltage-gated calcium channels resulting in a multipharmacology of
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free
International Nuclear Information System (INIS)
Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.
2014-01-01
Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Recovery of calcium from the effluent of direct oxide reduction process
International Nuclear Information System (INIS)
Ferro, P.; Mishra, B.; Olson, D.L.; Moore, J.J.; Averill, W.A.
1992-01-01
This paper reports that the production of plutonium by Direct Oxide Reduction [DOR] process using calcium generates significant amount of contaminated waste as calcium oxide saturated calcium chloride salt mix with calcium oxide content of up to 15 wt. pct. Fused salt electrolysis of a simulated slat mix [CaCl 2 + 15 wt. pct. CaO] is being carried out to election calcium, which can be recycled to the DOR rector along with the calcium chloride salt or may be used in-situ in an combined DOR and electrowinning process. The technology will resolve a major contaminated waste disposal problem, besides improving the cost and process efficiency in radioactive metal production. The process is being optimized in terms of the calcium solubility, cell temperature, current density and cell design to maximize the current efficiency. Scattered information is available regarding the solubility of calcium in calcium chloride salt in the present of calcium oxide. The solubility has also been found to depend on the use of graphite as the anode material. A porous ceramic sheath is being used around the anode to prevent the dissolution of electrowon calcium as oxide or carbonate and to prevent the contamination of salt by the anodic carbon. The electrode reactions are affected by the electrolyte composition and its viscosity which varies with time in this process and, therefore, electrochemical impedance is being measured to understand this time-dependent mechanisms
Directory of Open Access Journals (Sweden)
Cathy Chia-Yu Huang
Full Text Available In the retina, the L-type voltage-gated calcium channels (L-VGCCs are responsible for neurotransmitter release from photoreceptors and are under circadian regulation. Both the current densities and protein expression of L-VGCCs are significantly higher at night than during the day. However, the underlying mechanisms of circadian regulation of L-VGCCs in the retina are not completely understood. In this study, we demonstrated that the mechanistic/mammalian target of rapamycin complex (mTORC signaling pathway participated in the circadian phase-dependent modulation of L-VGCCs. The activities of the mTOR cascade, from mTORC1 to its downstream targets, displayed circadian oscillations throughout the course of a day. Disruption of mTORC1 signaling dampened the L-VGCC current densities, as well as the protein expression of L-VGCCs at night. The decrease of L-VGCCs at night by mTORC1 inhibition was in part due to a reduction of L-VGCCα1 subunit translocation from the cytosol to the plasma membrane. Finally, we showed that mTORC1 was downstream of the phosphatidylionositol 3 kinase-protein kinase B (PI3K-AKT signaling pathway. Taken together, mTORC1 signaling played a role in the circadian regulation of L-VGCCs, in part through regulation of ion channel trafficking and translocation, which brings to light a new functional role for mTORC1: the modulation of ion channel activities.
Multi-objective optimization of distributed generation with voltage ...
African Journals Online (AJOL)
DR OKE
1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...
Directory of Open Access Journals (Sweden)
Padma P Srinivasan
Full Text Available Voltage-sensitive calcium channels (VSCC regulate cellular calcium influx, one of the earliest responses to mechanical stimulation in osteoblasts. Here, we postulate that T-type VSCCs play an essential role in bone mechanical response to load and participate in events leading to the pathology of load-induced OA. Repetitive mechanical insult was used to induce OA in Cav3.2 T-VSCC null and wild-type control mouse knees. Osteoblasts (MC3T3-E1 and chondrocytes were treated with a selective T-VSCC inhibitor and subjected to fluid shear stress to determine how blocking of T-VSCCs alters the expression profile of each cell type upon mechanical stimulation. Conditioned-media (CM obtained from static and sheared MC3T3-E1 was used to assess the effect of osteoblast-derived factors on the chondrocyte phenotype. T-VSCC null knees exhibited significantly lower focal articular cartilage damage than age-matched controls. In vitro inhibition of T-VSCC significantly reduced the expression of both early and late mechanoresponsive genes in osteoblasts but had no effect on gene expression in chondrocytes. Furthermore, treatment of chondrocytes with CM obtained from sheared osteoblasts induced expression of markers of hypertrophy in chondrocytes and this was nearly abolished when osteoblasts were pre-treated with the T-VSCC-specific inhibitor. These results indicate that T-VSCC plays a role in signaling events associated with induction of OA and is essential to the release of osteoblast-derived factors that promote an early OA phenotype in chondrocytes. Further, these findings suggest that local inhibition of T-VSCC may serve as a therapy for blocking load-induced bone formation that results in cartilage degeneration.
Recording membrane potential changes through photoacoustic voltage sensitive dye
DEFF Research Database (Denmark)
Zhang, Haichong K.; Kang, Jeeun; Yan, Ping
2017-01-01
Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...
A model of propagating calcium-induced calcium release mediated by calcium diffusion
Backx, P. H.; de Tombe, P. P.; van Deen, J. H.; Mulder, B. J.; ter Keurs, H. E.
1989-01-01
The effect of sudden local fluctuations of the free sarcoplasmic [Ca++]i in cardiac cells on calcium release and calcium uptake by the sarcoplasmic reticulum (SR) was calculated with the aid of a simplified model of SR calcium handling. The model was used to evaluate whether propagation of calcium
Cullen, Patrick K; Gilman, T Lee; Winiecki, Patrick; Riccio, David C; Jasnow, Aaron M
2015-10-01
Memories for context become less specific with time resulting in animals generalizing fear from training contexts to novel contexts. Though much attention has been given to the neural structures that underlie the long-term consolidation of a context fear memory, very little is known about the mechanisms responsible for the increase in fear generalization that occurs as the memory ages. Here, we examine the neural pattern of activation underlying the expression of a generalized context fear memory in male C57BL/6J mice. Animals were context fear conditioned and tested for fear in either the training context or a novel context at recent and remote time points. Animals were sacrificed and fluorescent in situ hybridization was performed to assay neural activation. Our results demonstrate activity of the prelimbic, infralimbic, and anterior cingulate (ACC) cortices as well as the ventral hippocampus (vHPC) underlie expression of a generalized fear memory. To verify the involvement of the ACC and vHPC in the expression of a generalized fear memory, animals were context fear conditioned and infused with 4% lidocaine into the ACC, dHPC, or vHPC prior to retrieval to temporarily inactivate these structures. The results demonstrate that activity of the ACC and vHPC is required for the expression of a generalized fear memory, as inactivation of these regions returned the memory to a contextually precise form. Current theories of time-dependent generalization of contextual memories do not predict involvement of the vHPC. Our data suggest a novel role of this region in generalized memory, which should be incorporated into current theories of time-dependent memory generalization. We also show that the dorsal hippocampus plays a prolonged role in contextually precise memories. Our findings suggest a possible interaction between the ACC and vHPC controls the expression of fear generalization. Copyright © 2015 Elsevier Inc. All rights reserved.
Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma
International Nuclear Information System (INIS)
Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup
2002-01-01
The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate
DEFF Research Database (Denmark)
Grunnet, Morten; Kaufmann, Walter A
2004-01-01
Based on electrophysiological studies, Ca(2+)-activated K(+) channels and voltage-gated Ca(2+) channels appear to be located in close proximity in neurons. Such colocalization would ensure selective and rapid activation of K(+) channels by local increases in the cytosolic calcium concentration...
New method for determining avalanche breakdown voltage of silicon photomultipliers
International Nuclear Information System (INIS)
Chirikov-Zorin, I.
2017-01-01
The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru
Directory of Open Access Journals (Sweden)
Thanawath R Na Phuket
2009-07-01
Full Text Available The dorsal root ganglion (DRG contains heterogeneous populations of sensory neurons including primary nociceptive neurons and C-fibers implicated in pain signaling. Recent studies have demonstrated DRG hyperexcitability associated with downregulation of A-type K+ channels; however, the molecular correlate of the corresponding A-type K+ current (IA has remained hypothetical. Kv4 channels may underlie the IA in DRG neurons. We combined electrophysiology, molecular biology (whole-tissue and single-cell RT-PCR and immunohistochemistry to investigate the molecular basis of the IA in acutely dissociated DRG neurons from 7-8 day-old rats. Whole-cell recordings demonstrate a robust tetraethylammonium-resistant (20 mM and 4-aminopyridine-sensitive (5 mM IA. Matching Kv4 channel properties, activation and inactivation of this IA occur in the subthreshold range of membrane potentials and the rate of recovery from inactivation is rapid and voltage-dependent. Among Kv4 transcripts, the DRG expresses significant levels of Kv4.1 and Kv4.3 mRNAs. Also, single small-medium diameter DRG neurons (~30 mm exhibit correlated frequent expression of mRNAs encoding Kv4.1 and Nav1.8, a known nociceptor marker. In contrast, the expressions of Kv1.4 and Kv4.2 mRNAs at the whole-tissue and single-cell levels are relatively low and infrequent. Kv4 protein expression in nociceptive DRG neurons was confirmed by immunohistochemistry, which demonstrates colocalization of Kv4.3 and Nav1.8, and negligible expression of Kv4.2. Furthermore, specific dominant-negative suppression and overexpression strategies confirmed the contribution of Kv4 channels to IA in DRG neurons. Contrasting the expression patterns of Kv4 channels in the central and peripheral nervous systems, we discuss possible functional roles of these channels in primary sensory neurons.
Characterization of transport of calcium by microsomal membranes from roots maize
International Nuclear Information System (INIS)
Vaughan, M.A.
1985-01-01
This study investigates calcium transport by membranes of roots of maize isolated by differential centrifugation. The preparation was determined to be enriched in plasma membrane using market enzyme and electron microscopy. Using the 45 Ca filtration technique and liquid scintillation counting, vesicular calcium uptake was shown to be stimulated by added calmodulin and specific for and dependent on ATP. Conditions for maximal calcium accumulation were found to be 30 min incubation in the presence of 5 mM ATP, 5 mM MgCl 2 , 50 μM CaCl 2 , at 23 0 C, and at pH 6.5. Calcium uptake was inhibited by the ionophores A23187, X-537A, and ionomycin. Sodium fluoride, ruthenium red, and p-chloromercuribenzoate completely inhibited transport: diamide and vanadate produced slight inhibition; caffeine, caffeic acid, oligomycin, and ouabain produced little or no inhibition. Chlorpromazine, W7, trifluoperazine, and R 24 571 inhibit calcium uptake irrespective of added calmodulin, while W5 showed little effect on uptake. Verapamil, nifedipine, cinnarizine, flunarizine, lidoflazine, and diltiazem decreased calcium uptake by 17%-50%. Electron microscopic localization of calcium by pyroantimonate showed vesicles incubated with calmodulin and ATP showed the greatest amount of precipitate. These results suggest that these vesicles accumulate calcium in an ATP-dependent, calmodulin-stimulated manner
Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel
DEFF Research Database (Denmark)
Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle
2012-01-01
The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...
DEFF Research Database (Denmark)
Hansen, Pernille B L
2015-01-01
Over the years, it has been discussed whether T-type calcium channels Cav3 play a role in the cardiovascular and renal system. T-type channels have been reported to play an important role in renal hemodynamics, contractility of resistance vessels, and pacemaker activity in the heart. However...
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
International Nuclear Information System (INIS)
Hwang, Yong Pil; Kim, Hyung Gyun; Hien, Tran Thi; Jeong, Myung Ho; Jeong, Tae Cheon; Jeong, Hye Gwang
2011-01-01
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-α-stimulated monocytes to endothelial cells and suppressed the TNF-α induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-α-induced nuclear factor-κB activation, which was attenuated by pretreatment with N G -nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: ► Puerarin induced the phosphorylation of eNOS and the production of NO. ► Puerarin activated eNOS through ER-dependent PI3-kinase and Ca 2+ -dependent AMPK. ► Puerarin-induced NO was involved in the inhibition of NF-kB activation. ► Puerarin may help for prevention of vascular dysfunction and diabetes.
Molecular pathophysiology and pharmacology of the voltage-sensing module of neuronal ion channels.
