WorldWideScience

Sample records for two-micro-electrode voltage-clamp technique

  1. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Science.gov (United States)

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  2. An equivalent network representation of a clamped bimorph piezoelectric micromachined ultrasonic transducer with circular and annular electrodes using matrix manipulation techniques.

    Science.gov (United States)

    Sammoura, Firas; Smyth, Katherine; Kim, Sang-Gook

    2013-09-01

    An electric circuit model for a clamped circular bimorph piezoelectric micromachined ultrasonic transducer (pMUT) was developed for the first time. The pMUT consisted of two piezoelectric layers sandwiched between three thin electrodes. The top and bottom electrodes were separated into central and annular electrodes by a small gap. While the middle electrode was grounded, the central and annular electrodes were biased with two independent voltage sources. The strain mismatch between the piezoelectric layers caused the plate to vibrate and transmit a pressure wave, whereas the received echo generated electric charges resulting from plate deformation. The clamped pMUT plate was separated into a circular and an annular plate, and the respective electromechanical transformation matrices were derived. The force and velocity vectors were properly selected using Hamilton's principle and the necessary boundary conditions were invoked. The electromechanical transformation matrix for the clamped circular pMUT was deduced using simple matrix manipulation techniques. The pMUT performance under three biasing schemes was elaborated: 1) central electrode only, 2) central and annular electrodes with voltages of the same magnitude and polarity, and 3) central and annular electrodes with voltages of the same magnitude and opposite polarity. The circuit parameters of the pMUT were extracted for each biasing scheme, including the transformer ratio, the clamped electric impedance, and the open-circuit mechanical impedance. Each pMUT scheme was characterized under different acoustic loadings using the theoretically developed model, which was verified with finite element modeling (FEM) simulation. The electrode size was optimized to maximize the electromechanical transformer ratio. As such, the developed model could provide more insight into the design, optimization, and characterization of pMUTs and allow for performance comparison with their cMUT counterparts.

  3. Suppression of Spiral Waves by Voltage Clamp Techniques in a Conductance-Based Cardiac Tissue Model

    International Nuclear Information System (INIS)

    Lian-Chun, Yu; Guo-Yong, Zhang; Yong, Chen; Jun, Ma

    2008-01-01

    A new control method is proposed to control the spatio-temporal dynamics in excitable media, which is described by the Morris–Lecar cells model. It is confirmed that successful suppression of spiral waves can be obtained by spatially clamping the membrane voltage of the excitable cells. The low voltage clamping induces breakup of spiral waves and the fragments are soon absorbed by low voltage obstacles, whereas the high voltage clamping generates travel waves that annihilate spiral waves through collision with them. However, each method has its shortcomings. Furthermore, a two-step method that combines both low and high voltage clamp techniques is then presented as a possible way of out this predicament. (cross-disciplinary physics and related areas of science and technology)

  4. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  5. Voltage Balancing Control of Diode-Clamped Multilevel Inverter

    Directory of Open Access Journals (Sweden)

    ŞCHIOP Adrian

    2013-10-01

    Full Text Available In this paper is developed a control scheme for mono-phase diode clamped inverter to achieve balancing voltages on inverter capacitors. First, it develops a control scheme without taking into account the need to balance voltage on two capacitors. It examines the effects on the output voltage inverter, and then it realizes two control schemes that will balance the voltages. The simulations of control schemes were performed in OrCAD Pspice.

  6. Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

    Science.gov (United States)

    Masetto, S; Weng, T; Valli, P; Correia, M J

    1999-06-23

    Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

  7. Closed-form solution for static pull-in voltage of electrostatically actuated clamped-clamped micro/nano beams under the effect of fringing field and van der Waals force

    Science.gov (United States)

    Bhojawala, V. M.; Vakharia, D. P.

    2017-12-01

    This investigation provides an accurate prediction of static pull-in voltage for clamped-clamped micro/nano beams based on distributed model. The Euler-Bernoulli beam theory is used adapting geometric non-linearity of beam, internal (residual) stress, van der Waals force, distributed electrostatic force and fringing field effects for deriving governing differential equation. The Galerkin discretisation method is used to make reduced-order model of the governing differential equation. A regime plot is presented in the current work for determining the number of modes required in reduced-order model to obtain completely converged pull-in voltage for micro/nano beams. A closed-form relation is developed based on the relationship obtained from curve fitting of pull-in instability plots and subsequent non-linear regression for the proposed relation. The output of regression analysis provides Chi-square (χ 2) tolerance value equals to 1  ×  10-9, adjusted R-square value equals to 0.999 29 and P-value equals to zero, these statistical parameters indicate the convergence of non-linear fit, accuracy of fitted data and significance of the proposed model respectively. The closed-form equation is validated using available data of experimental and numerical results. The relative maximum error of 4.08% in comparison to several available experimental and numerical data proves the reliability of the proposed closed-form equation.

  8. Applying a foil queue micro-electrode in micro-EDM to fabricate a 3D micro-structure

    Science.gov (United States)

    Xu, Bin; Guo, Kang; Wu, Xiao-yu; Lei, Jian-guo; Liang, Xiong; Guo, Deng-ji; Ma, Jiang; Cheng, Rong

    2018-05-01

    Applying a 3D micro-electrode in a micro electrical discharge machining (micro-EDM) can fabricate a 3D micro-structure with an up and down reciprocating method. However, this processing method has some shortcomings, such as a low success rate and a complex process for fabrication of 3D micro-electrodes. By focusing on these shortcomings, this paper proposed a novel 3D micro-EDM process based on the foil queue micro-electrode. Firstly, a 3D micro-electrode was discretized into several foil micro-electrodes and these foil micro-electrodes constituted a foil queue micro-electrode. Then, based on the planned process path, foil micro-electrodes were applied in micro-EDM sequentially and the micro-EDM results of each foil micro-electrode were able to superimpose the 3D micro-structure. However, the step effect will occur on the 3D micro-structure surface, which has an adverse effect on the 3D micro-structure. To tackle this problem, this paper proposes to reduce this adverse effect by rounded corner wear at the end of the foil micro-electrode and studies the impact of machining parameters on rounded corner wear and the step effect on the micro-structure surface. Finally, using a wire cutting voltage of 80 V, a current of 0.5 A and a pulse width modulation ratio of 1:4, the foil queue micro-electrode was fabricated by wire electrical discharge machining. Also, using a pulse width of 100 ns, a pulse interval of 200 ns, a voltage of 100 V and workpiece material of 304# stainless steel, the foil queue micro-electrode was applied in micro-EDM for processing of a 3D micro-structure with hemispherical features, which verified the feasibility of this process.

  9. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  10. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  11. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al

    2017-11-10

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  12. A Microbeam Resonator with Partial Electrodes for Logic and Memory Elements

    KAUST Repository

    Hafiz, Md Abdullah Al; Ilyas, Saad; Ahmed, Sally; Younis, Mohammad I.; Fariborzi, Hossein

    2017-01-01

    We demonstrate logic and memory elements based on an in-plane clamped-clamped microbeam resonator. The micro-resonator is electrostatically actuated through a drive electrode and the motional signal is capacitively sensed at a sense electrode, while the resonance characteristics are modulated by DC voltage pulses provided at two separate partial electrodes, independent of the drive/sense electrodes. For the logic applications, we use two separate electrodes to provide DC voltages defined as the logic inputs. The high (low) motional signal at on-resonance (off-resonance) state is defined as the logic output state “1” (“0”). For the memory operation, two stable vibrational states, high and low, within the hysteretic regime are defined as the memory states, “1” and “0”, respectively. We take advantage of the split electrode configuration to provide positive and negative DC voltage pulses selectively to set/reset the memory states (“1”/“0”) without affecting the driving and sensing terminals. Excluding the energy cost for supporting electronics, these devices consume energy in 10’s of picojoules per logic/memory operations. Furthermore, the devices are fabricated using silicon on insulator (SOI) wafers, have the potential for on-chip integration, and operate at moderate pressure (~1 Torr) and room temperature.

  13. Cell-Detection Technique for Automated Patch Clamping

    Science.gov (United States)

    McDowell, Mark; Gray, Elizabeth

    2008-01-01

    A unique and customizable machinevision and image-data-processing technique has been developed for use in automated identification of cells that are optimal for patch clamping. [Patch clamping (in which patch electrodes are pressed against cell membranes) is an electrophysiological technique widely applied for the study of ion channels, and of membrane proteins that regulate the flow of ions across the membranes. Patch clamping is used in many biological research fields such as neurobiology, pharmacology, and molecular biology.] While there exist several hardware techniques for automated patch clamping of cells, very few of those techniques incorporate machine vision for locating cells that are ideal subjects for patch clamping. In contrast, the present technique is embodied in a machine-vision algorithm that, in practical application, enables the user to identify good and bad cells for patch clamping in an image captured by a charge-coupled-device (CCD) camera attached to a microscope, within a processing time of one second. Hence, the present technique can save time, thereby increasing efficiency and reducing cost. The present technique involves the utilization of cell-feature metrics to accurately make decisions on the degree to which individual cells are "good" or "bad" candidates for patch clamping. These metrics include position coordinates (x,y) in the image plane, major-axis length, minor-axis length, area, elongation, roundness, smoothness, angle of orientation, and degree of inclusion in the field of view. The present technique does not require any special hardware beyond commercially available, off-the-shelf patch-clamping hardware: A standard patchclamping microscope system with an attached CCD camera, a personal computer with an imagedata- processing board, and some experience in utilizing imagedata- processing software are all that are needed. A cell image is first captured by the microscope CCD camera and image-data-processing board, then the image

  14. Balance control strategy of two-amplitude actively clamped resonant DC-Link inverter clamping voltage%双幅有源箝位谐振直流环节逆变器箝位电压平衡控制策略

    Institute of Scientific and Technical Information of China (English)

    陈沁野; 张德华; 侯尧杰

    2012-01-01

    Aiming at the big loss of the traditional clamping voltage balance control strategies, in two-amplitude actively clamped resonant DC-LINK inverter, the work process of DC link was analyzed. In order to keep the clamp capacitor voltage balance the value set in DC-link work, no short-circuit control was proposed.The DC-link of inverter was calculated by Mathcad. The loss of two modes of short-circuit control and no short-circuit control were compared.Under the no short-circuit control and voltage ripple is not be greater than twenty percent, the parameters of the clamp capacitor were calculated. The results indicate that, the micro-power ACRDCLI clamping voltage balance use no short-circuit control,that can reduce the loss of the DC link and can use thin-film capacitor as a clamp capacitor to achieve the micro-power ACRDCLI low loss and iong life requirements.%针对微型功率双幅有源箝位谐振直流环节逆变器在正常工作过程中,传统箝位电压平衡母线短路控制策略带来损耗大的问题,开展了直流环节工作过程的分析,针对直流环节正常工作的情况下,箝位电容电压必须能平衡在设定值,提出了箝位电压平衡母线无短路控制策略,根据给出的损耗估算方法,通过Mathcad计算,对比了母线短路控制和无短路控制两种方式下的损耗,同时计算出了母线无短路控制箝位电容电压纹波不大于20%下的箝位电容参数.研究结果表明:微型功率ACRDCLI箝位电压平衡采用母线无短线控制,不但可以减少双幅有源箝位谐振直流环节逆变器的损耗,并且可以使用薄膜电容作为箝位电容,以达到微型功率ACRDCLI损耗低、寿命长的要求.

  15. Voltage clamp methods for the study of membrane currents and SR Ca2+ release in adult skeletal muscle fibres

    Science.gov (United States)

    Hernández-Ochoa, Erick O.; Schneider, Martin F.

    2012-01-01

    Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655

  16. Quantitative analysis of dual whole-cell voltage-clamp determination of gap junctional conductance

    NARCIS (Netherlands)

    van Rijen, H. V.; Wilders, R.; van Ginneken, A. C.; Jongsma, H. J.

    1998-01-01

    The dual whole-cell voltage-clamp technique is used widely for determination of kinetics and conductance of gap junctions. The use of this technique may, however, occasion to considerable errors. We have analysed the errors in steady state junctional conductance measurements under different

  17. Investigating ion channel conformational changes using voltage clamp fluorometry.

    Science.gov (United States)

    Talwar, Sahil; Lynch, Joseph W

    2015-11-01

    Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers

    International Nuclear Information System (INIS)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-01-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class

  19. An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers.

    Science.gov (United States)

    Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

    2013-07-01

    Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.

  20. DC dynamic pull-in predictions for a generalized clamped–clamped micro-beam based on a continuous model and bifurcation analysis

    International Nuclear Information System (INIS)

    Chao, Paul C-P; Chiu, C W; Liu, Tsu-Hsien

    2008-01-01

    This study is devoted to providing precise predictions of the dc dynamic pull-in voltages of a clamped–clamped micro-beam based on a continuous model. A pull-in phenomenon occurs when the electrostatic force on the micro-beam exceeds the elastic restoring force exerted by beam deformation, leading to contact between the actuated beam and bottom electrode. DC dynamic pull-in means that an instantaneous application of the voltage (a step function such as voltage) is applied. To derive the pull-in voltage, a dynamic model in partial differential equations is established based on the equilibrium among beam flexibility, inertia, residual stress, squeeze film, distributed electrostatic forces and its electrical field fringing effects. The method of Galerkin decomposition is then employed to convert the established system equations into reduced discrete modal equations. Considering lower-order modes and approximating the beam deflection by a different order series, bifurcation based on phase portraits is conducted to derive static and dynamic pull-in voltages. It is found that the static pull-in phenomenon follows dynamic instabilities, and the dc dynamic pull-in voltage is around 91–92% of the static counterpart. However, the derived dynamic pull-in voltage is found to be dependent on the varied beam parameters, different from a fixed predicted value derived in past works, where only lumped models are assumed. Furthermore, accurate closed-form predictions are provided for non-narrow beams. The predictions are finally validated by finite element analysis and available experimental data

  1. Accurate measurement of junctional conductance between electrically coupled cells with dual whole-cell voltage-clamp under conditions of high series resistance.

    Science.gov (United States)

    Hartveit, Espen; Veruki, Margaret Lin

    2010-03-15

    Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.

  2. Technique eliminates high voltage arcing at electrode-insulator contact area

    Science.gov (United States)

    Mealy, G.

    1967-01-01

    Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.

  3. Common voltage eliminating of SVM diode clamping three-level inverter connected to grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    A novel method of common voltage eliminating is put forward for SVM diode clamping three-level inverter connected to grid by calculation of common voltage of its various switching states. PLECS is used to model this three-level inverter connected to grid and good results are obtained. First...... analysis of common mode voltage for switching states of diode clamping 3-level inverter is given in detail. Second the common mode voltage eliminating control strategy of SVM is described for diode clamping three-level inverter. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping...... three-level inverter is presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS is a very powerful tool to real power circuits modeling. They have also verified that proposed common mode voltage eliminating control strategy of SVM is feasible...

  4. Effects of trimethoprim-sulfadiazine and detomidine on the function of equine Kv 11.1 channels in a two-electrode voltage-clamp (TEVC) oocyte model.

    Science.gov (United States)

    Trachsel, D S; Tejada, M A; Groesfjeld Christensen, V; Pedersen, P J; Kanters, J K; Buhl, R; Calloe, K; Klaerke, D A

    2018-03-22

    The long QT syndrome (LQTS) is a channelopathy that can lead to severe arrhythmia and sudden cardiac death. Pharmacologically induced LQTS is caused by interaction between drugs and potassium channels, especially the K v 11.1 channel. Due to such interactions, numerous drugs have been withdrawn from the market or are administered with precautions in human medicine. However, some compounds, such as trimethoprim-sulfonamide combinations are still widely used in veterinarian medicine. Therefore, we investigate the effect of trimethoprim-sulfadiazine (TMS), trimethoprim, sulfadiazine, and detomidine on equine-specific K v 11.1 channels. K v 11.1 channels cloned from equine hearts were heterologously expressed in Xenopus laevis oocytes, and whole cell currents were measured by two-electrode voltage-clamp before and after drug application. TMS blocked equine K v 11.1 current with an IC 50 of 3.74 mm (95% CI: 2.95-4.73 mm) and affected the kinetics of activation and inactivation. Similar was found for trimethoprim but not for sulfadiazine, suggesting the effect is due to trimethoprim. Detomidine did not affect equine K v 11.1 current. Thus, equine K v 11.1 channels are also susceptible to pharmacological block, indicating that some drugs may have the potential to affect repolarization in horse. However, in vivo studies are needed to assess the potential risk of these drugs to induce equine LQTS. © 2018 The Authors. Journal of Veterinary Pharmacology and Therapeutics Published by John Wiley & Sons Ltd.

  5. Finite element analysis on factors influencing the clamping force in an electrostatic chuck

    International Nuclear Information System (INIS)

    Wang Xingkuo; Yang Yiyong; Cheng Jia; Wang Kesheng; Sun Yuchun; Cao Minglu; Ji Linhong

    2014-01-01

    As one of the core components of IC manufacturing equipment, the electrostatic chuck (ESC) has been widely applied in semiconductor processing such as etching, PVD and CVD. The clamping force of the ESC is one of the most important technical indicators. A multi-physics simulation software COMSOL is used to analyze the factors influencing the clamping force. The curves between the clamping force and the main parameters such as DC voltage, electrode thickness, electrode radius, dielectric thickness and helium gap are obtained. Moreover, the effects of these factors on the clamping force are investigated by means of orthogonal experiments. The results show that the factors can be ranked in order of voltage, electrode radius, helium gap and dielectric thickness according to their importance, which may offer certain reference for the design of ESCs. (semiconductor devices)

  6. Gain-clamping techniques in two-stage double-pass L-band EDFA

    Indian Academy of Sciences (India)

    Two designs of long-wavelength band erbium-doped fiber amplifier (L-band. EDFA) for gain clamping in double-pass systems are demonstrated and compared. The first design is based on ring laser technique where a backward amplified spontaneous emis- sion (ASE) from the second stage is routed into the feedback loop ...

  7. Isolated PWM DC-AC SICAM with an active capacitive voltage clamp[Pulse Density Modulated; Pulse Width Modulation

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2004-03-15

    In this report an isolated PWM DC-AC SICAM with an active capacitive voltage clamp is presented. AC-DC power supply is implemented in its simplest form: diode rectifier followed by a medium-size charge-storage capacitors and possibly with an EMC filter on the mains entrance. Isolation from the AC mains is achieved using a high frequency (HF) transformer, whose voltages are not audio-modulated. The latter simplifies the design and is expected to have many advantages over the approach where the transformer voltages are modulated in regards to the audio signal reference. Input stage is built as a DC-AC inverter (push-pull, half-bridge or a full-bridge) and operated with 50% duty cycle, with all the challenges to avoid transformer saturation and obtain symmetrical operation. On the secondary side the output section is implemented as rectifier+inverter AC-AC stage, i.e. a true bidirectional bridge, which operation is aimed towards amplification of the audio signal. In order to solve the problem with the commutation of the load current, a dead time between the incoming and outgoing bidirectional switch is implemented, while a capacitive voltage clamp is used to keep the induced overvoltage to reasonable levels. The energy stored in the clamping capacitor is not wasted as in the dissipative clamps, but is rather transferred back to the primary side for further processing using an auxiliary isolated single-switch converter, i.e. an active clamping technique is used. (au)

  8. Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2010-01-01

    Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.

  9. Graphene-Based Linear Tandem Micro-Supercapacitors with Metal-Free Current Collectors and High-Voltage Output.

    Science.gov (United States)

    Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe

    2017-11-01

    Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

    Science.gov (United States)

    Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

    2014-03-17

    Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

  11. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.

    2014-08-17

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  12. Investigation of the Dynamics of a Clamped-Clamped Microbeam Near the Third Mode Using a Partial Electrode

    KAUST Repository

    Masri, Karim M.; Younis, Mohammad I.

    2014-01-01

    We present an investigation of the dynamics of a clamped-clamped microbeam excited electrostatically near its third mode. To maximize the response at the third mode, a partial electrode configuration is utilized. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. A shooting method to find the periodic motion is utilized to generate frequency response curves. The curves show hardenining behavior and dynamic pull-in. We show that the dynamic amplitude of the partial configuration is higher than that of a full electrode configuration. These results are promising for the use of higher-order modes for mass detection and for ultra sensitive resonant sensors.

  13. High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

    Science.gov (United States)

    Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

    2017-09-01

    The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

  14. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  15. A self-strain feedback tuning-fork-shaped ionic polymer metal composite clamping actuator with soft matter elasticity-detecting capability for biomedical applications.

    Science.gov (United States)

    Feng, Guo-Hua; Huang, Wei-Lun

    2014-12-01

    This paper presents a smart tuning-fork-shaped ionic polymer metal composite (IPMC) clamping actuator for biomedical applications. The two fingers of the actuator, which perform the clamping motion, can be electrically controlled through a unique electrode design on the IPMC material. The generated displacement or strain of the fingers can be sensed using an integrated soft strain-gage sensor. The IPMC actuator and associated soft strain gage were fabricated using a micromachining technique. A 13.5×4×2 mm(3) actuator was shaped from Nafion solution and a selectively grown metal electrode formed the active region. The strain gage consisted of patterned copper foil and polyethylene as a substrate. The relationship between the strain gage voltage output and the displacement at the front end of the actuator's fingers was characterized. The equivalent Young's modulus, 13.65 MPa, of the soft-strain-gage-integrated IPMC finger was analyzed. The produced clamping force exhibited a linear increasing rate of 1.07 mN/s, based on a dc driving voltage of 7 V. Using the developed actuator to clamp soft matter and simultaneously acquire its Young's modulus was achieved. This demonstrated the feasibility of the palpation function and the potential use of the actuator in minimally invasive surgery. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. High Performance ZVT with Bus Clamping Modulation Technique for Single Phase Full Bridge Inverters

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Yinglai; Ayyanar, Raja

    2016-03-20

    This paper proposes a topology based on bus clamping modulation and zero-voltage-transition (ZVT) technique to realize zero-voltage-switching (ZVS) for all the main switches of the full bridge inverters, and inherent ZVS and/or ZCS for the auxiliary switches. The advantages of the strategy include significant reduction in the turn-on loss of the ZVT auxiliary switches which typically account for a major part of the total loss in other ZVT circuits, and reduction in the voltage ratings of auxiliary switches. The modulation scheme and the commutation stages are analyzed in detail. Finally, a 1kW, 500 kHz switching frequency inverter of the proposed topology using SiC MOSFETs has been built to validate the theoretical analysis. The ZVT with bus clamping modulation technique of fixed timing and adaptive timing schemes are implemented in DSP TMS320F28335 resulting in full ZVS for the main switches in the full bridge inverter. The proposed scheme can save up to 33 % of the switching loss compared with no ZVT case.

  17. Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle

    Science.gov (United States)

    Morad, M.; Reeck, S.; Rao, M.

    1981-01-01

    In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.

  18. Voltammetry at micro-mesh electrodes

    Directory of Open Access Journals (Sweden)

    Wadhawan Jay D.

    2003-01-01

    Full Text Available The voltammetry at three micro-mesh electrodes is explored. It is found that at sufficiently short experimental durations, the micro-mesh working electrode first behaves as an ensemble of microband electrodes, then follows the behaviour anticipated for an array of diffusion-independent micro-ring electrodes of the same perimeter as individual grid-squares within the mesh. During prolonged electrolysis, the micro-mesh electrode follows that behaviour anticipated theoretically for a cubically-packed partially-blocked electrode. Application of the micro-mesh electrode for the electrochemical determination of carbon dioxide in DMSO electrolyte solutions is further illustrated.

  19. On the Nonlinear Dynamics of a Tunable Shock Micro-switch

    Science.gov (United States)

    Azizi, Saber; Javaheri, Hamid; Ghanati, Parisa

    2016-12-01

    A tunable shock micro-switch based on piezoelectric excitation is proposed in this study. This model includes a clamped-clamped micro-beam sandwiched with two piezoelectric layers throughout the entire length. Actuation of the piezoelectric layers via a DC voltage leads to an initial axial force in the micro-beam and directly affects on its overall bending stiffness; accordingly enables two-side tuning of both the trigger time and threshold shock. The governing motion equation, in the presence of an electrostatic actuation and a shock wave, is derived using Hamilton's principle. We employ the finite element method based on the Galerkin technique to obtain the temporal and phase responses subjected to three different shock waves including half sine, triangular and rectangular forms. Subsequently, we investigate the effect of the piezoelectric excitations on the threshold shock amplitude and trigger time.

  20. Evaluation of Niobium as Candidate Electrode Material for DC High Voltage Photoelectron Guns

    Science.gov (United States)

    BastaniNejad, M.; Mohamed, Abdullah; Elmustafa, A. A.; Adderley, P.; Clark, J.; Covert, S.; Hansknecht, J.; Hernandez-Garcia, C.; Poelker, M.; Mammei, R.; hide

    2012-01-01

    The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirror-like finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain) that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium) could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (< 10 pA) at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18:7 MV/m.

  1. A High-Voltage Integrated Circuit Engine for a Dielectrophoresis-based Programmable Micro-Fluidic Processor

    Science.gov (United States)

    Current, K. Wayne; Yuk, Kelvin; McConaghy, Charles; Gascoyne, Peter R. C.; Schwartz, Jon A.; Vykoukal, Jody V.; Andrews, Craig

    2010-01-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport droplets on programmable paths across its coated surface. This chip is the engine for a dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip system. This chip creates DEP forces that move and help inject droplets. Electrode excitation voltage and frequency are variable. With the electrodes driven with a 100V peak-to-peak periodic waveform, the maximum high-voltage electrode waveform frequency is about 200Hz. Data communication rate is variable up to 250kHz. This demonstration chip has a 32×32 array of nominally 100V electrode drivers. It is fabricated in a 130V SOI CMOS fabrication technology, dissipates a maximum of 1.87W, and is about 10.4 mm × 8.2 mm. PMID:23989241

  2. Capacitance and voltage matching between MnO2 nanoflake cathode and Fe2O3 nanoparticle anode for high-performance asymmetric micro-supercapacitors

    Institute of Scientific and Technical Information of China (English)

    Zehua Liu; Xiaocong Tian; Xu Xu; Liang He; Mengyu Yan; Chunhua Han; Yan Li; Wei Yang; Liqiang Mai

    2017-01-01

    Planar micro-supercapacitors show great potential as the energy storage unit in miniaturized electronic devices.Asymmetric structures have been widely investigated in micro-supercapacitors,and carbon-based materials are commonly applied in the electrodes.To integrate different metal oxides in both electrodes in micro-supercapacitors,the critical challenge is the pairing of different faradic metal oxides.Herein,we propose a strategy of matching the voltage and capacitance of two faradic materials that are fully integrated into one high-performance asymmetric micro-supercapadtor by a fadle and controllable fabrication process.The fabricated micro-supercapacitors employ MnO2 as the positive active material and Fe2O3 as the negative active material,respectively.The planar asymmetric micro-supercapacitors possess a high capacitance of 60 F·cm-3,a high energy density of 12 mW·h·cm-3,and a broad operation voltage range up to 1.2 V.

  3. Simple hardware implementation of voltage balancing in capacitor-clamped inverter

    Czech Academy of Sciences Publication Activity Database

    Kokeš, Petr; Semerád, Radko

    2009-01-01

    Roč. 54, č. 4 (2009), s. 325-341 ISSN 0001-7043 R&D Projects: GA MPO FT-TA4/077 Institutional research plan: CEZ:AV0Z20570509 Keywords : capacitor -clamped multilevel inverter * flying capacitor voltage balancing * pulse width modulation (PWM) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  4. Evaluation of niobium as candidate electrode material for dc high voltage photoelectron guns

    Directory of Open Access Journals (Sweden)

    M. BastaniNejad

    2012-08-01

    Full Text Available The field emission characteristics of niobium electrodes were compared to those of stainless steel electrodes using a DC high voltage field emission test apparatus. A total of eight electrodes were evaluated: two 304 stainless steel electrodes polished to mirrorlike finish with diamond grit and six niobium electrodes (two single-crystal, two large-grain, and two fine-grain that were chemically polished using a buffered-chemical acid solution. Upon the first application of high voltage, the best large-grain and single-crystal niobium electrodes performed better than the best stainless steel electrodes, exhibiting less field emission at comparable voltage and field strength. In all cases, field emission from electrodes (stainless steel and/or niobium could be significantly reduced and sometimes completely eliminated, by introducing krypton gas into the vacuum chamber while the electrode was biased at high voltage. Of all the electrodes tested, a large-grain niobium electrode performed the best, exhibiting no measurable field emission (<10  pA at 225 kV with 20 mm cathode/anode gap, corresponding to a field strength of 18.7  MV/m.

  5. Fabrication of high aspect ratio micro electrode by using EDM

    International Nuclear Information System (INIS)

    Elsiti, Nagwa Mejid; Noordin, M.Y.; Alkali, Adam Umar

    2016-01-01

    The electrical discharge machining (EDM) process inherits characteristics that make it a promising micro-machining technique. Micro electrical discharge machining (micro- EDM) is a derived form of EDM, which is commonly used to manufacture micro and miniature parts and components by using the conventional electrical discharge machining fundamentals. Moving block electro discharge grinding (Moving BEDG) is one of the processes that can be used to fabricate micro-electrode. In this study, a conventional die sinker EDM machine was used to fabricate the micro-electrode. Modifications are made to the moving BEDG, which include changing the direction of movements and control gap in one electrode. Consequently current was controlled due to the use of roughing, semi-finishing and finishing parameters. Finally, a high aspect ratio micro-electrode with a diameter of 110.49μm and length of 6000μm was fabricated. (paper)

  6. Micro-EDM process modeling and machining approaches for minimum tool electrode wear for fabrication of biocompatible micro-components

    DEFF Research Database (Denmark)

    Puthumana, Govindan

    2017-01-01

    Micro-electrical discharge machining (micro-EDM) is a potential non-contact method for fabrication of biocompatible micro devices. This paper presents an attempt to model the tool electrode wear in micro-EDM process using multiple linear regression analysis (MLRA) and artificial neural networks...... linear regression model was developed for prediction of TWR in ten steps at a significance level of 90%. The optimum architecture of the ANN was obtained with 7 hidden layers at an R-sq value of 0.98. The predicted values of TWR using ANN matched well with the practically measured and calculated values...... (ANN). The governing micro-EDM factors chosen for this investigation were: voltage (V), current (I), pulse on time (Ton) and pulse frequency (f). The proposed predictive models generate a functional correlation between the tool electrode wear rate (TWR) and the governing micro-EDM factors. A multiple...

  7. A Platform for Manufacturable Stretchable Micro-electrode Arrays

    NARCIS (Netherlands)

    Khoshfetrat Pakazad, S.; Savov, A.; Braam, S.R.; Dekker, R.

    2012-01-01

    A platform for the batch fabrication of pneumatically actuated Stretchable Micro-Electrode Arrays (SMEAs) by using state-of-the-art micro-fabrication techniques and materials is demonstrated. The proposed fabrication process avoids the problems normally associated with processing of thin film

  8. The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies

    Science.gov (United States)

    Ye, Qing; Heck, Gerard L.; Desimone, John A.

    1991-11-01

    Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.

  9. Cell voltage versus electrode potential range in aqueous supercapacitors

    Science.gov (United States)

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

  10. Five-Level Active-Neutral-Point-Clamped DC/DC Converter for Medium-Voltage DC Grids

    DEFF Research Database (Denmark)

    Liu, Dong; Deng, Fujin; Chen, Zhe

    2017-01-01

    This paper proposes a five-level active-neutralpoint- clamped (5L-ANPC) dc/dc converter for applications in medium voltage dc (MVDC) grids. A modulation strategy is proposed for the 5L-ANPC dc/dc converter to generate multilevel voltage waveforms, which can effectively reduce voltage change rate dv...... effectively eliminate high voltage leaps caused by the dead time effect. In addition, a capacitor voltage control strategy is proposed for the 5L-ANPC dc/dc converter to ensure the balanced flying capacitor voltage and desired five-level voltage waveforms. Finally, simulation and experimental studies...

  11. Integration of Polymer Micro-Electrodes for Bio-Sensing

    DEFF Research Database (Denmark)

    Argyraki, Aikaterini; Larsen, Simon Tylsgaard; Tanzi, Simone

    We present the fabrication of PEDOT and pyrolyzed micro-electrodes for the detection of neurotransmitter exocytosis from single cells. The patterns of the electrodes are defined with photolithography. The micro-electro-fluidic-chips were fabricated by bonding two injection molded TOPAS parts. Pol...

  12. Correlation of open cell-attached and excised patch clamp techniques.

    Science.gov (United States)

    Filipovic, D; Hayslett, J P

    1995-11-01

    The excised patch clamp configuration provides a unique technique for some types of single channel analyses, but maintenance of stable, long-lasting preparations may be confounded by rundown and/or rapid loss of seal. Studies were performed on the amiloride-sensitive Na+ channel, located on the apical surface of A6 cells, to determine whether the nystatin-induced open cell-attached patch could serve as an alternative configuration. Compared to excised inside-out patches, stable preparations were achieved more readily with the open cell-attached patch (9% vs. 56% of attempts). In both preparations, the current voltage (I-V) relation was linear, current amplitudes were equal at opposite equivalent clamped voltages, and Erev was zero in symmetrical Na+ solutions, indicating similar Na+ activities on the cytosolic and external surfaces of the patch. Moreover, there was no evidence that nystatin altered channel activity in the patch because slope conductance (3-4pS) and Erev (75 mV), when the bath was perfused with a high K:low Na solution (ENa = 80 mV), were nearly equal in both patch configurations. Our results therefore indicate that the nystatin-induced open cell-attached patch can serve as an alternative approach to the excised inside-out patch when experiments require modulation of univalent ions in the cytosol.

  13. Electrical crosstalk in two-port piezoelectric resonators and compensation solutions

    International Nuclear Information System (INIS)

    Qiu, H C; Schwarz, P; Völlm, H; Feili, D; Seidel, H; Wu, X Z

    2013-01-01

    Crosstalk is an impediment to electrically interfaced two-port resonators. The overall output function of two-port piezoelectric resonator is a superposition of the mechanical resonance behavior and electrical crosstalk, the latter coming mainly from the coupling feedthrough capacitance. In this paper, two crosstalk compensation solutions have been developed for an aluminum nitride-based doubly clamped beam resonator. The first solution demonstrates an on-chip self-cancellation technique of the feedthrough capacitance by using a compensation electrode and applying a complementary voltage to it, while the second solution applies an adjustable compensation voltage to the common bottom electrode. A specifically designed compensation-readout circuit is presented. Experimental investigations of the output signal have proved the efficiency of both crosstalk compensation solutions. (paper)

  14. Comparison between symmetrical and asymmetrical single phase multilevel inverter with diode-clamped topology

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Nami, A.; Zare, F.

    2008-01-01

    In this paper, a different configuration based on different DC bus voltage for a diode-clamped multilevel inverter has been presented. Two different symmetrical and asymmetrical arrangements of a four-level diode clamped inverters have been compared, in order to find an optimum arrangement...... compared with the conventional four-level inverter and this will lead to the reduction of harmonic content of output voltage. A predictive current control technique has been carried out to verify the viability of new configuration. The advantages of this control method are simplicity and applicability...

  15. Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

    Science.gov (United States)

    Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2004-03-22

    DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

  16. Analytical study of the frequency shifts of micro and nano clamped–clamped beam resonators due to an added mass

    KAUST Repository

    Bouchaala, Adam M.

    2016-03-18

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped–clamped micro and nano (Carbon nanotube) beams due to an added mass. Based on the Euler–Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes. © 2016 Springer Science+Business Media Dordrecht

  17. Novel high-voltage power lateral MOSFET with adaptive buried electrodes

    International Nuclear Information System (INIS)

    Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

    2012-01-01

    A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  18. Force-controlled patch clamp of beating cardiac cells.

    Science.gov (United States)

    Ossola, Dario; Amarouch, Mohamed-Yassine; Behr, Pascal; Vörös, János; Abriel, Hugues; Zambelli, Tomaso

    2015-03-11

    From its invention in the 1970s, the patch clamp technique is the gold standard in electrophysiology research and drug screening because it is the only tool enabling accurate investigation of voltage-gated ion channels, which are responsible for action potentials. Because of its key role in drug screening, innovation efforts are being made to reduce its complexity toward more automated systems. While some of these new approaches are being adopted in pharmaceutical companies, conventional patch-clamp remains unmatched in fundamental research due to its versatility. Here, we merged the patch clamp and atomic force microscope (AFM) techniques, thus equipping the patch-clamp with the sensitive AFM force control. This was possible using the FluidFM, a force-controlled nanopipette based on microchanneled AFM cantilevers. First, the compatibility of the system with patch-clamp electronics and its ability to record the activity of voltage-gated ion channels in whole-cell configuration was demonstrated with sodium (NaV1.5) channels. Second, we showed the feasibility of simultaneous recording of membrane current and force development during contraction of isolated cardiomyocytes. Force feedback allowed for a gentle and stable contact between AFM tip and cell membrane enabling serial patch clamping and injection without apparent cell damage.

  19. THREE-ELECTRODE AIR SWITCHBOARD WITH THE GRAPHITE ELECTRODES OF KATG-50 ON VOLTAGE TO ±50 KV AND IMPULSE CURRENT BY AMPLITUDE TO ±220 KA

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2015-04-01

    Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.

  20. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    NARCIS (Netherlands)

    Wilders, R.; Jongsma, H. J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap

  1. Investigation on power discharge in micro-EDM stainless steel drilling using different electrodes

    Energy Technology Data Exchange (ETDEWEB)

    D' Urso, G.; Maccarini, G.; Quarto, M.; Ravasio, C. [University of Bergamo, Bergamo (Italy)

    2015-10-15

    The present work deals with the execution of through micro-holes on stainless steel plates using a micro-EDM (Electrical discharge machining) machine. The investigation focuses on the influence of different electrodes' materials and power discharge on both the process performance and the dimensional characteristics of the holes. The experimental campaign was carried out by varying peak current and voltage in order to achieve both high and low power discharge conditions. Tubular electrodes made of three different materials (tungsten carbide, brass and copper) were used. The indexes taken into account were Material removal rate (MRR), Tool wear ratio (TWR), Diametral overcut (DOC) and Taper rate (TR). Brass and copper electrodes always resulted to be the best solution in terms of drilling speed even though the wear of these electrode types is remarkable higher than the tungsten one. On the opposite, tungsten carbide electrodes resulted to be the best solution when high dimensional and geometrical precision is required. Concerning the finishing of the hole inner surface, the best results were achieved using tungsten carbide electrode.

