WorldWideScience

Sample records for ucla lara state

  1. Leishmania species identification using FTA card sampling directly from patients' cutaneous lesions in the state of Lara, Venezuela.

    Science.gov (United States)

    Kato, Hirotomo; Watanabe, Junko; Mendoza Nieto, Iraida; Korenaga, Masataka; Hashiguchi, Yoshihisa

    2011-10-01

    A molecular epidemiological study was performed using FTA card materials directly sampled from lesions of patients with cutaneous leishmaniasis (CL) in the state of Lara, Venezuela, where causative agents have been identified as Leishmania (Viannia) braziliensis and L. (Leishmania) venezuelensis in previous studies. Of the 17 patients diagnosed with CL, Leishmania spp. were successfully identified in 16 patients based on analysis of the cytochrome b gene and rRNA internal transcribed spacer sequences. Consistent with previous findings, seven of the patients were infected with L. (V.) braziliensis. However, parasites from the other nine patients were genetically identified as L. (L.) mexicana, which differed from results of previous enzymatic and antigenic analyses. These results strongly suggest that L. (L.) venezuelensis is a variant of L. (L.) mexicana and that the classification of L. (L.) venezuelensis should be reconsidered. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  2. CHARACTERIZATION OF THE PUBLIC AND MASSIVE CONSTRUCTION OF SOCIAL INTEREST HOUSES DEVELOPED SINCE 2005 IN LARA STATE. VENEZUELA

    Directory of Open Access Journals (Sweden)

    José Antonio Lucena

    2018-04-01

    Full Text Available The main objective of this research is the public and massive construction of social interest housing, executed between 2005 and 2015 in the Iribarren and Palavecino municipalities of Lara State, Venezuela, in order to continue the investigation carried out in the years between 1994 and 2005, through the determination of evaluation parameters related to the design and construction characteristics of town planning and housing. It is a field research, not experimental descriptive, the representation shows 355 houses in 5 urbanisms. The relevant results showed a better architectural distribution of the houses than the ones developed in previous years, it showed an 80 % of urban equipment, 20,56% of the houses enclosures problems, 26,42% problems related to the soil, 16.9% reveals the entry of rain water and through windows 12.68% presents rain water entry through the door. Although the percentages of housing failures have been reduced, the percentages of faults in infrastructure services have increased, that is, better homes that lack basic services have been built. Recommending taking advantage of the identified opportunities for improvement.

  3. Validación de "infarto de miocardio" como causa de muerte en certificados de defunción, Barquisimeto, Estado Lara, Venezuela Validation of "myocardial infarction" as cause of death on death certificates in Barquisimeto, Lara state, Venezuela

    Directory of Open Access Journals (Sweden)

    Ricardo Granero

    1997-09-01

    Full Text Available Las tasas de mortalidad por cardiopatía isquémica (CI han sido utilizadas ampliamente en el diagnóstico de la salud cardiovascular de regiones y países. Sin embargo, su validez ha sido cuestionada fundamentalmente por lo que le da origen: el certificado de defunción (CDD. El presente estudio tiene el objetivo de establecer la validez del diagnóstico "infarto de miocardio (IM" como causa de muerte en los CDD de muertes intra-hospitalarias en la ciudad de Barquisimeto, Estado Lara, Venezuela. Entre julio de 1991 y junio de 1992, se identificaron todos los CDD con las características mencionadas, se trató de ubicar la historia clínica correspondiente a cada caso y cualquier otra información clínica pertinente. Se registraron 247 CDD elegibles y se ubicó información clínica adecuada en 136 casos (55%. Aplicando los criterios del Proyecto MONICA, se encontraron M-definitivo en 62 casos (45,6%, IM-probable en 31 casos (22,8% y No-IM en 43 casos (31,6%. Los resultados indican que existe un sobre registro de casos de muerte por IM del 32% (intervalo de confianza del 95% = 23,8-39,4. A la luz de estos resultados es necesario estudiar los factores que inciden en la exactitud de los diagnósticos IM en los CDD. Con esto tendríamos elementos para revisar las normas y los procedimientos empleados en la producción y manejo de los CDD, así como preparar un programa de educación para mejorar la precisión de los mismos.Death rates due to Ischemic Heart Disease (IHD are widely used to assess regional and national cardiovascular health status. However, their validity is questionable, essentially because they are based on death certificates (DCs. The present study was conducted in the Greater Metropolitan Area of Barquisimeto (Lara State, Venezuela, from June 1991 to July 1992. The purpose was to establish the validity of the diagnosis of myocardial infarction in DCs of intrahospital deaths. Efforts were made to locate all clinical charts and any

  4. Necesidades de aprendizaje sobre drogadicción en médicos generales integrales venezolanos de Lara (2007 Needs of learning on drug addiction in Venezuelan integral general physicians from Lara state (2007

    Directory of Open Access Journals (Sweden)

    Morayma Zulueta Yate

    2012-03-01

    of Iribarren municipality in Lara State, Venezuela. Methods: a retrospective, cross-sectional and descriptive study was conducted from December, 2006 to June, 2007. Study universe included 46 physicians working in consulting rooms of this municipality. To data collection a survey was applied previous informed consent. Absolute numbers and percentages were used as a measure by each variable used. Results: there was predominance of 28 physicians with a 6 and 10 years working experience for a 60.9 %. Total of physicians recognized as drugs the marihuana, heroin and cocaine. All declared that only the ill patient must to receive priority; also, the was predominance of the criterion that the treatment must to be applied when the patient is hospitalized for a 56.6 %. The was an scanty experience on the management of these patients for a 91.3 % and the 100 % of polled persons declared its total knowledge of the existence of the Drug Addiction National Program. Conclusions: there is a scanty knowledge regarding the management of drug addiction in the primary health care; the needs of learning by Venezuelan integral general physicians were identified.

  5. Suicidal ideation among students of the 7th, 8th, and 9th grades in the State of Lara, Venezuela: the Global School Health Survey.

    Science.gov (United States)

    Granero, Ricardo; Poni, Esteban; Poni, Carolin

    2008-12-01

    Suicidal behavior among adolescents is not a well-explored public health problem. Health policy decision-making on suicidal behavior needs reliable information on the prevalence of suicidal ideation (SI) and its associated risk factors to produce health promotion and prevention programs. The Global School Health Survey is a self-administered survey done on a random probabilistic sample among students of the 7th, 8th, and 9th grades in the Lara State, Venezuela, school period 2003 to 2004. Point prevalence of SI and associated factors were included and the odds (OR) of having SI was calculated given selected factors. Two-thousand seventy (2070) respondents, of which 13.5 % reported having SI in the last 12 months, and in females more than males (14.6% vs. 11.7%). The OR for SI, according to an associated risk factor, were among (a) females: age > or = 14 years (2.2), worries (3.42), loneliness (8.8), ever had sexual intercourse (5.58), alcohol (8.43) and (b) males: having only one or non close friends (3.69), alcohol (12.36), ever had sexual intercourse (2.73). Behavioral risk factors are relatively new in the field of surveillance systems; therefore, results on SI should be cautiously taken into consideration and a wide discussion should be encouraged as we learn how to best use the results for health promotion and disease prevention.

  6. Cambios en el uso de tabaco y factores relacionados en estudiantes del sexto al noveno grado, Estado Lara, Venezuela, años 2000 y 2003 Changes in tobacco use and related factors in Junior High School students, Lara State, Venezuela, 2000-2003

    Directory of Open Access Journals (Sweden)

    Ricardo Granero

    2006-09-01

    Full Text Available La Encuesta Mundial sobre Tabaquismo en Jóvenes (EMTAJOVEN, sistema de vigilancia basado en la escuela elemental, fue realizada en el Estado Lara, Venezuela, por una coalición de organizaciones. El instrumento incluye: actitudes, conocimientos, conductas; acceso a productos, propaganda y exposición al humo de tabaco en el ambiente. Participación 85,7% (2000 y 79,3% (2003. Prevalencias (% 2000 vs. 2003 de: "primer contacto con tabaco": sin cambios (22,8% y 22,8%; "Fumar su primer cigarrillo antes los 10 años": disminuyó en varones (21,5% y 16,7%; "Fumadores actuales": sin cambio (8,4% y 8,3%; "Fumadores que desean dejarlo": aumentó en varones (62,6% y 84,7%; "Expuestos al humo de tabaco en el ambiente en lugares públicos": aumentó (43,9% y 50,7%; "Apoya prohibir fumar en lugares públicos": sin cambios(> 80% ambos,; "Recibieron cigarrillos promocionales gratis": aumentó (9,5% a 13,4%. "No tuvieron problema al comprar": disminuyó en varones (97% y 74,3% y mujeres (95,9% y 90,3%. El tabaquismo se mantiene sin cambios lo que puede imputarse al mercadeo y a la falta de efectividad de las leyes. Los datos presentados permiten examinar políticas y programas actuales a fin de ajustarlos a la realidad.The Global Youth Tobacco Survey (GYTS is a school-based surveillance system. In Lara State, Venezuela, it was conducted by a coalition of organizations. The instrument includes: attitudes, knowledge, behaviors, exposure to environmental tobacco smoke, mass media, and marketing. Participation was 85.7% in 2000 and 79.3% in 2003. Comparing prevalence (% from 2000 to 2003: "first contact": unchanged (22.8%; "males having first cigarette before the age of 10": decreased (21.5% to 16.7%; "current cigarette smoker": unchanged (8.4% to 8.3%; "male smokers wanted to quit": increased (62.6% to 84.7%; "exposure to environmental tobacco smoke": increased (43.9% a 50.7%, "support ban on smoking in public places": unchanged (> 80%, "received free promotional

  7. APORTE PATRIMONIAL A PARTIR DEL PROCESO INMIGRATORIO CANARIO EN VENEZUELA Y EL ESTADO LARA ENTRE 1961 Y 1981

    OpenAIRE

    Pastrán Calles, Félix Reinaldo

    2017-01-01

    FULL TITLE PATRIMONIAL CONTRIBUTION FROM THE CANARY IMMIGRATION PROCESS IN VENEZUELA AND THE LARA STATE FROM 1961 TO 1981 RESUMEN El presente articulo tiene como objetivo reconocer el aporte patrimonial a partir del proceso inmigratorio canario en Venezuela y el Estado Lara, durante el periodo 1961 hasta 1981, periodo que abarca una amplitud de beneficios y desarrollo como resultado de acciones de canarios dentro del espacio geográfico venezolano. Metodológicamente se aplican los funda...

  8. Phlebotominae de Venezuela: Lutzomyia amilcari sp.n. del estado Lara

    Directory of Open Access Journals (Sweden)

    Conrado Arredondo Cardona

    1984-03-01

    Full Text Available Se describe el macho de Lutzomyia amilcari sp.n. capturado en el Parque Nacional de Yacambú, Distrito Andrés Eloy Blanco, Estado Lara, Venezuela. La especie puede ser identificada por la forma característica del parámetro. Pertenece al grupo Verrucarum, serie Verrucarum de Theodor (1965.A description is given of the male of Lutzomyia amilcari sp.n. who was collected in the National Park of Yacambú, State of Lara, Venezuela. This species is identified by the characteristic form of the paramere. It belongs to the Verrucarum Group, Verrucarum Series of Theodor (1965.

  9. Identificación de ectoparásitos en Oso melero (Tamandua tetradactyla), Estado Lara, Venezuela

    OpenAIRE

    Forlano R, María; Mujica L, Franklin; Gallardo Y, Johanmary; Rodríguez L, José

    2013-01-01

    Objetivo. Identificar especies de ectoparásitos encontrados parasitando naturalmente un Oso melero, el cual fue encontrado muriendo en una vía cercana al pueblo de Bobare, estado Lara, Venezuela. Materiales y métodos. Al ingresar el animal a la sala de anatomía del DCV-UCLA para ser sometido a la técnica de taxidermia, se procedió a revisar a través de la palpación toda la superficie corporal del Oso, con la finalidad de tomar muestras de ectoparásitos presentes en el hospedador; los especíme...

  10. Quem pode resistir a Lara Croft? Você? Who can resist Lara Croft? You?

    Directory of Open Access Journals (Sweden)

    Cláudio Lúcio Mendes

    2008-04-01

    Full Text Available Este artigo discute como o jogo eletrônico Tomb Raiderconstrói processos de subjetivação em relação a gênero e sexualidade. Para desenvolver essa discussão, duas questões foram centrais: quem esse jogo imagina que 'você' seja? Quem esse jogo propõe que 'você' seja? Ambas foram construídas com base em teorizações foucaultianas sobre os processos de subjetivação, conjuntamente com a noção de "modo de endereçamento" desenvolvido por Elizabeth Ellsworth e algumas discussões sobre gênero e sexualidade. Pautando-se nisso, buscou-se mostrar como marcas de gênero e sexualidade, culturalmente construídas, são empregadas nas elaborações da personagem central do jogo: Lara Croft. Contudo, conclui-se que tais marcas não configuram escolhas entre possíveis, mas são criações e invenções, tanto por parte dos elaboradores quanto pelos jogadores.This article discusses how the electronic game Tomb Raider constructs processes of subjectivation in relation to gender and sexuality. To develop this argument, two main questions were taken: Who does this game imagine 'you' are? Who does this game suggest 'you' to be? Both were built based on the Foucaultian Theory about processes of subjectivation, together with the concept of 'mode of address', developed by Elizabeth Ellsworth and some discussions about gender and sexuality. Based on this, this investigation wants to show how culturally built marks of gender and sexuality are used on elaborations of the main character of the game: Lara Croft. However, in conclusion, those marks cannot set the possible choices up, but are creations and inventions made by the game designers and the players.

  11. Flebotomofauna al sureste del estado Lara, Venezuela

    Directory of Open Access Journals (Sweden)

    Luis Eduardo Traviezo

    2006-10-01

    Full Text Available Introducción. El reporte de 522 casos de leishmaniasis cutánea americana entre los años1988 al 2002 en el estado Lara (específicamente al sureste donde hubo un repunte, motivó elestudio de los vectores implicados en la transmisión. Objetivos. Determinar la abundancia, diversidad y distribución de flebótomos durante un añoen 11 poblaciones situadas entre los 600 y 1600 metros sobre el nivel del mar, relacionandosu abundancia con elementos climáticos. Materiales y métodos. Para las capturas se utilizaron trampas CDC (18:00 a 06:00 horascolocadas en zonas domésticas, peridomésticas y selváticas de casas donde hubo casos deleishmaniasis cutánea y se utilizó trampa Shannon en los alrededores de éstas, entre las19:30 y las 22:50 horas. Resultados. Se identificaron 10.326 ejemplares (8.867 hembras y 1.459 machos con unadiversidad de 11 especies, siendo Lutzomyia youngi (Feliciangeli & Murillo 1987, la másabundante con un 96,54%, seguida de Lutzomyia ovallesi (Ortiz, 1952 con 2,9%,caracterizándose L. youngi por tener predilección por los ambientes peridomésticos y seapreció mayor actividad desde las 19:30 a las 20:30 horas (Shannon. La población de LasMaticas (1360 msnm presentó la mayor abundancia, con un pico anual que coincidió con elfinal del verano, las primeras lluvias del invierno (régimen unimodal, la mayor temperaturamedia mensual del año (24°C y la menor humedad mensual del año (70%. Conclusión. Esta información permite conocer la población, ambiente y época del año dondese incremente la probabilidad de transmisión de la enfermedad, por la abundancia de lasespecies vectoras.

  12. Gabriele D'Annunzio, Pleasure, translated and annotated by Lara ...

    African Journals Online (AJOL)

    User

    Page 1 ... translation, Lara Gochin Raffaelli was driven to produce a new and much improved translation of this ... Harding translation. By minimizing the novel's overwhelming eroticism and excluding allusions that might offend Victorian sensibilities, as well as passages deemed to be too intellectual for the genre, the text ...

  13. UCLA accelerator research ampersand development. Progress report

    International Nuclear Information System (INIS)

    1997-01-01

    This report discusses work on advanced accelerators and beam dynamics at ANL, BNL, SLAC, UCLA and Pulse Sciences Incorporated. Discussed in this report are the following concepts: Wakefield acceleration studies; plasma lens research; high gradient rf cavities and beam dynamics studies at the Brookhaven accelerator test facility; rf pulse compression development; and buncher systems for high gradient accelerator and relativistic klystron applications

  14. Laser wakefields at UCLA and LLNL

    International Nuclear Information System (INIS)

    Mori, W.B.; Clayton, C.E.; Joshi, C.; Dawson, J.M.; Decker, C.B.; Marsh, K.; Katsouleas, T.; Darrow, C.B.; Wilks, S.C.

    1991-01-01

    The authors report on recent progress at UCLA and LLNL on the nonlinear laser wakefield scheme. They find advantages to operating in the limit where the laser pulse is narrow enough to expel all the plasma electrons from the focal region. A description of the experimental program for the new short pulse 10 TW laser facility at LLNL is also presented

  15. LARA: Expert system for acoustic localization of robot in a LMFBR

    International Nuclear Information System (INIS)

    Lhuillier, C.; Malvache, P.

    1986-12-01

    The expert system LARA (Acoustic Localization of Autonomic Robot) has been developed to show the interest of introducing artificial intelligency for fine automatic positioning of refuelling machine in a LMFBR reactor. LARA which is equipped with an acoustic detector gives rapidly a good positioning on the fuel [fr

  16. UCLA accelerator research and development

    International Nuclear Information System (INIS)

    Cline, D.B.

    1992-01-01

    This progress report covers work supported by the above DOE grant over the period November 1, 1991 to July 31, 1992. The work is a program of experimental and theoretical studies in advanced particle accelerator research and development for high energy physics applications. The program features research at particle beam facilities in the United States and includes research on novel high power sources, novel focussing systems (e.g. plasma lens), beam monitors, novel high brightness, high current gun systems, and novel flavor factories in particular the φ Factory

  17. Juegos de Palo en Lara. Elementos para la historia social de un arte marcial venezolano

    Directory of Open Access Journals (Sweden)

    Röhrig Assunção, Matthias

    1999-04-01

    Full Text Available This article situates Venezuelan stick fighting among the wider field of European and Afro-American martial arts. The author analyses the different forms used since the early 19th century by men in the rural areas of the state of Lara, where it is still practised today. Whereas the Juego de Garrote serves recreational and sportive purposes, the Juego de Batalla is part of a broader devotion to Saint Anthony. The criminal records show how the use of the fighting stick in the period 1880-1930 allowed the construction of a male identity (the «guapo» through the frequent fights between men.

    Este trabajo intenta situar a los juegos de palo venezolanos dentro de una perspectiva más amplia de las artes marciales europeas y afro-americanas. Analiza las diferentes modalidades practicadas desde el siglo XIX por los hombres del campo en Lara, Estado donde se conservó su práctica hasta hoy en día. Mientras el Juego de Garrote servía y sirve para fines recreativos y deportivos, el Juego de Batalla era y es parte de la devoción a San Antonio. Los procesos criminales muestran cómo el uso del garrote permitió la construcción de una identidad masculina («el guapo» a través de las frecuentes riñas entre hombres en el período 1880-1930.

  18. The First Record Of The Salticid Spiders Sibianor larae And S. tantulus (Aranei, Salticidae In Ukraine

    Directory of Open Access Journals (Sweden)

    Evtushenko K. V.

    2015-04-01

    Full Text Available Two species of salticid spiders Sibianor larae Logunov, 2000 and S. tantulus (Simon, 1868 were revealed as a result of verification of collected samples from the forest zone of Ukraine. Th e redefined specimens were previously identify ed as S. aurocinctus (Ohlert, 1865. Specimens of S. aurocinctus were not found in the material. Geographic coordinates of localities and description of S. larae and S. tantulus habitats are provided.

  19. PACS module image communication at UCLA

    International Nuclear Information System (INIS)

    Stewart, B.K.; Taira, R.K.; Cho, P.S.; Mankovich, N.J.

    1987-01-01

    The advent of the ACR-NEMA digital and communication standard for PACS implementation between imaging, storage and display devices may simplify the networking problems inherent to PACS in the future. However, since the ACR-NEMA interface has not been implemented in manufactured products, the components of a PACS at the present time use various network interface designs, requiring substantial effort in the area of hardware and software integration. Many communication systems are used for the PACS implementation in Pediatric Radiology at UCLA, including baseband, broadband, as well as various parallel-line interface protocols, e.g. GP-IB. A VAX 11/750 minicomputer serves as the host computer for the UCLA Pediatric Radiology PACS system. Communication between the many peripherals take place through the host computer, which acts as the central node. Several communication links have been established, primarily: host computer to other local computers, image processors, various peripherals (digitizers, storage media, etc.) and, of course, to the 512, 1024 and 2048 viewing stations

  20. CNR LARA project, Italy: Airborne laboratory for environmental research

    Science.gov (United States)

    Bianchi, R.; Cavalli, R. M.; Fiumi, L.; Marino, C. M.; Pignatti, S.

    1995-01-01

    The increasing interest for the environmental problems and the study of the impact on the environment due to antropic activity produced an enhancement of remote sensing applications. The Italian National Research Council (CNR) established a new laboratory for airborne hyperspectral imaging, the LARA Project (Laboratorio Aero per Ricerche Ambientali - Airborne Laboratory for Environmental Research), equipping its airborne laboratory, a CASA-212, mainly with the Daedalus AA5000 MIVIS (Multispectral Infrared and Visible Imaging Spectrometer) instrument. MIVIS's channels, spectral bandwidths, and locations are chosen to meet the needs of scientific research for advanced applications of remote sensing data. MIVIS can make significant contributions to solving problems in many diverse areas such as geologic exploration, land use studies, mineralogy, agricultural crop studies, energy loss analysis, pollution assessment, volcanology, forest fire management and others. The broad spectral range and the many discrete narrow channels of MIVIS provide a fine quantization of spectral information that permits accurate definition of absorption features from a variety of materials, allowing the extraction of chemical and physical information of our environment. The availability of such a hyperspectral imager, that will operate mainly in the Mediterranean area, at the present represents a unique opportunity for those who are involved in environmental studies and land-management to collect systematically large-scale and high spectral-spatial resolution data of this part of the world. Nevertheless, MIVIS deployments will touch other parts of the world, where a major interest from the international scientific community is present.

  1. Conversation with Lara about the Earth and Land. (Spanish Title: Conversando con Lara sobre la Tierra y la Teirra.) Conversando com Lara sobre a Terra e a Terra

    Science.gov (United States)

    da Conceição Barbosa-Lima, Maria

    2010-12-01

    The present article is the analysis of a conversation between the author and Lara, a four-yearold- girl, enrolled in nursery school, while she makes a drawing of the Earth. It took place outside school environment and without any other person around to avoid interference during the interview. According to Ferreira & Silva (2004), a researcher can only comprehend a child's drawing, or form, by listening to him/her while he/she is creating it. Lara presented the traditional flat drawing, picturing the sky parallel to the ground, as reported by Nardi & Carvalho (1996). However, when asked to draw the World - term used by Butterworth et al. (2002), in order to avoid unnecessary confusion - she represented it by a circle, with herself on the surface. Her drawings led to the conclusion that such girl does not know yet the World in which she lives is the Earth, and probably because of that, within her age and consequent maturity, she accurately differentiates the concepts of land and Earth. El presente artículo analiza una entrevista libre, mientras una niña de 4 años y 4 meses, matriculada en el pregrado, dibuja la Tierra. Esta entrevista se realizó fuera del ambiente escolar y sin otra persona alrededor que pudiera interferir. De acuerdo con Ferreira Silva (2004), para quien investiga es posible conocer realmente lo que un niño o una niña pone en el papel a través de grafismos y/o dibujos si se lo escucha durante el proceso de creación de la escritura con imágenes. La niña, en este caso, representa la Tierra con el tradicional dibujo plano y el "cielo" paralelo al suelo, conforme analizaron Nardi & Carvalho (1996). Pero, cuando se Le solicita dibujar el "Mundo" - palabra empleada en un trabajo de Butterworth et al. (2002), con intención de no provocar "confusiones" innecesarias a sus sujetos de investigación- lo representa de forma circular, poniéndose sobre su superficie. Sus dibujos llevan a concluir que esta niña aún no tiene conocimiento que el mundo

  2. UCLA Translational Biomarker Development Program (UTBD)

    Energy Technology Data Exchange (ETDEWEB)

    Czernin, Johannes [Univ. of California, Los Angeles, CA (United States)

    2014-09-01

    The proposed UTBD program integrates the sciences of diagnostic nuclear medicine and (radio)chemistry with tumor biology and drug development. UTBD aims to translate new PET biomarkers for personalized medicine and to provide examples for the use of PET to determine pharmacokinetic (PK) and pharmacodynamic (PD) drug properties. The program builds on an existing partnership between the Ahmanson Translational Imaging Division (ATID) and the Crump Institute of Molecular Imaging (CIMI), the UCLA Department of Chemistry and the Division of Surgical Oncology. ATID provides the nuclear medicine training program, clinical and preclinical PET/CT scanners, biochemistry and biology labs for probe and drug development, radiochemistry labs, and two cyclotrons. CIMI provides DOE and NIH-funded training programs for radio-synthesis (START) and molecular imaging (SOMI). Other participating entities at UCLA are the Department of Chemistry and Biochemistry and the Division of Surgical Oncology. The first UTBD project focuses on deoxycytidine kinase, a rate-limiting enzyme in nucleotide metabolism, which is expressed in many cancers. Deoxycytidine kinase (dCK) positive tumors can be targeted uniquely by two distinct therapies: 1) nucleoside analog prodrugs such as gemcitabine (GEM) are activated by dCK to cytotoxic antimetabolites; 2) recently developed small molecule dCK inhibitors kill tumor cells by starving them of nucleotides required for DNA replication and repair. Since dCK-specific PET probes are now available, PET imaging of tumor dCK activity could improve the use of two different classes of drugs in a wide variety of cancers.

  3. Laras concept and its triggers: A case study on garap of jineman Uler Kambang

    Directory of Open Access Journals (Sweden)

    Widodo Widodo

    2017-06-01

    Full Text Available Laras is one unresolved aesthetic concept and gendhing garap models as the triggers have not been identified yet either. This paper is a case study which discusses a case of jineman garap Uler Kambang pélog lima, the first winner of Sindhèn Idol contest 2012, which is considered to have the most qualified performance to meet laras criteria. The purpose of this research is to figure out the laras concept construction and identify the gendhing garap models as its triggers. Laras concept reconstruction within the aesthetic framework of Javanese karawitan and identification of gendhing garap model are discussed based on concept of garap in Javanese karawitan. This research uses a qualitative-descriptive method. The results show that laras is a beautiful, delicate, and deep karawitan sense containing elements of mat, lega, betah, adhem, ayem, tentrem, jinem, sengsem, and marem. The triggering gendhing garap models include: garap of leres, rempeg, greget-urip, and sarèh-sumèlèh.

  4. Providing experiential information on early medical abortion: a qualitative evaluation of an animated personal account, Lara's Story.

    Science.gov (United States)

    Sherman, Sarah; Harden, Jeni; Cattanach, Dawn; Cameron, Sharon T

    2017-10-01

    An animated film has been created to provide information to women requesting early medical abortion (EMA). The 9 min film, Lara's Story , was created using one woman's personal account of her experience. This study evaluated the views of women who had recently undergone EMA on the film and its potential usefulness in providing experiential information to women requesting EMA. Women who had undergone EMA within the past month were recruited. They were shown the film and interviewed in a semi-structured style. Interviews were recorded and transcribed verbatim. They were analysed using cross-sectional indexing and thematic analysis with an inductive approach. 13 women were interviewed. All reported that the film gave a realistic account of EMA and most agreed that they would have wanted to watch it before EMA had it been available. Some said that it might help women who were struggling with decision-making with regard to EMA and all said that there should be unrestricted access to the film from the website of the abortion service. The women commented that the animated style of the film allowed all groups of women to relate to the story. Some commented that Lara's experience of pain, bleeding and side effects such as nausea differed from their own and therefore felt that it would be useful to make more than one woman's account available. The availability of animated audiovisual films recounting women's experiences of EMA might be a valuable adjunct to clinical information for women seeking EMA. © Faculty of Sexual and Reproductive Healthcare of the Royal College of Obstetricians and Gynaecologists (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. REFORMA/UCLA Mentor Program: A Mentoring Manual.

    Science.gov (United States)

    Tauler, Sandra

    Although mentoring dates back to Greek mythology, the concept continues to thrive in today's society. Mentoring is a strategy that successful people have known about for centuries. The REFORMA/UCLA Mentor Program has made use of this strategy since its inception in November 1985 at the Graduate School of Library and Information Science at the…

  6. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Musumeci, P. [UCLA Department of Physics and Astronomy, 475 Portola Plaza, Los Angeles, CA 90095-1547 (United States)], E-mail: musumeci@physics.ucla.edu; Moody, J.T.; Scoby, C.M. [UCLA Department of Physics and Astronomy, 475 Portola Plaza, Los Angeles, CA 90095-1547 (United States)

    2008-10-15

    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10{sup 7}-10{sup 8} electrons packed in bunches of {approx}100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics.

  7. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory

    International Nuclear Information System (INIS)

    Musumeci, P.; Moody, J.T.; Scoby, C.M.

    2008-01-01

    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10 7 -10 8 electrons packed in bunches of ∼100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics

  8. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory.

    Science.gov (United States)

    Musumeci, P; Moody, J T; Scoby, C M

    2008-10-01

    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10(7)-10(8) electrons packed in bunches of approximately 100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics.

  9. Improving determination of the Martian rotation parameters through the synergy between LaRa and RISE radioscience experiments

    Science.gov (United States)

    Le Maistre, S.; Péters, M. J.; Yseboodt, M.; Dehant, V. M. A.

    2017-12-01

    The LaRa experiment consists of a transponder onboard the ExoMars mission that has been designed to obtain two-way Doppler shift measurements from a X-band radiolink between the lander on Mars and the ground stations on Earth. LaRa is planned to last at least one Earth year and should begin to operate from January 2021. RISE is another transponder onboard the InSight mission. This NASA experiment should last at least one Martian year starting from November 2018. The Doppler measurements are used to obtain the Mars' orientation and rotation parameters (MOP) i.e. the length-of-day (LOD) variations, the precession rate and the nutations of the rotation axis, and the polar motion. One of the major objectives of LaRa is to improve our knowledge of the deep interior of Mars by precisely measuring the signature of the liquid core in the nutations. In this study, we performed numerical simulations of these Doppler measurements in order to evaluate the impact on the determination of the MOP and the gain in precision provided by the synergy between both LaRa and RISE experiments. We used the GINS (Géodésie par Intégrations Numériques Simultanées) software implemented by the CNES and further developed at ROB for planetary geodesy applications. We assess the advantage of having the LaRa experiment in a row or at the same time as RISE experiment by considering the following scenarios for comparison: RISE and LaRa alone, RISE followed by LaRa, LaRa together with RISE. In this way, we study the impact of an improved Doppler geometry induced by the involvement of two landers instead of one. The Doppler geometry is a fundamental aspect of radioscience experiments. It affects the measurement sensitivity to the MOP and is thereby an important factor in their determination. The variety of the geometry (especially the azimuth) provided by its omnidirectional patch antenna is a strength of LaRa compared to RISE (two directional horn antennas) that allows to improve the MOP

  10. Contaminación enteroparasitaria de lechugas expendidas en mercados del estado Lara. Venezuela

    OpenAIRE

    TRAVIEZO-VALLES, LUIS; DÁVILA, JUAN; RODRÍGUEZ, RICARDO; PERDOMO, OMAIRA; PÉREZ, JOSÉ

    2004-01-01

    Para determinar la contaminación de lechugas con enteroparásitos, se analizaron 100 muestras (50 lechuga americana y 50 lechuga romana) cultivadas en tres lugares distintos, Timotes y Bailadores (estado Mérida) y Chejendé (estado Trujillo) y expendidas en cuatro mercados diferentes del estado Lara: Terepaima, Cabudare, Las Trinitarias y Central. Las lechugas fueron procesadas según la técnica de Álvarez et al, modificada, detectando contaminación en el 29% de las muestras (16 LA y 13 LR) iden...

  11. Analysis of material removed from UCLA tokamaks Microtor and Macrotor

    International Nuclear Information System (INIS)

    Baer, D.R.; Thomas, M.T.; Taylor, R.J.

    1979-02-01

    This paper reports a first effort to examine the surface of the UCLA tokamaks, Microtor and Macrotor, by analyzing samples that have been exposed to plasma discharge and cleaning for long periods. The samples were sent to the Surface Science Section at the Pacific Northwest Laboratory (PNL). There, Auger electron spectrometry and sputter profile techniques were used to examine the samples, which had been handled in atmospheric conditions after being removed from the tokamak

  12. Experimental and theoretical high energy physics research. [UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Buchanan, Charles D.; Cline, David B.; Byers, N.; Ferrara, S.; Peccei, R.; Hauser, Jay; Muller, Thomas; Atac, Muzaffer; Slater, William; Cousins, Robert; Arisaka, Katsushi

    1992-01-01

    Progress in the various components of the UCLA High-Energy Physics Research program is summarized, including some representative figures and lists of resulting presentations and published papers. Principal efforts were directed at the following: (I) UCLA hadronization model, PEP4/9 e{sup +}e{sup {minus}} analysis, {bar P} decay; (II) ICARUS and astroparticle physics (physics goals, technical progress on electronics, data acquisition, and detector performance, long baseline neutrino beam from CERN to the Gran Sasso and ICARUS, future ICARUS program, and WIMP experiment with xenon), B physics with hadron beams and colliders, high-energy collider physics, and the {phi} factory project; (III) theoretical high-energy physics; (IV) H dibaryon search, search for K{sub L}{sup 0} {yields} {pi}{sup 0}{gamma}{gamma} and {pi}{sup 0}{nu}{bar {nu}}, and detector design and construction for the FNAL-KTeV project; (V) UCLA participation in the experiment CDF at Fermilab; and (VI) VLPC/scintillating fiber R D.

  13. UCLA Particle Physics Research Group annual progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.

    1981-08-01

    The objectives, basic research programs, recent results and continuing activities of the UCLA Particle Physics Research Group are presented. The objectives of the research are to discover, to formulate, and to elucidate the physics laws that govern the elementary constituents of matter and to determine basic properties of particles. A synopsis of research carried out last year is given. The main body of this report is the account of the techniques used in our investigations, the results obtained, and the plans for continuing and new research

  14. SAPS simulation with GITM/UCLA-RCM coupled model

    Science.gov (United States)

    Lu, Y.; Deng, Y.; Guo, J.; Zhang, D.; Wang, C. P.; Sheng, C.

    2017-12-01

    Abstract: SAPS simulation with GITM/UCLA-RCM coupled model Author: Yang Lu, Yue Deng, Jiapeng Guo, Donghe Zhang, Chih-Ping Wang, Cheng Sheng Ion velocity in the Sub Aurora region observed by Satellites in storm time often shows a significant westward component. The high speed westward stream is distinguished with convection pattern. These kind of events are called Sub Aurora Polarization Stream (SAPS). In March 17th 2013 storm, DMSP F18 satellite observed several SAPS cases when crossing Sub Aurora region. In this study, Global Ionosphere Thermosphere Model (GITM) has been coupled to UCLA-RCM model to simulate the impact of SAPS during March 2013 event on the ionosphere/thermosphere. The particle precipitation and electric field from RCM has been used to drive GITM. The conductance calculated from GITM has feedback to RCM to make the coupling to be self-consistent. The comparison of GITM simulations with different SAPS specifications will be conducted. The neutral wind from simulation will be compared with GOCE satellite. The comparison between runs with SAPS and without SAPS will separate the effect of SAPS from others and illustrate the impact on the TIDS/TADS propagating to both poleward and equatorward directions.

  15. EVALUASI CSE-UCLA PADA STUDI PROSES PEMBELAJARAN MATEMATIKA

    Directory of Open Access Journals (Sweden)

    Siska Andriani

    2015-12-01

    Full Text Available tandar proses merupakan salah satu standar nasional yang mengatur perencanaan, pelaksanaan, penilaian, dan pengawasan proses pembelajaran. Pelaksanaan standar proses yang terjadi di lapangan belum terlihat keterlaksanaannya. Tujuan penelitian ini yaitu memperoleh deskripsi keterlaksanaan standar proses pada proses pembelajaran matematika menggunakan analisis CSE-UCLA di SMP Negeri Satu Atap Lerep. Penelitian ini merupakan penelitian kualitatif dengan pendekatan evaluatif. Sumber data utama adalah guru matematika. Teknik pengumpulan data menggunakan wawancara, observasi, dan dokumentasi. Keabsahan data yang digunakan dalam penelitian ini menggunakan uji credibility (triangulasi dan kecukupan bahan referensi, uji transferability, dan uji dependability.  Hasil penelitian menunjukkan bahwa proses pembelajaran matematika di SMP Negeri Satu Atap Lerep sudah mengikuti standar proses. Implementasi standar proses dengan analisis CSE-UCLA menunjukkan bahwa standar proses dilaksanakan melalui tahap  perencanaan, pengembangan, implementasi, hasil dan dampak. Dampak yang muncul pembelajaran yang terjadi tidak maksimal. Selain itu, banyak faktor yang mempengaruhi implementasi standar proses pada pembelajaran matematika di SMP Negeri Satu Atap Lerep. Faktor-faktor tersebut berupa faktor pendukung dan faktor penghambat.

  16. Diversidad de helechos y licófitas de la Reserva Natural Punta Lara, Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Gabriela E Giudice

    2011-09-01

    Full Text Available Hasta el año 1987 el número de helechos y licofitas citados para la Reserva Punta Lara era de 30, incluyendo taxa específicos e infraespecíficos. El objetivo de este trabajo fue evaluar la diversidad de los helechos y licofitas que crecen en esta reserva, donde se halla el relicto más austral de las selvas en galería. Para llevar a cabo este estudio se realizaron viajes de campo durante los años 2006-2009 y se consultaron herbarios locales así como bibliografía especializada. Como resultado del estudio se determinaron 24 taxa de helechos y licofitas, de hábito predominantemente terrestre (70%; pocas acuáticas (17% y epífitas (13%; dos especies exóticas, mientras que otras dos especies nativas citadas previamente no fueron halladas. Cinco taxa fueron registrados con escasa frecuencia. Se infiere que las principales causas de amenaza para las poblaciones de licofitas y helechos en la Reserva Natural Punta Lara son la extracción para su comercialización, la introducción de plantas exóticas y las fluctuaciones climáticas (periodos de sequía. Se presenta una clave de identificación de los taxa registrados y se plantean futuras estrategias de conservación de las especies consideradas vulnerables.Diversity of ferns and lycophytes from Reserva Natural Punta Lara, Buenos Aires , Argentina. Punta Lara Natural Reserve shelters the relict of the Southernmost riparian forest in the world, where the flora is threatened by the anthropic expansion and by the introduction of exotic species. In this area the ferns and lycophytes grow in particular environments as marshland, grassland and marginal forest. The aim of this work was to evaluate the diversity of ferns and lycophytes that inhabit in Punta Lara Natural Reserve. Field trips were conducted from 2006 to 2009 and local herbaria and specific bibliography were also revised. As a result of our study twenty four taxa of ferns and lycophytes were recognized. Their habit was mainly

  17. UCLA Particle Physics Research Group annual progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.

    1983-11-01

    The objectives, basic research programs, recent results, and continuing activities of the UCLA Particle Physics Research Group are presented. The objectives of the research are to discover, to formulate, and to elucidate the physics laws that govern the elementary constituents of matter and to determine basic properties of particles. The research carried out by the Group last year may be divided into three separate programs: (1) baryon spectroscopy, (2) investigations of charge symmetry and isospin invariance, and (3) tests of time reversal invariance. The main body of this report is the account of the techniques used in our investigations, the results obtained, and the plans for continuing and new research. An update of the group bibliography is given at the end

  18. Recent reflectometry results from the UCLA plasma diagnostics group

    International Nuclear Information System (INIS)

    Gilmore, M.; Doyle, E.J.; Kubota, S.; Nguyen, X.V.; Peebles, W.A.; Rhodes, T.L.; Zeng, L.

    2001-01-01

    The UCLA Plasma Diagnostics Group has an active ongoing reflectometry program. The program is threefold, including 1) profile and 2) fluctuation measurements on fusion devices (DIII-D, NSTX, and others), and 3) basic reflectometry studies in linear and laboratory plasmas that seek to develop new measurement capabilities and increase the physics understanding of reflectometry. Recent results on the DIII-D tokamak include progress toward the implementation of FM reflectometry as a standard density profile diagnostic, and correlation length measurements in QDB discharges that indicate a very different scaling than normally observed in L-mode plasmas. The first reflectometry measurements in a spherical torus (ST) have also been obtained on NSTX. Profiles in NSTX show good agreement with those of Thomson scattering. Finally, in a linear device, a local magnetic field strength measurement based on O-X correlation reflectometry has been demonstrated to proof of principle level, and correlation lengths measured by reflectometry are in good agreement with probes. (author)

  19. Experimental And Theoretical High Energy Physics Research At UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Cousins, Robert D. [University of California Los Angeles

    2013-07-22

    This is the final report of the UCLA High Energy Physics DOE Grant No. DE-FG02- 91ER40662. This report covers the last grant project period, namely the three years beginning January 15, 2010, plus extensions through April 30, 2013. The report describes the broad range of our experimental research spanning direct dark matter detection searches using both liquid xenon (XENON) and liquid argon (DARKSIDE); present (ICARUS) and R&D for future (LBNE) neutrino physics; ultra-high-energy neutrino and cosmic ray detection (ANITA); and the highest-energy accelerator-based physics with the CMS experiment and CERN’s Large Hadron Collider. For our theory group, the report describes frontier activities including particle astrophysics and cosmology; neutrino physics; LHC interaction cross section calculations now feasible due to breakthroughs in theoretical techniques; and advances in the formal theory of supergravity.

  20. Development and Testing of UCLA's Electron Losses and Fields Investigation (ELFIN) Instrument Payload

    Science.gov (United States)

    Wilkins, C.; Bingley, L.; Angelopoulos, V.; Caron, R.; Cruce, P. R.; Chung, M.; Rowe, K.; Runov, A.; Liu, J.; Tsai, E.

    2017-12-01

    UCLA's Electron Losses and Fields Investigation (ELFIN) is a 3U+ CubeSat mission designed to study relativistic particle precipitation in Earth's polar regions from Low Earth Orbit. Upon its 2018 launch, ELFIN will aim to address an important open question in Space Physics: Are Electromagnetic Ion-Cyclotron (EMIC) waves the dominant source of pitch-angle scattering of high-energy radiation belt charged particles into Earth's atmosphere during storms and substorms? Previous studies have indicated these scattering events occur frequently during storms and substorms, and ELFIN will be the first mission to study this process in-situ.Paramount to ELFIN's success is its instrument suite consisting of an Energetic Particle Detector (EPD) and a Fluxgate Magnetometer (FGM). The EPD is comprised of two collimated solid-state detector stacks which will measure the incident flux of energetic electrons from 50 keV to 4 MeV and ions from 50 keV to 300 keV. The FGM is a 3-axis magnetic field sensor which will capture the local magnetic field and its variations at frequencies up to 5 Hz. The ELFIN spacecraft spins perpendicular to the geomagnetic field to provide 16 pitch-angle particle data sectors per revolution. Together these factors provide the capability to address the nature of radiation belt particle precipitation by pitch-angle scattering during storms and substorms.ELFIN's instrument development has progressed into the late Engineering Model (EM) phase and will soon enter Flight Model (FM) development. The instrument suite is currently being tested and calibrated at UCLA using a variety of methods including the use of radioactive sources and applied magnetics to simulate orbit conditions during spin sectoring. We present the methods and test results from instrument calibration and performance validation.

  1. Treatmen bagi pengemis pada Balai Rehabilitasi Sosial Bina Karya dan Laras Yogyakarta

    Directory of Open Access Journals (Sweden)

    azmi mustaqim

    2017-05-01

    This study aims to determine the treatments provided by Bina Karya and Laras Social Rehabilitation Center Yogyakarta to beggars. This study is using the descriptive qualitative method with the phenomenological approach. The research’s subject is Social and rehabilitation center’s employ and two beggars. Researcher is taking the data by interview and observation. For data analysis is using data reduce, data display and conclution.The result is, there are two causes of someone being a beggar, internal and external factors. Internal factor comes from individual self and external factor influenced by individual environment. Beggar’s characteristic based on the causes of poverty is low economic level, education level, without a job, homeless, without identity, free of lifestyle, without rules, aimless life, moral decadency and socio emotional low, shiftless, and less religious. The treatment provide based on characteristic will influence another treatment. Therefore treatments are given in an eclectic manner that combines several treatments as needed. Keyword: Treatment, a Beggar, Social Rehabilitation Center

  2. Global general pediatric surgery partnership: The UCLA-Mozambique experience.

    Science.gov (United States)

    Amado, Vanda; Martins, Deborah B; Karan, Abraar; Johnson, Brittni; Shekherdimian, Shant; Miller, Lee T; Taela, Atanasio; DeUgarte, Daniel A

    2017-09-01

    There has been increasing recognition of the disparities in surgical care throughout the world. Increasingly, efforts are being made to improve local infrastructure and training of surgeons in low-income settings. The purpose of this study was to review the first 5-years of a global academic pediatric general surgery partnership between UCLA and the Eduardo Mondlane University in Maputo, Mozambique. A mixed-methods approach was utilized to perform an ongoing needs assessment. A retrospective review of admission and operative logbooks was performed. Partnership activities were summarized. The needs assessment identified several challenges including limited operative time, personnel, equipment, and resources. Review of logbooks identified a high frequency of burn admissions and colorectal procedures. Partnership activities focused on providing educational resources, on-site proctoring, training opportunities, and research collaboration. This study highlights the spectrum of disease and operative case volume of a referral center for general pediatric surgery in sub-Saharan Africa, and it provides a context for academic partnership activities to facilitate training and improve the quality of pediatric general surgical care in limited-resource settings. Level IV. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Reliability and validity of the Danish version of the UCLA Loneliness Scale

    DEFF Research Database (Denmark)

    Lasgaard, Mathias

    2007-01-01

    The objective of this study was to examine the psychometric properties of a Danish version of the UCLA Loneliness Scale (UCLA). The 20-item scale was completed along with other measures in a national youth probability sample of 379 8th grade students aged 13-17. The scale showed high internal con....... The results, highly comparable to the original version of the scale, indicate that the Danish version of UCLA is a reliable and valid measure of loneliness....... consistency, and correlations between UCLA and measures of emotional loneliness, social loneliness, self-esteem, depression, extraversion, and neuroticism supported the convergent and discriminant validity of the scale. Exploratory factor analysis supported a unidimensional structure of the measure...