Miceli, Francesco; Soldovieri, Maria Virginia; Ambrosino, Paolo; De Maria, Michela; Manocchio, Laura; Medoro, Alessandro; Taglialatela, Maurizio
2015-01-01
Voltage-gated ion channels (VGICs) are membrane proteins that switch from a closed to open state in response to changes in membrane potential, thus enabling ion fluxes across the cell membranes. The mechanism that regulate the structural rearrangements occurring in VGICs in response to changes in membrane potential still remains one of the most challenging topic of modern biophysics. Na(+), Ca(2+) and K(+) voltage-gated channels are structurally formed by the assembly of four similar domains, each comprising six transmembrane segments. Each domain can be divided into two main regions: the Pore Module (PM) and the Voltage-Sensing Module (VSM). The PM (helices S5 and S6 and intervening linker) is responsible for gate opening and ion selectivity; by contrast, the VSM, comprising the first four transmembrane helices (S1-S4), undergoes the first conformational changes in response to membrane voltage variations. In particular, the S4 segment of each domain, which contains several positively charged residues interspersed with hydrophobic amino acids, is located within the membrane electric field and plays an essential role in voltage sensing. In neurons, specific gating properties of each channel subtype underlie a variety of biological events, ranging from the generation and propagation of electrical impulses, to the secretion of neurotransmitters and to the regulation of gene expression. Given the important functional role played by the VSM in neuronal VGICs, it is not surprising that various VSM mutations affecting the gating process of these channels are responsible for human diseases, and that compounds acting on the VSM have emerged as important investigational tools with great therapeutic potential. In the present review we will briefly describe the most recent discoveries concerning how the VSM exerts its function, how genetically inherited diseases caused by mutations occurring in the VSM affects gating in VGICs, and how several classes of drugs and toxins
Li, Yuwei; Ahrens, Molly J; Wu, Amy; Liu, Jennifer; Dudley, Andrew T
2011-01-01
For tissues that develop throughout embryogenesis and into postnatal life, the generation of differentiated cells to promote tissue growth is at odds with the requirement to maintain the stem cell/progenitor cell population to preserve future growth potential. In the growth plate cartilage, this balance is achieved in part by establishing a proliferative phase that amplifies the number of progenitor cells prior to terminal differentiation into hypertrophic chondrocytes. Here, we show that endogenous calcium/calmodulin-dependent protein kinase II (CamkII, also known as Camk2) activity is upregulated prior to hypertrophy and that loss of CamkII function substantially blocks the transition from proliferation to hypertrophy. Wnt signaling and Pthrp-induced phosphatase activity negatively regulate CamkII activity. Release of this repression results in activation of multiple effector pathways, including Runx2- and β-catenin-dependent pathways. We present an integrated model for the regulation of proliferation potential by CamkII activity that has important implications for studies of growth control and adult progenitor/stem cell populations.
Järn, Mikael; Areva, Sami; Pore, Viljami; Peltonen, Jouko; Linden, Mika
2006-09-12
Heterogeneous nucleation and growth of calcium phosphate (CaP) on sol-gel derived TiO(2) coatings was investigated in terms of surface topography and surface energy. The topography of the coatings was derived from AFM measurements, while the surface energy was determined with contact angle measurements. The degree of precipitation was examined with scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS). The precipitation of CaP was found to be dependent on both topography and surface energy. A high roughness value when combining the RMS roughness parameter S(q) with the number of local maxima per unit area parameter S(ds) enhances CaP formation. The hydrophilicity of the coating was also found to be of importance for CaP formation. We suggest that the water contact angle, which is a direct measure of the hydrophilicity of the surface, may be used to evaluate the surface energy dependent precipitation kinetics rather than using the often applied Lewis base parameter.
Tien, Jason; Peters, Christian J; Wong, Xiu Ming; Cheng, Tong; Jan, Yuh Nung; Jan, Lily Yeh; Yang, Huanghe
2014-01-01
TMEM16A forms calcium-activated chloride channels (CaCCs) that regulate physiological processes such as the secretions of airway epithelia and exocrine glands, the contraction of smooth muscles, and the excitability of neurons. Notwithstanding intense interest in the mechanism behind TMEM16A-CaCC calcium-dependent gating, comprehensive surveys to identify and characterize potential calcium sensors of this channel are still lacking. By aligning distantly related calcium-activated ion channels in the TMEM16 family and conducting systematic mutagenesis of all conserved acidic residues thought to be exposed to the cytoplasm, we identify four acidic amino acids as putative calcium-binding residues. Alterations of the charge, polarity, and size of amino acid side chains at these sites alter the ability of different divalent cations to activate the channel. Furthermore, TMEM16A mutant channels containing double cysteine substitutions at these residues are sensitive to the redox potential of the internal solution, providing evidence for their physical proximity and solvent accessibility. DOI: http://dx.doi.org/10.7554/eLife.02772.001 PMID:24980701
Altered mechanical properties of titin immunoglobulin domain 27 in the presence of calcium.
DuVall, Michael M; Gifford, Jessica L; Amrein, Matthias; Herzog, Walter
2013-04-01
Titin (connectin) based passive force regulation has been an important physiological mechanism to adjust to varying muscle stretch conditions. Upon stretch, titin behaves as a spring capable of modulating its elastic response in accordance with changes in muscle biochemistry. One such mechanism has been the calcium-dependent stiffening of titin domains that renders the spring inherently more resistant to stretch. This transient titin-calcium interaction may serve a protective function in muscle, which could preclude costly unfolding of select domains when muscles elongate to great lengths. To test this idea, fluorescence spectroscopy was performed revealing a change in the microenvironment of the investigated immunoglobulin domain 27 (I27) of titin with calcium. Additionally, an atomic force microscope was used to evaluate the calcium-dependent regulation of passive force by stretching eight linked titin I27 domains until they unfolded. When stretching in the presence of calcium, the I27 homopolymer chain became stabilized, displaying three novel properties: (1) higher stretching forces were needed to unfold the domains, (2) the stiffness, measured as a persistence length (PL), increased and (3) the peak-to-peak distance between adjacent I27 domains increased. Furthermore, a peak order dependence became apparent for both force and PL, reflecting the importance of characterizing the dynamic unfolding history of a polymer with this approach. Together, this novel titin Ig-calcium interaction may serve to stabilize the I27 domain permitting titin to tune passive force within stretched muscle in a calcium-dependent manner.
MOTOR ACCELERATION TIME OPTIMIZATION BY THE CHANGE OF THE SUPPLY VOLTAGE VALUE
Directory of Open Access Journals (Sweden)
G. K. Aslanov
2016-01-01
Full Text Available Abstract. It is proved that the deviation of the voltage from the nominal values, often leads to overheating of the motor windings, which reduces the insulation life to a great extent.The task of determining the change in the acceleration time of the motor depending on the switching time of its supply voltage is set. The modeling of DC motor 2ПН132М operation in the short- run changes in starting voltage from 380 V to 220 V - which is its nominal value-is carried out. By sweep method is determined the optimum time for switching the supply voltage of the motor. Mathematical dependencies and simulation results are presented.