  2. Investigation on power discharge in micro-EDM stainless steel drilling using different electrodes

    International Nuclear Information System (INIS)

    D'Urso, G.; Maccarini, G.; Quarto, M.; Ravasio, C.

    2015-01-01

    The present work deals with the execution of through micro-holes on stainless steel plates using a micro-EDM (Electrical discharge machining) machine. The investigation focuses on the influence of different electrodes' materials and power discharge on both the process performance and the dimensional characteristics of the holes. The experimental campaign was carried out by varying peak current and voltage in order to achieve both high and low power discharge conditions. Tubular electrodes made of three different materials (tungsten carbide, brass and copper) were used. The indexes taken into account were Material removal rate (MRR), Tool wear ratio (TWR), Diametral overcut (DOC) and Taper rate (TR). Brass and copper electrodes always resulted to be the best solution in terms of drilling speed even though the wear of these electrode types is remarkable higher than the tungsten one. On the opposite, tungsten carbide electrodes resulted to be the best solution when high dimensional and geometrical precision is required. Concerning the finishing of the hole inner surface, the best results were achieved using tungsten carbide electrode.

  3. A High Step-Down Interleaved Buck Converter with Active-Clamp Circuits for Wind Turbines

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2012-12-01

    Full Text Available In this paper, a high step-down interleaved buck coupled-inductor converter (IBCC with active-clamp circuits for wind energy conversion has been studied. In high step-down voltage applications, an IBCC can extend duty ratio and reduce voltage stresses on active switches. In order to reduce switching losses of active switches to improve conversion efficiency, a IBCC with soft-switching techniques is usually required. Compared with passive-clamp circuits, the IBCC with active-clamp circuits have lower switching losses and minimum ringing voltage of the active switches. Thus, the proposed IBCC with active-clamp circuits for wind energy conversion can significantly increase conversion efficiency. Finally, a 240 W prototype of the proposed IBCC with active-clamp circuits was built and implemented. Experimental results have shown that efficiency can reach as high as 91%. The proposed IBCC with active-clamp circuits is presented in high step-down voltage applications to verify the performance and the feasibility for energy conversion of wind turbines.

  4. Cold-electrode voltage fall for impulse arcs in argon between copper electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Diaz, O; Cooray, V, E-mail: oscar.diaz@angstrom.uu.se [Lightning Research Group, Division for Electricity, Uppsala University Angstroemlaboratoriet Box 5234, 751 20, Uppsala (Sweden)

    2011-06-23

    The full electric arc discharge in gases for short gaps in homogeneous electric field and pressure{center_dot}distance (pd) below 150 Torr{center_dot}cm, can be described as a transition between different discharge mechanisms such as: Townsend, glow, and arc. Once the arc is achieved the measured voltage drops to some volts and the current density increases several orders of magnitude. Depending upon the type of gas used, the electrode surface characteristics and type of electrical excitation, the cathode and anode voltage fall might change. The present work is directed to study the electrode fall (sum of anode and cathode falls) during a current impulse arc discharge between copper electrodes in ceramic tubes filled with argon between 0.01 and 6.5 Torr{center_dot}cm. The copper electrodes were cleaned, degassed and hydrogen reduced. The arc voltages were measured with fast/slow rise times and short/long duration current impulses produced by a RLC circuit. An increasing variation of the electrode fall was found at the pressure{center_dot}distance range analyzed.

  5. Overmodulation of n-level three-leg DC-AC diode-clamped converters with comprehensive capacitor voltage balance

    DEFF Research Database (Denmark)

    Busquets-Monge, S.; Maheshwari, Ram Krishan; Munk-Nielsen, Stig

    2013-01-01

    This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories are selec......This paper presents a novel PWM strategy for nlevel three-leg semiconductor-clamped dc-ac converters in the overmodulation region, with dc-link capacitor voltage balance in every switching cycle. The strategy is based on the virtual-vector concept. Suitable reference vector trajectories...

  6. Use of the Satinsky clamp for hilar clamping during robotic partial nephrectomy: indications, technique, and multi-center outcomes.

    Science.gov (United States)

    Abdullah, Newaj; Rahbar, Haider; Barod, Ravi; Dalela, Deepansh; Larson, Jeff; Johnson, Michael; Mass, Alon; Zargar, Homayoun; Kaouk, Jihad; Allaf, Mohamad; Bhayani, Sam; Stifelman, Michael; Rogers, Craig

    2017-03-01

    A Satinsky clamp may be a backup option for hilar clamping during robotic partial nephrectomy (RPN) if there are challenges with application of bulldog clamps, but there are potential safety concerns. We evaluate outcomes of RPN using Satinsky vs. bulldog clamps, and provide tips for safe use of the Satinsky as a backup option. Using a multi-center database, we identified 1073 patients who underwent RPN between 2006 and 2013, and had information available about method of hilar clamping (bulldog clamp vs. Satinsky clamp). Patient baseline characteristics, tumor features, and perioperative outcomes were compared between the Satinsky and bulldog clamp groups. A Satinsky clamp was used for hilar clamping in 94 (8.8 %) RPN cases, and bulldog clamps were used in 979 (91.2 %) cases. The use of a Satinsky clamp was associated with greater operative time (198 vs. 175 min, p hilar clamping during challenging RPN cases, but requires careful technique, and was rarely necessary.

  7. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Science.gov (United States)

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  8. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Directory of Open Access Journals (Sweden)

    Zhibin Hao

    Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  9. Equivalent circuit of frog atrial tissue as determined by voltage clamp-unclamp experiments.

    Science.gov (United States)

    Tarr, M; Trank, J

    1971-11-01

    The equivalent circuit that has been used in the analysis of nerve voltage-clamp data is that of the membrane capacity in parallel with the membrane resistance. Voltage-clamp experiments on frog atrial tissue indicate that this circuit will not suffice for this cardiac tissue. The change in membrane current associated with a step change in membrane potential does not show a rapid spike of capacitive current as would be expected for the simple parallel resistance-capacitance network. Rather, there is a step change in current followed by an exponential decay in current with a time constant of about 1 msec. This relatively slow capacitive charging current suggests that there is a resistance in series with the membrane capacity. A possible equivalent circuit is that of a series resistance external to the parallel resistance-capacitance network of the cell membranes. Another possible circuit assumes that the series resistance is an integral part of the cell membrane. The data presented in this paper demonstrate that the equivalent circuit of a bundle of frog atrial muscle is that of an external resistance in series with the cell membranes.

  10. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  11. Fabrication and Characterization of a Micro Methanol Sensor Using the CMOS-MEMS Technique

    Directory of Open Access Journals (Sweden)

    Chien-Fu Fong

    2015-10-01

    Full Text Available A methanol microsensor integrated with a micro heater manufactured using the complementary metal oxide semiconductor (CMOS-microelectromechanical system (MEMS technique was presented. The sensor has a capability of detecting low concentration methanol gas. Structure of the sensor is composed of interdigitated electrodes, a sensitive film and a heater. The heater located under the interdigitated electrodes is utilized to provide a working temperature to the sensitive film. The sensitive film prepared by the sol-gel method is tin dioxide doped cadmium sulfide, which is deposited on the interdigitated electrodes. To obtain the suspended structure and deposit the sensitive film, the sensor needs a post-CMOS process to etch the sacrificial silicon dioxide layer and silicon substrate. The methanol senor is a resistive type. A readout circuit converts the resistance variation of the sensor into the output voltage. The experimental results show that the methanol sensor has a sensitivity of 0.18 V/ppm.

  12. Fabrication and Characterization of a Micro Methanol Sensor Using the CMOS-MEMS Technique.

    Science.gov (United States)

    Fong, Chien-Fu; Dai, Ching-Liang; Wu, Chyan-Chyi

    2015-10-23

    A methanol microsensor integrated with a micro heater manufactured using the complementary metal oxide semiconductor (CMOS)-microelectromechanical system (MEMS) technique was presented. The sensor has a capability of detecting low concentration methanol gas. Structure of the sensor is composed of interdigitated electrodes, a sensitive film and a heater. The heater located under the interdigitated electrodes is utilized to provide a working temperature to the sensitive film. The sensitive film prepared by the sol-gel method is tin dioxide doped cadmium sulfide, which is deposited on the interdigitated electrodes. To obtain the suspended structure and deposit the sensitive film, the sensor needs a post-CMOS process to etch the sacrificial silicon dioxide layer and silicon substrate. The methanol senor is a resistive type. A readout circuit converts the resistance variation of the sensor into the output voltage. The experimental results show that the methanol sensor has a sensitivity of 0.18 V/ppm.

  13. Fabrication and Optimization of a Nanoporous Platinum Electrode and a Non-enzymatic Glucose Micro-sensor on Silicon

    Directory of Open Access Journals (Sweden)

    Younghun Kim

    2008-10-01

    Full Text Available In this paper, optimal conditions for fabrication of nanoporous platinum (Pt were investigated in order to use it as a sensitive sensing electrode for silicon CMOS integrable non-enzymatic glucose micro-sensor applications. Applied charges, voltages, and temperatures were varied during the electroplating of Pt into the formed nonionic surfactant C16EO8 nano-scaled molds in order to fabricate nanoporous Pt electrodes with large surface roughness factor (RF, uniformity, and reproducibility. The fabricated nanoporous Pt electrodes were characterized using atomic force microscopy (AFM and electrochemical cyclic voltammograms. Optimal electroplating conditions were determined to be an applied charge of 35 mC/mm2, a voltage of -0.12 V, and a temperature of 25 °C, respectively. The optimized nanoporous Pt electrode had an electrochemical RF of 375 and excellent reproducibility. The optimized nanoporous Pt electrode was applied to fabricate non-enzymatic glucose micro-sensor with three electrode systems. The fabricated sensor had a size of 3 mm x 3 mm, air gap of 10 µm, working electrode (WE area of 4.4 mm2, and sensitivity of 37.5 µA•L/mmol•cm2. In addition, it showed large detection range from 0.05 to 30 mmolL-1 and stable recovery responsive to the step changes in glucose concentration.

  14. TiN coated aluminum electrodes for DC high voltage electron guns

    International Nuclear Information System (INIS)

    Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew

    2015-01-01

    Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes

  15. New Modulation Strategy to Balance the Neutral-Point Voltage for Three-Level Neutral-Clamped Inverter Systems

    DEFF Research Database (Denmark)

    Choi, Uimin; Lee, June-Seok; Lee, Kyo-Beum

    2014-01-01

    This paper proposes a new modulation strategy that balances the neutral-point voltage for three-level neutral-clamped inverter systems. The proposed modulation replaces the P-type or N-type small switching states with other switching states that do not affect the neutral-point voltage. The zero...... and medium switching states are employed to help the neutral-point voltage balancing. This method little bit increases the switching events and output total harmonic distortion. However, this method has a strong balancing ability at all regions. Further, it is very simple to implement in both space vector...

  16. Voltage-Sharing Converter to Supply Single-Phase Asymmetrical Four-Level Diode-Clamped Inverter With High Power Factor Loads

    DEFF Research Database (Denmark)

    Boora, Arash A.; Nami, Alireza; Zare, Firuz

    2010-01-01

    The output voltage quality of some of the single-phase multilevel inverters can be improved when their dc-link voltages are regulated asymmetrically. Symmetrical and asymmetrical multilevel diode-clamped inverters have the problem of dc-link capacitor voltage balancing, especially when power factor...... that the proposed combination of introduced multioutput dc–dc converter and single-phase ADCI is a good candidate for power conversion in residential photovoltaic (PV) utilization....

  17. A Component-Reduced Zero-Voltage Switching Three-Level DC-DC Converter

    DEFF Research Database (Denmark)

    Qin, Zian; Pang, Ying; Wang, Huai

    2016-01-01

    The basic Zero-Voltage Switching (ZVS) three-level DC-DC converter has one clamping capacitor to realize the ZVS of the switches, and two clamping diodes to clamp the voltage of the clamping capacitor. In order to reduce the reverse recovery loss of the diode as well as its cost, this paper...... proposes to remove one of the clamping diodes in basic ZVS three-level DC-DC converter. With less components, the proposed converter can still have a stable clamping capacitor voltage, which is clamped at half of the dc link voltage. Moreover, the ZVS performance will be influenced by removing the clamping...

  18. Servo scanning 3D micro EDM for array micro cavities using on-machine fabricated tool electrodes

    Science.gov (United States)

    Tong, Hao; Li, Yong; Zhang, Long

    2018-02-01

    Array micro cavities are useful in many fields including in micro molds, optical devices, biochips and so on. Array servo scanning micro electro discharge machining (EDM), using array micro electrodes with simple cross-sectional shape, has the advantage of machining complex 3D micro cavities in batches. In this paper, the machining errors caused by offline-fabricated array micro electrodes are analyzed in particular, and then a machining process of array servo scanning micro EDM is proposed by using on-machine fabricated array micro electrodes. The array micro electrodes are fabricated on-machine by combined procedures including wire electro discharge grinding, array reverse copying and electrode end trimming. Nine-array tool electrodes with Φ80 µm diameter and 600 µm length are obtained. Furthermore, the proposed process is verified by several machining experiments for achieving nine-array hexagonal micro cavities with top side length of 300 µm, bottom side length of 150 µm, and depth of 112 µm or 120 µm. In the experiments, a chip hump accumulates on the electrode tips like the built-up edge in mechanical machining under the conditions of brass workpieces, copper electrodes and the dielectric of deionized water. The accumulated hump can be avoided by replacing the water dielectric by an oil dielectric.

  19. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.; Andersen, Michael A.E.

    2005-07-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify design, increase efficiency and integration level, reduce product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented. (au)

  20. Direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp

    DEFF Research Database (Denmark)

    Ljusev, Petar; Andersen, Michael Andreas E.

    2005-01-01

    This paper discusses the advantages and problems when implementing direct energy conversion switching-mode audio power amplifiers. It is shown that the total integration of the power supply and Class D audio power amplifier into one compact direct converter can simplify the design, increase...... efficiency, reduce the product volume and lower its cost. As an example, the principle of operation and the measurements made on a direct-conversion switching-mode audio power amplifier with active capacitive voltage clamp are presented....

  1. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    OpenAIRE

    Wilders, R.; Jongsma, H.J.

    1992-01-01

    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  2. High-speed micro electrode tool fabrication by a twin-wire EDM system

    International Nuclear Information System (INIS)

    Sheu, Dong-Yea

    2008-01-01

    This paper describes a new machining process which combines twin-electro-wire together with two electro discharge circuits to rapidly fabricate micro electrode tools. The results show that transistor electro discharge and RC electro discharge circuits coexist to fabricate micro tools with rough and finish machining both on the same machine. Compared to conventional wire electro discharge grinding (WEDG) technology, a twin-wire EDM system that combines rough and finish machining into one process allows the efficient fabrication of micro tools. This high-speed micro tool fabrication process can be applied not only to micro electrode machining but also to micro punching tool and micro probing tips machining

  3. High-speed micro-electro-discharge machining.

    Energy Technology Data Exchange (ETDEWEB)

    Chandrasekar, Srinivasan Dr. (.School of Industrial Engineering, West Lafayette, IN); Moylan, Shawn P. (School of Industrial Engineering, West Lafayette, IN); Benavides, Gilbert Lawrence

    2005-09-01

    When two electrodes are in close proximity in a dielectric liquid, application of a voltage pulse can produce a spark discharge between them, resulting in a small amount of material removal from both electrodes. Pulsed application of the voltage at discharge energies in the range of micro-Joules results in the continuous material removal process known as micro-electro-discharge machining (micro-EDM). Spark erosion by micro-EDM provides significant opportunities for producing small features and micro-components such as nozzle holes, slots, shafts and gears in virtually any conductive material. If the speed and precision of micro-EDM processes can be significantly enhanced, then they have the potential to be used for a wide variety of micro-machining applications including fabrication of microelectromechanical system (MEMS) components. Toward this end, a better understanding of the impacts the various machining parameters have on material removal has been established through a single discharge study of micro-EDM and a parametric study of small hole making by micro-EDM. The main avenues for improving the speed and efficiency of the micro-EDM process are in the areas of more controlled pulse generation in the power supply and more controlled positioning of the tool electrode during the machining process. Further investigation of the micro-EDM process in three dimensions leads to important design rules, specifically the smallest feature size attainable by the process.

  4. An improved control method of power electronic converters in low voltage micro-grid

    DEFF Research Database (Denmark)

    Xiaofeng, Sun; Qingqiu, Lv; Yanjun, Tian

    2011-01-01

    control of the voltage and frequency deviation added to power references could achieve secondary regulation of the voltage and frequency. In this paper, the authors take the steady and transient transition of grid connecting and disconnecting of the micro-grid as an example, and demonstrate......With the increasing acceptance, micro-grid, combined with distributed generation (DG), may be operated in two modes: grid-connected mode and island mode. In grid connected mode, energy management is the control objective. While in island mode, the control of Voltage and frequency will take...... the place. The conventional droop control can perform the energy management in grid-connected mode, but may not so effective when micro-grid transferring between grid-connected mode and island mode. The paper analysis the micro-grid in different modes (Conventional droop control, Voltage reference...

  5. High resolution micro-CT scanning as an innovative tool for evaluation of the surgical positioning of cochlear implant electrodes.

    Science.gov (United States)

    Postnov, A; Zarowski, A; De Clerck, N; Vanpoucke, F; Offeciers, F E; Van Dyck, D; Peeters, S

    2006-05-01

    X-ray microtomography (micro-CT) is a new technique allowing for visualization of the internal structure of opaque specimens with a quasi-histological quality. Among multiple potential applications, the use of this technique in otology is very promising. Micro-CT appears to be ideally suited for in vitro visualization of the inner ear tissues as well as for evaluation of the electrode damage and/or surgical insertion trauma during implantation of the cochlear implant electrodes. This technique can greatly aid in design and development of new cochlear implant electrodes and is applicable for temporal bone studies. The main advantage of micro-CT is the practically artefact-free preparation of the samples and the possibility of evaluation of the interesting parameters along the whole insertion depth of the electrode. This paper presents the results of the first application of micro-CT for visualization of the inner ear structures in human temporal bones and for evaluation of the surgical positioning of the cochlear implant electrodes relative to the intracochlear soft tissues.

  6. Micro controller application as x-ray machine's high voltage controller

    International Nuclear Information System (INIS)

    Wiranto Budi Santoso; Beny Syawaludin

    2010-01-01

    The micro controller application as x-ray machine's high voltage controller has been carried out. The purpose of this micro controller application is to give an accurate high voltage supply to the x-ray tube so that the x ray machine could produce the result as expected. The micro controller based X-ray machine's high voltage controller receives an input voltage from the keypad. This input value is displayed in the LCD (Liquid Crystal Display) screen. Then micro controller uses this input data to drive the stepper motor. The stepper motor adjusts the high voltage auto transformer's output according to the input value. The micro controller is programmed using BASCOM-B051 compiler. The test results show that the stepper motor could rotate according to an input value. (author)

  7. Nonlinear current-voltage characteristics of WO3-x nano-/micro-rods

    Science.gov (United States)

    Shen, Zhenguang; Peng, Zhijian; Zhao, Zengying; Fu, Xiuli

    2018-04-01

    A series of crystalline tungsten oxide nano-/micro-rods with different compositions of WO3, WO2.90, W19O55 (WO2.89) and W18O49 (WO2.72) but identical morphology feature were first prepared. Then, various nanoscaled electrical devices were fabricated from them by micro-fabrication through a focused ion beam technique. Interestingly, the devices from the oxygen-deficient WO3-x display significantly nonlinear current-voltage characteristics. The calculated nonlinear coefficients of the WO2.90, WO2.83, and WO2.72 varistors are 2.52, 3.32 and 4.91, respectively. The breakdown voltage of the WO2.90, WO2.83, and WO2.72 varistors are 1.93, 1.28 and 0.93 V, respectively. Such WO3-x nano-varistors might be promising for low-voltage electrical/electronic devices.

  8. Patch Clamp: A Powerful Technique for Studying the Mechanism of Acupuncture

    Directory of Open Access Journals (Sweden)

    D. Zhang

    2012-01-01

    Full Text Available Cellular and molecular events can be investigated using electrophysiological techniques. In particular, the patch-clamp method provides detailed information. In addition, the patch-clamp technique has become a powerful method for investigating the mechanisms underlying the effects of acupuncture. In this paper, recent researches on how acupuncture might modulate electrophysiological responses in the central nervous system (CNS and affect peripheral structures are reviewed.

  9. High-voltage electrode optimization towards uniform surface treatment by a pulsed volume discharge

    International Nuclear Information System (INIS)

    Ponomarev, A V; Pedos, M S; Scherbinin, S V; Mamontov, Y I; Ponomarev, S V

    2015-01-01

    In this study, the shape and material of the high-voltage electrode of an atmospheric pressure plasma generation system were optimised. The research was performed with the goal of achieving maximum uniformity of plasma treatment of the surface of the low-voltage electrode with a diameter of 100 mm. In order to generate low-temperature plasma with the volume of roughly 1 cubic decimetre, a pulsed volume discharge was used initiated with a corona discharge. The uniformity of the plasma in the region of the low-voltage electrode was assessed using a system for measuring the distribution of discharge current density. The system's low-voltage electrode - collector - was a disc of 100 mm in diameter, the conducting surface of which was divided into 64 radially located segments of equal surface area. The current at each segment was registered by a high-speed measuring system controlled by an ARM™-based 32-bit microcontroller. To facilitate the interpretation of results obtained, a computer program was developed to visualise the results. The program provides a 3D image of the current density distribution on the surface of the low-voltage electrode. Based on the results obtained an optimum shape for a high-voltage electrode was determined. Uniformity of the distribution of discharge current density in relation to distance between electrodes was studied. It was proven that the level of non-uniformity of current density distribution depends on the size of the gap between electrodes. Experiments indicated that it is advantageous to use graphite felt VGN-6 (Russian abbreviation) as the material of the high-voltage electrode's emitting surface. (paper)

  10. Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

    Science.gov (United States)

    Pervukhin, Viktor V; Sheven, Dmitriy G

    2010-01-01

    The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  11. A grid-connected single-phase photovoltaic micro inverter

    Science.gov (United States)

    Wen, X. Y.; Lin, P. J.; Chen, Z. C.; Wu, L. J.; Cheng, S. Y.

    2017-11-01

    In this paper, the topology of a single-phase grid-connected photovoltaic (PV) micro-inverter is proposed. The PV micro-inverter consists of DC-DC stage with high voltage gain boost and DC-AC conversion stage. In the first stage, we apply the active clamp circuit and two voltage multipliers to achieve soft switching technology and high voltage gain. In addition, the flower pollination algorithm (FPA) is employed for the maximum power point tracking (MPPT) in the PV module in this stage. The second stage cascades a H-bridge inverter and LCL filter. To feed high quality sinusoidal power into the grid, the software phase lock, outer voltage loop and inner current loop control method are adopted as the control strategy. The performance of the proposed topology is tested by Matlab/Simulink. A PV module with maximum power 300W and maximum power point voltage 40V is applied as the input source. The simulation results indicate that the proposed topology and the control strategy are feasible.

  12. Exploiting the spontaneous potential of the electrodes used in the capacitive mixing technique for the extraction of energy from salinity difference

    NARCIS (Netherlands)

    Brogioli, D.; Ziano, R.; Rica, R.A.; Salerno, D.; Kozynchenko, O.; Hamelers, H.V.M.; Mantegazza, F.

    2012-01-01

    The "capacitive mixing" (CAPMIX) technique is aimed at the extraction of energy from the salinity difference between the sea and rivers. It is based on the voltage rise that takes place at the electrodes when changing the salt concentration of the solution in which the two electrodes are dipped. In

  13. All-solid-state micro-supercapacitors based on inkjet printed graphene electrodes

    Science.gov (United States)

    Li, Jiantong; Mishukova, Viktoriia; Östling, Mikael

    2016-09-01

    The all-solid-state graphene-based in-plane micro-supercapacitors are fabricated simply through reliable inkjet printing of pristine graphene in interdigitated structure on silicon wafers to serve as both electrodes and current collectors, and a following drop casting of polymer electrolytes (polyvinyl alcohol/H3PO4). Benefiting from the printing processing, an attractive porous electrode microstructure with a large number of vertically orientated graphene flakes is observed. The devices exhibit commendable areal capacitance over 0.1 mF/cm2 and a long cycle life of over 1000 times. The simple and scalable fabrication technique for efficient micro-supercapacitors is promising for on-chip energy storage applications in emerging electronics.

  14. Frequency-domain analysis of intrinsic neuronal properties using high-resistant electrodes

    Directory of Open Access Journals (Sweden)

    Christian Rössert

    2009-08-01

    Full Text Available Intrinsic cellular properties of neurons in culture or slices are usually studied by the whole cell clamp method using low-resistant patch pipettes. These electrodes allow detailed analyses with standard electrophysiological methods such as current- or voltage-clamp. However, in these preparations large parts of the network and dendritic structures may be removed, thus preventing an adequate study of synaptic signal processing. Therefore, intact in vivo preparations or isolated in vitro whole brains have been used in which intracellular recordings are usually made with sharp, high-resistant electrodes to optimize the impalement of neurons. The general non-linear resistance properties of these electrodes, however, severely limit accurate quantitative studies of membrane dynamics especially needed for precise modelling. Therefore, we have developed a frequency-domain analysis of membrane properties that uses a Piece-wise Non-linear Electrode Compensation (PNEC method. The technique was tested in second-order vestibular neurons and abducens motoneurons of isolated frog whole brain preparations using sharp potassium chloride- or potassium acetate-filled electrodes. All recordings were performed without online electrode compensation. The properties of each electrode were determined separately after the neuronal recordings and were used in the frequency-domain analysis of the combined measurement of electrode and cell. This allowed detailed analysis of membrane properties in the frequency-domain with high-resistant electrodes and provided quantitative data that can be further used to model channel kinetics. Thus, sharp electrodes can be used for the characterization of intrinsic properties and synaptic inputs of neurons in intact brains.

  15. Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

    DEFF Research Database (Denmark)

    Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

    2010-01-01

    introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

  16. IMPORTANT: Fluke is recalling Digital Clamp Meters

    CERN Multimedia

    2013-01-01

    Fluke is voluntarily recalling four models of Digital Clamp Meters: Fluke 373, 374, 375 and 376. If you own one of these clamp meters, please stop using it and send it back to Fluke for repair even if you have not experienced problems.   Description of the problem: "The printed circuit assembly may not be properly fastened to the test lead input jack. This may result in inaccurate voltage readings, including a low or no-voltage reading on a circuit energised with a hazardous voltage, presenting a shock, electrocution or thermal burn hazard." To determine if your clamp meter is affected by this recall notice, and for more information, click here.

  17. Harmonic elimination in diode-clamped multilevel inverter using evolutionary algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Barkati, Said [Laboratoire d' analyse des Signaux et Systemes (LASS), Universite de M' sila, BP. 166, rue Ichbilia 28000 M' sila (Algeria); Baghli, Lotfi [Groupe de Recherche en Electrotechnique et Electronique de Nancy (GREEN), CNRS UMR 7030, Universite Henri Poincare Nancy 1, BP. 239, 54506 Vandoeuvre-les-Nancy (France); Berkouk, El Madjid; Boucherit, Mohamed-Seghir [Laboratoire de Commande des Processus (LCP), Ecole Nationale Polytechnique, BP. 182, 10 Avenue Hassen Badi, 16200 El Harrach, Alger (Algeria)

    2008-10-15

    This paper describes two evolutionary algorithms for the optimized harmonic stepped-waveform technique. Genetic algorithms and particle swarm optimization are applied to compute the switching angles in a three-phase seven-level inverter to produce the required fundamental voltage while, at the same time, specified harmonics are eliminated. Furthermore, these algorithms are also used to solve the starting point problem of the Newton-Raphson conventional method. This combination provides a very effective method for the harmonic elimination technique. This strategy is useful for different structures of seven-level inverters. The diode-clamped topology is considered in this study. (author)

  18. Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages

    Science.gov (United States)

    Kim, Jeonglae; Davidson, Scott; Mani, Ali

    2017-11-01

    Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.

  19. General Voltage Feedback Circuit Model in the Two-Dimensional Networked Resistive Sensor Array

    Directory of Open Access Journals (Sweden)

    JianFeng Wu

    2015-01-01

    Full Text Available To analyze the feature of the two-dimensional networked resistive sensor array, we firstly proposed a general model of voltage feedback circuits (VFCs such as the voltage feedback non-scanned-electrode circuit, the voltage feedback non-scanned-sampling-electrode circuit, and the voltage feedback non-scanned-sampling-electrode circuit. By analyzing the general model, we then gave a general mathematical expression of the effective equivalent resistor of the element being tested in VFCs. Finally, we evaluated the features of VFCs with simulation and test experiment. The results show that the expression is applicable to analyze the VFCs’ performance of parameters such as the multiplexers’ switch resistors, the nonscanned elements, and array size.

  20. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  1. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  2. A new method for analyzing and design of guard electrodes of high voltage insulators chain

    International Nuclear Information System (INIS)

    Vahidi, B.; Mohammad Zadeh, A.

    2002-01-01

    The main aim of this paper is analyzing design of guard electrodes of high voltage insulators chain. These electrodes are used for making the distribution of uniform potential across the insulators chain, reducing leakage current and preventing the degradation of insulators. If the design is not correct or in the case of insulators chain without guard electrodes, the potential distribution will not uniform. Thus the voltage drops on the insulators adjacent to conductors will be more than maximum voltage that can be tolerated by the insulators. Therefore these voltage drops can damage the insulators. In this paper A new method is introduced for analyzing and design of ga urad electrodes of high voltage insulators chain

  3. Robotic Automation of In Vivo Two-Photon Targeted Whole-Cell Patch-Clamp Electrophysiology.

    Science.gov (United States)

    Annecchino, Luca A; Morris, Alexander R; Copeland, Caroline S; Agabi, Oshiorenoya E; Chadderton, Paul; Schultz, Simon R

    2017-08-30

    Whole-cell patch-clamp electrophysiological recording is a powerful technique for studying cellular function. While in vivo patch-clamp recording has recently benefited from automation, it is normally performed "blind," meaning that throughput for sampling some genetically or morphologically defined cell types is unacceptably low. One solution to this problem is to use two-photon microscopy to target fluorescently labeled neurons. Combining this with robotic automation is difficult, however, as micropipette penetration induces tissue deformation, moving target cells from their initial location. Here we describe a platform for automated two-photon targeted patch-clamp recording, which solves this problem by making use of a closed loop visual servo algorithm. Our system keeps the target cell in focus while iteratively adjusting the pipette approach trajectory to compensate for tissue motion. We demonstrate platform validation with patch-clamp recordings from a variety of cells in the mouse neocortex and cerebellum. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Transformer-based asymmetrical embedded Z-source neutral point clamped inverters with continuous input current and enhanced voltage boost capability

    DEFF Research Database (Denmark)

    Mo, W.; Loh, Poh Chiang; Blaabjerg, Frede

    2013-01-01

    Z-source Neutral Point Clamped (NPC) inverters were introduced to integrate both the advantages of Z-source inverters and NPC inverters. However, traditional Z-source inverters suffer from high voltage stress and chopping input current. This paper proposes six types transformer-based impedance-so......-source NPC inverters which have enhanced voltage boost capability and continuous input current by utilizing of transformer and embedded dc source configuration. Experimental results are presented to verify the theory validation....

  5. Selective wetting-induced micro-electrode patterning for flexible micro-supercapacitors.

    Science.gov (United States)

    Kim, Sung-Kon; Koo, Hyung-Jun; Lee, Aeri; Braun, Paul V

    2014-08-13

    Selective wetting-induced micro-electrode patterning is used to fabricate flexible micro-supercapacitors (mSCs). The resulting mSCs exhibit high performance, mechanical stability, stable cycle life, and hold great promise for facile integration into flexible devices requiring on-chip energy storage. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A DC-Link Voltage Self-Balance Method for a Diode-Clamped Modular Multilevel Converter With Minimum Number of Voltage Sensors

    DEFF Research Database (Denmark)

    Gao, Congzhe; Jiang, Xinjian; Li, Yongdong

    2013-01-01

    Voltage balance issue of dc-link capacitors is very important for applications of a cascade multilevel converter or a modular multilevel converter. In this paper, a novel diode-clamped modular multilevel converter (DCM2C) topology is proposed and a power feedback control method is developed...... used traditional method; therefore, the system performance improvement and cost reduction are expected. Based on the proposed DCM2C, a novel N +1-level cascade multilevel topology is proposed for a cascade active power filter (CS-APF). The simulation and experimental results from the CS-APF have...

  7. Modulation of voltage-gated Na+ and K+ channels by pumiliotoxin 251D: a "joint venture" alkaloid from arthropods and amphibians.

    Science.gov (United States)

    Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan

    2008-03-01

    Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.

  8. A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

    Directory of Open Access Journals (Sweden)

    Yufei Teng

    2017-03-01

    Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

  9. Current-Voltage Characteristics of DC Discharge in Micro Gas Jet Injected into Vacuum Environment

    International Nuclear Information System (INIS)

    Matra, K; Furuta, H; Hatta, A

    2013-01-01

    A current-voltage characteristic of direct current (DC) gas discharge operated in a micro gas jet injected into a secondary electron microscope (SEM) chamber is presented. Ar gas was injected through a 30 μm orifice gas nozzle (OGN) and was evacuated by an additional pump to keep the high vacuum environment. Gas discharges were ignited between the OGN as anode and a counter electrode of Si wafer. The discharge was self-pulsating in most of the cases while it was stable at lower pressure, larger gap length, and larger time averaged current. The self-pulsating discharge was oscillated by the RC circuit consisting of a stray capacitor and a large ballast resistor. The real time plots of voltage and current during the pulsating was investigated using a discharge model.

  10. High voltage and high specific capacity dual intercalating electrode Li-ion batteries

    Science.gov (United States)

    West, William C. (Inventor); Blanco, Mario (Inventor)

    2010-01-01

    The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.

  11. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  12. Electrode configuration effects on the electrification and voltage variation in an electrostatic inkjet printing head

    International Nuclear Information System (INIS)

    Choi, Kyung Hyun; Ali, Adnan; Rahman, Ahsan; Malik Mohammad, Nauman; Rahman, Khalid; Khan, Arshad; Khan, Saleem; Kim, D S

    2010-01-01

    The electrode configuration of an electrostatic inkjet printing head is under study. This paper introduces the development of a new electrostatic inkjet head with an improved electrode configuration as compared to the conventional configuration. Two tungsten electrodes, connected in parallel, are inserted into the electrostatic print head at a certain angle from opposite sides. The aim of this double-side inserted angular electrodes (DSIAEs) head is to intensify the electrification of the fluid inside the head at minimum suitable exposure of the electrode, which results in maximizing surface charge density. The main advantage of the DSIAEs head is to get a very stable meniscus at low applied voltage for printing. This stable meniscus is transformed to a very stable jet by increasing the applied voltage. Therefore, printed patterns obtained with this DSIAEs head are more uniform because of a more stable meniscus and jet as compared to a conventional electrostatic vertically inserted single electrode head. Also, with this DSIAEs configuration, the life of the electrostatic inkjet printing head is increased.

  13. Selective Arterial Clamping Versus Hilar Clamping for Minimally Invasive Partial Nephrectomy.

    Science.gov (United States)

    Yezdani, Mona; Yu, Sue-Jean; Lee, David I

    2016-05-01

    Partial nephrectomy has become an accepted treatment of cT1 renal masses as it provides improved long-term renal function compared to radical nephrectomy (Campbell et al. J Urol. 182:1271-9, 2009). Hilar clamping is utilized to help reduce bleeding and improve visibility during tumor resection. However, concern over risk of kidney injury with hilar clamping has led to new techniques to reduce length of warm ischemia time (WIT) during partial nephrectomy. These techniques have progressed over the years starting with early hilar unclamping, controlled hypotension during tumor resection, selective arterial clamping, minimal margin techniques, and off-clamp procedures. Selective arterial clamping has progressed significantly over the years. The main question is what are the exact short- and long-term renal effects from increasing clamp time. Moreover, does it make sense to perform these more time-consuming or more complex procedures if there is no long-term preservation of kidney function? More recent studies have shown no difference in renal function 6 months from surgery when selective arterial clamping or even hilar clamping is employed, although there is short-term improved decline in estimated glomerular filtration rate (eGFR) with selective clamping and off-clamp techniques (Komninos et al. BJU Int. 115:921-8, 2015; Shah et al. 117:293-9, 2015; Kallingal et al. BJU Int. doi: 10.1111/bju.13192, 2015). This paper reviews the progression of total hilar clamping to selective arterial clamping (SAC) and the possible difference its use makes on long-term renal function. SAC may be attempted based on surgeon's decision-making, but may be best used for more complex, larger, more central or hilar tumors and in patients who have renal insufficiency at baseline or a solitary kidney.

  14. A multi-electrode and pre-deformed bilayer spring structure electrostatic attractive MEMS actuator with large stroke at low actuation voltage

    International Nuclear Information System (INIS)

    Hu, Fangrong; Li, Zhi; Xiong, Xianming; Niu, Junhao; Peng, Zhiyong; Qian, Yixian; Yao, Jun

    2012-01-01

    This paper presents a multi-electrode and pre-deformed bilayer spring structure electrostatic attractive microelectromechanical systems (MEMS) actuator; it has large stroke at relatively low actuation voltage. Generally, electrostatic-attractive-force-based actuators have small stroke due to the instability resulted from the electrostatic ‘pull-in’ phenomenon. However, in many applications, the electrostatic micro-actuator with large stroke at low voltage is more preferred. By introducing a multi-electrode and a pre-deformed bilayer spring structure, an electrostatic attractive MEMS actuator with large stroke at very low actuation voltage has been successfully demonstrated in this paper. The actuator contains a central plate with a size of 300 µm × 300 µm × 1.5 µm and it is supported by four L-shaped bilayer springs which are pre-deformed due to residual stresses. Each bilayer spring is simultaneously attracted by three adjacent fixed electrodes, and the factors affecting the electrostatic attractive force are analyzed by a finite element analysis method. The prototype of the actuator is fabricated by poly-multi-user-MEMS-process (PolyMUMP) and the static performance is tested using a white light interferometer. The measured stroke of the actuator reaches 2 µm at 13 V dc, and it shows a good agreement with the simulation. (paper)

  15. Silicon/SU8 multi-electrode micro-needle for in vivo neurochemical monitoring.

    Science.gov (United States)

    Vasylieva, Natalia; Marinesco, Stéphane; Barbier, Daniel; Sabac, Andrei

    2015-10-15

    Simultaneous monitoring of glucose and lactate is an important challenge for understanding brain energetics in physiological or pathological states. We demonstrate here a versatile method based on a minimally invasive single implantation in the rat brain. A silicon/SU8-polymer multi-sensing needle-shaped biosensor, was fabricated and tested. The multi-electrode array design comprises three platinum planar microelectrodes with a surface area of 40 × 200 µm(2) and a spacing of 200 µm, which were micromachined on a single 3mm long micro-needle having a 100 × 50 µm(2) cross-section for reduced tissue damage during implantation. Platinum micro-electrodes were aligned at the bottom of micro-wells obtained by photolithography on a SU8 photoresist layer. After clean room processing, each micro-electrode was functionalized inside the micro-wells by means of a micro-dispensing device, either with glucose oxidase or with lactate oxidase, which were cross-linked on the platinum electrodes. The third electrode covered with Bovine Serum Albumin (BSA) was used for the control of non-specific currents. The thick SU8 photoresist layer has revealed excellent electrical insulation of the micro-electrodes and between interconnection lines, and ensured a precise localization and packaging of the sensing enzymes on platinum micro-electrodes. During in vitro calibration with concentrations of analytes in the mM range, the micro-wells patterned in the SU8 photoresist proved to be highly effective in eliminating cross-talk signals, caused by H2O2 diffusion from closely spaced micro-electrodes. Moreover, our biosensor was successfully assayed in the rat cortex for simultaneous monitoring of both glucose and lactate during insulin and glucose administration. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Excitation contraction uncoupling by high intracellular [Ca2+] in frog skeletal muscle: a voltage clamp study.