  4. UCLA Particle and Nuclear Physics Research Group, 1993 progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.; Clajus, M.; Price, J.W.; Tippens, W.B.; White, D.B.

    1993-09-01

    The research programs of the UCLA Particle and Nuclear Physics Research Group, the research objectives, results of experiments, the continuing activities and new initiatives are presented. The primary goal of the research is to test the symmetries and invariances of particle/nuclear physics with special emphasis on investigating charge symmetry, isospin invariance, charge conjugation, and CP. Another important part of our work is baryon spectroscopy, which is the determination of the properties (mass, width, decay modes, etc.) of particles and resonances. We also measure some basic properties of light nuclei, for example the hadronic radii of 3 H and 3 He. Special attention is given to the eta meson, its production using photons, electrons, π ± , and protons, and its rare and not-so-rare decays. In Section 1, the physics motivation of our research is outlined. Section 2 provides a summary of the research projects. The status of each program is given in Section 3. We discuss the various experimental techniques used, the results obtained, and we outline the plans for the continuing and the new research. Details are presented of new research that is made possible by the use of the Crystal Ball Detector, a highly segmented NaI calorimeter and spectrometer with nearly 4π acceptance (it was built and used at SLAC and is to be moved to BNL). The appendix contains an update of the bibliography, conference participation, and group memos; it also indicates our share in the organization of conferences, and gives a listing of the colloquia and seminars presented by us

  5. Lander Radioscience LaRa, a Space Geodesy Experiment to Mars within the ExoMars 2020 mission.

    Science.gov (United States)

    Dehant, V. M. A.; Le Maistre, S.; Yseboodt, M.; Peters, M. J.; Karatekin, O.; Van Hove, B.; Rivoldini, A.; Baland, R. M.; Van Hoolst, T.

    2017-12-01

    The LaRa (Lander Radioscience) experiment is designed to obtain coherent two-way Doppler measurements from the radio link between the 2020 ExoMars lander and Earth over at least one Martian year. The LaRa instrument consists of a coherent transponder with up- and downlinks at X-band radio frequencies. The signal received from Earth is a pure carrier at 7.178 GHz; it is transponded back to Earth at a frequency of 8.434 GHz. The transponder is designed to maintain its lock and coherency over its planed one-hour observation sessions. The transponder mass is at the one-kg level. There are one uplink antenna and two downlink antennas. They are small patch antennas covered by a radome of 130gr for the downlink ones and of 200gr for the uplink. The signals will be generated and received by Earth-based radio antennas belonging to the NASA deep space network (DSN), the ESA tracking station network, or the Russian ground stations network. The instrument lifetime is more than twice the nominal mission duration of one Earth year. The Doppler measurements will be used to observe the orientation and rotation of Mars in space (precession, nutations, and length-of-day variations), as well as polar motion. The ultimate objective is to obtain information/constraints on the Martian interior, and on the sublimation/condensation cycle of atmospheric CO2. Orientation and rotational variations will allow us to constrain the moment of inertia of the entire planet, the moment of inertia of the core, and seasonal mass transfer between the atmosphere and the ice caps. The LaRa experiment will be combined with other previous radio science experiments such as the InSight (Interior Exploration using Seismic Investigations, Geodesy and Heat Transport) RISE experiment (Rotation and Interior Structure Experiment) with radio science data of the NASA Viking landers, Mars Pathfinder and Mars Exploration Rovers. In addition, other ExoMars2020 and TGO (Trace Gas Orbiter) experiments providing

  6. Aristocracia y monarquía en los reinos de Castilla y León: el caso de la familia Lara

    Directory of Open Access Journals (Sweden)

    Simon Doubleday

    2001-12-01

    Full Text Available Between the twelfth century and the fourteenth, there was a fundamental change in the basis of the Lara family s power. At the outset, their influence derived primarily from personal access to, and control over, the monarch; throughout the twelfth century, the family s wealth rested heavily on possession of the royal offices known as tenencias, which were the principal fruit of courtly influence. But from the middle of the thirteenth century, the aftershocks of the reconquests of Seville and Córdoba, and the expansion of royal administration, meant that symbiosis was increasingly supplanted by a confrontational political climate marked by an acceleration of patrimonial accumulation by aristocratic lineages such as the Laras. The new structure of aristocratic power would long outlast the Lara family itself, surviving well into the modem age and finding expression in a culture in which, more than in any other western European society, the authority and values of nobility were dominant.

  7. Diversidad de helechos y licófitas de la Reserva Natural Punta Lara, Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Gabriela E Giudice

    2011-09-01

    Full Text Available Hasta el año 1987 el número de helechos y licofitas citados para la Reserva Punta Lara era de 30, incluyendo taxa específicos e infraespecíficos. El objetivo de este trabajo fue evaluar la diversidad de los helechos y licofitas que crecen en esta reserva, donde se halla el relicto más austral de las selvas en galería. Para llevar a cabo este estudio se realizaron viajes de campo durante los años 2006-2009 y se consultaron herbarios locales así como bibliografía especializada. Como resultado del estudio se determinaron 24 taxa de helechos y licofitas, de hábito predominantemente terrestre (70%; pocas acuáticas (17% y epífitas (13%; dos especies exóticas, mientras que otras dos especies nativas citadas previamente no fueron halladas. Cinco taxa fueron registrados con escasa frecuencia. Se infiere que las principales causas de amenaza para las poblaciones de licofitas y helechos en la Reserva Natural Punta Lara son la extracción para su comercialización, la introducción de plantas exóticas y las fluctuaciones climáticas (periodos de sequía. Se presenta una clave de identificación de los taxa registrados y se plantean futuras estrategias de conservación de las especies consideradas vulnerables.

  8. Isotope ratio mass spectrometry (IRMS) versus laser-assisted ratio analyzer (LARA): a comparative study using two doses of.

    Science.gov (United States)

    Savarino, V; Landi, F; Dulbecco, P; Ricci, C; Tessieri, L; Biagini, R; Gatta, L; Miglioli, M; Celle, G; Vaira, D

    2000-11-01

    This study was carried out to compare the measurements and the diagnostic accuracy of the traditional expensive IRMS and the new economical LARA system using two doses of [13C]urea + two different test meals in patients undergoing upper gastrointestinal endoscopy, both before and after anti-Helicobacter treatment. A total of 354 dyspeptic patients underwent endoscopy with gastric biopsies to diagnose H. pylori infection by CLO-test and histology. No patients had taken antibiotics, bismuth, or antisecretory drugs in the 4 weeks before testing. After overnight fasting, breath samples were collected simultaneously in both plastic and glass tubes at baseline and at 30 and 60 min after urea ingestion. In 237 patients 100 mg [13C]urea + Ensure and in 117 patients 75 mg [13C]urea + citric acid were given. The test was also performed with the two urea dosages and meals in 67 and 64 infected patients, respectively, four weeks after anti-Helicobacter therapy. H. pylori was considered eradicated when both biopsy-based tests were negative. A delta value >5 per thousand was considered positive. Breath samples with insufficient CO2 levels at both 30 and 60 min were excluded from final analysis (N = 37 in pre- and N = 8 in posttreatment). There was excellent agreement between overall delta values of the two machines with both [13C]urea 100 mg + Ensure and [13C]urea 75 mg + citric acid. The 95% CI of the difference against the mean was wider with the former (mean -1.3, +6.3, and -9.4) than with the latter urea dosage and test meal (mean -1.2, +5.2 and -8.1). LARA and IRMS were equally effective (P = NS) in distinguishing infected from uninfected patients before therapy using both doses of [13C]urea and test meals (sensitivity ranged from 95% to 99% and specificity from 95% to 97%). This good performance was maintained in the posttreatment phase (sensitivity ranged from 90% to 100% and specificity from 90% to 97%), without any statistical difference among the various combinations

  9. Final Report UCLA-Thermochemical Storage with Anhydrous Ammonia

    Energy Technology Data Exchange (ETDEWEB)

    Lavine, Adrienne [Univ. of California, Los Angeles, CA (United States)

    2018-02-05

    investigation. UCLA has filed a patent that protects the new ideas developed during this project. Discussions are ongoing with potential investors with the aim of partnering for further work. As well as immediate improvements and extra work with the existing experimental system, a key goal is to extend it to a small solar-driven project at an early opportunity.

  10. UCLA1 aptamer inhibition of human immunodeficiency virus type 1 subtype C primary isolates in macrophages and selection of resistance

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2016-09-01

    Full Text Available isolates in monocyte-derived macrophages (MDMs). Of 4 macrophage-tropic isolates tested, 3 were inhibited by UCLA1 in the low nanomolar range (IC80 <29 nM). One isolate that showed reduced susceptibility (<50 nM) to UCLA1 contained mutations in the a5 helix...

  11. Christian Lara: Reconciling Vision and Execution in Sucre Amer and 1802 l’Epopée Guadeloupéenne

    Directory of Open Access Journals (Sweden)

    Meredith Robinson

    2015-11-01

    Full Text Available Invoking the past in film is a political gesture because it suggests new interpretations of historical events. French Caribbean director Christian Lara portrays the Guadeloupean rebellion of 1803 in two of his films. In his own words, he builds “a historical fresco” of the events, abounding with frequent changes of scenery, elaborate period costumes, and a wide range of minor and major characters through which he exposes France’s colonial wrongdoings. He further questions present French involvement in Guadeloupe. My aim in this paper is to demonstrate that his cinematic efforts, though criticized for their theatricality, underscore an urgency to correct and confirm the islands’ distinctive and inspiring local history.

  12. 77 FR 25739 - Notice of Inventory Completion: Fowler Museum at UCLA, Los Angeles, CA

    Science.gov (United States)

    2012-05-01

    ... objects are 1 awl, 1 bone tool, 2 obsidian biface fragments, 9 bags of obsidian debitage, 4 stone metate fragments, 4 bags of animal bone, 1 obsidian hydration sample, and 5 bags of organic flotation residue. The... artifacts and obsidian hydration dating. The Fowler Museum at UCLA has determined the human remains and...

  13. The UCLA Young Autism Project: A Reply to Gresham and Macmillan.

    Science.gov (United States)

    Smith, Tristam; Lovass, O. Ivar

    1997-01-01

    Responds to "Autistic Recovery? An Analysis and Critique of the Empirical Evidence on the Early Intervention Project" (Gresham and MacMillan), which criticizes research showing the effectiveness of the UCLA Youth Autism Project program for children with autism. The article's misunderstandings are discussed and the program is explained. (CR)

  14. Occupational Analysis: Hospital Radiologic Technologist. The UCLA Allied Health Professions Project.

    Science.gov (United States)

    Reeder, Glenn D.; And Others

    In an effort to meet the growing demand for skilled radiologic technologists and other supportive personnel educated through the associate degree level, a national survey was conducted as part of the UCLA Allied Health Professions Project to determine the tasks performed by personnel in the field and lay the groundwork for development of…

  15. A comparative study of gold UCLA-type and CAD/CAM titanium implant abutments

    Science.gov (United States)

    Park, Ji-Man; Lee, Jai-Bong; Heo, Seong-Joo

    2014-01-01

    PURPOSE The aim of this study was to evaluate the interface accuracy of computer-assisted designed and manufactured (CAD/CAM) titanium abutments and implant fixture compared to gold-cast UCLA abutments. MATERIALS AND METHODS An external connection implant system (Mark III, n=10) and an internal connection implant system (Replace Select, n=10) were used, 5 of each group were connected to milled titanium abutment and the rest were connected to the gold-cast UCLA abutments. The implant fixture and abutment were tightened to torque of 35 Ncm using a digital torque gauge, and initial detorque values were measured 10 minutes after tightening. To mimic the mastication, a cyclic loading was applied at 14 Hz for one million cycles, with the stress amplitude range being within 0 N to 100 N. After the cyclic loading, detorque values were measured again. The fixture-abutment gaps were measured under a microscope and recorded with an accuracy of ±0.1 µm at 50 points. RESULTS Initial detorque values of milled abutment were significantly higher than those of cast abutment (P.05). After cyclic loading, detorque values of cast abutment increased, but those of milled abutment decreased (Pabutment group and the cast abutment group after cyclic loading. CONCLUSION In conclusion, CAD/CAM milled titanium abutment can be fabricated with sufficient accuracy to permit screw joint stability between abutment and fixture comparable to that of the traditional gold cast UCLA abutment. PMID:24605206

  16. MHD PbLi experiments in MaPLE loop at UCLA

    International Nuclear Information System (INIS)

    Courtessole, C.; Smolentsev, S.; Sketchley, T.; Abdou, M.

    2016-01-01

    Highlights: • The paper overviews the MaPLE facility at UCLA: one-of-a-few PbLi MHD loop in the world. • We present the progress achieved in development and testing of high-temperature PbLi flow diagnostics. • The most important MHD experiments carried out since the first loop operation in 2011 are summarized. - Abstract: Experiments on magnetohydrodynamic (MHD) flows are critical to understanding complex flow phenomena in ducts of liquid metal blankets, in particular those that utilize eutectic alloy lead–lithium as breeder/coolant, such as self-cooled, dual-coolant and helium-cooled lead–lithium blanket concepts. The primary goal of MHD experiments at UCLA using the liquid metal flow facility called MaPLE (Magnetohydrodynamic PbLi Experiment) is to address important MHD effects, heat transfer and flow materials interactions in blanket-relevant conditions. The paper overviews the one-of-a-kind MaPLE loop at UCLA and presents recent experimental activities, including the development and testing of high-temperature PbLi flow diagnostics and experiments that have been performed since the first loop operation in 2011. We also discuss MaPLE upgrades, which need to be done to substantially expand the experimental capabilities towards a new class of MHD flow phenomena that includes buoyancy effects.

  17. MHD PbLi experiments in MaPLE loop at UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Courtessole, C., E-mail: cyril@fusion.ucla.edu; Smolentsev, S.; Sketchley, T.; Abdou, M.

    2016-11-01

    Highlights: • The paper overviews the MaPLE facility at UCLA: one-of-a-few PbLi MHD loop in the world. • We present the progress achieved in development and testing of high-temperature PbLi flow diagnostics. • The most important MHD experiments carried out since the first loop operation in 2011 are summarized. - Abstract: Experiments on magnetohydrodynamic (MHD) flows are critical to understanding complex flow phenomena in ducts of liquid metal blankets, in particular those that utilize eutectic alloy lead–lithium as breeder/coolant, such as self-cooled, dual-coolant and helium-cooled lead–lithium blanket concepts. The primary goal of MHD experiments at UCLA using the liquid metal flow facility called MaPLE (Magnetohydrodynamic PbLi Experiment) is to address important MHD effects, heat transfer and flow materials interactions in blanket-relevant conditions. The paper overviews the one-of-a-kind MaPLE loop at UCLA and presents recent experimental activities, including the development and testing of high-temperature PbLi flow diagnostics and experiments that have been performed since the first loop operation in 2011. We also discuss MaPLE upgrades, which need to be done to substantially expand the experimental capabilities towards a new class of MHD flow phenomena that includes buoyancy effects.

  18. UCLA Intermediate Energy Nuclear and Particle Physics Research: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Nefkens, B M.K. [Principal Investigator, ed.; Goetz, J; Lapik, A; Korolija, M; Prakhov, S; Starostin, A [ed.

    2011-05-18

    This project covers the following research: (a) Investigations into the structure of the proton and neutron. This is done by investigating the different resonance states of nucleons with beams of tagged, polarized photons, linearly as well as circularly, incident on polarized hydrogen/deuterium targets and measuring the production of {pi}{sup 0}, 2{pi}{sup }0, 3{pi}{sup 0}, {eta} , {eta}', {omega}, etc. The principal detector is the Crystal Ball multiphoton spectrometer which has an acceptance of nearly 4 . It has been moved to the MAMI accelerator facility of the University of Mainz, Germany. We investigate the conversion of electromagnetic energy into mesonic matter and conversely. (b) We investigate the consequences of applying the "standard" symmetries of isospin, G-parity, charge conjugation, C, P, T, and chirality using rare and forbidden decays of light mesons such as the {eta} ,{eta}' and {omega}. We also investigate the consequences of these symmetries being slightly broken symmetries. We do this by studying selected meson decays using the Crystal Ball detector. (c) We determine the mass, or more precisely the mass difference of the three light quarks (which are inputs to Quantum Chromodynamics) by measuring the decay rate of specially selected {eta} and {eta}' decay modes, again we use the Crystal Ball. (d)We have started a new program to search for the 33 missing cascade baryons using the CLAS detector at the Thomas Jefferson Laboratory. Cascade resonances are very special: they have double strangeness and are quite narrow. This implies that they can be discovered by the missing mass technique in photoproduction reactions such as in {gamma}p{yields}{Xi}{sup}K{sup +}K{sup +}. The cascade program is of particular importance for the upgrade to 12 GeV of the CLAS detector and for design of the Hall D at JLab. (e) Finally, we are getting more involved in a new program to measure the hadronic matter form factor of complex nuclei, in particular

  19. Evaluation of stability of interface between CCM (Co-Cr-Mo) UCLA abutment and external hex implant.

    Science.gov (United States)

    Yoon, Ki-Joon; Park, Young-Bum; Choi, Hyunmin; Cho, Youngsung; Lee, Jae-Hoon; Lee, Keun-Woo

    2016-12-01

    The purpose of this study is to evaluate the stability of interface between Co-Cr-Mo (CCM) UCLA abutment and external hex implant. Sixteen external hex implant fixtures were assigned to two groups (CCM and Gold group) and were embedded in molds using clear acrylic resin. Screw-retained prostheses were constructed using CCM UCLA abutment and Gold UCLA abutment. The external implant fixture and screw-retained prostheses were connected using abutment screws. After the abutments were tightened to 30 Ncm torque, 5 kg thermocyclic functional loading was applied by chewing simulator. A target of 1.0 × 10 6 cycles was applied. After cyclic loading, removal torque values were recorded using a driving torque tester, and the interface between implant fixture and abutment was evaluated by scanning electronic microscope (SEM). The means and standard deviations (SD) between the CCM and Gold groups were analyzed with independent t-test at the significance level of 0.05. Fractures of crowns, abutments, abutment screws, and fixtures and loosening of abutment screws were not observed after thermocyclic loading. There were no statistically significant differences at the recorded removal torque values between CCM and Gold groups ( P >.05). SEM analysis revealed that remarkable wear patterns were observed at the abutment interface only for Gold UCLA abutments. Those patterns were not observed for other specimens. Within the limit of this study, CCM UCLA abutment has no statistically significant difference in the stability of interface with external hex implant, compared with Gold UCLA abutment.

  20. Epidemiología de la enfermedad de Chagas en el municipio Andrés Eloy Blanco, Lara, Venezuela: infestación triatomínica y seroprevalencia en humanos Epidemiology of Chagas disease in Andrés Eloy Blanco, Lara, Venezuela: triatomine infestation and human seroprevalence

    Directory of Open Access Journals (Sweden)

    Claudina Rodríguez-Bonfante

    2007-05-01

    Full Text Available Se realizó un despistaje serológico y recolección de vectores en cuatro comunidades rurales del municipio Andrés Eloy Blanco, Estado Lara, Venezuela. La muestra fue escogida en forma sistemática y aleatoria basada en conglomerados familiares. Se muestrearon 869 habitantes para determinar anticuerpos anti-Trypanosoma cruzi y anti-Leishmania sp. por inmunofluorescencia indirecta, aceptando como positivo diluciones > a 1:32 para anticuerpos anti-T. cruzi no reactivos para antígenos de Leishmania sp., obteniendo una frecuencia de anticuerpos en la muestra de 6,9% (n = 60; de los cuales 46,66% son femeninos, 53,33% masculinos y 60% mayores de 40 años. Se observó que 5 (8,33% de los seropositivos eran menores de 10 años y 10 (16,66% menores de 20 años. Rhodnius prolixus y Panstrongylus geniculatus fueron los triatominos capturados, con índice de infestación de 1,9 y 10,54%, índice de colonización, del 0 y 18,18% en las viviendas infestadas e índice de infección a T. cruzi del 20 y 5,07%, respectivamente. Los resultados sugieren que existe una transmisión activa de la enfermedad de Chagas en el Municipio Andrés Eloy Blanco en las últimas dos décadas y que P. geniculatus está substituyendo a R. prolixus como vector de la enfermedad de Chagas.A seroepidemiological survey and vector captures were performed in four rural communities in Andrés Eloy Blanco, Lara State, Venezuela. Systematic random sampling was based on family clusters, with samples drawn from 869 individuals to determine anti-Trypanosoma cruzi and anti-Leishmania sp. antibodies by indirect immunofluorescence. Positive individuals were defined as > 1:32 for anti-T. cruzi antibody and non-reactive to Leishmania sp. antigen, revealing an antibody frequency of 6.9% (n = 60, of whom 46.66% were females and 53.33% males and 60% were over 39 years of age. Some 5 (8.33% seropositive individuals were under 10 years of age and 10 (16.66% under 20 years. Rhodnius prolixus and

  1. Evidências de validade da Escala Brasileira de Solidão UCLA

    Directory of Open Access Journals (Sweden)

    Sabrina Martins Barroso

    2016-03-01

    Full Text Available RESUMO Objetivo Este trabalho investigou as evidências de validade da Escala de Solidão UCLA para aplicação na população brasileira. Métodos Foram seguidas as fases: (1 autorização do autor e do Comitê de Ética; (2 tradução e retrotradução; (3 adaptação semântica; (4 validação. Utilizou-se para análise dos dados análise descritiva, fatorial exploratória, alpha de Cronbach, Kappa, teste de esfericidade de Barlett, teste Kaiser-Meyer-Olkin e correlação de Pearson. Para a adaptação, a escala foi submetida a especialistas e a um grupo focal com 8 participantes para adaptação semântica e a um estudo piloto com 126 participantes para adaptação transcultural. Da validação, participaram 818 pessoas, entre 20 e 87 anos, que responderam a duas versões da UCLA, ao Questionário de Saúde do Paciente, à Escala de Percepção de Suporte Social e a um questionário elaborado pelos autores. Resultados A escala mostrou dois fatores, que explicaram 56% da variância e alpha de 0,94. Conclusões A Escala de Solidão UCLA-BR indicou evidências de validade de construto e discriminante, além de boa fidedignidade, podendo ser utilizada para avaliação da solidão na população brasileira.

  2. Antonio Zambrana Lara, docente y pintor. Técnica y procedimientos dentro del Realismo Sevillano del último tercio del siglo XX

    OpenAIRE

    Domínguez Moreno, Gustavo

    2012-01-01

    El trabajo que aquí se presenta, cuyo título es Antonio Zambrana Lara, docente y pintor. Técnica y procedimiento dentro del Realismo Sevillano del último tercio del siglo XX, procurará analizar en profundidad las cuestiones relacionadas con la personalidad artística de Antonio Zambrana, a través de diversos asuntos, como por ejemplo su contextualización, intentando profundizar en un momento apasio nante del arte sevillano y especialmente en aquellos apartados que de manera más concreta se ref...

  3. Leveraging lean principles in creating a comprehensive quality program: The UCLA health readmission reduction initiative.

    Science.gov (United States)

    Afsar-Manesh, Nasim; Lonowski, Sarah; Namavar, Aram A

    2017-12-01

    UCLA Health embarked to transform care by integrating lean methodology in a key clinical project, Readmission Reduction Initiative (RRI). The first step focused on assembling a leadership team to articulate system-wide priorities for quality improvement. The lean principle of creating a culture of change and accountability was established by: 1) engaging stakeholders, 2) managing the process with performance accountability, and, 3) delivering patient-centered care. The RRI utilized three major lean principles: 1) A3, 2) root cause analyses, 3) value stream mapping. Baseline readmission rate at UCLA from 9/2010-12/2011 illustrated a mean of 12.1%. After the start of the RRI program, for the period of 1/2012-6/2013, the readmission rate decreased to 11.3% (p<0.05). To impact readmissions, solutions must evolve from smaller service- and location-based interventions into strategies with broader approach. As elucidated, a systematic clinical approach grounded in lean methodologies is a viable solution to this complex problem. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. UCLA's outreach program of science education in the Los Angeles schools.

    Science.gov (United States)

    Palacio-Cayetano, J; Kanowith-Klein, S; Stevens, R

    1999-04-01

    The UCLA School of Medicine's Interactive Multi-media Exercises (IMMEX) Project began its outreach into pre-college education in the Los Angeles area in 1993. The project provides a model in which software and technology are effectively intertwined with teaching, learning, and assessment (of both students' and teachers' performances) in the classroom. The project has evolved into a special collaboration between the medical school and Los Angeles teachers. UCLA faculty and staff work with science teachers and administrators from elementary, middle, and high schools. The program benefits ethnically and racially diverse groups of students in schools ranging from the inner city to the suburbs. The project's primary goal is to use technology to increase students' achievement and interest in science, including medicine, and thus move more students into the medical school pipeline. Evaluations from outside project evaluators (West Ed) as well as from teachers and IMMEX staff show that the project has already had a significant effect on teachers' professional development, classroom practice, and students' achievement in the Los Angeles area.

  5. The UCLA Multimodal Connectivity Database: A web-based platform for brain connectivity matrix sharing and analysis

    Directory of Open Access Journals (Sweden)

    Jesse A. Brown

    2012-11-01

    Full Text Available Brain connectomics research has rapidly expanded using functional MRI (fMRI and diffusion-weighted MRI (dwMRI. A common product of these varied analyses is a connectivity matrix (CM. A CM stores the connection strength between any two regions (nodes in a brain network. This format is useful for several reasons: 1 it is highly distilled, with minimal data size and complexity, 2 graph theory can be applied to characterize the network’s topology, and 3 it retains sufficient information to capture individual differences such as age, gender, intelligence quotient, or disease state. Here we introduce the UCLA Multimodal Connectivity Database (http://umcd.humanconnectomeproject.org, an openly available website for brain network analysis and data sharing. The site is a repository for researchers to publicly share CMs derived from their data. The site also allows users to select any CM shared by another user, compute graph theoretical metrics on the site, visualize a report of results, or download the raw CM. To date, users have contributed over 2000 individual CMs, spanning different imaging modalities (fMRI, dwMRI and disorders (Alzheimer’s, autism, Attention Deficit Hyperactive Disorder. To demonstrate the site’s functionality, whole brain functional and structural connectivity matrices are derived from 60 subjects’ (ages 26-45 resting state fMRI (rs-fMRI and dwMRI data and uploaded to the site. The site is utilized to derive graph theory global and regional measures for the rs-fMRI and dwMRI networks. Global and nodal graph theoretical measures between functional and structural networks exhibit low correspondence. This example demonstrates how this tool can enhance the comparability of brain networks from different imaging modalities and studies. The existence of this connectivity-based repository should foster broader data sharing and enable larger-scale meta analyses comparing networks across imaging modality, age group, and disease state.

  6. Megakorter metropolis / Lara Sargent

    Index Scriptorium Estoniae

    Sargent, Lara

    2008-01-01

    Miljonärist kunstikollektsionääri viiel korrusel paiknev kodu New Yorgis. Juurde ehitati kümnes korrus. Katusekorter on mõeldud kaasaegse kunsti kollektsiooni eksponeerimiseks. Korteri kavandas itaalia arhitekt Andrea Ballerini. Köögimööbel tehti eritellimusel. 12 värv. vaadet

  7. Construction and initial operation of MHD PbLi facility at UCLA

    International Nuclear Information System (INIS)

    Kunugi, T.; Yokomine, T.; Ueki, Y.; Smolentsev, S.; Li, F.-C.; Sketchley, T.; Abdou, M.A.; Yuki, K.

    2014-01-01

    We review current accomplishments in Task 1-3 'Flow Control and Thermofluid Modeling' of the Japan-US 'TITAN' collaboration program. Our task focuses on experimental activities and also computer modeling of magnetohydrodynamic flows and heat and mass transfer of electrically conducting fluids under conditions relevant to fusion blankets. Since our task started, major efforts were taken to design, construct and test a new magnetohydrodynamic lead-lithium (PbLi) loop at UCLA, to accumulate the PbLi handling technology, and to develop a high-temperature ultrasonic Doppler velocimetry and a differential-pressure measurement system for PbLi flows. In the present paper, the loop construction, the electromagnetic pump performance test, our on-going experiments with the constructed loop are described. (author)

  8. Emittance studies of the BNL/SLAC/UCLA 1.6 cell photocathode rf gun

    International Nuclear Information System (INIS)

    Palmer, D.T.; Miller, R.H.; Wang, X.J.

    1997-01-01

    The symmetrized 1.6 cell S-band photocathode gun developed by the BNL/SLAC/UCLA collaboration is in operation at the Brookhaven Accelerator Test Facility (ATF). A novel emittance compensation solenoid magnet has also been designed, built and is in operation at the ATF. These two subsystems form an emittance compensated photoinjector used for beam dynamics, advanced acceleration and free electron laser experiments at the ATF. The highest acceleration field achieved on the copper cathode is 150 MV/m, and the guns normal operating field is 130 MV/m. The maximum rf pulse length is 3 micros. The transverse emittance of the photoelectron beam were measured for various injection parameters. The 1 nC emittance results are presented along with electron bunch length measurements that indicated that at above the 400 pC, space charge bunch lengthening is occurring. The thermal emittance, ε o , of the copper cathode has been measured

  9. UCLA's Molecular Screening Shared Resource: enhancing small molecule discovery with functional genomics and new technology.

    Science.gov (United States)

    Damoiseaux, Robert

    2014-05-01

    The Molecular Screening Shared Resource (MSSR) offers a comprehensive range of leading-edge high throughput screening (HTS) services including drug discovery, chemical and functional genomics, and novel methods for nano and environmental toxicology. The MSSR is an open access environment with investigators from UCLA as well as from the entire globe. Industrial clients are equally welcome as are non-profit entities. The MSSR is a fee-for-service entity and does not retain intellectual property. In conjunction with the Center for Environmental Implications of Nanotechnology, the MSSR is unique in its dedicated and ongoing efforts towards high throughput toxicity testing of nanomaterials. In addition, the MSSR engages in technology development eliminating bottlenecks from the HTS workflow and enabling novel assays and readouts currently not available.

  10. Vision screening of abused and neglected children by the UCLA Mobile Eye Clinic.

    Science.gov (United States)

    Yoo, R; Logani, S; Mahat, M; Wheeler, N C; Lee, D A

    1999-07-01

    The purpose of our study was to present descriptive findings of ocular abnormalities in vision screening examinations of abused and neglected children. We compared the prevalence and the nature of eye diseases and refractive error between abused and neglected boys staying at the Hathaway Home, a residential facility for abused children, and boys from neighboring Boys and Girls clubs. The children in the study received vision screening examinations through the UCLA Mobile Eye Clinic following a standard format. Clinical data were analyzed by chi-square test. The children with a history of abuse demonstrated significantly higher prevalence of myopia, astigmatism, and external eye disorders. Our study suggests that children with a history of abuse may be at higher risk for visual impairment. These visual impairments may be the long-term sequelae of child abuse.

  11. Photocathode driven linac at UCLA for FEL and plasma wakefield acceleration experiments

    International Nuclear Information System (INIS)

    Hartman, S.; Aghamir, F.; Barletta, W.; Cline, D.; Dodd, J.; Katsouleas, T.; Kolonko, J.; Park, S.; Pellegrini, C.; Rosenzweig, J.; Smolin, J.; Terrien, J.; Davis, J.; Hairapetian, G.; Joshi, C.; Luhmann, N. Jr.; McDermott, D.

    1991-01-01

    The UCLA compact 20-MeV/c electron linear accelerator is designed to produce a single electron bunch with a peak current of 200 A, an rms energy spread of 0.2% or less, and a short 1.2 picosecond rms pulse duration. The linac is also designed to minimize emittance growth down the beamline so as to obtain emittances of the order of 8πmm-mrad in the experimental region. The linac will feed two beamlines, the first will run straight into the undulator for FEL experiments while the second will be used for diagnostics, longitudinal bunch compression, and other electron beam experiments. Here the authors describe the considerations put into the design of the accelerating structures and the transport to the experimental areas

  12. Strengthening the fission reactor nuclear science and engineering program at UCLA. Final technical report

    International Nuclear Information System (INIS)

    Okrent, D.

    1997-01-01

    This is the final report on DOE Award No. DE-FG03-92ER75838 A000, a three year matching grant program with Pacific Gas and Electric Company (PG and E) to support strengthening of the fission reactor nuclear science and engineering program at UCLA. The program began on September 30, 1992. The program has enabled UCLA to use its strong existing background to train students in technological problems which simultaneously are of interest to the industry and of specific interest to PG and E. The program included undergraduate scholarships, graduate traineeships and distinguished lecturers. Four topics were selected for research the first year, with the benefit of active collaboration with personnel from PG and E. These topics remained the same during the second year of this program. During the third year, two topics ended with the departure o the students involved (reflux cooling in a PWR during a shutdown and erosion/corrosion of carbon steel piping). Two new topics (long-term risk and fuel relocation within the reactor vessel) were added; hence, the topics during the third year award were the following: reflux condensation and the effect of non-condensable gases; erosion/corrosion of carbon steel piping; use of artificial intelligence in severe accident diagnosis for PWRs (diagnosis of plant status during a PWR station blackout scenario); the influence on risk of organization and management quality; considerations of long term risk from the disposal of hazardous wastes; and a probabilistic treatment of fuel motion and fuel relocation within the reactor vessel during a severe core damage accident

  13. Antalya İli Batı Kıyıları (Lara – Kalkan'nın Ekonomik Amaçlı Deniz Algleri

    Directory of Open Access Journals (Sweden)

    Furkan DURUCAN

    2014-12-01

    Abstract: This study has been carried out with seasonal samples in five stations in order to determine commercial seaweed in west coast of Antalya Province (Lara, Phaselis, Beymelek, Kaş, Kalkan. At the end of study, Rhodophyta (Corallina elongata Ellis & Solander, Corallina officinalis (Linnaeus, Gelidium capillaceum (S.G. Gmelin Kützing, Gelidium latifolium (Greville Bornet & Thuret, Jania adhaerens Lamouroux, Jania rubens (Linnaeus Lamouroux, Porphyra leucosticta Thuret, Heterokontophyta (Cystoseira compressa (Esper Gerloff et Nizamuddin, Cystoseira crinita Duby, Cystoseira elegans Sauvageau, Cystoseira spinosa Sauvageau, Cystoseira stricta (Montagne Sauvageau, Padina pavonica (Linnaeus Thivy, Sargassum vulgare C. Agardh, Chlorophyta (Enteromorpha intestinalis (L. Nees, Gayralia oxysperma (Kützing K.L. Vinogradova ex Scagel et al. ve Ulva lactuca Linnaeus. Species belong to the families have been determined as an important economic potential in this region. Key Words: Mediterranean, Antalya, seaweeds for economic purposing

  14. Thinking Sound and Body-Motion Shapes in Music: Public Peer Review of “Gesture and the Sonic Event in Karnatak Music” by Lara Pearson

    Directory of Open Access Journals (Sweden)

    Rolfe Inge Godøy

    2013-12-01

    Full Text Available It seems that the majority of research on music-related body motion has so far been focused on Western music, so this paper by Lara Pearson on music-related body motion in Indian vocal music is a most welcome contribution to this field. But research on music-related body motion does present us with a number of challenges, ranging from issues of method to fundamental issues of perception and multi-modal integration in music. In such research, thinking of perceptually salient features in different modalities (sound, motion, touch, etc. as shapes seems to go well with our cognitive apparatus, and also be quite practical in representing the features in question. The research reported in this paper gives us an insight into how tracing shapes by hand motion is an integral part of teaching Indian vocal music, and the approach of this paper also holds promise for fruitful future research.

  15. Initial draft of CSE-UCLA evaluation model based on weighted product in order to optimize digital library services in computer college in Bali

    Science.gov (United States)

    Divayana, D. G. H.; Adiarta, A.; Abadi, I. B. G. S.

    2018-01-01

    The aim of this research was to create initial design of CSE-UCLA evaluation model modified with Weighted Product in evaluating digital library service at Computer College in Bali. The method used in this research was developmental research method and developed by Borg and Gall model design. The results obtained from the research that conducted earlier this month was a rough sketch of Weighted Product based CSE-UCLA evaluation model that the design had been able to provide a general overview of the stages of weighted product based CSE-UCLA evaluation model used in order to optimize the digital library services at the Computer Colleges in Bali.

  16. Wavelet-based blind identification of the UCLA Factor building using ambient and earthquake responses

    International Nuclear Information System (INIS)

    Hazra, B; Narasimhan, S

    2010-01-01

    Blind source separation using second-order blind identification (SOBI) has been successfully applied to the problem of output-only identification, popularly known as ambient system identification. In this paper, the basic principles of SOBI for the static mixtures case is extended using the stationary wavelet transform (SWT) in order to improve the separability of sources, thereby improving the quality of identification. Whereas SOBI operates on the covariance matrices constructed directly from measurements, the method presented in this paper, known as the wavelet-based modified cross-correlation method, operates on multiple covariance matrices constructed from the correlation of the responses. The SWT is selected because of its time-invariance property, which means that the transform of a time-shifted signal can be obtained as a shifted version of the transform of the original signal. This important property is exploited in the construction of several time-lagged covariance matrices. The issue of non-stationary sources is addressed through the formation of several time-shifted, windowed covariance matrices. Modal identification results are presented for the UCLA Factor building using ambient vibration data and for recorded responses from the Parkfield earthquake, and compared with published results for this building. Additionally, the effect of sensor density on the identification results is also investigated

  17. Microscopic evaluation of implant platform adaptation with UCLA-type abutments: in vitro study

    Directory of Open Access Journals (Sweden)

    Vinícius Anéas RODRIGUES

    Full Text Available Abstract Introduction The fit between abutment and implant is crucial to determine the longevity of implant-supported prostheses and the maintenance of peri-implant bones. Objective To evaluate the vertical misfit between different abutments in order to provide information to assist abutment selection. Material and method UCLA components (N=40 with anti-rotational system were divided as follows: components usinated in titanium (n=10 and plastic components cast proportionally in titanium (n=10, nickel-chromium-titanium-molybdenum (n=10 and nickel-chromium (n=10 alloys. All components were submitted to stereomicroscope analysis and were randomly selected for characterization by SEM. Result Data were analyzed using mean and standard deviation and subjected to ANOVA-one way, where the groups proved to statistically different (p=<0.05, followed by Tukey’s test. Conclusion The selection of material influences the value of vertical misfit. The group machined in Ti showed the lowest value while the group cast in Ni Cr showed the highest value of vertical misfit.

  18. Construction and initial operation of MHD PbLi facility at UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Smolentsev, S., E-mail: sergey@fusion.ucla.edu; Li, F.-C.; Morley, N.; Ueki, Y.; Abdou, M.; Sketchley, T.

    2013-06-15

    Highlights: • New MHD PbLi loop has been constructed and tested at UCLA. • Pressure diagnostics system has been developed and successfully tested. • Ultrasound Doppler velocimeter is tested as velocity diagnostics. • Experiments on pressure drop reduction have been performed. • Experiments on MHD flow in a duct with SiC flow channel insert are underway. -- Abstract: A magnetohydrodynamic flow facility MaPLE (Magnetohydrodynamic PbLi Experiment) that utilizes molten eutectic alloy lead–lithium (PbLi) as working fluid has been constructed and tested at University of California, Los Angeles. The loop operation parameters are: maximum magnetic field 1.8 T, PbLi temperature up to 350 °C, maximum PbLi flow rate with/without a magnetic field 15/50 l/min, maximum pressure head 0.15 MPa. The paper describes the loop itself and its major components, basic operation procedures, experience of handling PbLi, initial loop testing, flow diagnostics and current and near-future experiments. The obtained test results of the loop and its components have demonstrated that the new facility is fully functioning and ready for experimental studies of magnetohydrodynamic, heat and mass transfer phenomena in PbLi flows and also can be used in mock up testing in conditions relevant to fusion applications.

  19. The UCLA/SLAC Ultra-High Gradient Cerenkov Wakefield Accelerator Experiment

    CERN Document Server

    Thompson, Matthew C; Hogan, Mark; Ischebeck, Rasmus; Muggli, Patric; Rosenzweig, James E; Scott, A; Siemann, Robert; Travish, Gil; Walz, Dieter; Yoder, Rodney

    2005-01-01

    An experiment is planned to study the performance of dielectric Cerenkov wakefield accelerating structures at extremely high gradients in the GV/m range. This new UCLA/SLAC collaboration will take advantage of the unique SLAC FFTB electron beam and its demonstrated ultra-short pulse lengths and high currents (e.g., sz = 20 μm at Q = 3 nC). The electron beam will be focused down and sent through varying lengths of fused silica capillary tubing with two different sizes: ID = 200 μm / OD = 325 μm and ID = 100 μm / OD = 325 μm. The pulse length of the electron beam will be varied in order to alter the accelerating gradient and probe the breakdown threshold of the dielectric structures. In addition to breakdown studies, we plan to collect and measure coherent Cerenkov radiation emitted from the capillary tube to gain information about the strength of the accelerating fields. Status and progress on the experiment are reported.

  20. Investigating plasma-rotation methods for the Space-Plasma Physics Campaign at UCLA's BAPSF.

    Science.gov (United States)

    Finnegan, S. M.; Koepke, M. E.; Reynolds, E. W.

    2006-10-01

    In D'Angelo et al., JGR 79, 4747 (1974), rigid-body ExB plasma flow was inferred from parabolic floating-potential profiles produced by a spiral ionizing surface. Here, taking a different approach, we report effects on barium-ion azimuthal-flow profiles using either a non-emissive or emissive spiral end-electrode in the WVU Q-machine. Neither electrode produced a radially-parabolic space-potential profile. The emissive spiral, however, generated controllable, radially-parabolic structure in the floating potential, consistent with a second population of electrons having a radially-parabolic parallel-energy profile. Laser-induced-fluorescence measurements of spatially resolved, azimuthal-velocity distribution functions show that, for a given flow profile, the diamagnetic drift of hot (>>0.2eV) ions overwhelms the ExB-drift contribution. Our experiments constitute a first attempt at producing controllable, rigid-body, ExB plasma flow for future experiments on the LArge-Plasma-Device (LAPD), as part of the Space-Plasma Physics Campaign (at UCLA's BAPSF).

  1. HUBUNGAN ASUPAN NATRIUM, FREKUENSI DAN DURASI AKTIVITAS FISIK TERHADAP TEKANAN DARAH LANSIA DI PANTI SOSIAL TRESNA WERDHA BUDI SEJAHTERA DAN BINA LARAS BUDI LUHUR KOTA BANJARBARU, KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Rijanti Abdurrachim

    2017-01-01

    Full Text Available Elderly tends to face health problems caused by a decrease in body functions due to aging. One of the most health problems experienced by elderly is in cardiovascular system like hypertension. Factors influenced blood pressures are overweight, less physical activity, and eating high sodium foods. This study aimed to determine the relationship between sodium intake, frequency and duration of physical activity to blood pressure of elderly at Tresna Werdha Budi Sejahtera and Bina Laras Budi Luhur nursing homes in Banjarbaru. This research used cross sectional design. Pearson test were applied (α = 0.05. This study involved 65 elderly aged 60-74 years, 28 males (43% and 37 females (57%. Data were collected using questionnaires. Nutrient contents were obtained using 1x24 hour food recall for 2 days included weekend. The result of Pearson test indicated that there was a significant positive correlation between sodium intake with systolic (p <0.05 and diastolic (p <0.05 levels. Moreover, there was a significant negative correlation between the frequency of physical activity with systolic (p < 0.05 and diastolic (p <0.05 levels; there was a significant negative correlation between physical activity duration and sistolic blood pressure (p<0.05. However, there was no significant correlation between physical activity duration and diastolic blood pressure. It was suggested that health workers should improve health promotion program using posters and do counseling about healthy lifestyles, i.e. suggesting people to avoid high sodium foods and do physical activity regularly.