Mamillapalli, Ramanaiah; VanHouten, Joshua; Dann, Pamela; Bikle, Daniel; Chang, Wenhan; Brown, Edward
2013-01-01
To meet the demands for milk calcium, the lactating mother adjusts systemic calcium and bone metabolism by increasing dietary calcium intake, increasing bone resorption, and reducing renal calcium excretion. As part of this adaptation, the lactating mammary gland secretes PTHrP into the maternal circulation to increase bone turnover and mobilize skeletal calcium stores. Previous data have suggested that, during lactation, the breast relies on the calcium-sensing receptor (CaSR) to coordinate PTHrP secretion and milk calcium transport with calcium availability. To test this idea genetically, we bred BLG-Cre mice with CaSR-floxed mice to ablate the CaSR specifically from mammary epithelial cells only at the onset of lactation (CaSR-cKO mice). Loss of the CaSR in the lactating mammary gland did not disrupt alveolar differentiation or milk production. However, it did increase the secretion of PTHrP into milk and decreased the transport of calcium from the circulation into milk. CaSR-cKO mice did not show accelerated bone resorption, but they did have a decrease in bone formation. Loss of the mammary gland CaSR resulted in hypercalcemia, decreased PTH secretion, and increased renal calcium excretion in lactating mothers. Finally, loss of the mammary gland CaSR resulted in decreased calcium accrual by suckling neonates, likely due to the combination of increased milk PTHrP and decreased milk calcium. These results demonstrate that the mammary gland CaSR coordinates maternal bone and calcium metabolism, calcium transport into milk, and neonatal calcium accrual during lactation. PMID:23782944
Directory of Open Access Journals (Sweden)
V. V. Schwartau
2014-04-01
connect ion conformationally rearranged, thus passing the signal through the chain of intermediaries. The most important function of calcium is its participation in many cell signaling pathways. Channels, pumps, gene expression, synthesis of alkaloids, protective molecules, NO etc. respond to changes in [Ca2+]cyt, while transductors are represented by a number of proteins. The universality of calcium is evident in the study in connection with other signaling systems, such as NO, which is involved in the immune response and is able to control the feedback activity of protein activators channels, producing nitric oxide. Simulation of calcium responses can determine the impact of key level and their regulation, and also depends on the type of stimulus and the effector protein that specifically causes certain changes. Using spatiotemporal modeling, scientists showed that the key components for the formation of Ca2+ bursts are the internal and external surfaces of the nucleus membrane. The research was aimed at understanding of the mechanisms of influence of Ca2+-binding components on Ca2+ oscillations. The simulation suggests the existence of a calcium depot EPR with conjugated lumen of the nucleus which releases its contents to nucleoplasm. With these assumptions, the mathematical model was created and confirmed experimentally. It describes the oscillation of nuclear calcium in root hairs of Medicago truncatula at symbiotic relationship of plants and fungi (rhizobia. Calcium oscillations are present in symbiotic relationships of the cortical layer of plant root cells. Before penetration of bacteria into the cells, slow oscillations of Ca2+ are observed, but with their penetration into the cells the oscillation frequency increases. These processes take place by changing buffer characteristics of the cytoplasm caused by signals from microbes, such as Nod-factor available after penetration of bacteria through the cell wall. Thus, the basic known molecular mechanisms for
E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.
Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej
2018-04-17
E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.
Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks
Teverovsky, Alexander
2016-01-01
Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.
Calcium and Egg Activation in Drosophila
Sartain, Caroline V.; Wolfner, Mariana F.
2012-01-01
Summary In many animals, a rise in intracellular calcium levels is the trigger for egg activation, the process by which an arrested mature oocyte transitions to prepare for embryogenesis. In nearly all animals studied to date, this calcium rise, and thus egg activation, is triggered by the fertilizing sperm. However in the insects that have been examined, fertilization is not necessary to activate their oocytes. Rather, these insects’ eggs activate as they transit through the female’s reproductive tract, regardless of male contribution. Recent studies in Drosophila have shown that egg activation nevertheless requires calcium and that the downstream events and molecules of egg activation are also conserved, despite the difference in initial trigger. Genetic studies have uncovered essential roles for the calcium-dependent enzyme calcineurin and its regulator calcipressin, and have hinted at roles for calmodulin, in Drosophila egg activation. Physiological and in vitro studies have led to a model in which mechanical forces that impact the Drosophila oocyte as it moves through the reproductive tract triggers the influx of calcium from the external environment, thereby initiating egg activation. Future research will aim to test this model, as well as to determine the spatiotemporal dynamics of cytoplasmic calcium flux and mode of signal propagation in this unique system. PMID:23218670
International Nuclear Information System (INIS)
Sonnenberg, J.; Pansini, A.R.; Christakos, S.
1984-01-01
A sensitive double antibody RIA has been developed for the 28,000 mol wt rat renal vitamin D-dependent calcium-binding protein. Using this assay, concentrations of calcium-binding protein (CaBP) as low as 30 ng can be measured. The assay is precise (intraassay variability, 5.0%) and reproductible (interassay variability, 8.2%). Measurements of renal CaBP by RIA showed a good correlation with measurements of CaBP by the chelex resin assay and by polyacrylamide gel analysis by densitometric tracing using a purified CaBP marker. The concentration of CaBP in the vitamin D-replete rat kidney is 7.3 +/- 1.0 (mean +/- SEM) micrograms/mg protein. In vitamin D-deficient rats the level of renal CaBP is 2.6 +/- 0.3 micrograms/mg protein. Tissue distribution of immunoreactive rat renal CaBP showed the highest concentration of CaBP in the rat cerebellum (38.3 +/- 5.1 micrograms/mg protein). Lower concentrations of immunoreactive CaBP were detected in several other rat tissues. No immunoreactive CaBP was detected in rat or human serum. In necropsy human kidney and cerebellum, high levels of immunoreactive CaBP were also detected (1.5 +/- 0.1 and 27.3 +/- 2.1 micrograms/mg protein, respectively). When extracts of rat kidney and brain and human cerebellum and kidney were assayed at several dilutions, immunodisplacement curves parallel to that of pure renal CaBP were observed, indicating immunochemical similarity. Fractionation of extracts of rat cerebellum, human kidney, and human cerebellum on Sephadex G-100 revealed immunoreactivity and calcium-binding activity in the 28,000 mol wt region similar to rat kidney
Willis, Michael; Kaufmann, Walter A; Wietzorrek, Georg; Hutter-Paier, Birgit; Moosmang, Sven; Humpel, Christian; Hofmann, Franz; Windisch, Manfred; Knaus, Hans-Günther; Marksteiner, Josef
2010-01-01
Cumulative evidence indicates that amyloid-beta peptides exert some of their neurodegenerative effects through modulation of L-type voltage gated calcium channels, which play key roles in a diverse range of CNS functions. In this study we examined the expression of CaV1.2 L-type voltage gated calcium channels in transgenic mice overexpressing human AbetaPP751 with the London (V717I) and Swedish (K670M/N671L) mutations by immunohistochemistry in light and electron microscopy. In hippocampal layers of wild type and transgenic mice, CaV1.2 channels were predominantly localized to somato-dendritic domains of neurons, and to astrocytic profiles with an age-dependent increase in labeling density. In transgenic animals, CaV1.2-like immunoreactive clusters were found in neuronal profiles in association with amyloid-beta plaques. Both the number and density of these clusters depended upon age of animals and number of plaques. The most striking difference between wild type and transgenic mice was the age-dependent expression of CaV1.2 channels in reactive astrocytes. At the age of 6 month, CaV1.2 channels were rarely detected in reactive astrocytes of transgenic mice, but an incremental number of CaV1.2 expressing reactive astrocytes was found with increasing age of animals and number of amyloid-beta plaques. This study demonstrates that CaV1.2 channels are highly expressed in reactive astrocytes of 12-months of age transgenic mice, which might be a consequence of the increasing amyloid burden. Further studies should clarify which functional implications are associated with the higher availability of CaV1.2 channels in late stage Alzheimer's disease.