    Science.gov (United States)

    Olivera, J Fernando; Pizarro, Gonzalo

    2016-10-01

    Raising the intracellular [Ca 2+ ] ([Ca 2+ ] i ) was previously found to produce uncoupling between the electrical depolarization of the transverse tubules and contraction in skinned muscle fibers. Here we study the effect of elevated [Ca 2+ ] i in voltage clamped cut fibers of frog skeletal muscle to establish how the charge movement, a measure of the activation of the dihydropyridine receptors (DHPR)-voltage sensors, and Ca 2+ release, a consequence of the opening of the ryanodine receptor (RyR)-release channels, were affected. [Ca 2+ ] i was raised by various procedures (pharmacological release from the sarcoplasmic reticulum, application of high [Ca 2+ ] i intracellular solution, permeabilization of the plasma membrane by a Ca 2+ ionophore) all of which produced impairment of excitation-contraction coupling. The charge movement was reduced from 20.2 ± 1.24 to 9.9 ± 0.94 nC/μF meanwhile the Ca 2+ release flux was reduced from 13.5 + 0.7 to 2.2 ± 0.3 μM/ms (n = 33). This suggests that a significant fraction of the DHPRs that remained functional, could not activate RyRs, and were therefore presumably disconnected. These results are broadly consistent with the original reports in skinned fibers. Uncoupling was prevented by the addition to the intracellular solution of the protease inhibitor leupeptin. In approximately 40 % of the uncoupled cells we observed that the [Ca 2+ ] i transient continued to rise after the voltage clamp pulse was turned off. This loss of control by membrane voltage suggests that the uncoupled release channels might have another mechanism of activation, likely by Ca 2+ .

  17. Five-level Z-source diode-clamped inverter

    DEFF Research Database (Denmark)

    Gao, F.; Loh, Poh Chiang; Blaabjerg, Frede

    2010-01-01

    This study proposes a five-level Z-source diode-clamped inverter designed with two intermediate Z-source networks connected between the dc input sources and rear-end inverter circuitry. By partially shorting the Z-source networks, new operating states not previously reported for two-level Z......-source inverter are introduced here for operating the proposed inverter with voltage buck–boost energy conversion ability and five-level phase voltage switching. These characteristic features are in fact always ensured at the inverter terminal output by simply adopting a properly designed carrier modulation...

  18. A Fabrication Technique for Nano-gap Electrodes by Atomic Force Microscopy Nano lithography

    International Nuclear Information System (INIS)

    Jalal Rouhi; Shahrom Mahmud; Hutagalung, S.D.; Kakooei, S.

    2011-01-01

    A simple technique is introduced for fabrication of nano-gap electrodes by using nano-oxidation atomic force microscopy (AFM) lithography with a Cr/ Pt coated silicon tip. AFM local anodic oxidation was performed on silicon-on-insulator (SOI) surfaces by optimization of desired conditions to control process in contact mode. Silicon electrodes with gaps of sub 31 nm were fabricated by nano-oxidation method. This technique which is simple, controllable, inexpensive and fast is capable of fabricating nano-gap structures. The current-voltage measurements (I-V) of the electrodes demonstrated very good insulating characteristics. The results show that silicon electrodes have a great potential for fabrication of single molecule transistors (SMT), single electron transistors (SET) and the other nano electronic devices. (author)

  19. Development of gas-liquid two-phase flow measurement technique in narrow channel. Application of micro wire-mesh sensor to the flow between parallel plates

    International Nuclear Information System (INIS)

    Ito, Daisuke; Kikura, Hiroshige; Aritomi, Masanori

    2009-01-01

    A novel two-phase flow measuring technique based on local electrical conductivity measurement was developed for clarifications of three-dimensional flow structure in gas-liquid two-phase flow in a narrow channel. The measuring method applies the principle of conventional wire-mesh tomography, which can measure the instantaneous void fraction distributions in a cross-section of a flow channel. In this technique, the electrodes are fixed on the inside of the walls facing each other, and the local void fractions were obtained by the electrical conductivity measurement between electrodes arranged on each wall. Therefore, the flow structure and the bubble behavior can be investigated by three-dimensional void fraction distributions in the channel with narrow gap. In this paper, a micro Wire-Mesh Sensor (μWMS) which has the gap of 3 mm was developed, and the instantaneous void fraction distributions were measured. From the measured distributions, three-dimensional bubble distributions were reconstructed, and bubble volumes and bubble velocities were estimated. (author)

  20. Asymmetric Flexible MXene-Reduced Graphene Oxide Micro-Supercapacitor

    KAUST Repository

    Couly, Cedric

    2017-11-27

    Current microfabrication of micro-supercapacitors often involves multistep processing and delicate lithography protocols. In this study, simple fabrication of an asymmetric MXene-based micro-supercapacitor that is flexible, binder-free, and current-collector-free is reported. The interdigitated device architecture is fabricated using a custom-made mask and a scalable spray coating technique onto a flexible, transparent substrate. The electrode materials are comprised of titanium carbide MXene (Ti3C2Tx) and reduced graphene oxide (rGO), which are both 2D layered materials that contribute to the fast ion diffusion in the interdigitated electrode architecture. This MXene-based asymmetric micro-supercapacitor operates at a 1 V voltage window, while retaining 97% of the initial capacitance after ten thousand cycles, and exhibits an energy density of 8.6 mW h cm−3 at a power density of 0.2 W cm−3. Further, these micro-supercapacitors show a high level of flexibility during mechanical bending. Utilizing the ability of Ti3C2Tx-MXene electrodes to operate at negative potentials in aqueous electrolytes, it is shown that using Ti3C2Tx as a negative electrode and rGO as a positive one in asymmetric architectures is a promising strategy for increasing both energy and power densities of micro-supercapacitors.

  1. Outside-out "sniffer-patch" clamp technique for in situ measures of neurotransmitter release.

    Science.gov (United States)

    Muller-Chrétien, Emilie

    2014-01-01

    The mechanism underlying neurotransmitter release is a critical research domain for the understanding of neuronal network function; however, few techniques are available for the direct detection and measurement of neurotransmitter release. To date, the sniffer-patch clamp technique is mainly used to investigate these mechanisms from individual cultured cells. In this study, we propose to adapt the sniffer-patch clamp technique to in situ detection of neurosecretion. Using outside-out patches from donor cells as specific biosensors plunged in acute cerebral slices, this technique allows for proper detection and quantification of neurotransmitter release at the level of the neuronal network.

  2. Development of large area resistive electrodes for ATLAS NSW MicroMEGAS

    CERN Document Server

    Ochi, Atsuhiko; The ATLAS collaboration

    2015-01-01

    MicroMegas with resistive anode will be used for the NSW upgrade of the ATLAS experiment at LHC. The resistive electrode is one of key technology for MPGDs to prevent sparks. Large area resistive electrodes for the MM have been developed using two different technology; screen printing and carbon sputtering. Maximum size of each resistive foil is 45cm x 220cm with printed pattern of 425 micron pitch strips. Those technologies are also suitable to mass production. The prototypes of series production model have been produced successfully. We will report the development and production status and test results of the resistive MicroMegas.

  3. Activity patterns of cultured neural networks on micro electrode arrays

    NARCIS (Netherlands)

    Rutten, Wim; van Pelt, J.

    2001-01-01

    A hybrid neuro-electronic interface is a cell-cultured micro electrode array, acting as a neural information transducer for stimulation and/or recording of neural activity in the brain or the spinal cord (ventral motor region or dorsal sensory region). It consists of an array of micro electrodes on

  4. Achievable peak electrode voltage reduction by neurostimulators using descending staircase currents to deliver charge.

    Science.gov (United States)

    Halpern, Mark

    2011-01-01

    This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.

  5. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  6. Pulsewidth-modulated 2-source neutral-point-clamped inverter

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Loh, Poh Chang; Gao, Feng

    2007-01-01

    This paper presents the careful integration of a newly proposed Z-source topological concept to the basic neutral-point-clamped (NPC) inverter topology for designing a three-level inverter with both voltage-buck and voltage-boost capabilities. The designed Z-source NPC inverter uses two unique X......-shaped inductance-capacitance (LC) impedance networks that are connected between two isolated dc input power sources and its inverter circuitry for boosting its AC output voltage. Through the design of an appropriate pulsewidth-modulation (PWM) algorithm, the two impedance networks can be short......-circuited sequentially (without shooting through the inverter full DC link) for implementing the ldquonearest-three-vectorrdquo modulation principle with minimized harmonic distortion and device commutations per half carrier cycle while performing voltage boosting. With only a slight modification to the inverter PWM...

  7. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  8. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.

    2016-12-05

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  9. The Effect of an Added Mass on the Frequency Shifts of a Clamped-Clamped Microbeam for Bio-Mass Detection

    KAUST Repository

    Bouchaala, Adam M.; Nayfeh, Ali H.; Younis, Mohammad I.

    2016-01-01

    We present analytical formulations to calculate the induced resonance frequency shifts of electrically actuated clamped-clamped microbeams due to an added mass. Based on the Euler-Bernoulli beam theory, we investigate the linear dynamic responses of the beams added masses, which are modeled as discrete point masses. Analytical expressions based on perturbation techniques and a one-mode Galerkin approximation are developed to calculate accurately the frequency shifts under a DC voltage as a function of the added mass and position. The analytical results are compared to numerical solution of the eigenvalue problem. Results are shown for the fundamental as well as the higher-order modes of the beams. The results indicate a significant increase in the frequency shift, and hence the sensitivity of detection, when scaling down to nano scale and using higher-order modes.

  10. S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Yoni Haitin

    Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.

  11. Implementation of a fast 16-Bit dynamic clamp using LabVIEW-RT.

    Science.gov (United States)

    Kullmann, Paul H M; Wheeler, Diek W; Beacom, Joshua; Horn, John P

    2004-01-01

    The dynamic-clamp method provides a powerful electrophysiological tool for creating virtual ionic conductances in living cells and studying their influence on membrane potential. Here we describe G-clamp, a new way to implement a dynamic clamp using the real-time version of the Lab-VIEW programming environment together with a Windows host, an embedded microprocessor that runs a real-time operating system and a multifunction data-acquisition board. The software includes descriptions of a fast voltage-dependent sodium conductance, delayed rectifier, M-type and A-type potassium conductances, and a leak conductance. The system can also read synaptic conductance waveforms from preassembled data files. These virtual conductances can be reliably implemented at speeds < or =43 kHz while simultaneously saving two channels of data with 16-bit precision. G-clamp also includes utilities for measuring current-voltage relations, synaptic strength, and synaptic gain. Taking an approach built on a commercially available software/hardware platform has resulted in a system that is easy to assemble and upgrade. In addition, the graphical programming structure of LabVIEW should make it relatively easy for others to adapt G-clamp for new experimental applications.

  12. Issues regarding the usage of MPPT techniques in micro grid systems

    Science.gov (United States)

    Szeidert, I.; Filip, I.; Dragan, F.; Gal, A.

    2018-01-01

    The main objective of the control strategies applied at hybrid micro grid systems (wind/hydro/solar), that function based on maximum power point tracking (MPPT) techniques is to improve the conversion system’s efficiency and to preserve the quality of the generated electrical energy (voltage and power factor). One of the main goals of maximum power point tracking strategy is to achieve the harvesting of the maximal possible energy within a certain time period. In order to implement the control strategies for micro grid, there are typically required specific transducers (sensor for wind speed, optical rotational transducers, etc.). In the technical literature, several variants of the MPPT techniques are presented and particularized at some applications (wind energy conversion systems, solar systems, hydro plants, micro grid hybrid systems). The maximum power point tracking implementations are mainly based on two-level architecture. The lower level controls the main variable and the superior level represents the MPPT control structure. The paper presents micro grid structures developed at Politehnica University Timisoara (PUT) within the frame of a research grant. The paper is focused on the application of MPPT strategies on hybrid micro grid systems. There are presented several structures and control strategies and are highlighted their advantages and disadvantages, together with practical implementation guidelines.

  13. Measurement of Mechatronic Property of Biological Gel with Micro-Vibrating Electrode at Ultrasonic Frequency

    Directory of Open Access Journals (Sweden)

    Shigehiro Hashimoto

    2008-10-01

    Full Text Available A measurement system has been designed with a micro-vibrating electrode at ultrasonic frequency to measure local impedance of biological gel in vitro. The designed system consists of two electrodes, where one of the electrodes vibrates with a piezoelectric actuator. The component of variation at impedance between two electrodes with vibration of one electrode is analyzed at the corresponding spectrum. The manufactured system was applied to measure impedance of a physiological saline solution, a potassium chloride solution, a dextran aqueous solution, and an egg. The experimental results show that the designed system is effective to measure local mechatronic property of biological gel.

  14. Unbalanced voltage control of virtual synchronous generator in isolated micro-grid

    Science.gov (United States)

    Cao, Y. Z.; Wang, H. N.; Chen, B.

    2017-06-01

    Virtual synchronous generator (VSG) control is recommended to stabilize the voltage and frequency in isolated micro-grid. However, common VSG control is challenged by widely used unbalance loads, and the linked unbalance voltage problem worsens the power quality of the micro-grid. In this paper, the mathematical model of VSG was presented. Based on the analysis of positive- and negative-sequence equivalent circuit of VSG, an approach was proposed to eliminate the negative-sequence voltage of VSG with unbalance loads. Delay cancellation method and PI controller were utilized to identify and suppress the negative-sequence voltages. Simulation results verify the feasibility of proposed control strategy.

  15. Accurate electrostatic and van der Waals pull-in prediction for fully clamped nano/micro-beams using linear universal graphs of pull-in instability

    Science.gov (United States)

    Tahani, Masoud; Askari, Amir R.

    2014-09-01

    In spite of the fact that pull-in instability of electrically actuated nano/micro-beams has been investigated by many researchers to date, no explicit formula has been presented yet which can predict pull-in voltage based on a geometrically non-linear and distributed parameter model. The objective of present paper is to introduce a simple and accurate formula to predict this value for a fully clamped electrostatically actuated nano/micro-beam. To this end, a non-linear Euler-Bernoulli beam model is employed, which accounts for the axial residual stress, geometric non-linearity of mid-plane stretching, distributed electrostatic force and the van der Waals (vdW) attraction. The non-linear boundary value governing equation of equilibrium is non-dimensionalized and solved iteratively through single-term Galerkin based reduced order model (ROM). The solutions are validated thorough direct comparison with experimental and other existing results reported in previous studies. Pull-in instability under electrical and vdW loads are also investigated using universal graphs. Based on the results of these graphs, non-dimensional pull-in and vdW parameters, which are defined in the text, vary linearly versus the other dimensionless parameters of the problem. Using this fact, some linear equations are presented to predict pull-in voltage, the maximum allowable length, the so-called detachment length, and the minimum allowable gap for a nano/micro-system. These linear equations are also reduced to a couple of universal pull-in formulas for systems with small initial gap. The accuracy of the universal pull-in formulas are also validated by comparing its results with available experimental and some previous geometric linear and closed-form findings published in the literature.

  16. Design and testing of a novel piezoelectric micro-motor actuated by asymmetrical inertial impact driving principle.

    Science.gov (United States)

    Zeng, Ping; Sun, Shujie; Li, Li'an; Xu, Feng; Cheng, Guangming

    2014-03-01

    In this paper, an asymmetrical inertial impact driving principle is first proposed, and accordingly a novel piezoelectrically actuated linear micro-motor is developed. It is driven by the inertial impact force generated by piezoelectric smart cantilever (PSC) with asymmetrical clamping locations during a driving cycle. When the PSC is excited by typical harmonic voltage signals, different equivalent stiffness will be induced due to its asymmetrical clamping locations when it is vibrating back and forth, leading to a tiny displacement difference on the two opposite directions in a cycle, and then the accumulation of tiny displacement difference will allow directional movements. A prototype of the proposed motor has been developed and investigated by means of experimental tests. The motion and dynamics characteristics of the prototype are well studied. The experimental results demonstrate that the resolution of the micro-motor is 0.02 μm, the maximum velocity is 16.87 mm/s, and the maximum loading capacity can reach up to 1 kg with a voltage of 100 V and 35 Hz.

  17. Micro-CAT with redundant electrodes (CATER)

    International Nuclear Information System (INIS)

    Berg, F.D. van den; Eijk, C.W.E. van; Hollander, R.W.; Sarro, P.M.

    2000-01-01

    High-rate X-ray or neutron counting introduces the problem of hit multiplicity when 2D position reconstruction is demanded. Implementation of a third readout electrode having a different angle than the anode or cathode allows to eliminate multiplicity problems. We present experimental results of a new type of gas-filled micro-patterned radiation detector, called 'Compteur a Trous a Electrodes Redondantes (CATER)', that disposes of such an extra readout channel in the form of a ring-shaped electrode that is positioned between the anode and the cathode. The ionic signal is shared between the ring-electrode and the cathode strip in a way that can be controlled by their potential difference. We observe a strong signal dependence on the drift field, which can be understood by the reduced transparency for the primary charge at high drift fields

  18. A micro-structured Si-based electrodes for high capacity electrical double layer capacitors

    International Nuclear Information System (INIS)

    Krikscikas, Valdas; Oguchi, Hiroyuki; Hara, Motoaki; Kuwano, Hiroki; Yanazawa, Hiroshi

    2014-01-01

    We challenged to make basis for Si electrodes of electric double layer capacitors (EDLC) used as a power source of micro-sensor nodes. Mcroelectromechanical systems (MEMS) processes were successfully introduced to fabricate micro-structured Si-based electrodes to obtain high surface area which leads to high capacity of EDLCs. Study of fundamental properties revealed that the microstructured electrodes benefit from good wettability to electrolytes, but suffer from electric resistance. We found that this problem can be solved by metal-coating of the electrode surface. Finally we build an EDLC consisting of Au-coated micro-structured Si electrodes. This EDLC showed capacity of 14.3 mF/cm 2 , which is about 530 times larger than that of an EDLC consisting of flat Au electrodes

  19. Applications of Dynamic Clamp to Cardiac Arrhythmia Research: Role in Drug Target Discovery and Safety Pharmacology Testing

    Directory of Open Access Journals (Sweden)

    Francis A. Ortega

    2018-01-01

    Full Text Available Dynamic clamp, a hybrid-computational-experimental technique that has been used to elucidate ionic mechanisms underlying cardiac electrophysiology, is emerging as a promising tool in the discovery of potential anti-arrhythmic targets and in pharmacological safety testing. Through the injection of computationally simulated conductances into isolated cardiomyocytes in a real-time continuous loop, dynamic clamp has greatly expanded the capabilities of patch clamp outside traditional static voltage and current protocols. Recent applications include fine manipulation of injected artificial conductances to identify promising drug targets in the prevention of arrhythmia and the direct testing of model-based hypotheses. Furthermore, dynamic clamp has been used to enhance existing experimental models by addressing their intrinsic limitations, which increased predictive power in identifying pro-arrhythmic pharmacological compounds. Here, we review the recent advances of the dynamic clamp technique in cardiac electrophysiology with a focus on its future role in the development of safety testing and discovery of anti-arrhythmic drugs.

  20. Molecular motions that shape the cardiac action potential: Insights from voltage clamp fluorometry.

    Science.gov (United States)

    Zhu, Wandi; Varga, Zoltan; Silva, Jonathan R

    2016-01-01

    Very recently, voltage-clamp fluorometry (VCF) protocols have been developed to observe the membrane proteins responsible for carrying the ventricular ionic currents that form the action potential (AP), including those carried by the cardiac Na(+) channel, NaV1.5, the L-type Ca(2+) channel, CaV1.2, the Na(+)/K(+) ATPase, and the rapid and slow components of the delayed rectifier, KV11.1 and KV7.1. This development is significant, because VCF enables simultaneous observation of ionic current kinetics with conformational changes occurring within specific channel domains. The ability gained from VCF, to connect nanoscale molecular movement to ion channel function has revealed how the voltage-sensing domains (VSDs) control ion flux through channel pores, mechanisms of post-translational regulation and the molecular pathology of inherited mutations. In the future, we expect that this data will be of great use for the creation of multi-scale computational AP models that explicitly represent ion channel conformations, connecting molecular, cell and tissue electrophysiology. Here, we review the VCF protocol, recent results, and discuss potential future developments, including potential use of these experimental findings to create novel computational models. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Effect of Micro Electrical Discharge Machining Process Conditions on Tool Wear Characteristics: Results of an Analytic Study

    DEFF Research Database (Denmark)

    Puthumana, Govindan; P., Rajeev

    2016-01-01

    Micro electrical discharge machining is one of the established techniques to manufacture high aspect ratio features on electrically conductive materials. This paper presents the results and inferences of an analytical study for estimating theeffect of process conditions on tool electrode wear...... characteristicsin micro-EDM process. A new approach with two novel factors anticipated to directly control the material removal mechanism from the tool electrode are proposed; using discharge energyfactor (DEf) and dielectric flushing factor (DFf). The results showed that the correlation between the tool wear rate...... (TWR) and the factors is poor. Thus, individual effects of each factor on TWR are analyzed. The factors selected for the study of individual effects are pulse on-time, discharge peak current, gap voltage and gap flushing pressure. The tool wear rate decreases linearly with an increase in the pulse on...

  2. Lability criteria for metal complexes in micro-electrode voltammetry

    NARCIS (Netherlands)

    Leeuwen, van H.P.; Pinheiro, J.P.

    1999-01-01

    Theoretical expressions are derived for the voltammetric lability criteria of metal complexes in the micro-electrode regime. The treatment includes three limiting situations: (i) the macro-electrode limit, where both the diffusion layer and the dissociation reaction layer are linear; (ii) an

  3. Gigaseal formation in patch clamping with applications of nanotechnology

    CERN Document Server

    Malboubi, Majid

    2014-01-01

    This book presents an investigation of gigaseal formation using micro/nanotechnology. The aims of the book are twofold. First, it explains the mechanisms of gigaseal formation using the latest discoveries. Second, it provides practical techniques for frequent formation of high resistance seals. The formation of a high-resistance electrical seal, also known as a gigaseal, between a cell membrane and a glass micropipette tip is essential in patch-clamp experiments. Even though four decades have passed since the introduction of the patch-clamping technique by Neher and Sakmann, gigaseal formation remains an obstacle in developing the high-throughput ion channel screening systems required by the pharmaceutical industry. Here the authors share their latest methods for achieving gigaseal formation and describe techniques that are highly desirable at both research and industrial levels. Nanotechnology has been found to be a powerful tool for studying and modifying glass micropipettes and in tackling the problem of g...

  4. Piezoresistive cantilever force-clamp system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sung-Jin; Petzold, Bryan C.; Pruitt, Beth L. [Department of Mechanical Engineering, Stanford University, Stanford, California 94305 (United States); Goodman, Miriam B. [Department of Molecular and Cellular Physiology, Stanford University, Stanford, California 94305 (United States)

    2011-04-15

    We present a microelectromechanical device-based tool, namely, a force-clamp system that sets or ''clamps'' the scaled force and can apply designed loading profiles (e.g., constant, sinusoidal) of a desired magnitude. The system implements a piezoresistive cantilever as a force sensor and the built-in capacitive sensor of a piezoelectric actuator as a displacement sensor, such that sample indentation depth can be directly calculated from the force and displacement signals. A programmable real-time controller operating at 100 kHz feedback calculates the driving voltage of the actuator. The system has two distinct modes: a force-clamp mode that controls the force applied to a sample and a displacement-clamp mode that controls the moving distance of the actuator. We demonstrate that the system has a large dynamic range (sub-nN up to tens of {mu}N force and nm up to tens of {mu}m displacement) in both air and water, and excellent dynamic response (fast response time, <2 ms and large bandwidth, 1 Hz up to 1 kHz). In addition, the system has been specifically designed to be integrated with other instruments such as a microscope with patch-clamp electronics. We demonstrate the capabilities of the system by using it to calibrate the stiffness and sensitivity of an electrostatic actuator and to measure the mechanics of a living, freely moving Caenorhabditis elegans nematode.

  5. The second sodium site in the dopamine transporter controls cation permeability and is regulated by chloride

    DEFF Research Database (Denmark)

    Borre, Lars; Andreassen, Thorvald F; Shi, Lei

    2014-01-01

    The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted mutagene......The dopamine transporter (DAT) belongs to the family of neurotransmitter:sodium symporters (NSSs) and controls dopamine (DA) homeostasis by mediating Na(+)- and Cl(-)-dependent reuptake of DA. Here we used two-electrode voltage clamp measurements in Xenopus oocytes together with targeted...

  6. Modeling of SVM Diode Clamping Three-Level Inverter Connected to Grid

    DEFF Research Database (Denmark)

    Guo, Yougui; Zeng, Ping; Zhu, Jieqiong

    2011-01-01

    PLECS is used to model the diode clamping three-level inverter connected to grid and good results are obtained. First the output voltage SVM is described for diode clamping three-level inverter with loads connected to Y. Then the output voltage SVM of diode clamping three-level inverter is simply...... analyzed with loads connected to △. But it will be further researched in the future. Third, PLECS is briefly introduced. Fourth, the modeling of diode clamping three-level inverter is briefly presented with PLECS. Finally, a series of simulations are carried out. The simulation results tell us PLECS...... is very powerful tool to real power circuits and it is very easy to simulate them. They have also verified that SVM control strategy is feasible to control the diode clamping three-level inverter....

  7. PZT Thin-Film Micro Probe Device with Dual Top Electrodes

    Science.gov (United States)

    Luo, Chuan

    Lead zirconate titanate (PZT) thin-film actuators have been studied intensively for years because of their potential applications in many fields. In this dissertation, a PZT thin-film micro probe device is designed, fabricated, studied, and proven to be acceptable as an intracochlear acoustic actuator. The micro probe device takes the form of a cantilever with a PZT thin-film diaphragm at the tip of the probe. The tip portion of the probe will be implanted in cochlea later in animal tests to prove its feasibility in hearing rehabilitation. The contribution of the dissertation is three-fold. First, a dual top electrodes design, consisting of a center electrode and an outer electrode, is developed to improve actuation displacement of the PZT thin-film diaphragm. The improvement by the dual top electrodes design is studied via a finite element model. When the dimensions of the dual electrodes are optimized, the displacement of the PZT thin-film diaphragm increases about 30%. A PZT thin-film diaphragm with dual top electrodes is fabricated to prove the concept, and experimental results confirm the predictions from the finite element analyses. Moreover, the dual electrode design can accommodate presence of significant residual stresses in the PZT thin-film diaphragm by changing the phase difference between the two electrodes. Second, a PZT thin-film micro probe device is fabricated and tested. The fabrication process consists of PZT thin-film deposition and deep reactive ion etching (DRIE). The uniqueness of the fabrication process is an automatic dicing mechanism that allows a large number of probes to be released easily from the wafer. Moreover, the fabrication is very efficient, because the DRIE process will form the PZT thin-film diaphragm and the special dicing mechanism simultaneously. After the probes are fabricated, they are tested with various possible implantation depths (i.e., boundary conditions). Experimental results show that future implantation depths

  8. Micro mass spectrometer on a chip.

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, Dolores Y.; Blain, Matthew Glenn; Fleming, James Grant

    2005-11-01

    The design, simulation, fabrication, packaging, electrical characterization and testing analysis of a microfabricated a cylindrical ion trap ({mu}CIT) array is presented. Several versions of microfabricated cylindrical ion traps were designed and fabricated. The final design of the individual trap array element consisted of two end cap electrodes, one ring electrode, and a detector plate, fabricated in seven tungsten metal layers by molding tungsten around silicon dioxide (SiO{sub 2}) features. Each layer of tungsten is then polished back in damascene fashion. The SiO{sub 2} was removed using a standard release processes to realize a free-hung structure. Five different sized traps were fabricated with inner radii of 1, 1.5, 2, 5 and 10 {micro}m and heights ranging from 3-24 {micro}m. Simulations examined the effects of ion and neutral temperature, the pressure and nature of cooling gas, ion mass, trap voltage and frequency, space-charge, fabrication defects, and other parameters on the ability of micrometer-sized traps to store ions. The electrical characteristics of the ion trap arrays were determined. The capacitance was 2-500 pF for the various sized traps and arrays. The resistance was in the order of 1-2 {Omega}. The inductance of the arrays was calculated to be 10-1500 pH, depending on the trap and array sizes. The ion traps' field emission characteristics were assessed. It was determined that the traps could be operated up to 125 V while maintaining field emission currents below 1 x 10{sup -15} A. The testing focused on using the 5-{micro}m CITs to trap toluene (C{sub 7}H{sub 8}). Ion ejection from the traps was induced by termination of the RF voltage applied to the ring electrode and current measured on the collector electrode suggested trapping of ions in 1-10% of the traps. Improvements to the to the design of the traps were defined to minimize voltage drop to the substrate, thereby increasing trapping voltage applied to the ring electrode, and to

  9. A model for electrode effects using percolation theory

    International Nuclear Information System (INIS)

    Wuethrich, R.; Bleuler, H.

    2004-01-01

    Electrode effects are known for more than 150 years. These effects, with undesirable consequences in industrial aluminium electrolysis, can be used to micro-machine glass with Spark Assisted Chemical Engraving (SACE). In this paper, a novel approach for theoretical analysis of the phenomenon is proposed by considering the bubble growth and bubble departure from electrodes as a stochastic process. The critical conditions (critical voltage and current density) are predicted in function of electrode geometry and electrolyte concentration as well as the static mean current-voltage characteristics prior to the onset of the effects. The different regions of the current-voltage characteristics, as identified by previous authors, are described and explained. It is shown that all relevant processes for the onset of the electrodes effects happen in the adherence region of the bubble layer. The model is applied for vertical cylindrical electrodes and compared with experimental data

  10. Design of a microscopic electrical impedance tomography system using two current injections

    International Nuclear Information System (INIS)

    Liu, Qin; Oh, Tong In; Wi, Hun; Woo, Eung Je; Lee, Eun Jung; Seo, Jin Keun

    2011-01-01

    We describe a novel design of a microscopic electrical impedance tomography (micro-EIT) system for long-term noninvasive monitoring of cell or tissue cultures. The core of the micro-EIT system is a sample container including two pairs of current-injection electrodes and 360 voltage-sensing electrodes. In designing the container, we took advantage of a hexagonal structure with fixed dimensions and electrode configuration. This eliminated technical difficulties related to the unknown irregular boundary geometry of an imaging object in conventional medical EIT. Attaching a pair of large current-injection electrodes fully covering the left and right sides of the hexagonal container, we generated uniform parallel current density inside the container filled with saline. The 360 voltage-sensing electrodes were placed on the front, bottom and back sides of the hexagonal container in three sets of 8 × 15 arrays with equal gaps between them. We measured voltage differences between all neighboring pairs along the direction of the parallel current pathway. For the homogeneous container, all measured voltages must be the same since the voltage changes linearly along that direction. Any anomaly in the container perturbed the current pathways and therefore equipotential lines to produce different differential voltage data. For conductivity image reconstructions, we adopted a lately developed image reconstruction algorithm for this electrode configuration to first produce projected conductivity images on the front, bottom and back sides. Using a backprojection method, we reconstructed three-dimensional conductivity images from those projection images. To improve the image quality and also to meet the mathematical requirement on the uniqueness of a reconstructed image, we used a second pair of thin and long current-injection electrodes located at the middle of the front and back sides. This paper describes the design and construction of such a micro-EIT system with experimental

  11. Micro-Membrane Electrode Assembly Design to Precisely Measure the in Situ Activity of Oxygen Reduction Reaction Electrocatalysts for PEMFC.

    Science.gov (United States)

    Long, Zhi; Li, Yankai; Deng, Guangrong; Liu, Changpeng; Ge, Junjie; Ma, Shuhua; Xing, Wei

    2017-06-20

    An in situ micro-MEA technique, which could precisely measure the performance of ORR electrocatalyst using Nafion as electrolyte, was designed and compared with regular thin-film rotating-disk electrode (TFRDE) (0.1 M HClO 4 ) and normal in situ membrane electrode assembly (MEA) tests. Compared to the traditional TFRDE method, the micro-MEA technique makes the acquisition of catalysts' behavior at low potential values easily achieved without being limited by the solubility of O 2 in water. At the same time, it successfully mimics the structure of regular MEAs and obtains similar results to a regular MEA, thus providing a new technique to simply measure the electrode activity without being bothered by complicated fabrication of regular MEA. In order to further understand the importance of in situ measurement, Fe-N-C as a typical oxygen reduction reaction (ORR) free-Pt catalyst was evaluated by TFRDE and micro-MEA. The results show that the half wave potential of Fe-N-C only shifted negatively by -135 mV in comparison with state-of-the-art Pt/C catalysts from TFRDE tests. However, the active site density, mass transfer of O 2 , and the proton transfer conductivity are found to strongly influence the catalyst activity in the micro-MEA, thereby resulting in a much lower limiting current density than Pt/C (8.7 times lower). Hence, it is suggested that the micro-MEA is better in evaluating the in situ ORR performance, where the catalysts are characterized more thoroughly in terms of intrinsic activity, active site density, proton transfer, and mass transfer properties.

  12. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin

    2014-07-07

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that, similarly to the case of Au-vacuum-Au previously studied, the transition voltages of Ag and Pt metal-vacuum-metal junctions with atomic protrusions on the electrode surface are determined by the local density of states of the p-type atomic orbitals of the protrusion. Since the energy position of the Pt 6p atomic orbitals is higher than that of the 5p/6p of Ag and Au, the transition voltage of Pt-vacuum-Pt junctions is larger than that of both Ag-vacuum-Ag and Au-vacuum-Au junctions. When one moves to analyzing asymmetric molecular junctions constructed with biphenyl thiol as central molecule, then the transition voltage is found to depend on the specific bonding site for the sulfur atom in the thiol group. In particular agreement with experiments, where the largest transition voltage is found for Ag and the smallest for Pt, is obtained when one assumes S binding at the hollow-bridge site on the Ag/Au(111) surface and at the adatom site on the Pt(111) one. This demonstrates the critical role played by the linker-electrode binding geometry in determining the transition voltage of devices made of conjugated thiol molecules. © 2014 AIP Publishing LLC.

  13. Zoom system without moving element by using two liquid crystal lenses with spherical electrode

    Science.gov (United States)

    Yang, Ren-Kai; Lin, Chia-Ping; Su, Guo-Dung J.

    2017-08-01

    A traditional zoom system is composed of several elements moving relatively toward other components to achieve zooming. Unlike tradition system, an electrically control zoom system with liquid crystal (LC) lenses is demonstrated in this paper. To achieve zooming, we apply two LC lenses whose optical power is controlled by voltage to replace two moving lenses in traditional zoom system. The mechanism of zoom system is to use two LC lenses to form a simple zoom system. We found that with such spherical electrodes, we could operate LC lens at voltage range from 31V to 53 V for 3X tunability in optical power. For each LC lens, we use concave spherical electrode which provide lower operating voltage and great tunability in optical power, respectively. For such operating voltage and compact size, this zoom system with zoom ratio approximate 3:1 could be applied to mobile phone, camera and other applications.

  14. PWM Regulation of Grid-Tied PV System on the Base of Photovoltaic-Fed Diode-Clamped Inverters

    Directory of Open Access Journals (Sweden)

    Oleschuk V.I.

    2015-12-01

    Full Text Available Investigation of grid-tied photovoltaic system on the base of two diode-clamped inverters, controlled by specific algorithms of pulse-width modulation (PWM, has been done. This system includes two strings of photovoltaic panels feeding two diode-clamped inverters. The outputs of inverters are connected with the corresponding windings on the primary side of three-phase transformer, connected with a grid. In order to reduce phase voltage distortion and to increase efficiency of operation of the system, special scheme of control and modulation of inverters has been used, providing minimization of common-mode voltages and voltage waveforms symmetries under different operating conditions. Detailed simulation of processes in this photovoltaic-fed power conversion system has been executed. The results of simulations verify good performance of photovoltaic system regulated in accordance with specific strategy of control and modulation.

  15. An 11 μ w, two-electrode transimpedance biosignal amplifier with active current feedback stabilization.

    Science.gov (United States)

    Inan, O T; Kovacs, G T A

    2010-04-01

    A novel two-electrode biosignal amplifier circuit is demonstrated by using a composite transimpedance amplifier input stage with active current feedback. Micropower, low gain-bandwidth product operational amplifiers can be used, leading to the lowest reported overall power consumption in the literature for a design implemented with off-the-shelf commercial integrated circuits (11 μW). Active current feedback forces the common-mode input voltage to stay within the supply rails, reducing baseline drift and amplifier saturation problems that can be present in two-electrode systems. The bandwidth of the amplifier extends from 0.05-200 Hz and the midband voltage gain (assuming an electrode-to-skin resistance of 100 kΩ) is 48 dB. The measured output noise level is 1.2 mV pp, corresponding to a voltage signal-to-noise ratio approaching 50 dB for a typical electrocardiogram (ECG) level input of 1 mVpp. Recordings were taken from a subject by using the proposed two-electrode circuit and, simultaneously, a three-electrode standard ECG circuit. The residual of the normalized ensemble averages for both measurements was computed, and the power of this residual was 0.54% of the power of the standard ECG measurement output. While this paper primarily focuses on ECG applications, the circuit can also be used for amplifying other biosignals, such as the electroencephalogram.