  2. Validation of the UCLA Child Post traumatic stress disorder-reaction index in Zambia

    Directory of Open Access Journals (Sweden)

    Cohen Judith A

    2011-09-01

    Full Text Available Abstract Background Sexual violence against children is a major global health and human rights problem. In order to address this issue there needs to be a better understanding of the issue and the consequences. One major challenge in accomplishing this goal has been a lack of validated child mental health assessments in low-resource countries where the prevalence of sexual violence is high. This paper presents results from a validation study of a trauma-focused mental health assessment tool - the UCLA Post-traumatic Stress Disorder - Reaction Index (PTSD-RI in Zambia. Methods The PTSD-RI was adapted through the addition of locally relevant items and validated using local responses to three cross-cultural criterion validity questions. Reliability of the symptoms scale was assessed using Cronbach alpha analyses. Discriminant validity was assessed comparing mean scale scores of cases and non-cases. Concurrent validity was assessed comparing mean scale scores to a traumatic experience index. Sensitivity and specificity analyses were run using receiver operating curves. Results Analysis of data from 352 youth attending a clinic specializing in sexual abuse showed that this adapted PTSD-RI demonstrated good reliability, with Cronbach alpha scores greater than .90 on all the evaluated scales. The symptom scales were able to statistically significantly discriminate between locally identified cases and non-cases, and higher symptom scale scores were associated with increased numbers of trauma exposures which is an indication of concurrent validity. Sensitivity and specificity analyses resulted in an adequate area under the curve, indicating that this tool was appropriate for case definition. Conclusions This study has shown that validating mental health assessment tools in a low-resource country is feasible, and that by taking the time to adapt a measure to the local context, a useful and valid Zambian version of the PTSD-RI was developed to detect

  3. RESEÑA DE LAS I JORNADAS DE INVESTIGACIÓN DE INGENIERÍA CIVIL Y URBANISMO UCLA 2015

    OpenAIRE

    J. C. Rincón

    2016-01-01

    A través del presente ensayo, se esboza el acontecer de las I Jornadas de Investigación de Ingeniería Civil y Urbanismo UCLA 2015, la cual se desarrolló durante los días 15 y 16 de marzo del 2016, en las instalaciones del decanato de Ingeniería Civil de la Universidad Centroccidental Lisandro Alvarado. Se presentaron ponencias alusivas a trabajos de investigación relacionados a ingeniería civil, específicamente en las áreas de estructuras, hidráulica y sanitaria, ingeniería de construcción...

  4. UCLA intermediate energy nuclear physics and relativistic heavy ion physics. Annual report, February 1, 1983-January 31, 1984

    International Nuclear Information System (INIS)

    1984-01-01

    In this contract year the UCLA Intermediate Energy Group has continued to pursue a general set of problems in intermediate energy physics using new research tools and theoretical insights. Our program to study N-N scattering and proton-light nucleus scattering has been enhanced by a new polarized target facility (both hydrogen and deuterium) at the High Resolution Spectrometer (HRS) of the Los Alamos Meson Physics Facility (LAMPF). This facility has been constructed by our group in collaboration with physicists from KEK, LAMPF and the University of Minnesota; and the first set of experiments studying polarized beam-polarized target scattering at the HRS were completed this summer and early fall. The HRS mode of operation has led to some unique design features which are described. At the Bevalac, a new beam line spectrometer will be constructed for us during this year and next to significantly enhance our capability to study subthreshold k + , k - and anti p production in relativistic heavy ion collisions and to search for fractionally charged particles. During this period a proposal is being prepared for a very large acceptance spectrometer and its associated beam line which will be used to detect dilepton pairs produced in relativistic heavy ion collisions. In concert with these experimental projects, theoretical advances in the understanding of new data from the HRS, particularly spin transfer data, have been made by the UCLA group and are described

  5. Validación de "infarto de miocardio" como causa de muerte en certificados de defunción, Barquisimeto, Estado Lara, Venezuela

    Directory of Open Access Journals (Sweden)

    Granero Ricardo

    1997-01-01

    Full Text Available Las tasas de mortalidad por cardiopatía isquémica (CI han sido utilizadas ampliamente en el diagnóstico de la salud cardiovascular de regiones y países. Sin embargo, su validez ha sido cuestionada fundamentalmente por lo que le da origen: el certificado de defunción (CDD. El presente estudio tiene el objetivo de establecer la validez del diagnóstico "infarto de miocardio (IM" como causa de muerte en los CDD de muertes intra-hospitalarias en la ciudad de Barquisimeto, Estado Lara, Venezuela. Entre julio de 1991 y junio de 1992, se identificaron todos los CDD con las características mencionadas, se trató de ubicar la historia clínica correspondiente a cada caso y cualquier otra información clínica pertinente. Se registraron 247 CDD elegibles y se ubicó información clínica adecuada en 136 casos (55%. Aplicando los criterios del Proyecto MONICA, se encontraron M-definitivo en 62 casos (45,6%, IM-probable en 31 casos (22,8% y No-IM en 43 casos (31,6%. Los resultados indican que existe un sobre registro de casos de muerte por IM del 32% (intervalo de confianza del 95% = 23,8-39,4. A la luz de estos resultados es necesario estudiar los factores que inciden en la exactitud de los diagnósticos IM en los CDD. Con esto tendríamos elementos para revisar las normas y los procedimientos empleados en la producción y manejo de los CDD, así como preparar un programa de educación para mejorar la precisión de los mismos.

  6. Validación de "infarto de miocardio" como causa de muerte en certificados de defunción, Barquisimeto, Estado Lara, Venezuela

    Directory of Open Access Journals (Sweden)

    Ricardo Granero

    Full Text Available Las tasas de mortalidad por cardiopatía isquémica (CI han sido utilizadas ampliamente en el diagnóstico de la salud cardiovascular de regiones y países. Sin embargo, su validez ha sido cuestionada fundamentalmente por lo que le da origen: el certificado de defunción (CDD. El presente estudio tiene el objetivo de establecer la validez del diagnóstico "infarto de miocardio (IM" como causa de muerte en los CDD de muertes intra-hospitalarias en la ciudad de Barquisimeto, Estado Lara, Venezuela. Entre julio de 1991 y junio de 1992, se identificaron todos los CDD con las características mencionadas, se trató de ubicar la historia clínica correspondiente a cada caso y cualquier otra información clínica pertinente. Se registraron 247 CDD elegibles y se ubicó información clínica adecuada en 136 casos (55%. Aplicando los criterios del Proyecto MONICA, se encontraron M-definitivo en 62 casos (45,6%, IM-probable en 31 casos (22,8% y No-IM en 43 casos (31,6%. Los resultados indican que existe un sobre registro de casos de muerte por IM del 32% (intervalo de confianza del 95% = 23,8-39,4. A la luz de estos resultados es necesario estudiar los factores que inciden en la exactitud de los diagnósticos IM en los CDD. Con esto tendríamos elementos para revisar las normas y los procedimientos empleados en la producción y manejo de los CDD, así como preparar un programa de educación para mejorar la precisión de los mismos.

  7. Epidemiología de la enfermedad de Chagas en el municipio Andrés Eloy Blanco, Lara, Venezuela: infestación triatomínica y seroprevalencia en humanos

    OpenAIRE

    Rodríguez-Bonfante,Claudina; Amaro,Aned; García,María; Mejías Wohlert,Ligia Elena; Guillen,Pamela; Antonio García,Rafael; Álvarez,Naysan; Díaz,Marialejandra; Cárdenas,Elsys; Castillo,Silvia; Bonfante-Garrido,Rafael; Bonfante-Cabarcas,Rafael

    2007-01-01

    Se realizó un despistaje serológico y recolección de vectores en cuatro comunidades rurales del municipio Andrés Eloy Blanco, Estado Lara, Venezuela. La muestra fue escogida en forma sistemática y aleatoria basada en conglomerados familiares. Se muestrearon 869 habitantes para determinar anticuerpos anti-Trypanosoma cruzi y anti-Leishmania sp. por inmunofluorescencia indirecta, aceptando como positivo diluciones > a 1:32 para anticuerpos anti-T. cruzi no reactivos para antígenos de Leishmania...

  8. Simulations of the BNL/SLAC/UCLA 1.6 cell emittance compensated photocathode RF gun low energy beam line

    International Nuclear Information System (INIS)

    Palmer, D.T.; Miller, R.H.; Winick, H.

    1995-01-01

    A dedicated low energy (2 to 10 MeV) experimental beam line is now under construction at Brookhaven National Laboratories Accelerator Test Facility (BNL/ATF) for photocathode RF gun testing and photoemission experiments. The design of the experimental line, using the 1.6 cell photocathode RF gun developed by the BNL/SLAC/UCLA RF gun collaboration is presented. Detailed beam dynamics simulations were performed for the 1.6 cell RF gun injector using a solenoidal emittance compensation technique. An experimental program for testing the 1.6 cell RF gun is presented. This program includes beam loading caused by dark current, higher order mode field measurements, integrated and slice emittance measurements using a pepper-pot and RF kicker cavity

  9. Preliminary conceptual design for a 510 MeV electron/positron injector for a UCLA φ factory

    International Nuclear Information System (INIS)

    Dahlbacka, G.; Hartline, R.; Barletta, W.; Pellegrini, C.

    1991-01-01

    UCLA is proposing a compact suer conducting high luminosity (10 32-33 cm -2 sec -1 ) e + e - collider for a φ factory. To achieve the required e + e - currents, full energy injections from a linac with intermediate storage in a Positron Accumulator Ring (PAR) is used. The elements of the linac are outlined with cost and future flexibility in mind. The preliminary conceptual design starts with a high current gun similar in design to those developed at SLAC and at ANL (for the APS). Four 4-section linac modules follow, each driven by a 60 MW klystron with a 1 μsec macropulse and an average current of 8.6 A. The first 4-section model is used to create positrons in a tungsten target at 186 MeV. The three remaining three modules are used to accelerate the e + e - beam to 558 MeV (no load limit) for injection into the PAR

  10. Development and validation of Australian aphasia rehabilitation best practice statements using the RAND/UCLA appropriateness method.

    Science.gov (United States)

    Power, Emma; Thomas, Emma; Worrall, Linda; Rose, Miranda; Togher, Leanne; Nickels, Lyndsey; Hersh, Deborah; Godecke, Erin; O'Halloran, Robyn; Lamont, Sue; O'Connor, Claire; Clarke, Kim

    2015-07-02

    To develop and validate a national set of best practice statements for use in post-stroke aphasia rehabilitation. Literature review and statement validation using the RAND/UCLA Appropriateness Method (RAM). A national Community of Practice of over 250 speech pathologists, researchers, consumers and policymakers developed a framework consisting of eight areas of care in aphasia rehabilitation. This framework provided the structure for the development of a care pathway containing aphasia rehabilitation best practice statements. Nine speech pathologists with expertise in aphasia rehabilitation participated in two rounds of RAND/UCLA appropriateness ratings of the statements. Panellists consisted of researchers, service managers, clinicians and policymakers. Statements that achieved a high level of agreement and an overall median score of 7-9 on a nine-point scale were rated as 'appropriate'. 74 best practice statements were extracted from the literature and rated across eight areas of care (eg, receiving the right referrals, providing intervention). At the end of Round 1, 71 of the 74 statements were rated as appropriate, no statements were rated as inappropriate, and three statements were rated as uncertain. All 74 statements were then rated again in the face-to-face second round. 16 statements were added through splitting existing items or adding new statements. Seven statements were deleted leaving 83 statements. Agreement was reached for 82 of the final 83 statements. This national set of 82 best practice statements across eight care areas for the rehabilitation of people with aphasia is the first to be validated by an expert panel. These statements form a crucial component of the Australian Aphasia Rehabilitation Pathway (AARP) (http://www.aphasiapathway.com.au) and provide the basis for more consistent implementation of evidence-based practice in stroke rehabilitation. Published by the BMJ Publishing Group Limited. For permission to use (where not already

  11. Development and validation of Australian aphasia rehabilitation best practice statements using the RAND/UCLA appropriateness method

    Science.gov (United States)

    Power, Emma; Thomas, Emma; Worrall, Linda; Rose, Miranda; Togher, Leanne; Nickels, Lyndsey; Hersh, Deborah; Godecke, Erin; O'Halloran, Robyn; Lamont, Sue; O'Connor, Claire; Clarke, Kim

    2015-01-01

    Objectives To develop and validate a national set of best practice statements for use in post-stroke aphasia rehabilitation. Design Literature review and statement validation using the RAND/UCLA Appropriateness Method (RAM). Participants A national Community of Practice of over 250 speech pathologists, researchers, consumers and policymakers developed a framework consisting of eight areas of care in aphasia rehabilitation. This framework provided the structure for the development of a care pathway containing aphasia rehabilitation best practice statements. Nine speech pathologists with expertise in aphasia rehabilitation participated in two rounds of RAND/UCLA appropriateness ratings of the statements. Panellists consisted of researchers, service managers, clinicians and policymakers. Main outcome measures Statements that achieved a high level of agreement and an overall median score of 7–9 on a nine-point scale were rated as ‘appropriate’. Results 74 best practice statements were extracted from the literature and rated across eight areas of care (eg, receiving the right referrals, providing intervention). At the end of Round 1, 71 of the 74 statements were rated as appropriate, no statements were rated as inappropriate, and three statements were rated as uncertain. All 74 statements were then rated again in the face-to-face second round. 16 statements were added through splitting existing items or adding new statements. Seven statements were deleted leaving 83 statements. Agreement was reached for 82 of the final 83 statements. Conclusions This national set of 82 best practice statements across eight care areas for the rehabilitation of people with aphasia is the first to be validated by an expert panel. These statements form a crucial component of the Australian Aphasia Rehabilitation Pathway (AARP) (http://www.aphasiapathway.com.au) and provide the basis for more consistent implementation of evidence-based practice in stroke rehabilitation. PMID:26137883

  12. Educating European Corporate Communication Professionals for Senior Management Positions: A Collaboration between UCLA's Anderson School of Management and the University of Lugano

    Science.gov (United States)

    Forman, Janis

    2005-01-01

    UCLA's program in strategic management for European corporate communication professionals provides participants with a concentrated, yet selective, immersion in those management disciplines taught at U.S. business schools, topics that are essential to their work as senior advisors to CEOs and as leaders in the field. The choice of topics…

  13. Neutralization of several adult and paediatric HIV-1 subtype C isolates using a shortened synthetic derivative of gp120 binding aptamer called UCLA1.

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2009-07-01

    Full Text Available This paper present a chemically synthesised derivative of the B40 parental aptamer, called UCLA1 (Cohen et al., 2008), was used for neutralization of endemic subtype C clinical isolates of HIV-1 from adult and paediatric patients and subtype B lab...

  14. "Os quatro cavaleiros de um íntimo apocalipse" e suas biografias vicárias: Fernando Sabino, Otto Lara Resende, Hélio Pellegrino e Paulo Mendes Campos na escrita de perfis

    Directory of Open Access Journals (Sweden)

    Gabriela Kvacek Betella

    2007-08-01

    Full Text Available Fernando Sabino, Otto Lara Resende, Hélio Pellegrino e Paulo Mendes Campos traçaram retratos de pessoas com as quais conviveram ao longo de suas vidas por meio de perfis concisos, seja na forma de elegias seja mesmo de necrológios. Embora esses textos sejam imprescindíveis para fundamentar o estilo de cada um dos escritores mineiros, eles também carregam a síntese de cada experiência pessoal, que é fundamental para a análise da crônica, gênero que o quarteto praticou e no qual podem ser enquadrados os perfis examinados neste ensaio.Fernando Sabino, Otto Lara Resende, Hélio Pellegrino and Paulo Mendes Campos wrote portraits of people with whom they were intimate along their lives by means of short profiles, either in the form of elegies or even of necrologies. Although these texts are necessary in order to set up the style of each one of these writers from Minas Gerais, they also carry the synthesis of each personal experience, which is fundamental for the analysis of the chronicle, a literary genre that the quartet of writers practiced and within which the profiles examined in this essay can be classified.

  15. The Outlook of Workforce Development in Community Colleges. UCLA Community College Bibliography

    Science.gov (United States)

    Zarkesh, Maryam

    2004-01-01

    The 2004 State of the Union address included an announcement that $250 million was being allocated to community colleges for workforce development programs. This indication of support was good news in light of the recent trends for level funding or cutting back on educational programs, and demonstrates the perceived benefits of workforce…

  16. A framework for improving access and customer service times in health care: application and analysis at the UCLA Medical Center.

    Science.gov (United States)

    Duda, Catherine; Rajaram, Kumar; Barz, Christiane; Rosenthal, J Thomas

    2013-01-01

    There has been an increasing emphasis on health care efficiency and costs and on improving quality in health care settings such as hospitals or clinics. However, there has not been sufficient work on methods of improving access and customer service times in health care settings. The study develops a framework for improving access and customer service time for health care settings. In the framework, the operational concept of the bottleneck is synthesized with queuing theory to improve access and reduce customer service times without reduction in clinical quality. The framework is applied at the Ronald Reagan UCLA Medical Center to determine the drivers for access and customer service times and then provides guidelines on how to improve these drivers. Validation using simulation techniques shows significant potential for reducing customer service times and increasing access at this institution. Finally, the study provides several practice implications that could be used to improve access and customer service times without reduction in clinical quality across a range of health care settings from large hospitals to small community clinics.

  17. LGBT and Information Studies: The Library and Archive OUTreach Symposium at UCLA; and In the Footsteps of Barbara Gittings: An Appreciation

    OpenAIRE

    Keilty, Patrick

    2007-01-01

    On November 17, 2006 the InterActions editorial team attended the Library and Archives OUTreach symposium at UCLA. This galvanizing event brought together academics, practitioners, and activists from the information studies field to discuss the importance of increasing visibility around lesbian, gay, bisexual, and transgendered (LGBT) issues as they pertain to libraries and information seeking. Given the tremendous energy generated by these proceedings, we asked Patrick Keilty, a doctoral st...

  18. An analysis of appropriate delivery of postoperative radiation therapy for endometrial cancer using the RAND/UCLA Appropriateness Method: Executive summary

    Directory of Open Access Journals (Sweden)

    Ellen Jones, MD, PhD

    2016-01-01

    Conclusions: This analysis based on the RAND/UCLA Method shows significant agreement with the 2014 endometrial Guideline. Areas of divergence, often in scenarios with low-level evidence, included use of external beam RT plus vaginal brachytherapy in stages II and III and external beam RT alone in early-stage patients. Furthermore, the analysis explores other important questions regarding management of this disease site.

  19. UCLA space-time area law model: A persuasive foundation for hadronization

    International Nuclear Information System (INIS)

    Abachi, S.; Buchanan, C.; Chien, A.; Chun, S.; Hartfiel, B.

    2007-01-01

    From the studies of rates and distributions of heavy quark (c,b) mesons we have developed additional evidence that hadron formation, at least in the simplest environment of e + e - collisions, is dominantly controlled by a space-time area law (''STAL''), an approach suggested by both non-perturbative QCD and relativistic string models. From the dynamics of heavy quarks whose classical space-time world-lines deviate significantly from the light-cone, we report the exact calculation of the relevant space-time area and the derivation of a Lorentz invariant variable, z eff , which reduces to the light-cone momentum fraction z for low mass quarks. Using z eff in the exponent of our fragmentation function in place of z, we find persuasive agreement with L=0,1 charmed and bottom meson data as well as for u,d,s L=0 states. Presuming STAL to be a valid first-order description for all these meson data, we find the scale of other possible second-order effects to be limited to ∝20% or less of the observed rates. The model favors a b-quark mass of ∝4.5 GeV. (orig.)

  20. Ucla, escuela elemental

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1962-03-01

    Full Text Available La Escuela Elemental de Preparación de la Universidad de California, en Los Angeles, está dedicada a la educación e investigación y preparación del profesorado de la infancia. Se ha construido en un paraje maravilloso, de frondosa vegetación, frente a un terreno bastante quebrado, circunstancia que presta mayor encanto al conjunto, construido con gran pericia y adaptación al paisaje a base de una dominante horizontalidad, con materiales sencillos (ladrillos, hierro y madera y gran comunicación con la naturaleza mediante grandes cristaleras correderas que ensanchan las clases y las suplementan hacia el jardín de acuerdo con las nuevas normas y prácticas docentes.

  1. Material analyses of foam-based SiC FCI after dynamic testing in PbLi in MaPLE loop at UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez, Maria, E-mail: maria.gonzalez@ciemat.es [LNF-CIEMAT, Avda Complutense, 40, 28040 Madrid (Spain); Rapisarda, David; Ibarra, Angel [LNF-CIEMAT, Avda Complutense, 40, 28040 Madrid (Spain); Courtessole, Cyril; Smolentsev, Sergey; Abdou, Mohamed [Fusion Science and Technology Center, UCLA (United States)

    2016-11-01

    Highlights: • Samples from foam-based SiC FCI were analyzed by looking at their SEM microstructure and elemental composition. • After finishing dynamic experiments in the flowing hot PbLi, the liquid metal ingress has been confirmed due to infiltration through local defects in the protective inner CVD layer. • No direct evidences of corrosion/erosion were observed; these defects could be related to the manufacturing process. - Abstract: Foam-based SiC flow channel inserts (FCIs) developed and manufactured by Ultramet, USA are currently under testing in the flowing hot lead-lithium (PbLi) alloy in the MaPLE loop at UCLA to address chemical/physical compatibility and to access the MHD pressure drop reduction. UCLA has finished the first experimental series, where a single uninterrupted long-term (∼6500 h) test was performed on a 30-cm FCI segment in a magnetic field up to 1.8 T at the temperature of 300 °C and maximum flow velocities of ∼ 15 cm/s. After finishing the experiments, the FCI sample was extracted from the host stainless steel duct and cut into slices. Few of them have been analyzed at CIEMAT as a part of the joint collaborative effort on the development of the DCLL blanket concept in the EU and the US. The initial inspection of the slices using optical microscopic analysis at UCLA showed significant PbLi ingress into the bulk FCI material that resulted in degradation of insulating properties of the FCI. Current material analyses at CIEMAT are based on advanced techniques, including characterization of FCI samples by FESEM to study PbLi ingress, imaging of cross sections, composition analysis by EDX and crack inspection. These analyses suggest that the ingress was caused by local defects in the protective inner CVD layer that might be originally present in the FCI or occurred during testing.

  2. UCLA1, a synthetic derivative of a gp120 RNA aptamer, inhibits entry of human immunodeficiency virus type 1 subtype C

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2012-05-01

    Full Text Available such as South Africa (47), where this study was conducted, we assessed the sensitivity of a large panel of subtype C isolates derived from adult and pediatric patients at different stages of HIV-1 infection against UCLA1. We examined its neutralization..., 34). These were derived from the CAPRISA 002 acute infection study cohort (18), subtype C reference panel (31), pediatric and AIDS patients? isolates (9, 17), and a subtype C consensus sequence clone (ConC) (26). The subtype C pseudoviruses were...

  3. The Benefits of Adding SETI to the University Curriculum and What We Have Learned from a SETI Course Recently Offered at UCLA

    Science.gov (United States)

    Lesyna, Larry; Margot, Jean-Luc; Greenberg, Adam; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, William; Miles, Brittany E.; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse

    2017-01-01

    We advocate for the inclusion of a full-term course entirely devoted to SETI in the university curriculum. SETI usually warrants only a few lectures in a traditional astronomy or astrobiology course. SETI’s rich interdisciplinary character serves astronomy students by introducing them to scientific and technological concepts that will aid them in their dissertation research or later in their careers. SETI is also an exciting topic that draws students from other disciplines and teaches them astronomical concepts that they might otherwise never encounter in their university studies. We have composed syllabi that illustrate the breadth and depth that SETI courses provide for advanced undergraduate or graduate students. The syllabi can also be used as a guide for an effective SETI course taught at a descriptive level.After a pilot course in 2015, UCLA formally offered a course titled "EPSS C179/279 - Search for Extraterrestrial Intelligence: Theory and Applications" in Spring 2016. The course was designed for advanced undergraduate students and graduate students in the science, technical, engineering, and mathematical fields. In 2016, 9 undergraduate students and 5 graduate students took the course. Students designed an observing sequence for the Arecibo and Green Bank telescopes, observed known planetary systems remotely, wrote a sophisticated and modular data processing pipeline, analyzed the data, and presented the results. In the process, they learned radio astronomy fundamentals, software development, signal processing, and statistics. The instructor believes that the students were eager to learn because of the engrossing nature of SETI. The students rated the course highly, in part because of the observing experience and the teamwork approach. The next offering will be in Spring 2017.See lxltech.com and seti.ucla.edu

  4. Science and Engineering of the Environment of Los Angeles: A GK-12 Experiment at Developing Science Communications Skills in UCLA's Graduate Program

    Science.gov (United States)

    Moldwin, M. B.; Hogue, T. S.; Nonacs, P.; Shope, R. E.; Daniel, J.

    2008-12-01

    Many science and research skills are taught by osmosis in graduate programs with the expectation that students will develop good communication skills (speaking, writing, and networking) by observing others, attending meetings, and self reflection. A new National Science Foundation Graduate Teaching Fellows in K- 12 Education (GK-12; http://ehrweb.aaas.org/gk12new/) program at UCLA (SEE-LA; http://measure.igpp.ucla.edu/GK12-SEE-LA/overview.html ) attempts to make the development of good communication skills an explicit part of the graduate program of science and engineering students. SEE-LA places the graduate fellows in two pairs of middle and high schools within Los Angeles to act as scientists-in- residence. They are partnered with two master science teachers and spend two-days per week in the classroom. They are not student teachers, or teacher aides, but scientists who contribute their content expertise, excitement and experience with research, and new ideas for classroom activities and lessons that incorporate inquiry science. During the one-year fellowship, the graduate students also attend a year-long Preparing Future Faculty seminar that discusses many skills needed as they begin their academic or research careers. Students are also required to include a brief (two-page) summary of their research that their middle or high school students would be able to understand as part of their published thesis. Having students actively thinking about and communicating their science to a pre-college audience provides important science communication training and helps contribute to science education. University and local pre- college school partnerships provide an excellent opportunity to support the development of graduate student communication skills while also contributing significantly to the dissemination of sound science to K-12 teachers and students.

  5. Alternativa pedagógica para favorecer la rehabilitación física de niños (as de edad preescolar con\tdesviaciones físico – motoras del consejo popular Celso Maragoto Lara

    Directory of Open Access Journals (Sweden)

    Gladys Hernández Albisa

    2009-06-01

    Full Text Available Este trabajo consiste en diseñar una alternativa pedagógica para favorecer  la rehabilitación física de niños (as con  desviaciones físico-motoras de edad preescolar  del Consejo Popular Celso Maragoto Lara encaminada a propiciar la actividad físico deportiva que cumple tres funciones esenciales en la vida del niño: una la función biológica determinada por el necesario desarrollo de las capacidades motrices tan vitales para el desarrollo del cuerpo humano; una función psicológica determinada por la garantía de la armonía, la estabilidad, la confianza y la seguridad en si mismo y  una función social encaminada a desarrollar estilos sanos de vida y una personalidad humana integral más su integración social en la vida adulta independiente. A partir de un estudio previo se caracterizó el proceso de rehabilitación física de niños (as con desviaciones físico-motoras de edad preescolar, se determinaron las deficiencias, las cuales sirvieron  de  indicadores  para  diseñar  una    alternativa  pedagógica  para  la rehabilitación física, a través del uso de programas de la revolución, proporcionar  actividades a la familia brindándole  el apoyo afectivo necesario , ofreciéndole información que le permita crear un ambiente familiar armónico y equilibrado al conocer el valor de la rehabilitación física de sus hijos. Esta alternativa pedagógica   además se convierte en un material de apoyo a la docencia,  por  cuanto  facilita  al  docente  variadas  formas  en  que  puede contribuir  en  sus  alumnos  a la  rehabilitación  física a  partir  del  carácter interdisciplinario  y  las  potencialidades  que  brinda  el  contenido  docente  el trabajo hacia ese fin.   La alternativa pedagógica fue aplicada en el Consejo Popular Celso Maragoto Lara de forma experimental, por lo que se tendrán en cuenta las valoraciones, considerando que la misma pueda ser enriquecida

  6. Elma Bahçelerinde Bazı Önemli Zararlılara Karşı Azadirachtin ve Kaolin Uygulamalarının Etkisi

    Directory of Open Access Journals (Sweden)

    Nazım KÜÇÜKBALLI

    2018-02-01

    Full Text Available Elma bahçelerinde ekonomik kayıplara neden olan birçok hastalık, zararlı ve yabancıot türü bulunmaktadır. Zararlılar içinde elma içkurdu, kırmızıörümcekler ve yaprakbitleri ana zararlılar arasında yer almaktadır. Elma üretiminin yoğun yapıldığı Isparta ilinde özellikle yağışlı geçen yıllarda yılda 20 kezden daha fazla ilaçlama yapıldığı bilinmektedir. Bu çalışmada söz konusu zararlılara karşı çevre ve yararlılara fazla etkisi olmadığı bilinen azadirachtin ve kaolinin etkisi 2015 yılında incelenmiştir. Denemeler Süleyman Demirel Üniversitesi, Ziraat Fakültesi bünyesinde bulunan 5 ve 2 dekarlık iki elma bahçesinde yürütülmüştür. Her bahçe dört parsele ayrılmış ve her bir parsele kaolin, azadirachtin (neem, karşılaştırma ilacı olarak chlorpyrifos-ethyl ve Kontrol parseline de su püskürtme şeklinde uygulanmıştır. Denemeler tesadüf blokları deneme desenine göre kurulmuş olup, her tekerrürde 8 ağaç olacak şekilde 6 tekerrürlü olarak düzenlenmiştir. Her hafta, her bir ağaçtan 40 yaprak örneği alınarak Tetranychus urticae, Pananychus ulmi, Aphis pomi ve Dysaphis plantaginea sayımları yapılmıştır. Elma içkurdu zararı ise hasat zamanında ağaç üzerinde ve yere düşen meyvelerde bulaşma oranına göre belirlenmiştir. Çalışma sonucunda yaprakbitine karşı en etkili Chlorpyrifos-ethyl bulunmuş, bunu kaolin ve neem izlemiştir. Preparatlar kırmızıörümceklere karşı benzer etki gösterirken elma içkurdu bulaşma oranları sırasıyla, kontrol parselinde %49.99, kaolin parselinde %42.27, neem parselinde %41.20 ve chlorpyrifos-ethyl parselinde %31.23 olmuştur.

  7. La actividad física mediante juegos tradicionales adaptados para mejorar la incorporación del adulto mayor a los círculos de abuelos del consejo popular Celso Maragoto Lara

    Directory of Open Access Journals (Sweden)

    Owen Emilio Castro Lázaro

    2011-03-01

    Full Text Available En el presente trabajo se dan a conocer los resultados de la aplicación de juegos tradicionales adaptados para mejorar la incorporación del adulto mayor a los Círculos de Abuelos de la comunidad perteneciente al consultorio # 217 del consejo popular Celso Maragoto Lara del municipio Pinar del Río. Como paso previó se realizó un diagnóstico inicial pudiéndose constatar: . La poca incorporación del adulto mayor a la actividad física. . No se sienten motivados por las actividades físicas que se realizan en los Círculos de Abuelos y . A los adultos mayores incorporados a la realización de actividades físicas les gustaría mucho realizar juegos tradicionales como parte de sus clases en el Círculo de Abuelos. Sobre la base de las dificultades detectadas, se elaboró y aplicó durante seis meses un plan de juegos tradicionales para hacer más dinámica y entretenida la clase con estos adultas mayores que necesitan atención por parte del profesor de Cultura Física, así como del médico de la familia contribuyendo a elevar la autoestima y las relaciones sociales. La aplicación de estas actividades tuvo un resultado positivo, pues se incremento la participación de los adultos mayores al Círculo de Abuelos.

  8. Autism Spectrum Disorder Reclassified: A Second Look at the 1980s Utah/UCLA Autism Epidemiologic Study

    Science.gov (United States)

    Miller, Judith S.; Bilder, Deborah; Farley, Megan; Coon, Hilary; Pinborough-Zimmerman, Judith; Jenson, William; Rice, Catherine E.; Fombonne, Eric; Pingree, Carmen B.; Ritvo, Edward; Ritvo, Riva-Ariella; McMahon, William M.

    2013-01-01

    The purpose of the present study was to re-examine diagnostic data from a state-wide autism prevalence study (n = 489) conducted in the 1980s to investigate the impact of broader diagnostic criteria on autism spectrum disorder (ASD) case status. Sixty-four (59%) of the 108 originally "Diagnosed Not Autistic" met the current ASD case definition.…

  9. The fitness of copings constructed over UCLA abutments and the implant, constructed by different techniques: casting and casting with laser welding Adaptação de copings de ritânio ao implante, construídos sobre pilares UCLA por duas técnicas: fundição e fundição com soldagem de bordo laser

    Directory of Open Access Journals (Sweden)

    Elza Maria Valadares da Costa

    2004-12-01

    Full Text Available The alternative for the reposition of a missing tooth is the osteointegrated implant being the passive adaptation between the prosthodontic structure and the implant a significant factor for the success of this experiment, a comparative study was done between the two methods for confectioning a single prosthodontic supported by an implant. To do so a screwed implant with a diameter of 3.75mm and a length of 10.0mm (3i Implant innovations, Brasil was positioned in the middle of a resin block and over it we screwed 15 UCLA abutments shaped and anti-rotationable (137CNB, Conexão Sistemas de Próteses, Brasil with a torque of 20N.cm without any laboratorial procedure (control group - CTRLG. From a silicon model 15 UCLA-type calcinatable compounds (56CNB, Conexão Sistemas de Próteses, Brasil were screwed (20 N.cm, received a standard waxing (plain buccal surface and were cast in titanium (casting group - CG and other 15 compounds, UCLA - type shaped in titanium (137 CNB, Conexão Sistemas de Próteses, Brasil received the same standard waxing. These last copings were cast in titanium separated from each other and were laser-welded to the respective abutments on their border (Laser-welding group - LWG. The border adaptation was observed in the implant/compound interface, under measurement microscope, on the y axis, in 4 vestibular, lingual, mesial and distal referential points previously marked on the block. The arithmetical means were obtained and an exploratory data analysis was performed to determine the most appropriate statistical test. Descriptive statistics data (µm for Control (mean±standard deviation: 13.50 ± 21.80; median 0.00, for Casting (36.20±12.60; 37.00, for Laser (10.50 ±12.90; 3.00 were submitted to Kruskal-Wallis ANOVA, alpha = 5%. Results test showed that distorsion median values differ statistically (kw = 17.40; df =2; p = 0.001A reposição de um elemento dentário pode ser feita por um implante osseointegrado sendo que a

  10. Autism Spectrum Disorder Reclassified: A Second Look at the 1980s Utah/UCLA Autism Epidemiologic Study

    Science.gov (United States)

    Miller, Judith S.; Farley, Megan; Coon, Hilary; Pinborough-Zimmerman, Judith; Jenson, William; Rice, Catherine E.; Fombonne, Eric; Pingree, Carmen B.; Ritvo, Edward; Ritvo, Riva-Ariella; McMahon, William M.

    2015-01-01

    The purpose of the present study was to re-examine diagnostic data from a state-wide autism prevalence study (n = 489) conducted in the 1980s to investigate the impact of broader diagnostic criteria on autism spectrum disorder (ASD) case status. Sixty-four (59 %) of the 108 originally “Diagnosed Not Autistic” met the current ASD case definition. The average IQ estimate in the newly identified group (IQ = 35.58; SD = 23.01) was significantly lower than in the original group (IQ = 56.19 SD = 21.21; t = 5.75; p autism with intellectual disability. The current analysis puts this historic work into context and highlights differences in ascertainment between epidemiological studies performed decades ago and those of today. PMID:22696195

  11. Activated learning; providing structure in global health education at the David Geffen School of Medicine at the University of California, Los Angeles (UCLA)- a pilot study.

    Science.gov (United States)

    Jordan, Jaime; Hoffman, Risa; Arora, Gitanjli; Coates, Wendy

    2016-02-16

    Global health rotations are increasingly popular amongst medical students. The training abroad is highly variable and there is a recognized need for global health curriculum development. We sought to create and evaluate a curriculum, applicable to any global health rotation, that requires students to take an active role in their education and promotes engagement. Prospective, observational, mixed method study of 4th year medical students enrolled in global health courses at UCLA in 2011-12. Course directors identified 4 topics common to all rotations (traditional medicine, health systems, limited resources, pathology) and developed activities for students to complete abroad: observation, interview and reflection on resources, pathology, medical practices; and compare/contrast their experience with the US healthcare system. Students posted responses on a discussion board moderated by US faculty. After the rotation, students completed an anonymous internet-based evaluative survey. Responses were tabulated. Qualitative data from discussion board postings and free response survey items were analyzed using the framework method. 14 (100 %) students completed the Activated Learning assignment. 12 submitted the post rotation survey (85.7 %). Activated Learning enhanced GH education for 67 % and facilitated engagement in the local medical culture for 67 %. Qualitative analysis of discussion board posting demonstrated multiple areas of knowledge gain and analysis of free response survey items revealed 5 major themes supporting Activated Learning: guided learning, stimulation of discussion, shared interactions, cultural understanding, and knowledge of global healthcare systems. Increased interactivity emerged as the major theme for future improvement. The results of this study suggest that an Activated Learning program may enhance education, standardize curricular objectives across multiple sites and promote engagement in local medical culture, pathology and delivery

  12. ATS-6 - UCLA fluxgate magnetometer

    Science.gov (United States)

    Mcpherron, R. L.; Coleman, P. J., Jr.; Snare, R. C.

    1975-01-01

    A summary of the design of the University of California at Los Angeles' fluxgate magnetometer is presented. Instrument noise in the bandwidth 0.001 to 1.0 Hz is of order 85 m gamma. The DC field of the spacecraft transverse to the earth-pointing axis is 1.0 + or - 21 gamma in the X direction and -2.4 + or - 1.3 gamma in the Y direction. The spacecraft field parallel to this axis is less than 5 gamma. The small spacecraft field has made possible studies of the macroscopic field not previously possible at synchronous orbit. At the 96 W longitude of Applications Technology Satellite-6 (ATS-6), the earth's field is typically inclined 30 deg to the dipole axis at local noon. Most perturbations of the field are due to substorms. These consist of a rotation in the meridian to a more radial field followed by a subsequent rotation back. The rotation back is normally accompanied by transient variations in the azimuthal field. The exact timing of these perturbations is a function of satellite location and the details of substorm development.

  13. Conjunto de actividades educativas y físicas para mejorar el control metabólico de los pacientes diabéticos, de la tercera edad del\tconsultorio #154, del Consejo Popular Celso Maragoto Lara del municipio Pinar del Río

    Directory of Open Access Journals (Sweden)

    Raydel Gámez García

    2009-06-01

    Full Text Available El profesor de educación física en su interacción con personas de la tercera edad se encuentra con uno de los problemas de salud de la actualidad: la diabetes mellitus. La diabetes mellitus es una enfermedad crónica, heredable y es considerada una enfermedad grave, cuyo tratamiento exige de educación y ejercicio físico. Teniendo en cuenta esta problemática nos proponemos un conjunto  de  actividades  educativas  y  físicas  para mejorar  el  control metabólico de los pacientes diabéticos de la tercera edad, del  consultorio #154, del consejo popular Celso Maragoto Lara del  municipio Pinar del Río.

  14. How does sagittal imbalance affect the appropriateness of surgical indications and selection of procedure in the treatment of degenerative scoliosis? Findings from the RAND/UCLA Appropriate Use Criteria study.

    Science.gov (United States)

    Daubs, Michael D; Brara, Harsimran S; Raaen, Laura B; Chen, Peggy Guey-Chi; Anderson, Ashaunta T; Asch, Steven M; Nuckols, Teryl K

    2018-05-01

    Degenerative lumbar scoliosis (DLS) is often associated with sagittal imbalance, which may affect patients' health outcomes before and after surgery. The appropriateness of surgery and preferred operative approaches has not been examined in detail for patients with DLS and sagittal imbalance. The goals of this article were to describe what is currently known about the relationship between sagittal imbalance and health outcomes among patients with DLS and to determine how indications for surgery in patients with DLS differ when sagittal imbalance is present. This study included a literature review and an expert panel using the RAND/University of California at Los Angeles (UCLA) Appropriateness Method. To develop appropriate use criteria for DLS, researchers at the RAND Corporation recently employed the RAND/UCLA Appropriateness Method, which involves a systematic review of the literature and multidisciplinary expert panel process. Experts reviewed a synopsis of published literature and rated the appropriateness of five common operative approaches for 260 different clinical scenarios. In the present work, we updated the literature review and compared panelists' ratings in scenarios where imbalance was present versus absent. This work was funded by the Collaborative Spine Research Foundation, a group of surgical specialty societies and device manufacturers. On the basis of 13 eligible studies that examined sagittal imbalance and outcomes in patients with DLS, imbalance was associated with worse functional status in the absence of surgery and worse symptoms and complications postoperatively. Panelists' ratings demonstrated a consistent pattern across the diverse clinical scenarios. In general, when imbalance was present, surgery was more likely to be appropriate or necessary, including in some situations where surgery would otherwise be inappropriate. For patients with moderate to severe symptoms and imbalance, a deformity correction procedure was usually appropriate

  15. Software Engineering Support of the Third Round of Scientific Grand Challenge Investigations: An Earth Modeling System Software Framework Strawman Design that Integrates Cactus and UCLA/UCB Distributed Data Broker

    Science.gov (United States)

    Talbot, Bryan; Zhou, Shu-Jia; Higgins, Glenn

    2002-01-01

    One of the most significant challenges in large-scale climate modeling, as well as in high-performance computing in other scientific fields, is that of effectively integrating many software models from multiple contributors. A software framework facilitates the integration task. both in the development and runtime stages of the simulation. Effective software frameworks reduce the programming burden for the investigators, freeing them to focus more on the science and less on the parallel communication implementation, while maintaining high performance across numerous supercomputer and workstation architectures. This document proposes a strawman framework design for the climate community based on the integration of Cactus, from the relativistic physics community, and UCLA/UCB Distributed Data Broker (DDB) from the climate community. This design is the result of an extensive survey of climate models and frameworks in the climate community as well as frameworks from many other scientific communities. The design addresses fundamental development and runtime needs using Cactus, a framework with interfaces for FORTRAN and C-based languages, and high-performance model communication needs using DDB. This document also specifically explores object-oriented design issues in the context of climate modeling as well as climate modeling issues in terms of object-oriented design.

  16. O jornalismo e a literatura em Otto Lara Resende

    OpenAIRE

    Aio, Allan de Abreu [UNESP

    2007-01-01

    Este estudo pretende discutir as relações entre jornalismo e literatura enquanto discursos que se cruzam ao longo da história e, ao mesmo tempo, preservam características singulares que os distanciam de uma relação mais próxima nos tempos atuais. Do lado do jornalismo, o bom português pregado pelos manuais de redação não é suficiente para potencializar a capacidade de informação do discurso, diante de um referencial ora complexo, ora sutil. Nesses casos, a linguagem da mediação social poderia...

  17. Ajatu muusa külalislahke korter / Lara Sargent

    Index Scriptorium Estoniae

    Sargent, Lara

    2008-01-01

    Inglise modelli ja kaasaegse inglise kunsti muusa Jibby Beane'i valgest ja avarast Londoni korterist, mis mahutab palju kaasaegset kunsti. 11 värv. vaadet. Vt. ka lk. 63: Arunurm, Kristjan. Glamuurselt valge (valik esemeid korteri sisustamiseks samas võtmes)

  18. Plasma Confinement in the UCLA Electric Tokamak.

    Science.gov (United States)

    Taylor, Robert J.

    2001-10-01

    The main goal of the newly constructed large Electric Tokamak (R = 5 m, a = 1 m, BT 8 x 10^12 cm-3 when there is no MHD activity. The electron temperature, derived from the plasma conductivity is > 250 eV with a central electron energy confinement time > 350 msec in ohmic conditions. The sawteeth period is 50 msec. Edge plasma rotation is induced by plasma biasing via electron injection in an analogous manner to that seen in CCT(R.J. Taylor, M.L. Brown, B.D. Fried, H. Grote, J.R. Liberati, G.J. Morales, P. Pribyl, D. Darrow, and M. Ono. Phys. Rev Lett. 63 2365 1989.) and the neoclassical bifurcation is close to that described by Shaing et al(K.C. Shaing and E.C. Crume, Phys. Rev. Lett. 63 2369 (1989).). In the ohmic phase the confinement tends to be MHD limited. The ICRF heating eliminates the MHD disturbances. Under second harmonic heating conditions, we observe an internal confinement peaking characterized by doubling of the core density and a corresponding increase in the central electron temperature. Charge exchange data, Doppler data in visible H-alpha light, and EC radiation all indicate that ICRF heating works much better than expected. The major effort is focused on increasing the power input and controlling the resulting equilibrium. This task appears to be easy since our current pulses are approaching the 3 second mark without RF heating or current drive. Our initial experience with current profile control, needed for high beta plasma equilibrium, will be also discussed.

  19. A new species of Hemerobiella Kimmins (Neuroptera, Hemerobiidae) from Venezuela with notes on the genus.

    Science.gov (United States)

    Sosa, Francisco; Lara, Rogéria I R; Martins, Caleb C

    2015-10-09

    Hemerobiella periotoi Sosa & Lara sp. nov. is described from Venezuela. The new species was collected at the edges of a mature cloud forest in Lara state. This is the third species known in Hemerobiella Kimmins, and the second recorded from Venezuela. Additionally, new Venezuelan records and illustrations of H. oswaldi Monserrat, as well as, a key to Hemerobiella species are provided.

  20. On the possibility of a steady state tokamak

    International Nuclear Information System (INIS)

    Dawson, J.M.; Nunan, W.J.; Ma, S.