Haines, Ricci J; Corbin, Karen D; Pendleton, Laura C; Eichler, Duane C
2012-07-27
Endothelial nitric-oxide synthase (eNOS) utilizes l-arginine as its principal substrate, converting it to l-citrulline and nitric oxide (NO). l-Citrulline is recycled to l-arginine by two enzymes, argininosuccinate synthase (AS) and argininosuccinate lyase, providing the substrate arginine for eNOS and NO production in endothelial cells. Together, these three enzymes, eNOS, AS, and argininosuccinate lyase, make up the citrulline-NO cycle. Although AS catalyzes the rate-limiting step in NO production, little is known about the regulation of AS in endothelial cells beyond the level of transcription. In this study, we showed that AS Ser-328 phosphorylation was coordinately regulated with eNOS Ser-1179 phosphorylation when bovine aortic endothelial cells were stimulated by either a calcium ionophore or thapsigargin to produce NO. Furthermore, using in vitro kinase assay, kinase inhibition studies, as well as protein kinase Cα (PKCα) knockdown experiments, we demonstrate that the calcium-dependent phosphorylation of AS Ser-328 is mediated by PKCα. Collectively, these findings suggest that phosphorylation of AS at Ser-328 is regulated in accordance with the calcium-dependent regulation of eNOS under conditions that promote NO production and are in keeping with the rate-limiting role of AS in the citrulline-NO cycle of vascular endothelial cells.
Miyai, Kentaro; Onishi, Toshikazu; Kashimada, Kenichi; Hasegawa, Yukihiro
2015-01-01
Patients with vitamin D-dependent rickets type 1A (VDDR1A) are usually treated with alfacalcidol, an analog of vitamin D. Around puberty, an increased dose of alfacalcidol is recommended for these patients to avoid hypocalcemia and secondary hyperparathyroidism. However, no indicators of secondary hyperparathyroidism except for PTH are presently known. The aim of this study is to evaluate whether urinary calcium to creatinine ratio (U-Ca/Cr) is useful as a biomarker of secondary hyperparathyroidism in VDDR1A patients in order to determine the proper dose of alfacalcidol. Two brothers with VDDR1A were recruited who had null mutations of CYP27B1 which encodes 1-alpha-hydroxylase of vitamin D. We investigated the relationship between U-Ca/Cr and intact-PTH around puberty when the brothers showed hypocalcemia with secondary hyperparathyroidism. The results were compared to those of five patients with vitamin D deficiency (VDD). As a result, high intact-PTH levels were observed when U-Ca/Cr decreased to less than 0.1 (mg/mg) in both VDDR1A brothers. This relationship was also observed in the VDD patients. However, it is necessary to take into account body calcium status, either in depletion or in excess, to accurately evaluate the relationship between U-Ca/Cr and secondary hyperparathyroidism. First, low U-Ca/Cr was detected in situations with calcium depletion without hyperparathyroidism in the VDDR1A patients. Second, high U-Ca/Cr with hyperparathyroidism could be detected theoretically in a condition of excess calcium supply. In conclusion, a U-Ca/Cr ratio of less than 0.1 (mg/mg) in VDDR1A patients is useful to accurately evaluate calcium depletion and secondary hyperparathyroidism.
Almadanim, M. Cecí lia; Alexandre, Bruno M.; Rosa, Margarida T.G.; Sapeta, Helena; Leitã o, Antó nio E.; Ramalho, José C.; Lam, TuKiet T.; Negrã o, Só nia; Abreu, Isabel A.; Oliveira, M. Margarida
2017-01-01
Calcium-dependent protein kinases (CDPKs) are involved in plant tolerance mechanisms to abiotic stresses. Although CDPKs are recognized as key messengers in signal transduction, the specific role of most members of this family remains unknown. Here
Chapter 9: Model Systems for Formation and Dissolution of Calcium Phosphate Minerals
Energy Technology Data Exchange (ETDEWEB)
Orme, C A; Giocondi, J L
2006-07-29
Calcium phosphates are the mineral component of bones and teeth. As such there is great interest in understanding the physical mechanisms that underlie their growth, dissolution, and phase stability. Control is often achieved at the cellular level by the manipulation of solution states and the use of crystal growth modulators such as peptides or other organic molecules. This chapter begins with a discussion of solution speciation in body fluids and relates this to important crystal growth parameters such as the supersaturation, pH, ionic strength and the ratio of calcium to phosphate activities. We then discuss the use of scanning probe microscopy as a tool to measure surface kinetics of mineral surfaces evolving in simplified solutions. The two primary themes that we will touch on are the use of microenvironments that temporally evolve the solution state to control growth and dissolution; and the use of various growth modifiers that interact with the solution species or with mineral surfaces to shift growth away from the lowest energy facetted forms. The study of synthetic minerals in simplified solution lays the foundation for understand mineralization process in more complex environments found in the body.
DEFF Research Database (Denmark)
Perrier, J F; Mejia-Gervacio, S; Hounsgaard, J
2000-01-01
1. The involvement of intracellular calcium and calmodulin in the modulation of plateau potentials in motoneurones was investigated using intracellular recordings from a spinal cord slice preparation. 2. Chelation of intracellular calcium with BAPTA-AM or inactivation of calmodulin with W-7 or tr...
Calcium mobilization in HeLa cells induced by nitric oxide.