  16. Clamping characteristics study on different types of clamping unit

    Energy Technology Data Exchange (ETDEWEB)

    Jiao, Zhiwei; Liu, Haichao; Xie, Pengcheng [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); Yang, Weimin [College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing China 100029 (China); State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing China 100029 (China)

    2015-05-22

    Plastic products are becoming more and more widely used in aerospace, IT, digital electronics and many other fields. With the development of technology, the requirement of product precision is getting higher and higher. However, type and working performance of clamping unit play a decisive role in product precision. Clamping characteristics of different types of clamping unit are discussed in this article, which use finite element numerical analysis method through the software ABAQUS to study the clamping uniformity, and detect the clamping force repeatability precision. The result shows that compared with toggled three-platen clamping unit, clamping characteristics of internal circulation two-platen clamping unit are better, for instance, its mold cavity deformation and force that bars and mold parting surface suffered are more uniform, and its clamping uniformity and repeatability precision is also better.

  17. Duo-Active-Neutral-Point-Clamped Multilevel Converter: An Exploration of the Fundamental Topology and Experimental Verification

    DEFF Research Database (Denmark)

    Dargahi, Vahid; Corzine, Keith A.; Enslin, Johan H.

    2018-01-01

    For medium-voltage (MV) industrial applications such as the HVDC and adjustable-speed ac-motor drives, the multilevel voltage-source converters are deemed the predominant topologies. One of the promising derived-topologies from the neutral-point-clamped (NPC) configuration is the active NPC (ANPC......) structure with an improved balanced lossdistribution performance. This paper introduces duo-ANPC (D-ANPC) converter topology, which is controlled with a new modulation technique. The suggested control method regulates the flying capacitor (FC) voltages naturally at their reference values and preserves...

  18. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  19. LED-Based High-Voltage Lines Warning System

    Directory of Open Access Journals (Sweden)

    Eldar MUSA

    2013-04-01

    Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

  20. A micro-coupling for micro mechanical systems

    Science.gov (United States)

    Li, Wei; Zhou, Zhixiong; Zhang, Bi; Xiao, Yunya

    2016-05-01

    The error motions of micro mechanical systems, such as micro-spindles, increase with the increasing of the rotational speed, which not only decreases the rotational accuracy, but also promotes instability and limits the maximum operational speed. One effective way to deal with it is to use micro-flexible couplings between the drive and driven shafts so as to reduce error motions of the driven shaft. But the conventional couplings, such as diaphragm couplings, elastomeric couplings, bellows couplings, and grooved couplings, etc, cannot be directly used because of their large and complicated structures. This study presents a novel micro-coupling that consists of a flexible coupling and a shape memory alloy (SMA)-based clamp for micro mechanical systems. It is monolithic and can be directly machined from a shaft. The study performs design optimization and provides manufacturing considerations, including thermo-mechanical training of the SMA ring for the desired Two-Way-Shape-Memory effect (TWSMe). A prototype micro-coupling and a prototype micro-spindle using the proposed coupling are fabricated and tested. The testing results show that the prototype micro-coupling can bear a torque of above 5 N • mm and an axial force of 8.5 N and be fitted with an SMA ring for clamping action at room temperature (15 °C) and unclamping action below-5 °C. At the same time, the prototype micro-coupling can work at a rotational speed of above 200 kr/min with the application to a high-speed precision micro-spindle. Moreover, the radial runout error of the artifact, as a substitute for the micro-tool, is less than 3 μm while that of turbine shaft is above 7 μm. It can be concluded that the micro-coupling successfully accommodates misalignment errors of the prototype micro-spindle. This research proposes a micro-coupling which is featured with an SMA ring, and it is designed to clamp two shafts, and has smooth transmission, simple assembly, compact structure, zero-maintenance and

  1. Analysis of low-pressure dc breakdown in nitrogen between two spherical iron electrodes

    International Nuclear Information System (INIS)

    Pejovic, Momcilo M.; Nesic, Nikola T.; Pejovic, Milic M.

    2006-01-01

    The influence of afterglow period τ, voltage increase rate k, and electrode gap d on breakdown voltage U b for a nitrogen-filled tube with spherical electrodes of diameter D>>d and p=6.5 mbar has been investigated. The data for the breakdown voltage were obtained for the case when there is a presence of N( 4 S) atoms, which release secondary electrons via recombination on the cathode. By fitting the experimental data of breakdown voltage mean values as a function of the voltage increase rate, the static breakdown voltages for afterglow periods of 15 and 100 s were estimated. The electrical field as a function of the electrode gap using breakdown voltage mean values was also determined. It is shown that experimental results of the breakdown voltage mean value as a function of pd in the interval of d from 0.82 to 1.62 mm can be very well described with Paschen's law, valid for the case of parallel-plate electrodes

  2. Higher order modes excitation of electrostatically actuated clamped–clamped microbeams: experimental and analytical investigation

    KAUST Repository

    Jaber, Nizar

    2016-01-06

    © 2016 IOP Publishing Ltd. In this study, we demonstrate analytically and experimentally the excitations of the higher order modes of vibrations in electrostatically actuated clamped-clamped microbeam resonators. The concept is based on using partial electrodes with shapes that induce strong excitation of the mode of interest. The devices are fabricated using polyimide as a structural layer coated with nickel from the top and chrome and gold layers from the bottom. Experimentally, frequency sweeps with different electro-dynamical loading conditions are shown to demonstrate the excitation of the higher order modes of vibration. Using a half electrode, the second mode is excited with high amplitude of vibration compared with almost zero response using the full electrode. Also, using a two-third electrode configuration is shown to amplify the third mode resonance amplitude compared with the full electrode under the same electrical loading conditions. An analytical model is developed based on the Euler-Bernollui beam model and the Galerkin method to simulate the device response. Good agreement between the simulation results and the experimental data is reported.

  3. Multilevel Converter by Cascading Two-Level Three-Phase Voltage Source Converter

    Directory of Open Access Journals (Sweden)

    Abdullrahman A. Al-Shamma’a

    2018-04-01

    Full Text Available This paper proposes a topology using isolated, cascaded multilevel voltage source converters (VSCs and employing two-winding magnetic elements for high-power applications. The proposed topology synthesizes 6 two-level, three-phase VSCs, so the power capability of the presented converter is six times the capability of each VSC module. The characteristics of the proposed topology are demonstrated through analyzing its current relationships, voltage relationships and power capability in detail. The power rating is equally shared among the VSC modules without the need for a sharing algorithm; thus, the converter operates as a single three-phase VSC. The comparative analysis with classical neutral-point clamped, flying capacitor and cascaded H-bridge exhibits the superior features of fewer insulated gate bipolar transistors (IGBTs, capacitor requirement and fewer diodes. To validate the theoretical performance of the proposed converter, it is simulated in a MATLAB/Simulink environment and the results are experimentally demonstrated using a laboratory prototype.

  4. Electron current extraction from radio frequency excited micro-dielectric barrier discharges

    International Nuclear Information System (INIS)

    Wang, Jun-Chieh; Kushner, Mark J.; Leoni, Napoleon; Birecki, Henryk; Gila, Omer

    2013-01-01

    Micro dielectric barrier discharges (mDBDs) consist of micro-plasma devices (10–100 μm diameter) in which the electrodes are fully or partially covered by dielectrics, and often operate at atmospheric pressure driven with radio frequency (rf) waveforms. In certain applications, it may be desirable to extract electron current out of the mDBD plasma, which necessitates a third electrode. As a result, the physical structure of the m-DBD and the electron emitting properties of its materials are important to its operation. In this paper, results from a two-dimensional computer simulation of current extraction from mDBDs sustained in atmospheric pressure N 2 will be discussed. The mDBDs are sandwich structures with an opening of tens-of-microns excited with rf voltage waveforms of up to 25 MHz. Following avalanche by electron impact ionization in the mDBD cavity, the plasma can be expelled from the cavity towards the extraction electrode during the part of the rf cycle when the extraction electrode appears anodic. The electron current extraction can be enhanced by biasing this electrode. The charge collection can be controlled by choice of rf frequency, rf driving voltage, and permittivity of the dielectric barrier.

  5. Large gap plasma display cell with auxiliary electrodes: macro-cell experiments and two-dimensional modelling

    International Nuclear Information System (INIS)

    Ouyang, J T; Callegari, Th; Caillier, B; Boeuf, J-P

    2003-01-01

    In this paper we use a two-dimensional fluid model and a 'macroscopic' PDP cell to investigate the possibility of using large gap configurations with auxiliary electrodes to improve the efficiency of PDP discharge cells. The large gap allows operation in a transient positive column regime where energy is more efficiently deposited into xenon excitation, while the auxiliary electrodes are used to keep reasonable values of the operating voltage. Two types of auxiliary electrode configurations (floating and powered) are considered. The discharge characteristics and the discharge efficiency in exciting xenon are studied with simulations and by measuring the intensity of infrared emission from xenon and visible emission from neon in a macroscopic PDP cell. The results show that an efficient positive column regime can be achieved at reasonably low operating voltages when the auxiliary electrode configuration is carefully designed

  6. Comparative Study of Modulation Techniques for Two-Level Voltage Source Inverters

    Directory of Open Access Journals (Sweden)

    Barry W. Williams

    2016-06-01

    Full Text Available A detailed comparative study of modulation techniques for single and three phase dc-ac inverters is presented.  Sinusoidal Pulse Width Modulation, Triplen Sinusoidal Pulse Width Modulation, Space Vector Modulation, Selective Harmonic Elimination and Wavelet Modulation are assessed and compared in terms of maximum fundamental output, harmonic performance, switching losses and operational mode.  The presented modulation techniques are applied to single and three phase voltage source inverters and are simulated using SIMULINK.  The simulation results clarify the inverter performance achieved using the different modulations techniques.

  7. Functionality and stability data of detergent purified nAChR from Torpedo using lipidic matrixes and macroscopic electrophysiology

    Directory of Open Access Journals (Sweden)

    Luis F. Padilla-Morales

    2016-03-01

    Full Text Available The presented data provides additional information about the assessment of affinity purified nicotinic acetylcholine receptor (nAChR rich membrane solubilized with long chain (16 saturated carbons lysophospholipid with glycerol headgroup (LFG-16. The assessment of stability and functionality of solubilized membrane protein is a critical step prior to further crystallization trails. One of the key factors for this task is the appropriate choice of a detergent that can support nAChR activity and stability comparable to the crude membranes. The stability of the nAChR-LFG-16 complex incorporated into lipid cubic phase (LCP was monitored for a period of 30 days by means of fluorescence recovery after photobleaching (FRAP and the functionality was evaluated after its incorporation into Xenopus oocyte by means of the two electrode voltage clamp technique. Keywords: Detergents, Fluorescence recovery after photobleaching, Lipidic Cubic Phase, nAChR, Planar lipid bilayer, Two-electrode voltage clamp

  8. A Hybrid Cascade Converter Topology With Series-Connected Symmetrical and Asymmetrical Diode-Clamped H-Bridge Cells

    DEFF Research Database (Denmark)

    Nami, Alireza; Zare, Firuz; Ghosh, Arindam

    2011-01-01

    to approach a very low total harmonic distortion of voltage and current, which leads to the possible elimination of the output filter. Regarding the proposed configuration, a new cascade inverter is verified by cascading an asymmetrical diode-clamped inverter, in which 19 levels can be synthesized in output......A novel H-bridge multilevel pulsewidth modulation converter topology based on a series connection of a high-voltage diode-clamped inverter and a low-voltage conventional inverter is proposed in this paper. A dc link voltage arrangement for the new hybrid and asymmetric solution is presented to have...... voltage with the same number of components. To balance the dc link capacitor voltages for the maximum output voltage resolution as well as synthesize asymmetrical dc link combination, a new multi-output boost converter is utilized at the dc link voltage of a seven-level H-bridge diode-clamped inverter...

  9. Micro supercapacitors based on a 3D structure with symmetric graphene or activated carbon electrodes

    Science.gov (United States)

    Li, Siwei; Wang, Xiaohong; Xing, Hexin; Shen, Caiwei

    2013-11-01

    This paper presents three-dimensional (3D) micro supercapacitors with thick interdigital electrodes supported and separated by SU-8. Nanoporous carbon materials including graphene and activated carbon (AC) are used as active materials in self-supporting composites to build the electrodes. The SU-8 separators provide mechanical support for thick electrodes and allow a considerable amount of material to be loaded in a limited footprint area. The prototypes have been accomplished by a simple microelectromechanical systems (MEMS) fabrication process and sealed by polydimethylsiloxane (PDMS) caps with ionic liquid electrolytes injected into the electrode area. Electrochemical tests demonstrate that the graphene-based prototype with 100 µm thick electrodes shows good power performance and provides a considerable specific capacitance of about 60 mF cm-2. Two AC-based prototypes show larger capacitance of 160 mF cm-2 and 311 mF cm-2 with 100 µm and 200 µm thick electrodes respectively, because of higher volume density of the material. The results demonstrate that both thick 3D electrode structure and volume capacitance of the electrode material are key factors for high-performance micro supercapacitors, which can be potentially used in specific applications such as power suppliers and storage components for harvesters.

  10. Neutral-point voltage dynamic model of three-level NPC inverter for reactive load

    DEFF Research Database (Denmark)

    Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

    2012-01-01

    A three-level neutral-point-clamped inverter needs a controller for the neutral-point voltage. Typically, the controller design is based on a dynamic model. The dynamic model of the neutral-point voltage depends on the pulse width modulation technique used for the inverter. A pulse width modulati...

  11. Cooperation of micro- and meso-porous carbon electrode materials in electric double-layer capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Cheng [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, 5625 Renmin Street, Changchun 130022, Jilin Province (China); Graduate University of Chinese Academy of Sciences, Beijing 100039 (China); Qi, Li; Wang, Hongyu [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, 5625 Renmin Street, Changchun 130022, Jilin Province (China); Yoshio, Masaki [Advanced Research Center, Saga University, 1341 Yoga-machi, Saga 840-0047 (Japan)

    2010-07-01

    The capacitive characteristics of micro- and meso-porous carbon materials have been compared in cyclic voltammetric studies and galvanostatic charge-discharge tests. Meso-porous carbon can keep certain high capacitance values at high scan rates, whereas micro-porous carbon possesses very high capacitance values at low scan rates but fades quickly as the scan rate rises up. For better performance of electric double-layer capacitors (EDLCs), the cooperative application of both kinds of carbon materials has been proposed in the following two ways: mixing both kinds of carbons in the same electrode or using the asymmetric configuration of carbon electrodes in the same EDLC. The cooperative effect on the electrochemical performance has also been addressed. (author)

  12. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  13. Control Strategy of Two Capacitor Voltages for Separate MPPTs in Photovoltaic Systems Using Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Choi, Ui-Min; Blaabjerg, Frede; Lee, Kyo-Beum

    2015-01-01

    The centralized topology with three-level inverters are widely used in photovoltaic (PV) systems due to their less installation costs and complexity. However, the common maximum power point tracking (MPPT) is a disadvantage of the centralized topology particularly under the partial shading...... and panel mismatch conditions. In this system, if PV modules are separately connected to the split capacitor voltage, the MPPT efficiency can be improved by the proposed control strategy. By the proposed method, the two capacitor voltages can be controlled asymmetrically to perform the separate MPPTs...... of each PV module connected to separate capacitors. The outputs can be generated without distortion even if two capacitors are asymmetrically regulated. Simulation and experimental results verify the validity and feasibility of the proposed methods....

  14. Research of Dielectric Breakdown Micro fluidic Sampling Chip

    International Nuclear Information System (INIS)

    Jiang, F.; Lei, Y.; Yu, J.

    2013-01-01

    Micro fluidic chip is mainly driven electrically by external electrode and array electrode, but there are certain disadvantages in both of ways, which affect the promotion and application of micro fluidic technology. This paper discusses a scheme that uses the conductive solution in a microchannel made by PDMS, replacing electrodes and the way of dielectric breakdown to achieve microfluidic chip driver. It could reduce the driving voltage and simplify the chip production process. To prove the feasibility of this method, we produced a micro fluidic chip used in PDMS material with the lithography technology and experimented it. The results showed that using the dielectric breakdown to achieve microfluidic chip driver is feasible, and it has certain application prospect.

  15. Study of surface atmospheric pressure glow discharge plasma based on ultrathin laminated electrodes in air

    Science.gov (United States)

    Zhao, Luxiang; Liu, Wenzheng; Li, Zhiyi; Ma, Chuanlong

    2018-05-01

    A method to generate large-area surface plasma in air by micro-discharge is proposed. Two ultrathin laminated electrode structures of non-insulating and insulating types were formed by using the nanoscale ITO conductive layer. The surface glow discharge in atmospheric air is realized in low discharge voltage by constructing the special electric field of two-dimensional unidirectional attenuation. In particular, the insulating electrode structure can avoid the loss of ITO electrodes so that the discharge stability can be increased, and the treated objects can be prevented from metal ion pollution caused by the electrode in the discharge. It has broad application prospects in the fields of aerodynamics and material surface treatment.

  16. Efficiency enhancement of silicon nanowire solar cells by using UV/Ozone treatments and micro-grid electrodes

    Science.gov (United States)

    Chen, Junyi; Subramani, Thiyagu; Sun, Yonglie; Jevasuwan, Wipakorn; Fukata, Naoki

    2018-05-01

    Silicon nanowire solar cells were fabricated by metal catalyzed electroless etching (MCEE) followed by thermal chemical vapor deposition (CVD). In this study, we investigated two effects, a UV/ozone treatment and the use of a micro-grid electrodes, to enhance light absorption and reduce the optic losses in the solar cell device. The UV/ozone treatment successfully improved the conversion efficiency. The micro-grid electrodes were then applied in solar cell devices subjected to a back surface field (BSF) treatment and rapid thermal annealing (RTA). These effects improved the conversion efficiency from 9.4% to 10.9%. Moreover, to reduce surface recombination and improve the continuity of front electrodes, we optimized the etching time of the MCEE process, giving a high efficiency of 12.3%.

  17. Cell voltage versus electrode potential range in aqueous supercapacitors

    OpenAIRE

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...

  18. Determination of formation heterogeneity at a range of scales using novel multi-electrode resistivity scanning techniques

    International Nuclear Information System (INIS)

    Williams, G.M.; Jackson, P.D.; Ward, R.S.; Sen, M.A.; Meldrum, P.; Lovell, M.

    1991-01-01

    The traditional method of measuring ground resistivity involves passing a current through two outer electrodes, measuring the potential developed across two electrodes in between, and applying Ohm's Law. In the RESCAN system developed by the British Geological Survey, each electrode can be electronically selected and controlled by software to either pass current or measure potential. Thousands of electrodes can be attached to the system either in 2-D surface arrays or along special plastic covered probes driven vertically into the ground or emplaced in boreholes. Under computer control, the resistivity distribution within the emplaced array can be determined automatically with unprecedented detail and speed, and may be displayed as an image. So far, the RESCAN system has been applied at the meso-scale in monitoring the radial migration of an electrolyte introduced into a recharge well in an unconsolidated aquifer; and CORSCAN at the micro-scale on drill cores to evaluate spatial variability in physical properties. The RESCAN technique has considerable potential for determining formation heterogeneity at different scales and provides a basis for developing stochastic models of groundwater and solute flow in heterogeneous systems. 13 figs.; 1 tab.; 12 refs

  19. Three Level Diode Clamped Inverter Fed Induction Motor with Dtc-Svm

    OpenAIRE

    V. Ranjith Kumar

    2013-01-01

    This project presents a three-level diode-clamped inverter feeding an asynchronous motor drive with direct torque control (DTC). The control method is based on DTC operating principles. The stator voltage vector reference is computed from the stator flux and torque errors imposed by the flux and torque controllers. This voltage reference is then generated using a diode-clamped inverter, where each phase of the inverter can be implemented using a dc source, which would be available from fuel c...

  20. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  1. Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

    2010-12-15

    We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

  2. The Stiffness Variation of a Micro-Ring Driven by a Traveling Piecewise-Electrode

    Directory of Open Access Journals (Sweden)

    Yingjie Li

    2014-09-01

    Full Text Available In the practice of electrostatically actuated micro devices; the electrostatic force is implemented by sequentially actuated piecewise-electrodes which result in a traveling distributed electrostatic force. However; such force was modeled as a traveling concentrated electrostatic force in literatures. This article; for the first time; presents an analytical study on the stiffness variation of microstructures driven by a traveling piecewise electrode. The analytical model is based on the theory of shallow shell and uniform electrical field. The traveling electrode not only applies electrostatic force on the circular-ring but also alters its dynamical characteristics via the negative electrostatic stiffness. It is known that; when a structure is subjected to a traveling constant force; its natural mode will be resonated as the traveling speed approaches certain critical speeds; and each natural mode refers to exactly one critical speed. However; for the case of a traveling electrostatic force; the number of critical speeds is more than that of the natural modes. This is due to the fact that the traveling electrostatic force makes the resonant frequencies of the forward and backward traveling waves of the circular-ring different. Furthermore; the resonance and stability can be independently controlled by the length of the traveling electrode; though the driving voltage and traveling speed of the electrostatic force alter the dynamics and stabilities of microstructures. This paper extends the fundamental insights into the electromechanical behavior of microstructures driven by electrostatic forces as well as the future development of MEMS/NEMS devices with electrostatic actuation and sensing.

  3. A CMOS Micro-power, Class-AB “Flipped” Voltage Follower using the quasi floating-gate technique

    Directory of Open Access Journals (Sweden)

    Juan Jesus Ocampo-Hidalgo

    2017-05-01

    Full Text Available This paper presents the design and characterization of a new analog voltage follower for low-voltage applications. The main idea is based on the “Flipped” Voltage Follower and the use of the quasi-floating gate technique for achieving class AB operation. A test cell was simulated and fabricated using a 0,5 μm CMOS technology. When the proposed circuit is supplied with VDD = 1,5 V, it presents a power consumption of only 413 μW. Measurement and experimental results show a gain bandwidth product of 10 MHz and a total harmonic distortion of 1,12 % at 1 MHz.

  4. Effect of non-uniform Hall parameter on the electrode voltage drop in Faraday-type combustion MHD generators

    International Nuclear Information System (INIS)

    Gupta, G.P.; Rohatgi, V.K.

    1982-01-01

    Following a simplified approach, an expression is derived for the gas-dynamic voltage drop in a finitely segmented Faraday-type combustion MHD generator, taking into account the non-uniform Hall parameter across the channel. Combining the electrical sheath voltage drop, discussed briefly, with the gas-dynamic voltage drop, the effect of a non-uniform Hall parameter on the electrode voltage drop is studied using the theoretical and experimental input parameters of the Indian MHD channel test. The condition for the validity of the usual assumption of uniform Hall parameter across the channel is pointed out. Analysis of the measured electrode voltage drop predicts the real gas conductivity in the core to be in the range of 60 to 75 per cent of the theoretically calculated core conductivity. (author)

  5. Strain response of stretchable micro-electrodes: Controlling sensitivity with serpentine designs and encapsulation

    International Nuclear Information System (INIS)

    Gutruf, Philipp; Walia, Sumeet; Nur Ali, Md; Sriram, Sharath; Bhaskaran, Madhu

    2014-01-01

    The functionality of flexible electronics relies on stable performance of thin film micro-electrodes. This letter investigates the behavior of gold thin films on polyimide, a prevalent combination in flexible devices. The dynamic behavior of gold micro-electrodes has been studied by subjecting them to stress while monitoring their resistance in situ. The shape of the electrodes was systematically varied to examine resistive strain sensitivity, while an additional encapsulation was applied to characterize multilayer behavior. The realized designs show remarkable tolerance to repetitive strain, demonstrating that curvature and encapsulation are excellent approaches for minimizing resistive strain sensitivity to enable durable flexible electronics

  6. Multi-mode excitation of a clamped–clamped microbeam resonator

    KAUST Repository

    Younis, Mohammad I.

    2015-02-18

    We present modeling and simulation of the nonlinear dynamics of a microresonator subjected to two-source electrostatic excitation. The resonator is composed of a clamped–clamped beam excited by a DC voltage load superimposed to two AC voltage loads of different frequencies. One frequency is tuned close to the first natural frequency of the beam and the other is close to the third (second symmetric) natural frequency. A multi-mode Galerkin procedure is applied to extract a reduced-order model, which forms the basis of the numerical simulations. Time history response, Poincare’ sections, Fast Fourier Transforms FFT, and bifurcation diagrams are used to reveal the dynamics of the system. The results indicate complex nonlinear phenomena, which include quasiperiodic motion, torus bifurcations, and modulated chaotic attractors.

  7. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

    Science.gov (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

    2018-03-24

    further protocols: a series of traditional square step voltage clamps, and also a novel voltage clamp comprising a collection of physiologically relevant action potentials. We demonstrate that we can make predictive cell-specific models that outperform the use of averaged data from a number of different cells, and thereby examine which changes in gating are responsible for cell-cell variability in current kinetics. Our technique allows rapid collection of consistent and high quality data, from single cells, and produces more predictive mathematical ion channel models than traditional approaches. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  8. A patch-clamp ASIC for nanopore-based DNA analysis.

    Science.gov (United States)

    Kim, Jungsuk; Maitra, Raj; Pedrotti, Kenneth D; Dunbar, William B

    2013-06-01

    In this paper, a fully integrated high-sensitivity patch-clamp system is proposed for single-molecule deoxyribonucleic acid (DNA) analysis using a nanopore sensor. This system is composed of two main blocks for amplification and compensation. The amplification block is composed of three stages: 1) a headstage, 2) a voltage-gain difference amplifier, and 3) a track-and-hold circuit, that amplify a minute ionic current variation sensed by the nanopore while the compensation block avoids the headstage saturation caused by the input parasitic capacitances during sensing. By employing design techniques novel for this application, such as an instrumentation--amplifier topology and a compensation switch, we minimize the deleterious effects of the input-offset voltage and the input parasitic capacitances while attaining hardware simplicity. This system is fabricated in a 0.35 μm 4M2P CMOS process and is demonstrated using an α-hemolysin protein nanopore for detection of individual molecules of single-stranded DNA that pass through the 1.5 nm-diameter pore. In future work, the refined system will functionalize single and multiple solid-state nanopores formed in integrated microfluidic devices for advanced DNA analysis, in scientific and diagnostic applications.

  9. Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes

    KAUST Repository

    Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

    2014-01-01

    The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green's function formalism combined with density functional theory. Our calculations show that, similarly

  10. Two-dimensional threshold voltage model and design considerations for gate electrode work function engineered recessed channel nanoscale MOSFET: I

    International Nuclear Information System (INIS)

    Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj

    2009-01-01

    This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology

  11. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  12. Analytic analysis on asymmetrical micro arcing in high plasma potential RF plasma systems

    International Nuclear Information System (INIS)

    Yin, Y; McKenzie, D R; Bilek, M M M

    2006-01-01

    We report experimental and analytical results on asymmetrical micro arcing in a RF (radio frequency) plasma. Micro arcing, resulting from high plasma potential, in RF plasma was found to occur only on the grounded electrode for a variety of electrode and surface configurations. The analytic derivation was based on a simple RF time-dependent Child-Langmuir sheath model and electric current continuity. We found that the minimum potential difference in one RF period across the grounded electrode sheath depends on the area ratio of the grounded electrode to the powered electrode. As the area ratio increases, the minimum potential difference across a sheath increases for the grounded electrode but not for the RF powered electrode. We showed that discharge time in micro arcing is more than 100 RF periods; thus the presence of a continuous high electric field in one RF cycle results in micro arcing on the grounded electrode. However, the minimum potential difference in one RF period across the powered electrode sheath is always small so that it prevents micro arcing occurring even though the average sheath voltage can be large. This simple analytic model is consistent with particle-in-cell simulation results

  13. A curved electrode electrostatic actuator designed for large displacement and force in an underwater environment

    International Nuclear Information System (INIS)

    Preetham, B S; Lake, Melinda A; Hoelzle, David J

    2017-01-01

    There is a need for the development of large displacement ( O (10 −6 ) m) and force ( O (10 −6 ) N) electrostatic actuators with low actuation voltages (<  ±8 V) for underwater bio- MEMS applications. In this paper, we present the design, fabrication, and characterization of a curved electrode electrostatic actuator in a clamped–clamped beam configuration meant to operate in an underwater environment. Our curved electrode actuator is unique in that it operates in a stable manner past the pull-in instability. Models based on the Rayleigh–Ritz method accurately predict the onset of static instability and the displacement versus voltage function, as validated by quasistatic experiments. We demonstrate that the actuator is capable of achieving a large peak-to-peak displacement of 19.5 µ m and force of 43 µ N for a low actuation voltage of less than  ±8 V and is thus appropriate for underwater bio -MEMS applications. (paper)

  14. High Operating Voltage Supercapacitor Using PPy/AC Composite Electrode Based on Simple Dipping Method

    Directory of Open Access Journals (Sweden)

    Kyoungho Kim

    2015-01-01

    Full Text Available As various wearable devices are emerging, self-generated power sources, such as piezoelectric generators, triboelectric generators, and thermoelectric generators, are of interest. To adapt self-generated power sources for application devices, a supercapacitor is necessary because of the short generation times (1–10 ms and low generated power (1–100 μW of self-generated power sources. However, to date, supercapacitors are too large to be adapted for wearable devices. There have been many efforts to reduce the size of supercapacitors by using polypyrrole (PPy for high energy supercapacitor electrodes. However, these supercapacitors have several disadvantages, such as a low operating voltage due to the use of an aqueous electrolyte, and complex manufacturing methods, such as the hydrogel and aerosol methods. In particular, the low operating voltage (~1.0 V is a significant issue because most electronic components operate above 3.0 V. In this study, we successfully demonstrated the high operating voltage (3.0 V of a supercapacitor using a PPy/activated carbon (AC composite electrode based on the chemical polymerization of the PPy by simple dipping. In addition, a twofold enhancement of its energy density was achieved compared with conventional supercapacitors using AC electrodes.

  15. Two-dimensional tracking of a motile micro-organism allowing high-resolution observation with various imaging techniques

    International Nuclear Information System (INIS)

    Oku, H.; Ogawa, N.; Ishikawa, M.; Hashimoto, K.

    2005-01-01

    In this article, a micro-organism tracking system using a high-speed vision system is reported. This system two dimensionally tracks a freely swimming micro-organism within the field of an optical microscope by moving a chamber of target micro-organisms based on high-speed visual feedback. The system we developed could track a paramecium using various imaging techniques, including bright-field illumination, dark-field illumination, and differential interference contrast, at magnifications of 5 times and 20 times. A maximum tracking duration of 300 s was demonstrated. Also, the system could track an object with a velocity of up to 35 000 μm/s (175 diameters/s), which is significantly faster than swimming micro-organisms

  16. Processing of Micro and Nanofibers of Polypyrrole/Polyethylene Oxide/Nylon-6 by the Technique of Electrospinning

    Directory of Open Access Journals (Sweden)

    Olvera-Gracia Manuel

    2013-10-01

    Full Text Available Micro and nano-fibers from polymers in solution can be easily obtained by using the so called electrospinning technique. The principle of this technique relies on apply- ing a positive voltage to the polymer solution and a negative voltage to a collector. By increasing voltage, the surface tension will be overcome and will eject some kind of fiber deposited on the collector. The continuous fibers production will be formed like a membrane. The fibers provide a large surface area due to their small diameter, therefore, their application is considered of commercial and scientific interest. In this study, fibers from a solution made of nylon-6, polyethylene oxide and polypyrrole were obtained. Chloroform and formic acid were used as solvents for these polymers. The fibers obtained were characterized by scanning electron microscopy, FT-IR spectroscopy, X-ray diffraction and electrical conductivity. These results indicate that the diameters of the composite fibers are on the micro and nanometric range, and the conductivity thereof is that of a semiconductor material.

  17. Visualizing the transient electroosmotic flow and measuring the zeta potential of microchannels with a micro-PIV technique.

    Science.gov (United States)

    Yan, Deguang; Nguyen, Nam-Trung; Yang, Chun; Huang, Xiaoyang

    2006-01-14

    We have demonstrated a transient micro particle image velocimetry (micro-PIV) technique to measure the temporal development of electroosmotic flow in microchannels. Synchronization of different trigger signals for the laser, the CCD camera, and the high-voltage switch makes this measurement possible with a conventional micro-PIV setup. Using the transient micro-PIV technique, we have further proposed a method on the basis of inertial decoupling between the particle electrophoretic motion and the fluid electroosmotic flow to determine the electrophoretic component in the particle velocity and the zeta potential of the channel wall. It is shown that using the measured zeta potentials, the theoretical predictions agree well with the transient response of the electroosmotic velocities measured in this work.

  18. Evaluation of diagnostic technique for degradation of low-voltage electric cables with silicone rubber insulator

    International Nuclear Information System (INIS)

    Mikami, Masao

    2005-01-01

    As a part of countermeasures against ageing problems of nuclear power plants, it is requested to establish non-destructive diagnostic technique for their degradation of low voltage electric cables and assessment standard of their life. Having aimed at investigating the degradation of low-voltage electric cable with silicone rubber insulator, change of its surface hardness at elevated temperature were measured by indenter modules. Moreover, we also measured the elongation at break, which is regarded as general degradation index of electric cables, and the surface hardness with a micro hardness meter. Consequently, it is seen that the indenter modulus measurement is (1) capable to obtain general feature of the thermal degradation of silicone rubber insulator, (2) applicable to diagnose the degree of degradation of the electric cable by converting the result to elongation at break, (3) well correlated with the hardness measurement of the electric cable with the micro hardness meter. (author)

  19. Some questions of the technique of high-voltage testing of accele-- rating tube space in electrostatic accelerators

    International Nuclear Information System (INIS)

    Romanov, V.A.; Ivanov, V.V.; Mukhametshin, V.I.; Dmitriev, E.P.; Kidalov, A.I.

    1983-01-01

    In the course of high-voltage testing of accelerating spaces a wide spread of experimental values of electric strength is observed. This circumstance is determined by a number of factors one of which is the technique used for high-voltage testing. For the purpose of obtaining more reliable experimental data on electric strength of accelerating spaces it is suggested to take for a criterion of electric strength of an accelerating space in long accelerating tubes a long-time withstood voltage which is equal approximately to a doubled working space voltage obtained as a result of a smooth voltage rise at dark current density not exceeding (1...5)x10 -2 A/cm 2 . In the course of testing of accelerating spaces of 25 mm height with total working area of electrodes approximately 360 cm 2 and insulator area onto vacuum approximately 150 cm 2 a long-time 70 kV voltage with dark current less than 1.10 -8 A is obtained

  20. Mechanical nonlinearity elimination with a micromechanical clamped-free semicircular beams resonator

    Science.gov (United States)

    Chen, Dongyang; Chen, Xuying; Wang, Yong; Liu, Xinxin; Guan, Yangyang; Xie, Jin

    2018-04-01

    This paper reports a micro-machined clamped-free semicircular beam resonator aiming to eliminate the nonlinearity that widely exists in traditional mechanical resonators. Cubic coefficients over vibration displacement due to axial extension of the beams are analyzed through theoretical modelling, and the corresponding frequency effect is demonstrated. With the device working in the elastic vibration mode, the cubic coefficients are eliminated by using a free end to release the nonlinear extension of beams and thus the inside axial stress. The amplitude-frequency (A-f) effect is overcome in a large region of source power, and the coefficient of frequency softening is linearized in a large region of polarization voltage. As a result, the resonator can be driven at larger vibration amplitude to achieve a high signal to noise ratio and power handling performance.

  1. The effect of thermal conductivity of the tool electrode in spark-assisted chemical engraving gravity-feed micro-drilling

    International Nuclear Information System (INIS)

    Mousa, M; Allagui, A; Ng, H D; Wüthrich, R

    2009-01-01

    Spark-assisted chemical engraving (SACE) is a non-traditional micro-machining technology based on electrochemical discharge phenomena. In SACE gravity-feed micro-drilling, various parameters including the thermal properties of the tool electrode play a significant role in the process. Based on a series of experiments using tool electrodes with different thermal properties, the effect in SACE gravity-feed micro-drilling is discussed. It is demonstrated that machining with higher thermal conductivity tool electrodes results in faster machining during the discharge regime and slower machining during the hydrodynamic regime of SACE gravity-feed micro-drilling

  2. A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

    International Nuclear Information System (INIS)

    Pei, Chengquan; Tian, Jinshou; Liu, Zhen; Qin, Hong; Wu, Shengli

    2017-01-01

    A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.

  3. A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

    Energy Technology Data Exchange (ETDEWEB)

    Pei, Chengquan [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Tian, Jinshou [Xi’an Institute of Optics and Precision Mechanics, Chinese Academy of Sciences, Xi' an 710119 (China); Liu, Zhen [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Qin, Hong [School of Computer Science and Technology, Xi' an University of Science and Technology, Xi' an 710054 (China); Wu, Shengli, E-mail: slwu@mail.xjtu.edu.cn [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China)

    2017-04-11

    A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.

  4. Intelligent voltage control in a DC micro-grid containing PV generation and energy storage

    OpenAIRE

    Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro

    2014-01-01

    This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...

  5. Effect of applied voltage on phase components of composite coatings prepared by micro-arc oxidation

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Wenjun [Department of Prosthodontics, Guanghua School of Stomatology, Sun Yat-sen University, Guangzhou 510055 (China); Fang, Yu-Jing [Department of Colorectal Surgery, State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center, Guangzhou 510060 (China); Zheng, Huade [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); Tan, Guoxin [Guangdong University of Technology, Guangdong Province 510006 (China); Cheng, Haimei [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); Ning, Chengyun, E-mail: imcyning@scut.edu.cn [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China)

    2013-10-01

    In this report, we present results from our experiments on composite coatings formed on biomedical titanium substrates by micro-arc oxidation (MAO) in constant-voltage mode. The coatings were prepared on the substrates in an aqueous electrolyte containing calcium acetate and β-glycerol phosphate disodium salt pentahydrate (β-GP). We analyzed the element distribution and phase components of the coatings prepared at different voltages by X-ray diffraction, thin-coating X-ray diffraction, electron-probe microanalysis, and Fourier-transform infrared spectroscopy. The results show that the composite coatings formed at 500 V consist of titania (TiO{sub 2}), hydroxylapatite (HA), and calcium carbonate (CaCO{sub 3}). Furthermore, the concentration of Ca, P, and Ti gradually changes with increasing applied voltage, and the phase components of the composite coatings gradually change from the bottom of the coating to the top: the bottom layer consists of TiO{sub 2}, the middle layer consists of TiO{sub 2} and HA, and the top layer consists of HA and a small amount of CaCO{sub 3}. The formation of HA directly on the coating surface by MAO technique can greatly enhance the surface bioactivity. - Highlights: • Coatings prepared on biomedical titanium substrate by micro-arc oxidation • Coatings composed of titania, hydroxyapatite and calcium carbonate • Hydroxyapatite on the coating surface can enhance the surface bioactivity.