    1994-01-01

    This symposium is particularly honoring Tom for his guiding of the graduate program in plasma physics at Princeton. For this reason I thought it would be appropriate for me to speak about some work a graduate student of mine, Bill Nunan, is doing, at UCLA. In a real sense the UCLA graduate program in Plasma Physics has many roots in the Princeton program which Tom so skillfully guided. copyright American Institute of Physics 1994

  1. State of the States

    Science.gov (United States)

    Journal of Education Finance, 2017

    2017-01-01

    In 2016, a group of school finance scholars and public school practitioners gathered in Jacksonville, Florida, for the National Education Finance Academy's annual conference to discuss, among an array of topics, the state of P-20 finance in all 50 states. At the roundtable discussion, 36 states were represented, and scholars representing 30 states…

  2. Metal and trace element concentration evaluation in sediment profiles of the TietÊ River, State Of SÃO Paulo, by INAA and ICP OES techniques

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Josiane S., E-mail: josi.s@usp.br [Instituto de Pesquisas Tecnológicas do Estado de São Paulo (LAQ- CQuiM/IPT), São Paulo, SP (Brazil). Lab. de Análises Químicas; Rocha, Flavio R.; Fávaro, Déborah I. T., E-mail: defavaro@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (LAN/IPEN/CNEN-SP), São Paulo, SP (Brazil). Lab. de Análise por Ativação Neutrônica

    2017-07-01

    The present study presents concentration results for heavy metals, major and trace elements, in two sediment cores collected along the Tietê River: Salto de Itu to Porto Feliz ( Core 4 at point T-5) and Laras to Anhembi (Core 6 at point T18). As, Ba, Br, Co, Cr, Cs, Hf, Rb, Sb, Sc, Ta, Th, U and Zn concentrations by Instrumental Neutron Activation Analysis (INAA) and Al, Ba, Cd, Co, Cr, Cu, Mn, Ni, Pb, Ti, V and Zn concentrations by Inductively Coupled Plasma Optical Emission Spectrometry (ICP OES) were determined. The enrichment factor (EF), to assess the presence of anthropogenic pollution sources, was calculated and showed FE > 1.5 values for As, Br, Cs, Hf, Rb, Ta, Th, U and Zn, confirming the anthropogenic contribution for these elements, in all fractions from both cores. As, Cd, Cr, Cu, Ni, Pb and Zn concentrations were compared to guideline values (TEL and PEL) from the Canadian Council of Ministers of the Environment (CCME) and adopted by the São Paulo State Environmental Company (CETESB) and concentration values between TEL and PEL were found, for all fractions from both cores, presenting good and or regular sediment quality classification, the worst being Core 6. (author)

  3. Metal and trace element concentration evaluation in sediment profiles of the TietÊ River, State Of SÃO Paulo, by INAA and ICP OES techniques

    International Nuclear Information System (INIS)

    Soares, Josiane S.; Rocha, Flavio R.; Fávaro, Déborah I. T.

    2017-01-01

    The present study presents concentration results for heavy metals, major and trace elements, in two sediment cores collected along the Tietê River: Salto de Itu to Porto Feliz ( Core 4 at point T-5) and Laras to Anhembi (Core 6 at point T18). As, Ba, Br, Co, Cr, Cs, Hf, Rb, Sb, Sc, Ta, Th, U and Zn concentrations by Instrumental Neutron Activation Analysis (INAA) and Al, Ba, Cd, Co, Cr, Cu, Mn, Ni, Pb, Ti, V and Zn concentrations by Inductively Coupled Plasma Optical Emission Spectrometry (ICP OES) were determined. The enrichment factor (EF), to assess the presence of anthropogenic pollution sources, was calculated and showed FE > 1.5 values for As, Br, Cs, Hf, Rb, Ta, Th, U and Zn, confirming the anthropogenic contribution for these elements, in all fractions from both cores. As, Cd, Cr, Cu, Ni, Pb and Zn concentrations were compared to guideline values (TEL and PEL) from the Canadian Council of Ministers of the Environment (CCME) and adopted by the São Paulo State Environmental Company (CETESB) and concentration values between TEL and PEL were found, for all fractions from both cores, presenting good and or regular sediment quality classification, the worst being Core 6. (author)

  4. UCLA program in reactor studies: The ARIES tokamak reactor study

    International Nuclear Information System (INIS)

    1991-01-01

    The ARIES research program is a multi-institutional effort to develop several visions of tokamak reactors with enhanced economic, safety, and environmental features. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Four ARIES visions are currently planned for the ARIES program. The ARIES-1 design is a DT-burning reactor based on ''modest'' extrapolations from the present tokamak physics database and relies on either existing technology or technology for which trends are already in place, often in programs outside fusion. ARIES-2 and ARIES-4 are DT-burning reactors which will employ potential advances in physics. The ARIES-2 and ARIES-4 designs employ the same plasma core but have two distinct fusion power core designs; ARIES-2 utilize the lithium as the coolant and breeder and vanadium alloys as the structural material while ARIES-4 utilizes helium is the coolant, solid tritium breeders, and SiC composite as the structural material. Lastly, the ARIES-3 is a conceptual D- 3 He reactor. During the period Dec. 1, 1990 to Nov. 31, 1991, most of the ARIES activity has been directed toward completing the technical work for the ARIES-3 design and documenting the results and findings. We have also completed the documentation for the ARIES-1 design and presented the results in various meetings and conferences. During the last quarter, we have initiated the scoping phase for ARIES-2 and ARIES-4 designs

  5. Physical acoustics at UCLA in the study of superfluid helium

    International Nuclear Information System (INIS)

    Rudnick, I.

    1976-01-01

    The theory of sound propagation in superfluid helium is reviewed. The theory of first, second, fourth and third sound is considered. A simple approximate derivation of the velocity of third sound is given and the Doppler shift of first, second, third and fourth sound is discussed. Experimental aspects of first, second, third and fourth sound are considered in turn. For first sound consideration is given to first-sound transducers, cavitation in liquid helium and velocity at the lambda transition. Second-sound transducers and the velocity of second sound at the lambda transition are discussed. Experimental aspects of third-sound transducers, the velocity and attenuation of third sound, the critical velocity of superfluid films and the thickness of a moving film are then discussed. Various aspects of fourth sound are considered. (B.R.H.)

  6. UCLA High Speed, High Volume Laboratory Network for Infectious Diseases

    Science.gov (United States)

    2008-04-01

    of Human Influenza A( H1N2 ) Reassortant Viruses during the 2001–2002 Influenza Season. Journal Infectious Diseases 2002;186:1490–1493...X, Smith CB, Mungall BA, Lindstrom SE, Hall HE, Subbarao K, et al. Intercontinental circulation of human influenza A( H1N2 ) reas- sortant viruses...numerous samples containing highly pathologic avian influenza and other select agents (dual-use). With FY07 (available), FY08 (available) and FY 09

  7. UCLA High Speed, High Volume Laboratory Network for Infectious Diseases

    National Research Council Canada - National Science Library

    Layne, Scott P

    2008-01-01

    Background. Government agencies and expert panels have recognized the need for laboratories capable of analyzing tens of thousands of biological samples per day that have hundreds of times more capability than at present...

  8. The UCLA-Philippine Language Program, 1957-1966.

    Science.gov (United States)

    Bowen, J. Donald

    This document discusses in detail the development and operation of a language program implemented in the Philippines, beginning in 1957, with the assistance of the University of California, Los Angeles, through the Rockefeller Foundation. The program faced a number of difficulties including a school system in the process of post-war rebuilding, a…

  9. SATURNUS: the UCLA infrared free-electron laser project

    International Nuclear Information System (INIS)

    Dodd, J.W.; Hartman, S.C.; Park, S.; Pellegrini, C.; Rosenzweig, J.B.; Smolin, J.A.; Hairapetian, G.; Kolonko, J.; Barletta, W.A.; Cline, D.B.; Favis, J.G.; Joshi, C.J.; Luhmann, N.C. Jr.; Ivanchenkov, S.N.; Khlebnikov, A.S.; Lachin, Y.Y.; Varfolomeev, A.A.

    1991-01-01

    A compact 20 MeV linac with an RF laser-driven electron gun will be used to drive a high-gain (10cm gain length), 10.6 μm wavelength FEL amplifier, operating in the SASE mode. Saturnus will mainly study FEL physics in the high-gain regime, including start-up from noise, optical guiding, sidebands, saturation, and superradiance, with emphasis on the effects important for future short wavelength operation of FEL's. The hybrid undulator was designed and built at the Kurchatov Inst. of Atomic Energy in the USSR. The primary magnetic flux is provided by C-shaped iron yokes, where between the poles thin blocks of neodymium-iron-boron magnets are placed to provide additional magnetic flux along the undulator axis. The field strength is adjusted by moving the thin Nd-Fe-B blocks on a set screw mount. The initial assembly will have forty periods, each 1.5 cm long. The gap distance between the yoke pole-pieces is fixed at 5 mm. The undulator field has been measured, yielding on an axis peak value of 6.6kGauss, which closely matches computer simulations

  10. The LLNL/UCLA high gradient inverse free electron laser

    Energy Technology Data Exchange (ETDEWEB)

    Moody, J. T.; Musumeci, P.; Anderson, G.; Anderson, S.; Betts, S.; Fisher, S.; Gibson, D.; Tremaine, A.; Wu, S. [Department of Physics and Astronomy, UCLA, Los Angeles California, 90095 (United States); Lawrence Livermore National Laboratory (United States)

    2012-12-21

    We describe the Inverse Free Electron Accelerator currently under construction at Lawrence Livermore National Lab. Upon completion of this accelerator, high brightness electrons generated in the photoinjector blowout regime and accelerated to 50 MeV by S-band accelerating sections will interact with > 4 TW peak power Ti:Sapphire laser in a highly tapered 50 cm undulator and experience an acceleration gradient of > 200 MeV/m. We present the final design of the accelerator as well as the results of start-to-end simulations investigating preservation of beam quality and tolerances involved with this accelerator.

  11. The Consumer Protection Clinical Course at UCLA School of Law

    Science.gov (United States)

    Bergman, Paul

    1978-01-01

    The Consumer Protection clinical course, in which case supervision is provided by government agency personnel, is described. Implications are considered regarding the necessity and emphasis of a seminar component, and the usefulness of clinical courses in teaching substantive law as well as lawyering skills. (LBH)

  12. Akademisyenlerin Meslek Ahlakına Aykırı Olan Davranışlara İlişkin Algıları (Çomü Eğitim Fakültesi Örneği Academicians’ Perceptions Of Behaviours Against Occupational Ethics (A Case In Comu, Faculty Of Education

    Directory of Open Access Journals (Sweden)

    İlknur MAYA

    2013-07-01

    Full Text Available This study aims at determining what academicians consider to beagainst ethics in activities that they perform (such as educationalactivities, research and social service and their causes as well as howto prevent them. It also makes an attempt at identifying the dilemmasacademicians might have concerning ethics. The research uses a semistructuredinterview technique, one of the qualitative research methods.The research group was composed of the 50 subjects chosen throughsnowball sampling from the 100 academicians group working in theFaculty of Education in Canakkale Onsekiz Mart University. Inductiveanalysis, a type of content analysis, was conducted in the analysis ofthe data. The behaviours that the academicians considered to beagainst occupational ethics were mostly related with educationalactivities, and second mostly related with research activities. Theacademicians consider refusing to teach with no excuse, coming toclass late without an excuse/ leaving the classroom early, notconducting the instruction effectively and qualitatively, failing to fulfillthe responsibilities at university due to working outside the University,not treating students equally / fairly against professional ethics most interms of educational-instructional activities. They consider not givingthe quotations and resources correctly, not conducting high quality andoriginal research studies and making changes in the research dataunproffessional most in terms of research- related activities. Besides,they find doing nothing for social service against professional ethics interms of service to the society. The causes for such behaviours werelisted as personal characteristics, desiring to promote quickly and timeinsuffiency, economic insuffiency, and institutional expectations. Theacademicians stated that those behaviours could be prevented throughthe formation of an institutional culture, having role-models amongadministrators especially and among employees, the formation of

  13. Prevalencia de factores de riesgo para enfermedad cardiovascular en el estado de Lara,Venezuela, 2008

    OpenAIRE

    Infante Viloria, Elizabeth

    2011-01-01

    Descripció del recurs: 22 juliol 2011 Las enfermedades cardiovasculares, subgrupo de enfermedades crónicas no trasmisibles, constituyen un importante problema de salud pública, no solo por su magnitud, reflejada en el primer lugar que ocupan entre las causas de morbi-mortalidad en el mundo, sino por su elevado poder discapacitante. Según la OMS cada año mueren más personas por esta causa que por otra. Se calcula que en 2005 murieron por esta causa 17,5 millones de personas, lo cual represe...

  14. Karakteristik Pemakaian Bahasa Laras Iklan pada Jejaring Sosial Instagram (Kajian Sosiolinguistik)

    OpenAIRE

    DOMPAS, YETTY

    2017-01-01

    This research entitled Characteristic of Register Used in Advertisement on Instagram. Some problems that will be explained in this research are how is the characteristics of diction on advertisement on Instagram? And how is the code mixing on advertisement on Instagram? This research aimed to describe the characteristics of diction and code mixing on advertisement on Instagram. The method used in this research is observation method which observes the use of language on advertisement on Inst...

  15. FAILED STATE

    African Journals Online (AJOL)

    Dr. Miles R. Cone

    The state and society are mutual symbionts as far as their political, economic and social relationships .... consequences have played a role in the African state's deviation from the 'strong state' ideal. .... International Olympic Committee (IOC).

  16. Payment - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Payment measures – state data. This data set includes state-level data for the payment measures associated with an episode of care for heart attack, heart failure,...

  17. Supersqueezed states from squeezed states

    International Nuclear Information System (INIS)

    Nieto, M.M.

    1992-01-01

    Using super-Baker-Campbell-Hausdorff relations on the elements of the supergroup OSP(2/2), we derive the supersqueeze operator and the supersqueezed states, which are the supersymmetric generalization of the squeezed states of the harmonic oscillator

  18. Excited states

    CERN Document Server

    Lim, Edward C

    1974-01-01

    Excited States, Volume I reviews radiationless transitions, phosphorescence microwave double resonance through optical spectra in molecular solids, dipole moments in excited states, luminescence of polar molecules, and the problem of interstate interaction in aromatic carbonyl compounds. The book discusses the molecular electronic radiationless transitions; the double resonance techniques and the relaxation mechanisms involving the lowest triplet state of aromatic compounds; as well as the optical spectra and relaxation in molecular solids. The text also describes dipole moments and polarizab

  19. Multiquark states

    International Nuclear Information System (INIS)

    Wang, F.; Ping, J.L.; Quing, D.; Goldman, T.

    2005-01-01

    The pentaquark state recently discovered has been discussed based on various quark model calculations. Odd parity for the state cannot be ruled out theoretically because the contributions related to nontrivial color structures have not been studied completely. Other multiquark states, especially dibaryons, have been discussed also. A strangeness -3 NΩ dibaryons, have been shown to have a width as small as 12-22 keV and should be detectable in Ω-high-productivity reactions such as at RHIC, COMPAS, and the planned JHF and FAIR projects [ru

  20. Altered States

    International Development Research Centre (IDRC) Digital Library (Canada)

    But as members of the international community, we can take advantage of .... The connections and their effects, between people and states, are not just more ...... children's IQs and are linked to attention disorders, aggression, and delinquency.

  1. State Climatologist

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Quarterly newsletter published by the American Association of State Climatologists. Library includes volumes 1 through 21, for the years 1977-1997.

  2. State Averages

    Data.gov (United States)

    U.S. Department of Health & Human Services — A list of a variety of averages for each state or territory as well as the national average, including each quality measure, staffing, fine amount and number of...

  3. HCAHPS - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — A list of the state averages for the HCAHPS survey responses. HCAHPS is a national, standardized survey of hospital patients about their experiences during a recent...

  4. Cryptosporidium diagnosis by qPCR in cats at Rio de Janeiro state, Brazil

    Directory of Open Access Journals (Sweden)

    Lara Patrícia Santos Carrasco

    2016-11-01

    Full Text Available ABSTRACT. Carrasco L.P.S., Oliveira R.L.S., Moreira C.M.R., Santos C.R.G.R., Corgozinho K.B. & Souza H.J.M. [Cryptosporidium diagnosis by qPCR in cats at Rio de Janeiro state, Brazil.] Diagnóstico de Cryptosporidium spp. pela técnica de qPCR em gatos no estado do Rio de Janeiro, Brasil. Revista Brasileira de Medicina Veterinária, 38(Supl.:22-26, 2016. Programa de Pós-Graduação em MedicinaVeteriná- ria, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro, BR-465, Km 7, Seropédica, RJ 23890-000, Brasil. E-mail: carrasco.lara@gmail.com Cryptosporidium spp. is recognized as an important etiologic agent of diarrhea in many countries. The aim of this study was to detect the presence of DNA of the parasite Cryptosporidium spp. in feces of cats with history of chronic diarrhea attended in the Feline Medicine Sector of the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, by the polymerase chain reaction technique in real time (RT-PCR. In this study, 100 animals were admitted, of any breed or sex and from 8 weeks of age. As inclusion criteria, patients had to have diarrhea history for more than three weeks, with little success of clinical response to previously established therapies. From the samples obtained by collecting via washing the animal colon and spontaneous defecation, methods of direct examination of the feces, centrifugal flotation technique and real-time PCR were carried out. Of all cats selected for this study, 10% showed infection by Cryptosporidium spp. Most positive animals were aged over one year (70% and only 30% had up to one year old. Cats were 50% purebred and 50% were domestic short hair cats. The clinical signs presented by these cats at the time of consultation were diarrhea (60% and prolapsed rectum (40%. Four animals had co-infections with other enteropathogens (40%, such as Giardia, Toxocara sp. or Tritrichomonas fetus alone or combined. We concluded that infection by

  5. Rydberg states

    International Nuclear Information System (INIS)

    Brouillard, F.

    1983-01-01

    This chapter considers the formation of Rydberg atoms; their radiative decay; their behavior in electric and electromagnetic fields; and their collisions with atoms and ions. Discusses electron capture into high excited states; laser excitation of Rydberg states; Stark shift and Stark mixing; field ionization; ionization in oscillating fields; thermal collisions of Rydberg atoms; fast collisions of Rydberg atoms; n-changing collisions; and charge exchange. Points out that a large amount of experimental work has been done on collisions of Rydberg atoms with neutral perturbers at thermal energies, and most of it concerns the destruction of Rydberg alkali atoms in collisions with rare gases

  6. State Treasure

    Science.gov (United States)

    Olson, Cathy Applefeld

    2013-01-01

    When a music teacher is named Teacher of the Year for an entire state, one just know a special story awaits. The narrative of Heidi Welch, director of music at Hillsboro-Deering High School in New Hampshire, does not disappoint. Welch, who grew up in abject poverty and was often homeless, developed her love of music through memorizing and singing…

  7. FAILED STATE

    African Journals Online (AJOL)

    Dr. Miles R. Cone

    colonial history is the 'artificial nature' of Africa's state borders and the notion that statehood ..... Source: Central Intelligence Agency, 2003b. Scientia .... As a virtue of the lack of faith in the country's banking system, this move had the opposite ...

  8. RIVER STATE

    African Journals Online (AJOL)

    principals randomly selected from one hundred secondary schools in Cross River State. The data collected ... There was no siyriificant influerlce of gender on principals' leadership styles effectiveness. ... result of the cultural stereotyping of males and females by .... schools were single sex boys, another 10 were single sex ...

  9. State of the States 2016: Arts Education State Policy Summary

    Science.gov (United States)

    Aragon, Stephanie

    2016-01-01

    The "State of the States 2016" summarizes state policies for arts education identified in statute or administrative code for all 50 states and the District of Columbia. Information is based on a comprehensive search of state education statute and codes on each state's relevant websites. Complete results from this review are available in…

  10. The Anopheles (Anopheles) Crucians Subgroup in the United States (Diptera: Culicidae)

    Science.gov (United States)

    1976-01-01

    clans specimens in the Del -Mar-Va Peninsula (Buescher et al. J-920). The sig- nificance of these arbovirus isolations is discussed later. SYSTEMATIC...34EAH45", 5-VIII-1972, Rogers, 1L (UCLA), Belize: Sierra de Agua , IV-T.946, A. J. Walker, 29 (IJCLA). "BHA138", 1967, Mosq. Mid. Amer. 19 (UCLA), "BH366...highly acid Alabama swamp. The water had a high concentration of sulfate, sodium, potassium and ferrous ions as a result of contamination by a

  11. State perspectives

    International Nuclear Information System (INIS)

    Neill, R.H.

    1985-01-01

    Expectations by States in fulfilling their responsibilities in the disposal of radioactive wastes as defined in the Nuclear Waste Policy Act are discussed. Specific areas include informational needs, participation in the process of site selection and characterization, access to technical data in a timely manner, and development of consultation and cooperation agreements. Experiences in New Mexico over the past seven years in conducting an independent technical review of the WIPP Project are described. A discussion is included of avoidable factors that contribute to public concern of radioactive waste disposal on relative risk, voluntary versus involuntary risk, technological needs, changes in disposal practices, public health concerns and enforcement of regulations

  12. State of the States, 2012: Arts Education State Policy Summary

    Science.gov (United States)

    Arts Education Partnership (NJ1), 2012

    2012-01-01

    The "State of the States 2012" summarizes state policies for arts education identified in statute or code for all 50 states and the District of Columbia. Information is based primarily on results from the AEP Arts Education State Policy Survey conducted in 2010-11, and updated in April 2012.

  13. [Risk of death 4 years after a 1st cerebral infarction: prospective study in Barquisimeto, Estado Lara, Venezuela].

    Science.gov (United States)

    Poni, E; Granero, R; Escobar, B

    1995-12-01

    Stroke, the 5th. cause of death in Venezuela, has been associated to cerebral infarction. However, there is little information concerning lethality factors. 33 atherothrombotic subtype stroke patients, 31 (96%) Latino and 2(4%) white, were admitted into a prospective study to analyze the role of 11 mortality risk factors for those patients. A mortality relative risk (RR) > 1.5 or Mortality RR for patients age 65 and over (RR = 2.95) and 4 year mortality RR for male patients (RR = 2.04) were clinically and statistically significant. History of high blood pressure was protective (RR = 0.62) probably due to good medical control. Cumulative mortality was higher than that of comparable studies, even from the first week of follow-up, reaching 67% at the 4th year.

  14. LARA. Localization of an automatized refueling machine by acoustical sounding in breeder reactors - implementation of artificial intelligence techniques

    International Nuclear Information System (INIS)

    Lhuillier, C.; Malvache, P.

    1987-01-01

    The automatic control of the machine which handles the nuclear subassemblies in fast neutron reactors requires autonomous perception and decision tools. An acoustical device allows the machine to position in the work area. Artificial intelligence techniques are implemented to interpret the data: pattern recognition, scene analysis. The localization process is managed by an expert system. 6 refs.; 8 figs

  15. Climate Science Program at California State University, Northridge

    Science.gov (United States)

    Steele Cox, H.; Klein, D.; Cadavid, A. C.; Foley, B.

    2012-12-01

    Due to its interdisciplinary nature, climate science poses wide-ranging challenges for science and mathematics students seeking careers in this field. There is a compelling need for universities to provide coherent programs in climate science in order to train future climate scientists. With funding from NASA Innovations in Climate Education (NICE), California State University, Northridge (CSUN), is creating the CSUN Climate Science Program. An interdisciplinary team of faculty members is working in collaboration with UCLA, Santa Monica College and NASA/JPL partners to create a new curriculum in climate science. The resulting sequence of climate science courses, or Pathway for studying the Mathematics of Climate Change (PMCC), is integrated into a Bachelor of Science degree program in the Applied Mathematical Sciences offered by the Mathematics Department at CSUN. The PMCC consists of courses offered by the departments of Mathematics, Physics, and Geography and is designed to prepare students for Ph.D. programs in technical fields relevant to global climate change and related careers. The students who choose to follow this program will be guided to enroll in the following sequence of courses for their 12 units of upper division electives: 1) A newly created course junior level course, Math 396CL, in applied mathematics which will introduce students to applications of vector calculus and differential equations to the study of thermodynamics and atmospheric dynamics. 2) An already existing course, Math 483, with new content on mathematical modeling specialized for this program; 3) An improved version of Phys 595CL on the mathematics and physics of climate change with emphasis on Radiative Transfer; 4) A choice of Geog 407 on Remote Sensing or Geog 416 on Climate Change with updated content to train the students in the analysis of satellite data obtained with the NASA Earth Observing System and instruction in the analysis of data obtained within a Geographical

  16. EL MODELO B-LEARNING APLICADO A LA ENSEÑANZA DEL CURSO DE MATEMÁTICA I EN LA CARRERA DE INGENIERÍA CIVIL (THE MODEL B-LEARNING APPLIED TO THE THEACHING OF COURSE OF MATHEMATICS I IN CIVIL ENGINEERING

    Directory of Open Access Journals (Sweden)

    Troncoso Rodriguez Oswaldo

    2010-12-01

    Full Text Available Resumen:Esta experiencia tuvo como propósito la implementación del modelo b-learning en la enseñanza de la asignatura Matemática I, de la carrera de Ingeniería Civil, de la Universidad Centroccidental “Lisandro Alvarado” (UCLA, ubicada en Venezuela, estado Lara. En la misma se usaron de las tecnologías Web como elementos enriquecedores del proceso de enseñanza y aprendizaje, la plataforma Moodle y la combinación de estrategias propias de la educación presencial con estrategias propias de la educación virtual. La metodología utilizada corresponde a un proyecto factible orientado hacia la innovación tecnológica, pues busca resolver problemas y promover el empleo de tecnologías. El análisis de los resultados se enfocó a la eficiencia y eficacia de la propuesta. Para la eficiencia se analizaron los resultados de las entrevistas semi-estructuradas y las expectativas despertadas por el curso. Además, se consideraron los resultados de la alfabetización tecnológica y de la prueba de conocimientos previos necesarios para Matemática I. Para la eficacia se consideró el rendimiento académico y la calidad general del curso. Como conclusión se destaca que el modelo b-learning posibilita la participación activa del estudiante, pero el docente debe diseñar de manera pedagógica situaciones de aprendizaje para apoyar, informar, comunicar e interactuar pues esta es una forma se puede generar en el estudiante conocimientos específicos de la asignatura y promover en ellos el desarrollo de estrategias para el aprendizaje autónomo.Abstract:This experience had as a purpose the implementation of the b-learning model in the teaching of the Mathematics I, in the Civil Engineering, of the University Centroccidental “Lisandro Alvarado” (UCLA, located in Lara state, Venezuela. In the same one they were used of the Web technologies like wealth-producing elements of the process of education and learning, the platform Moodle and the

  17. Quantum States Transfer by Analogous Bell States

    International Nuclear Information System (INIS)

    Mei Di; Li Chong; Yang Guohui; Song Heshan

    2008-01-01

    Transmitting quantum states by channels of analogous Bell states is studied in this paper. We analyze the transmitting process, constructed the probabilitic unitary operator, and gain the largest successful transfer quantum state probability.

  18. Advanced density profile reflectometry; the state-of-the-art and measurement prospects for ITER

    Science.gov (United States)

    Doyle, E. J.

    2006-10-01

    Dramatic progress in millimeter-wave technology has allowed the realization of a key goal for ITER diagnostics, the routine measurement of the plasma density profile from millimeter-wave radar (reflectometry) measurements. In reflectometry, the measured round-trip group delay of a probe beam reflected from a plasma cutoff is used to infer the density distribution in the plasma. Reflectometer systems implemented by UCLA on a number of devices employ frequency-modulated continuous-wave (FM-CW), ultrawide-bandwidth, high-resolution radar systems. One such system on DIII-D has routinely demonstrated measurements of the density profile over a range of electron density of 0-6.4x10^19,m-3, with ˜25 μs time and ˜4 mm radial resolution, meeting key ITER requirements. This progress in performance was made possible by multiple advances in the areas of millimeter-wave technology, novel measurement techniques, and improved understanding, including: (i) fast sweep, solid-state, wide bandwidth sources and power amplifiers, (ii) dual polarization measurements to expand the density range, (iii) adaptive radar-based data analysis with parallel processing on a Unix cluster, (iv) high memory depth data acquisition, and (v) advances in full wave code modeling. The benefits of advanced system performance will be illustrated using measurements from a wide range of phenomena, including ELM and fast-ion driven mode dynamics, L-H transition studies and plasma-wall interaction. The measurement capabilities demonstrated by these systems provide a design basis for the development of the main ITER profile reflectometer system. This talk will explore the extent to which these reflectometer system designs, results and experience can be translated to ITER, and will identify what new studies and experimental tests are essential.

  19. Asociación entre la incidencia de leishmaniosis cutánea y el índice de desarrollo humano y sus componentes en cuatro estados endémicos de Venezuela Association between cutaneous leishmaniasis incidence and the human development index and its components in four endemic states of Venezuela

    Directory of Open Access Journals (Sweden)

    Alfonso J. Rodríguez-Morales

    2010-03-01

    Full Text Available Objetivos. Evaluar las posibles asociaciones entre el índice de desarrollo humano (IDH y sus componentes, y la incidencia de Leishmaniosis cutánea (LC en cuatro estados endémicos de Venezuela (Mérida, Trujillo, Lara y Sucre en el período 1994 al 2003. Materiales y métodos. La data socioeconómica (clasificada de acuerdo al Banco Mundial se obtuvo del Instituto Nacional de Estadística y la epidemiológica del Ministerio de Salud, ambos de Venezuela. Para este estudio ecológico se evaluó la variación anual de las variables y se realizó modelos de regresión. Resultados. El IDH varió en el período, de 0,6746 en 1994 a 0,8144 en 2003 (p=0,90, asimismo, se observó un aumento de la incidencia acumulada de Leishmaniosis, en especial del año 1998 (7,3 casos/100 000 hab a 1999 (11,3 casos/100 000 hab. Al analizar con los modelos de regresión lineal, se observó que la relación entre las variables epidemiológicas y sociales era diferente a nivel de los Estados evaluados. Para Mérida y Trujillo se observó un descenso significativo de la incidencia de LC con relación al aumento del porcentaje de alfabetización (pObjectives. Assess potential relationships between the Human Development Index (HDI and its components and the incidence of cutaneous leishmaniasis (CL in four endemic States of Venezuela (Mérida, Trujillo, Lara and Sucre in the period 1994-2003. Material and methods. Socioeconomical data (classified according the World Bank was obtained from the National Institute of Statistics, and the epidemiological data from the Ministry of Health, both from Venezuela. For this ecological study the annual variation of the variables was assessed and also regression models were done. Results. The HDI varied in the period from 0.6746 in 1994 to 0.8144 in 2003 (p=0.90. During this time an increase in the cumulative incidence of Leishmaniasis was observed, particularly from 1998 (7.3 cases/100,000 pop to 1999 (11.3 cases/100,000 pop. Analyzing

  20. Less head motion during MRI under task than resting-state conditions.

    Science.gov (United States)

    Huijbers, Willem; Van Dijk, Koene R A; Boenniger, Meta M; Stirnberg, Rüdiger; Breteler, Monique M B

    2017-02-15

    Head motion reduces data quality of neuroimaging data. In three functional magnetic resonance imaging (MRI) experiments we demonstrate that people make less head movements under task than resting-state conditions. In Experiment 1, we observed less head motion during a memory encoding task than during the resting-state condition. In Experiment 2, using publicly shared data from the UCLA Consortium for Neuropsychiatric Phenomics LA5c Study, we again found less head motion during several active task conditions than during a resting-state condition, although some task conditions also showed comparable motion. In the healthy controls, we found more head motion in men than in women and more motion with increasing age. When comparing clinical groups, we found that patients with a clinical diagnosis of bipolar disorder, or schizophrenia, move more compared to healthy controls or patients with ADHD. Both these experiments had a fixed acquisition order across participants, and we could not rule out that a first or last scan during a session might be particularly prone to more head motion. Therefore, we conducted Experiment 3, in which we collected several task and resting-state fMRI runs with an acquisition order counter-balanced. The results of Experiment 3 show again less head motion during several task conditions than during rest. Together these experiments demonstrate that small head motions occur during MRI even with careful instruction to remain still and fixation with foam pillows, but that head motion is lower when participants are engaged in a cognitive task. These finding may inform the choice of functional runs when studying difficult-to-scan populations, such as children or certain patient populations. Our findings also indicate that differences in head motion complicate direct comparisons of measures of functional neuronal networks between task and resting-state fMRI because of potential differences in data quality. In practice, a task to reduce head motion

  1. Employee, State of Alaska

    Science.gov (United States)

    Business Resources Division of Corporations, Business & Professional Licensing Dept. of Commerce Benefits Resources State Employee Directory State Calendar State Training: LearnAlaska State Travel Manager) Web Mail (Outlook) Login Who to Call Health Insurance Insurance Benefits Health and Optional

  2. Optimal resource states for local state discrimination

    Science.gov (United States)

    Bandyopadhyay, Somshubhro; Halder, Saronath; Nathanson, Michael

    2018-02-01

    We study the problem of locally distinguishing pure quantum states using shared entanglement as a resource. For a given set of locally indistinguishable states, we define a resource state to be useful if it can enhance local distinguishability and optimal if it can distinguish the states as well as global measurements and is also minimal with respect to a partial ordering defined by entanglement and dimension. We present examples of useful resources and show that an entangled state need not be useful for distinguishing a given set of states. We obtain optimal resources with explicit local protocols to distinguish multipartite Greenberger-Horne-Zeilinger and graph states and also show that a maximally entangled state is an optimal resource under one-way local operations and classical communication to distinguish any bipartite orthonormal basis which contains at least one entangled state of full Schmidt rank.

  3. Sweeping the State Space

    DEFF Research Database (Denmark)

    Mailund, Thomas

    The thesis describes the sweep-line method, a newly developed reduction method for alleviating the state explosion problem inherent in explicit-state state space exploration. The basic idea underlying the sweep-line method is, when calculating the state space, to recognise and delete states...... that are not reachable from the currently unprocessed states. Intuitively we drag a sweep-line through the state space with the invariant that all states behind the sweep-line have been processed and are unreachable from the states in front of the sweep-line. When calculating the state space of a system we iteratively...

  4. Alaska State Trails Program

    Science.gov (United States)

    Recreation Search DNR State of Alaska Home Menu Parks Home Alaska State Trails Boating Safety Design and Home / Alaska State Trails Alaska State Trails Program Trails in the Spotlight Glacier Lake and Saddle Trails in Kachemak State Park Glacier Lake A Popular route joins the Saddle and Glacier Lake Trails. The

  5. Evidence-Based Social Skills Training for Adolescents with Autism Spectrum Disorders: The UCLA PEERS Program

    Science.gov (United States)

    Laugeson, Elizabeth A.; Frankel, Fred; Gantman, Alexander; Dillon, Ashley R.; Mogil, Catherine

    2012-01-01

    The present study examines the efficacy and durability of the PEERS Program, a parent-assisted social skills group intervention for high-functioning adolescents with ASD. Results indicate that teens receiving PEERS significantly improved their social skills knowledge, social responsiveness, and overall social skills in the areas of social…

  6. Musica de la Frontera: Research Note on the UCLA Frontera Digital Archive

    Science.gov (United States)

    Romero, Robert Chao

    2005-01-01

    The Frontera Digital Archive is an impressive and invaluable research tool for multidisciplinary scholars of Chicana/o studies and Latin American studies. The archive preserves rare Mexican vernacular musical recordings and provides convenient access to these recordings via Internet.

  7. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

    Science.gov (United States)

    2007-03-01

    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  8. A summary of the results from the UCLA OGO-5 fluxgate magnetometer

    Science.gov (United States)

    Coleman, P. J., Jr.; Russell, C. T.

    1973-01-01

    The OGO-5 fluxgate magnetometer experiment (E-14) was designed to measure the vector magnetic field over the full range of the OGO-5 orbit. Thus, it had a dynamic range of + or - 64,000 gamma yet it maintained a precision of + or - 1/16 gamma at all times. This enabled a broad spectrum of problems to be attached. Studies of the magnetospheric waves, currents, waves-particle interactions, pitch angle distributions and wave normal directions were made. The structure of the magnetopause, the magnetotail, and bow shock were probed, waves and discontinuities in the solar wind were examined and the various phases of substorms were examined in depth.

  9. UCLA program in theory and modeling of edge physics and plasma material interaction

    International Nuclear Information System (INIS)

    Conn, R.W.; Najmabadi, F.; Grossman, A.; Merriman, B.; Day, M.

    1992-01-01

    Our research activity in edge plasma modeling is directed towards understanding edge plasma behavior and towards innovative solutions for controlling the edge plasma as well as the design and operation of impurity control, particle exhaust. and plasma facing components. During the last nine months, substantial progress was made in many areas. The highlights are: (A) Development of a second-generation edge-plasma simulation code (Section II); (B) Development of models for gas-target divertors, including a 1 1/2-D fluid model for plasma and Monte Carlo neutral-transport simulations (Section III); and (C) Utilization of the RF ponderomotive force and electrostatic biasing to distribute the heat load on a larger area of the divertor plate, and the development of analytical and numerical transport models that include both ponderomotive and electrostatic potentials

  10. Far-infrared laser scattering from spontaneous and driven fluctuations in the UCLA microtor tokamak

    International Nuclear Information System (INIS)

    Lee, P.; Luhmann, N.C.; Park, H. Jr.; Peebles, W.A.; Taylor, R.J.; Xu, Ying; Yu, C.X.

    1982-01-01

    A far-infrared (FIR) laser scattering system for the study of tokamak density fluctuations is described. Recent scattering data from low frequency microturbulence in high density (n >= 5 x 10 13 cm -3 ) microtor discharges are presented. In addition, the first observation and identification of internal modes generated during ICRF heating are described. The latter study directly conforms to fast wave mode conversion theory in a two-ion species plasma. In particular, the first internal observation of mode converted ion Bernstein waves in a tokamak plasma has been made. (author)

  11. Syllabus for Privacy and Information Technology, Fall 2017, UCLA Information Studies

    OpenAIRE

    Borgman, Christine L.

    2017-01-01

    Privacy is a broad topic that covers many disciplines, stakeholders, and concerns. This course addresses the intersection of privacy and information technology, surveying a wide array of topics of concern for research and practice in the information fields. Among the topics covered are the history and changing contexts of privacy; privacy risks and harms; law, policies, and practices; privacy in searching for information, in reading, and in libraries; surveillance, networks, and privacy by de...

  12. 76 FR 36148 - Notice of Inventory Completion: Fowler Museum at UCLA, Los Angeles, CA

    Science.gov (United States)

    2011-06-21

    ... in consultation with representatives of the Bear River Band of the Rohnerville Rancheria, California... notice. The Bear River Band of the Rohnerville Rancheria, California, and the Blue Lake Rancheria... Historic Medical Museum. A search of the Wellcome archives produced no documentation directly related to...

  13. Center for Multiscale Plasma Dynamics: Report on Activities (UCLA/MIT), 2009-2010

    Energy Technology Data Exchange (ETDEWEB)

    Carter, Troy Alan [Univ. of California, Los Angeles, CA (United States)

    2014-10-03

    The final “phaseout” year of the CMPD ended July 2010; a no cost extension was requested until May 2011 in order to enable the MIT subcontract funds to be fully utilized. Research progress over this time included verification and validation activities for the BOUT and BOUT++ code, studies of spontaneous reconnection in the VTF facility at MIT, and studies of the interaction between Alfv´en waves and drift waves in LAPD. The CMPD also hosted the 6th plasma physics winter school in 2010 (jointly with the NSF frontier center the Center for Magnetic Self-Organization, significant funding came from NSF for this most recent iteration of theWinter School).

  14. Materials data base and design equations for the UCLA solid breeder blanket

    International Nuclear Information System (INIS)

    Sharafat, S.; Amodeo, R.; Ghoniem, N.M.

    1986-02-01

    The materials and properties investigated for this blanket study are listed. The phenomenological equations and mathematical fits for all materials and properties considered are given. Efforts to develop a swelling equation based on the few experimental data points available for breeder materials are described. The sintering phenomena for ceramics is investigated

  15. 76 FR 48176 - Notice of Inventory Completion: Fowler Museum at UCLA, Los Angeles, CA

    Science.gov (United States)

    2011-08-08

    ...; Tohono O'odham Nation of Arizona; and the Zuni Tribe of the Zuni Reservation, New Mexico. The Salt River... Indian Reservation, Arizona; and Tohono O'odham Nation of Arizona (hereinafter referred to as ``The Four...

  16. Materials data base and design equations for the UCLA solid breeder blanket

    International Nuclear Information System (INIS)

    Sharafat, S.; Amodeo, R.; Ghoniem, N.M.

    1986-01-01

    The need for a complete and coherent material data base for fusion reactor systems has been an important issue for some time now. Since the choices for materials used in fusion reactors are becoming more apparent, it is important to be able to quickly access this data to facilitate reactor design. The philosophy of a data base is one of expansion and modification. This will lead to a constantly growing collection of most recently acquired information. Based on this philosophy special care has been given to the structure, the accessibility and ease of modification. The data base is developed primarily for use on Personal Computers (PC's). In Section 10.2. materials and properties investigated for this blanket study are listed. Section 10.3. is a list of phenomenological equations and mathematical fits for all materials and properties considered. Section 10.4. describes the authors efforts to develop a swelling equations based on the few experimental data points available for breeder materials. In Section 10.5. the sintering phenomena for ceramics is investigated

  17. UCLA at TREC 2014 Clinical Decision Support Track: Exploring Language Models, Query Expansion, and Boosting

    Science.gov (United States)

    2014-11-01

    qualitative benet to the retrieved results compared to lower and higher boost factors. 3 Query terms Comments right lower quadrant abdominal pain ... pain for hours, decreased appetite, and enlarged appendix on abdominal ultrasound. Table 1 describes the query terms for an example patient summary. The...the diagnostic process. For example, pediatric cases, women of child- bearing age, and geriatic populations each have a distinct set of possible

  18. The UCLA hadronization model and Pt correlation study at √s = 29 GeV

    International Nuclear Information System (INIS)

    Chun, Sebong.

    1989-01-01

    With only longitudinal phase space, a linear confining quark potential, and Clebsch-Gordon coefficients, the authors demonstrate remarkable agreement with a large body of data. This involves only two parameters of a modified Lund symmetric fragmentation function a, b and three coherent lengths: the number of hadrons over which the transverse momentum P t is required to be compensated, the degree of the spin correlation between a diquark and its partner anti-diquark in baryon and anti-baryon production, and the degree of suppression of successive mesons created between a baryon and anti-baryon (which comes from the uncertainty principle). These coherent lengths have a common fundamental characteristic, namely, the propagation length of information along the chain of produced hadrons. As a separate effort to probe the propagation length of P t , we studied the correlations in momentum transverse to the event jet-axis for neighboring particles close in rapidity, which reflect the tendency of back-to-back production of the hadron pairs. He found indications of interesting correlations, but that a larger data sample is needed for definitive understanding of the area

  19. Earthquake and ambient vibration monitoring of the steel-frame UCLA factor building

    Science.gov (United States)

    Kohler, M.D.; Davis, P.M.; Safak, E.

    2005-01-01

    Dynamic property measurements of the moment-resisting steel-frame University of California, Los Angeles, Factor building are being made to assess how forces are distributed over the building. Fourier amplitude spectra have been calculated from several intervals of ambient vibrations, a 24-hour period of strong winds, and from the 28 March 2003 Encino, California (ML = 2.9), the 3 September 2002 Yorba Linda, California (ML = 4.7), and the 3 November 2002 Central Alaska (Mw = 7.9) earthquakes. Measurements made from the ambient vibration records show that the first-mode frequency of horizontal vibration is between 0.55 and 0.6 Hz. The second horizontal mode has a frequency between 1.6 and 1.9 Hz. In contrast, the first-mode frequencies measured from earthquake data are about 0.05 to 0.1 Hz lower than those corresponding to ambient vibration recordings indicating softening of the soil-structure system as amplitudes become larger. The frequencies revert to pre-earthquake levels within five minutes of the Yorba Linda earthquake. Shaking due to strong winds that occurred during the Encino earthquake dominates the frequency decrease, which correlates in time with the duration of the strong winds. The first shear wave recorded from the Encino and Yorba Linda earthquakes takes about 0.4 sec to travel up the 17-story building. ?? 2005, Earthquake Engineering Research Institute.

  20. Community College Faculty Retention: Examining Burnout, Stress, and Job Satisfaction. UCLA Community College Bibliography

    Science.gov (United States)

    McJunkin, Kyle Stewart

    2005-01-01

    Recent literature on faculty departure from community colleges has focused primarily on faculty retirement. Less research has been conducted on turnover related to stress and faculty burnout, particularly at the community college level. In order to shed some light on this subject, the citations in this annotated bibliography focus on the…

  1. State Traffic Safety Information

    Data.gov (United States)

    Department of Transportation — The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic...

  2. State Transportation Statistics 2014

    Science.gov (United States)

    2014-12-15

    The Bureau of Transportation Statistics (BTS) presents State Transportation Statistics 2014, a statistical profile of transportation in the 50 states and the District of Columbia. This is the 12th annual edition of State Transportation Statistics, a ...

  3. State Park Trails

    Data.gov (United States)

    Minnesota Department of Natural Resources — This data set is a collection of ArcView shapefiles (by park) of trails within statutory boundaries of individual MN State Parks, State Recreation Areas and State...

  4. State Park Statutory Boundaries

    Data.gov (United States)

    Minnesota Department of Natural Resources — Legislative statutory boundaries for sixty six state parks, six state recreation areas, and eight state waysides. These data are derived principally from DNR's...