Huang, Yimei; Zheng, Liqin; Yang, Hongqin; Chen, Jiangxu; Wang, Yuhua; Li, Hui; Xie, Shusen
2014-01-01
Nitric oxide (NO) has been proposed to be involved in tumor growth and metastasis. However, the mechanism by which nitric oxide modulates cancer cell growth and metastasis on cellular and molecular level is still not fully understood. This work utilized confocal microscopy and fluorescence microplate reader to investigate the effects of exogenous NO on the mobilization of calcium, which is one of the regulators of cell migration, in HeLa cells. The results show that NO elevates calcium in concentration-dependent manner in HeLa cells. And the elevation of calcium induced by NO is due to calcium influx and calcium release from intracellular calcium stores. Moreover, calcium release from intracellular stores is dominant. Furthermore, calcium release from mitochondria is one of the modulation pathways of NO. These findings would contribute to recognizing the significance of NO in cancer cell proliferation and metastasis. © Wiley Periodicals, Inc.
Edström Hägerwall, Anneli M. L.; Rydengård, Victoria; Fernlund, Per; Mörgelin, Matthias; Baumgarten, Maria; Cole, Alexander M.; Malmsten, Martin; Kragelund, Birthe B.; Sørensen, Ole E.
2012-01-01
The innate immune factors controlling Candida albicans are mostly unknown. Vulvovaginal candidiasis is common in women and affects approximately 70–75% of all women at least once. Despite the propensity of Candida to colonize the vagina, transmission of Candida albicans following sexual intercourse is very rare. This prompted us to investigate whether the post coital vaginal milieu contained factors active against C. albicans. By CFU assays, we found prominent candidacidal activity of post coital seminal plasma at both neutral and the acid vaginal pH. In contrast, normal seminal plasma did not display candidacidal activity prior to acidification. By antifungal gel overlay assay, one clearing zone corresponding to a protein band was found in both post coital and normal seminal plasma, which was subsequently identified as β-microseminoprotein. At neutral pH, the fungicidal activity of β-microseminoprotein and seminal plasma was inhibited by calcium. By NMR spectroscopy, amino acid residue E71 was shown to be critical for the calcium coordination. The acidic vaginal milieu unleashed the fungicidal activity by decreasing the inhibitory effect of calcium. The candidacidal activity of β-microseminoprotein was mapped to a fragment of the C-terminal domain with no structural similarity to other known proteins. A homologous fragment from porcine β-microseminoprotein demonstrated calcium-dependent fungicidal activity in a CFU assay, suggesting this may be a common feature for members of the β-microseminoprotein family. By electron microscopy, β-microseminoprotein was found to cause lysis of Candida. Liposome experiments demonstrated that β-microseminoprotein was active towards ergosterol-containing liposomes that mimic fungal membranes, offering an explanation for the selectivity against fungi. These data identify β-microseminoprotein as an important innate immune factor active against C. albicans and may help explain the low sexual transmission rate of Candida
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
Studies on endogenous circulating calcium entry blocker and stimulator
International Nuclear Information System (INIS)
Pang, P.K.T.; Yang, M.C.M.
1986-01-01
Several synthetic compounds have been studied extensively for their calcium entry blockade and stimulation in smooth muscles. It is hypothesized that there should be endogenous substances which control calcium entry into cells. We recently investigated the effect of some vasoactive hormones on calcium entry. Our studies on rat tail artery helical strip showed that the in vitro vasoconstriction produced by arginine vasopressin (AVP) decreased stepwise with decreasing concentration of both calcium. After exposure of the tail artery to calcium-free Ringer's solution for 1 minute or longer, the tissue lost its ability to respond to AVP. Subsequent addition of calcium to the medium produced immediate contraction. Measurements of low affinity lanthanum resistant pool of calcium with 45 Ca showed that AVP increased calcium uptake by tail artery in a dose-dependent manner. In another study rat tail artery helical strip indicated that the vasorelaxing action of parathyroid hormone (PTH) was related to an inhibition of calcium uptake. AVP or 60 mM potassium chloride increased the low affinity lanthanum resistant pool of calcium in rate tail artery and PTH inhibited the increase. In conclusion, AVP and PTH may behave like endogenous calcium entry stimulator and inhibitor respectively in vascular tissues
Energy and calcium ion dependence of proteolysis during sporulation of Bacillus subtilis cells
International Nuclear Information System (INIS)
O'Hara, M.B.; Hageman, J.H.
1990-01-01
The authors have shown, with an optimized [ 14 C]leucine-labeling and chasing procedure, that intracellular protein degradation in sporulating cells of Bacillus subtilis 168 (trpC2) is apparently energy dependent. Sodium arsenate, sodium azide, carbonyl cyanide m-chlorophenylhydrozone, and N,N'-dicyclohexylcarbodiimide, at levels which did not induce appreciable lysis (≤ 10%) over 10-h periods of sporulation, inhibited intracellular proteolysis by 13 to 93%. Exponentially growing cells acquired arsenate resistance. In contrast to earlier reports, the authors found that chloramphenicol strongly inhibited proteolysis even when added 6 h into the sporulation process. Restricting the calcium ion concentration in the medium had no effect on rates or extent of vegetative growth, strongly inhibited sporulation, and inhibited rates of proteolysis by 60% or more. Inhibitors of energy metabolism, at the same levels which inhibited proteolysis, did not affect the rate or degree of uptake of Ca 2+ by cells. Restricting the Ca 2+ concentration in the medium reduced by threefold of the specific activity in cells of the major intracellular serine proteinase after 12 h of sporulation. finally, cells of a mutant of B. subtilis bearing an insertionally inactivated gene for the Ca 2+ -dependent intracellular proteinase-1 degraded protein in chemically defined sporulation medium at a rate indistinguishable from that of the wild-type cells for period of 8 h
Joeckel, Elke; Haber, Tobias; Prawitt, Dirk; Junker, Kerstin; Hampel, Christian; Thüroff, Joachim W; Roos, Frederik C; Brenner, Walburgis
2014-02-28
The prognosis for renal cell carcinoma (RCC) is related to a high rate of metastasis, including 30% of bone metastasis. Characteristic for bone tissue is a high concentration of calcium ions. In this study, we show a promoting effect of an enhanced extracellular calcium concentration on mechanisms of bone metastasis via the calcium-sensing receptor (CaSR) and its downstream signaling molecules. Our analyses were performed using 33 (11/category) matched specimens of normal and tumor tissue and 9 (3/category) primary cells derived from RCC patients of the 3 categories: non-metastasized, metastasized into the lung and metastasized into bones during a five-year period after nephrectomy. Expression of CaSR was determined by RT-PCR, Western blot analyses and flow cytometry, respectively. Cells were treated by calcium and the CaSR inhibitor NPS 2143. Cell migration was measured in a Boyden chamber with calcium (10 μM) as chemotaxin and proliferation by BrdU incorporation. The activity of intracellular signaling mediators was quantified by a phospho-kinase array and Western blot. The expression of CaSR was highest in specimens and cells of patients with bone metastases. Calcium treatment induced an increased migration (19-fold) and proliferation (2.3-fold) exclusively in RCC cells from patients with bone metastases. The CaSR inhibitor NPS 2143 elucidated the role of CaSR on the calcium-dependent effects. After treatment with calcium, the activity of AKT, PLCγ-1, p38α and JNK was clearly enhanced and PTEN expression was almost completely abolished in bone metastasizing RCC cells. Our results indicate a promoting effect of extracellular calcium on cell migration and proliferation of bone metastasizing RCC cells via highly expressed CaSR and its downstream signaling pathways. Consequently, CaSR may be regarded as a new prognostic marker predicting RCC bone metastasis.