  6. Characterizing the Effects of Micro Electrical Discharge Machining Parameters on Material Removal Rate during Micro EDM Drilling of Tungsten Carbide (WC-Co)

    Science.gov (United States)

    Hourmand, Mehdi; Sarhan, Ahmed A. D.; Sayuti, Mohd

    2017-10-01

    Micro-dies, molds and miniaturized products can be manufactured using micro EDM process. In this research, EDM machine and on-machine fabricated CuW micro-electrode were utilized to produce the micro holes in WC-16%Co. The effects of voltage, current, pulse ON time, pulse OFF time, capacitor and rotating speed on Material removal rate (MRR) during micro EDM drilling of WC-16% Co was analyzed using fractional factorial design method. ANOVA analysis shows that increasing current, rotating speed, capacitor and decreasing voltage and pulse ON time lead to the amplify in MRR. It was found that out of all the factors, current and capacitor had the most significant effect on MRR, while the effect of capacitor was more than current. Eventually, it can be concluded that micro holes can be produced using EDM machine.

  7. Modulation of voltage-gated channel currents by harmaline and harmane.

    Science.gov (United States)

    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

    2005-01-01

    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

  8. A High-Voltage SOI CMOS Exciter Chip for a Programmable Fluidic Processor System.

    Science.gov (United States)

    Current, K W; Yuk, K; McConaghy, C; Gascoyne, P R C; Schwartz, J A; Vykoukal, J V; Andrews, C

    2007-06-01

    A high-voltage (HV) integrated circuit has been demonstrated to transport fluidic droplet samples on programmable paths across the array of driving electrodes on its hydrophobically coated surface. This exciter chip is the engine for dielectrophoresis (DEP)-based micro-fluidic lab-on-a-chip systems, creating field excitations that inject and move fluidic droplets onto and about the manipulation surface. The architecture of this chip is expandable to arrays of N X N identical HV electrode driver circuits and electrodes. The exciter chip is programmable in several senses. The routes of multiple droplets may be set arbitrarily within the bounds of the electrode array. The electrode excitation waveform voltage amplitude, phase, and frequency may be adjusted based on the system configuration and the signal required to manipulate a particular fluid droplet composition. The voltage amplitude of the electrode excitation waveform can be set from the minimum logic level up to the maximum limit of the breakdown voltage of the fabrication technology. The frequency of the electrode excitation waveform can also be set independently of its voltage, up to a maximum depending upon the type of droplets that must be driven. The exciter chip can be coated and its oxide surface used as the droplet manipulation surface or it can be used with a top-mounted, enclosed fluidic chamber consisting of a variety of materials. The HV capability of the exciter chip allows the generated DEP forces to penetrate into the enclosed chamber region and an adjustable voltage amplitude can accommodate a variety of chamber floor thicknesses. This demonstration exciter chip has a 32 x 32 array of nominally 100 V electrode drivers that are individually programmable at each time point in the procedure to either of two phases: 0deg and 180deg with respect to the reference clock. For this demonstration chip, while operating the electrodes with a 100-V peak-to-peak periodic waveform, the maximum HV electrode

  9. Precision of single-engage micro Hall effect measurements

    DEFF Research Database (Denmark)

    Henrichsen, Henrik Hartmann; Hansen, Ole; Kjær, Daniel

    2014-01-01

    Recently a novel microscale Hall effect measurement technique has been developed to extract sheet resistance (RS), Hall sheet carrier density (NHS) and Hall mobility (μH) from collinear micro 4-point probe measurements in the vicinity of an insulating boundary [1]. The technique measures in less...... than a minute directly the local transport properties, which enables in-line production monitoring on scribe line test pads [2]. To increase measurement speed and reliability, a method in which 4-point measurements are performed using two different electrode pitches has been developed [3......]. In this study we calculate the measurement error on RS, NHS and μH resulting from electrode position errors, probe placement, sample size and Hall signal magnitude. We show the relationship between measurement precision and electrode pitch, which is important when down-scaling the micro 4-point probe to fit...

  10. The application of phase contrast X-ray techniques for imaging Li-ion battery electrodes

    Science.gov (United States)

    Eastwood, D. S.; Bradley, R. S.; Tariq, F.; Cooper, S. J.; Taiwo, O. O.; Gelb, J.; Merkle, A.; Brett, D. J. L.; Brandon, N. P.; Withers, P. J.; Lee, P. D.; Shearing, P. R.

    2014-04-01

    In order to accelerate the commercialization of fuel cells and batteries across a range of applications, an understanding of the mechanisms by which they age and degrade at the microstructural level is required. Here, the most widely commercialized Li-ion batteries based on porous graphite based electrodes which de/intercalate Li+ ions during charge/discharge are studied by two phase contrast enhanced X-ray imaging modes, namely in-line phase contrast and Zernike phase contrast at the micro (synchrotron) and nano (laboratory X-ray microscope) level, respectively. The rate of charge cycling is directly dependent on the nature of the electrode microstructure, which are typically complex multi-scale 3D geometries with significant microstructural heterogeneities. We have been able to characterise the porosity and the tortuosity by micro-CT as well as the morphology of 5 individual graphite particles by nano-tomography finding that while their volume varied significantly their sphericity was surprisingly similar. The volume specific surface areas of the individual grains measured by nano-CT are significantly larger than the total volume specific surface area of the electrode from the micro-CT imaging, which can be attributed to the greater particle surface area visible at higher resolution.

  11. The application of phase contrast X-ray techniques for imaging Li-ion battery electrodes

    International Nuclear Information System (INIS)

    Eastwood, D.S.; Bradley, R.S.; Tariq, F.; Cooper, S.J.; Taiwo, O.O.; Gelb, J.; Merkle, A.; Brett, D.J.L.; Brandon, N.P.; Withers, P.J.; Lee, P.D.; Shearing, P.R.

    2014-01-01

    In order to accelerate the commercialization of fuel cells and batteries across a range of applications, an understanding of the mechanisms by which they age and degrade at the microstructural level is required. Here, the most widely commercialized Li-ion batteries based on porous graphite based electrodes which de/intercalate Li + ions during charge/discharge are studied by two phase contrast enhanced X-ray imaging modes, namely in-line phase contrast and Zernike phase contrast at the micro (synchrotron) and nano (laboratory X-ray microscope) level, respectively. The rate of charge cycling is directly dependent on the nature of the electrode microstructure, which are typically complex multi-scale 3D geometries with significant microstructural heterogeneities. We have been able to characterise the porosity and the tortuosity by micro-CT as well as the morphology of 5 individual graphite particles by nano-tomography finding that while their volume varied significantly their sphericity was surprisingly similar. The volume specific surface areas of the individual grains measured by nano-CT are significantly larger than the total volume specific surface area of the electrode from the micro-CT imaging, which can be attributed to the greater particle surface area visible at higher resolution

  12. Gambierol, a toxin produced by the dinoflagellate Gambierdiscus toxicus, is a potent blocker of voltage-gated potassium channels☆

    Science.gov (United States)

    Cuypers, Eva; Abdel-Mottaleb, Yousra; Kopljar, Ivan; Rainier, Jon D.; Raes, Adam L.; Snyders, Dirk J.; Tytgat, Jan

    2008-01-01

    In this study, we pharmacologically characterized gambierol, a marine polycyclic ether toxin which is produced by the dinoflagellate Gambierdiscus toxicus. Besides several other polycyclic ether toxins like ciguatoxins, this scarcely studied toxin is one of the compounds that may be responsible for ciguatera fish poisoning (CFP). Unfortunately, the biological target(s) that underlies CFP is still partly unknown. Today, ciguatoxins are described to specifically activate voltage-gated sodium channels by interacting with their receptor site 5. But some dispute about the role of gambierol in the CFP story shows up: some describe voltage-gated sodium channels as the target, while others pinpoint voltage-gated potassium channels as targets. Since gambierol was never tested on isolated ion channels before, it was subjected in this work to extensive screening on a panel of 17 ion channels: nine cloned voltage-gated ion channels (mammalian Nav1.1–Nav1.8 and insect Para) and eight cloned voltage-gated potassium channels (mammalian Kv1.1–Kv1.6, hERG and insect ShakerIR) expressed in Xenopus laevis oocytes using two-electrode voltage-clamp technique. All tested sodium channel subtypes are insensitive to gambierol concentrations up to 10 μM. In contrast, Kv1.2 is the most sensitive voltage-gated potassium channel subtype with almost full block (>97%) and an half maximal inhibitory concentration (IC50) of 34.5 nM. To the best of our knowledge, this is the first study where the selectivity of gambierol is tested on isolated voltage-gated ion channels. Therefore, these results lead to a better understanding of gambierol and its possible role in CFP and they may also be useful in the development of more effective treatments. PMID:18313714

  13. A Low-Power and Low-Voltage Power Management Strategy for On-Chip Micro Solar Cells

    Directory of Open Access Journals (Sweden)

    Ismail Cevik

    2015-01-01

    Full Text Available Fundamental characteristics of on-chip micro solar cell (MSC structures were investigated in this study. Several MSC structures using different layers in three different CMOS processes were designed and fabricated. Effects of PN junction structure and process technology on solar cell performance were measured. Parameters for low-power and low-voltage implementation of power management strategy and boost converter based circuits utilizing fractional voltage maximum power point tracking (FVMPPT algorithm were determined. The FVMPPT algorithm works based on the fraction between the maximum power point operation voltage and the open circuit voltage of the solar cell structure. This ratio is typically between 0.72 and 0.78 for commercially available poly crystalline silicon solar cells that produce several watts of power under typical daylight illumination. Measurements showed that the fractional voltage ratio is much higher and fairly constant between 0.82 and 0.85 for on-chip mono crystalline silicon micro solar cell structures that produce micro watts of power. Mono crystalline silicon solar cell structures were observed to result in better power fill factor (PFF that is higher than 74% indicating a higher energy harvesting efficiency.

  14. Fabrication of a Micro-Needle Array Electrode by Thermal Drawing for Bio-Signals Monitoring.

    Science.gov (United States)

    Ren, Lei; Jiang, Qing; Chen, Keyun; Chen, Zhipeng; Pan, Chengfeng; Jiang, Lelun

    2016-06-17

    A novel micro-needle array electrode (MAE) fabricated by thermal drawing and coated with Ti/Au film was proposed for bio-signals monitoring. A simple and effective setup was employed to form glassy-state poly (lactic-co-glycolic acid) (PLGA) into a micro-needle array (MA) by the thermal drawing method. The MA was composed of 6 × 6 micro-needles with an average height of about 500 μm. Electrode-skin interface impedance (EII) was recorded as the insertion force was applied on the MAE. The insertion process of the MAE was also simulated by the finite element method. Results showed that MAE could insert into skin with a relatively low compression force and maintain stable contact impedance between the MAE and skin. Bio-signals, including electromyography (EMG), electrocardiography (ECG), and electroencephalograph (EEG) were also collected. Test results showed that the MAE could record EMG, ECG, and EEG signals with good fidelity in shape and amplitude in comparison with the commercial Ag/AgCl electrodes, which proves that MAE is an alternative electrode for bio-signals monitoring.

  15. Fabrication of a Micro-Needle Array Electrode by Thermal Drawing for Bio-Signals Monitoring

    Directory of Open Access Journals (Sweden)

    Lei Ren

    2016-06-01

    Full Text Available A novel micro-needle array electrode (MAE fabricated by thermal drawing and coated with Ti/Au film was proposed for bio-signals monitoring. A simple and effective setup was employed to form glassy-state poly (lactic-co-glycolic acid (PLGA into a micro-needle array (MA by the thermal drawing method. The MA was composed of 6 × 6 micro-needles with an average height of about 500 μm. Electrode-skin interface impedance (EII was recorded as the insertion force was applied on the MAE. The insertion process of the MAE was also simulated by the finite element method. Results showed that MAE could insert into skin with a relatively low compression force and maintain stable contact impedance between the MAE and skin. Bio-signals, including electromyography (EMG, electrocardiography (ECG, and electroencephalograph (EEG were also collected. Test results showed that the MAE could record EMG, ECG, and EEG signals with good fidelity in shape and amplitude in comparison with the commercial Ag/AgCl electrodes, which proves that MAE is an alternative electrode for bio-signals monitoring.

  16. Interfacial pH-gradient induced micro-capillary filling with the aid of transverse electrodes arrays in presence of electrical double layer effects

    International Nuclear Information System (INIS)

    Jain, Avi; Chakraborty, Suman

    2010-01-01

    In the present work, we outline the design and analysis of a micro-capillary filling mechanism through the aid of interfacial pH gradients (and hence interfacial tension gradients) generated by employing arrays of transverse electrodes inducing step changes in voltages, in a natural buffer system that requires low power and no synthetic ampholytes. The capillary transport is modulated by a dynamic and non-trivial coupling between the interfacial tension and viscous resistances, as a consequence of the underlying intermolecular interactions. The competing effects of the driving and the retarding forces effectively determine the displacement, velocity and acceleration characteristics of the capillary front, in a dynamically evolving manner. A comprehensive theoretical model of capillary dynamics is developed here to address these issues in details, thereby revealing the combined influence of the interfacial electrochemistry and the applied transverse voltages, as guided by the pertinent fundamental thermodynamic principles governed by free energy considerations and the physico-chemical phenomena over interfacial scales. Non-trivial implications of the pH-gradient driven micro-capillary transport are aptly emphasized, so as to offer significant physical insights on the adopted strategy as a guiding principle for facilitating capillary filling processes by inducing a modulation in the effective interfacial energy. Particular implications on the capillary filling time are also pinpointed, revealing the effectiveness of the adopted design strategy. Finally, a universal scaling relationship of the capillary filling time as a function of the pertinent operating parameters is derived, so as to provide a generalized guideline for implementing the design scheme. A non-dimensional parameter, depending simultaneously on the inter-electrode pitch and the transverse voltage, is identified, which may be kept to a minimal limit within the other operating constraints of the chosen

  17. Study of squeeze film damping in a micro-beam resonator based on micro-polar theory

    Directory of Open Access Journals (Sweden)

    Mina Ghanbari

    Full Text Available In this paper, squeeze film damping in a micro-beam resonator based on micro-polar theory has been investigated. The proposed model for this study consists of a clamped-clamped micro-beam bounded between two fixed layers. The gap between the micro-beam and layers is filled with air. As fluid behaves differently in micro scale than macro, the micro-scale fluid field in the gap has been modeled based on micro-polar theory. Equation of motion governing transverse deflection of the micro- beam based on modified couple stress theory and also non-linear Reynolds equation of the fluid field based on micropolar theory have been non-dimensionalized, linearized and solved simultaneously in order to calculate the quality factor of the resonator. The effect of micropolar parameters of air on the quality factor has been investigated. The quality factor of the of the micro-beam resonator for different values of non-dimensionalized length scale of the beam, squeeze number and also non-dimensionalized pressure has been calculated and compared to the obtained values of quality factor based on classical theory.

  18. Modeling CICR in rat ventricular myocytes: voltage clamp studies

    Directory of Open Access Journals (Sweden)

    Palade Philip T

    2010-11-01

    Full Text Available Abstract Background The past thirty-five years have seen an intense search for the molecular mechanisms underlying calcium-induced calcium-release (CICR in cardiac myocytes, with voltage clamp (VC studies being the leading tool employed. Several VC protocols including lowering of extracellular calcium to affect Ca2+ loading of the sarcoplasmic reticulum (SR, and administration of blockers caffeine and thapsigargin have been utilized to probe the phenomena surrounding SR Ca2+ release. Here, we develop a deterministic mathematical model of a rat ventricular myocyte under VC conditions, to better understand mechanisms underlying the response of an isolated cell to calcium perturbation. Motivation for the study was to pinpoint key control variables influencing CICR and examine the role of CICR in the context of a physiological control system regulating cytosolic Ca2+ concentration ([Ca2+]myo. Methods The cell model consists of an electrical-equivalent model for the cell membrane and a fluid-compartment model describing the flux of ionic species between the extracellular and several intracellular compartments (cell cytosol, SR and the dyadic coupling unit (DCU, in which resides the mechanistic basis of CICR. The DCU is described as a controller-actuator mechanism, internally stabilized by negative feedback control of the unit's two diametrically-opposed Ca2+ channels (trigger-channel and release-channel. It releases Ca2+ flux into the cyto-plasm and is in turn enclosed within a negative feedback loop involving the SERCA pump, regulating[Ca2+]myo. Results Our model reproduces measured VC data published by several laboratories, and generates graded Ca2+ release at high Ca2+ gain in a homeostatically-controlled environment where [Ca2+]myo is precisely regulated. We elucidate the importance of the DCU elements in this process, particularly the role of the ryanodine receptor in controlling SR Ca2+ release, its activation by trigger Ca2+, and its

  19. Application of vertical micro-disk MHD electrode to the analysis of heterogeneous magneto-convection

    Energy Technology Data Exchange (ETDEWEB)

    Sugiyama, A. [Saitama Industrial Technology Center, Japan Society for the Promotion of Science, Kawaguchi (Japan). Domestic Research Fellowship; Hashiride, M.; Morimoto, R.; Nagai, Y. [Saitama Industrial Technology Center, Kawaguchi (Japan). Materials Engineering Division; Aogaki, R. [Polytechnic University, Sagamihara (Japan). Department of Product Design

    2004-11-01

    With a micro-disk electrode in vertical magnetic fields, heterogeneous magneto-convection in vertical magnetic fields was quantitatively examined for the redox reaction of ferrocyanide-ferricyanide ions. It was concluded that the current density controlled by the magneto-convection is in proportion to the 1/3rd power of the product of the magnetic flux density and its gradient. Then, by using the same electrode system, the diffusion current induced by the vertical MHD (magnetohydrodynamic) flow was measured for the reduction of cuprous ions to copper atoms. The current density in this case was, as theoretically predicted, a function of the 1st power of the magnetic flux density. Finally, to visualize this characteristic flow pattern of the vertical MHD flow, copper electrodeposition onto the micro-disk electrode in a vertical magnetic field was performed; a typical morphological pattern of the deposit (single micro-mystery circle) was observed, as expected. (author)

  20. Application of vertical micro-disk MHD electrode to the analysis of heterogeneous magneto-convection

    International Nuclear Information System (INIS)

    Sugiyama, Atsushi; Hashiride, Makoto; Morimoto, Ryoichi; Nagai, Yutaka; Aogaki, Ryoichi

    2004-01-01

    With a micro-disk electrode in vertical magnetic fields, heterogeneous magneto-convection in vertical magnetic fields was quantitatively examined for the redox reaction of ferrocyanide-ferricyanide ions. It was concluded that the current density controlled by the magneto-convection is in proportion to the 1/3rd power of the product of the magnetic flux density and its gradient. Then, by using the same electrode system, the diffusion current induced by the vertical MHD (magnetohydrodynamic) flow was measured for the reduction of cuprous ions to copper atoms. The current density in this case was, as theoretically predicted, a function of the 1st power of the magnetic flux density. Finally, to visualize this characteristic flow pattern of the vertical MHD flow, copper electrodeposition onto the micro-disk electrode in a vertical magnetic field was performed; a typical morphological pattern of the deposit (single micro-mystery circle) was observed, as expected

  1. Experimental investigation on material migration phenomena in micro-EDM of reaction-bonded silicon carbide

    Energy Technology Data Exchange (ETDEWEB)

    Liew, Pay Jun [Department of Mechanical Systems and Design, Tohoku University, Aramaki Aoba 6-6-01, Aoba-ku, Sendai, 980-8579 (Japan); Manufacturing Process Department, Faculty of Manufacturing Engineering, Universiti Teknikal Malaysia Melaka, Hang Tuah Jaya, 76100, Durian Tunggal, Melaka (Malaysia); Yan, Jiwang, E-mail: yan@mech.keio.ac.jp [Department of Mechanical Engineering, Faculty of Science and Technology, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama, 223-8522 (Japan); Kuriyagawa, Tsunemoto [Department of Mechanical Systems and Design, Tohoku University, Aramaki Aoba 6-6-01, Aoba-ku, Sendai, 980-8579 (Japan)

    2013-07-01

    Material migration between tool electrode and workpiece material in micro electrical discharge machining of reaction-bonded silicon carbide was experimentally investigated. The microstructural changes of workpiece and tungsten tool electrode were examined using scanning electron microscopy, cross sectional transmission electron microscopy and energy dispersive X-ray under various voltage, capacitance and carbon nanofibre concentration in the dielectric fluid. Results show that tungsten is deposited intensively inside the discharge-induced craters on the RB-SiC surface as amorphous structure forming micro particles, and on flat surface region as a thin interdiffusion layer of poly-crystalline structure. Deposition of carbon element on tool electrode was detected, indicating possible material migration to the tool electrode from workpiece material, carbon nanofibres and dielectric oil. Material deposition rate was found to be strongly affected by workpiece surface roughness, voltage and capacitance of the electrical discharge circuit. Carbon nanofibre addition in the dielectric at a suitable concentration significantly reduced the material deposition rate.

  2. Experimental investigation on material migration phenomena in micro-EDM of reaction-bonded silicon carbide

    International Nuclear Information System (INIS)

    Liew, Pay Jun; Yan, Jiwang; Kuriyagawa, Tsunemoto

    2013-01-01

    Material migration between tool electrode and workpiece material in micro electrical discharge machining of reaction-bonded silicon carbide was experimentally investigated. The microstructural changes of workpiece and tungsten tool electrode were examined using scanning electron microscopy, cross sectional transmission electron microscopy and energy dispersive X-ray under various voltage, capacitance and carbon nanofibre concentration in the dielectric fluid. Results show that tungsten is deposited intensively inside the discharge-induced craters on the RB-SiC surface as amorphous structure forming micro particles, and on flat surface region as a thin interdiffusion layer of poly-crystalline structure. Deposition of carbon element on tool electrode was detected, indicating possible material migration to the tool electrode from workpiece material, carbon nanofibres and dielectric oil. Material deposition rate was found to be strongly affected by workpiece surface roughness, voltage and capacitance of the electrical discharge circuit. Carbon nanofibre addition in the dielectric at a suitable concentration significantly reduced the material deposition rate.

  3. An Investigation of the Micro-Electrical Discharge Machining of Nickel-Titanium Shape Memory Alloy Using Grey Relations Coupled with Principal Component Analysis

    Directory of Open Access Journals (Sweden)

    Mustufa Haider Abidi

    2017-11-01

    Full Text Available Shape memory alloys (SMAs are advanced engineering materials which possess shape memory effects and super-elastic properties. Their high strength, high wear-resistance, pseudo plasticity, etc., makes the machining of Ni-Ti based SMAs difficult using traditional techniques. Among all non-conventional processes, micro-electric discharge machining (micro-EDM is considered one of the leading processes for micro-machining, owing to its high aspect ratio and capability to machine hard-to-cut materials with good surface finish.The selection of the most appropriate input parameter combination to provide the optimum values for various responses is very important in micro-EDM. This article demonstrates the methodology for optimizing multiple quality characteristics (overcut, taper angle and surface roughness to enhance the quality of micro-holes in Ni-Ti based alloy, using the Grey–Taguchi method. A Taguchi-based grey relational analysis coupled with principal component analysis (Grey-PCA methodology was implemented to investigate the effect of three important micro-EDM process parameters, namely capacitance, voltage and electrode material.The analysis of the individual responses established the importance of multi-response optimization. The main effects plots for the micro-EDM parameters and Analysis of Variance (ANOVA indicate that every parameter does not produce same effect on individual responses, and also that the percent contribution of each parameter to individual response is highly varied. As a result, multi-response optimization was implemented using Grey-PCA. Further, this study revealed that the electrode material had the strongest effect on the multi-response parameter, followed by the voltage and capacitance. The main effects plot for the Grey-PCA shows that the micro-EDM parameters “capacitance” at level-2 (i.e., 475 pF, “discharge voltage” at level-1 (i.e., 80 V and the “electrode material” Cu provided the best multi-response.

  4. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Pain, H. J.; Fearn, D. G.; Distefano, E. [Imperial College. London (United Kingdom)

    1966-10-15

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 {mu}mHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  5. Electrode Conduction Processes Segmented Electrode-Insulator Ratio Effects in MHD Power Generation Experiments

    International Nuclear Information System (INIS)

    Pain, H.J.; Fearn, D.G.; Distefano, E.

    1966-01-01

    (a) Electrode conduction processes have been investigated using a plasma produced in an electromagnetic shock tube operating with argon at 70 μmHg pressure. Complete voltage-current characteristics were obtained by the variation of load and applied voltage. These indicated the existence of two conduction regimes with a complex transition region. In the first regime the current, controlled by ion mobility, rose linearly with voltage to saturate between 10 mA and 1 A depending on conditions. Electrode contamination was significant. The second regime involved large currents controlled by electron mobility and emission from the cathode. The current again increased linearly with voltage and reached 200 A. Observation of induced voltages in transverse magnetic fields and of plasma deceleration in non-uniform fields showed that in the electromagnetic shock tube the plasma was heated predominantly by the driver discharge. Its conductivity was calculated using properties measured by a Langmuir double probe. In both regimes the plasma conductivity was also found from the gradient of the voltage current characteristics using experimental electric field fringing factors and the experimental values were compared with theory. (b) Larger-scale experiments used a combustion-driven shock tube where argon plasma flow, magnetic field and induced current flow were mutually orthogonal. The supersonic flow velocity and thermodynamic parameters of the plasma were accurately known. The electrode channel consisted of a segmented system of 12 electrode pairs with an electrode insulator ratio ranging from 1 to 21, with electrode plus insulator length remaining constant, and with maximum Hall parameter values of unity. Different electrode load combinations (Faraday and Hall generators) have been studied in measuring the power generated and the flow of longitudinal currents between adjacent electrodes. A maximum power of 0,8 MW was obtained, the power output decreasing inversely with the

  6. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    International Nuclear Information System (INIS)

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  7. Electrochemical impedance characterization of FeSn2 electrodes for Li-ion batteries

    International Nuclear Information System (INIS)

    Chamas, M.; Lippens, P-E.; Jumas, J-C.; Hassoun, J.; Panero, S.; Scrosati, B.

    2011-01-01

    Highlights: → In this paper we study a tin based, FeSn 2 , high capacity lithium-alloying electrode. → The electrochemical performance of this electrode in lithium batteries is remarkably influenced by the current rate. → This aspect is investigated by electrochemical techniques such as galvanostatic cycling and impedance spectroscopy. → The results demonstrated that the good electrochemical behavior of the electrode at the higher currents is due to the formation of a stable solid electrolyte interphase (SEI) film. - Abstract: This work reports the electrochemical characterization of a micro-scale FeSn 2 electrode in a lithium battery. The electrode is proposed as anode material for advanced lithium ion batteries due to its characteristics of high capacity (500 mAh g -1 ) and low working voltage (0.6 V vs. Li). The electrochemical alloying process is studied by cyclic voltammetry and galvanostatic cycling while the interfacial properties are investigated by electrochemical impedance spectroscopy. The impedance measurements in combination with the galvanostatic cycling tests reveal relatively low overall impedance values and good electrochemical performance for the electrode, both in terms of delivered capacity and cycling stability, even at the higher C-rate regimes.

  8. Contributions of counter-charge in a potassium channel voltage-sensor domain

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

    2011-01-01

    Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

  9. Single stage buck-boost DC-AC neutral point clamped inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Andrew, A.

    2012-01-01

    This paper proposes a new single stage buck-boost DC-AC neutral point clamped inverter topology which integrates the cascaded configurations of recently introduced inductor-capacitor-capacitor-transformer impedance source network (by Adamowicz) and classic NPC configuration. As a consequence......, it has enhanced buck-boost functionality and low output voltage distortions compared to the traditional Z-source inverter; it has continuous input current which reduces the source stress and inverter noise; it also contains two built-in capacitors which can block the DC current in the transformer...... windings thus preventing the core from saturation; lowers the voltage stresses and power losses of inverter switches and reduces the sizes of filtering devices and as well as obtains better output performance compared to the original two-level Z-source inverters. A phase disposition pulse width modulation...

  10. Development of three-electrode type micro-electrochemical reactor on anodized aluminum with photon rupture and electrochemistry

    International Nuclear Information System (INIS)

    Sakairi, Masatoshi; Yamada, Masashi; Kikuchi, Tastuya; Takahashi, Hideaki

    2007-01-01

    Photon rupture with a focused single pulse of pulsed YAG-laser irradiation was used to fabricate an aluminum electrochemical micro-reactor. Porous type anodic oxide film formed on aluminum specimens was irradiated in solutions with a pulsed Nd-YAG laser beam through a convex lens to fabricate micro-channels, micro-electrode, and through holes (for reference electrode, solution inlet, and outlet). During irradiation, specimens were moved by a computer controlled XYZ stage. After irradiation, the surface of the micro-channel and through hole were again treated to form anodic oxide film and the surface of the micro-electrode was treated electrochemically to provide an Au layer. The calculated volume of the micro-reactor including micro-channel and through holes is about 1.5 μl. The cyclic voltammogram of the micro-electrochemical cell was measured in K 3 Fe(CN) 6 /K 4 Fe(CN) 6 with both static and flowing solution at different scanning rates. The anodic and cathodic peak currents were measured and the values depended on scanning rate and ion concentration when the solution was static. With the flowing solution, limiting currents were observed and the anodic limiting current was increased with the cubic root of the solution flow rate

  11. Micro Electro Discharge Machining of Electrically Nonconductive Ceramics

    International Nuclear Information System (INIS)

    Schubert, A.; Zeidler, H.; Hackert, M.; Wolf, N.

    2011-01-01

    EDM is a known process for machining of hard and brittle materials. Due to its noncontact and nearly forceless behaviour, it has been introduced into micro manufacturing and through constant development it is now an important means for producing high-precision micro geometries. One restriction of EDM is its limitation to electrically conducting materials.Today many applications, especially in the biomedical field, make use of the benefits of ceramic materials, such as high strength, very low wear and biocompatibility. Common ceramic materials such as Zirconium dioxide are, due to their hardness in the sintered state, difficult to machine with conventional cutting techniques. A demand for the introduction of EDM to these materials could so far not be satisfied because of their nonconductive nature.At the Chemnitz University of Technology and the Fraunhofer IWU, investigations in the applicability of micro-EDM for the machining of nonconductive ceramics are being conducted. Tests are undertaken using micro-EDM drilling with Tungsten carbide tool electrodes and ZrO 2 ceramic workpieces. A starting layer, in literature often referred to as 'assisting electrode' is used to set up a closed electric circuit to start the EDM process. Combining carbon hydride based dielectric and a specially designed low-frequency vibration setup to excite the workpiece, the process environment can be held within parameters to allow for a constant EDM process even after the starting layer is machined. In the experiments a cylindrical 120 μm diameter Tungsten carbide tool electrode and Y 2 O 3 - and MgO- stabilized ZrO 2 worpieces are used. The current and voltage signals of the discharges within the different stages of the process (machining of the starting layer, machining of the base material, transition stage) are recorded and their characteristics compared to discharges in metallic material. Additionally, the electrode feed is monitored. The influences of the process parameters are

  12. Design of micro, flexible light-emitting diode arrays and fabrication of flexible electrodes

    International Nuclear Information System (INIS)

    Gao, Dan; Wang, Weibiao; Liang, Zhongzhu; Liang, Jingqiu; Qin, Yuxin; Lv, Jinguang

    2016-01-01

    In this study, we design micro, flexible light-emitting diode (LED) array devices. Using theoretical calculations and finite element simulations, we analyze the deformation of the conventional single electrode bar. Through structure optimization, we obtain a three-dimensional (3D), chain-shaped electrode structure, which has a greater bending degree. The optimized electrodes not only have a bigger bend but can also be made to spin. When the supporting body is made of polydimethylsiloxane (PDMS), the maximum bending degree of the micro, flexible LED arrays (4  ×  1 arrays) was approximately 230 µ m; this was obtained using the finite element method. The device (4  ×  1 arrays) can stretch to 15%. This paper describes the fabrication of micro, flexible LED arrays using microelectromechancial (MEMS) technology combined with electroplating technology. Specifically, the isolated grooves are made by dry etching which can isolate and protect the light-emitting units. A combination of MEMS technology and wet etching is used to fabricate the large size spacing. (paper)

  13. Micro-inverter solar panel mounting

    Science.gov (United States)

    Morris, John; Gilchrist, Phillip Charles

    2016-02-02

    Processes, systems, devices, and articles of manufacture are provided. Each may include adapting micro-inverters initially configured for frame-mounting to mounting on a frameless solar panel. This securement may include using an adaptive clamp or several adaptive clamps secured to a micro-inverter or its components, and using compressive forces applied directly to the solar panel to secure the adaptive clamp and the components to the solar panel. The clamps can also include compressive spacers and safeties for managing the compressive forces exerted on the solar panels. Friction zones may also be used for managing slipping between the clamp and the solar panel during or after installation. Adjustments to the clamps may be carried out through various means and by changing the physical size of the clamps themselves.

  14. A micro-power LDO with piecewise voltage foldback current limit protection

    International Nuclear Information System (INIS)

    Wei Hailong; Liu Youbao; Guo Zhongjie; Liao Xue

    2012-01-01

    To achieve a constant current limit, low power consumption and high driving capability, a micro-power LDO with a piecewise voltage-foldback current-limit circuit is presented. The current-limit threshold is dynamically adjusted to achieve a maximum driving capability and lower quiescent current of only 300 nA. To increase the loop stability of the proposed LDO, a high impedance transconductance buffer under a micro quiescent current is designed for splitting the pole that exists at the gate of the pass transistor to the dominant pole, and a zero is designed for the purpose of the second pole phase compensation. The proposed LDO is fabricated in a BiCMOS process. The measurement results show that the short-circuit current of the LDO is 190 mA, the constant limit current under a high drop-out voltage is 440 mA, and the maximum load current under a low drop-out voltage is up to 800 mA. In addition, the quiescent current of the LDO is only 7 μA, the load regulation is about 0.56% on full scale, the line regulation is about 0.012%/V, the PSRR at 120 Hz is 58 dB and the drop-out voltage is only 70 mV when the load current is 250 mA. (semiconductor integrated circuits)

  15. Energy harvesting in high voltage measuring techniques

    International Nuclear Information System (INIS)

    Żyłka, Pawel; Doliński, Marcin

    2016-01-01

    The paper discusses selected problems related to application of energy harvesting (that is, generating electricity from surplus energy present in the environment) to supply autonomous ultra-low-power measurement systems applicable in high voltage engineering. As a practical example of such implementation a laboratory model of a remote temperature sensor is presented, which is self-powered by heat generated in a current-carrying busbar in HV- switchgear. Presented system exploits a thermoelectric harvester based on a passively cooled Peltier module supplying micro-power low-voltage dc-dc converter driving energy-efficient temperature sensor, microcontroller and a fibre-optic transmitter. Performance of the model in laboratory simulated conditions are presented and discussed. (paper)

  16. Plasma assisted fabrication of multi-layer graphene/nickel hybrid film as enhanced micro-supercapacitor electrodes

    Science.gov (United States)

    Ding, Q.; Li, W. L.; Zhao, W. L.; Wang, J. Y.; Xing, Y. P.; Li, X.; Xue, T.; Qi, W.; Zhang, K. L.; Yang, Z. C.; Zhao, J. S.

    2017-03-01

    A facile synthesis strategy has been developed for fabricating multi-layer graphene/nickel hybrid film as micro-supercapacitor electrodes by using plasma enhanced chemical vapor deposition. The as-presented method is advantageous for rapid graphene growth at relatively low temperature of 650 °C. In addition, after pre-treating for the as-deposited nickel film by using argon plasma bombardment, the surface-to-volume ratio of graphene film on the treated nickel substrate is effectively increased by the increasing of surface roughness. This is demonstrated by the characterization results from transmission electron microscopy, scanning electron microscope and atomic force microscopy. Moreover, the electrochemical performance of the resultant graphene/nickel hybrid film as micro-supercapacitor working electrode was investigated by cyclic voltammetry and galvanostatic charge/discharge measurements. It was found that the increase of the surface-to-volume ratio of graphene/nickel hybrid film improved the specific capacitance of 10 times as the working electrode of micro-supercapacitor. Finally, by using comb columnar shadow mask pattern, the micro-supercapacitor full cell device was fabricated. The electrochemical performance measurements of the micro-supercapacitor devices indicate that the method presented in this study provides an effective way to fabricate micro-supercapacitor device with enhanced energy storage property.

  17. A small-gap electrostatic micro-actuator for large deflections

    Science.gov (United States)

    Conrad, Holger; Schenk, Harald; Kaiser, Bert; Langa, Sergiu; Gaudet, Matthieu; Schimmanz, Klaus; Stolz, Michael; Lenz, Miriam

    2015-01-01

    Common quasi-static electrostatic micro actuators have significant limitations in deflection due to electrode separation and unstable drive regions. State-of-the-art electrostatic actuators achieve maximum deflections of approximately one third of the electrode separation. Large electrode separation and high driving voltages are normally required to achieve large actuator movements. Here we report on an electrostatic actuator class, fabricated in a CMOS-compatible process, which allows high deflections with small electrode separation. The concept presented makes the huge electrostatic forces within nanometre small electrode separation accessible for large deflections. Electrostatic actuations that are larger than the electrode separation were measured. An analytical theory is compared with measurement and simulation results and enables closer understanding of these actuators. The scaling behaviour discussed indicates significant future improvement on actuator deflection. The presented driving concept enables the investigation and development of novel micro systems with a high potential for improved device and system performance. PMID:26655557

  18. Exploiting Stretchable Metallic Springs as Compliant Electrodes for Cylindrical Dielectric Elastomer Actuators (DEAs

    Directory of Open Access Journals (Sweden)

    Chien-Hao Liu

    2017-11-01

    Full Text Available In recent years, dielectric elastomer actuators (DEAs have been widely used in soft robots and artificial bio-medical applications. Most DEAs are composed of a thin dielectric elastomer layer sandwiched between two compliant electrodes. DEAs vary in their design to provide bending, torsional, and stretch/contraction motions under the application of high external voltages. Most compliant electrodes are made of carbon powders or thin metallic films. In situations involving large deformations or improper fabrication, the electrodes are susceptible to breakage and increased resistivity. The worst cases result in a loss of conductivity and functional failure. In this study, we developed a method by which to exploit stretchable metallic springs as compliant electrodes for cylindrical DEAs. This design was inspired by the extensibility of mechanical springs. The main advantage of this approach is the fact that the metallic spring-like compliant electrodes remain conductive and do not increase the stiffness as the tube-like DEAs elongate in the axial direction. This can be attributed to a reduction in thickness in the radial direction. The proposed cylindrical structure is composed of highly-stretchable VHB 4905 film folded within a hollow tube and then sandwiched between copper springs (inside and outside to allow for stretching and contraction in the axial direction under the application of high DC voltages. We fabricated a prototype and evaluated the mechanical and electromechanical properties of the device experimentally using a high-voltage source of 9.9 kV. This device demonstrated a non-linear increase in axial stretching with an increase in applied voltage, reaching a maximum extension of 0.63 mm (axial strain of 2.35% at applied voltage of 9.9 kV. Further miniaturization and the incorporation of compressive springs are expected to allow the implementation of the proposed method in soft micro-robots and bio-mimetic applications.