  5. Geomorphology and sedimentology of badlands system in the southwest coastline of Castle Araya, Sucre State, Venezuela

    Directory of Open Access Journals (Sweden)

    Franklin Antonio Nuñez Ravelo

    2017-03-01

    Full Text Available The study area is located in the south-west coast of Araya in Sucre State, between 10° 33’30’’ N , 10°33’59’’ N y 64°15’32’’ W, 64°15’36’’ W, which it is affected by erosion processes impacting the population center that sits there. Hence the research is to analyze the geomorphological processes developed, based on a model no-experimental and design field, in descriptive and explanatory levels, operationalized in three phases: a field, to collect 21 samples of surface sediment (0-20 cm distributed in 12 samples in the first badlands and 9 samples in the second and lift the morphometry of these landforms erosion; (b image analysis, three stages such as the development of thematic maps from the Topographical maps of Cumana, Geological Araya Peninsula and The Cadastral Charter covered: Punta Caracare; followed by drawing sketches of gullies, from the data collected in the field, refer to height, length and width of the land. Corresponding to the last two variables data were corrected by the equation suggested by Wolf and Ghilani (2008, for data collected on slopes using measuring tape; and finally drawing the sketch of the apical cliff line drawn from the interpretation of the captured images of Google Earth for the years 2003, 2006, 2009 and 2011, based on the proposal of Soriano (2009 and (c laboratory, to analyze the comportamientode physical properties such as: hygroscopic water content, determined by gravimetric method, based on the arguments presented by Rivera, et al. (2006 and Toledo (2009; size distribution of the particles (Method Bouyoucos following the protocol reported by Lara (1985; Percentage of dispersion and soil (double hydrometer method based on the specifications referred by porters and Alva (1999. As for the chemical-mineralogical properties, it was determined from 10 samples analysis of total rocks and clay mineralogy, for both analyzes samples were prepared, processed and analyzed in the laboratory

  6. Minimally conscious state or cortically mediated state?

    Science.gov (United States)

    Naccache, Lionel

    2018-04-01

    Durable impairments of consciousness are currently classified in three main neurological categories: comatose state, vegetative state (also recently coined unresponsive wakefulness syndrome) and minimally conscious state. While the introduction of minimally conscious state, in 2002, was a major progress to help clinicians recognize complex non-reflexive behaviours in the absence of functional communication, it raises several problems. The most important issue related to minimally conscious state lies in its criteria: while behavioural definition of minimally conscious state lacks any direct evidence of patient's conscious content or conscious state, it includes the adjective 'conscious'. I discuss this major problem in this review and propose a novel interpretation of minimally conscious state: its criteria do not inform us about the potential residual consciousness of patients, but they do inform us with certainty about the presence of a cortically mediated state. Based on this constructive criticism review, I suggest three proposals aiming at improving the way we describe the subjective and cognitive state of non-communicating patients. In particular, I present a tentative new classification of impairments of consciousness that combines behavioural evidence with functional brain imaging data, in order to probe directly and univocally residual conscious processes.

  7. State nuclear initiatives in the United States

    International Nuclear Information System (INIS)

    Strauss, P.L.; Stoiber, C.R.

    1977-01-01

    The paper deals with State nuclear initiatives regarding the role of nuclear power in the energy future of the United States. The question of whether and under what circumstances nuclear facilities should be used to generate electricity was put to the popular vote in several States in 1976. Some general principles of Federal-State relations are discussed with specific reference to nuclear regulations. The initiative mechanism itself is described as well as its legal form and background. The parallel developments in the State and Federal legislative consideration of nuclear issues is reviewed and the suggested reasons for the defeat of the proposals in the seven States concerned are discussed. Finally, the author draws some conclusions on the effects of the 1976 initiatives on future decision-making in the US on energy policy in general and nuclear power in particular. (NEA) [fr

  8. Transcriptome States Reflect Imaging of Aging States.

    Science.gov (United States)

    Eckley, D Mark; Coletta, Christopher E; Orlov, Nikita V; Wilson, Mark A; Iser, Wendy; Bastian, Paul; Lehrmann, Elin; Zhang, Yonqing; Becker, Kevin G; Goldberg, Ilya G

    2018-06-14

    In this study, we describe a morphological biomarker that detects multiple discrete subpopulations (or "age-states") at several chronological ages in a population of nematodes (Caenorhabditis elegans). We determined the frequencies of three healthy adult states and the timing of the transitions between them across the lifespan. We used short-lived and long-lived strains to confirm the general applicability of the state classifier and to monitor state progression. This exploration revealed healthy and unhealthy states, the former being favored in long-lived strains and the latter showing delayed onset. Short-lived strains rapidly transitioned through the putative healthy state. We previously found that age-matched animals in different age-states have distinct transcriptome profiles. We isolated animals at the beginning and end of each identified state and performed microarray analysis (principal component analysis, relative sample to sample distance measurements, and gene set enrichment analysis). In some comparisons, chronologically identical individuals were farther apart than morphologically identical individuals isolated on different days. The age-state biomarker allowed assessment of aging in a novel manner, complementary to chronological age progression. We found hsp70 and some small heat shock protein genes are expressed later in adulthood, consistent with the proteostasis collapse model.

  9. Tomography of nonclassical states

    NARCIS (Netherlands)

    Bazrafkan, MR; Man'ko, [No Value

    2003-01-01

    A review of the symplectic tomography method is presented. Superpositions of different types of photon states are considered within the framework of the tomography approach. Such nonclassical photon states as even and odd coherent states, crystallized Schrodinger cat states, and other superposition

  10. The State and Corporatism

    DEFF Research Database (Denmark)

    Kaspersen, Lars Bo; Schmidt-Hansen, Ulrich

    in corporatist theory. In particular, we draw upon a conceptualization of the state developed by Michael Mann and Eric Nordlinger's different forms of state autonomy. We propose a state-centered theoretical focus enabling us to grasp the role of the state in the dynamics of the corporatist system. In the second...... to the development of the `Danish model', but that these actors were often orchestrated by the state. At crucial moments the direction of these different actors was even determined by the state. In the first part of the article, it is argued that the state has been under-theorized and to some extent neglected...

  11. Photon virtual bound state

    International Nuclear Information System (INIS)

    Inoue, J.; Ohtaka, K.

    2004-01-01

    We study virtual bound states in photonics, which are a vectorial extension of electron virtual bound states. The condition for these states is derived. It is found that the Mie resonant state which satisfies the condition that the size parameter is less than the angular momentum should be interpreted as a photon virtual bound state. In order to confirm the validity of the concept, we compare the photonic density of states, the width of which represents the lifetime of the photon virtual bound states, with numerical results

  12. Solid state video cameras

    CERN Document Server

    Cristol, Y

    2013-01-01

    Solid State Video Cameras reviews the state of the art in the field of solid-state television cameras as compiled from patent literature. Organized into 10 chapters, the book begins with the basic array types of solid-state imagers and appropriate read-out circuits and methods. Documents relating to improvement of picture quality, such as spurious signal suppression, uniformity correction, or resolution enhancement, are also cited. The last part considerssolid-state color cameras.

  13. Quantum-state discrimination

    International Nuclear Information System (INIS)

    Roa, Luis; Retamal, Juan Carlos; Saavedra, Carlos

    2002-01-01

    A proposal for a physical implementation of a quantum-state discrimination protocol using an ion in a linear trap is studied, where two nonorthogonal quantum states are codified using two electronic states of the ion. In addition, a protocol is given for discriminating superpositions of nonorthogonal entangled states between ions inside widely separated optical cavities. The discrimination protocol is extended to the case of N linearly independent nonorthogonal quantum states lying in a space of 2N-1 dimensions

  14. Verification of hypergraph states

    Science.gov (United States)

    Morimae, Tomoyuki; Takeuchi, Yuki; Hayashi, Masahito

    2017-12-01

    Hypergraph states are generalizations of graph states where controlled-Z gates on edges are replaced with generalized controlled-Z gates on hyperedges. Hypergraph states have several advantages over graph states. For example, certain hypergraph states, such as the Union Jack states, are universal resource states for measurement-based quantum computing with only Pauli measurements, while graph state measurement-based quantum computing needs non-Clifford basis measurements. Furthermore, it is impossible to classically efficiently sample measurement results on hypergraph states unless the polynomial hierarchy collapses to the third level. Although several protocols have been proposed to verify graph states with only sequential single-qubit Pauli measurements, there was no verification method for hypergraph states. In this paper, we propose a method for verifying a certain class of hypergraph states with only sequential single-qubit Pauli measurements. Importantly, no i.i.d. property of samples is assumed in our protocol: any artificial entanglement among samples cannot fool the verifier. As applications of our protocol, we consider verified blind quantum computing with hypergraph states, and quantum computational supremacy demonstrations with hypergraph states.

  15. Crystallized Schroedinger cat states

    International Nuclear Information System (INIS)

    Castanos, O.; Lopez-Pena, R.; Man'ko, V.I.

    1995-01-01

    Crystallized Schroedinger cat states (male and female) are introduced on the base of extension of group construction for the even and odd coherent states of the electromagnetic field oscillator. The Wigner and Q functions are calculated and some are plotted for C 2 , C 3 , C 4 , C 5 , C 3v Schroedinger cat states. Quadrature means and dispersions for these states are calculated and squeezing and correlation phenomena are studied. Photon distribution functions for these states are given explicitly and are plotted for several examples. A strong oscillatory behavior of the photon distribution function for some field amplitudes is found in the new type of states

  16. Most energetic passive states.

    Science.gov (United States)

    Perarnau-Llobet, Martí; Hovhannisyan, Karen V; Huber, Marcus; Skrzypczyk, Paul; Tura, Jordi; Acín, Antonio

    2015-10-01

    Passive states are defined as those states that do not allow for work extraction in a cyclic (unitary) process. Within the set of passive states, thermal states are the most stable ones: they maximize the entropy for a given energy, and similarly they minimize the energy for a given entropy. Here we find the passive states lying in the other extreme, i.e., those that maximize the energy for a given entropy, which we show also minimize the entropy when the energy is fixed. These extremal properties make these states useful to obtain fundamental bounds for the thermodynamics of finite-dimensional quantum systems, which we show in several scenarios.

  17. Excited states v.6

    CERN Document Server

    Lim, Edward C

    1982-01-01

    Excited States, Volume 6 is a collection of papers that discusses the excited states of molecules. The first paper discusses the linear polyene electronic structure and potential surfaces, considering both the theoretical and experimental approaches in such electronic states. This paper also reviews the theory of electronic structure and cites some experimental techniques on polyene excitations, polyene spectroscopic phenomenology, and those involving higher states of polyenes and their triplet states. Examples of these experimental studies of excited states involve the high-resolution one-pho

  18. Drug Poisoning Mortality by State: United States

    Data.gov (United States)

    U.S. Department of Health & Human Services — This dataset describes drug poisoning deaths at the U.S. and state level by selected demographic characteristics, and includes age-adjusted death rates for drug...

  19. The Welfare State vs. the Redistributive State.

    Science.gov (United States)

    Plattner, Marc F.

    1979-01-01

    While the principles of progressive taxation and the welfare state have come to be almost universally accepted, it would be a serious error to infer that American policy has ever embraced the idea of income redistribution. (Author)

  20. State diagrams of tokamaks and state transitions

    International Nuclear Information System (INIS)

    Minardi, E.

    1992-01-01

    In a simple one-fluid cylindrical model of transport and of dissipative effects, the family of the magnetic states of the Tokamak which correspond to a vanishing entropy production in the confinement region is characterized by a define relation or ''state equation'' involving the relevant parameters of the discharge. An investigation is made as to how the entropy production changes when the current density profile is rearranged by a perturbation which conserves the poloidal magnetic flux. It is shown that for a sufficiently short time interval, that is to say t 2 E τ s where τ E is the energy confinement time and τ s is the resistive time, neighbouring bifurcating equilibria exist which can be reached with a flux-conserving transition and with increase of the magnetic entropy. The family of these new states can also be characterized by a state equation involving the relevant discharge parameters. When the state equations of the two families are simultaneously satisfied by the same set of parameter values, a flux-conserving, entropy-increasing transition may take place between states of the two families. The modifications of the current density and of the temperature profiles involved in the transition and the conditions that the discharge parameters should satisfy in order that the transition could occur are investigated. (author)

  1. STATE_SYSTEM

    Data.gov (United States)

    Kansas Data Access and Support Center — This dataset is a single centerline highway network representation of the 10,000 miles Kansas State Highway System (Interstate, U.S., and Kansas routes). The state...

  2. State Capitalism in Eurasia

    NARCIS (Netherlands)

    C. Spechler, Martin; Ahrens, Joachim; Hoen, Herman W.

    2017-01-01

    The book specifies the type of economic system that has arisen in Central Asian. It presents three types of state-capitalism established in the former Soviet Union states in Eurasia - crony, dual sector, and predatory capitalism.

  3. Stats of the States

    Science.gov (United States)

    ... and age-adjusted death rates from unintentional injuries/accidents. Stroke Mortality by State, 2013 - Number of deaths and age-adjusted death rates from cerebrovascular disease. Alzheimer's Disease Mortality by State, 2013 - Number ...

  4. Complications and Deaths - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Complications and deaths - state data. This data set includes state-level data for the hip/knee complication measure, the Agency for Healthcare Research and Quality...

  5. Complications and Deaths - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Complications and deaths - state data. This data set includes state-level data for the hip/knee complication measure, the CMS Patient Safety Indicators, and 30-day...

  6. State Water Districts

    Data.gov (United States)

    California Natural Resource Agency — State Water Project District boundaries are areas where state contracts provide water to the district in California. This database is designed as a regions polygon...

  7. State Program Integrity Reviews

    Data.gov (United States)

    U.S. Department of Health & Human Services — State program integrity reviews play a critical role in how CMS provides effective support and assistance to states in their efforts to combat provider fraud and...

  8. Malaria Treatment (United States)

    Science.gov (United States)

    ... Providers, Emergency Consultations, and General Public. Contact Us Malaria Treatment (United States) Recommend on Facebook Tweet Share Compartir Treatment of Malaria: Guidelines For Clinicians (United States) Download PDF version ...

  9. Heart Attack Payment - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Payment for heart attack patients measure – state data. This data set includes state-level data for payments associated with a 30-day episode of care for heart...

  10. State Transportation Statistics 2010

    Science.gov (United States)

    2011-09-14

    The Bureau of Transportation Statistics (BTS), a part of DOTs Research and Innovative Technology Administration (RITA), presents State Transportation Statistics 2010, a statistical profile of transportation in the 50 states and the District of Col...

  11. State transportation statistics 2009

    Science.gov (United States)

    2009-01-01

    The Bureau of Transportation Statistics (BTS), a part of DOTs Research and : Innovative Technology Administration (RITA), presents State Transportation : Statistics 2009, a statistical profile of transportation in the 50 states and the : District ...

  12. State Transportation Statistics 2011

    Science.gov (United States)

    2012-08-08

    The Bureau of Transportation Statistics (BTS), a part of DOTs Research and Innovative Technology Administration (RITA), presents State Transportation Statistics 2011, a statistical profile of transportation in the 50 states and the District of Col...

  13. 7 CFR 1220.615 - State and United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false State and United States. 1220.615 Section 1220.615... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.615 State and United States. State and United States include the 50 States of the United States of America, the District of Columbia...

  14. 7 CFR 1220.129 - State and United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false State and United States. 1220.129 Section 1220.129... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.129 State and United States. The terms State and United States include the 50 States of the United States of America, the District...

  15. 7 CFR 1209.21 - State and United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false State and United States. 1209.21 Section 1209.21... Definitions § 1209.21 State and United States. (a) State means any of the several States, the District of Columbia, and the Commonwealth of Puerto Rico. (b) United States means collectively the several States of...

  16. Changing State Digital Libraries

    Science.gov (United States)

    Pappas, Marjorie L.

    2006-01-01

    Research has shown that state virtual or digital libraries are evolving into websites that are loaded with free resources, subscription databases, and instructional tools. In this article, the author explores these evolving libraries based on the following questions: (1) How user-friendly are the state digital libraries?; (2) How do state digital…

  17. Solid state radiation dosimetry

    International Nuclear Information System (INIS)

    Moran, P.R.

    1976-01-01

    Important recent developments provide accurate, sensitive, and reliable radiation measurements by using solid state radiation dosimetry methods. A review of the basic phenomena, devices, practical limitations, and categories of solid state methods is presented. The primary focus is upon the general physics underlying radiation measurements with solid state devices

  18. Determinants of State Aid

    NARCIS (Netherlands)

    Buiren, K.; Brouwer, E.

    2010-01-01

    From economic theory we derive a set of hypotheses on the determination of state aid. Econometric analysis on EU state aid panel data is carried out to test whether the determinants we expect on the basis of theory, correspond to the occurrence of state aid in practice in the EU. We find that

  19. Matrix product state description of Halperin states

    Science.gov (United States)

    Crépel, V.; Estienne, B.; Bernevig, B. A.; Lecheminant, P.; Regnault, N.

    2018-04-01

    Many fractional quantum Hall states can be expressed as a correlator of a given conformal field theory used to describe their edge physics. As a consequence, these states admit an economical representation as an exact matrix product state (MPS) that was extensively studied for the systems without any spin or any other internal degrees of freedom. In that case, the correlators are built from a single electronic operator, which is primary with respect to the underlying conformal field theory. We generalize this construction to the archetype of Abelian multicomponent fractional quantum Hall wave functions, the Halperin states. These can be written as conformal blocks involving multiple electronic operators and we explicitly derive their exact MPS representation. In particular, we deal with the caveat of the full wave-function symmetry and show that any additional SU(2) symmetry is preserved by the natural MPS truncation scheme provided by the conformal dimension. We use our method to characterize the topological order of the Halperin states by extracting the topological entanglement entropy. We also evaluate their bulk correlation lengths, which are compared to plasma analogy arguments.

  20. Remote state preparation through hyperentangled atomic states

    Science.gov (United States)

    Nawaz, Mehwish; ul-Islam, Rameez-; Ikram, Manzoor

    2018-04-01

    Hyperentangled states have enhanced channel capacity in quantum processing and have yielded` evident increased communication speed in quantum informatics as a consequence of excessively high information content coded over each quantum entity. In the present article, we intend to demonstrate this fact by utilizing atomic states simultaneously entangled both in internal as well as external degrees of freedom, i.e. the de Broglie motion for remote state preparation (RSP). The results clearly demonstrate that we can efficiently communicate two bit information while manipulating only a single quantum subsystem. The states are prepared and manipulated using atomic Bragg diffraction as well as Ramsey interferometry, both of which are now considered as standard, state of the art tools based on cavity quantum electrodynamics. Since atomic Bragg diffraction is a large interaction time regime and produces spatially well separated, decoherence resistant outputs, the schematics presented here for the RSP offer important perspectives on efficient detection as well as unambiguous information coding and readout. The article summarizes the experimental feasibility of the proposal, culminating with a brief discussion.

  1. Quantum states of light

    CERN Document Server

    Furusawa, Akira

    2015-01-01

    This book explains what quantum states of light look like. Of special interest, a single photon state is explained by using a wave picture, showing that it corresponds to the complementarity of a quantum. Also explained is how light waves are created by photons, again corresponding to the complementarity of a quantum. The author shows how an optical wave is created by superposition of a "vacuum" and a single photon as a typical example. Moreover, squeezed states of light are explained as "longitudinal" waves of light and Schrödinger's cat states as macroscopic superposition states.

  2. Symmetries of Chimera States

    Science.gov (United States)

    Kemeth, Felix P.; Haugland, Sindre W.; Krischer, Katharina

    2018-05-01

    Symmetry broken states arise naturally in oscillatory networks. In this Letter, we investigate chaotic attractors in an ensemble of four mean-coupled Stuart-Landau oscillators with two oscillators being synchronized. We report that these states with partially broken symmetry, so-called chimera states, have different setwise symmetries in the incoherent oscillators, and in particular, some are and some are not invariant under a permutation symmetry on average. This allows for a classification of different chimera states in small networks. We conclude our report with a discussion of related states in spatially extended systems, which seem to inherit the symmetry properties of their counterparts in small networks.

  3. Generalized hypergeometric coherent states

    International Nuclear Information System (INIS)

    Appl, Thomas; Schiller, Diethard H

    2004-01-01

    We introduce a large class of holomorphic quantum states by choosing their normalization functions to be given by generalized hypergeometric functions. We call them generalized hypergeometric states in general, and generalized hypergeometric coherent states in particular, if they allow a resolution of unity. Depending on the domain of convergence of the generalized hypergeometric functions, we distinguish generalized hypergeometric states on the plane, the open unit disc and the unit circle. All states are eigenstates of suitably defined lowering operators. We then study their photon number statistics and phase properties as revealed by the Husimi and Pegg-Barnett phase distributions. On the basis of the generalized hypergeometric coherent states we introduce new analytic representations of arbitrary quantum states in Bargmann and Hardy spaces as well as generalized hypergeometric Husimi distributions and corresponding phase distributions

  4. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  5. Qutrit magic state distillation

    International Nuclear Information System (INIS)

    Anwar, Hussain; Browne, Dan E; Campbell, Earl T

    2012-01-01

    Magic state distillation (MSD) is a purification protocol that plays an important role in fault-tolerant quantum computation. Repeated iteration of the steps of an MSD protocol generates pure single non-stabilizer states, or magic states, from multiple copies of a mixed resource state using stabilizer operations only. Thus mixed resource states promote the stabilizer operations to full universality. MSD was introduced for qubit-based quantum computation, but little has been known concerning MSD in higher-dimensional qudit-based computation. Here, we describe a general approach for studying MSD in higher dimensions. We use it to investigate the features of a qutrit MSD protocol based on the five-qutrit stabilizer code. We show that this protocol distils non-stabilizer magic states, and identify two types of states that are attractors of this iteration map. Finally, we show how these states may be converted, via stabilizer circuits alone, into a state suitable for state-injected implementation of a non-Clifford phase gate, enabling non-Clifford unitary computation. (paper)

  6. State Technologies Advancement Collaborative

    Energy Technology Data Exchange (ETDEWEB)

    David S. Terry

    2012-01-30

    The U. S. Department of Energy (DOE), National Association of State Energy Officials (NASEO), and Association of State Energy Research and Technology Transfer Institutions (ASERTTI) signed an intergovernmental agreement on November 14, 2002, that allowed states and territories and the Federal Government to better collaborate on energy research, development, demonstration and deployment (RDD&D) projects. The agreement established the State Technologies Advancement Collaborative (STAC) which allowed the states and DOE to move RDD&D forward using an innovative competitive project selection and funding process. A cooperative agreement between DOE and NASEO served as the contracting instrument for this innovative federal-state partnership obligating funds from DOE's Office of Energy Efficiency and Renewable Energy and Office of Fossil Energy to plan, fund, and implement RDD&D projects that were consistent with the common priorities of the states and DOE. DOE's Golden Field Office provided Federal oversight and guidance for the STAC cooperative agreement. The STAC program was built on the foundation of prior Federal-State efforts to collaborate on and engage in joint planning for RDD&D. Although STAC builds on existing, successful programs, it is important to note that it was not intended to replace other successful joint DOE/State initiatives such as the State Energy Program or EERE Special Projects. Overall the STAC process was used to fund, through three competitive solicitations, 35 successful multi-state research, development, deployment, and demonstration projects with an overall average non-federal cost share of 43%. Twenty-two states were awarded at least one prime contract, and organizations in all 50 states and some territories were involved as subcontractors in at least one STAC project. Projects were funded in seven program areas: (1) Building Technologies, (2) Industrial Technologies, (3) Transportation Technologies, (4) Distributed Energy

  7. Quantum State Engineering Via Coherent-State Superpositions

    Science.gov (United States)

    Janszky, Jozsef; Adam, P.; Szabo, S.; Domokos, P.

    1996-01-01

    The quantum interference between the two parts of the optical Schrodinger-cat state makes possible to construct a wide class of quantum states via discrete superpositions of coherent states. Even a small number of coherent states can approximate the given quantum states at a high accuracy when the distance between the coherent states is optimized, e. g. nearly perfect Fock state can be constructed by discrete superpositions of n + 1 coherent states lying in the vicinity of the vacuum state.

  8. Quantum chimera states

    Energy Technology Data Exchange (ETDEWEB)

    Viennot, David, E-mail: david.viennot@utinam.cnrs.fr; Aubourg, Lucile

    2016-02-15

    We study a theoretical model of closed quasi-hermitian chain of spins which exhibits quantum analogues of chimera states, i.e. long life classical states for which a part of an oscillator chain presents an ordered dynamics whereas another part presents a disordered dynamics. For the quantum analogue, the chimera behaviour deals with the entanglement between the spins of the chain. We discuss the entanglement properties, quantum chaos, quantum disorder and semi-classical similarity of our quantum chimera system. The quantum chimera concept is novel and induces new perspectives concerning the entanglement of multipartite systems. - Highlights: • We propose a spin chain model with long range couplings having purely quantum states similar to the classical chimera states. • The quantum chimera states are characterized by the coexistence of strongly entangled and non-entangled spins in the same chain. • The quantum chimera states present some characteristics of quantum chaos.

  9. Quantum chimera states

    International Nuclear Information System (INIS)

    Viennot, David; Aubourg, Lucile

    2016-01-01

    We study a theoretical model of closed quasi-hermitian chain of spins which exhibits quantum analogues of chimera states, i.e. long life classical states for which a part of an oscillator chain presents an ordered dynamics whereas another part presents a disordered dynamics. For the quantum analogue, the chimera behaviour deals with the entanglement between the spins of the chain. We discuss the entanglement properties, quantum chaos, quantum disorder and semi-classical similarity of our quantum chimera system. The quantum chimera concept is novel and induces new perspectives concerning the entanglement of multipartite systems. - Highlights: • We propose a spin chain model with long range couplings having purely quantum states similar to the classical chimera states. • The quantum chimera states are characterized by the coexistence of strongly entangled and non-entangled spins in the same chain. • The quantum chimera states present some characteristics of quantum chaos.

  10. Muonium states in semiconductors

    International Nuclear Information System (INIS)

    Patterson, B.D.

    1987-01-01

    There is a brief summary of what is known about the muonium states isotropic, anisotropic and diamagnetic in diamond and zincblende semiconductors. The report deals with muonium spectroscopy, including the formation probabilities, hyperfine parameters and electronic g-factors of the states. The dynamics of the states is treated including a discussion of the transition from isotropic Mu to anisotropic Mu in diamond, temperature-dependent linewidthes in silicon and germanium and effects of daping and radiation damage

  11. Theoretical solid state physics

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Research activities at ORNL in theoretical solid state physics are described. Topics covered include: surface studies; particle-solid interactions; electronic and magnetic properties; and lattice dynamics

  12. Solid state physics

    CERN Document Server

    Burns, Gerald

    2013-01-01

    Solid State Physics, International Edition covers the fundamentals and the advanced concepts of solid state physics. The book is comprised of 18 chapters that tackle a specific aspect of solid state physics. Chapters 1 to 3 discuss the symmetry aspects of crystalline solids, while Chapter 4 covers the application of X-rays in solid state science. Chapter 5 deals with the anisotropic character of crystals. Chapters 6 to 8 talk about the five common types of bonding in solids, while Chapters 9 and 10 cover the free electron theory and band theory. Chapters 11 and 12 discuss the effects of moveme

  13. Nuclear cluster states

    International Nuclear Information System (INIS)

    Rae, W.D.M.; Merchant, A.C.

    1993-01-01

    We review clustering in light nuclei including molecular resonances in heavy ion reactions. In particular we study the systematics, paying special attention to the relationships between cluster states and superdeformed configurations. We emphasise the selection rules which govern the formation and decay of cluster states. We review some recent experimental results from Daresbury and elsewhere. In particular we report on the evidence for a 7-α chain state in 28 Si in experiments recently performed at the NSF, Daresbury. Finally we begin to address theoretically the important question of the lifetimes of cluster states as deduced from the experimental energy widths of the resonances. (Author)

  14. Rotating quantum states

    International Nuclear Information System (INIS)

    Ambruş, Victor E.; Winstanley, Elizabeth

    2014-01-01

    We revisit the definition of rotating thermal states for scalar and fermion fields in unbounded Minkowski space–time. For scalar fields such states are ill-defined everywhere, but for fermion fields an appropriate definition of the vacuum gives thermal states regular inside the speed-of-light surface. For a massless fermion field, we derive analytic expressions for the thermal expectation values of the fermion current and stress–energy tensor. These expressions may provide qualitative insights into the behaviour of thermal rotating states on more complex space–time geometries

  15. Excited states 2

    CERN Document Server

    Lim, Edward C

    2013-01-01

    Excited States, Volume 2 is a collection of papers that deals with molecules in the excited states. The book describes the geometries of molecules in the excited electronic states. One paper describes the geometries of a diatomic molecule and of polyatomic molecules; it also discusses the determination of the many excited state geometries of molecules with two, three, or four atoms by techniques similar to diatomic spectroscopy. Another paper introduces an ordered theory related to excitons in pure and mixed molecular crystals. This paper also presents some experimental data such as those invo

  16. Visitor, State of Alaska

    Science.gov (United States)

    /Fishing License Get a Birth Certificate, Marriage License, etc. Alaska Permanent Fund Dividend Statewide Library Alaska Historical Society Alaska State Museum Sheldon Jackson Museum Industry Facts Agriculture

  17. Orthogonalization of correlated states

    International Nuclear Information System (INIS)

    Fantoni, S.; Pandharipande, V.R.

    1988-01-01

    A scheme for orthogonalizing correlated states while preserving the diagonal matrix elements of the Hamiltonian is developed. Conventional perturbation theory can be used with the orthonormal correlated basis obtained from this scheme. Advantages of using orthonormal correlated states in calculations of the response function and correlation energy are discussed

  18. Business, State of Alaska

    Science.gov (United States)

    Investment Advisors Business Law Charitable Gaming Division of Banking & Securities Laws Relating to Skip to content State of Alaska myAlaska My Government Resident Business in Alaska Visiting Alaska State Government Jobs Federal Jobs Starting a Small Business Living Get a Driver License Get a Hunting

  19. Gender and the State

    DEFF Research Database (Denmark)

    Dahl, Hanne Marlene; Kantola, Johanna

    2005-01-01

    The article argues from a Nordic, feminist and post-structuralist position that feminism state theories need to be developed methodologically.......The article argues from a Nordic, feminist and post-structuralist position that feminism state theories need to be developed methodologically....

  20. Maximally multipartite entangled states

    Science.gov (United States)

    Facchi, Paolo; Florio, Giuseppe; Parisi, Giorgio; Pascazio, Saverio

    2008-06-01

    We introduce the notion of maximally multipartite entangled states of n qubits as a generalization of the bipartite case. These pure states have a bipartite entanglement that does not depend on the bipartition and is maximal for all possible bipartitions. They are solutions of a minimization problem. Examples for small n are investigated, both analytically and numerically.

  1. States in Process Calculi

    Directory of Open Access Journals (Sweden)

    Christoph Wagner

    2014-08-01

    Full Text Available Formal reasoning about distributed algorithms (like Consensus typically requires to analyze global states in a traditional state-based style. This is in contrast to the traditional action-based reasoning of process calculi. Nevertheless, we use domain-specific variants of the latter, as they are convenient modeling languages in which the local code of processes can be programmed explicitly, with the local state information usually managed via parameter lists of process constants. However, domain-specific process calculi are often equipped with (unlabeled reduction semantics, building upon a rich and convenient notion of structural congruence. Unfortunately, the price for this convenience is that the analysis is cumbersome: the set of reachable states is modulo structural congruence, and the processes' state information is very hard to identify. We extract from congruence classes of reachable states individual state-informative representatives that we supply with a proper formal semantics. As a result, we can now freely switch between the process calculus terms and their representatives, and we can use the stateful representatives to perform assertional reasoning on process calculus models.

  2. Solid State Division

    International Nuclear Information System (INIS)

    Green, P.H.; Watson, D.M.

    1989-08-01

    This report contains brief discussions on work done in the Solid State Division of Oak Ridge National Laboratory. The topics covered are: Theoretical Solid State Physics; Neutron scattering; Physical properties of materials; The synthesis and characterization of materials; Ion beam and laser processing; and Structure of solids and surfaces

  3. Solid State Division

    Energy Technology Data Exchange (ETDEWEB)

    Green, P.H.; Watson, D.M. (eds.)

    1989-08-01

    This report contains brief discussions on work done in the Solid State Division of Oak Ridge National Laboratory. The topics covered are: Theoretical Solid State Physics; Neutron scattering; Physical properties of materials; The synthesis and characterization of materials; Ion beam and laser processing; and Structure of solids and surfaces. (LSP)

  4. Solid state track detectors

    International Nuclear Information System (INIS)

    Reuther, H.

    1976-11-01

    This paper gives a survey of the present state of the development and the application of solid state track detectors. The fundamentals of the physical and chemical processes of the track formation and development are explained, the different detector materials and their registration characteristics are mentioned, the possibilities of the experimental practice and the most variable applications are discussed. (author)

  5. Kurds, states and tribes

    NARCIS (Netherlands)

    Bruinessen, M.M. van

    2002-01-01

    At most times, Kurdish society has existed at the periphery of, and functioned as a buffer between, two or more neighbouring states. From c. 1500 until the First World War, the relevant states were the Ottoman Empire in the west and Safavid, later Qajar Iran in the east (with Russia and the

  6. Small States in Europe

    DEFF Research Database (Denmark)

    This book offers an accessible, coherent and informative analysis of contemporary and future foreign policy challenges facing small states in Europe.......This book offers an accessible, coherent and informative analysis of contemporary and future foreign policy challenges facing small states in Europe....

  7. Dissociative State and Competence

    Directory of Open Access Journals (Sweden)

    Yu-Ju Lin

    2007-10-01

    Full Text Available This report presents the results of forensic evaluation of the civil competence of a case of alleged dissociative identity disorder (DID and discusses whether such dissociative states substantially jeopardize civil competence. A 40-year-old woman claimed that she had had many personalities since her college days. From the age of 37 to 40, she shopped excessively, which left her with millions of dollars of debt. She ascribed her shopping to a certain identity state, over which she had no control. (In this article, we use the term identity state to replace personality as an objective description of a mental state. She thus raised the petition of civil incompetence. During the forensic evaluation, it was found that the identity states were relatively stable and mutually aware of each other. The switch into another identity state was sometimes under voluntary control. The subject showed consistency and continuity in behavioral patterns across the different identity states, and no matter which identity state she was in, there was no evidence of impairment in her factual knowledge of social situations and her capacity for managing personal affairs. We hence concluded that she was civilly competent despite the claimed DID. Considering that the existence and diagnosis of DID are still under dispute and a diagnosis of DID alone is not sufficient to interdict a person's civil right, important clinical and forensic issues remain to be answered.

  8. Welfare State Transformation

    DEFF Research Database (Denmark)

    Obinger, Herbert; Starke, Peter

    2014-01-01

    This paper describes welfare state transformation in OECD countries since the 1970s against the background of the post-war settlement. Relying on quantitative macro-data and qualitative information from the literature, we show that welfare states have con-verged, especially regarding various...

  9. The Danish welfare state

    DEFF Research Database (Denmark)

    Larsen, Jørgen Elm; Bengtsson, Tea Torbenfeldt; Frederiksen, Morten

    The Danish Welfare State analyzes a broad range of areas, such as globalization, labor marked, family life, health and social exclusion, the book demonstrates that life in a modern welfare state is changing rapidly, creating both challenges and possibilities for future management....

  10. DUBNA: Member States

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The political upheaval in what was the Soviet Union was reflected in an Extraordinary Plenipotentiaries Committee of Joint Institute for Nuclear Research (JINR) Member States, held in Dubna, near Moscow, on 10-13 December, with representatives of eleven sovereign republics of the former Soviet State taking part

  11. Thermalization of squeezed states

    International Nuclear Information System (INIS)

    Solomon, Allan I

    2005-01-01

    Starting with a thermal squeezed state defined as a conventional thermal state based on an appropriate Hamiltonian, we show how an important physical property, the signal-to-noise ratio, is degraded, and propose a simple model of thermalization (Kraus thermalization)

  12. Metrics of quantum states

    International Nuclear Information System (INIS)

    Ma Zhihao; Chen Jingling

    2011-01-01

    In this work we study metrics of quantum states, which are natural generalizations of the usual trace metric and Bures metric. Some useful properties of the metrics are proved, such as the joint convexity and contractivity under quantum operations. Our result has a potential application in studying the geometry of quantum states as well as the entanglement detection.

  13. State alternative route designations

    International Nuclear Information System (INIS)

    1989-07-01

    Pursuant to the Hazardous Materials Transportation Act (HMTA), the Department of Transportation (DOT) has promulgated a comprehensive set of regulations regarding the highway transportation of high-level radioactive materials. These regulations, under HM-164 and HM-164A, establish interstate highways as the preferred routes for the transportation of radioactive materials within and through the states. The regulations also provide a methodology by which a state may select alternative routes. First,the state must establish a ''state routing agency,'' defined as an entity authorized to use the state legal process to impose routing requirements on carriers of radioactive material (49 CFR 171.8). Once identified, the state routing agency must select routes in accordance with Large Quantity Shipments of Radioactive Materials or an equivalent routing analysis. Adjoining states and localities should be consulted on the impact of proposed alternative routes as a prerequisite of final route selection. Lastly, the states must provide written notice of DOT of any alternative route designation before the routes are deemed effective

  14. Healthcare. State Report

    Science.gov (United States)

    Carnevale, Anthony P.; Smith, Nicole; Gulish, Artem; Beach, Bennett H.

    2012-01-01

    This report projects education requirements linked to forecasted job growth in healthcare by state and the District of Columbia from 2010 through 2020. It complements a larger national report which projects educational demand for healthcare for the same time period. The national report shows that with or without Obamacare, the United States will…

  15. Categorical Tensor Network States

    Directory of Open Access Journals (Sweden)

    Jacob D. Biamonte

    2011-12-01

    Full Text Available We examine the use of string diagrams and the mathematics of category theory in the description of quantum states by tensor networks. This approach lead to a unification of several ideas, as well as several results and methods that have not previously appeared in either side of the literature. Our approach enabled the development of a tensor network framework allowing a solution to the quantum decomposition problem which has several appealing features. Specifically, given an n-body quantum state |ψ〉, we present a new and general method to factor |ψ〉 into a tensor network of clearly defined building blocks. We use the solution to expose a previously unknown and large class of quantum states which we prove can be sampled efficiently and exactly. This general framework of categorical tensor network states, where a combination of generic and algebraically defined tensors appear, enhances the theory of tensor network states.

  16. Failing Failed States

    DEFF Research Database (Denmark)

    Holm, Hans-Henrik

    2002-01-01

    coverage. A Danish survey of newsrooms shows that the national world-view and prevalent news criteria prevent consistent coverage. It is argued that politicians are the ones who determine national agendas: it is from political initiatives, rather than media coverage, that failing states and humanitarian......When states are failing, when basic state functions are no longer carried out, and when people have no security, humanitarian crises erupt. In confronting this problem, the stronger states have followed an ad hoc policy of intervention and aid. In some cases, humanitarian disasters have resulted...... from inaction. Often, the media are blamed. Politicians complain about the media when they interfere (the CNN effect), and when they do not. This article looks at how the media do cover failing states. Sierra Leone and Congo are used as examples. The analysis shows that there is little independent...

  17. Permutationally invariant state reconstruction

    DEFF Research Database (Denmark)

    Moroder, Tobias; Hyllus, Philipp; Tóth, Géza

    2012-01-01

    Feasible tomography schemes for large particle numbers must possess, besides an appropriate data acquisition protocol, an efficient way to reconstruct the density operator from the observed finite data set. Since state reconstruction typically requires the solution of a nonlinear large-scale opti...... optimization, which has clear advantages regarding speed, control and accuracy in comparison to commonly employed numerical routines. First prototype implementations easily allow reconstruction of a state of 20 qubits in a few minutes on a standard computer.......-scale optimization problem, this is a major challenge in the design of scalable tomography schemes. Here we present an efficient state reconstruction scheme for permutationally invariant quantum state tomography. It works for all common state-of-the-art reconstruction principles, including, in particular, maximum...

  18. State and market

    Directory of Open Access Journals (Sweden)

    Ivan Ferenčak

    2014-10-01

    Full Text Available The debate about the relationship between state and market, about their relative importance, does not cease to be topical, and there is no end of it in sight. The market (invisible hand does need, more or less, the help of the state (visible hand. Liberal sympathizers of the market prefer a “small” state whose ambitions include only providing an adaptable legal framework in which and by which the market functions, and (re allocation of resources, because of the inherent defects of the market. Proponents of welfare economics will wish for progressive taxation and redistribution of income. Keynes’s mission to save capitalism meant an increase in the importance of the state and appearance of a new, stabilizing role of the state. Excessive unemployment is to be prevented by fine-tuning. Unfortunately, Keynes’s critics from the public choice camp will say that the state (government is not perfect, and, as a rule, falls into the trap of asymmetry. Only and solely in theory will it apply that a perfect state means perfect functioning of an imperfect market.

  19. Theoretical solid state physics

    CERN Document Server

    Haug, Albert

    2013-01-01

    Theoretical Solid State Physics, Volume 1 focuses on the study of solid state physics. The volume first takes a look at the basic concepts and structures of solid state physics, including potential energies of solids, concept and classification of solids, and crystal structure. The book then explains single-electron approximation wherein the methods for calculating energy bands; electron in the field of crystal atoms; laws of motion of the electrons in solids; and electron statistics are discussed. The text describes general forms of solutions and relationships, including collective electron i

  20. Autonomy of State Agencies

    DEFF Research Database (Denmark)

    Hansen, Morten Balle; Niklasson, Birgitta; Roness, Paul

    agencies in four Nordic countries: Denmark, Finland, Norway and Sweden. By using survey data from more than 500 state agencies in the four countries, the article analyses whether there is indeed a Scandinavian style of autonomy and result control and assesses which structural, cultural, and environmental......NPM-doctrines states that ideal-type agencies should have a high level of managerial autonomy, while being controlled through result-based control instruments, like performance contracts. In this article, the authors present a first preliminary attempt to comparatively analyze the autonomy of state...... variables might explain similarities and differences in the autonomy of agencies....

  1. Variational Transition State Theory

    Energy Technology Data Exchange (ETDEWEB)

    Truhlar, Donald G. [Univ. of Minnesota, Minneapolis, MN (United States)

    2016-09-29

    This is the final report on a project involving the development and applications of variational transition state theory. This project involved the development of variational transition state theory for gas-phase reactions, including optimized multidimensional tunneling contributions and the application of this theory to gas-phase reactions with a special emphasis on developing reaction rate theory in directions that are important for applications to combustion. The development of variational transition state theory with optimized multidimensional tunneling as a useful computational tool for combustion kinetics involved eight objectives.

  2. The solid state maser

    CERN Document Server

    Orton, J W; Walling, J C; Ter Haar, D

    1970-01-01

    The Solid State Maser presents readings related to solid state maser amplifier from the first tentative theoretical proposals that appeared in the early 1950s to the successful realization of practical devices and their application to satellite communications and radio astronomy almost exactly 10 years later. The book discusses a historical account of the early developments (including that of the ammonia maser) of solid state maser; the properties of paramagnetic ions in crystals; the development of practical low noise amplifiers; and the characteristics of maser devices designed for communica

  3. Correlations in Werner States

    International Nuclear Information System (INIS)

    Luo Shunlong; Li Nan

    2008-01-01

    Werner states are paradigmatic examples of quantum states and play an innovative role in quantum information theory. In investigating the correlating capability of Werner states, we find the curious phenomenon that quantum correlations, as quantified by the entanglement of formation, may exceed the total correlations, as measured by the quantum mutual information. Consequently, though the entanglement of formation is so widely used in quantifying entanglement, it cannot be interpreted as a consistent measure of quantum correlations per se if we accept the folklore that total correlations are measured (or rather upper bounded) by the quantum mutual information.

  4. Understanding solid state physics

    CERN Document Server

    Holgate, Sharon Ann

    2009-01-01

    Where Sharon Ann Holgate has succeeded in this book is in packing it with examples of the application of solid state physics to technology. … All the basic elements of solid state physics are covered … . The range of materials is good, including as it does polymers and glasses as well as crystalline solids. In general, the style makes for easy reading. … Overall this book succeeds in showing the relevance of solid state physics to the modern world … .-Contemporary Physics, Vol. 52, No. 2, 2011I was indeed amused and inspired by the wonderful images throughout the book, carefully selected by th

  5. Giant resonances on excited states

    International Nuclear Information System (INIS)

    Besold, W.; Reinhard, P.G.; Toepffer, C.

    1984-01-01

    We derive modified RPA equations for small vibrations about excited states. The temperature dependence of collective excitations is examined. The formalism is applied to the ground state and the first excited state of 90 Zr in order to confirm a hypothesis which states that not only the ground state but every excited state of a nucleus has a giant resonance built upon it. (orig.)

  6. US State Submerged Lands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Submerged Lands Act (43 U.S.C. Section 1301 et seq.) grants coastal states title to natural resources located within their coastal submerged lands and navigable...

  7. State Geodatabase for Connecticut

    Data.gov (United States)

    US Census Bureau, Department of Commerce — The 2015 TIGER Geodatabases are extracts of selected nation based and state based geographic and cartographic information from the U.S. Census Bureau's Master...

  8. State Geodatabase for Indiana

    Data.gov (United States)

    US Census Bureau, Department of Commerce — The 2015 TIGER Geodatabases are extracts of selected nation based and state based geographic and cartographic information from the U.S. Census Bureau's Master...

  9. United States housing, 2012

    Science.gov (United States)

    Delton Alderman

    2013-01-01

    Provides current and historical information on housing market in the United States. Information includes trends for housing permits and starts, housing completions for single and multifamily units, and sales and construction. This report will be updated annually.