Directory of Open Access Journals (Sweden)
Brinton Roberta
2008-12-01
Full Text Available Abstract Background Factors that regulate intracellular calcium concentration are known to play a critical role in brain function and neural development, including neural plasticity and neurogenesis. We previously demonstrated that the neurosteroid allopregnanolone (APα; 5α-pregnan-3α-ol-20-one promotes neural progenitor proliferation in vitro in cultures of rodent hippocampal and human cortical neural progenitors, and in vivo in triple transgenic Alzheimer's disease mice dentate gyrus. We also found that APα-induced proliferation of neural progenitors is abolished by a calcium channel blocker, nifedipine, indicating a calcium dependent mechanism for the proliferation. Methods In the present study, we investigated the effect of APα on the regulation of intracellular calcium concentration in E18 rat hippocampal neurons using ratiometric Fura2-AM imaging. Results Results indicate that APα rapidly increased intracellular calcium concentration in a dose-dependent and developmentally regulated manner, with an EC50 of 110 ± 15 nM and a maximal response occurring at three days in vitro. The stereoisomers 3β-hydroxy-5α-hydroxy-pregnan-20-one, and 3β-hydroxy-5β-hydroxy-pregnan-20-one, as well as progesterone, were without significant effect. APα-induced intracellular calcium concentration increase was not observed in calcium depleted medium and was blocked in the presence of the broad spectrum calcium channel blocker La3+, or the L-type calcium channel blocker nifedipine. Furthermore, the GABAA receptor blockers bicuculline and picrotoxin abolished APα-induced intracellular calcium concentration rise. Conclusion Collectively, these data indicate that APα promotes a rapid, dose-dependent, stereo-specific, and developmentally regulated increase of intracellular calcium concentration in rat embryonic hippocampal neurons via a mechanism that requires both the GABAA receptor and L-type calcium channel. These data suggest that AP
Rodgers, Allen L.; Jackson, Graham E.
2017-04-01
Chondroitin sulfate (CS) occurs in human urine. It has several potential binding sites for calcium and as such may play an inhibitory role in calcium oxalate and calcium phosphate (kidney stone disease by reducing the supersaturation (SS) and crystallization of these salts. Urinary magnesium is also a role player in determining speciation in stone forming processes. This study was undertaken to determine the thermodynamic parameters for binding of the disaccharide unit of two different CS isomers with calcium and magnesium. These included the binding constant K. Experiments were performed using an isothermal titration calorimeter (ITC) at 3 different pH levels in the physiological range in human urine. Data showed that interactions between the CS isomers and calcium and magnesium occur via one binding site, thought to be sulfate, and that log K values are 1.17-1.93 and 1.77-1.80 for these two metals respectively. Binding was significantly stronger in Mg-CS than in Ca-CS complexes and was found to be dependent on pH in the latter but not in the former. Furthermore, binding in Ca-CS complexes was dependent on the location of the sulfate binding site. This was not the case in the Mg-CS complexes. Interactions were shown to be entropy driven and enthalpy unfavourable. These findings can be used in computational modeling studies to predict the effects of the calcium and magnesium CS complexes on the speciation of calcium and the SS of calcium salts in real urine samples.
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Wu, Yuda; Zhao, Gang; Wei, Chengye; Liu, Shuang; Fu, Yu; Liu, Xvxiong
2018-01-01
As a kind of artificial muscle intelligent material, the biological gel electric driver has the advantages of low driving voltage, large strain, good biological compatibility, good flexibility, low price, etc. The application prospect is broad and it has high academic value. Alginate, as a common substance in sea, has characteristics of low cost, green and pollution-free. Therefore,this paper obtains biological gel electric actuator by sodium alginate and calcium chloride. Effects on output force of the electric actuator is researched by changing the crosslinking of calcium chloride concentration and the output force enhancement mechanism is analyzed in this paper.
Patel, R; Rutten, K; Valdor, M; Schiene, K; Wigge, S; Schunk, S; Damann, N; Christoph, T; Dickenson, A H
2015-06-25
Prialt, a synthetic version of Ca(v)2.2 antagonist ω-conotoxin MVIIA derived from Conus magus, is the first clinically approved voltage-gated calcium channel blocker for refractory chronic pain. However, due to the narrow therapeutic window and considerable side effects associated with systemic dosing, Prialt is only administered intrathecally. N-triazole oxindole (TROX-1) is a novel use-dependent and activation state-selective small-molecule inhibitor of Ca(v)2.1, 2.2 and 2.3 calcium channels designed to overcome the limitations of Prialt. We have examined the neurophysiological and behavioral effects of blocking calcium channels with TROX-1. In vitro, TROX-1, in contrast to state-independent antagonist Prialt, preferentially inhibits Ca(v)2.2 currents in rat dorsal root ganglia (DRG) neurons under depolarized conditions. In vivo electrophysiology was performed to record from deep dorsal horn lamina V/VI wide dynamic range neurons in non-sentient spinal nerve-ligated (SNL) and sham-operated rats. In SNL rats, spinal neurons exhibited reduced responses to innocuous and noxious punctate mechanical stimulation of the receptive field following subcutaneous administration of TROX-1, an effect that was absent in sham-operated animals. No effect was observed on neuronal responses evoked by dynamic brushing, heat or cold stimulation in SNL or sham rats. The wind-up response of spinal neurons following repeated electrical stimulation of the receptive field was also unaffected. Spinally applied TROX-1 dose dependently inhibited mechanically evoked neuronal responses in SNL but not sham-operated rats, consistent with behavioral observations. This study confirms the pathological state-dependent actions of TROX-1 through a likely spinal mechanism and reveals a modality selective change in calcium channel function following nerve injury. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Roles of calcium/calmodulin-dependent kinase II in long-term memory formation in crickets.