  19. The Electrode Modality Development in Pulsed Electric Field Treatment Facilitates Biocellular Mechanism Study and Improves Cancer Ablation Efficacy.

    Science.gov (United States)

    Cen, Chao; Chen, Xinhua

    2017-01-01

    Pulsed electric field treatment is now widely used in diverse biological and medical applications: gene delivery, electrochemotherapy, and cancer therapy. This minimally invasive technique has several advantages over traditional ablation techniques, such as nonthermal elimination and blood vessel spare effect. Different electrodes are subsequently developed for a specific treatment purpose. Here, we provide a systematic review of electrode modality development in pulsed electric field treatment. For electrodes invented for experiment in vitro, sheet electrode and electrode cuvette, electrodes with high-speed fluorescence imaging system, electrodes with patch-clamp, and electrodes with confocal laser scanning microscopy are introduced. For electrodes invented for experiment in vivo, monopolar electrodes, five-needle array electrodes, single-needle bipolar electrode, parallel plate electrodes, and suction electrode are introduced. The pulsed electric field provides a promising treatment for cancer.

  20. The application of phase contrast X-ray techniques for imaging Li-ion battery electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Eastwood, D.S. [Manchester X-ray Imaging Facility, School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Research Complex at Harwell, Didcot, Oxon OX11 0FA (United Kingdom); Bradley, R.S. [Manchester X-ray Imaging Facility, School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Tariq, F.; Cooper, S.J. [Dept. Earth Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Taiwo, O.O. [Dept. Chemical Engineering, University College London, London WC1E 7JE (United Kingdom); Gelb, J.; Merkle, A. [Carl Zeiss X-ray Microscopy Inc., Pleasanton, CA 94588 (United States); Brett, D.J.L. [Dept. Chemical Engineering, University College London, London WC1E 7JE (United Kingdom); Brandon, N.P. [Dept. Earth Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Withers, P.J.; Lee, P.D. [Manchester X-ray Imaging Facility, School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Research Complex at Harwell, Didcot, Oxon OX11 0FA (United Kingdom); Shearing, P.R., E-mail: p.shearing@ucl.ac.uk [Dept. Chemical Engineering, University College London, London WC1E 7JE (United Kingdom)

    2014-04-01

    In order to accelerate the commercialization of fuel cells and batteries across a range of applications, an understanding of the mechanisms by which they age and degrade at the microstructural level is required. Here, the most widely commercialized Li-ion batteries based on porous graphite based electrodes which de/intercalate Li{sup +} ions during charge/discharge are studied by two phase contrast enhanced X-ray imaging modes, namely in-line phase contrast and Zernike phase contrast at the micro (synchrotron) and nano (laboratory X-ray microscope) level, respectively. The rate of charge cycling is directly dependent on the nature of the electrode microstructure, which are typically complex multi-scale 3D geometries with significant microstructural heterogeneities. We have been able to characterise the porosity and the tortuosity by micro-CT as well as the morphology of 5 individual graphite particles by nano-tomography finding that while their volume varied significantly their sphericity was surprisingly similar. The volume specific surface areas of the individual grains measured by nano-CT are significantly larger than the total volume specific surface area of the electrode from the micro-CT imaging, which can be attributed to the greater particle surface area visible at higher resolution.

  1. Comparative Evaluation of Pulsewidth Modulation Strategies for Z-Source Neutral-Point-Clamped Inverter

    DEFF Research Database (Denmark)

    Loh, P.C.; Blaabjerg, Frede; Wong, C.P.

    2007-01-01

    modulation (PWM) strategies for controlling the Z-source NPC inverter. While developing the PWM techniques, attention has been devoted to carefully derive them from a common generic basis for improved portability, easier implementation, and most importantly, assisting readers in understanding all concepts......Z-source neutral-point-clamped (NPC) inverter has recently been proposed as an alternative three-level buck-boost power conversion solution with an improved output waveform quality. In principle, the designed Z-source inverter functions by selectively "shooting through" its power sources, coupled...... to the inverter using two unique Z-source impedance networks, to boost the inverter three-level output waveform. Proper modulation of the new inverter would therefore require careful integration of the selective shoot-through process to the basic switching concepts to achieve maximal voltage-boost, minimal...

  2. Pull-in behavior analysis of vibrating functionally graded micro-cantilevers under suddenly DC voltage

    Directory of Open Access Journals (Sweden)

    Jamal Zare

    2015-01-01

    Full Text Available The present research attempts to explain dynamic pull-in instability of functionally graded micro-cantilevers actuated by step DC voltage while the fringing-field effect is taken into account in the vibrational equation of motion. By employing modern asymptotic approach namely Homotopy Perturbation Method with an auxiliary term, high-order frequency-amplitude relation is obtained, then the influences of material properties and actuation voltage on dynamic pull-in behavior are investigated. It is demonstrated that the auxiliary term in the homotopy perturbation method is extremely effective for higher order approximation and two terms in series expansions are sufficient to produce an acceptable solution. The strength of this analytical procedure is verified through comparison with numerical results.

  3. Voltage balancing in modular energy storage of power supply for micro resistance welding

    Directory of Open Access Journals (Sweden)

    Kozhushko Yu. V.

    2017-10-01

    Full Text Available Micro resistance welding is one of the most effective ways to obtain permanent joints of metal parts. The quality of welded joints strongly depends on the characteristics of the power supply of welding equipment. The power supplies for micro resistance welding based on Energy Storage topology have a softer impact on the network than the ones based on Direct Energy topology. The use of supercapacitors for Energy Storage type power supplies makes it possible to reduce the dimensions of welding equipment and to improve its technical parameters. However, the feature of the supercapacitors is low value of the nominal voltage, which usually does not exceed 3 V. To provide higher voltage, the modules of supercapacitors connected in series are designed. In order to extend the life time of such modules, a voltage balancing system is required. A circuit for balancing the voltage of a modular supercapacitor energy storage of a power supply for micro resistance welding is proposed. The fragments of calculation of control units of a supercapacitor module cell are given. The simulation of the balancing circuit operation is carried out and time charts of the supercapacitor charge process are obtained. The operability and effectiveness of the proposed solution is confirmed. The advantage of the proposed circuit is the possibility of obtaining the high efficiency because of returning the excessive energy of the module cell back into the power supply.

  4. High-voltage test and measuring techniques

    CERN Document Server

    Hauschild, Wolfgang

    2014-01-01

    It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

  5. Planning for Micro-grid with Static Voltage Stability and Maximizing Renewable Energy Utilization

    Science.gov (United States)

    Zhou, Youfu; Zhang, Yuhong; Lv, Xuehai; Zhang, Wentai; Wei, Jun; Zhang, Changhua; Chen, Xin

    2017-05-01

    The access position and capacity of distribution generation (DG) affect the static voltage stability of micro-grid, thus affecting the renewable energy utilization. In the current reform of the energy supply side, a multi-objective optimization model is established, aiming at the abandoning wind and abandoning light problem. This model has three advantages, which are the largest renewable energy utilization, static voltage stability of micro-grid and the minimum cost of DG investment considering environmental benefits. It can effectively promote the use of wind power, photovoltaic power generation and other renewable energy sources. In this paper, the multi-objective optimization problem is transformed into a single objective programming problem by using the deviation method; the optimal solution of multi-objective function is solved by using particle swarm optimization algorithm, so as to establish the planning scheme of micro-grid. Simulation results prove the correctness and feasibility of the optimization method.

  6. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  7. Micro Tools with Pneumatic Actuators for Desktop Factories

    Directory of Open Access Journals (Sweden)

    Björn HOXHOLD

    2009-10-01

    Full Text Available This paper presents the design, the simulation and the fabrication process of two novel pneumatically driven auxiliary micro tools that can be used to improve and to speed up assembling processes in desktop factories. The described micro systems are designed to function as centrifugal feeders for small glass balls or active clamping devices with small external dimensions. They are able to deliver more than six balls per second on demand to a gripper and align and clamp single chips in a fixed position.

  8. The Dynamics of a Doubly Clamped Microbeam Near the Primary Resonance: Experimental and Analytical Investigation

    KAUST Repository

    Masri, Karim M.

    2016-01-20

    We present experimental and analytical investigation of the dynamics of a doubly clamped microbeam near its primary resonance. The microbeam is excited electrostatically by an electrode on the first half of the beam. These microbeams are fabricated using polyimide as structural layer coated with nickel from top and chromium and gold layers from bottom. A noise signal is applied to experimentally detect the natural frequencies. Then, frequency sweep tests are generated for various values of DC bias revealing hardening, transition, and softening behavior of the microbeam. We report for the first time the transition from lower stable state, to unstable state, and then to large stable state experimentally. A multi-mode Galerkin method is used to develop a reduced order model (ROM) of the beam. Shooting method is used to find the periodic motion and is utilized to generate frequency response curves. The curves show good agreement with the experimental results with hardening behavior at lower DC voltage then softening at higher voltage loads and dynamic pull-in. © Copyright 2015 by ASME.

  9. Independent control strategy of two DC-link voltages for separate MPPTs in transformerless photovoltaic systems using neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Choi, Uimin; Blaabjerg, Frede; Lee, Kyo-Beum

    2014-01-01

    To improve the efficiency of the photovoltaic (PV) system, the centralized topology using three-level inverters are widely used. In this system, PV modules are separately connected to the split DC-links. This causes a decrease of maximum power point tracking (MPPT) efficiency under the partial...... shading condition. This paper proposes an independent control of two DC-link voltages for separate MPPT of each PV module in three-level inverters. The proposed method is simply implemented by adding or subtracting the time-offset to the three-phase turn-on times and modifying the reference voltages...

  10. Battery charger with a capacitor-diode clamped LLC resonant converter

    OpenAIRE

    Tsang, C.; Bingham, C.; Foster, M. P.; Stone, D.; Leech, J.

    2016-01-01

    The paper proposes a novel battery charger through use of\\ud two serially-connected LLC resonant converters. The first\\ud stage utilises a capacitor-diode clamped LLC resonant\\ud converter which allows operation in both constant voltage\\ud (CV) and constant current (CC) modes, as found in most\\ud battery chargers, to be realised, whilst the second stage\\ud provides the necessary gain and line and load regulation. A\\ud design example is included that demonstrates the resulting\\ud converter top...

  11. Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier

    Directory of Open Access Journals (Sweden)

    Abdel-Salam Mazen

    2016-01-01

    Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.

  12. Improved Active-Neutral-Point-Clamped (I-ANPC) Multilevel Converter: Fundamental Circuit Topology, Innovative Modulatioin Technique, and Experimental Validation

    DEFF Research Database (Denmark)

    Dargahi, Vahid; Corzine, Keith A.; Enslin, Johan H.

    2018-01-01

    For medium-voltage (MV) high-power industrial applications including HVDC and variable-speed motor drives, multilevel converters are deemed predominant topology. One of the promising derived-topologies from neutral-point-clamped (NPC) configuration is active NPC (ANPC) inverter that offers improved......-capacitor (FC) and four switches such as the insulated-gate bipolar transistors (IGBTs). The I-ANPC converter has considerable advantages over the classic multilevel inverters that makes it a preferable topology for MV applications. The substantial reduction in the number of cells in comparison with classic...

  13. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  14. Quality of root fillings performed with two root filling techniques. An in vitro study using micro-CT

    DEFF Research Database (Denmark)

    Møller, L; Wenzel, A; Wegge-Larsen, AM

    2013-01-01

    -section images from Micro-computed Tomography scans. Results. All root canal fillings had voids. Permutation test showed no statistically significant difference between the two root filling techniques in relation to presence of voids (p = 0.092). A statistically significant difference in obturation time between...

  15. Human motor cortical activity recorded with Micro-ECoG electrodes, during individual finger movements.

    Science.gov (United States)

    Wang, W; Degenhart, A D; Collinger, J L; Vinjamuri, R; Sudre, G P; Adelson, P D; Holder, D L; Leuthardt, E C; Moran, D W; Boninger, M L; Schwartz, A B; Crammond, D J; Tyler-Kabara, E C; Weber, D J

    2009-01-01

    In this study human motor cortical activity was recorded with a customized micro-ECoG grid during individual finger movements. The quality of the recorded neural signals was characterized in the frequency domain from three different perspectives: (1) coherence between neural signals recorded from different electrodes, (2) modulation of neural signals by finger movement, and (3) accuracy of finger movement decoding. It was found that, for the high frequency band (60-120 Hz), coherence between neighboring micro-ECoG electrodes was 0.3. In addition, the high frequency band showed significant modulation by finger movement both temporally and spatially, and a classification accuracy of 73% (chance level: 20%) was achieved for individual finger movement using neural signals recorded from the micro-ECoG grid. These results suggest that the micro-ECoG grid presented here offers sufficient spatial and temporal resolution for the development of minimally-invasive brain-computer interface applications.

  16. Radial wedge flange clamp

    Science.gov (United States)

    Smith, Karl H.

    2002-01-01

    A radial wedge flange clamp comprising a pair of flanges each comprising a plurality of peripheral flat wedge facets having flat wedge surfaces and opposed and mating flat surfaces attached to or otherwise engaged with two elements to be joined and including a series of generally U-shaped wedge clamps each having flat wedge interior surfaces and engaging one pair of said peripheral flat wedge facets. Each of said generally U-shaped wedge clamps has in its opposing extremities apertures for the tangential insertion of bolts to apply uniform radial force to said wedge clamps when assembled about said wedge segments.

  17. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  18. An Influence of Parameters of Micro-Electrical Discharge Machining On Wear of Tool Electrode

    DEFF Research Database (Denmark)

    Puthumana, Govindan

    2017-01-01

    To achieve better precision of features generated using the micro-electrical dischargemachining (micro-EDM), there is a necessity to minimize the wear of the toolelectrode, because a change in the dimensions of the electrode is reflected directly orindirectly on the feature. This paper presents...

  19. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Science.gov (United States)

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  20. DNA-FET using carbon nanotube electrodes

    International Nuclear Information System (INIS)

    Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

    2006-01-01

    We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

  1. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  2. Displacement sensing based on resonant frequency monitoring of electrostatically actuated curved micro beams

    International Nuclear Information System (INIS)

    Krakover, Naftaly; Krylov, Slava; Ilic, B Robert

    2016-01-01

    The ability to control nonlinear interactions of suspended mechanical structures offers a unique opportunity to engineer rich dynamical behavior that extends the dynamic range and ultimate device sensitivity. We demonstrate a displacement sensing technique based on resonant frequency monitoring of curved, doubly clamped, bistable micromechanical beams interacting with a movable electrode. In this configuration, the electrode displacement influences the nonlinear electrostatic interactions, effective stiffness and frequency of the curved beam. Increased sensitivity is made possible by dynamically operating the beam near the snap-through bistability onset. Various in-plane device architectures were fabricated from single crystal silicon and measured under ambient conditions using laser Doppler vibrometry. In agreement with the reduced order Galerkin-based model predictions, our experimental results show a significant resonant frequency reduction near critical snap-through, followed by a frequency increase within the post-buckling configuration. Interactions with a stationary electrode yield a voltage sensitivity up to  ≈560 Hz V −1 and results with a movable electrode allow motion sensitivity up to  ≈1.5 Hz nm −1 . Our theoretical and experimental results collectively reveal the potential of displacement sensing using nonlinear interactions of geometrically curved beams near instabilities, with possible applications ranging from highly sensitive resonant inertial detectors to complex optomechanical platforms providing an interface between the classical and quantum domains. (paper)

  3. Faradic resistance of the electrode/electrolyte interface.

    Science.gov (United States)

    Mayer, S; Geddes, L A; Bourland, J D; Ogborn, L

    1992-09-01

    A new method is used to measure the direct-current (Faradic) resistance of a single electrode/electrolyte interface. The method employs a constant-current pulse and a potential-sensing electrode. By choosing a sufficiently long pulse duration, the voltage between the test and potential-sensing electrode exhibits a three-phase response. In the steady-state phase, the voltage measured is equal to the current flowing through the electrode Faradic resistance and the resistance of the electrolyte between the test and potential-sensing electrode. By measuring this latter resistance with a high-frequency sinusoidal alternating current, the voltage drop in the electrolyte is calculated and subtracted from the voltage measured between the test and potential-sensing electrode, thereby allowing calculation of the Faradic resistance. By plotting the reciprocal of the Faradic resistance against current density and fitting the data points to a third-order polynomial, it is possible to determine the zero-current density (Faradic) resistance. This technique was used to determine the Faradic resistance of electrodes (0.1 cm2) of stainless-steel, platinum, platinum-iridium and rhodium in 0.9 per cent NaCl at 25 degrees. The zero current Faradic resistance is lowest for platinum (30.3 k omega), slightly higher for platinum-iridium (47.6k omega), much higher for rhodium (111k omega) and highest for type 316 stainless-steel (345k omega). In all cases, the Faradic resistance decreases dramatically with increasing current density.

  4. Recent Progress in Micro-Supercapacitors with In-Plane Interdigital Electrode Architecture.

    Science.gov (United States)

    Liu, Nishuang; Gao, Yihua

    2017-12-01

    Due to the boom of miniaturized electronic devices in the last decade, there are great demands for ultrathin and flexible on-chip rechargeable energy storage microdevices. Supercapacitor, as one of the most hopeful appearing energy storage devices, can provide a wonderful alternative to batteries or electrolytic capacitors, owing to its fast charge and discharge rates, high power density, and long cycling stability. Especially for the recently developed micro-supercapacitors, the unique in-plane interdigital electrode architecture can fully meet the integration requirements of rapidly developed miniaturized electronic devices, and improve the power density of the unit via shortening the ionic diffusion distance between the interdigital electrodes. This concept introduces the recent advances on the design, fabrication, and application of planar micro-supercapacitors for on-chip energy storage from an overall perspective. Moreover, challenges and future development trends are discussed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Micro-hole array fluorescent sensor based on AC-Dielectrophoresis (DEP) for simultaneous analysis of nano-molecules

    Science.gov (United States)

    Kim, Hye Jin; Kang, Dong-Hoon; Lee, Eunji; Hwang, Kyo Seon; Shin, Hyun-Joon; Kim, Jinsik

    2018-02-01

    We propose a simple fluorescent bio-chip based on two types of alternative current-dielectrophoretic (AC-DEP) force, attractive (positive DEP) and repulsive (negative DEP) force, for simultaneous nano-molecules analysis. Various radius of micro-holes on the bio-chip are designed to apply the different AC-DEP forces, and the nano-molecules are concentrated inside the micro-hole arrays according to the intensity of the DEP force. The bio-chip was fabricated by Micro Electro Mechanical system (MEMS) technique, and was composed of two layers; a SiO2 layer and Ta/Pt layer were accomplished for an insulation layer and a top electrode with micro-hole arrays to apply electric fields for DEP force, respectively. Each SiO2 and Ta/Pt layers were deposited by thermal oxidation and sputtering, and micro-hole arrays were fabricated with Inductively Coupled Plasma (ICP) etching process. For generation of each positive and negative DEP at micro-holes, we applied two types of sine-wave AC voltage with different frequency range alternately. The intensity of the DEP force was controlled by the radius of the micro-hole and size of nano-molecule, and calculated with COMSOL multi-physics. Three types of nano-molecules labelled with different fluorescent dye were used and the intensity of nano-molecules was examined by the fluorescent optical analysis after applying the DEP force. By analyzing the fluorescent intensities of the nano-molecules, we verify the various nano-molecules in analyte are located successfully inside corresponding micro-holes with different radius according to their size.

  6. Thermal property testing technique on micro specimen

    International Nuclear Information System (INIS)

    Baba, Tetsuya; Kishimoto, Isao; Taketoshi, Naoyuki

    2000-01-01

    This study aims at establishment of further development on some testing techniques on the nuclear advanced basic research accumulated by the National Research Laboratory of Metrology for ten years. For this purpose, a technology to test heat diffusion ratio and specific heat capacity of less than 3 mm in diameter and 1 mm in thickness of micro specimen and technology to test heat diffusion ratio at micro area of less than 1 mm in area along cross section of less than 10 mm in diameter of column specimen were developed to contribute to common basic technology supporting the nuclear power field. As a result, as an element technology to test heat diffusion ratio and specific heat capacity of the micro specimen, a specimen holding technique stably to hold a micro specimen with 3 mm in diameter could be developed. And, for testing the specific heat capacity by using the laser flush differential calorimetry, a technique to hold two specimen of 5 mm in diameter at their proximities was also developed. In addition, by promoting development of thermal property data base capable of storing thermal property data obtained in this study and with excellent workability in this 1998 fiscal year a data in/out-put program with graphical user interface could be prepared. (G.K.)

  7. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    International Nuclear Information System (INIS)

    Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

    2013-01-01

    The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

  8. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  9. The relation of electrode voltages to charge position in SLC arc and final focus beam position monitors

    International Nuclear Information System (INIS)

    Fordham, C.

    1989-01-01

    The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs

  10. Micro-discharge noise and radiation damage of silicon microstrip sensors

    International Nuclear Information System (INIS)

    Ohsugi, T.; Iwata, Y.; Ohyama, H.; Ohmoto, T.; Yoshikawa, M.; Handa, T.; Kurino, K.; Fujita, K.; Kitabayashi, H.; Tamura, N.; Hatakenaka, T.; Maeohmichi, M.; Takahata, M.; Nakao, M.; Iwasaki, H.; Kohriki, T.; Terada, S.; Unno, Y.; Takashima, R.; Yamamoto, K.; Yamamura, K.

    1996-01-01

    We have examined experimentally some existing ideas for improving the radiation hardness of silicon microstrip sensors. We confirm that the extended electrode and the deep implant-strip proposed on the basis of simulation studies works effectively to suppress micro-discharge as well as junction breakdown of the bias or guard ring. For an integrated coupling capacitor a double layer structure of SiO 2 and Si 3 N 4 provides better radiation hardness than that of single SiO 2 coupling in our design conditions. The onset voltage of the micro-discharge on the bias/guard ring has been studied for an extended electrode and a floating guard ring. (orig.)

  11. Simultaneous determination of the residual stress, elastic modulus, density and thickness of ultrathin film utilizing vibrating doubly clamped micro-/nanobeams

    International Nuclear Information System (INIS)

    Stachiv, Ivo; Kuo, Chih-Yun; Fang, Te-Hua; Mortet, Vincent

    2016-01-01

    Measurement of ultrathin film thickness and its basic properties can be highly challenging and time consuming due to necessity of using several very sophisticated devices. Here, we report an easy accessible resonant based method capable to simultaneously determinate the residual stress, elastic modulus, density and thickness of ultrathin film coated on doubly clamped micro-/nanobeam. We show that a general dependency of the resonant frequencies on the axial load is also valid for in-plane vibrations, and the one depends only on the considered vibrational mode. As a result, we found that the film elastic modulus, density and thickness can be evaluated from two measured in-plane and out-plane fundamental resonant frequencies of micro-/nanobeam with and without film under different prestress forces. Whereas, the residual stress can be determined from two out-plane (in-plane) measured consecutive resonant frequencies of beam with film under different prestress forces without necessity of knowing film and substrate properties and dimensions. Moreover, we also reveal that the common uncertainties in force (and thickness) determination have a negligible (and minor) impact on the determined film properties. The application potential of the present method is illustrated on the beam made of silicon and SiO_2 with deposited 20 nm thick AlN and 40 nm thick Au thin films, respectively.

  12. Understanding capacity fade in silicon based electrodes for lithium-ion batteries using three electrode cells and upper cut-off voltage studies

    Science.gov (United States)

    Beattie, Shane D.; Loveridge, M. J.; Lain, Michael J.; Ferrari, Stefania; Polzin, Bryant J.; Bhagat, Rohit; Dashwood, Richard

    2016-01-01

    Commercial Li-ion batteries are typically cycled between 3.0 and 4.2 V. These voltages limits are chosen based on the characteristics of the cathode (e.g. lithium cobalt oxide) and anode (e.g. graphite). When alternative anode/cathode chemistries are studied the same cut-off voltages are often, mistakenly, used. Silicon (Si) based anodes are widely studied as a high capacity alternative to graphite for Lithium-ion batteries. When silicon-based anodes are paired with high capacity cathodes (e.g. Lithium Nickel Cobalt Aluminium Oxide; NCA) the cell typically suffers from rapid capacity fade. The purpose of this communication is to understand how the choice of upper cut-off voltage affects cell performance in Si/NCA cells. A careful study of three-electrode cell data will show that capacity fade in Si/NCA cells is due to an ever-evolving silicon voltage profile that pushes the upper voltage at the cathode to >4.4 V (vs. Li/Li+). This behaviour initially improves cycle efficiency, due to liberation of new lithium, but ultimately reduces cycling efficiency, resulting in rapid capacity fade.

  13. A Novel Neutral Point Clamped Full-Bridge Topology for Transformerless Photovoltaic Grid-Connected Inverters

    Directory of Open Access Journals (Sweden)

    M. Pakdel

    2017-04-01

    Full Text Available This paper presents a novel neutral point clamped full-bridge topology for transformerless photovoltaic grid-tied inverters. Transformerless grid-connected inverters have been used widely in recent years since they offer higher efficiency and lower costs. Ground leakage current suppression is the main issue which should be considered carefully in transformerless photovoltaic grid-connected inverters. Among different methods used to decline ground leakage current, neutral point clamped (NPC topologies are considered more useful and effective. In NPC topologies, the short-circuited output voltage at the freewheeling period is clamped to the middle of the DC bus voltage. Therefore, the common-mode voltage (CM will be constant at the whole switching period. Various NPC topologies such as H6 [1], HB-ZVR [2], oH5 [3], and PN-NPC [4] have been proposed. In this paper, a novel NPC topology is proposed which has lower power losses and higher efficiency over previous topologies. Furthermore, the proposed NPC topology exhibits a similar ground leakage current with the PN-NPC topology. The proposed NPC topology is analyzed theoretically using simulation studies and an experimental prototype is provided to verify theoretical analysis and simulation studies.

  14. Robotic multi-well planar patch-clamp for native and primary mammalian cells

    Science.gov (United States)

    Milligan, Carol J; Li, Jing; Sukumar, Piruthivi; Majeed, Yasser; Dallas, Mark L; English, Anne; Emery, Paul; Porter, Karen E; Smith, Andrew M; McFadzean, Ian; Beccano-Kelly, Dayne; Bahnasi, Yahya; Cheong, Alex; Naylor, Jacqueline; Zeng, Fanning; Liu, Xing; Gamper, Nikita; Jiang, Lin-Hua; Pearson, Hugh A; Peers, Chris; Robertson, Brian; Beech, David J

    2009-01-01

    Multi-well robotic planar patch-clamp has become common in drug development and safety programmes because it enables efficient and systematic testing of compounds against ion channels during voltage-clamp. It has not, however, been adopted significantly in other important areas of ion channel research, where conventional patch-clamp remains the favoured method. Here we show the wider potential of the multi-well approach with the capability for efficient intracellular solution exchange, describing protocols and success rates for recording from a range of native and primary mammalian cells derived from blood vessels, arthritic joints, and the immune and central nervous systems. The protocol involves preparing a suspension of single cells to be dispensed robotically into 4-8 microfluidic chambers each containing a glass chip with a small aperture. Under automated control, giga-seals and whole-cell access are achieved followed by pre-programmed routines of voltage paradigms and fast extracellular or intracellular solution exchange. Recording from 48 chambers usually takes 1-6 hr depending on the experimental design and yields 16-33 cell recordings. PMID:19197268

  15. A Compact Closed-Loop Optogenetics System Based on Artifact-Free Transparent Graphene Electrodes

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-03-01

    Full Text Available Electrophysiology is a decades-old technique widely used for monitoring activity of individual neurons and local field potentials. Optogenetics has revolutionized neuroscience studies by offering selective and fast control of targeted neurons and neuron populations. The combination of these two techniques is crucial for causal investigation of neural circuits and understanding their functional connectivity. However, electrical artifacts generated by light stimulation interfere with neural recordings and hinder the development of compact closed-loop systems for precise control of neural activity. Here, we demonstrate that transparent graphene micro-electrodes fabricated on a clear polyethylene terephthalate film eliminate the light-induced artifact problem and allow development of a compact battery-powered closed-loop optogenetics system. We extensively investigate light-induced artifacts for graphene electrodes in comparison to metal control electrodes. We then design optical stimulation module using micro-LED chips coupled to optical fibers to deliver light to intended depth for optogenetic stimulation. For artifact-free integration of graphene micro-electrode recordings with optogenetic stimulation, we design and develop a compact closed-loop system and validate it for different frequencies of interest for neural recordings. This compact closed-loop optogenetics system can be used for various applications involving optogenetic stimulation and electrophysiological recordings.

  16. Phase-lock loop of Grid-connected Voltage Source Converter under non-ideal grid condition

    DEFF Research Database (Denmark)

    Wang, Haojie; Sun, Hai; Han, Minxiao

    2015-01-01

    It is a normal practice that the DC micro-grid is connected to AC main grid through Grid-connected Voltage Source Converter (G-VSC) for voltage support. Accurate control of DC micro-grid voltage is difficult for G-VSC under unbalanced grid condition as the fundamental positive-sequence component...... and distorted system voltage the proposed PLL can accurately detect the fundamental positive-sequence component of grid voltage thus accurate control of DC micro-grid voltage can be realized....... phase information cannot be accurately tracked. Based on analysis of the cause of double-frequency ripple when unbalance exists in main grid, a phase-locked loop (PLL) detection technique is proposed. Under the conditions of unsymmetrical system voltage, varying system frequency, single-phase system...

  17. Inertial piezoelectric linear motor driven by a single-phase harmonic wave with automatic clamping mechanism

    Science.gov (United States)

    He, Liangguo; Chu, Yuheng; Hao, Sai; Zhao, Xiaoyong; Dong, Yuge; Wang, Yong

    2018-05-01

    A novel, single-phase, harmonic-driven, inertial piezoelectric linear motor using an automatic clamping mechanism was designed, fabricated, and tested to reduce the sliding friction and simplify the drive mechanism and power supply control of the inertial motor. A piezoelectric bimorph and a flexible hinge were connected in series to form the automatic clamping mechanism. The automatic clamping mechanism was used as the driving and clamping elements. A dynamic simulation by Simulink was performed to prove the feasibility of the motor. The finite element method software COMSOL was used to design the structure of the motor. An experimental setup was built to validate the working principle and evaluate the performance of the motor. The prototype motor outputted a no-load velocity of 3.178 mm/s at a voltage of 220 Vp-p and a maximum traction force of 4.25 N under a preload force of 8 N. The minimum resolution of 1.14 μm was achieved at a driving frequency of 74 Hz, a driving voltage of 50 Vp-p, and a preload force of 0 N.

  18. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  19. Is early cord clamping, delayed cord clamping or cord milking best?

    Science.gov (United States)

    Vatansever, Binay; Demirel, Gamze; Ciler Eren, Elif; Erel, Ozcan; Neselioglu, Salim; Karavar, Hande Nur; Gundogdu, Semra; Ulfer, Gozde; Bahadir, Selcen; Tastekin, Ayhan

    2018-04-01

    To compare the antioxidant status of three cord clamping procedures (early clamping, delayed clamping and milking) by analyzing the thiol-disulfide balance. This randomized controlled study enrolled 189 term infants who were divided into three groups according to the cord clamping procedure: early clamping, delayed clamping and milking. Blood samples were collected from the umbilical arteries immediately after clamping, and the thiol/disulfide homeostasis was analyzed. The native and total thiol levels were significantly (p total thiol ratio was significantly (p = .026) lower in the delayed cord clamping and milking groups compared with the early clamping groups. Early cord clamping causes the production of more disulfide bonds and lower thiol levels, indicating that oxidation reactions are increased in the early cord clamping procedure compared with the delayed cord clamping and milking procedures. The oxidant capacity is greater with early cord clamping than with delayed clamping or cord milking. Delayed cord clamping or milking are beneficial in neonatal care, and we suggest that they be performed routinely in all deliveries.

  20. Enhanced Buck-Boost Three-Level Neutral-Point-Clamped Inverters

    DEFF Research Database (Denmark)

    Tan, K. K.; Gao, F.; Chiang Loh, Poh

    2009-01-01

    In traditional three-level neutral-point-clamped (NPC) inverters, a major issue is capacitor voltage imbalance, which results in low order harmonics. The compensation of the capacitor voltages often require additional control complexity, which cannot be conveniently implemented. The "alternative...... phase opposition disposition" (APOD) modulation method used in traditional NPC topologies also has lower harmonics performance as compared to the "phase disposition" (PD) modulation method.In this paper, we introduce a new three-level NPC topology that utilises the harmonically superior PD modulation...... method, with the ability to easily adjust for capacitor voltage imbalances. To further improve the boost capability of the three-level NPC inverters, another new topology introduces 2 additional diodes,achieving higher boost performance while totally eliminating thepossibility of capacitor voltage...

  1. Voltage Stabilizer Based on SPWM technique Using Microcontroller

    OpenAIRE

    K. N. Tarchanidis; J. N. Lygouras; P. Botsaris

    2013-01-01

    This paper presents an application of the well known SPWM technique on a voltage stabilizer, using a microcontroller. The stabilizer is AC/DC/AC type. So, the system rectifies the input AC voltage to a suitable DC level and the intelligent control of an embedded microcontroller regulates the pulse width of the output voltage in order to produce through a filter a perfect sinusoidal AC voltage. The control program on the microcontroller has the ability to change the FET transistor ...

  2. Micro flexible robot hand using electro-conjugate fluid

    Science.gov (United States)

    Ueno, S.; Takemura, K.; Yokota, S.; Edamura, K.

    2013-12-01

    An electro-conjugate fluid (ECF) is a kind of functional fluid, which produces a flow (ECF flow) when subjected to high DC voltage. Since it only requires a tiny electrode pair in micrometer size in order to generate the ECF flow, the ECF is a promising micro fluid pressure source. This study proposes a novel micro robot hand using the ECF. The robot hand is mainly composed of five flexible fingers and an ECF flow generator. The flexible finger is made of silicone rubber having several chambers in series along its axis. When the chambers are depressurized, the chambers deflate resulting in making the actuator bend. On the other hand, the ECF flow generator has a needle-ring electrode pair inside. When putting the ECF flow generator into the ECF and applying voltage of 6.0 kV to the electrode pair, we can obtain the pressure of 33.1 kPa. Using the components mentioned above, we developed the ECF robot hand. The height, the width and the mass of the robot hand are 45 mm, 40 mm and 5.2 g, respectively. Since the actuator is flexible, the robot hand can grasp various objects with various shapes without complex controller.

  3. Four- year thyroidectomy procedures: Ligasure Vs. clamp & tie

    Directory of Open Access Journals (Sweden)

    Pazoki AR

    2010-01-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: The electrothermal bipolar vessel sealing system is an adjunct to the hemostatic technique, which has been successfully used in many abdominal operation, recently made available to thyroid surgery. The purpose of this was compare the outcomes of new hemostatic technique with traditional method of clamp and tie."n"nMethods: In this retrospective cross-sectional study has been done in surgery's wards of Milad & Rasul- Akram hospitals in Tehran, Iran. During three- year period between 2005-2008 all patients with different kind of pathology that need operation were assessed. Time duration of surgery and hospital stay and post surgery complication in two group, ligasure (n=45 and clamp & tie (n=145 were compared with each others."n"nResults: No difference was seen between two groups in time duration of surgery. Significant difference was seen in hospital stay and complications of surgery. Time of operation in Ligasure group was 132/22 minute and in clamp and tie group was 130/10 minute. There was found significant difference in duration of hospital stay and postoperative complication. Hypocalcemia were seen in two and 24 cases in Ligasure and Clamp & Tie group, respectively (p<0.05. Hospital stay was 2

  4. Detection of underground mined voids using line electrode resistivity technique - case study

    Energy Technology Data Exchange (ETDEWEB)

    Peng, S.S.; Ziaie, F. (West Virginia University, Morgantown, WV (USA))

    1991-06-01

    A new resistivity method was developed and tested in three phases; simulated model, similitude model, and field survey. This resistivity method was a combination of the Bristow arrangement and line electrode method. Three line electrodes were chosen so that the sinkhole electrode was emplaced at a far distance from the other two electrodes. Any of the two electrodes and the sinkhole electrode were activated and several resistivity profiles perpendicular to the line electrode prepared for different electrodes activation. Subsurface cavities caused resistivity anomalies which were interpreted to locate their sources (cavities) and estimate the depths and dimension of the cavities. A coal mine site employing the room and pillar mining system was selected to confirm the results of the laboratory. The results of the interpretation indicated that the entry with a dimension of 135 cm high and 5.40 m wide at a depth of 25.50 m can be detected by this method. The resolution of the detectability of this method proved a great success when compared to other resistivity techniques. 6 refs., 6 figs.

  5. The combined use of scanning vibrating electrode technique and micro-potentiometry to assess the self-repair processes in defects on 'smart' coatings applied to galvanized steel

    International Nuclear Information System (INIS)

    Taryba, M.; Lamaka, S.V.; Snihirova, D.; Ferreira, M.G.S.; Montemor, M.F.; Wijting, W.K.; Toews, S.; Grundmeier, G.