  10. Teale State Assembly Districts

    Data.gov (United States)

    California Natural Resource Agency — California Spatial Information System (CaSIL) is a project designed to improve access to geo-spatial and geo-spatial related data information throughout the state of...

  11. State Air Quality Standards.

    Science.gov (United States)

    Pollution Engineering, 1978

    1978-01-01

    This article presents in tabular form the air quality standards for sulfur dioxide, carbon monoxide, nitrogen dioxide, photochemicals, non-methane hydrocarbons and particulates for each of the 50 states and the District of Columbia. (CS)

  12. Varieties in State Capitalism

    DEFF Research Database (Denmark)

    Li, Ming Hua; Cui, Lin; Lu, Jiangyong

    2014-01-01

    Institutional diversity characterizing state-owned enterprises (SOEs) from emerging economies holds critical but under-examined implications for their internationalization activities. Different types of SOEs can exhibit distinct motivations, strategic resources, and adaptive capabilities for pene...

  13. Negative-ion states

    International Nuclear Information System (INIS)

    Compton, R.N.

    1982-01-01

    In this brief review, we discuss some of the properties of atomic and molecular negative ions and their excited states. Experiments involving photon reactions with negative ions and polar dissociation are summarized. 116 references, 14 figures

  14. Baryoniums and related states

    International Nuclear Information System (INIS)

    Hong-Mo, C.

    1978-01-01

    A brief introduction is given to current theoretical ideas on baryonium states with particular emphasis on their interpretation as 'colour molecules'. It is argued that baryonium spectroscopy provides a valuable test for colour as a new degree of freedom. (author)

  15. Decay of Hoyle state

    Indian Academy of Sciences (India)

    2014-11-02

    Nov 2, 2014 ... T K RANA, C BHATTACHARYA, S KUNDU, ... of various direct 3α decay mechanisms of the Hoyle state. ... Pramana – J. Phys., Vol. ... FMD predicts a compact triangle shape and LEFT predicts a bent arm chain structure,.

  16. Political State Boundary (National)

    Data.gov (United States)

    Department of Transportation — State boundaries with political limit - boundaries extending into the ocean (NTAD). The TIGER/Line Files are shapefiles and related database files (.dbf) that are an...

  17. Engaging Future Failing States

    Science.gov (United States)

    2011-03-23

    military missions in the Middle East, the Balkans, Africa, Asia , and South America. There is an increasing proliferation of failed and failing states...disparity, overpopulation , food security, health services availability, migration pressures, environmental degradation, personal and 22 community

  18. State of Services Report

    Data.gov (United States)

    Social Security Administration — A comprehensive monthly report portraying customer experience with our various service options. The State of Services is shared with the ACOSS and is presented to...

  19. Periodically modulated dark states

    Science.gov (United States)

    Han, Yingying; Zhang, Jun; Zhang, Wenxian

    2018-04-01

    Phenomena of electromagnetically induced transparency (PEIT) may be interpreted by the Autler-Townes Splitting (ATS), where the coupled states are split by the coupling laser field, or by the quantum destructive interference (QDI), where the atomic phases caused by the coupling laser and the probe laser field cancel. We propose modulated experiments to explore the PEIT in an alternative way by periodically modulating the coupling and the probe fields in a Λ-type three-level system initially in a dark state. Our analytical and numerical results rule out the ATS interpretation and show that the QDI interpretation is more appropriate for the modulated experiments. Interestingly, dark state persists in the double-modulation situation where control and probe fields never occur simultaneously, which is significant difference from the traditional dark state condition. The proposed experiments are readily implemented in atomic gases, artificial atoms in superconducting quantum devices, or three-level meta-atoms in meta-materials.

  20. State Transportation Statistics 2012

    Science.gov (United States)

    2013-08-15

    The Bureau of Transportation Statistics (BTS), a part of the U.S. Department of Transportation's (USDOT) Research and Innovative Technology Administration (RITA), presents State Transportation Statistics 2012, a statistical profile of transportation ...

  1. State Transportation Statistics 2013

    Science.gov (United States)

    2014-09-19

    The Bureau of Transportation Statistics (BTS), a part of the U.S. Department of Transportations (USDOT) Research and Innovative Technology Administration (RITA), presents State Transportation Statistics 2013, a statistical profile of transportatio...

  2. Outpatient Imaging Efficiency - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Use of medical imaging - state data. These measures give you information about hospitals' use of medical imaging tests for outpatients. Examples of medical imaging...

  3. New Mexico State Parks

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This dataset provides an initial version of the generalized physical boundaries of New Mexico State Parks, in polygonal form with limited attributes, compiled using...

  4. Thermodynamics of Crystalline States

    CERN Document Server

    Fujimoto, Minoru

    2010-01-01

    Thermodynamics is a well-established discipline of physics for properties of matter in thermal equilibrium surroundings. Applying to crystals, however, the laws encounter undefined properties of crystal lattices, which therefore need to be determined for a clear and well-defined description of crystalline states. Thermodynamics of Crystalline States explores the roles played by order variables and dynamic lattices in crystals in a wholly new way. This book is divided into three parts. The book begins by clarifying basic concepts for stable crystals. Next, binary phase transitions are discussed to study collective motion of order variables, as described mostly as classical phenomena. In the third part, the multi-electron system is discussed theoretically, as a quantum-mechanical example, for the superconducting state in metallic crystals. Throughout the book, the role played by the lattice is emphasized and examined in-depth. Thermodynamics of Crystalline States is an introductory treatise and textbook on meso...

  5. State Agency Administrative Boundaries

    Data.gov (United States)

    Kansas Data Access and Support Center — This database comprises 28 State agency boundaries and point of contact. The Kansas Geological Survey collected legal descriptions of the boundaries for various...

  6. State DOT mission evolution.

    Science.gov (United States)

    2013-04-01

    This paper highlights the challenges faced by six state departments of transportation (California, Colorado, Florida, Massachusetts, Missouri, Oregon) and the views of their respective chief executive officers within the context of national trends. E...

  7. MSIS State Summary Datamarts

    Data.gov (United States)

    U.S. Department of Health & Human Services — This page provides background needed to take advantage of the capabilities of the MSIS State Summary Datamart. This mart allows the user to develop high-level...

  8. Healthcare Associated Infections - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare-Associated Infections (HAI) measures - state data. These measures are developed by Centers for Disease Control and Prevention (CDC) and collected...

  9. Asking for more State

    DEFF Research Database (Denmark)

    Johansen, Mette-Louise

    2010-01-01

    This paper addresses a period of embedding, as Achille Mbembe puts it when discussing the novelty of the postcolony (Mbembe 2001: 242, 01/09/2008); in this paper the term applies to conceptualise particular social processes of state/citizen entanglement within the realm of western welfare bureauc...... the concept of welfare, moral order and legality is constantly negotiated and reconstituted. From this perspective, I explore everyday ghetto life as frontier practices within the community and with the state....

  10. State of the Market

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Industrial Profits In the first two months, the combined profits of all state-owned enterprises as well as non-state enterprises with annual sales revenue of more than 5 million yuan (enterprises above designated size) totaled 203.4 billion yuan, increasing 21.8 percent compared with the same period last year, according to the National Bureau of Statistics (NBS) (see graph 1).

  11. State of the Market

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Industrial Profits From January to June, the total volume of profits made by all state-owned enterprises as well as non-state enterprises with annual sales revenue of more than 5 million yuan (enterprises above designated size) stood at 810.7 billion yuan, expanding 28 percent compared with the same period last year, according to the National Bureau of Statistics (NBS) (see graph 1).

  12. Appealing to the State

    DEFF Research Database (Denmark)

    Nielsen, Marie Vejrup

    2014-01-01

    This essay analyzes identity formation of majority religion in the context of intentional, political processes of change in state-church relations from a perspective that combines discursive institutionalism with the insights from governance research.......This essay analyzes identity formation of majority religion in the context of intentional, political processes of change in state-church relations from a perspective that combines discursive institutionalism with the insights from governance research....

  13. State responses to biotechnology.

    Science.gov (United States)

    Harris, Rebecca C

    2015-01-01

    This article reviews biotechnology legislation in the 50 states for 11 policy areas spanning 1990-2010, an era of immense growth in biotechnology, genetic knowledge, and significant policy development. Policies regarding health insurance, life insurance, long-term care insurance, DNA data bank collection, biotech research protection, biotech promotion and support, employment discrimination, genetic counselor licensing, human cloning, and genetic privacy each represent major policy responses arising from biotechnology and coinciding with key areas of state regulation (insurance, criminal justice, economic development, labor law, health and safety, privacy, and property rights). This analysis seeks to answer three questions regarding biotechnology legislation at the state level: who is acting (policy adoption), when is policy adopted (policy timing), and what is policy doing (policy content). Theoretical concerns examine state ideology (conservative or liberal), policy type (economic or moral), and the role of external events (federal law, news events, etc.) on state policy adoption. Findings suggest ideological patterns in adoption, timing, and content of biotech policy. Findings also suggest economic policies tend to be more uniform in content than moral policies, and findings also document a clear link between federal policy development, external events, and state policy response.

  14. Bound and rebound states

    International Nuclear Information System (INIS)

    Orzalesi, C.A.

    1979-01-01

    In relativistic quantum theory, bound states generate forces in the crossed channel; such forces can affect the binding and self-consistent solutions should be sought for the bound-state problem. The author investigates how self-consistency can be achieved by successive approximations, in a simple scalar model and with successive relativistic eikonal approximations (EAs). Within the generalized ladder approximation, some exact properties of the resulting ''first generation'' bound states are discussed. The binding energies in this approximation are rather small even for rather large values of the primary coupling constant. The coupling of the constituent particles to the first-generation reggeon is determined by a suitable EA and a new generalized ladder amplitude is constructed with rungs given either by the primary gluons or by the first-generation reggeons. The resulting new (second-generation) bound states are found in a reggeized EA. The size of the corrections to the binding energies due to the rebinding effects is surprisingly large. The procedure is then iterated, so as to find - again in an EA - the third-generation bound states. The procedure is found to be self-consistent already at this stage: the third-generation bound states coincide with those of second generation, and no further rebinding takes place in the higher iterations of the approximation method. Features - good and bad - of the model are discussed, as well as the possible relevance of rebinding mechanisms in hadron dynamics. (author)

  15. Machine learning topological states

    Science.gov (United States)

    Deng, Dong-Ling; Li, Xiaopeng; Das Sarma, S.

    2017-11-01

    Artificial neural networks and machine learning have now reached a new era after several decades of improvement where applications are to explode in many fields of science, industry, and technology. Here, we use artificial neural networks to study an intriguing phenomenon in quantum physics—the topological phases of matter. We find that certain topological states, either symmetry-protected or with intrinsic topological order, can be represented with classical artificial neural networks. This is demonstrated by using three concrete spin systems, the one-dimensional (1D) symmetry-protected topological cluster state and the 2D and 3D toric code states with intrinsic topological orders. For all three cases, we show rigorously that the topological ground states can be represented by short-range neural networks in an exact and efficient fashion—the required number of hidden neurons is as small as the number of physical spins and the number of parameters scales only linearly with the system size. For the 2D toric-code model, we find that the proposed short-range neural networks can describe the excited states with Abelian anyons and their nontrivial mutual statistics as well. In addition, by using reinforcement learning we show that neural networks are capable of finding the topological ground states of nonintegrable Hamiltonians with strong interactions and studying their topological phase transitions. Our results demonstrate explicitly the exceptional power of neural networks in describing topological quantum states, and at the same time provide valuable guidance to machine learning of topological phases in generic lattice models.

  16. 31 CFR 515.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 515.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including the Trust Territory of...

  17. 31 CFR 500.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 500.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including U.S. trust territories...

  18. 31 CFR 535.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 535.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof including the Trust Territory of...

  19. Quantum Teleportation of Tripartite Arbitrary State via W State

    Institute of Scientific and Technical Information of China (English)

    XUE Zheng-Yuan; YI You-Min; CAO Zhuo-Liang

    2005-01-01

    A scheme of teleportation of a tripartite state via W state is suggested. The W state serves as quantum channels. Standard Bell-state measurements and Von Neumann measurements are performed. After the sender operates the measurements and informs the receiver her results, he can reconstruct the original state by the corresponding unitary transformation. The probability of the successful teleportation is also obtained.

  20. The mathematics behind chimera states

    Science.gov (United States)

    Omel’chenko, O. E.

    2018-05-01

    Chimera states are self-organized spatiotemporal patterns of coexisting coherence and incoherence. We give an overview of the main mathematical methods used in studies of chimera states, focusing on chimera states in spatially extended coupled oscillator systems. We discuss the continuum limit approach to these states, Ott-Antonsen manifold reduction, finite size chimera states, control of chimera states and the influence of system design on the type of chimera state that is observed.

  1. Kur’an’a Göre Üstünlük Duygusunun Düşünce ve Davranışlara Etkileri

    Directory of Open Access Journals (Sweden)

    Harun Savut

    2015-06-01

    Full Text Available Üstünlük duygusu insanın tüm davranışlarını etkisi altına alan, düşünce ve davranışlarda sapmalara sebep olan bir tavırdır. Doğruyu kendisini merkeze koyarak değerlendiren insanın tüm kutsalı yine kendisi olur. Şayet çevredekiler bu kutsalı onaylarsa kabul edilir ve değer görürler. Aksinin söz konusu olduğu durumlarda ise karşı durulması gereken düşman şeklinde algılanırlar. Bu ise akli melekelerin önünde set oluşturan, doğru düşünmeyi negatif yönde etkileyen, bu sebeple de yanlışları tetikleyen bir durumdur. Bunun neticesinde hakkın kabulü zorlaşır, hatta imkansız bir hal alır. İnsanı kendi algısı ile çelişen gerçekleri, doğruları inkara sürükler. Benlik kaynaklı bu savrulma küfür ve şirkin kapılarını açar. Bu makalede üstünlük hissinin yol açtığı algı ve düşünme hatalarıyla tebarüz eden kişilerin düşüncelerinde ortaya çıkan savrulmalar, yanılsamalar analiz edilmiştir. Üstünlük algısının gerekçelendirilmesinde kişi veya toplumun sahip olduğu imkanların rolü değerlendirilmiştir. Üstünlük hissinin neden olduğu tahammülsüzlük ve algı kapanması üzerinde durulmuştur.

  2. Parasitosis intestinales y factores de riesgo en niños: Ambulatorio urbano tipo II Dr. Agustín Zubillaga, Barquisimeto-Lara

    OpenAIRE

    Amaro C, Mariana I; Salcedo G, Darling J; Uris G, Marianny K; Valero B, Karen N; Vergara A, Mariany T; Cárdenas, Elsys; Vidal, Angel C; Sánchez Ch, Julia A

    2011-01-01

    Introducción: La posible asociación de las parasitosis intestinales con la pobreza y el saneamiento ambiental insuficiente, hacen necesario estudiar la prevalencia de este hecho en un barrio pobre de la ciudad de Barquisimeto, Venezuela. Objetivo: Determinar la frecuencia de parasitosis intestinales y factores de riesgo en niños de 1 a 12 años, de una zona pobre de Barquisimeto, Venezuela, área de influencia del Ambulatorio Urbano Tipo II “Dr. Agustín Zubillaga”. Método: Se realizó un estudio...

  3. S-29: Osgood Schlatter Olan ve Olmayan Adölesan Sporcularda; Patellar Yüksekliğin İzokinetik Sonuçlara Etkisi

    Directory of Open Access Journals (Sweden)

    Canan Gönen Aydın

    2017-03-01

    Full Text Available GİRİŞAraştırmamızın amacı;os good schlatter tanısı olan ve patella yüksekliği bulunan adölesan sporcuların izokinetik kas kuvvetlerinin değerlendirmek.Biz patella yüksekliğinin kas gücünü etkileyeceğini düşünmekteyiz. GEREÇ ve YÖNTEMÇalışmamıza 73 sporcu, 146 diz dahil edildi. (yaş ortalaması 13,6 ± 1,8, body mass index 20,6± 3,3 kg/m2 Dizleri; OGS olan(n=95 ve olmayan( WOGS n=51 olarak ikiye ayırdık. Ayrıca Caton-Deschamps metodu kullanarak PA olanları tespit ettik.Sporcuların dizlerinin Cybex norm (CSMI Humac Norm, ABD izokinetik dinamometre ile değerlendridik.(Resim 1BULGULAROGS ve WOGS dizlerin kas kuvveti değerlendirmesinde; 60 ° / s açısal hızda peak torque flexion ve ekstansiyonda (PT p=0,01 daha kuvvetli olduğunu tespit ettik.(tablo 1 PA olan grupla PA olmayan dizlere baktığımızda ise; PTF (60°/s ve total work flexion (180°/s anlamlı bir farklılık vardı.(p=0,01 Fakat peak torque/body weight (PT/BW değerleri arasında istatistiksel olarak anlamlı bir fark yoktu.TARTIŞMA / SONUÇÇalışmamız; radyolojik olarak yüksekte olan patellaların; izokinetik değerlendirmeyi etkilemediğini ortaya koymuştur. PA'li sporcuların daha güçlü kuadriseps kasına sahip olabileceğini ve sonuç olarak OGS'ye yol açtığını varsaydık. Ancak OGS ile dizde kas kuvveti ve PA varlığı arasında herhangi bir ilişki bulamadık.OGS veWOGS lerin demografik özellikleri.İzokinetik değerlendirmeleriOGSMean±SSWithoutOGSMean±SSpn9551Age13,2 ±1,814,2±1,70,002*BMI (kg/m220,3±321,2±3,70,12PTE 60°/s (Nm92 ± 35111 ± 490,01*PT/BW E 60°/s (Nm157 ± 55171 ± 540,14PTF 60°/s (Nm53 ±2065 ±310,01*PT/BWF 60°/s (Nm88 ±2997 ±360,13F/E ratio 60°/s (Nm60 ±1759 ±160,71TWE 180°/s (Nm685±286771±3310,12TW/BW E 180°/s (Nm1171±4841182±4540,88TWF 180°/s (Nm427±220510±2100,05TW/BWF180°/s (Nm717±352807±3460,14F/E ratio 180°/s (Nm67±3171±270,5BMI= body mass index. PTE = peak torque extansıon. PT/BW E = peak torque / Body weight extension. PTF= peak torque flexion. PT/BWF == peak torque / Body weight flexion.F/E ratio = flexor/extensor. TWE=Total work extension. TW/BW E= Total work / Body weight extension. TWF= Total work flexion.TW/BWF= Total work / Body weight flexion* independent samples’ t test *P<0.05

  4. Discrete density of states

    International Nuclear Information System (INIS)

    Aydin, Alhun; Sisman, Altug

    2016-01-01

    By considering the quantum-mechanically minimum allowable energy interval, we exactly count number of states (NOS) and introduce discrete density of states (DOS) concept for a particle in a box for various dimensions. Expressions for bounded and unbounded continua are analytically recovered from discrete ones. Even though substantial fluctuations prevail in discrete DOS, they're almost completely flattened out after summation or integration operation. It's seen that relative errors of analytical expressions of bounded/unbounded continua rapidly decrease for high NOS values (weak confinement or high energy conditions), while the proposed analytical expressions based on Weyl's conjecture always preserve their lower error characteristic. - Highlights: • Discrete density of states considering minimum energy difference is proposed. • Analytical DOS and NOS formulas based on Weyl conjecture are given. • Discrete DOS and NOS functions are examined for various dimensions. • Relative errors of analytical formulas are much better than the conventional ones.

  5. Discrete density of states

    Energy Technology Data Exchange (ETDEWEB)

    Aydin, Alhun; Sisman, Altug, E-mail: sismanal@itu.edu.tr

    2016-03-22

    By considering the quantum-mechanically minimum allowable energy interval, we exactly count number of states (NOS) and introduce discrete density of states (DOS) concept for a particle in a box for various dimensions. Expressions for bounded and unbounded continua are analytically recovered from discrete ones. Even though substantial fluctuations prevail in discrete DOS, they're almost completely flattened out after summation or integration operation. It's seen that relative errors of analytical expressions of bounded/unbounded continua rapidly decrease for high NOS values (weak confinement or high energy conditions), while the proposed analytical expressions based on Weyl's conjecture always preserve their lower error characteristic. - Highlights: • Discrete density of states considering minimum energy difference is proposed. • Analytical DOS and NOS formulas based on Weyl conjecture are given. • Discrete DOS and NOS functions are examined for various dimensions. • Relative errors of analytical formulas are much better than the conventional ones.

  6. Smallest chimera states

    Science.gov (United States)

    Maistrenko, Yuri; Brezetsky, Serhiy; Jaros, Patrycja; Levchenko, Roman; Kapitaniak, Tomasz

    2017-01-01

    We demonstrate that chimera behavior can be observed in small networks consisting of three identical oscillators, with mutual all-to-all coupling. Three different types of chimeras, characterized by the coexistence of two coherent oscillators and one incoherent oscillator (i.e., rotating with another frequency) have been identified, where the oscillators show periodic (two types) and chaotic (one type) behaviors. Typical bifurcations at the transitions from full synchronization to chimera states and between different types of chimeras have been described. Parameter regions for the chimera states are obtained in the form of Arnold tongues, issued from a singular parameter point. Our analysis suggests that chimera states can be observed in small networks relevant to various real-world systems.

  7. The state manager

    International Nuclear Information System (INIS)

    Defendini, A.; Jones, R.; Matheys, J.P.; Vyvre, P.V.; Vascotto, A.

    1992-01-01

    The State Manager system (SM) is a set of tools, developed at CERN, for the control of large data-acquisition systems. A dedicated object-based language is used to describe the various components of the data-acquisition system. Each component is declared in terms of finite state machines and sequences of parametrized actions to be performed for operations such as the start and end of a run. The description, written by the user, is translated into Ada to produce a run-control program capable of controlling processes in a distributed environment. A Motif-based graphical interface to the control program displays the current state of all the components and can be used to control the overall data-acquisition system. The SM has been used by several experiments both at CERN and other organizations. We present here the architecture of the SM, some design choices, and the experience acquired from its use. (author)

  8. The association between state attachment security and state Mindfulness.

    Directory of Open Access Journals (Sweden)

    Christopher A Pepping

    Full Text Available Recent research suggests that attachment and mindfulness are related, though the nature of this association is unclear. Here we present two studies examining whether there is a causal relationship between state attachment and state mindfulness. Study 1 investigated the effects of experimentally increasing state mindfulness on state attachment security. State mindfulness was successfully enhanced, but this led to no change in state attachment security. Study 2 investigated the effects of experimentally enhancing state attachment security on state mindfulness. State attachment security was successfully enhanced, but this did not lead to any change in state mindfulness. These findings suggest that there is not a direct, immediate causal relationship between state attachment and state mindfulness as a result of brief experimental manipulations. Future research should examine these associations in longer term interventions.

  9. Rapanos v. United States & Carabell v. United States

    Science.gov (United States)

    Documents associated with guidance for implementing the definition of waters of the United States under the Clean Water Act following the Rapanos v. United States, and Carabell v. United States Supreme Court decision.

  10. Resonant state expansions

    International Nuclear Information System (INIS)

    Lind, P.

    1993-02-01

    The completeness properties of the discrete set of bound state, virtual states and resonances characterizing the system of a single nonrelativistic particle moving in a central cutoff potential is investigated. From a completeness relation in terms of these discrete states and complex scattering states one can derive several Resonant State Expansions (RSE). It is interesting to obtain purely discrete expansion which, if valid, would significantly simplify the treatment of the continuum. Such expansions can be derived using Mittag-Leffler (ML) theory for a cutoff potential and it would be nice to see if one can obtain the same expansions starting from an eigenfunction theory that is not restricted to a finite sphere. The RSE of Greens functions is especially important, e.g. in the continuum RPA (CRPA) method of treating giant resonances in nuclear physics. The convergence of RSE is studied in simple cases using square well wavefunctions in order to achieve high numerical accuracy. Several expansions can be derived from each other by using the theory of analytic functions and one can the see how to obtain a natural discretization of the continuum. Since the resonance wavefunctions are oscillating with an exponentially increasing amplitude, and therefore have to be interpreted through some regularization procedure, every statement made about quantities involving such states is checked by numerical calculations.Realistic nuclear wavefunctions, generated by a Wood-Saxon potential, are used to test also the usefulness of RSE in a realistic nuclear calculation. There are some fundamental differences between different symmetries of the integral contour that defines the continuum in RSE. One kind of symmetry is necessary to have an expansion of the unity operator that is idempotent. Another symmetry must be used if we want purely discrete expansions. These are found to be of the same form as given by ML. (29 refs.)

  11. Graphene ground states

    Science.gov (United States)

    Friedrich, Manuel; Stefanelli, Ulisse

    2018-06-01

    Graphene is locally two-dimensional but not flat. Nanoscale ripples appear in suspended samples and rolling up often occurs when boundaries are not fixed. We address this variety of graphene geometries by classifying all ground-state deformations of the hexagonal lattice with respect to configurational energies including two- and three-body terms. As a consequence, we prove that all ground-state deformations are either periodic in one direction, as in the case of ripples, or rolled up, as in the case of nanotubes.

  12. Multiquark resonant states

    International Nuclear Information System (INIS)

    Shahbazian, B.A.

    1982-01-01

    The invariant mass spectra of forty nine hadronic systems with hypercharge, strangeness and baryon number, varied in wide limits have been studied. Resonance peaks have been found in the invariant mass spectra of Y 2 and #betta#pπ 2495 MeV/c 2 resonant states. Three more candidates for anti qq 4 states were found #bettaπ# + π + : 1705, 2072, 2605 MeV/c 2 . The masses of all these candidates are in good agreement with Bag Model predictions. A hypercharge selection rule is suggested: ''The hypercharge of hadronic resonances in weak gravitational fields cannot exceed one Y <= 1

  13. Solid state physics

    CERN Document Server

    Grosso, Giuseppe

    2013-01-01

    Solid State Physics is a textbook for students of physics, material science, chemistry, and engineering. It is the state-of-the-art presentation of the theoretical foundations and application of the quantum structure of matter and materials. This second edition provides timely coverage of the most important scientific breakthroughs of the last decade (especially in low-dimensional systems and quantum transport). It helps build readers' understanding of the newest advances in condensed matter physics with rigorous yet clear mathematics. Examples are an integral part of the text, carefully de

  14. Narrow Sigma -hypernuclear states

    CERN Document Server

    Gal, A

    1980-01-01

    It is shown that the spin-isospin dependence of low-energy Sigma N to Lambda N conversion leads to substantial quenching of nuclear-matter estimates of the widths of some Sigma -hypernuclear states produced in (K/sup -/, pi ) reactions, to a level below 10 MeV. The estimated widths compare favorably with those of the Sigma -hypernuclear peaks recently observed at CERN for /sup 7/Li, /sup 9/Be, and /sup 12/C. Tentative quantum number assignments are suggested for these states. (10 refs).

  15. Solid-state circuits

    CERN Document Server

    Pridham, G J

    2013-01-01

    Solid-State Circuits provides an introduction to the theory and practice underlying solid-state circuits, laying particular emphasis on field effect transistors and integrated circuits. Topics range from construction and characteristics of semiconductor devices to rectification and power supplies, low-frequency amplifiers, sine- and square-wave oscillators, and high-frequency effects and circuits. Black-box equivalent circuits of bipolar transistors, physical equivalent circuits of bipolar transistors, and equivalent circuits of field effect transistors are also covered. This volume is divided

  16. Solid state theory

    CERN Document Server

    Harrison, Walter A

    2011-01-01

    ""A well-written text . . . should find a wide readership, especially among graduate students."" - Dr. J. I. Pankove, RCA.The field of solid state theory, including crystallography, semi-conductor physics, and various applications in chemistry and electrical engineering, is highly relevant to many areas of modern science and industry. Professor Harrison's well-known text offers an excellent one-year graduate course in this active and important area of research. While presenting a broad overview of the fundamental concepts and methods of solid state physics, including the basic quantum theory o

  17. Solid-State Nanopore

    Directory of Open Access Journals (Sweden)

    Zhishan Yuan

    2018-02-01

    Full Text Available Abstract Solid-state nanopore has captured the attention of many researchers due to its characteristic of nanoscale. Now, different fabrication methods have been reported, which can be summarized into two broad categories: “top-down” etching technology and “bottom-up” shrinkage technology. Ion track etching method, mask etching method chemical solution etching method, and high-energy particle etching and shrinkage method are exhibited in this report. Besides, we also discussed applications of solid-state nanopore fabrication technology in DNA sequencing, protein detection, and energy conversion.

  18. Mini mental state examination

    DEFF Research Database (Denmark)

    Kørner, Ejnar Alex; Lauritzen, Lise; Wang, August

    2008-01-01

    INTRODUCTION: The Mini Mental State Examination (MMSE) is widely used in Denmark, but often in non-validated versions. In 2000 a cross-sectional workgroup decided on a new common version of the MMSE with a corresponding manual, which is validated for the first time in the present study. MATERIALS...... the severity of dementia disorders. Udgivelsesdato: 2008-Feb-25...

  19. Crystalline beam ground state

    International Nuclear Information System (INIS)

    Wei, Jie; Li, Xiao-Ping; Sessler, A.M.

    1993-01-01

    In order to employ Molecular Dynamics method, commonly used in condensed matter physics, we have derived the equations of motion for a beam of charged particles in the rotating rest frame of the reference particle. We include in the formalism that the particles are confined by the guiding and focusing magnetic fields, and that they are confined in a conducting vacuum pipe while interacting with each other via a Coulomb force. Numerical simulations has been performed to obtain the equilibrium structure. The effects of the shearing force, centrifugal force, and azimuthal variation of the focusing strength are investigated. It is found that a constant gradient storage ring can not give a crystalline beam, but that an alternating-gradient (AG) structure can. In such a machine the ground state is, except for one-dimensional (1-D) crystals, time-dependent. The ground state is a zero entropy state, despite the time-dependent, periodic variation of the focusing force. The nature of the ground state, similar to that found by Rahman and Schiffer, depends upon the density and the relative focusing strengths in the transverse directions. At low density, the crystal is 1-D. As the density increases, it transforms into various kinds of 2-D and 3-D crystals. If the energy of the beam is higher than the transition energy of the machine, the crystalline structure can not be formed for lack of radial focusing

  20. Crystalline beam ground state

    International Nuclear Information System (INIS)

    Wei, Jie; Li, Xiao-Ping

    1993-01-01

    In order to employ molecular dynamics (MD) methods, commonly used in condensed matter physics, we have derived the equations of motion for a beam of charged particles in the rotating rest frame of the reference particle. We include in the formalism that the particles are confined by the guiding and focusing magnetic fields, and that they are confined in a conducting vacuum pipe while interacting with each other via a Coulomb force. Numerical simulations using MD methods has been performed to obtain the equilibrium crystalline beam structure. The effect of the shearing force, centrifugal force, and azimuthal variation of the focusing strength are investigated. It is found that a constant gradient storage ring can not give a crystalline beam, but that an alternating-gradient (AG) structure can. In such a machine the ground state is, except for one-dimensional (1-D) crystals, time dependent. The ground state is a zero entropy state, despite the time-dependent, periodic variation of the focusing force. The nature of the ground state, similar to that found by Schiffer et al. depends upon the density and the relative focusing strengths in the transverse directions. At low density, the crystal is 1-D. As the density increases, it transforms into various kinds of 2-D and 3-D crystals. If the energy of the beam is higher than the transition energy of the machine, the crystalline structure can not be formed for lack of radial focusing

  1. Decay of Hoyle state

    Indian Academy of Sciences (India)

    2014-11-02

    Nov 2, 2014 ... The prediction of Hoyle state was necessitated to explain the abundance of carbon, which is crucial for the existence of life on Earth and is the stepping stone for understanding the abundance of other heavier elements. After the experimental confirmation of its existence, soon it was realized that the Hoyle ...

  2. Nuclear ground state

    International Nuclear Information System (INIS)

    Negele, J.W.

    1975-01-01

    The nuclear ground state is surveyed theoretically, and specific suggestions are given on how to critically test the theory experimentally. Detailed results on 208 Pb are discussed, isolating several features of the charge density distributions. Analyses of 208 Pb electron scattering and muonic data are also considered. 14 figures

  3. The Islamic State unfiltered

    NARCIS (Netherlands)

    Gloerich, Inte; Rowson, Rose; Cachia, Rebecca; Clandillon, Susan; Kolopaking, Cristel

    Instagram has become an unsuspecting pulpit ­– seemingly caught off guard – for those determined to spread a militant message of Islamic State terror. Graphic, fanatical and oftentimes heavily photoshopped images weave through Instagram’s labyrinth of sunset snaps and gym selfies to advance a

  4. United States Attorney Prosecutions

    Science.gov (United States)

    1993-10-01

    property of CocaCola Bottling Company, Fayetteville, North Carolina, of a value in excess of $100.00, in violation of Title 18 United States Code, Section...another, to-wit: a Cocacola soft drink machine, the amount of damage to said personal property being more than $200.00, in violation of North Carolina

  5. State Skill Standards: Welding

    Science.gov (United States)

    Pointer, Mike; Naylor, Randy; Warden, John; Senek, Gene; Shirley, Charles; Lefcourt, Lew; Munson, Justin; Johnson, Art

    2005-01-01

    The Department of Education has undertaken an ambitious effort to develop statewide occupational skill standards. The standards in this document are for welding programs and are designed to clearly state what the student should know and be able to do upon completion of an advanced high-school program. The writing team determined that any statewide…

  6. State Skill Standards: Photography

    Science.gov (United States)

    Howell, Frederick; Reed, Loretta; Jensen, Capra; Robison, Gary; Taylor, Susan; Pavesich, Christine

    2007-01-01

    The Department of Education has undertaken an ambitious effort to develop statewide skill standards for all content areas in career and technical education. The standards in this document are for photography programs and are designed to clearly state what the student should know and be able to do upon completion of an advanced high-school program.…

  7. State Dependence in Unemployment

    DEFF Research Database (Denmark)

    Ahmad, Nisar

    2014-01-01

    This study examines the extent state dependence among unemployed immigrants in a dynamic discrete choice framework. Three alternative methodologies are employed to control for the problem of the initial condition. The empirical findings show that there is a considerable correlation between the un...

  8. State Energy Resilience Framework

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Finster, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Pillon, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Petit, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Trail, J. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-12-01

    The energy sector infrastructure’s high degree of interconnectedness with other critical infrastructure systems can lead to cascading and escalating failures that can strongly affect both economic and social activities.The operational goal is to maintain energy availability for customers and consumers. For this body of work, a State Energy Resilience Framework in five steps is proposed.

  9. 75 FR 31465 - United States, State of Illinois, State of Colorado, and State of Indiana

    Science.gov (United States)

    2010-06-03

    ..., and often offer full-service restaurants or in-service dining. Premiere theatres also differ from... selection is deemed not to be a suitable alternative, the United States shall in its sole discretion select... suitable alternative pursuant to Section VI(A). If AMC's selection is deemed not to be a suitable...

  10. Unequal Welfare States

    NARCIS (Netherlands)

    A.J. Soede; J.C. Vrooman; P.M. Ferraresi; G. Segre

    2004-01-01

    The financial sustainability of the ageing welfare states in Europe has become a key policy issue recently. This study highlights a different aspect of the ageing process, namely its potential impact on income distributions. Since older people usually live on a lower income, their growing share

  11. Control of Squeezed States

    OpenAIRE

    Bloch, Anthony M.; Rojo, Alberto G.

    2000-01-01

    In this paper we consider the classical and quantum control of squeezed states of harmonic oscillators. This provides a method for reducing noise below the quantum limit and provides an example of the control of under-actuated systems in the stochastic and quantum context. We consider also the interaction of a squeezed quantum oscillator with an external heat bath.

  12. Crystalline beam ground state

    International Nuclear Information System (INIS)

    Wei, J.; Li, X.P.

    1993-01-01

    In order to employ the Molecular Dynamics method, commonly used in condensed matter physics, the authors have derived the equations of motion for a beam of charged particles in the rotating rest frame of the reference particle. They include in the formalism that the particles are confined by the guiding and focusing magnetic fields, and that they are confined in a conducting vacuum pipe while interacting with each other via a Coulomb force. Numerical simulations has been performed to obtain the equilibrium structure. The effects of the shearing force, centrifugal force, and azimuthal variation of the focusing strength are investigated. It is found that a constant gradient storage ring can not give a crystalline beam, but that an alternating-gradient (AG) structure can. In such a machine the ground state is, except for one-dimensional (1-D) crystals, time-dependent. The ground state is a zero entropy state, despite the time-dependent, periodic variation of the focusing force. The nature of the ground state, similar to that found by Rahman and Schiffer, depends upon the density and the relative focusing strengths in the transverse directions. At low density, the crystal is 1-D. As the density increases, it transforms into various kinds of 2-D and 3-D crystals. If the energy of the beam is higher than the transition energy of the machine, the crystalline structure can not be formed for lack of radial focusing

  13. Present State Examination

    DEFF Research Database (Denmark)

    Pedersen, Kamilla; Bertelsen, Aksel

    Present State Examination (PSE) 5. udgave er en revideret version af speciallæge i psykiatri Aksel Bertelsens oprindelige materiale. Aksel Bertelsen er ophavsmand til PSE og til den danske udgave af ICD-10. Revisionen omfatter et forbedret layout, en modernisering af sproget, tilføjelse af...

  14. The Islamic State Unfiltered

    NARCIS (Netherlands)

    Gloerich, I.; Kolopaking, C.; Cachia, R.; Rowson, R.; Clandillon, Susan

    Instagram has become an unsuspecting pulpit ­– seemingly caught off guard – for those determined to spread a militant message of Islamic State terror. Graphic, fanatical and oftentimes heavily photoshopped images weave through Instagram’s labyrinth of sunset snaps and gym selfies to advance a

  15. Phase squeezed states

    International Nuclear Information System (INIS)

    Chizhov, A.V.; Paris, M.G.A.

    1998-01-01

    Phase squeezed states of a single mode radiation field have been introduced as eigenstates of a linear combination of lowering and raising operators. The explicit expression in the Fock basis has been obtained and some relevant properties have been illustrated. (author)

  16. State Virtual Libraries

    Science.gov (United States)

    Pappas, Marjorie L.

    2003-01-01

    Virtual library? Electronic library? Digital library? Online information network? These all apply to the growing number of Web-based resource collections managed by consortiums of state library entities. Some, like "INFOhio" and "KYVL" ("Kentucky Virtual Library"), have been available for a few years, but others are just starting. Searching for…

  17. The Liquid State

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 6. The Liquid State - The Arrangement of Atoms. K R Rao. General Article Volume 2 Issue 6 June 1997 pp 54-59. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/002/06/0054-0059 ...

  18. State-set branching

    DEFF Research Database (Denmark)

    Jensen, Rune Møller; Veloso, Manuela M.; Bryant, Randal E.

    2008-01-01

    In this article, we present a framework called state-set branching that combines symbolic search based on reduced ordered Binary Decision Diagrams (BDDs) with best-first search, such as A* and greedy best-first search. The framework relies on an extension of these algorithms from expanding a sing...

  19. Singlet Ground State Magnetism:

    DEFF Research Database (Denmark)

    Loidl, A.; Knorr, K.; Kjems, Jørgen

    1979-01-01

    The magneticGamma 1 –Gamma 4 exciton of the singlet ground state system TbP has been studied by inelastic neutron scattering above the antiferromagnetic ordering temperature. Considerable dispersion and a pronounced splitting was found in the [100] and [110] directions. Both the band width...

  20. Plutonium valence state distributions

    International Nuclear Information System (INIS)

    Silver, G.L.

    1974-01-01

    A calculational method for ascertaining equilibrium valence state distributions of plutonium in acid solutions as a function of the plutonium oxidation number and the solution acidity is illustrated with an example. The method may be more practical for manual use than methods based upon polynomial equations. (T.G.)

  1. Create Your State

    Science.gov (United States)

    Dunham, Kris; Melvin, Samantha

    2011-01-01

    Students are often encouraged to work together with their classmates, sometimes with other classes, occasionally with kids at other schools, but rarely with kids across the country. In this article the authors describe the Create Your State project, a collaborative nationwide project inspired by the Texas Chair Project wherein the artist, Damien…

  2. Highways: Interstate, US & State

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This dataset contains lines for all highways in the state of New Mexico. It is in a vector digital data structure digitized from a USGS 1:500,000 scale map of the...

  3. States of Matter

    Indian Academy of Sciences (India)

    Deepak Dhar. States of Matter. Deepak Dhar. Keywords. Solid, liquid, gas, glasses, powders. D Dhar is a theoretical physicist at the Tata. Institute of Funamental. Research, Mumbai. His research interests are mainly in the area of non- equilibrium statistical physics. All of us have read about solid, liquid and gaseous.

  4. Alaska State Legislature

    Science.gov (United States)

    Standing Committees Finance Committees Special Committees Joint Committees Conference Committees Other , administrative support to the Legislature and all divisions, and has the responsibility for accounting, payroll Information Offices within the state. Accounting Santé Lesh, Administrative Operations Manager 465-3852

  5. Afghanistan, state and society

    DEFF Research Database (Denmark)

    Kværnø, Ole

    In June 2007, the RAND Corporation and the Royal Danish Defence College hosted a conference titled “Afghanistan: State and Society, Great Power Politics, and the Way Ahead”. The two-day event, held in Copenhagen, was attended by more than 100 politicians, scholars, academics, and representative...

  6. Administering Our State Library Agencies

    Science.gov (United States)

    DuFrane, Gerard

    1970-01-01

    A satire on the application of scientific management principles to a state library agency. Covers relationships of the state librarian to staff, the profession, and state and federal governments. (Author/JS)

  7. Understanding the pointer states

    International Nuclear Information System (INIS)

    Alexandre Brasil, Carlos; Andreta de Castro, Leonardo

    2015-01-01

    In quantum mechanics, pointer states are eigenstates of the observable of the measurement apparatus that represent the possible positions of the display pointer of the equipment. The origin of this concept lies in attempts to fill the blanks in Everett’s relative-state interpretation, and to make it a fully valid description of physical reality. To achieve this, it was necessary to consider not only the main system interacting with the measurement apparatus (like von Neumann and Everett did) but also the role of the environment in eliminating correlations between different possible measurements when interacting with the measurement apparatus. The interaction of the environment with the main system (and the measurement apparatus) is the core of the decoherence theory, which followed Everett’s thesis. In this article, we review the measurement process according to von Neumann, Everett’s relative state interpretation, the purpose of decoherence and some of its follow-up until Wojciech Zurek’s primordial paper that consolidated the concept of pointer states, previously presented by Heinz Dieter Zeh. Employing a simple physical model consisting of a pair of two-level systems—one representing the main system, the other the measurement apparatus—and a thermal bath—representing the environment—we show how pointer states emerge, explaining its contributions to the question of measurement in quantum mechanics, as well as its limitations. Finally, we briefly show some of its consequences. This paper is accessible to readers with elementary knowledge about quantum mechanics, on the level of graduate courses. (paper)

  8. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  9. Coherent states and rational surfaces

    International Nuclear Information System (INIS)

    Brody, Dorje C; Graefe, Eva-Maria

    2010-01-01

    The state spaces of generalized coherent states associated with special unitary groups are shown to form rational curves and surfaces in the space of pure states. These curves and surfaces are generated by the various Veronese embeddings of the underlying state space into higher dimensional state spaces. This construction is applied to the parameterization of generalized coherent states, which is useful for practical calculations, and provides an elementary combinatorial approach to the geometry of the coherent state space. The results are extended to Hilbert spaces with indefinite inner products, leading to the introduction of a new kind of generalized coherent states.

  10. The State of Preschool 2012: State Preschool Yearbook. Executive Summary

    Science.gov (United States)

    Barnett, W. Steven; Carolan, Megan E.; Fitzgerald, Jen; Squires, James H.

    2012-01-01

    The 2012 "State Preschool Yearbook" profiles state-funded prekindergarten programs in the United States. The "Yearbook" compares each state program's standards against a checklist of 10 research-based quality standards benchmarks. Although the benchmarks against which the National Institute for Early Education Research (NIEER)…

  11. Quantum information with Gaussian states

    International Nuclear Information System (INIS)

    Wang Xiangbin; Hiroshima, Tohya; Tomita, Akihisa; Hayashi, Masahito

    2007-01-01

    Quantum optical Gaussian states are a type of important robust quantum states which are manipulatable by the existing technologies. So far, most of the important quantum information experiments are done with such states, including bright Gaussian light and weak Gaussian light. Extending the existing results of quantum information with discrete quantum states to the case of continuous variable quantum states is an interesting theoretical job. The quantum Gaussian states play a central role in such a case. We review the properties and applications of Gaussian states in quantum information with emphasis on the fundamental concepts, the calculation techniques and the effects of imperfections of the real-life experimental setups. Topics here include the elementary properties of Gaussian states and relevant quantum information device, entanglement-based quantum tasks such as quantum teleportation, quantum cryptography with weak and strong Gaussian states and the quantum channel capacity, mathematical theory of quantum entanglement and state estimation for Gaussian states

  12. Localized states in semiconductors

    International Nuclear Information System (INIS)

    Sarker, A.Q.

    1976-08-01

    The multi-valley effective mass formalism for the asymmetric energy surfaces developed in an earlier paper is extended for the calculations of the ground state energies of isocoric donors in Ge. The impurity potential is constructed from the k-dependent dielectric function of Ge and a variational trial wave function, belonging to an irreducible representation of the point group Tsub(d) of the Hamiltonian, is used. The calculated energy levels for the singlet A 1 and the triplet T 2 symmetries of the ls states for As in Ge is found to be of the same order (-9.6 to-12.8 meV) as observed experimentally; however, the predicted E(A 1 ) - E(T 2 ) splitting is rather too small (approximately -0.5 to -0.7 meV) compared with the observed value -4.23 meV

  13. Cutting state identification

    International Nuclear Information System (INIS)

    Berger, B.S.; Minis, I.; Rokni, M.