Directory of Open Access Journals (Sweden)
Makoto Mizunami
Full Text Available Ca(2+/calmodulin (CaM-dependent protein kinase II (CaMKII is a key molecule in many systems of learning and memory in vertebrates, but roles of CaMKII in invertebrates have not been characterized in detail. We have suggested that serial activation of NO/cGMP signaling, cyclic nucleotide-gated channel, Ca(2+/CaM and cAMP signaling participates in long-term memory (LTM formation in olfactory conditioning in crickets, and here we show participation of CaMKII in LTM formation and propose its site of action in the biochemical cascades. Crickets subjected to 3-trial conditioning to associate an odor with reward exhibited memory that lasts for a few days, which is characterized as protein synthesis-dependent LTM. In contrast, animals subjected to 1-trial conditioning exhibited memory that lasts for only several hours (mid-term memory, MTM. Injection of a CaMKII inhibitor prior to 3-trial conditioning impaired 1-day memory retention but not 1-hour memory retention, suggesting that CaMKII participates in LTM formation but not in MTM formation. Animals injected with a cGMP analogue, calcium ionophore or cAMP analogue prior to 1-trial conditioning exhibited 1-day retention, and co-injection of a CaMKII inhibitor impaired induction of LTM by the cGMP analogue or that by the calcium ionophore but not that by the cAMP analogue, suggesting that CaMKII is downstream of cGMP production and Ca(2+ influx and upstream of cAMP production in biochemical cascades for LTM formation. Animals injected with an adenylyl cyclase (AC activator prior to 1-trial conditioning exhibited 1-day retention. Interestingly, a CaMKII inhibitor impaired LTM induction by the AC activator, although AC is expected to be a downstream target of CaMKII. The results suggest that CaMKII interacts with AC to facilitate cAMP production for LTM formation. We propose that CaMKII serves as a key molecule for interplay between Ca(2+ signaling and cAMP signaling for LTM formation, a new role of Ca
Hu, Xiaoqin; You, Huiyan
2009-11-01
In capillary electrophoresis, 0-40 kV (even higher) voltage can be reached by a connecting double-model high voltage power supply. In the article, water-soluble vitamins, VB1, VB2, VB6, VC, calcium D-pantothenate, D-biotin, nicotinic acid and folic acid in vegetable, were separated by using the high voltage power supply under the condition of electrolyte water solution as running buffer. The separation conditions, such as voltage, the concentration of buffer and pH value etc. , were optimized during the experiments. The results showed that eight water-soluble vitamins could be baseline separated in 2.2 min at 40 kV applied voltage, 25 mmol/L sodium tetraborate buffer solution (pH 8.8). The water-soluble vitamins in spinach were quantified and the results were satisfied. The linear correlation coefficients of the water-soluble vitamins ranged from 0.9981 to 0.9999. The detection limits ranged from 0.2 to 0.3 mg/L. The average recoveries ranged from 88.0% to 100.6% with the relative standard deviations (RSD) range of 1.15%-4.13% for the spinach samples.
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yong Pil; Kim, Hyung Gyun [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of); Hien, Tran Thi [College of Pharmacy, Chosun University, Gwangju (Korea, Republic of); Jeong, Myung Ho [Heart Research Center, Chonnam National University Hospital, Gwangju (Korea, Republic of); Jeong, Tae Cheon, E-mail: taecheon@ynu.ac.kr [College of Pharmacy, Yeungnam University, Gyungsan (Korea, Republic of); Jeong, Hye Gwang, E-mail: hgjeong@cnu.ac.kr [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of)
2011-11-15
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-{alpha}-stimulated monocytes to endothelial cells and suppressed the TNF-{alpha} induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-{alpha}-induced nuclear factor-{kappa}B activation, which was attenuated by pretreatment with N{sup G}-nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: Black-Right-Pointing-Pointer Puerarin induced the phosphorylation of eNOS and the production of NO. Black-Right-Pointing-Pointer Puerarin activated eNOS through ER-dependent PI3-kinase and Ca{sup 2+}-dependent AMPK. Black-Right-Pointing-Pointer Puerarin-induced NO was involved in the inhibition of NF-kB activation. Black-Right-Pointing-Pointer Puerarin may help for prevention of vascular dysfunction and diabetes.
Liu, Yang; Lin, Changmin; Zeng, Yang; Li, Haihong; Cai, Bozhi; Huang, Keng; Yuan, Yanping; Li, Yu
2016-01-01
This study aimed to develop and evaluate barium and calcium microcapsules as candidates for scaffolding in artificial dermal papilla. Dermal papilla cells (DPCs) were isolated and cultured by one-step collagenase treatment. The DPC-Ba and DPC-Ca microcapsules were prepared by using a specially designed, high-voltage, electric-field droplet generator. Selected microcapsules were assessed for long-term inductive properties with xenotransplantation into Sprague-Dawley rat ears. Both barium and calcium microcapsules maintained xenogenic dermal papilla cells in an immunoisolated environment and induced the formation of hair follicle structures. Calcium microcapsules showed better biocompatibility, permeability, and cell viability in comparison with barium microcapsules. Before 18 weeks, calcium microcapsules gathered together, with no substantial immune response. After 32 weeks, some microcapsules were near inflammatory cells and wrapped with fiber. A few large hair follicles were found. Control samples showed no marked changes at the implantation site. Barium microcapsules were superior to calcium microcapsules in structural and mechanical stability. The cells encapsulated in hydrogel barium microcapsules exhibited higher short-term viability. This study established a model to culture DPCs in 3D culture conditions. Barium microcapsules may be useful in short-term transplantation study. Calcium microcapsules may provide an effective scaffold for the development of artificial dermal papilla.
Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter
Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.;
2012-01-01
At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.
Calcium-dependent behavioural responses to acute copper exposure in Oncorhynchus mykiss
DEFF Research Database (Denmark)
Poulsen, S.B.; Svendsen, Jon Christian; Aarestrup, Kim
2014-01-01
Using rainbow trout Oncorhynchus mykiss, the present study demonstrated that: (1) calcium (Ca) increased the range of copper (Cu) concentrations that O. mykiss avoided; (2) Ca conserved the maintenance of pre-exposure swimming activity during inescapable acute (10 min) Cu exposure. Data showed th...