    2011-01-01

    Research highlights: → Weldable primers were modified with submicron containers loaded with corrosion inhibitors. → SVET and micro-potentiometry were used to study the corrosion inhibition ability. → Submicron containers do not damage the barrier properties of model primers. → Artificial defects of 50μm x 50 μm in a coating can be easily analyzed by SVET and SIET. → Inhibiting dissolution of sacrificial Zn may result in detrimental dissolution of Fe. - Abstract: Model weldable primer coatings for galvanized steel were modified with submicron containers loaded with corrosion inhibitors. This procedure aims at introducing a new functionality in the thin coatings self-repair ability. The assessment of this property demands new protocols and new approaches, combining conventional electrochemical methods with electrochemical and analytical techniques of micrometer spatial resolution. Thus, in this work model defects were created in the coatings by using a focused ion beam (FIB). The coated samples, containing the model defects, were immersed in a NaCl 0.05 M solution and the corrosion inhibition ability was studied using the scanning vibrating electrode technique (SVET) and the scanning ion-selective electrode technique (SIET). SVET-SIET measurements were performed quasi-simultaneously. Qualitative chemical analysis was performed by SEM combined with EDS. Complementary studies were carried out by electrochemical impedance spectroscopy (EIS) to assess the effect of the containers filled with corrosion inhibitors on the barrier properties of the coatings. The electrochemical results highlight the importance of the combined use of integral and localized electrochemical techniques to extract information for a better understanding of the corrosion processes and corresponding repair of active microscopic defects formed on thin coatings containing inhibitor filled containers.

  6. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    KAUST Repository

    Wu, Kunlin

    2012-12-13

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

  7. Constant-frequency, clamped-mode resonant converters

    Science.gov (United States)

    Tsai, Fu-Sheng; Materu, Peter; Lee, Fred C.

    1987-01-01

    Two novel clamped-mode resonant converters are proposed which operate at a constant frequency while retaining many desired features of conventional series- and parallel-resonant converters. State-plane analysis techniques are used to identify all possible operating modes and define their mode boundaries. Control-to-output characteristics are derived that specify the regions for natural and forced commutation. The predicted operating modes are verified using a prototype circuit.

  8. Design and implementation of an array of micro-electrochemical detectors for two-dimensional liquid chromatography--proof of principle.

    Science.gov (United States)

    Abia, Jude A; Putnam, Joel; Mriziq, Khaled; Guiochon, Georges A

    2010-03-05

    Simultaneous two-dimensional liquid chromatography (2D-LC) is an implementation of two-dimensional liquid chromatography which has the potential to provide very fast, yet highly efficient separations. It is based on the use of time x space and space x space separation systems. The basic principle of this instrument has been validated long ago by the success of two-dimensional thin layer chromatography. The construction of a pressurized wide and flat column (100 mm x 100 mm x 1 mm) operated under an inlet pressure of up to 50 bar was described previously. However, to become a modern analytical method, simultaneous 2D-LC requires the development of detectors suitable for the monitoring of the composition of the eluent of this pressurized planar, wide column. An array of five equidistant micro-electrochemical sensors was built for this purpose and tested. Each sensor is a three-electrode system, with the working electrode being a 25 microm polished platinum micro-electrode. The auxiliary electrode is a thin platinum wire and the reference electrode an Ag/AgCl (3M sat. KCl) electrode. In this first implementation, proof of principle is demonstrated, but the final instrument will require a much larger array. 2010 Elsevier B.V. All rights reserved.

  9. From understanding cellular function to novel drug discovery: the role of planar patch-clamp array chip technology

    Directory of Open Access Journals (Sweden)

    Christophe ePy

    2011-10-01

    Full Text Available All excitable cell functions rely upon ion channels that are embedded in their plasma membrane. Perturbations of ion channel structure or function result in pathologies ranging from cardiac dysfunction to neurodegenerative disorders. Consequently, to understand the functions of excitable cells and to remedy their pathophysiology, it is important to understand the ion channel functions under various experimental conditions – including exposure to novel drug targets. Glass pipette patch-clamp is the state of the art technique to monitor the intrinsic and synaptic properties of neurons. However, this technique is labor-intensive and has low data throughput. Planar patch-clamp chips, integrated into automated systems, offer high throughputs but are limited to isolated cells from suspensions, resulting in questionable models of true physiological function, and are unsuitable for studies involving neuronal communication. Multi-electrode arrays (MEA, in contrast, have the ability to monitor network activity by measuring local field potentials from multiple extracellular sites, but specific ion channel activity is challenging to extract from these multiplexed signals. Here we describe a novel planar patch-clamp chip technology that enables the simultaneous high resolution electrophysiological interrogation of individual neurons at multiple sites in synaptically connected neuronal networks, thereby combining the advantages of MEA and patch-clamp techniques. Each neuron can be probed through an aperture that connects to a dedicated subterranean microfluidic channel. Neurons growing in networks are aligned to the apertures by physisorbed or chemisorbed chemical cues. In this review, we describe the design and fabrication process of these chips, the approach to the chemical patterning for cell placement, and present physiological data from cultured neuronal cells.

  10. A 3D-Space Vector Modulation Algorithm for Three Phase Four Wire Neutral Point Clamped Inverter Systems as Power Quality Compensator

    Directory of Open Access Journals (Sweden)

    Palanisamy Ramasamy

    2017-11-01

    Full Text Available A Unified Power Quality Conditioner (UPQC is designed using a Neutral Point Clamped (NPC multilevel inverter to improve the power quality. When designed for high/medium voltage and power applications, the voltage stress across the switches and harmonic content in the output voltage are increased. A 3-phase 4-wire NPC inverter system is developed as Power Quality Conditioner using an effectual three dimensional Space Vector Modulation (3D-SVM technique. The proposed system behaves like a UPQC with shunt and series active filter under balanced and unbalanced loading conditions. In addition to the improvement of the power quality issues, it also balances the neutral point voltage and voltage balancing across the capacitors under unbalanced condition. The hardware and simulation results of proposed system are compared with 2D-SVM and 3D-SVM. The proposed system is stimulated using MATLAB and the hardware is designed using FPGA. From the results it is evident that effectual 3D-SVM technique gives better performance compared to other control methods.

  11. High stored-energy breakdown tests on electrodes made of stainless steel, copper, titanium and molybdenum

    Energy Technology Data Exchange (ETDEWEB)

    Esch, H. P. L. de, E-mail: hubert.de-esch@cea.fr; Simonin, A.; Grand, C. [CEA-Cadarache, IRFM, F-13108 St. Paul-lez-Durance (France)

    2015-04-08

    IRFM have conducted resilience tests on electrodes made of Cu, stainless steel 304L, Ti and Mo against breakdowns up to 170 kV and 300 J. The tests of the 10×10 cm{sup 2} electrodes have been performed at an electrode distance d=11 mm under vacuum (P∼5×10{sup −6} mbar). No great difference in voltage holding between the materials could be identified; all materials could reach a voltage holding between 140 and 170 kV over the 11 mm gap, i.e. results scatter within a ±10% band. After exposure to ∼10000 seconds of high-voltage (HV) on-time, having accumulated ∼1000 breakdowns, the electrodes were inspected. The anodes were covered with large and small craters. The rugosity of the anodes had increased substantially, that of the cathodes to a lesser extent. The molybdenum electrodes are least affected, but this does not show in their voltage holding capability. It is hypothesized that penetrating high-energy electrons from the breakdown project heat below the surface of the anode and cause a micro-explosion of material when melting point is exceeded. Polished electrodes have also been tested. The polishing results in a substantially reduced breakdown rate in the beginning, but after having suffered a relatively small number (∼100) of breakdowns, the polished electrodes behaved the same as the unpolished ones.

  12. Programming voltage reduction in phase change memory cells with tungsten trioxide bottom heating layer/electrode

    International Nuclear Information System (INIS)

    Rao Feng; Song Zhitang; Gong Yuefeng; Wu Liangcai; Feng Songlin; Chen, Bomy

    2008-01-01

    A phase change memory cell with tungsten trioxide bottom heating layer/electrode is investigated. The crystalline tungsten trioxide heating layer promotes the temperature rise in the Ge 2 Sb 2 Te 5 layer which causes the reduction in the reset voltage compared to a conventional phase change memory cell. Theoretical thermal simulation and calculation for the reset process are applied to understand the thermal effect of the tungsten trioxide heating layer/electrode. The improvement in thermal efficiency of the PCM cell mainly originates from the low thermal conductivity of the crystalline tungsten trioxide material.

  13. Statistical Analysis of Partial Discharge Characteristics in Transformer Oil at the “Point-Plane” Electrode at Alternating Voltage

    Directory of Open Access Journals (Sweden)

    Korobeynikov S.M.

    2017-08-01

    Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.

  14. Simulation For Synchronization Of A Micro-Grid With Three-Phase Systems

    Directory of Open Access Journals (Sweden)

    Mohammad Jafari Far

    2015-08-01

    Full Text Available Abstract today due to the high reliability of the micro-grids they have developed significantly. They have two states of operation the island state and connection to the main grid. Under certain circumstances the micro-grid is connected to or disconnected from the network. Synchronization of a micro-grid with the network must be done when its voltage is synchronized with the voltage in the main grid. Phase lock loops are responsible to identify the voltage phase of the micro-gird and the main grid and when these two voltages are in the same phase they connect the micro-grid to the main grid. In this research the connection of a micro-grid to the main grid in the two phases of synchronous and asynchronous voltage is simulated and investigated.

  15. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    International Nuclear Information System (INIS)

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  16. Control of local intracellular calcium concentration with dynamic-clamp controlled 2-photon uncaging.

    Directory of Open Access Journals (Sweden)

    Erwin Idoux

    Full Text Available The variations of the intracellular concentration of calcium ion ([Ca(2+](i are at the heart of intracellular signaling, and their imaging is therefore of enormous interest. However, passive [Ca(2+](i imaging provides no control over these variations, meaning that a full exploration of the functional consequences of [Ca(2+](i changes is difficult to attain. The tools designed so far to modify [Ca(2+](i, even qualitatively, suffer drawbacks that undermine their widespread use. Here, we describe an electro-optical technique to quantitatively set [Ca(2+](i, in real time and with sub-cellular resolution, using two-photon Ca(2+ uncaging and dynamic-clamp. We experimentally demonstrate, on neurons from acute olfactory bulb slices of Long Evans rats, various capabilities of this technique previously difficult to achieve, such as the independent control of the membrane potential and [Ca(2+](i variations, the functional knocking-in of user-defined virtual voltage-dependent Ca(2+ channels, and the standardization of [Ca(2+](i patterns across different cells. Our goal is to lay the groundwork for this technique and establish it as a new and versatile tool for the study of cell signaling.

  17. A thermoelectric voltage effect in polyethylene oxide

    International Nuclear Information System (INIS)

    Martin, Bjoern; Wagner, Achim; Kliem, Herbert

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

  18. A thermoelectric voltage effect in polyethylene oxide

    CERN Document Server

    Martin, B; Kliem, H

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

  19. Zero-voltage DC/DC converter with asymmetric pulse-width modulation for DC micro-grid system

    Science.gov (United States)

    Lin, Bor-Ren

    2018-04-01

    This paper presents a zero-voltage switching DC/DC converter for DC micro-grid system applications. The proposed circuit includes three half-bridge circuit cells connected in primary-series and secondary-parallel in order to lessen the voltage rating of power switches and current rating of rectifier diodes. Thus, low voltage stress of power MOSFETs can be adopted for high-voltage input applications with high switching frequency operation. In order to achieve low switching losses and high circuit efficiency, asymmetric pulse-width modulation is used to turn on power switches at zero voltage. Flying capacitors are used between each circuit cell to automatically balance input split voltages. Therefore, the voltage stress of each power switch is limited at Vin/3. Finally, a prototype is constructed and experiments are provided to demonstrate the circuit performance.

  20. Maintaining stability of standalone Micro-Grid by employing electrical and mechanical fault ride through techniques upon fixed speed wind generation systems

    International Nuclear Information System (INIS)

    Kamel, Rashad M.

    2013-01-01

    Highlights: • This paper presented two fault ride through techniques for fixed speed wind systems. • The first technique is implemented by inserting a series resistance with the terminals of wind generator. • Second technique is performed by adapting the gear ratio to spill some mechanical power. - Abstract: This study presents two different Fault Ride Through (FRT) techniques to keep and restore stability of Fixed Speed Wind Generation system (FSWGs) installed in standalone Micro-Grid (MG). The first technique is an electrical FRT and is implemented by inserting a series resistance with the terminals of FSWGs during fault to maintain reasonable value of terminal voltage and consequently help stability restoration. The second controller is a mechanical FRT controller and is performed by change the gear ratio of wind generation systems to spill part of extracted mechanical power and consequently improving stability issue. Obtained results proved that each controller able to maintain the stability of FSWGs under the most severe disturbance conditions (400 ms three phase fault at FSWGs terminals). The first controller is faster than the second controller in restoring FSWGs stability. Superior results and performances are obtained when the two FRT techniques are employed simultaneously. Without employing any one of the two FRT techniques, FSWGs is not able to maintain or restore its stability after fault clearing. Consequently, MG will lose one of its micro-sources and cannot keep its stability during the standalone mode, unless load shedding strategy is activated. The two proposed controllers are simple, effective, and economical attractive

  1. A new clamp method for firing bricks | Obeng | Journal of Applied ...

    African Journals Online (AJOL)

    A new clamp method for firing bricks. ... Journal of Applied Science and Technology ... To overcome this operational deficiencies, a new method of firing bricks that uses brick clamp technique that incorporates a clamp wall of 60 cm thickness, a six tier approach of sealing the top of the clamp (by combination of green bricks) ...

  2. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  3. Small Molecules for Early Endosome-Specific Patch Clamping.

    Science.gov (United States)

    Chen, Cheng-Chang; Butz, Elisabeth S; Chao, Yu-Kai; Grishchuk, Yulia; Becker, Lars; Heller, Stefan; Slaugenhaupt, Susan A; Biel, Martin; Wahl-Schott, Christian; Grimm, Christian

    2017-07-20

    To resolve the subcellular distribution of endolysosomal ion channels, we have established a novel experimental approach to selectively patch clamp Rab5 positive early endosomes (EE) versus Rab7/LAMP1-positive late endosomes/lysosomes (LE/LY). To functionally characterize ion channels in endolysosomal membranes with the patch-clamp technique, it is important to develop techniques to selectively enlarge the respective organelles. We found here that two small molecules, wortmannin and latrunculin B, enlarge Rab5-positive EE when combined but not Rab7-, LAMP1-, or Rab11 (RE)-positive vesicles. The two compounds act rapidly, specifically, and are readily applicable in contrast to genetic approaches or previously used compounds such as vacuolin, which enlarges EE, RE, and LE/LY. We apply this approach here to measure currents mediated by TRPML channels, in particular TRPML3, which we found to be functionally active in both EE and LE/LY in overexpressing cells as well as in endogenously expressing CD11b+ lung-tissue macrophages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Influence of squeeze film damping on the higher-order modes of clamped–clamped microbeams

    KAUST Repository

    Alcheikh, Nouha

    2016-05-06

    This paper presents an experimental study and a finite-element analysis of the effect of squeeze film damping on the resonance frequency and quality factor of the higher-order flexure vibrations modes of clamped-clamped microbeams. Viscoelastic and silicon nitride microbeams are fabricated and are electrostatically actuated by various electrode configurations to trigger the first, second, and third modes. The damping characteristic and the resonance frequency of these modes are examined for a wide range of gas pressure and electrostatic voltage loads. The results of the silicon nitride beams and viscoelastic beams are compared. It is found that the intrinsic material loss is the major dissipation mechanism at low pressure for the viscoelastic microbeams, significantly limiting their quality factor. It is also found that while the silicon nitride beams show higher quality factors at the intrinsic and molecular regimes of pressure, due to their low intrinsic loss, their quality factors near atmospheric pressure are lower than those of the viscoelastic microbeams. Further, the higher-order modes of all the beams show much higher quality factors at atmospheric pressure compared to the first mode, which could be promising for operating such resonators in air. Experimental results and finite element model simulations show good agreement for resonance frequency and quality factor for the three studied modes. © 2016 IOP Publishing Ltd.

  5. Two-dimensional Cu2Si sheet: a promising electrode material for nanoscale electronics

    Science.gov (United States)

    Meng Yam, Kah; Guo, Na; Zhang, Chun

    2018-06-01

    Building electronic devices on top of two-dimensional (2D) materials has recently become one of most interesting topics in nanoelectronics. Finding high-performance 2D electrode materials is one central issue in 2D nanoelectronics. In the current study, based on first-principles calculations, we compare the electronic and transport properties of two nanoscale devices. One device consists of two single-atom-thick planar Cu2Si electrodes, and a nickel phthalocyanine (NiPc) molecule in the middle. The other device is made of often-used graphene electrodes and a NiPc molecule. Planer Cu2Si is a new type of 2D material that was recently predicted to exist and be stable under room temperature [11]. We found that at low bias voltages, the electric current through the Cu2Si–NiPc–Cu2Si junction is about three orders higher than that through graphene–NiPc–graphene. Detailed analysis shows that the surprisingly high conductivity of Cu2Si–NiPc–Cu2Si originates from the mixing of the Cu2Si state near Fermi energy and the highest occupied molecular orbital of NiPc. These results suggest that 2D Cu2Si may be an excellent candidate for electrode materials for future nanoscale devices.

  6. A new method to compensate impedance artefacts for Li-ion batteries with integrated micro-reference electrodes

    NARCIS (Netherlands)

    Raijmakers, L.H.J.; Notten, P.H.L.; Lammers, M.J.G.

    2017-01-01

    In order to measure the electrochemical characteristics of both electrodes inside Li-ion batteries, micro-reference electrodes (μREF) turned out to be very useful. However, measuring the electrochemical impedance with respect to μREF can lead to severe measurement artefacts, making a detailed

  7. Contribution to high voltage matrix switches reliability

    International Nuclear Information System (INIS)

    Lausenaz, Yvan

    2000-01-01

    Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr

  8. Highly selective water channel activity measured by voltage clamp: analysis of planar lipid bilayers reconstituted with purified AqpZ.

    Science.gov (United States)

    Pohl, P; Saparov, S M; Borgnia, M J; Agre, P

    2001-08-14

    Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.

  9. Ready fabrication of thin-film electrodes from building nanocrystals for micro-supercapacitors.

    Science.gov (United States)

    Chen, Zheng; Weng, Ding; Wang, Xiaolei; Cheng, Yanhua; Wang, Ge; Lu, Yunfeng

    2012-04-18

    Thin-film pseudocapacitor electrodes with ultrafast lithium storage kinetics, high capacitance and excellent cycling stability were fabricated from monodispersed TiO(2) building nanocrystals, providing a novel approach towards next-generation micro-supercapacitor applications. This journal is © The Royal Society of Chemistry 2012

  10. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  11. Decommissioning: dismantling of thickwalled steel structures using the contact-arc-metal-drilling technique. Final report

    International Nuclear Information System (INIS)

    Bach, F.W.; Lindemaier, J.; Philipp, E.

    1998-01-01

    1. Status of the technology: Today austenitic steel components with a material thickness of more than 200 mm cannot be cut surely by using conventional thermal cutting techniques. A reduction of the wall thickness, by using an effective cutting technique with low restoring forces, is necessary but not available, now. 2. Objectives: Target of the project was the qualification of the thermal contact-arc-metal-drilling technique, based on the contact-arc-metal-cutting technique for the reduction of the wall thickness of steel components in preparation for other cutting techniques to finish the dismantling task if necessary. 3. Methode: Development of the contact-arc-metal-drilling technique for the production of deep (>200 mm) blind holes with non-circular cross sections. Optimization of the drilling parameters and quantification of the released emissions under a radiological aspect. Development of a monitoring system for the electrode wear and a device for changing weared electrodes automatically. 4. Result: The contact-arc-metal-drilling technique was qualified by producing blind holes with a depth of 230 mm. The aerosols, hydrosols and gas emissions of the process were quantified and various monitoring techniques for the wear of the electrode were tested. A pneumatically aided clamping and changing device for electrodes was designed and tested. 5. Applications: The designed clamping device with its integrated pneumatically aided electrode release can be adapted directly to a tool guiding machine. Using this cutting technique steel components with a material thickness of 230 mm can be reduced to a remaining wall thickness and the released emissions can be estimated. (orig.) [de

  12. Micromachined Planar Supercapacitor with Interdigital Buckypaper Electrodes

    Directory of Open Access Journals (Sweden)

    Yun-Ting Chen

    2018-05-01

    Full Text Available In this work, a flexible micro-supercapacitor with interdigital planar buckypaper electrodes is presented. A simple fabrication process involving vacuum filtration method and SU-8 molding techniques is proposed to fabricate in-plane interdigital buckypaper electrodes on a membrane filter substrate. The proposed process exhibits excellent flexibility for future integration of the micro-supercapacitors (micro-SC with other electronic components. The device’s maximum specific capacitance measured using cyclic voltammetry was 107.27 mF/cm2 at a scan rate of 20 mV/s. The electrochemical stability was investigated by measuring the performance of charge-discharge at different discharge rates. Devices with different buckypaper electrode thicknesses were also fabricated and measured. The specific capacitance of the proposed device increased linearly with the buckypaper electrode thickness. The measured leakage current was approximately 9.95 µA after 3600 s. The device exhibited high cycle stability, with 96.59% specific capacitance retention after 1000 cycles. A Nyquist plot of the micro-SC was also obtained by measuring the impedances with frequencies from 1 Hz to 50 kHz; it indicated that the equivalent series resistance value was approximately 18 Ω.

  13. The hypertriglyceridemic clamp technique. Studies using long-chain and structured triglyceride emulsions in healthy subjects.

    Science.gov (United States)

    Nordenström, Jörgen; Thörne, Anders; Aberg, Wiveca; Carneheim, Claes; Olivecrona, Thomas

    2006-11-01

    In a randomized crossover study, plasma kinetics of 2 different types of fat emulsions were studied in 8 healthy volunteers by using a hypertriglyceridemic clamp technique. The method involves the stabilization of serum triglyceride (TG) concentration during 180 minutes at a predetermined level (4 mmol/L) by adjustment of TG infusion rate by repeated online measurements of serum TG concentration. The fat emulsions under study were a long-chain fatty acid triglyceride (LCT) emulsion (Intralipid 20%, Fresenius Kabi, Sweden) and a structured triglyceride (STG) emulsion (Structolipid 20%, Fresenius Kabi) where medium- and long-chain fatty acids have been interesterified within a TG molecule. The hypertriglyceridemic clamp was found to have acceptable reproducibility when tested in 3 healthy individuals on 2 different occasions, as similar steady-state TG levels were obtained by infusing similar amounts of fat. The average (+/-SEM) TG concentration during the 180-minute clamp was similar for STGs and LCTs (4.0 +/- 0.1 vs 3.9 +/- 0.1 mmol/L; not significant), but the amount of fat that had to be infused was significantly higher during STG than during LCT clamping (0.31 +/- 0.04 vs 0.21 +/- 0.02 g TG per minute; P < .05). Higher serum levels of free fatty acids (1.80 +/- 0.13 vs 0.96 +/- 0.09 mmol/L; P < .05), free glycerol (1.30 +/- 0.07 vs 0.76 +/- 0.08 mmol/L; P < .001), and beta-OH butyrate (1.61 +/- 0.44 vs 1.17 +/- 0.23 mmol/L; not significant) were obtained at the end of the clamp during infusion of STGs compared with LCTs. During infusion of STGs the medium-chain fatty acids octanoic (C:8) and decanoic acid (C:10) constituted approximately half of circulating fatty acids that correspond to the compositional ratio of the emulsion. Plasma lipoprotein lipase (LPL) concentration was higher during STG than during LCT clamping (6.06 +/- 0.62 vs 3.15 +/- 0.40 mU/mL; P < .05), and there was a positive correlation between the mean LPL concentration and the amount of

  14. Trans-Z-source and Γ-Z-source neutral-point-clamped inverters

    DEFF Research Database (Denmark)

    Wei, Mo; Loh, Poh Chiang; Blaabjerg, Frede

    2015-01-01

    Z-source neutral-point-clamped (NPC) inverters are earlier proposed for obtaining voltage buck-boost and three-level switching simultaneously. Their performances are, however, constrained by a trade-off between their input-to-output gain and modulation ratio. This trade-off can lead to high...

  15. High-current and low acceleration voltage arsenic ion implanted polysilicon-gate and source-drain electrode Si mos transistor

    International Nuclear Information System (INIS)

    Saito, Yasuyuki; Sugimura, Yoshiro; Sugihara, Michiyuki

    1993-01-01

    The fabrication process of high current arsenic (As) ion implanted polysilicon (Si) gate and source drain (SD) electrode Si n-channel metal oxide-semiconductor field effect transistor (MOSFET) was examined. Poly Si film n-type doping was performed by using high current (typical current: 2mA) and relatively low acceleration voltage (40keV) As ion implantation technique (Lintott series 3). It was observed that high dose As implanted poly Si films as is show refractoriness against radical fluorine excited by microwave. Using GCA MANN4800 (m/c ID No.2, resist: OFPR) mask pattern printing technique, the high current As ion implantation technique and radical fluorine gas phase etching (Chemical dry etching: CDE) technique, the n-channel Poly Si gate (ρs = ≅100Ω/□) enhancement MQSFETs(ρs source drain = ≅50Ω/□, SiO 2 gate=380 angstrom) with off-leak-less were obtained on 3 inch Czochralski grown 2Ωcm boron doped p type wafers (Osaka titanium). By the same process, a 8 bit single chip μ-processor with 26MHz full operation was performed

  16. Integration of Fuel Cell Micro-CHPs on Low. Voltage Grid: A Danish Case Study

    DEFF Research Database (Denmark)

    You, Shi; Marra, Francesco; Træholt, Chresten

    2012-01-01

    The future significance of fuel cell (FC) powered micro combined heat and power (micro-CHP) units in meeting the residential energy demands is set to increase, which may have a considerable impact on the low voltage (LV) grid. The objective of this paper is to investigate into the related technical...... issues using a Danish case study with different penetration levels of uncoordinated FC micro-CHPs. Based on the findings, it is recommended to design grid oriented integration strategies such as Virtual Power Plants (VPPs) for achieving future smart grids with a large roll out of distributed energy...

  17. Dynamic Pull-In Investigation of a Clamped-Clamped Nanoelectromechanical Beam under Ramp-Input Voltage and the Casimir Force

    Directory of Open Access Journals (Sweden)

    Amir R. Askari

    2014-01-01

    Full Text Available The influence of the Casimir excitation on dynamic pull-in instability of a nanoelectromechanical beam under ramp-input voltage is studied. The ramp-input actuation has applications in frequency sweeping of RF-N/MEMS. The presented model is nonlinear due to the inherent nonlinearity of electrostatics and the Casimir excitations as well as the geometric nonlinearity of midplane stretching. A Galerkin based reduced order modeling is utilized. It is found that the calculated dynamic pull-in ramp input voltage leads to dynamic pull-in step input voltage by increasing the slope of voltage-time diagram. This fact is utilized to verify the results of present study.

  18. Sub-millimeter arbitrary arrangements of monolithically micro-scale electrical double layer capacitors

    International Nuclear Information System (INIS)

    Laszczyk, Karolina U; Kazufumi, Kobashi; Sakurai, Shunsuke; Sekiguchi, Atsuko; Futaba, Don N; Yamada, Takeo; Hata, Kenji

    2015-01-01

    We report the investigation on the reproducibility of micro-scale electric double layer capacitors (micro-EDLCs). The micro-EDLC components were fabricated parallel using photolithography, wet and dry processing. Electrodes of the micro-EDLCs are highly dense packed Single Wall Carbon Nanotubes (SWCNTs) that form a mesh structure. The micro- EDLCs are connected 1-10 in series and in parallel being unified electrical circuits to tune the capacitance and the operational voltage. To confirm the reproducibility of the cells as well as the yield we performed electrochemical measurements in order to define the performance uniformity between cells strings and individual cells connected in a string. For 1-10 cells in series and in parallel the trends for the capacitance and operational voltage satisfied electrophysics rules governing cells addition. However, the measurements of the individual cells in a string revealed the significant performance discrepancy that might result in a shorten life cycling of a circuit. (paper)

  19. Sub-millimeter arbitrary arrangements of monolithically micro-scale electrical double layer capacitors

    Science.gov (United States)

    Laszczyk, Karolina U.; Kazufumi, Kobashi; Sakurai, Shunsuke; Sekiguchi, Atsuko; Futaba, Don N.; Yamada, Takeo; Hata, Kenji

    2015-12-01

    We report the investigation on the reproducibility of micro-scale electric double layer capacitors (micro-EDLCs). The micro-EDLC components were fabricated parallel using photolithography, wet and dry processing. Electrodes of the micro-EDLCs are highly dense packed Single Wall Carbon Nanotubes (SWCNTs) that form a mesh structure. The micro- EDLCs are connected 1-10 in series and in parallel being unified electrical circuits to tune the capacitance and the operational voltage. To confirm the reproducibility of the cells as well as the yield we performed electrochemical measurements in order to define the performance uniformity between cells strings and individual cells connected in a string. For 1-10 cells in series and in parallel the trends for the capacitance and operational voltage satisfied electrophysics rules governing cells addition. However, the measurements of the individual cells in a string revealed the significant performance discrepancy that might result in a shorten life cycling of a circuit.

  20. Electron transfer at boron-doped diamond electrodes modified by graphitic micro-domains

    Energy Technology Data Exchange (ETDEWEB)

    Mahe, E.; Devilliers, D. [Pierre et Marie Curie Univ., Paris (France). Electrochemistry Lab.; Comninellis, C. [Lausanne Ecole Polytechnique, Lausanne (Switzerland). Groupe de Genie Electrochimique

    2006-07-01

    Boron-doped (BDD) electrodes have been used in electrolysis procedures for the last 10 years. The mechanical stability of the electrode, its large electrochemical window and its low capacitive current place this new electrode material as an alternative for replacing more costly or toxic materials such as mercury. However, the ferri/ferrocyanide system of boron-doped electrodes has shown contradictory results in the literature. This study proposed a cathodic pre-treatment which relied on the presence of residual graphitic domains formed during the preparation of the BDD film. An experiment was conducted in which the doping procedure was used to control the amount of graphitic phase on the electrode with highly oriented pyrolytic graphite (HOPG) grafted on the BDD surface. Surface characterization with Raman spectroscopy and Scanning Electron Microscopy (SEM) was then carried out using cyclic voltammetry and electrochemical impedance spectroscopy. The electroanalytical determination of the amount of graphitic micro-domains was described and a pulse procedure was proposed which obtained a reproducible surface state. 2 refs., 2 figs.

  1. Textile Wastewater Treatment by Electrocoagulation Process using Aluminum Electrodes

    Directory of Open Access Journals (Sweden)

    Edris Bazrafshan

    2014-03-01

    Full Text Available Background and purpose: Textile industries are among the most polluting industries regarding the volume and the complexity of treatment of its effluents discharge. This study investigated the efficiency of electrocoagulation process using aluminum electrodes in basic red 18 dye removal from aqueous solutions. Materials and Methods: This study was performed in a bipolar batch reactor with six aluminum electrodes connected in parallel. Several important parameters, such as initial pH of solution, initial dye concentration, applied voltage; conductivity and reaction time were studied in an attempt to achieve higher removal efficiency. Results: The electrochemical technique showed satisfactory dye removal efficiency and reliable performance in treating of basic red 18. The maximum efficiency of dye removal which was obtained in voltage of 50 V, reaction time of 60 min, initial concentration 50 mg/L, conductivity 3000 μS/cm and pH 7 was equal to 97.7%. Dye removal efficiency was increased accordance to increase of applied voltage and in contrast electrode and energy consumption was increased simultaneously. Conclusion: As a conclusion, the method was found to be highly efficient and relatively fast compared to conventional existing techniques for dye removal from aqueous solutions.

  2. Comparison between wire mesh and plate electrodes during Wide-pattern machining on invar fine sheet using through-mask electrochemical micromachining

    Energy Technology Data Exchange (ETDEWEB)

    Chun, Kwang-ho; Jin, Da-som; Kim, Seong-hyun; Lee, Eun-sang [Inha University, Incheon (Korea, Republic of)

    2017-04-15

    Many research on the fabrication of Organic light emitting diodes (OLED) shadow masks with high resolution have been carried out because of the development of the smart-display industry. It is the parts of display panel which has millions of micro holes on invar (Fe- Ni) fine sheet. Various techniques such as laser machining, chemical etching and Electrochemical micro-machining (EMM) are used to produce micro-hole arrays. In this study, Through-mask electrochemical machining (TMEMM) combine with portion of photolithography process was applied to fabricate micro-hole arrays on invar fine sheet. The sheet was coated with dry film photoresist. Two types of electrode, plate and mesh, was used to compare the influence of electrode type. The sheet was coated with dry film photoresist with micro- sized through holes. The results were compared in regard to uniformity and taper angle. Compared with the plate electrode, the mesh electrode has better uniformity and taper angle which is important criteria of OLED shadow mask. These results could be used to improve TMEMM for invar fine sheet when it is applied to fabricate micro-hole arrays and help to obtain optical uniformity and desired taper angles.

  3. DETERMINATION OF ANALYTICAL CALCULATION ERROR OF MAGNETIC FIELD OF HIGH-VOLTAGE CABLE LINES WITH TWO-POINT BONDED CABLE SHIELDS CAUSED BY NON-UNIFORM CURRENT DISTRIBUTION IN THE SHIELDS

    Directory of Open Access Journals (Sweden)

    M. I. Baranov

    2017-06-01

    Full Text Available Purpose. To obtain new calculation correlations, determining approximate energy dissipation and electric erosion of massive basic metallic electrodes in the high-voltage high-current air switchboard (HVCAS of atmospheric pressure, in-use in the bit chain of the high-voltage electrophysics setting (HVES with the powerful capacity store of energy (CSE. Methodology. Electrophysics bases of technique of high-voltage and large impulsive currents (LIC, scientific and technical bases of development and planning of high-voltage heavy-current impulsive electro-devices, including HVES and powerful CSE, and also methods of measuring in their bit chains of LIC of the microsecond temporal range. Results. On the basis of new engineering approach the results of calculation estimation of excretions energy and electric erosion of massive basic metallic electrodes are resulted in probed HVCAS. New correlations are obtained for the approximate calculation of thermal energy, selected in an impulsive air spark and on the workings surfaces of anode and cathode of HVCAS. It is entered and a new electrophysics concept, touching equivalent active resistance of impulsive air spark, is mathematically certain. New formulas are obtained for the approximate calculation of most depth of single round crater of destruction on the workings surfaces of basic metallic electrodes of HVCAS, and also mass of metal, thrown out magnetic pressure from this crater of destruction on the electrodes of switch for one electric discharge through them powerful CSE HVES. It is shown that the radius of the indicated single crater of destruction is approximately equal to the maximal radius of plasma channel of a spark discharge between a cathode and anode of HVCAS. The executed high-current experiments in the bit chain of HVES with powerful CSE validated row of the got and in-use calculation correlations for the estimation of energy dissipation and electric erosion of metallic electrodes in

  4. IMPROVING BANDWIDTH OF FLIPPED VOLTAGE FOLLOWER USING GATE-BODY DRIVEN TECHNIQUE

    Directory of Open Access Journals (Sweden)

    VANDANA NIRANJAN

    2017-01-01

    Full Text Available In this paper, a new approach to enhance the bandwidth of flipped voltage follower is explored. The proposed approach is based on gate-body driven technique. This technique boosts the transconductance in a MOS transistor as both gate and body/bulk terminals are tied together and used as signal input. This novel technique appears as a good solution to merge the advantages of gate-driven and bulk-driven techniques and suppress their disadvantages. The gate-body driven technique utilizes body effect to enable low voltage low power operation and improves the overall performance of flipped voltage follower, providing it with low output impedance, high input impedance and bandwidth extension ratio of 2.614. The most attractive feature is that bandwidth enhancement has been achieved without use of any passive component or extra circuitry. Simulations in PSpice environment for 180 nm CMOS technology verified the predicted theoretical results. The improved flipped voltage follower is particularly interesting for high frequency low noise signal processing applications.