    1997-01-01

    Cutting states associated with the orthogonal cutting of stiff cylinders are identified through an analysis of the singular values of a Toeplitz matrix of third order cumulants of acceleration measurements. The ratio of the two pairs of largest singular values is shown to differentiate between light cutting, medium cutting, pre-chatter and chatter states. Sequences of cutting experiments were performed in which either depth of cut or turning frequency was varied. Two sequences of experiments with variable turning frequency and five with variable depth of cut, 42 cutting experiments in all, provided a database for the calculation of third order cumulants. Ratios of singular values of cumulant matrices find application in the analysis of control of orthogonal cutting

  14. Thermodynamics of Crystalline States

    CERN Document Server

    Fujimoto, Minoru

    2013-01-01

    Thermodynamics is a well-established discipline of physics for properties of matter in thermal equilibrium with the surroundings. Applying to crystals, however, the laws encounter undefined properties of crystal lattice, which therefore need to be determined for a clear and well-defined description of crystalline states. Thermodynamics of Crystalline States explores the roles played by order variables and dynamic lattices in crystals in a wholly new way. The book begins by clarifying basic concepts for stable crystals. Next, binary phase transitions are discussed to study collective motion of order variables, as described mostly as classical phenomena. New to this edition is the examination of magnetic crystals, where magnetic symmetry is essential for magnetic phase transitions. The multi-electron system is also discussed  theoretically, as a quantum-mechanical example, for superconductivity in metallic crystals. Throughout the book, the role played by the lattice is emphasized and studied in-depth. Thermod...

  15. Parallel Polarization State Generation.

    Science.gov (United States)

    She, Alan; Capasso, Federico

    2016-05-17

    The control of polarization, an essential property of light, is of wide scientific and technological interest. The general problem of generating arbitrary time-varying states of polarization (SOP) has always been mathematically formulated by a series of linear transformations, i.e. a product of matrices, imposing a serial architecture. Here we show a parallel architecture described by a sum of matrices. The theory is experimentally demonstrated by modulating spatially-separated polarization components of a laser using a digital micromirror device that are subsequently beam combined. This method greatly expands the parameter space for engineering devices that control polarization. Consequently, performance characteristics, such as speed, stability, and spectral range, are entirely dictated by the technologies of optical intensity modulation, including absorption, reflection, emission, and scattering. This opens up important prospects for polarization state generation (PSG) with unique performance characteristics with applications in spectroscopic ellipsometry, spectropolarimetry, communications, imaging, and security.

  16. Bringing Different States in

    DEFF Research Database (Denmark)

    Breidahl, Karen Nielsen; Fersch, Barbara

    2018-01-01

    Migration scholars have long been concerned with understanding what influences the incorporation of migrants into their host societies. The theoretical development in this field has been dominated for several years by North American migration scholars who have not been much interested...... of the article, it is exemplified how these insights can be applied when studying the Danish welfare state in a comparative perspective, drawing on examples on the influence of family policies on migrants’ attitudes towards women’s paid work....... in the influence of welfare state institutions. In recent years, European migration scholars have, however, contributed to important insights on the impact of the national integration context on the socioeconomic incorporation of migrants. The aim of this article is to contribute to this burgeoning research field...

  17. Models of multiquark states

    International Nuclear Information System (INIS)

    Lipkin, H.J.

    1986-01-01

    The success of simple constituent quark models in single-hardon physics and their failure in multiquark physics is discussed, emphasizing the relation between meson and baryon spectra, hidden color and the color matrix, breakup decay modes, coupled channels, and hadron-hadron interactions via flipping and tunneling of flux tubes. Model-independent predictions for possible multiquark bound states are considered and the most promising candidates suggested. A quark approach to baryon-baryon interactions is discussed

  18. Weak states and security

    OpenAIRE

    Rakipi, Albert

    2006-01-01

    Cataloged from PDF version of article. Although the weak 1 failing states have often been deseribed as the single most important problem for the international order s ince the en d of Cold W ar (F .Fukuyaına 2004:92) several dimensions of this phenomenon still remain unexplored. While this phenomenon has been present in the international politics even earlier, only the post Cold W ar period accentuated its relationship with security issues. Following the Cold W ar' s "peacef...

  19. Algebras of Information States

    Czech Academy of Sciences Publication Activity Database

    Punčochář, Vít

    2017-01-01

    Roč. 27, č. 5 (2017), s. 1643-1675 ISSN 0955-792X R&D Projects: GA ČR(CZ) GC16-07954J Institutional support: RVO:67985955 Keywords : information states * relational semantics * algebraic semantics * intuitionistic logic * inquisitive disjunction Subject RIV: AA - Philosophy ; Religion OBOR OECD: Philosophy, History and Philosophy of science and technology Impact factor: 0.909, year: 2016

  20. Commonwealth of (Independent States

    Directory of Open Access Journals (Sweden)

    Vrućinić Dušan

    2013-01-01

    Full Text Available Following the stages from the establishment itself to the present day of the functioning of such a specific regional organization as the Commonwealth of Independent States (CIS, the article seeks to further explain the meaning of its existence, efficiency and functioning. The CIS was created in order to make the dissolution of a major world super-power, which throughout the 20th century together with the USA defined the bipolar world, as painless as possible, especially for the new countries and its nationally and ethnically diverse population. During the early years after the dissolution of the USSR, the CIS played a major role in a more flexible and less severe dissolution of the Soviet empire, alleviating the consequences for its people. A more efficient functioning among the republics in all fields was also one of the tasks of the Commonwealth, to which it was devoted to the extent which was permitted by the then, not too favourable circumstances. Difficult years of economic crisis did not allow the CIS to mutually integrate its members as much as possible on the economy level. Thanks to the economic recovery of the post-Soviet states in the early 21st century, the Commonwealth has also been transformed, reformed, and renewed, and all this in order to achieve better and more fruitful cooperation between the members. The CIS may serve as a proper example of how the former Soviet Union states are inextricably linked by social, security-political, economic, cultural, communication-transport, and other ties, thanks to the centuries-long existence of the peoples of these states in this area, despite both internal and external factors which occasionally, but temporarily halt the post-Soviet integration. Mathematically expressed, the CIS members are naturally predisposed, to be reciprocally depended on each other, just as they also have the capacity for successful cooperation in the future times and epochs brought on by the modern world.

  1. Nevada state revenues analysis

    International Nuclear Information System (INIS)

    1988-06-01

    This report analyzes the major sources of revenue to the Nevada State General Fund for purposes of estimating impacts associated with the siting of a nuclear waste repository at Yucca Mountain in Nye County, Nevada. Each major revenue source is analyzed to identify relationships among the economic or demographic base, the revenue base, and the revenues generated. Trends and changes in the rates and/or base are highlighted. A model is developed for each revenue source to allow impact estimation

  2. Solid state detector design

    International Nuclear Information System (INIS)

    Gunarwan Prayitno; Ahmad Rifai

    2010-01-01

    Much has been charged particle detector radiation detector made by the industry, especially those engaged in the development of detection equipment and components. The development and further research will be made solid state detector with silicon material. To be able to detect charged particles (radiation), required the processing of silicon material into the detector material. The method used to make silicon detector material is a lithium evaporations. Having formed an intrinsic region contactor installation process, and with testing. (author)

  3. Investigating Quantum Modulation States

    Science.gov (United States)

    2016-03-01

    Coherent state quantum data encryption is highly interoperable with current classical optical infrastructure in both fiber and free space optical networks...hub’s field of regard has a transmit/receive module that are endpoints of the Lyot filter stage tree within the hub’s backend electro-optics control... mobile airborne and space-borne networking. Just like any laser communication technology, QC links are affected by several sources of distortions

  4. State Controled Avantgarde?

    DEFF Research Database (Denmark)

    Kreutzfeldt, Jacob

    2016-01-01

    State controlled radio developed in the Nordic countries by the middle of the 1920es. Danish Radio was established for a trial period in April 1925, and was permanently founded in April 1926. Swedish radio was founded in 1925 and Norwegian radio in 1933. The new and unquestionably powerful medium...... to the program sheet from Danish Broadcasting Corporation (DBC) the program included transmission of music from the Radio Orchestra, sound film and transmissions from theatres and dance restaurants in Copenhage...

  5. Tracking intruder states

    Energy Technology Data Exchange (ETDEWEB)

    Riedinger, L L; Mueller, W F; Yu, C H [Tennessee Univ., Knoxville, TN (United States). Dept. of Physics

    1992-08-01

    The deformation-driving effects of intruder states are studied by analysis of various types of data on rotational bands in rare-earth deformed nuclei. The sensitivity of four measurables (bandhead energy, B(E2) value, neutron i{sub 13/2} crossing frequency, and signature splitting) to increased deformation in an intruder band is shown. The analysis of signature splitting systematics is extended to known superdeformed bands. (author). 22 refs., 5 figs.

  6. On coherent states

    International Nuclear Information System (INIS)

    Polubarinov, I.V.

    1975-01-01

    A definition of the coherent state representation is given in this paper. In the representation quantum theory equations take the form of classical field theory equations (with causality inherent to the latter) not only in simple cases (free field and interactions with an external current or field), but also in the general case of closed systems of interacting fields. And, conversely, a classical field theory can be transformed into a form of a quantum one

  7. The nuclear state

    International Nuclear Information System (INIS)

    Jungk, R.

    1979-01-01

    A general picture is given of the technical and sociological problems which it is said arise in the 'nuclear state'. Separate chapters are entitled: radiation fodder; the gamblers; the atomic man; the intimidated; the proliferators; atomic terrorists; the supervised. The Foreword, entitled 'the hard path' (i.e. with nuclear power) is contrasted with a final chapter entitled 'Prospect: the soft path' (i.e. without nuclear power). (U.K.)

  8. United States rejoin ITER

    International Nuclear Information System (INIS)

    Roberts, M.

    2003-01-01

    Upon pressure from the United States Congress, the US Department of Energy had to withdraw from further American participation in the ITER Engineering Design Activities after the end of its commitment to the EDA in July 1998. In the years since that time, changes have taken place in both the ITER activity and the US fusion community's position on burning plasma physics. Reflecting the interest in the United States in pursuing burning plasma physics, the DOE's Office of Science commissioned three studies as part of its examination of the option of entering the Negotiations on the Agreement on the Establishment of the International Fusion Energy Organization for the Joint Implementation of the ITER Project. These were a National Academy Review Panel Report supporting the burning plasma mission; a Fusion Energy Sciences Advisory Committee (FESAC) report confirming the role of ITER in achieving fusion power production, and The Lehman Review of the ITER project costing and project management processes (for the latter one, see ITER CTA Newsletter, no. 15, December 2002). All three studies have endorsed the US return to the ITER activities. This historical decision was announced by DOE Secretary Abraham during his remarks to employees of the Department's Princeton Plasma Physics Laboratory. The United States will be working with the other Participants in the ITER Negotiations on the Agreement and is preparing to participate in the ITA

  9. Variational transition state theory

    International Nuclear Information System (INIS)

    Truhlar, D.G.

    1986-01-01

    This project is concerned with the development and applications of generalized transition state theory and multidimensional tunneling approximations to chemical reaction rates. They have developed and implemented several practical versions of variational transition state theory (VTST), namely canonical variational theory (CVT), improved canonical variational theory (ICVT), and microcanonical variational theory (μVT). They have also developed and implemented several accurate multidimensional semiclassical tunneling approximations, the most accurate of which are the small-curvature semiclassical adiabatic (SCSA), large-curvature version-3 (LC3), and least-action (LA) approximations. They have applied the methods to thermal rate constants, using transmission coefficients based on ground-state tunneling, and they have also presented and applied adiabatic and diabatic extensions to calculated rate constants for vibrationally excited reactants. Their general goal is to develop accurate methods for calculating chemical reaction rate constants that remain practical even for reasonably complicated molecules. The approximations mentioned above yield rate constants for systems whose potential energy surface is known or assumed. Thus a second, equally important aspect of their work is the determination or modeling, semi-empirically and/or from electronic structure calculations, of potential energy surfaces

  10. JWL Equation of State

    Energy Technology Data Exchange (ETDEWEB)

    Menikoff, Ralph [Los Alamos National Laboratory

    2015-12-15

    The JWL equation of state (EOS) is frequently used for the products (and sometimes reactants) of a high explosive (HE). Here we review and systematically derive important properties. The JWL EOS is of the Mie-Grueneisen form with a constant Grueneisen coefficient and a constants specific heat. It is thermodynamically consistent to specify the temperature at a reference state. However, increasing the reference state temperature restricts the EOS domain in the (V, e)-plane of phase space. The restrictions are due to the conditions that P ≥ 0, T ≥ 0, and the isothermal bulk modulus is positive. Typically, this limits the low temperature regime in expansion. The domain restrictions can result in the P-T equilibrium EOS of a partly burned HE failing to have a solution in some cases. For application to HE, the heat of detonation is discussed. Example JWL parameters for an HE, both products and reactions, are used to illustrate the restrictions on the domain of the EOS.

  11. Deep inelastic final states

    International Nuclear Information System (INIS)

    Girardi, G.

    1980-11-01

    In these lectures we attempt to describe the final states of deep inelastic scattering as given by QCD. In the first section we shall briefly comment on the parton model and give the main properties of decay functions which are of interest for the study of semi-inclusive leptoproduction. The second section is devoted to the QCD approach to single hadron leptoproduction. First we recall basic facts on QCD log's and derive after that the evolution equations for the fragmentation functions. For this purpose we make a short detour in e + e - annihilation. The rest of the section is a study of the factorization of long distance effects associated with the initial and final states. We then show how when one includes next to leading QCD corrections one induces factorization breaking and describe the double moments useful for testing such effects. The next section contains a review on the QCD jets in the hadronic final state. We begin by introducing the notion of infrared safe variable and defining a few useful examples. Distributions in these variables are studied to first order in QCD, with some comments on the resummation of logs encountered in higher orders. Finally the last section is a 'gaullimaufry' of jet studies

  12. Plant state display device

    International Nuclear Information System (INIS)

    Kadota, Kazuo; Ito, Toshiichiro.

    1994-01-01

    The device of the present invention conducts information processing suitable for a man to solve a problem in a plant such as a nuclear power plant incorporating a great amount of information, where safety is required and provides information to an operator. Namely, theories and rules with respect to the flow and balanced state of materials and energy upon plant start-up, and a vapor cycle of operation fluids are symbolized and displayed on the display screen of the device. Then, the display of the plant information suitable to the information processing for a man to dissolve problems is provided. Accordingly, a mechanism for analyzing a purpose of the plant is made more definite, thereby enabling to prevent an erroneous judgement of an operator and occurrence of plant troubles. In addition, a simular effect can also be expected when the theories and rules with respect to the flow and the balanced state of materials and energy and thermohydrodynamic behavior of the operation fluids in a state of after-heat removing operation during shutdown of the plant are symbolized and displayed. (I.S.)

  13. Information Equation of State

    Directory of Open Access Journals (Sweden)

    M. Paul Gough

    2008-07-01

    Full Text Available Landauer’s principle is applied to information in the universe. Once stars began forming there was a constant information energy density as the increasing proportion of matter at high stellar temperatures exactly compensated for the expanding universe. The information equation of state was close to the dark energy value, w = -1, for a wide range of redshifts, 10 > z > 0.8, over one half of cosmic time. A reasonable universe information bit content of only 1087 bits is sufficient for information energy to account for all dark energy. A time varying equation of state with a direct link between dark energy and matter, and linked to star formation in particular, is clearly relevant to the cosmic coincidence problem. In answering the ‘Why now?’ question we wonder ‘What next?’ as we expect the information equation of state to tend towards w = 0 in the future.c

  14. United States advanced technologies

    International Nuclear Information System (INIS)

    Longenecker, J.R.

    1985-01-01

    In the United States, the advanced technologies have been applied to uranium enrichment as a means by which it can be assured that nuclear fuel cost will remain competitive in the future. The United States is strongly committed to the development of advanced enrichment technology, and has brought both advanced gas centrifuge (AGC) and atomic vapor laser isotope separation (AVLIS) programs to a point of significant technical refinement. The ability to deploy advanced technologies is the basis for the confidence in competitive future price. Unfortunately, the development of advanced technologies is capital intensive. The year 1985 is the key year for advanced technology development in the United States, since the decision on the primary enrichment technology for the future, AGC or AVLIS, will be made shortly. The background on the technology selection process, the highlights of AGC and AVLIS programs and the way to proceed after the process selection are described. The key objective is to maximize the sales volume and minimize the operating cost. This will help the utilities in other countries supply low cost energy on a reliable, long term basis. (Kako, I.)

  15. Overlaps of partial Néel states and Bethe states

    International Nuclear Information System (INIS)

    Foda, O; Zarembo, K

    2016-01-01

    Partial Néel states are generalizations of the ordinary Néel (classical anti-ferromagnet) state that can have arbitrary integer spin. We study overlaps of these states with Bethe states. We first identify this overlap with a partial version of reflecting-boundary domain-wall partition function, and then derive various determinant representations for off-shell and on-shell Bethe states. (paper: quantum statistical physics, condensed matter, integrable systems)

  16. State estimation in networked systems

    NARCIS (Netherlands)

    Sijs, J.

    2012-01-01

    This thesis considers state estimation strategies for networked systems. State estimation refers to a method for computing the unknown state of a dynamic process by combining sensor measurements with predictions from a process model. The most well known method for state estimation is the Kalman

  17. Functional State Modelling of Cultivation Processes: Dissolved Oxygen Limitation State

    Directory of Open Access Journals (Sweden)

    Olympia Roeva

    2015-04-01

    Full Text Available A new functional state, namely dissolved oxygen limitation state for both bacteria Escherichia coli and yeast Saccharomyces cerevisiae fed-batch cultivation processes is presented in this study. Functional state modelling approach is applied to cultivation processes in order to overcome the main disadvantages of using global process model, namely complex model structure and a big number of model parameters. Alongwith the newly introduced dissolved oxygen limitation state, second acetate production state and first acetate production state are recognized during the fed-batch cultivation of E. coli, while mixed oxidative state and first ethanol production state are recognized during the fed-batch cultivation of S. cerevisiae. For all mentioned above functional states both structural and parameter identification is here performed based on experimental data of E. coli and S. cerevisiae fed-batch cultivations.

  18. Teleportations of Mixed States and Multipartite Quantum States

    Institute of Scientific and Technical Information of China (English)

    YU Chang-Shui; WANG Ya-Hong; SONG He-Shan

    2007-01-01

    In this paper, we propose a protocol to deterministically teleport an unknown mixed state of qubit by utilizing a maximally bipartite entangled state of qubits as quantum channel. Ifa non-maximally entangled bipartite pure state is employed as quantum channel, the unknown mixed quantum state of qubit can be teleported with 1 - √1 - C2 probability, where C is the concurrence of the quantum channel. The protocol can also be generalized to teleport a mixed state of qudit or a multipartite mixed state. More important purpose is that, on the basis of the protocol, the teleportation of an arbitrary multipartite (pure or mixed) quantum state can be decomposed into the teleportation of each subsystem by employing separate entangled states as quantum channels. In the case of deterministic teleportation,Bob only needs to perform unitary transformations on his single particles in order to recover the initial teleported multipartite quantum state.

  19. Coherent states in quantum mechanics

    International Nuclear Information System (INIS)

    Rodrigues, R. de Lima; Fernandes Junior, Damasio; Batista, Sheyla Marques

    2001-12-01

    We present a review work on the coherent states is non-relativistic quantum mechanics analysing the quantum oscillators in the coherent states. The coherent states obtained via a displacement operator that act on the wave function of ground state of the oscillator and the connection with Quantum Optics which were implemented by Glauber have also been considered. A possible generalization to the construction of new coherent states it is point out. (author)

  20. Coherent states in quantum mechanics

    CERN Document Server

    Rodrigues, R D L; Fernandes, D

    2001-01-01

    We present a review work on the coherent states is non-relativistic quantum mechanics analysing the quantum oscillators in the coherent states. The coherent states obtained via a displacement operator that act on the wave function of ground state of the oscillator and the connection with Quantum Optics which were implemented by Glauber have also been considered. A possible generalization to the construction of new coherent states it is point out.

  1. State Energy Program Operations Manual

    Energy Technology Data Exchange (ETDEWEB)

    Office of Building Technology, State and Community Programs

    1999-03-17

    The State Energy Program Operations Manual is a reference tool for the states and the program officials at the U.S. Department of Energy's Office of Building Technology, State and Community Programs and Regional Support Offices as well as State Energy Offices. The Manual contains information needed to apply for and administer the State Energy Program, including program history, application rules and requirements, and program administration and monitoring requirements.

  2. The United States

    International Nuclear Information System (INIS)

    Art, R.J.

    1991-01-01

    This paper reports that at least in the national security arena, the outcomes of bureaucratic infighting and domestic political struggles are not determined wholly by what goes on with the state. Rather struggles among contending groups are greatly affected by what is perceived to be happening outside the nation. Because external conditions give greater potency to some domestic forces over other, the external environment is never neutral in its domestic impact. The decisions of the period 1950-53 discussed above illustrate the point. But so too do the decisions of 1947, 1960-61 and 1969-72. In the 1947 case, Soviet intransigence provoked US nuclear rearmament. In the 1960-61 case, extended deterrent considerations pushed the United States to preserve its again newly discovered nuclear superiority. In the 1969-72 case, a Soviet determination to remain equal forced US acceptance of nuclear equality. And perhaps the best evidence of all, the perpetuation of parity ended the US inclination to resort to nuclear brinkmanship. In each instance, concerns about relative position heavily affected nuclear choice. Finally, the events of the past three years testify to the effects of international events on domestic choice. Under the terms of the 1987 INF Treaty, the two superpowers decided to dismantle and destroy an entire class of missiles of intermediate range (500-3000 kilometers) that both had deployed in Europe in the 1970s and 1980s, and in their June 1990 joint statement on strategic nuclear weapons, President Gorbachev and Brush agreed to cut the number of Soviet and US long range nuclear forces by 30 per cent. This agreement marks a watershed in US-Soviet strategic arm negotiations because for the first time the United States and the Soviet Union agreed in principals to reduce the number of weapons aimed at one another. Between 1985 and 1990 the cold war was brought to a close

  3. Legislative update: United States

    International Nuclear Information System (INIS)

    Anon.

    2007-01-01

    The US Senate consented to the ratification of the Convention on Supplementary Compensation for Nuclear Damage (CSC) on 4 August 2006. The entry into force of the Convention on Supplementary Compensation will substantially change the face of the international nuclear liability regime. The CSC is a free-standing instrument, open to all states. This means that countries can become party to a new global regime providing for liability and compensation for victims of a nuclear incident, without also having to become a contracting party to the Paris Convention or the Vienna Convention. This is certainly a major step forward given that at the present time, over half of the world's reactors in operation or under construction are not covered by any of the international nuclear third party liability conventions. The CSC creates an instrument by which states can ensure that more money will be made available to compensate more victims for a broader range of damage than ever before. The CSC provides for two tiers of compensation. The first tier, fixed at 300 million Special Drawing Rights, is to be provided by the liable operator. This tier is to be distributed on a non-discriminatory basis to victims both inside and outside of the Installation State. If 300 million SDRs are insufficient to compensate all damage, then contracting parties will be required to contribute to the second tier (the international fund). The amount of this second tier is not fixed, but rather will depend on the number of operating nuclear power plants in contracting parties, and is designed to increase as the number of such plants increases

  4. Solid state physics

    CERN Document Server

    Burns, Gerald

    2013-01-01

    The objective of Solid State Physics is to introduce college seniors and first-year graduate students in physics, electrical engineering, materials science, chemistry, and related areas to this diverse and fascinating field. I have attempted to present this complex subject matter in a coherent, integrated manner, emphasizing fundamental scientific ideas to give the student a strong understanding and ""feel"" for the physics and the orders of magnitude involved. The subject is varied, covering many important, sophisticated, and practical areas, which, at first, may appear unrelated but which ar

  5. Nuclear molecular states

    International Nuclear Information System (INIS)

    Abe, Y.

    1975-01-01

    The effects of polarization on the stability of α-cluster structures in 8 Be and 12 C nuclei are studied in the intrinsic states. The extent of the polarization of α-clusters is investigated by employing a molecular-orbital model. Two α-cluster structure of 8 Be is shown to be extremely stable, and a triangular configuration of three α-clusters is also shown to be stable, but the polarizations of α-clusters are found rather large. Gruemmer--Faessler's method is discussed and their results are shown to be trivial

  6. Two electron Rydberg states

    International Nuclear Information System (INIS)

    Cooke, W.E.

    1981-01-01

    This paper addresses the study of two-electron Rydberg atoms. With Multichannel Quantum Defect Theory (MQDT), there is a technique for characterizing a spectra in terms of a small number of parameters. A survey of some important effects specific to two-electon Rydberg states, using primarily the alkaline earth atoms for examples, is made. The remainder of the paper deals with a discussion of the electron-electron interaction, including some of the basic points of MQDT. Energy exchange between two electrons is also addressed

  7. Advanced solid state batteries

    Energy Technology Data Exchange (ETDEWEB)

    Levasseur, A; Delmas, C; Menetrier, M; Hagenmuller, P

    1984-01-01

    Direct electrochemical storage of electricity is attractive because of its adaptability to vehicle traction as well as to stationary applications. Important advancements are necessary to improve primary or secondary batteries so far used. The aim of this study was to develop and to characterize materials for the next generation of advanced, rechargeable solid state batteries for vehicle transport and stationary storage applications. One of the best electricity storage systems was the lithium/intercalation compound secondary battery, though up to now the behavior of liquid organic electrolytes did not allow for good recycling in such systems. The research program for these batteries is described.

  8. Triggers of State Failure

    Science.gov (United States)

    2010-03-01

    à 1990) à l’aide de données collatérales additionnelles. Les auteurs du document n’ont pas essayé de suivre les événements qui étaient en cours...défaillance étatique, et les auteurs du document ont reconnu qu’il ne serait pas très utile de reproduire toutes ces informations. Le document s’appuie le...30 Carment, David. Assessing state failure: implications for theory and policy. in Third World Quarterly. Vol 24, no 3. pp 407-427. 30 DRDC

  9. ECO INDUSTRIAL STATE

    Directory of Open Access Journals (Sweden)

    Mariana López Pascual

    2015-06-01

    The facades will become aesthetically pleasing for the public space or such with the installation of a new technology of a photovoltaic-glass with transparency that can be used for windows or displays. A social program of artistic murals will accompany this with the aim for awareness on environmental protection. This is a project seeks to intervene in the public space, inviting the private sector for the economic investment and nurture to gives neighbours and all Barcelona's citizens a new and attractive image of this Industrial State

  10. Solid state optical microscope

    Science.gov (United States)

    Young, Ian T.

    1983-01-01

    A solid state optical microscope wherein wide-field and high-resolution images of an object are produced at a rapid rate by utilizing conventional optics with a charge-coupled photodiode array. A galvanometer scanning mirror, for scanning in one of two orthogonal directions is provided, while the charge-coupled photodiode array scans in the other orthogonal direction. Illumination light from the object is incident upon the photodiodes, creating packets of electrons (signals) which are representative of the illuminated object. The signals are then processed, stored in a memory, and finally displayed as a video signal.

  11. Nuclear quasimolecular states

    International Nuclear Information System (INIS)

    Ritz, Thorsten; Scheid, Werner; Schmidt, Juergen

    1996-01-01

    Two aspects are reported: (a) Resonances in the scattering of 12 C on 12 C are interpreted within a phenomenological model of two oblately deformed 12 C nuclei. The corresponding quasibound states describe the nuclei rotating around the internuclear axis and carrying out butterfly and radial oscillations; (b) Angle-integrated cross sections of the scattering of 58 Ni on 58 Ni are calculated with the coupled channel method by taking the low energy spectrum of 58 Ni into account and compared with recent experimental data of Cindro et al. in the energy range between E cm = 110 and 115 MeV. (authors)

  12. Solid state mechanics

    International Nuclear Information System (INIS)

    Habib, P.

    1988-01-01

    The 1988 progress report of the Solid State Mechanics laboratory (Polytechnic School, France) is presented. The research program domains are the following: investigations concerning the stability and bifurcation of the reversible or irreversible mechanical systems, the problems related to the theoretical and experimental determination of the materials rheological properties, the fatigue crack formation and propagation in multiple-axial stress conditions, the expert systems, and the software applied in the reinforced earth structures dimensioning. Moreover, the published papers, the books, the congress communications, the thesis, and the patents are listed [fr

  13. Transcending the nation state

    DEFF Research Database (Denmark)

    Cort, Pia

    2009-01-01

    competition. This article surveys vocational education and training models in Europe, applying a discursive institutionalist perspective in order to describe how vocational education and training as an institution is being reframed by means of the Copenhagen Process, and concludes that a European model......Throughout Europe, vocational education and training is undergoing reform and modernisation as part of a common EU policy process, the Copenhagen Process. The aim of this Process is initiate a pan-European modernisation of vocational education and training in order to meet the challenges of global...... is under construction which aims to transcend the nation state by introducing a new way of "thinking" vocational education and training....

  14. Polynomial intelligent states

    International Nuclear Information System (INIS)

    Milks, Matthew M; Guise, Hubert de

    2005-01-01

    The construction of su(2) intelligent states is simplified using a polynomial representation of su(2). The cornerstone of the new construction is the diagonalization of a 2 x 2 matrix. The method is sufficiently simple to be easily extended to su(3), where one is required to diagonalize a single 3 x 3 matrix. For two perfectly general su(3) operators, this diagonalization is technically possible but the procedure loses much of its simplicity owing to the algebraic form of the roots of a cubic equation. Simplified expressions can be obtained by specializing the choice of su(3) operators. This simpler construction will be discussed in detail

  15. State laws on tobacco control--United States, 1998.

    Science.gov (United States)

    Fishman, J A; Allison, H; Knowles, S B; Fishburn, B A; Woollery, T A; Marx, W T; Shelton, D M; Husten, C G; Eriksen, M P

    1999-06-25

    State laws addressing tobacco use, the leading preventable cause of death in the United States, are summarized. Laws address smoke-free indoor air, minors' access to tobacco products, advertising of tobacco products, and excise taxes on tobacco products. Legislation effective through December 31, 1998. CDC identified laws addressing tobacco control by using an on-line legal research database. CDC's findings were verified with the National Cancer Institute's State Cancer Legislative Database. Since a previous surveillance summary on state tobacco-control laws published in November 1995 (covering legislation effective through June 30, 1995), several states have enacted new restrictions or strengthened existing legislation that addresses smoke-free indoor air, minors' access to tobacco, tobacco advertising, and tobacco taxes. Five states strengthened their smoke-free indoor air legislation. All states and Washington, D.C., continued to prohibit the sale and distribution of tobacco products to minors; however, 21 states expanded minors' access laws by designating enforcement authorities, adding license suspension or revocation for sale to minors, or requiring signage. Since the 1995 report, eight additional states (a total of 19 states and Washington, D.C.) now ban vending machines from areas accessible to minors. Thirteen states restrict advertising of tobacco products, an increase of four states since the 1995 report. Although the number of states that tax cigarettes and smokeless tobacco did not change, 13 states increased excise taxes on cigarettes, and five states increased excise taxes on smokeless tobacco products. The average state excise tax on cigarettes is 38.9 cents per pack, an increase of 7.4 cents compared with the average tax in the 1995 report. State laws addressing tobacco control vary in relation to restrictiveness, enforcement and penalties, preemptions, and exceptions. The data summarizing state tobacco-control laws are available through CDC

  16. Parameter and State Estimator for State Space Models

    Directory of Open Access Journals (Sweden)

    Ruifeng Ding

    2014-01-01

    Full Text Available This paper proposes a parameter and state estimator for canonical state space systems from measured input-output data. The key is to solve the system state from the state equation and to substitute it into the output equation, eliminating the state variables, and the resulting equation contains only the system inputs and outputs, and to derive a least squares parameter identification algorithm. Furthermore, the system states are computed from the estimated parameters and the input-output data. Convergence analysis using the martingale convergence theorem indicates that the parameter estimates converge to their true values. Finally, an illustrative example is provided to show that the proposed algorithm is effective.

  17. The ABC's of teaching social skills to adolescents with autism spectrum disorder in the classroom: the UCLA PEERS (®) Program.

    Science.gov (United States)

    Laugeson, Elizabeth A; Ellingsen, Ruth; Sanderson, Jennifer; Tucci, Lara; Bates, Shannon

    2014-09-01

    Social skills training is a common treatment method for adolescents with autism spectrum disorder (ASD), yet very few evidence-based interventions exist to improve social skills for high-functioning adolescents on the spectrum, and even fewer studies have examined the effectiveness of teaching social skills in the classroom. This study examines change in social functioning for adolescents with high-functioning ASD following the implementation of a school-based, teacher-facilitated social skills intervention known as Program for the Education and Enrichment of Relational Skills (PEERS (®) ). Seventy-three middle school students with ASD along with their parents and teachers participated in the study. Participants were assigned to the PEERS (®) treatment condition or an alternative social skills curriculum. Instruction was provided daily by classroom teachers and teacher aides for 14-weeks. Results reveal that in comparison to an active treatment control group, participants in the PEERS (®) treatment group significantly improved in social functioning in the areas of teacher-reported social responsiveness, social communication, social motivation, social awareness, and decreased autistic mannerisms, with a trend toward improved social cognition on the Social Responsiveness Scale. Adolescent self-reports indicate significant improvement in social skills knowledge and frequency of hosted and invited get-togethers with friends, and parent-reports suggest a decrease in teen social anxiety on the Social Anxiety Scale at a trend level. This research represents one of the few teacher-facilitated treatment intervention studies demonstrating effectiveness in improving the social skills of adolescents with ASD in the classroom: arguably the most natural social setting of all.

  18. 76 FR 43721 - Notice of Intent To Repatriate Cultural Items: Fowler Museum at UCLA, Los Angeles, CA

    Science.gov (United States)

    2011-07-21

    ... small ceramic bowl, 3 stone gaming pieces, 2 stone plaque fragments, 3 red clay vessels, 16 shell disc... site was a burial ground with numerous Hohokam cremations and other features. This site is dated from A... removed from the ground. The unassociated funerary objects are identified based on their contextual burial...

  19. A Randomized Controlled Trial to Improve Social Skills in Young Adults with Autism Spectrum Disorder: The UCLA PEERS® Program

    Science.gov (United States)

    Laugeson, Elizabeth A.; Gantman, Alexander; Kapp, Steven K.; Orenski, Kaely; Ellingsen, Ruth

    2015-01-01

    Research suggests that impaired social skills are often the most significant challenge for those with autism spectrum disorder (ASD), yet few evidence-based social skills interventions exist for adults on the spectrum. This replication trial tested the effectiveness of PEERS, a caregiver-assisted social skills program for high-functioning young…

  20. 77 FR 11571 - Notice of Intent To Repatriate Cultural Items: Fowler Museum at UCLA, Los Angeles, CA

    Science.gov (United States)

    2012-02-27

    ... Pima-Maricopa Indian Community of the Salt River Reservation, Arizona; and the Tohono O'odham Nation of... Indian Community of the Salt River Reservation, Arizona; Tohono O'odham Nation of Arizona; and the Zuni...

  1. TU-CD-BRD-04: UCLA Experience, with Focus On Developing Metrics and Using RO-ILS

    International Nuclear Information System (INIS)

    Beron, P.

    2015-01-01

    It has long been standard practice in radiation oncology to report internally when a patient’s treatment has not gone as planned and to report events to regulatory agencies when legally required. Most potential errors are caught early and never affect the patient. Quality assurance steps routinely prevent errors from reaching the patient, and these “near misses” are much more frequent than treatment errors. A growing number of radiation oncology facilities have implemented incident learning systems to report and analyze both errors and near misses. Using the term “incident learning” instead of “event reporting” emphasizes the need to use these experiences to change the practice and make future errors less likely and promote an educational, non-punitive environment. There are challenges in making such a system practical and effective. Speakers from institutions of different sizes and practice environments will share their experiences on how to make such a system work and what benefits their clinics have accrued. Questions that will be addressed include: How to create a system that is easy for front line staff to access How to motivate staff to report How to promote the system as positive and educational and not punitive or demeaning How to organize the team for reviewing and responding to reports How to prioritize which reports to discuss in depth How not to dismiss the rest How to identify underlying causes How to design corrective actions and implement change How to develop useful statistics and analysis tools How to coordinate a departmental system with a larger risk management system How to do this without a dedicated quality manager Some speakers’ experience is with in-house systems and some will share experience with the AAPM/ASTRO national Radiation Oncology Incident Learning System (RO-ILS). Reports intended to be of value nationally need to be comprehensible to outsiders; examples of useful reports will be shown. There will be ample time set aside for audience members to contribute to the discussion. Learning Objectives: Learn how to promote the use of an incident learning system in a clinic. Learn how to convert “event reporting” into “incident learning”. See examples of practice changes that have come out of learning systems. Learn how the RO-ILS system can be used as a primary internal learning system. Learn how to create succinct, meaningful reports useful to outside readers. Gary Ezzell chairs the AAPM committee overseeing RO-ILS and has received an honorarium from ASTRO for working on the committee reviewing RO-ILS reports. Derek Brown is a director of http://TreatSafely.org . Brett Miller has previously received travel expenses and an honorarium from Varian. Phillip Beron has nothing to report

  2. MO-E-BRC-02: MRI-Guided Online Adaptive Radiotherapy: The UCLA Approach to Quality Management

    Energy Technology Data Exchange (ETDEWEB)

    Lamb, J. [University of California, Los Angeles (United States)

    2016-06-15

    Online adaptive radiation therapy has the potential to ensure delivery of optimal treatment to the patient by accounting for anatomical and potentially functional changes that occur from one fraction to the next and over the course of treatment. While on-line adaptive RT (ART) has been a topic of many publications, discussions, and research, it has until very recently remained largely a concept and not a practical implementation. However, recent advances in on-table imaging, use of deformable image registration for contour generation and dose tracking, faster and more efficient plan optimization, as well as fast quality assurance method has enabled the implementation of ART in the clinic in the past couple of years. The introduction of these tools into routine clinical use requires many considerations and progressive knowledge to understand how processes that have historically taken hours/days to complete can now be done in less than 30 minutes. This session will discuss considerations to perform real time contouring, planning and patient specific QA, as well as a practical workflow and the required resources. Learning Objectives: To understand the difficulties, challenges and available technologies for online adaptive RT. To understand how to implement online adaptive therapy in a clinical environment and to understand the workflow and resources required. To understand the limitations and sources of uncertainty in the online adaptive process I have research funding from ViewRay Inc. and Philips Medical Systems.; R. Kashani, I have research funding from ViewRay Inc. and Philips Medical Systems.; X. Li, Research supported by Elekta Inc.

  3. MO-E-BRC-02: MRI-Guided Online Adaptive Radiotherapy: The UCLA Approach to Quality Management

    International Nuclear Information System (INIS)

    Lamb, J.

    2016-01-01

    Online adaptive radiation therapy has the potential to ensure delivery of optimal treatment to the patient by accounting for anatomical and potentially functional changes that occur from one fraction to the next and over the course of treatment. While on-line adaptive RT (ART) has been a topic of many publications, discussions, and research, it has until very recently remained largely a concept and not a practical implementation. However, recent advances in on-table imaging, use of deformable image registration for contour generation and dose tracking, faster and more efficient plan optimization, as well as fast quality assurance method has enabled the implementation of ART in the clinic in the past couple of years. The introduction of these tools into routine clinical use requires many considerations and progressive knowledge to understand how processes that have historically taken hours/days to complete can now be done in less than 30 minutes. This session will discuss considerations to perform real time contouring, planning and patient specific QA, as well as a practical workflow and the required resources. Learning Objectives: To understand the difficulties, challenges and available technologies for online adaptive RT. To understand how to implement online adaptive therapy in a clinical environment and to understand the workflow and resources required. To understand the limitations and sources of uncertainty in the online adaptive process I have research funding from ViewRay Inc. and Philips Medical Systems.; R. Kashani, I have research funding from ViewRay Inc. and Philips Medical Systems.; X. Li, Research supported by Elekta Inc.

  4. UCLA, British astronomers discover wake of planet around nearby star. Strong evidence for solar system like ours

    CERN Multimedia

    2002-01-01

    "An international team of astronomers reports the first strong evidence for the existence of massive planets on wide orbits - like those of Saturn, Uranus and Neptune - around many stars. The new research provides some of the strongest evidence so far that solar systems similar to our own, or even larger, are likely to exist: (1 page).

  5. Reliability and validity of the Roberts UCLA Loneliness Scale (RULS-8) with Dutch-speaking adolescents in Belgium

    NARCIS (Netherlands)

    Goossens, Luc; Klimstra, Theo; Luyckx, Koen; Vanhalst, Janne; Teppers, Eveline

    2014-01-01

    The internal consistency and construct validity of the RULS-8, a brief measure of loneliness for use with adolescents, was examined in three samples of Dutch-speaking adolescents in Belgium (for a total of N = 6,236). The measure showed high levels of internal consistency (ranging between .80 and

  6. Initial liquid metal magnetohydrodynamic thin film flow experiments in the MeGA-loop facility at UCLA

    International Nuclear Information System (INIS)

    Morley, N.B.; Gaizer, A.A.; Tillack, M.S.; Abdou, M.A.

    1995-01-01

    Free surface thin film flows of liquid metal were investigated experimentally in the presence of a coplanar magnetic field. This investigation was performed in a new magnetohydrodynamic (MHD) flow facility, the MeGA-loop, utilizing a low melting temperature lead-bismuth alloy as the working metal. Owing to the relatively low magnetic field produced by the present field coil system, the ordinary hydrodynamic and low MHD interaction regimes only were investigated. At the high flow speeds necessary for self cooling, the importance of a well designed and constructed channel becomes obvious. Partial MHD drag, increasing the film height, is observed as Haβ 2 becomes greater than unity. MHD laminarization of the turbulent film flows is observed when Haβ/Re>0.002, but fully laminar flow was not reached. Suggestions for facility upgrades to achieve greater MHD interaction are presented in the context of these initial results. (orig.)

  7. TU-CD-BRD-04: UCLA Experience, with Focus On Developing Metrics and Using RO-ILS

    Energy Technology Data Exchange (ETDEWEB)

    Beron, P. [University of California, Los Angeles (United States)

    2015-06-15

    It has long been standard practice in radiation oncology to report internally when a patient’s treatment has not gone as planned and to report events to regulatory agencies when legally required. Most potential errors are caught early and never affect the patient. Quality assurance steps routinely prevent errors from reaching the patient, and these “near misses” are much more frequent than treatment errors. A growing number of radiation oncology facilities have implemented incident learning systems to report and analyze both errors and near misses. Using the term “incident learning” instead of “event reporting” emphasizes the need to use these experiences to change the practice and make future errors less likely and promote an educational, non-punitive environment. There are challenges in making such a system practical and effective. Speakers from institutions of different sizes and practice environments will share their experiences on how to make such a system work and what benefits their clinics have accrued. Questions that will be addressed include: How to create a system that is easy for front line staff to access How to motivate staff to report How to promote the system as positive and educational and not punitive or demeaning How to organize the team for reviewing and responding to reports How to prioritize which reports to discuss in depth How not to dismiss the rest How to identify underlying causes How to design corrective actions and implement change How to develop useful statistics and analysis tools How to coordinate a departmental system with a larger risk management system How to do this without a dedicated quality manager Some speakers’ experience is with in-house systems and some will share experience with the AAPM/ASTRO national Radiation Oncology Incident Learning System (RO-ILS). Reports intended to be of value nationally need to be comprehensible to outsiders; examples of useful reports will be shown. There will be ample time set aside for audience members to contribute to the discussion. Learning Objectives: Learn how to promote the use of an incident learning system in a clinic. Learn how to convert “event reporting” into “incident learning”. See examples of practice changes that have come out of learning systems. Learn how the RO-ILS system can be used as a primary internal learning system. Learn how to create succinct, meaningful reports useful to outside readers. Gary Ezzell chairs the AAPM committee overseeing RO-ILS and has received an honorarium from ASTRO for working on the committee reviewing RO-ILS reports. Derek Brown is a director of http://TreatSafely.org . Brett Miller has previously received travel expenses and an honorarium from Varian. Phillip Beron has nothing to report.

  8. State of the art

    International Nuclear Information System (INIS)

    Lederman, L.M.

    1983-01-01

    There is a large body of experience in high luminosity data taking in fixed target research. We try to consider a wide variety of high rate experiments which were limited by the detector (not by available beam) to a preset number of collisions per second. We then attempt to translate these state-of-the-art experiments to effective collider experiments. To this end, we extend the chosen detector to a comparison 4π collider detector operating near 1 TeV. There are several issues: (1) effective solid angle must be translated to approx. = 4π, (2) environments may be quite different, e.g., beam dump near fixed target or beam halo muons vs. collider backgrounds, (3) the multiplicity varies over the experiments selected and (4) we have to treat open vs closed geometries. The large variety of experiments selected is designed to average over the causes for detector limitation. Finally we chose detectors which have produced physics in order to gauge the state of the art

  9. Solid state magnetism

    CERN Document Server

    Crangle, John

    1991-01-01

    Solid state magnetism is important and attempts to understand magnetic properties have led to an increasingly deep insight into the fundamental make up of solids. Both experimental and theoretical research into magnetism continue to be very active, yet there is still much ground to cover before there can be a full understanding. There is a strong interplay between the developments of materials science and of magnetism. Hundreds of new materials have been dis­ covered, often with previously unobserved and puzzling magnetic prop­ erties. A large and growing technology exists that is based on the magnetic properties of materials. Very many devices used in everyday life involve magnetism and new applications are being invented all the time. Under­ standing the fundamental background to the applications is vital to using and developing them. The aim of this book is to provide a simple, up-to-date introduction to the study of solid state magnetism, both intrinsic and technical. It is designed to meet the needs a...

  10. Metastable states in magnetic nanorings

    DEFF Research Database (Denmark)

    Castaño, F. J.; Ross, C. A.; Frandsen, Cathrine

    2003-01-01

    Magnetization states and hysteresis behavior of small ferromagnetic rings, of diameters 180-520 nm, have been investigated using magnetic force microscopy. In addition to the expected bi-domain ("onion") and flux-closed ("vortex") magnetization states, a metastable state has been found. This "twi......Magnetization states and hysteresis behavior of small ferromagnetic rings, of diameters 180-520 nm, have been investigated using magnetic force microscopy. In addition to the expected bi-domain ("onion") and flux-closed ("vortex") magnetization states, a metastable state has been found....... This "twisted" state contains a 360degrees domain wall which can exist over a wide range of applied fields. Four possible configurations of the twisted state are possible. Micromagnetic modeling shows that the twisted state is stabilised in small diameter, narrow rings. Additionally, more complex configurations...

  11. Local cloning of CAT states

    International Nuclear Information System (INIS)

    Rahaman, Ramij

    2011-01-01

    In this Letter we analyze the (im)possibility of the exact cloning of orthogonal three-qubit CAT states under local operation and classical communication (LOCC) with the help of a restricted entangled state. We also classify the three-qubit CAT states that can (not) be cloned under LOCC restrictions and extend the results to the n-qubit case. -- Highlights: → We analyze the (im)possibility of exact cloning of orthogonal CAT states under LOCC. → We also classify the set of CAT states that can(not) be cloned by LOCC. → No set of orthogonal CAT states can be cloned by LOCC with help of similar CAT state. → Any two orthogonal n-qubit GHZ-states can be cloned by LOCC with help of a GHZ state.

  12. State of the States: Fuel Cells in America 2015

    Energy Technology Data Exchange (ETDEWEB)

    Sandra Curtin and Jennifer Gangi

    2015-12-17

    This December 2015 report, the sixth in a series, provides a comprehensive analysis of state activities supporting fuel cell and hydrogen technology, profiles of leading states, and a catalog of recent installations, policies, funding, and deployments around the country.

  13. Set discrimination of quantum states

    International Nuclear Information System (INIS)

    Zhang Shengyu; Ying Mingsheng

    2002-01-01

    We introduce a notion of set discrimination, which is an interesting extension of quantum state discrimination. A state is secretly chosen from a number of quantum states, which are partitioned into some disjoint sets. A set discrimination is required to identify which set the given state belongs to. Several essential problems are addressed in this paper, including the condition of perfect set discrimination, unambiguous set discrimination, and in the latter case, the efficiency of the discrimination. This generalizes some important results on quantum state discrimination in the literature. A combination of state and set discrimination and the efficiency are also studied

  14. Parent di-nuclear quasimolecular states as exotic resonant states

    International Nuclear Information System (INIS)

    Grama, N.

    2002-01-01

    It in shown that the parent di-nuclear quasimolecular state is an exotic resonant state that corresponds to a S-matrix pole in the neighbourhood of an attractor in the k-plane. The properties of the parent quasimolecular states i.e. energy, widths, deviation from the linear dependence of the energy on l(l + 1) doorway character and criteria for observability, result naturally from the general properties of the exotic resonant states. (author)

  15. SwingStates: adding state machines to the swing toolkit

    OpenAIRE

    Appert , Caroline; Beaudouin-Lafon , Michel

    2006-01-01

    International audience; This article describes SwingStates, a library that adds state machines to the Java Swing user interface toolkit. Unlike traditional approaches, which use callbacks or listeners to define interaction, state machines provide a powerful control structure and localize all of the interaction code in one place. SwingStates takes advantage of Java's inner classes, providing programmers with a natural syntax and making it easier to follow and debug the resulting code. SwingSta...

  16. Teleportation of Two-Particle Entangled State via Cluster State

    Institute of Scientific and Technical Information of China (English)

    LI Da-Chuang; CAO Zhuo-Liang

    2007-01-01

    In this paper,two schemes for teleporting an unknown two-particle entangled state from the sender (Alice)to the receiver (Bob) via a four-particle entangled cluster state are proposed.In these two schemes,the unknown twoparticle entangled state can be teleported perfectly.The successful probabilities and fidelities of the schemes can reach unity.

  17. steady – state performance of induction and transfer state

    African Journals Online (AJOL)

    eobe

    This paper presents paper presents paper presents the steady the steady the steady–state performance state performance state performance comparison comparison comparison between polyphase induction motor and polyphase between polyphase induction motor and polyphase. TF motor operating in. TF motor ...

  18. State distribution and reliability of some multi- state systems with ...

    African Journals Online (AJOL)

    mn : G series systems and second, the multi-state consecutive kn-out-of-mn : G parallel systems (see denitions 1 and 2).We begin by giving a non recursive formula which calculates the state distribution and the reliability of multi-state ...

  19. FIPRED state of art

    International Nuclear Information System (INIS)

    Ohai, D.; Meleg, T.; Dumitrescu, I.; Benga, D.

    2009-01-01

    Full text: The paper presents the FIPRED (Fission Product Release from Debris Bed) Project state of art (UO 2 sintered pellets oxidation). The FIPRED Project is dedicated to the study of the fission products released from irradiated pellets present in debris bed. The fission product release is produced by oxidative self disintegration of sintered pellets at air ingress and it depends on temperature. The experimental program covered experiments of 300-1400 deg. C in air diluted with nitrogen at different concentrations of oxygen and different steam-air mixture. The experiments were performed using the SETARAM thermo-gravimetric equipment and the FIPRED EQ equipment designed and manufactured especially for this type of experiment. The powders (fragments), resulted from UO 2 pellets self disintegration, were characterized by sieving and SEM. The self disintegration mechanism was demonstrated using the experimental result obtained and thermodynamically data of uranium oxides. (authors)

  20. State, religion and toleration

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2009-01-01

    Contribution to Religion and State - From separation to cooperation? Legal-philosophical reflections for a de-secularized world. (IVR Cracow Special Workshop). Eds. Bart. C. Labuschagne & Ari M. Solon. Abstract: Toleration is indeed a complex phenomenon. A discussion of the concept will have...... to underline not only the broadmindedness and liberty of individuals or of groups, but also the relevant distinctions and arguments in political philosophy, epistemology, philosophy of religion and philosophical anthropology and their connection with educational issues. Through a discussion of these relations......, the essay argues three theses: (1) Toleration is not reducible to an ethics of spiritual freedom. (2) Toleration is not neutral to fanatism. (3) Toleration involves esteem for the person....

  1. Geometry of Quantum States

    International Nuclear Information System (INIS)

    Hook, D W

    2008-01-01

    A geometric framework for quantum mechanics arose during the mid 1970s when authors such as Cantoni explored the notion of generalized transition probabilities, and Kibble promoted the idea that the space of pure quantum states provides a natural quantum mechanical analogue for classical phase space. This central idea can be seen easily since the projection of Schroedinger's equation from a Hilbert space into the space of pure spaces is a set of Hamilton's equations. Over the intervening years considerable work has been carried out by a variety of authors and a mature description of quantum mechanics in geometric terms has emerged with many applications. This current offering would seem ideally placed to review the last thirty years of progress and relate this to the most recent work in quantum entanglement. Bengtsson and Zyczkowski's beautifully illustrated volume, Geometry of Quantum States (referred to as GQS from now on) attempts to cover considerable ground in its 466 pages. Its topics range from colour theory in Chapter 1 to quantum entanglement in Chapter 15-to say that this is a whirlwind tour is, perhaps, no understatement. The use of the work 'introduction' in the subtitle of GQS, might suggest to the reader that this work be viewed as a textbook and I think that this interpretation would be incorrect. The authors have chosen to present a survey of different topics with the specific aim to introduce entanglement in geometric terms-the book is not intended as a pedagogical introduction to the geometric approach to quantum mechanics. Each of the fifteen chapters is a short, and mostly self-contained, essay on a particular aspect or application of geometry in the context of quantum mechanics with entanglement being addressed specifically in the final chapter. The chapters fall into three classifications: those concerned with the mathematical background, those which discuss quantum theory and the foundational aspects of the geometric framework, and

  2. Perfect and imperfect states

    Directory of Open Access Journals (Sweden)

    Nikitović Aleksandar

    2013-01-01

    Full Text Available Early Greek ethics embodied in Cretan and Spartan mores, served as a model for Plato`s political theory. Plato theorized the contents of early Greek ethics, aspiring to justify and revitalize the fundamental principles of a traditional view of the world. However, according to Plato`s new insight, deed is further from the truth than a thought i.e. theory. The dorian model had to renounce its position to the perfect prototype of a righteous state, which is a result of the inner logic of philosophical theorizing in early Greek ethics. Prototype and model of philosophical reflection, in comparison to philosophical theory, becomes minor and deficient. Philosophical theorizing of early Greek ethics philosophically formatted Greek heritage, initiating substantial changes to the content of traditional ethics. Replacement of the myth with ontology, as a new foundation of politics, transformed early Greek ethics in various relevant ways. [Projekat Ministarstva nauke Republike Srbije, br. 179049

  3. Activating Welfare States

    DEFF Research Database (Denmark)

    Kvist, Jon

    for children and the elderly, which in turn allows in particular women to (re-)enter the labour market, de-commodification of labour through easy accessible and relative generous cash benefits providing a more flexible labour market, and re-commodification of labour through conditioning of benefits and active......This paper investigates how welfare states may actively contribute to promote employment opportunities, i.e. participation in the labour market through various operations and policies. The principal operations concern in particular the de-familiarisation of caring tasks through social services...... labour market policies giving long-term unemployed and people with low skills better opportunities to participate in the labour market, whether the ordinary or in special activities....

  4. Solid state detector module

    International Nuclear Information System (INIS)

    Hoffman, D. M.

    1985-01-01

    A solid state detector in which each scintillator is optimally configured and coupled with its associated sensing diode in a way which exploits light piping effects to enhance efficiency, and at the same time provide a detector which is modular in nature. To achieve light piping, the scintillator crystal is oriented such that its sides conform with the crystal cleavage plane, and the sides are highly polished. An array of tungsten collimator plates define the individual channels. Multi-channel scintillator/diode modules are mounted behind and in registry with the plurality of collimator plates. A plurality of scintillators are bonded together after coating the surfaces thereof to minimize optical crosstalk. After lapping the face of the scintillator module, it is then bonded to a diode module with individual scintillators in registration with individual diodes. The module is then positioned in the detector array with collimator plates at the junctions between the scintillators

  5. Steady-state spheromak

    International Nuclear Information System (INIS)

    Jarboe, T.R.

    1982-01-01

    A major effort is being made in the national program to make the operation of axisymmetric, toroidal confinement systems steady state by the application of expensive rf current drive. Described here is a method by which such a confinement system, the spheromak, can be refluxed indefinitely through the application of dc power. As a step towards dc sustainment we have operated the present CTX source in the slow source mode with a longer power application time (approx. 0.1 ms) and successfully generated long-lived spheromaks. If the erosion of the electrodes can be controlled as well as it is with MPD arcs then dc operation should be very clean. If only a small fraction (approx. 10% for an experiment) of the poloidal flux of the spheromak connects to the source then the dc sustainment can be very efficient. The amount of connecting flux that is necessary for sustainment needs to be determined experimentally

  6. Surface states and spectra

    International Nuclear Information System (INIS)

    Jaksic, V.; Last, Y.; California Inst. of Tech., Pasadena, CA

    2001-01-01

    Let Z + d+1 =Z d x Z + , let H 0 be the discrete Laplacian on the Hilbert space l 2 (Z + d+1 ) with a Dirichlet boundary condition, and let V be a potential supported on the boundary ∂Z + d+1 . We introduce the notions of surface states and surface spectrum of the operator H=H 0 +V and explore their properties. Our main result is that if the potential V is random and if the disorder is either large or small enough, then in dimension two H has no surface spectrum on σ(H 0 ) with probability one. To prove this result we combine Aizenman-Molchanov theory with techniques of scattering theory. (orig.)

  7. Holographic Quantum States

    International Nuclear Information System (INIS)

    Osborne, Tobias J.; Eisert, Jens; Verstraete, Frank

    2010-01-01

    We show how continuous matrix product states of quantum fields can be described in terms of the dissipative nonequilibrium dynamics of a lower-dimensional auxiliary boundary field by demonstrating that the spatial correlation functions of the bulk field correspond to the temporal statistics of the boundary field. This equivalence (1) illustrates an intimate connection between the theory of continuous quantum measurement and quantum field theory, (2) gives an explicit construction of the boundary field allowing the extension of real-space renormalization group methods to arbitrary dimensional quantum field theories without the introduction of a lattice parameter, and (3) yields a novel interpretation of recent cavity QED experiments in terms of quantum field theory, and hence paves the way toward observing genuine quantum phase transitions in such zero-dimensional driven quantum systems.

  8. Relativistic bound states

    International Nuclear Information System (INIS)

    Ritchie, Burke

    2006-01-01

    The Hamiltonian for Dirac's second-order equation depends nonlinearly on the potential V and the energy E. For this reason the magnetic contribution to the Hamiltonian for s-waves, which has a short range, is attractive for a repulsive Coulomb potential (V>0) and repulsive for an attractive Coulomb potential (V 2 . Usually solutions are found in the regime E=mc 2 +ε , where except for high Z, ε 2 . Here it is shown that for V>0 the attractive magnetic term and the linear repulsive term combine to support a bound state near E=0.5mc 2 corresponding to a binding energy E b =-ε =0.5mc 2

  9. Multimuon final states

    International Nuclear Information System (INIS)

    Crespo, J.-M.

    1980-04-01

    Multimuon final states have been detected by 3 experiments in the interactions of the muon beams of CERN (280 GeV) and FNAL (210 GeV) with heavy targets. For the first time production of J/PSI (3100) by space-like photons has been observed and its dependence on ν, Q 2 and t compared to Vector Dominance and photon-gluon fusion models. Also a clear signal has been seen for 3μ above QED tridents (outside J/PSI mass range) and 2μ events which are well described by charm production. An upper limit for the production of the T by high energy muons has been set

  10. State Housing Revival

    DEFF Research Database (Denmark)

    Donovan, Elizabeth

    2015-01-01

    Government funded housing for people in need is a challenge many countries face around the world. This research investigates how to sustainably regenerate post-war suburban state housing in New Zealand, in particular, the suburb of Glen Innes in Auckland. Reviving the community and regenerating...... the buildings is essential for improving the overall quality of the neighbourhoods both socially and physically. Achieving this in a holistic sustainable manner illustrates that there are alternatives to demolition and new builds, as the answer to the current housing shortage problems. New Zealand is confronted...... with the dilemma of what to do with existing government-funded housing which are no longer socially or physically suitable for the current demographic. New Zealand has a large cultural diversity with many new immigrants from the Pacific Islands and Asia. There is a need for culturally flexible and inclusive...

  11. The police state myth

    International Nuclear Information System (INIS)

    Spinrad, B.I.

    1985-01-01

    This chapter attempts to refute the assertion made by antinuclear groups that the use of nuclear energy will lead to a suppression of civil liberties in the US. The ''police state'' argument is based on the belief that the management of nuclear materials would necessitate the investigation of the stability and loyalties of their managers, and that in an instance of the theft of nuclear weapons material, police countermeasures might have to include violations of due process with regard to entry and search. It is pointed out that the screening of a person for a responsible position does not violate due process, and the fact that nuclear materials are radioactive and can be easility detected at some distance indicates that close police searches would not be necessary in the case of theft

  12. Beyond States and Markets

    DEFF Research Database (Denmark)

    Stahl, Rune Møller

    The paper will analyse the ideological assumptions at the core of the form of neoclassical macroeconomic theory that emerged to eclipse Keynesianism the 1970s. By revisiting some of the central papers and model such as Kydland & Prescott’s 1977 “Time Inconsistency Model”, Sargent & Wallace’s 1976...... ”Policy - ineffectiveness proposition” and the microfoundations of the Lucas - critique from 1976, the paper offers a reinterpretation of the main tenets of the tradition of New Classical Macroeconomics (NCM). In policy and scholarly debates NCM has primarily been seen as a critique of government...... in economic governance. This r ereading offers new aspects to the understanding of the general relationship between neoclassical economics and neoliberal policy, and cast new light on the understanding of why neoliberal governance have generally not resulted in any substantial rollback of the state...

  13. Weather and emotional state

    Science.gov (United States)

    Spasova, Z.

    2010-09-01

    Introduction Given the proven effects of weather on the human organism, an attempt to examine its effects on a psychic and emotional level has been made. Emotions affect the bio-tonus, working ability and concentration, hence their significance in various domains of economic life, such as health care, education, transportation, tourism, etc. Data and methods The research has been made in Sofia City within a period of 8 months, using 5 psychological methods (Eysenck Personality Questionnaire (EPQ), State-Trait Anxiety Inventory (STAI), Test for Self-assessment of the emotional state (developed by Wessman and Ricks), Test for evaluation of moods and Test "Self-confidence - Activity - Mood" (developed by the specialists from the Military Academy in Saint Petersburg). The Fiodorov-Chubukov's complex-climatic method was used to characterize meteorological conditions because of the purpose to include in the analysis a maximal number of meteorological elements. 16 weather types are defined in dependence of the meteorological elements values according to this method. Abrupt weather changes from one day to another, defined by the same method, were considered as well. Results and discussions The results obtained by t-test show that the different categories of weather lead to changes in the emotional status, which indicates a character either positive or negative for the organism. The abrupt weather changes, according to expectations, have negative effect on human emotions but only when a transition to the cloudy weather or weather type, classified as "unfavourable" has been realized. The relationship between weather and human emotions is rather complicated since it depends on individual characteristics of people. One of these individual psychological characteristics, marked by the dimension "neuroticism", has a strong effect on emotional reactions in different weather conditions. Emotionally stable individuals are more "protected" to the weather influence on their emotions

  14. Realizing Controllable Quantum States

    Science.gov (United States)

    Takayanagi, Hideaki; Nitta, Junsaku

    1. Entanglement in solid states. Orbital entanglement and violation of bell inequalities in mesoscopic conductors / M. Büttiker, P. Samuelsson and E. V. Sukhoruk. Teleportation of electron spins with normal and superconducting dots / O. Sauret, D. Feinberg and T. Martin. Entangled state analysis for one-dimensional quantum spin system: singularity at critical point / A. Kawaguchi and K. Shimizu. Detecting crossed Andreev reflection by cross-current correlations / G. Bignon et al. Current correlations and transmission probabilities for a Y-shaped diffusive conductor / S. K. Yip -- 2. Mesoscopic electronics. Quantum bistability, structural transformation, and spontaneous persistent currents in mesoscopic Aharonov-Bohm loops / I. O. Kulik. Many-body effects on tunneling of electrons in magnetic-field-induced quasi one-dimensional systems in quantum wells / T. Kubo and Y. Tokura. Electron transport in 2DEG narrow channel under gradient magnetic field / M. Hara et al. Transport properties of a quantum wire with a side-coupled quantum dot / M. Yamaguchi et al. Photoconductivity- and magneto-transport studies of single InAs quantum wires / A. Wirthmann et al. Thermoelectric transports in charge-density-wave systems / H. Yoshimoto and S. Kurihara -- 3. Mesoscopic superconductivity. Parity-restricted persistent currents in SNS nanorings / A. D. Zaikin and S. V. Sharov. Large energy dependence of current noise in superconductingh/normal metal junctions / F. Pistolesi and M. Houzet. Generation of photon number states and their superpositions using a superconducting qubit in a microcavity / Yu-Xi Liu, L. F. Wei and F. Nori. Andreev interferometry for pumped currents / F. Taddei, M. Governale and R. Fazio. Suppression of Cooper-pair breaking against high magnetic fields in carbon nanotubes / J. Haruyama et al. Impact of the transport supercurrent on the Josephson effect / S. N. Shevchenko. Josephson current through spin-polarized Luttinger liquid / N. Yokoshi and S. Kurihara

  15. Neural-Network Quantum States, String-Bond States, and Chiral Topological States

    Science.gov (United States)

    Glasser, Ivan; Pancotti, Nicola; August, Moritz; Rodriguez, Ivan D.; Cirac, J. Ignacio

    2018-01-01

    Neural-network quantum states have recently been introduced as an Ansatz for describing the wave function of quantum many-body systems. We show that there are strong connections between neural-network quantum states in the form of restricted Boltzmann machines and some classes of tensor-network states in arbitrary dimensions. In particular, we demonstrate that short-range restricted Boltzmann machines are entangled plaquette states, while fully connected restricted Boltzmann machines are string-bond states with a nonlocal geometry and low bond dimension. These results shed light on the underlying architecture of restricted Boltzmann machines and their efficiency at representing many-body quantum states. String-bond states also provide a generic way of enhancing the power of neural-network quantum states and a natural generalization to systems with larger local Hilbert space. We compare the advantages and drawbacks of these different classes of states and present a method to combine them together. This allows us to benefit from both the entanglement structure of tensor networks and the efficiency of neural-network quantum states into a single Ansatz capable of targeting the wave function of strongly correlated systems. While it remains a challenge to describe states with chiral topological order using traditional tensor networks, we show that, because of their nonlocal geometry, neural-network quantum states and their string-bond-state extension can describe a lattice fractional quantum Hall state exactly. In addition, we provide numerical evidence that neural-network quantum states can approximate a chiral spin liquid with better accuracy than entangled plaquette states and local string-bond states. Our results demonstrate the efficiency of neural networks to describe complex quantum wave functions and pave the way towards the use of string-bond states as a tool in more traditional machine-learning applications.

  16. Korean War Veterans by State

    Data.gov (United States)

    Department of Veterans Affairs — The spreadsheet of Korean War Veterans by State includes the total Korean War Veteran population for each state and broken out by age and gender. It also includes...

  17. The intermediate state in Patd

    African Journals Online (AJOL)

    ) Jesus had assumed. (concerning the 'intermediate state') as existing, anything which does not exist. Three basic things about the intermediate state emerge from the parable: (a) Jesus recognizes that at the moment of death, in ipso articulo.

  18. Probabilistic broadcasting of mixed states

    International Nuclear Information System (INIS)

    Li Lvjun; Li Lvzhou; Wu Lihua; Zou Xiangfu; Qiu Daowen

    2009-01-01

    It is well known that the non-broadcasting theorem proved by Barnum et al is a fundamental principle of quantum communication. As we are aware, optimal broadcasting (OB) is the only method to broadcast noncommuting mixed states approximately. In this paper, motivated by the probabilistic cloning of quantum states proposed by Duan and Guo, we propose a new way for broadcasting noncommuting mixed states-probabilistic broadcasting (PB), and we present a sufficient condition for PB of mixed states. To a certain extent, we generalize the probabilistic cloning theorem from pure states to mixed states, and in particular, we generalize the non-broadcasting theorem, since the case that commuting mixed states can be exactly broadcast can be thought of as a special instance of PB where the success ratio is 1. Moreover, we discuss probabilistic local broadcasting (PLB) of separable bipartite states

  19. State Drug Utilization Data 2003

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  20. State Drug Utilization Data 2011

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  1. State Program Integrity Assessment (SPIA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The State Program Integrity Assessment (SPIA) is the Centers for Medicare and Medicaid Services (CMS) first national data collection on state Medicaid program...

  2. Veteran Religious Affiliation by State

    Data.gov (United States)

    Department of Veterans Affairs — This dataset provide a count of Veteran by their religious affiliation and state of residence. The dataset set covers all 50 states, District of Columbia and other...

  3. Breast Cancer Rates by State

    Science.gov (United States)

    ... Associated Lung Ovarian Prostate Skin Uterine Cancer Home Breast Cancer Rates by State Language: English (US) Español (Spanish) ... from breast cancer each year. Rates of Getting Breast Cancer by State The number of people who get ...

  4. State Drug Utilization Data 2009

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  5. State Drug Utilization Data 2016

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  6. State Online Query System (SOLQ)

    Data.gov (United States)

    Social Security Administration — Designed specifically for State Human Service agencies, SOLQ allows States real-time online access to SSA's SSN verification service and, if permitted, retrieval of...

  7. Timely and Effective Care - State

    Data.gov (United States)

    U.S. Department of Health & Human Services — Timely and Effective Care measures - state data. This data set includes state-level data for measures of heart attack care, heart failure care, pneumonia care,...

  8. State Drug Utilization Data 2017

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  9. State Drug Utilization Data 1996

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  10. State Drug Utilization Data 2008

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  11. State Drug Utilization Data 1992

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  12. State Drug Utilization Data 1995

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  13. State Drug Utilization Data 1998

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  14. State Drug Utilization Data 2014

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  15. State Drug Utilization Data 2005

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  16. State Drug Utilization Data 2002

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  17. State Drug Utilization Data 2004

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  18. State Drug Utilization Data 1993

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  19. State Drug Utilization Data 2006

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  20. State Drug Utilization Data 2012

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  1. State Drug Utilization Data 1999

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  2. State Drug Utilization Data 2015

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  3. State Drug Utilization Data 1997

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  4. State Drug Utilization Data 1991

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  5. State Drug Utilization Data 2001

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  6. State Drug Utilization Data 2007

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  7. State Drug Utilization Data 2013

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  8. State Cancer Profiles Web site

    Data.gov (United States)

    U.S. Department of Health & Human Services — The State Cancer Profiles (SCP) web site provides statistics to help guide and prioritize cancer control activities at the state and local levels. SCP is a...

  9. State Drug Utilization Data 1994

    Data.gov (United States)

    U.S. Department of Health & Human Services — Drug utilization data are reported by states for covered outpatient drugs that are paid for by state Medicaid agencies since the start of the Medicaid Drug Rebate...

  10. State of the States. Fuel Cells in America 2012

    Energy Technology Data Exchange (ETDEWEB)

    Curtin, Sandra [Fuel Cells 2000, Washington, DC (United States); Gangi, Jennifer [Fuel Cells 2000, Washington, DC (United States); Skukowski, Ryan [Fuel Cells 2000, Washington, DC (United States)

    2012-09-01

    This report, written by Fuel Cells 2000 and partially funded by the U.S. Department of Energy's Fuel Cell Technologies Program, continues to build on the April 2010 State of the States report that provided a snapshot of fuel cell and hydrogen activity in the 50 states and District of Columbia. This update report provides more details on the progress and activities that happened since the second report, issued in June 2011. Details reported for each state include new policies and funding, recent and planned fuel cell and hydrogen installations, and recent activity by state industry and universities.

  11. Supercoherent states and physical systems

    International Nuclear Information System (INIS)

    Fatyga, B.W.; Kostelecky, V.A.; Truax, D.R.

    1991-01-01

    A method is developed for obtaining coherent states of a system admitting a supersymmetry. These states are called supercoherent states. The approach presented in this talk is based on an extension to supergroups of the usual group-theoretic approach. The example of the supersymmetric harmonic oscillator is discussed, thereby illustrating some of the attractive features of the method. Supercoherent states of an electron moving in a constant magnetic field are also described. 35 refs

  12. Unbound states in quantum heterostructures

    Directory of Open Access Journals (Sweden)

    Ferreira R

    2006-01-01

    Full Text Available AbstractWe report in this review on the electronic continuum states of semiconductor Quantum Wells and Quantum Dots and highlight the decisive part played by the virtual bound states in the optical properties of these structures. The two particles continuum states of Quantum Dots control the decoherence of the excited electron – hole states. The part played by Auger scattering in Quantum Dots is also discussed.

  13. Influence of Noises on Remote State Preparation Using GHZ State

    International Nuclear Information System (INIS)

    Liang Huaqiu; Liu Jinming

    2008-01-01

    Using a quantum channel consisting of a GHZ state exposed to noisy environment, we investigate how to remotely prepare an entangled state and a qubit state, respectively. By solving the master equation in the Lindblad form, the influence of the various types of noises on the GHZ state is first discussed. Then we use the fidelity to describe how close the remotely prepared state and the initial state are. Our results show that the fidelity is a function of the decoherence rates and the angles of the initial state. It is found that for each of the two RSP schemes, the influence of the noise acting simultaneously in x, y, and z directions on the average fidelity is the strongest while the influence of the noise acting in x or z direction on the average fidelity is relatively weaker

  14. Configurational entropy of glueball states

    Energy Technology Data Exchange (ETDEWEB)

    Bernardini, Alex E., E-mail: alexeb@ufscar.br [Departamento de Física, Universidade Federal de São Carlos, PO Box 676, 13565-905, São Carlos, SP (Brazil); Braga, Nelson R.F., E-mail: braga@if.ufrj.br [Instituto de Física, Universidade Federal do Rio de Janeiro, Caixa Postal 68528, RJ 21941-972 (Brazil); Rocha, Roldão da, E-mail: roldao.rocha@ufabc.edu.br [CMCC, Universidade Federal do ABC, UFABC, 09210-580, Santo André (Brazil)

    2017-02-10

    The configurational entropy of glueball states is calculated using a holographic description. Glueball states are represented by a supergravity dual picture, consisting of a 5-dimensional graviton–dilaton action of a dynamical holographic AdS/QCD model. The configurational entropy is studied as a function of the glueball spin and of the mass, providing information about the stability of the glueball states.

  15. Deceptive Business Practices: State Regulations.

    Science.gov (United States)

    Rohrer, Daniel Morgan

    Although much has been done at the federal level to control deceptive advertising practices, many states have no criminal laws designed to regulate advertising, and several states recently repealed such laws. This paper examines states' efforts to balance the advertiser's freedom of speech with the consumer's need for information about products by…

  16. Bell inequalities for graph states

    International Nuclear Information System (INIS)

    Toth, G.; Hyllus, P.; Briegel, H.J.; Guehne, O.

    2005-01-01

    Full text: In the last years graph states have attracted an increasing interest in the field of quantum information theory. Graph states form a family of multi-qubit states which comprises many popular states such as the GHZ states and the cluster states. They also play an important role in applications. For instance, measurement based quantum computation uses graph states as resources. From a theoretical point of view, it is remarkable that graph states allow for a simple description in terms of stabilizing operators. In this contribution, we investigate the non-local properties of graph states. We derive a family of Bell inequalities which require three measurement settings for each party and are maximally violated by graph states. In turn, any graph state violates at least one of the inequalities. We show that for certain types of graph states the violation of these inequalities increases exponentially with the number of qubits. We also discuss connections to other entanglement properties such as the positively of the partial transpose or the geometric measure of entanglement. (author)

  17. State Energy Program Fact Sheet

    Energy Technology Data Exchange (ETDEWEB)

    None

    2018-02-01

    The U.S. Department of Energy’s State Energy Program (SEP) provides funding and technical assistance to states, territories, and the District of Columbia to enhance energy security, advance state-led energy initiatives, and maximize the benefits of decreasing energy waste.

  18. Penn State DOE GATE Program

    Energy Technology Data Exchange (ETDEWEB)

    Anstrom, Joel

    2012-08-31

    The Graduate Automotive Technology Education (GATE) Program at The Pennsylvania State University (Penn State) was established in October 1998 pursuant to an award from the U.S. Department of Energy (U.S. DOE). The focus area of the Penn State GATE Program is advanced energy storage systems for electric and hybrid vehicles.

  19. Competing States in the t-J Model: Uniform d-Wave State versus Stripe State versus Stripe State

    NARCIS (Netherlands)

    Corboz, P.R.; Rice, T.M.; Troyer, M.

    2014-01-01

    Variational studies of the t-J model on the square lattice based on infinite projected-entangled pair states confirm an extremely close competition between a uniform d-wave superconducting state and different stripe states. The site-centered stripe with an in-phase d-wave order has an equal or only

  20. Multipartite fully nonlocal quantum states

    International Nuclear Information System (INIS)

    Almeida, Mafalda L.; Cavalcanti, Daniel; Scarani, Valerio; Acin, Antonio

    2010-01-01

    We present a general method for characterizing the quantum correlations obtained after local measurements on multipartite systems. Sufficient conditions for a quantum system to be fully nonlocal according to a given partition, as well as being (genuinely) multipartite fully nonlocal, are derived. These conditions allow us to identify all completely connected graph states as multipartite fully nonlocal quantum states. Moreover, we show that this feature can also be observed in mixed states: the tensor product of five copies of the Smolin state, a biseparable and bound entangled state, is multipartite fully nonlocal.

  1. Luminescence and the solid state

    CERN Document Server

    Ropp, Richard C

    2013-01-01

    Since the discovery of the transistor in 1948, the study of the solid state has been burgeoning. Recently, cold fusion and the ceramic superconductor have given cause for excitement. There are two approaches possible to this area of science, namely, that of solid state physics and solid state chemistry, although both overlap extensively. The former is more concerned with electronic states in solids (including electromagnetics) whereas the latter is more concerned with interactions of atoms in solids. The area of solid state physics is well documented, however, there are very few texts which de

  2. Circular states of atomic hydrogen

    International Nuclear Information System (INIS)

    Lutwak, R.; Holley, J.; Chang, P.P.; Paine, S.; Kleppner, D.; Ducas, T.

    1997-01-01

    We describe the creation of circular states of hydrogen by adiabatic transfer of a Rydberg state in crossed electric and magnetic fields, and also by adiabatic passage in a rotating microwave field. The latter method permits rapid switching between the two circular states of a given n manifold. The two methods are demonstrated experimentally, and results are presented of an analysis of the field ionization properties of the circular states. An application for the circular states is illustrated by millimeter-wave resonance in hydrogen of the n=29→n=30 transition. copyright 1997 The American Physical Society

  3. Entanglement entropy of excited states

    International Nuclear Information System (INIS)

    Alba, Vincenzo; Fagotti, Maurizio; Calabrese, Pasquale

    2009-01-01

    We study the entanglement entropy of a block of contiguous spins in excited states of spin chains. We consider the XY model in a transverse field and the XXZ Heisenberg spin chain. For the latter, we developed a numerical application of the algebraic Bethe ansatz. We find two main classes of states with logarithmic and extensive behavior in the dimension of the block, characterized by the properties of excitations of the state. This behavior can be related to the locality properties of the Hamiltonian having a given state as the ground state. We also provide several details of the finite size scaling

  4. Vehicle electrical system state controller

    Science.gov (United States)

    Bissontz, Jay E.

    2017-10-17

    A motor vehicle electrical power distribution system includes a plurality of distribution sub-systems, an electrical power storage sub-system and a plurality of switching devices for selective connection of elements of and loads on the power distribution system to the electrical power storage sub-system. A state transition initiator provides inputs to control system operation of switching devices to change the states of the power distribution system. The state transition initiator has a plurality of positions selection of which can initiate a state transition. The state transition initiator can emulate a four position rotary ignition switch. Fail safe power cutoff switches provide high voltage switching device protection.

  5. Fiscal Liability of State Contractors

    Directory of Open Access Journals (Sweden)

    Santiago Fajardo-Peña

    2017-06-01

    Full Text Available The State contract is one of the most important tools for public management. The formation, execution and liquidation of State contracts are also a potential cause of State patrimonial damages. Perhaps for this reason, many State contractors are prosecuted as if they were public spending managers. The question, however, is not as simple. The fiscal liability process has a qualified recipient: the fiscal manager. In this article, through a conceptual exposition and a case study, we identify the criterion for determining in which cases a State contractor acquires the function of controlling public funds and when he/she can be subjected to a fiscal liability.

  6. 4- states of 16O

    International Nuclear Information System (INIS)

    Barker, F.C.; Smith, R.; Morrison, I.; Amos, K.A.

    1981-01-01

    A three-state isospin-mixing model is fitted to available data on pion scattering and nucleon pickup relevant to the 4 - states of 16 O at 17.79, 18.98 and 19.80 MeV. An excellent fit to all data is obtained, and the state descriptions are shown to be consistent with inelastic proton scattering measurements. The 18.98 MeV state is predominantly 1p-1h T = 1, while the other two states have significant isospin mixing and 3p-3h admixtures

  7. Southern states' routing agency report

    International Nuclear Information System (INIS)

    1989-02-01

    The Southern states' routing agency report is a compendium of 16-southern states' routing programs relative to the transportation of high-level radioactive materials. The report identifies the state-designated routing agencies as defined under 49 Code of Federal Regulations (CFR) Part 171 and provides a reference to the source ad scope of the agencies' rulemaking authority. Additionally, the state agency and contact designated by the state's governor to receive advance notification and shipment routing information under 10 CFR Parts 71 and 73 are also listed

  8. Southern States' Routing Agency Report

    International Nuclear Information System (INIS)

    1990-03-01

    The Southern States' Routing Agency Report is a compendium of 16-southern states' routing program for the transportation of high-level radioactive materials. The report identifies the state-designated routing agencies as defined under 49 Code of Federal Regulations (CFR) Part 171 and provides a reference to the source and scope of the agencies' rulemaking authority. Additionally, the state agency and contact designated by the state's governor to receive advance notification and shipment routing information under 10 CFR Parts 71 and 73 are also listed

  9. Tavria state agrotechnological university

    Directory of Open Access Journals (Sweden)

    N. V. Shcherbakova

    2015-04-01

    Full Text Available It can be argued that life priorities of young people, including student ones, are not yet well established, therefore, have a certain ability to transformation. In turn, the family has a huge influence on the processes of changes in the value system of young people, in addition, the institution of the family has an impact on shaping the personality of almost every representative of the younger generation. It is necessary to consider the role of the state in the preparation of the family Institution to perform educational functions. The essence of this role is to prepare parents for the process of education, in other words, to increase the level of their pedagogical culture. This is because most parents do not have pedagogical education. Therefore there is a contradiction: the older generation is actively engaged in education without having any methods or tools for this process. In fact, some ways to resolve the conflict are the basic content of this article. In the future, the resolution of this contradiction, will transform social relations so that they were based on spiritual norms, which, in turn, will lead to the preservation and further development of Ukrainian culture, and society in general.

  10. A Solid State Pyranometer

    Directory of Open Access Journals (Sweden)

    Dumitrescu Anca Laura

    2015-12-01

    Full Text Available The construction of a solid state device-based pyranometer designated to broadband irradiance measurements is presented in this paper. The device is built on the physical basis that the temperature difference between two bodies of identical shape and external surface area, identically exposed to the incident radiation, but having different absorption and heat transfer coefficients (e.g. one body is painted white and the other is painted black, is proportional to the incident irradiance. This proportionality may be put in evidence if the two bodies consisting of identical arrays of correspondingly painted semiconductor diodes, due to the thermal behaviour of their p-n junction. It is theoretically predicted and experimentally confirmed that the voltage drop across a diode passed through a constant forward current linearly decreases with the temperature of the junction. In other words, a signal proportional to the irradiance of the light source may be obtained via conventional analog electronics. The calibration of the apparatus, as performed by means of a professional device (LP PYRA 03, indicates a good linearity.

  11. A Solid State Pyranometer

    Science.gov (United States)

    Dumitrescu, Anca Laura; Paulescu, Marius; Ercuta, Aurel

    2015-12-01

    The construction of a solid state device-based pyranometer designated to broadband irradiance measurements is presented in this paper. The device is built on the physical basis that the temperature difference between two bodies of identical shape and external surface area, identically exposed to the incident radiation, but having different absorption and heat transfer coefficients (e.g. one body is painted white and the other is painted black), is proportional to the incident irradiance. This proportionality may be put in evidence if the two bodies consisting of identical arrays of correspondingly painted semiconductor diodes, due to the thermal behaviour of their p-n junction. It is theoretically predicted and experimentally confirmed that the voltage drop across a diode passed through a constant forward current linearly decreases with the temperature of the junction. In other words, a signal proportional to the irradiance of the light source may be obtained via conventional analog electronics. The calibration of the apparatus, as performed by means of a professional device (LP PYRA 03), indicates a good linearity.

  12. State of the industry

    International Nuclear Information System (INIS)

    Lilly, P.; Ogden, S.O.; Sell, D.P.; Garges, T.W.

    1991-01-01

    This panel discussion on the state of the US coal industry presented three points of view. The issue is one of perspective, for the coal miner current conditions are not particularly encouraging given the economic climate, environmental issues, and the ambiguity of the proposed National Energy Strategy. To make matters worse, much of the public views the production and utilization of coal as an environmental risk. It is easy to overlook the fact that the US coal industry is poised for tremendous growth and opportunity. Demand for energy and electricity worldwide is projected to increase significantly and coal is expected to play a major role. New technologies such as clean coal combustion and coal gasification will be required to meet growing human and environmental requirements. The coal industry must educate the public on the capabilities of coal, advance new technologies for deployment and commercial development, demonstrate prudent mining and safety records and develop human talent and skills necessary to advance US coal in the 21st century

  13. Portable laboratories for radioactivity measurements

    International Nuclear Information System (INIS)

    Damljanovic, D.; Smelcerovic, M.; Koturovic, A.; Drndarevic, V.; Sobajic, M.

    1989-01-01

    The portable radiometric laboratories LARA-10, LARA-GS, LARA-86 and ALARA-10 designed, developed and produced at the Boris Kidric Institute are described. Earlier models (LARA-1, LARA-1D, LARA-2 and LARA-5) are presented in brief. The basic characteristics of the devices and methods of measurements are given. All the instruments are battery operated and almost all can also use 220V/50Hz supply. They are a very suitable facility for radiological monitoring of soil, water, food, clothes etc., when working in field conditions (author)

  14. Topological orders in rigid states

    International Nuclear Information System (INIS)

    Wen, X.G.

    1990-01-01

    The authors study a new kind of ordering topological order in rigid states (the states with no local gapless excitations). This paper concentrates on characterization of the different topological orders. As an example the authors discuss in detail chiral spin states of 2+1 dimensional spin systems. Chiral spin states are described by the topological Chern-Simons theories in the continuum limit. The authors show that the topological orders can be characterized by a non-Abelian gauge structure over the moduli space which parametrizes a family of the model Hamiltonians supporting topologically ordered ground states. In 2 + 1 dimensions, the non-Abelian gauge structure determines possible fractional statistics of the quasi-particle excitations over the topologically ordered ground states. The dynamics of the low lying global excitations is shown to be independent of random spatial dependent perturbations. The ground state degeneracy and the non-Abelian gauge structures discussed in this paper are very robust, even against those perturbations that break translation symmetry. The authors also discuss the symmetry properties of the degenerate ground states of chiral spin states. The authors find that some degenerate ground states of chiral spin states on torus carry non-trivial quantum numbers of the 90 degrees rotation

  15. 7 CFR 1160.104 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true United States. 1160.104 Section 1160.104 Agriculture... Definitions § 1160.104 United States. United States means the 48 contiguous states in the continental United States and the District of Columbia, except that United States means the 50 states of the United States...

  16. 22 CFR 1508.1005 - State.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true State. 1508.1005 Section 1508.1005 Foreign...) Definitions § 1508.1005 State. (a) State means— (1) Any of the states of the United States; (2) The District... States; or (5) Any agency or instrumentality of a state. (b) For purposes of this part, State does not...

  17. State-to-state and state-to-all-states reactive scattering angular distributions: F+H 2→HF+H

    International Nuclear Information System (INIS)

    Emmons, R.W.; Suck, S.H.

    1983-01-01

    How each state-to-state reactive transition determines nonundulatory ''state-to-all-states'' angular distribution has not yet been investigated. Here we present a complete exposure of state-to-state distorted-wave Born-approximation angular distributions in order to examine how the nonoscillatory and backward-peaked state-to-all-states reactive scattering angular distribution occurs

  18. 31 CFR 19.1005 - State.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false State. 19.1005 Section 19.1005 Money... (NONPROCUREMENT) Definitions § 19.1005 State. (a) State means— (1) Any of the states of the United States; (2) The... States; or (5) Any agency or instrumentality of a state. (b) For purposes of this part, State does not...

  19. Molecular Ωb states

    Science.gov (United States)

    Liang, Wei-Hong; Dias, J. M.; Debastiani, V. R.; Oset, E.

    2018-05-01

    Motivated by the recent finding of five Ωc states by the LHCb collaboration, and the successful reproduction of three of them in a recent approach searching for molecular states of meson-baryon with the quantum numbers of Ωc, we extend these ideas and make predictions for the interaction of meson-baryon in the beauty sector, searching for poles in the scattering matrix that correspond to physical states. We find several Ωb states: two states with masses 6405 MeV and 6465 MeV for JP = 1/2-; two more states with masses 6427 MeV and 6665 MeV for 3/2-; and three states between 6500 and 6820 MeV, degenerate with JP = 1/2-, 3/2-, stemming from the interaction of vector-baryon in the beauty sector.

  20. Probabilistic cloning of equidistant states

    International Nuclear Information System (INIS)

    Jimenez, O.; Roa, Luis; Delgado, A.

    2010-01-01

    We study the probabilistic cloning of equidistant states. These states are such that the inner product between them is a complex constant or its conjugate. Thereby, it is possible to study their cloning in a simple way. In particular, we are interested in the behavior of the cloning probability as a function of the phase of the overlap among the involved states. We show that for certain families of equidistant states Duan and Guo's cloning machine leads to cloning probabilities lower than the optimal unambiguous discrimination probability of equidistant states. We propose an alternative cloning machine whose cloning probability is higher than or equal to the optimal unambiguous discrimination probability for any family of equidistant states. Both machines achieve the same probability for equidistant states whose inner product is a positive real number.