  5. Development of a time projection chamber with micro-pixel electrodes

    International Nuclear Information System (INIS)

    Kubo, Hidetoshi; Miuchi, Kentaro; Nagayoshi, Tsutomu; Ochi, Atsuhiko; Orito, Reiko; Takada, Atsushi; Tanimori, Toru; Ueno, Masaru

    2003-01-01

    A time projection chamber (TPC) based on a gaseous chamber with micro-pixel electrodes (μ-PIC) has been developed for measuring three-dimensional tracks of charged particles. The μ-PIC with a detection area of 10x10 cm 2 consists of a double-sided printing circuit board. Anode pixels are formed with 0.4 mm pitch on strips aligned perpendicular to the cathode strips in order to obtain a two-dimensional position. In the TPC with drift length of 8 cm, 4 mm wide field cage electrodes are aligned at 1 mm spaces and a uniform electric field of about 0.4 kV/cm is produced. For encoding of the three-dimensional position a synchronous readout system has been developed using Field Programmable Gate Arrays with 40 MHz clock. This system enables us to reconstruct the three-dimensional track of the particle at successive points like a cloud chamber even at high event rate. The drift velocity of electrons in the TPC was measured with the tracks of cosmic muons for 3 days, during which the TPC worked stably with the gas gain of 3000. With a radioisotope of gamma-ray source the three-dimensional track of a Compton scattered electron was taken successfully

  6. MEMS-based clamp with a passive hold function for precision position retaining of micro manipulators

    International Nuclear Information System (INIS)

    Brouwer, D M; Van Dijk, J; Soemers, H M J R; De Jong, B R; De Boer, M J; Jansen, H V; Krijnen, G J M

    2009-01-01

    In this paper the design, modeling and fabrication of a precision MEMS-based clamp with a relatively large clamping force are presented. The purpose of the clamp is to mechanically fix a six-degree-of-freedom (DOF) MEMS-based sample manipulator (Brouwer et al J. Int. Soc. Precis. Eng. Nanotechnol. submitted) once the sample has been positioned in all DOFs. The clamping force is generated by a rotational electrostatic comb-drive actuator and can be latched passively by a parallel plate type electrostatically driven locking device. The clamp design is based on the principles of exact constraint design, resulting in a high actuation compliance (flexibility) combined with a high suspension stiffness. Therefore, a relatively large blocking force of 1.4 mN in relation to the used area of 1.8 mm 2 is obtained. The fabrication is based on silicon bulk micromachining technology and combines a high-aspect-ratio deep reactive ion etching (DRIE), conformal deposition of low-pressure chemical vapor deposition (LPCVD) silicon nitride and an anisotropic potassium hydroxide (KOH) backside etching technology. Special attention is given to void reduction of Si x N y trench isolation and reduction of heating phenomena during front-side release etching. Guidelines are given for the applied process. Measurements showed that the clamp was able to fix, hold and release a test actuator. The dynamic behavior was in good agreement with the modal analysis

  7. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  8. The combined use of scanning vibrating electrode technique and micro-potentiometry to assess the self-repair processes in defects on 'smart' coatings applied to galvanized steel

    Energy Technology Data Exchange (ETDEWEB)

    Taryba, M. [ICEMS, Instituto Superior Tecnico, UTL, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Lamaka, S.V., E-mail: sviatlana.lamaka@ist.utl.p [ICEMS, Instituto Superior Tecnico, UTL, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Snihirova, D. [ICEMS, Instituto Superior Tecnico, UTL, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Ferreira, M.G.S. [ICEMS, Instituto Superior Tecnico, UTL, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); CICECO, Dep. Ceramics and Glass Eng., University of Aveiro, 3810-193 Aveiro (Portugal); Montemor, M.F. [ICEMS, Instituto Superior Tecnico, UTL, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Wijting, W.K.; Toews, S.; Grundmeier, G. [Institute for Polymer Materials and Processes, University of Paderborn, 33098 Paderborn (Germany)

    2011-04-30

    Research highlights: {yields} Weldable primers were modified with submicron containers loaded with corrosion inhibitors. {yields} SVET and micro-potentiometry were used to study the corrosion inhibition ability. {yields} Submicron containers do not damage the barrier properties of model primers. {yields} Artificial defects of 50{mu}m x 50 {mu}m in a coating can be easily analyzed by SVET and SIET. {yields} Inhibiting dissolution of sacrificial Zn may result in detrimental dissolution of Fe. - Abstract: Model weldable primer coatings for galvanized steel were modified with submicron containers loaded with corrosion inhibitors. This procedure aims at introducing a new functionality in the thin coatings self-repair ability. The assessment of this property demands new protocols and new approaches, combining conventional electrochemical methods with electrochemical and analytical techniques of micrometer spatial resolution. Thus, in this work model defects were created in the coatings by using a focused ion beam (FIB). The coated samples, containing the model defects, were immersed in a NaCl 0.05 M solution and the corrosion inhibition ability was studied using the scanning vibrating electrode technique (SVET) and the scanning ion-selective electrode technique (SIET). SVET-SIET measurements were performed quasi-simultaneously. Qualitative chemical analysis was performed by SEM combined with EDS. Complementary studies were carried out by electrochemical impedance spectroscopy (EIS) to assess the effect of the containers filled with corrosion inhibitors on the barrier properties of the coatings. The electrochemical results highlight the importance of the combined use of integral and localized electrochemical techniques to extract information for a better understanding of the corrosion processes and corresponding repair of active microscopic defects formed on thin coatings containing inhibitor filled containers.

  9. Sol-gel/drop-coated micro-thick TiO{sub 2} memristors for γ-ray sensing

    Energy Technology Data Exchange (ETDEWEB)

    Abunahla, Heba [Department of Electrical and Computer Engineering, Khalifa University of Science, Technology and Research, Abu Dhabi (United Arab Emirates); Jaoude, Maguy Abi, E-mail: maguy.abijaoude@kustar.ac.ae [Department of Applied Mathematics and Sciences, Khalifa University of Science, Technology and Research, Abu Dhabi (United Arab Emirates); O' Kelly, Curtis J.; Mohammad, Baker [Department of Electrical and Computer Engineering, Khalifa University of Science, Technology and Research, Abu Dhabi (United Arab Emirates)

    2016-12-01

    Sol-gel/drop-coated micro-thick TiO{sub 2} memristors were investigated and developed for low-power radiation sensing. Devices constructed with coated aluminum (Al) electrodes exhibited unipolar I-V characteristics with dynamic turn-on voltage, and progressive R{sub OFF}/R{sub ON} ratio loss under applied bias. Endurance failure of micro-thick Al/Al stacks is ascribed to gradual passivation of Al surface resulting from an electrically-enhanced oxygen-ion diffusion. By exchanging a single Al contact with higher work function copper (Cu) metal, two distinct superimposed TiO{sub 2} phases were formed. The TiO{sub 2} coating on Al surface was carbon-contaminated and amorphous, while that on Cu was found to be additionally doped with Cu{sup (I/II)} ions resulting from the corrosion of the surface of the electrode by the amine-based gelation agent. After initial forming, the hybrid stack could achieve a bipolar memristance, with high R{sub OFF}/R{sub ON} (up to 10{sup 6}), and over 10 switching cycles at low-operating voltages (±1 V). The enhanced memristive switching properties of Al/Cu devices are explained via cooperative valence-change/electrochemical-metallization processes, involving migration of oxygen and copper species. The advanced micro-thick TiO{sub 2} memristors were exposed to Cs-137 γ-rays, providing for the first time initial insights into their radiation detection capabilities. The sensing mechanism through these devices could be actuated by synergistic radiation-induced and field-driven photo-electric effects. - Highlights: • Micro-thick TiO{sub 2} memristors with Al or Cu electrodes are advanced via sol-gel drop-coating. • Memristive switching in Al/TiO{sub 2}/Al structure is not viable due to resistance build-up. • Drop-coated Cu electrode gets corroded by ethanolamine additive, introducing Cu{sup (I/II)} cations into bulk TiO{sub 2}. • Bipolar memristance in Al/TiO{sub 2}/Cu{sup (I/II)} doped-TiO{sub 2}/Cu structure is depicted for the

  10. Gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors with an asymmetric graphene electrode

    Directory of Open Access Journals (Sweden)

    Joonwoo Kim

    2015-09-01

    Full Text Available The gate voltage and drain current stress instabilities in amorphous In–Ga–Zn–O thin-film transistors (a-IGZO TFTs having an asymmetric graphene electrode structure are studied. A large positive shift in the threshold voltage, which is well fitted to a stretched-exponential equation, and an increase in the subthreshold slope are observed when drain current stress is applied. This is due to an increase in temperature caused by power dissipation in the graphene/a-IGZO contact region, in addition to the channel region, which is different from the behavior in a-IGZO TFTs with a conventional transparent electrode.

  11. Built-in test of electrode degradation of multi-electrode array biosensors

    NARCIS (Netherlands)

    Liu, H.Y.; Dumas, N.; Richardson, A.; Heal, R.; Kerkhoff, Hans G.

    2006-01-01

    Micro-electrode array (MEA) is a widely used platform in biosensor systems, which provide a technology in communicating with micro chemical and biological world. This paper addresses hte topic of testing micro electrode degradation for MEAs, which is a common encountered damage during its

  12. Hollow micro string based calorimeter device

    DEFF Research Database (Denmark)

    2014-01-01

    positions so as to form a free released double clamped string in-between said two longitudinally distanced positions said micro-channel string comprising a microfluidic channel having a closed cross section and extending in the longitudinal direction of the hollow string, acoustical means adapted...

  13. ß-adrenergic regulation of ion transport in pancreatic ducts: Patch-clamp study of isolated rat pancreatic ducts

    DEFF Research Database (Denmark)

    Novak, I

    1998-01-01

    BACKGROUND & AIMS: In the intact pancreas, bicarbonate secretion is thought to be controlled by a number of regulators, including adrenergic agonists. The aim of this study was to investigate the effects of adrenergic agonists on pancreatic ducts, which are the site of bicarbonate secretion....... METHODS: Small intralobular ducts were isolated from rat pancreas and studied in vitro by the whole-cell patch clamp technique. Cell membrane voltages and currents were indicators of cellular ion transport. In some ducts, intracellular Ca2+ activity was measured by fluorescence optical methods. RESULTS...

  14. Low Energy Desalination Using Battery Electrode Deionization

    KAUST Repository

    Kim, Taeyoung

    2017-09-21

    New electrochemical technologies that use capacitive or battery electrodes are being developed to minimize energy requirements for desalinating brackish waters. When a pair of electrodes is charged in capacitive deionization (CDI) systems, cations bind to the cathode and anions bind to the anode, but high applied voltages (>1.2 V) result in parasitic reactions and irreversible electrode oxidation. In the battery electrode deionization (BDI) system developed here, two identical copper hexacyanoferrate (CuHCF) battery electrodes were used that release and bind cations, with anion separation occurring via an anion exchange membrane. The system used an applied voltage of 0.6 V, which avoided parasitic reactions, achieved high electrode desalination capacities (up to 100 mg-NaCl/g-electrode, 50 mM NaCl influent), and consumed less energy than CDI. Simultaneous production of desalinated and concentrated solutions in two channels avoided a two-cycle approach needed for CDI. Stacking additional membranes between CuHCF electrodes (up to three anion and two cation exchange membranes) reduced energy consumption to only 0.02 kWh/m3 (approximately an order of magnitude lower than values reported for CDI), for an influent desalination similar to CDI (25 mM decreased to 17 mM). These results show that BDI could be effective as a very low energy method for brackish water desalination.

  15. Allosteric substrate switching in a voltage-sensing lipid phosphatase.

    Science.gov (United States)

    Grimm, Sasha S; Isacoff, Ehud Y

    2016-04-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We found that the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), has not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage-sensing domain (VSD). Using fast fluorescence resonance energy transfer (FRET) reporters of PIPs to monitor enzyme activity and voltage-clamp fluorometry to monitor conformational changes in the VSD, we found that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage-sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This two-step allosteric control over a dual-specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility, endocytosis and exocytosis.

  16. Using a Voltage Domain Programmable Technique for Low-Power Management Cell-Based Design

    Directory of Open Access Journals (Sweden)

    Ching-Hwa Cheng

    2011-09-01

    Full Text Available The Multi-voltage technique is an effective way to reduce power consumption. In the proposed cell-based voltage domain programmable (VDP technique, the high and low voltages applied to logic gates are programmable. The flexible voltage domain reassignment allows the chip performance and power consumption to be dynamically adjusted. In the proposed technique, the power switches possess the feature of flexible programming after chip manufacturing. This VDP method does not use an external voltage regulator to regulate the supply voltage level from outside of the chip but can be easily integrated within the design. This novel technique is proven by use of a video decoder test chip, which shows 55% and 61% power reductions compared to conventional single-Vdd and low-voltage designs, respectively. This power-aware performance adjusting mechanism shows great power reduction with a good power-performance management mechanism.

  17. Current-voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution.

    Science.gov (United States)

    Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke

    2012-01-01

    We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  18. Current–voltage characteristics of single-molecule diarylethene junctions measured with adjustable gold electrodes in solution

    Directory of Open Access Journals (Sweden)

    Bernd M. Briechle

    2012-11-01

    Full Text Available We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current–voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.

  19. Artificial intelligence techniques for voltage control

    Energy Technology Data Exchange (ETDEWEB)

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  20. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  1. Characteristics of MAO coating obtained on ZK60 Mg alloy under two and three steps voltage-increasing modes in dual electrolyte

    Science.gov (United States)

    Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei

    2017-03-01

    The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.

  2. Quality factor improvement of silicon nitride micro string resonators

    DEFF Research Database (Denmark)

    Schmid, Silvan; Malm, Bjarke; Boisen, Anja

    2011-01-01

    Resonant micro and nano strings are of interest for sensor applications due to their extraordinary high quality factors, low mass and tunable resonant frequency. It has been found that the quality factor of strings is usually limited by clamping loss. In this work, clamping loss has been addressed...... by varying the clamping design and string geometry. We present silicon nitride micro strings with quality factors (Q) of up to 4 million in high vacuum achieved by minimizing clamping loss. For applications such as for chemical sensing, strings need to vibrate at atmospheric pressure. Maximal quality factor...

  3. Single-step fabrication of electrodes with controlled nanostructured surface roughness using optically-induced electrodeposition

    Science.gov (United States)

    Liu, N.; Li, M.; Liu, L.; Yang, Y.; Mai, J.; Pu, H.; Sun, Y.; Li, W. J.

    2018-02-01

    The customized fabrication of microelectrodes from gold nanoparticles (AuNPs) has attracted much attention due to their numerous applications in chemistry and biomedical engineering, such as for surface-enhanced Raman spectroscopy (SERS) and as catalyst sites for electrochemistry. Herein, we present a novel optically-induced electrodeposition (OED) method for rapidly fabricating gold electrodes which are also surface-modified with nanoparticles in one single step. The electrodeposition mechanism, with respect to the applied AC voltage signal and the elapsed deposition time, on the resulting morphology and particle sizes was investigated. The results from SEM and AFM analysis demonstrated that 80-200 nm gold particles can be formed on the surface of the gold electrodes. Simultaneously, both the size of the nanoparticles and the roughness of the fabricated electrodes can be regulated by the deposition time. Compared to state-of-the-art methods for fabricating microelectrodes with AuNPs, such as nano-seed-mediated growth and conventional electrodeposition, this OED technique has several advantages including: (1) electrode fabrication and surface modification using nanoparticles are completed in a single step, eliminating the need for prefabricating micro electrodes; (2) the patterning of electrodes is defined using a digitally-customized, projected optical image rather than using fixed physical masks; and (3) both the fabrication and surface modification processes are rapid, and the entire fabrication process only requires less than 6 s.

  4. Application of wire beam electrode technique to investigate initiation and propagation of rebar corrosion

    International Nuclear Information System (INIS)

    Shi, Wei; Dong, Ze Hua; Kong, De Jie; Guo, Xing Peng

    2013-01-01

    Multi-electrode technique named as wire beam electrode (WBE) was used to study pitting corrosion of rebar under concrete cover. When WBE embedded mortar sample was immersed in NaCl solution, uneven distributions of galvanic current and open circuit potential (OCP) on the WBE were observed due to the initiation of pitting corrosion. The following oxygen depletion in mortar facilitated the negative shift of the OCP and the smoothing of the current and potential distributions. Wetting–drying cycle experiments showed that corrosion products instead of oxygen in wet mortar specimen sustained the propagation of pitting corrosion due to Fe (III) taking part in cathodic depolarization during oxygen-deficient wet period, which was confirmed by micro-Raman spectroscopy. In addition, new pitting corrosion occurred mainly near the corrosion products, leading to preferentially horizontal propagation of rust layer on the WBE. A localized corrosion factor was further presented to quantify the localised corrosion based on galvanic current maps

  5. Application of wire beam electrode technique to investigate initiation and propagation of rebar corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Wei; Dong, Ze Hua, E-mail: zehua.dong@gmail.com; Kong, De Jie; Guo, Xing Peng

    2013-06-15

    Multi-electrode technique named as wire beam electrode (WBE) was used to study pitting corrosion of rebar under concrete cover. When WBE embedded mortar sample was immersed in NaCl solution, uneven distributions of galvanic current and open circuit potential (OCP) on the WBE were observed due to the initiation of pitting corrosion. The following oxygen depletion in mortar facilitated the negative shift of the OCP and the smoothing of the current and potential distributions. Wetting–drying cycle experiments showed that corrosion products instead of oxygen in wet mortar specimen sustained the propagation of pitting corrosion due to Fe (III) taking part in cathodic depolarization during oxygen-deficient wet period, which was confirmed by micro-Raman spectroscopy. In addition, new pitting corrosion occurred mainly near the corrosion products, leading to preferentially horizontal propagation of rust layer on the WBE. A localized corrosion factor was further presented to quantify the localised corrosion based on galvanic current maps.

  6. Integration of 100% Micro-Distributed Energy Resources in the Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    You, Shi; Segerberg, Helena

    2014-01-01

    of heat pumps (HPs) and plug-in electric vehicles (PEVs) at 100% penetration level on a representative urban residential low voltage (LV) distribution network of Denmark are investigated by performing a steady-state load flow analysis through an integrated simulation setup. Three DERs integration...... oriented integration strategies, having 100% integration of DER in the provided LV network is feasible.......The existing electricity infrastructure may to a great extent limit a high penetration of the micro-sized Distributed Energy Resources (DERs), due to the physical bottlenecks, e.g. thermal capacitates of cables, transformers and the voltage limitations. In this study, the integration impacts...

  7. Flexible and stretchable electrodes for dielectric elastomer actuators

    Science.gov (United States)

    Rosset, Samuel; Shea, Herbert R.

    2013-02-01

    Dielectric elastomer actuators (DEAs) are flexible lightweight actuators that can generate strains of over 100 %. They are used in applications ranging from haptic feedback (mm-sized devices), to cm-scale soft robots, to meter-long blimps. DEAs consist of an electrode-elastomer-electrode stack, placed on a frame. Applying a voltage between the electrodes electrostatically compresses the elastomer, which deforms in-plane or out-of plane depending on design. Since the electrodes are bonded to the elastomer, they must reliably sustain repeated very large deformations while remaining conductive, and without significantly adding to the stiffness of the soft elastomer. The electrodes are required for electrostatic actuation, but also enable resistive and capacitive sensing of the strain, leading to self-sensing actuators. This review compares the different technologies used to make compliant electrodes for DEAs in terms of: impact on DEA device performance (speed, efficiency, maximum strain), manufacturability, miniaturization, the integration of self-sensing and self-switching, and compatibility with low-voltage operation. While graphite and carbon black have been the most widely used technique in research environments, alternative methods are emerging which combine compliance, conduction at over 100 % strain with better conductivity and/or ease of patternability, including microfabrication-based approaches for compliant metal thin-films, metal-polymer nano-composites, nanoparticle implantation, and reel-to-reel production of μm-scale patterned thin films on elastomers. Such electrodes are key to miniaturization, low-voltage operation, and widespread commercialization of DEAs.

  8. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  9. Photovoltaic panel clamp

    Science.gov (United States)

    Mittan, Margaret Birmingham [Oakland, CA; Miros, Robert H. J. [Fairfax, CA; Brown, Malcolm P [San Francisco, CA; Stancel, Robert [Loss Altos Hills, CA

    2012-06-05

    A photovoltaic panel clamp includes an upper and lower section. The interface between the assembled clamp halves and the module edge is filled by a flexible gasket material, such as EPDM rubber. The gasket preferably has small, finger like protrusions that allow for easy insertion onto the module edge while being reversed makes it more difficult to remove them from the module once installed. The clamp includes mounting posts or an integral axle to engage a bracket. The clamp also may include a locking tongue to secure the clamp to a bracket.

  10. A Novel Method for In-Situ Monitoring of Local Voltage, Temperature and Humidity Distributions in Fuel Cells Using Flexible Multi-Functional Micro Sensors

    Science.gov (United States)

    Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping

    2011-01-01

    In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it. PMID:22319361

  11. A novel method for in-situ monitoring of local voltage, temperature and humidity distributions in fuel cells using flexible multi-functional micro sensors.

    Science.gov (United States)

    Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping

    2011-01-01

    In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it.

  12. A Novel Method for In-Situ Monitoring of Local Voltage, Temperature and Humidity Distributions in Fuel Cells Using Flexible Multi-Functional Micro Sensors

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chang

    2011-01-01

    Full Text Available In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS. These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it.

  13. Electrode-shaping for the excitation and detection of permitted arbitrary modes in arbitrary geometries in piezoelectric resonators.

    Science.gov (United States)

    Pulskamp, Jeffrey S; Bedair, Sarah S; Polcawich, Ronald G; Smith, Gabriel L; Martin, Joel; Power, Brian; Bhave, Sunil A

    2012-05-01

    This paper reports theoretical analysis and experimental results on a numerical electrode shaping design technique that permits the excitation of arbitrary modes in arbitrary geometries for piezoelectric resonators, for those modes permitted to exist by the nonzero piezoelectric coefficients and electrode configuration. The technique directly determines optimal electrode shapes by assessing the local suitability of excitation and detection electrode placement on two-port resonators without the need for iterative numerical techniques. The technique is demonstrated in 61 different electrode designs in lead zirconate titanate (PZT) thin film on silicon RF micro electro-mechanical system (MEMS) plate, beam, ring, and disc resonators for out-of-plane flexural and various contour modes up to 200 MHz. The average squared effective electromechanical coupling factor for the designs was 0.54%, approximately equivalent to the theoretical maximum value of 0.53% for a fully electroded length-extensional mode beam resonator comprised of the same composite. The average improvement in S(21) for the electrode-shaped designs was 14.6 dB with a maximum improvement of 44.3 dB. Through this piezoelectric electrodeshaping technique, 95% of the designs showed a reduction in insertion loss.

  14. Theoretical and experimental study of the bending influence on the capacitance of interdigitated micro-electrodes patterned on flexible substrates

    International Nuclear Information System (INIS)

    Molina-Lopez, F.; Briand, D.; Rooij, N. F. de; Kinkeldei, T.; Tröster, G.

    2013-01-01

    Interdigitated electrodes are common structures in the fields of microelectronics and MEMS. Recent developments in flexible electronics compel an understanding of such structures under bending constraints. In this work, the behavior of interdigitated micro-electrodes when subjected to circular bending has been theoretically and experimentally studied through changes in capacitance. An analytical model has been developed to calculate the expected variation in capacitance of such structures while undergoing outward and inward bending along the direction perpendicular to the electrodes. The model combines conformal mapping techniques to account for the electric field redistribution and fundamental aspects of solid mechanics in order to define the geometrical deformation of the electrodes while bending. To experimentally verify our theoretical predictions, several interdigitated electrode structures with different geometries were fabricated on polymeric substrates by means of photolithography. The samples, placed in a customized bending setup, were bent to controlled radii of curvature while measuring their capacitance. A maximum variation in capacitance of less than 3% was observed at a minimum radius of curvature of 2.5 mm for all the devices tested with very thin electrodes whereas changes of up to 7% were found on stiffer, plated electrodes. Larger or smaller variations would be possible, in theory, by adjusting the geometry of the device. This work establishes a useful predictive tool for the design and evaluation of truly flexible/bendable electronics consisting of interdigitated structures, allowing one to tune the bending influence on the capacitance value through geometrical design

  15. Micro Electro Discharge Machining for Nonconductive Ceramic Materials

    Directory of Open Access Journals (Sweden)

    Mohammad Yeakub Ali

    2018-03-01

    Full Text Available In micro-electro discharge machining (micro-EDM of nonconductive ceramics, material is removed mainly by spalling due to the dominance of alternating thermal load. The established micro-EDM models established for single spark erosion are not applicable for nonconductive ceramics because of random spalling. Moreover, it is difficult to create single spark on a nonconductive ceramic workpiece when the spark is initiated by the assisting electrode. In this paper, theoretical model of material removal rate (MRR as the function of capacitance and voltage is developed for micro-EDM of nonconductive zirconium oxide (ZrO2. It is shown that the charging and discharging duration depend on the capacitance and resistances of the circuit. The number of sparks per unit time is estimated from the single spark duration s derived from heat transfer fundamentals. The model showed that both the capacitance and voltage are significant process parameters where any increase of capacitance and voltage increases the MRR. However, capacitance was found to be the dominating parameter over voltage. As in case of higher capacitances, the creation of a conductive carbonic layer on the machined surface was not stable; the effective window of machining 101 - 103 pF capacitance and 80 - 100 V gap voltage or 10 - 470 pF capacitance and 80 - 110 V gap voltage. This fact was confirmed EDX analysis where the presence of high carbon content was evident. Conversely, the spark was found to be inconsistent using parameters beyond these ranges and consequently insignificant MRR. Nevertheless, the effective number of sparks per second were close to the predicted numbers when machining conductive copper material. In addition, higher percentage of ineffective pulses was observed during the machining which eventually reduced the MRR. In case of validation, average deviations between the predicted and experimental values were found to be around 10%. Finally, micro-channels were machined on

  16. Capacitive mixing with electrodes of the same kind for energy production from salinity differences

    Science.gov (United States)

    Marino, M.; Kozynchenko, O.; Tennison, S.; Brogioli, D.

    2016-03-01

    The capacitive mixing technique is aimed at producing renewable energy from salinity differences, for example between sea and river water. The technique makes use of two electrodes that modify their potential in opposite directions when the concentration of the solution in which they are immersed is changed, as a consequence of the dynamics of the electric double layer which forms in the ionic solution. Unfortunately, it is difficult to find two electrodes presenting both optimal performances and opposite potential variations. In order to overcome this problem, we present here a cell scheme with electrodes of the same kind (and thus identical dependence of potential on concentration) which can be operated with a CapMix cycle; it is based on a concentration cell with identical electrodes dipped into two compartments separated by a non-perm-selective porous diaphragm. Thanks to the cyclic operation, the actual cell voltage rise and the power production are close to the values obtained with the traditional scheme, or even higher, depending on the features of the ion transport in the liquid junction region. We present an experimental demonstration of the working principles and we study the power production and energy efficiency in the light of the theory of ion transport in fluids. We show that our technique is competitive with respect to the other CapMix techniques, with the relevant advantage that we make use of only one kind of electrode.

  17. Micro-fabricated flexible PZT cantilever using d33 mode for energy harvesting

    Science.gov (United States)

    Cho, Hyunok; Park, Jongcheol; Park, Jae Yeong

    2017-12-01

    This paper presents a micro-fabricated flexible and curled PZT [Pb(Zr0.52Ti0.48)O3] cantilever using d33 piezoelectric mode for vibration based energy harvesting applications. The proposed cantilever based energy harvester consists of polyimide, PZT thin film, and inter-digitated IrOx electrodes. The flexible cantilever was formed using bulk-micromachining on a silicon wafer to integrate it with ICs. The d33 piezoelectric mode was applied to achieve a large output voltage by using inter-digitated electrodes, and the PZT thin film on polyimide layer has a remnant polarization and coercive filed of approximately 2 P r = 47.9 μC/cm2 and 2 E c = 78.8 kV/cm, respectively. The relative dielectric constant was 900. The fabricated micro-electromechanical systems energy harvester generated output voltages of 1.2 V and output power of 117 nW at its optimal resistive load of 6.6 MΩ from its resonant frequency of 97.8 Hz with an acceleration of 5 m/s2.

  18. Evaluation of clamp effects on LMFBR piping systems

    International Nuclear Information System (INIS)

    Jones, G.L.

    1980-01-01

    Loop-type liquid metal breeder reactor plants utilize thin-wall piping to mitigate through-wall thermal gradients due to rapid thermal transients. These piping loops require a support system to carry the combined weight of the pipe, coolant and insulation and to provide attachments for seismic restraints. The support system examined here utilizes an insulated pipe clamp designed to minimize the stresses induced in the piping. To determine the effect of these clamps on the pipe wall a non-linear, two-dimensional, finite element model of the clamp, insulation and pipe wall was used to determine the clamp/pipe interface load distributions which were then applied to a three-dimensional, finite element model of the pipe. The two-dimensional interaction model was also utilized to estimate the combined clamp/pipe stiffness

  19. Optical detection of ion diffusion in electrochromic poly(3,4-ethylenedioxy)thiophene film using microcantilever electrodes

    DEFF Research Database (Denmark)

    Lin, Rong; Stokbro, Kurt; Madsen, Dorte Nørgaard

    2005-01-01

    potential of the film induced dark (light-absorbing) rings, which spread out from the anode on a time scale of seconds. The rate of expansion of the rings as well as the final diameter depended on the bias voltage. Using two micro four-point probes simultaneously, we measured with one probe the conductance......We present measurements of microscale electrochromic switching of poly(3,4-ethylenedioxy)thiophene doped with poly(4-styrene sulfonate), thin film using microfabricated multi-point probe electrodes. After treatment with a dilute hydrochloric acid, a voltage bias above 3 V with respect to the ground...... of the film outside, near and inside a dark ring induced by a voltage applied to another probe and found the resistivity to be directly related to the observed absorbance of the film. The standard electrochromic mechanism of ion insertion was used to explain the observations. We anticipate this experimental...

  20. A 1.0 V 78 mircoW reconfigurable ASIC embedded in an intelligent electrode for continuous remote ECG applications.

    Science.gov (United States)

    Yang, Geng; Chen, Jian; Jonsson, Fredrik; Tenhunen, Hannu; Zheng, Li-Rong

    2009-01-01

    In this paper, a reconfigurable, low-power Application Specific Integrated Circuit (ASIC) that extracts and transmits electrocardiograph (ECG) signals is presented. An Intelligent Electrode is introduced which consists of the proposed ASIC and a micro spike array, permitting onsite ECG signal acquisition, processing and transmission. Fabricated in a standard 0.18 microm CMOS process, the ASIC consumes 78 microW with 1.0 V core voltage at 6 MHz operating frequency and only occupies 2.25 mm(2). The tiny silicon size makes it possible and suitable to embed the proposed ASIC into an Intelligent Electrode, and the low power consumption makes it feasible for long term continuous ECG monitoring.

  1. Scanning reference electrode techniques in localized corrosion

    International Nuclear Information System (INIS)

    Isaacs, H.S.; Vyas, B.

    1979-04-01

    The principles, advantages, and implementations of scanning reference electrode techniques are reviewed. Data related to pitting, intergranular corrosion, welds and stress corrosion cracking are presented. The technique locates the position of localized corrosion and can be used to monitor the development of corrosion and changes in the corrosion rate under a wide range of conditions

  2. "Imaging" LEIS of micro-patterned solid oxide fuel cell electrodes

    Science.gov (United States)

    Druce, John; Simrick, Neil; Ishihara, Tatsumi; Kilner, John

    2014-08-01

    Understanding the kinetics of oxygen exchange between the gas phase and a ceramic electrode is key to optimising the performance of electrochemical energy conversion devices such as Solid Oxide Fuel Cells. Clearly the surface chemistry of these materials is important, and surface sensitive techniques such as Low Energy Ion Scattering (LEIS) can provide important compositional information key to unravelling electrode kinetics. In this work, we use high lateral resolution LEIS to perform local analyses of a micropatterned electrode structure, of the type often used for studies of the geometrical dependences of electrode performance. We find that the results are comparable to those for bulk materials, but detect evidence of cation interdiffusion from the electrode to the electrolyte. Finally, we note that this preliminary study could open the prospect of in situ measurements of cells near operating conditions.

  3. Presentation of Various Tactile Sensations Using Micro-Needle Electrotactile Display.

    Directory of Open Access Journals (Sweden)

    Mayuko Tezuka

    Full Text Available Tactile displays provoke tactile sensations by artificially stimulating tactile receptors. While many types of tactile displays have been developed, electrotactile displays that exploit electric stimulation can be designed to be thin, light, flexible and thus, wearable. However, the high voltages required to stimulate tactile receptors and limited varieties of possible sensations pose problems. In our previous work, we developed an electrotactile display using a micro-needle electrode array that can drastically reduce the required voltage by penetrating through the high-impedance stratum corneum painlessly, but displaying various tactile sensations was still a challenge. In this work, we demonstrate presentation of tactile sensation of different roughness to the subjects, which is enabled by the arrangement of the electrodes; the needle electrodes are on the fingertip and the ground electrode is on the fingernail. With this arrangement, the display can stimulate the tactile receptors that are located not only in the shallow regions of the finger but also those in the deep regions. It was experimentally revealed that the required voltage was further reduced compared to previous devices and that the roughness presented by the display was controlled by the pulse frequency and the switching time, or the stimulation flow rate. The proposed electrotactile display is readily applicable as a new wearable haptic device for advanced information communication technology.

  4. Serially Connected Micro Amorphous Silicon Solar Cells for Compact High-Voltage Sources

    Directory of Open Access Journals (Sweden)

    Jiyoon Nam

    2016-01-01

    Full Text Available We demonstrate a compact amorphous silicon (a-Si solar module to be used as high-voltage power supply. In comparison with the organic solar module, the main advantages of the a-Si solar module are its compatibility with photolithography techniques and relatively high power conversion efficiency. The open circuit voltage of a-Si solar cells can be easily controlled by serially interconnecting a-Si solar cells. Moreover, the a-Si solar module can be easily patterned by photolithography in any desired shapes with high areal densities. Using the photolithographic technique, we fabricate a compact a-Si solar module with noticeable photovoltaic characteristics as compared with the reported values for high-voltage power supplies.

  5. Micro-mechanical resonators for dynamically reconfigurable reduced voltage logic gates

    Science.gov (United States)

    Chappanda, K. N.; Ilyas, S.; Younis, M. I.

    2018-05-01

    Due to the limitations of transistor-based logic devices such as their poor performance at elevated temperature, alternative computing methods are being actively investigated. In this work, we present electromechanical logic gates using electrostatically coupled in-plane micro-cantilever resonators operated at modest vacuum conditions of 5 Torr. Operating in the first resonant mode, we demonstrate 2-bit XOR, 2- and 3-bit AND, 2- and 3-bit NOR, and 1-bit NOT gates; all condensed in the same device. Through the designed electrostatic coupling, the required voltage for the logic gates is reduced by 80%, along with the reduction in the number of electrical interconnects and devices per logic operation (contrary to transistors). The device is dynamically reconfigurable between any logic gates in real time without the need for any change in the electrical interconnects and the drive circuit. By operating in the first two resonant vibration modes, we demonstrate mechanical logic gates consisting of two 2-bit AND and two 2-bit XOR gates. The device is tested at elevated temperatures and is shown to be functional as a logic gate up to 150 °C. Also, the device has high reliability with demonstrated lifetime greater than 5  ×  1012 oscillations.

  6. Micro-mechanical resonators for dynamically reconfigurable reduced voltage logic gates

    KAUST Repository

    Chappanda, K N

    2018-02-16

    Due to the limitations of transistor-based logic devices such as their poor performance at elevated temperature, alternative computing methods are being actively investigated. In this work, we present electromechanical logic gates using electrostatically coupled in-plane micro-cantilever resonators operated at modest vacuum conditions of 5 Torr. Operating in the first resonant mode, we demonstrate 2-bit XOR, 2- and 3-bit AND, 2- and 3-bit NOR, and 1-bit NOT gates; all condensed in the same device. Through the designed electrostatic coupling, the required voltage for the logic gates is reduced by 80%, along with the reduction in the number of electrical interconnects and devices per logic operation (contrary to transistors). The device is dynamically reconfigurable between any logic gates in real time without the need for any change in the electrical interconnects and the drive circuit. By operating in the first two resonant vibration modes, we demonstrate mechanical logic gates consisting of two 2-bit AND and two 2-bit XOR gates. The device is tested at elevated temperatures and is shown to be functional as a logic gate up to 150 °C. Also, the device has high reliability with demonstrated lifetime greater than 5 × 10 oscillations.

  7. Micro-mechanical resonators for dynamically reconfigurable reduced voltage logic gates

    KAUST Repository

    Chappanda , K. N.; Ilyas, Saad; Younis, Mohammad I.

    2018-01-01

    Due to the limitations of transistor-based logic devices such as their poor performance at elevated temperature, alternative computing methods are being actively investigated. In this work, we present electromechanical logic gates using electrostatically coupled in-plane micro-cantilever resonators operated at modest vacuum conditions of 5 Torr. Operating in the first resonant mode, we demonstrate 2-bit XOR, 2- and 3-bit AND, 2- and 3-bit NOR, and 1-bit NOT gates; all condensed in the same device. Through the designed electrostatic coupling, the required voltage for the logic gates is reduced by 80%, along with the reduction in the number of electrical interconnects and devices per logic operation (contrary to transistors). The device is dynamically reconfigurable between any logic gates in real time without the need for any change in the electrical interconnects and the drive circuit. By operating in the first two resonant vibration modes, we demonstrate mechanical logic gates consisting of two 2-bit AND and two 2-bit XOR gates. The device is tested at elevated temperatures and is shown to be functional as a logic gate up to 150 °C. Also, the device has high reliability with demonstrated lifetime greater than 5 × 10 oscillations.

  8. A technique to reduce plasma armature formation voltage

    International Nuclear Information System (INIS)

    Jamison, K.A.; Littrell, D.M.

    1991-01-01

    The initiation of a plasma armature by foil vaporization in a railgun is often accompanied by a large, fast, voltage transient appearing on both the breech and muzzle of the gun. For a railgun driven by an inductor/opening switch power supply, this voltage transient becomes a concern during current commutation from the switch to the railgun. To lessen the requirements on the opening switch, techniques must be found to reduce the armature formation voltage. This paper presents the experimental results from railgun firings at AFATL's Electromagnetic Launcher Basic Research Facility (Site A-15, Eglin Air Force Base, Florida) using different shapes of initiation foils. These foils have been designed to vaporize into a plasma armature with reduced transient voltages. A design criteria was developed to ensure that all portions of the foil vaporize at slightly different times

  9. Breakdown study of dc silicon micro-discharge devices

    International Nuclear Information System (INIS)

    Schwaederlé, L; Kulsreshath, M K; Lefaucheux, P; Tillocher, T; Dussart, R; Overzet, L J

    2012-01-01

    The influence of geometrical and operating parameters on the electrical characteristics of dc microcavity discharges provides insight into their controlling physics. We present here results of such a study on silicon-based microcavity discharge devices carried out in helium at pressure ranging from 100 to 1000 Torr. Different micro-reactor configurations were measured. The differences include isolated single cavities versus arrays of closely spaced cavities, various cavity geometries (un-etched as well as isotropically and anisotropically etched), various dimensions (100 or 150 µm cavity diameter and 0-150 µm depth). The electrode gap was kept constant in all cases at approximately 6 µm. The applied electric field reaches 5 × 10 7 V m -1 which results in current and power densities up to 2 A cm -2 and 200 kW cm -3 , respectively. The number of microcavities and the microcavity depth are shown to be the most important geometrical parameters for predicting breakdown and operation of microcavity devices. The probability of initiatory electron generation which is volume dependent and the electric field strength which is depth dependent are, respectively, considered to be responsible. The cavity shape (isotropic/anisotropic) and diameter had no significant influence. The number of micro-discharges that could be ignited depends on the rate of voltage rise and pressure. Larger numbers ignite at lower frequency and pressure. In addition, the voltage polarity has the largest influence on the electrical characteristics of the micro-discharge of all parameters, which is due to both the asymmetric role of electrodes as electron emitter and the non-uniformity of the electric field resulting in different ionization efficiencies. The qualitative shape of all breakdown voltage versus pressure curves can be explained in terms of the distance over which the discharge breakdown effectively occurs as long as one understand that this distance can depend on pressure. (paper)

  10. Direct laser-patterned micro-supercapacitors from paintable MoS2 films.

    Science.gov (United States)

    Cao, Liujun; Yang, Shubin; Gao, Wei; Liu, Zheng; Gong, Yongji; Ma, Lulu; Shi, Gang; Lei, Sidong; Zhang, Yunhuai; Zhang, Shengtao; Vajtai, Robert; Ajayan, Pulickel M

    2013-09-09

    Micrometer-sized electrochemical capacitors have recently attracted attention due to their possible applications in micro-electronic devices. Here, a new approach to large-scale fabrication of high-capacitance, two-dimensional MoS2 film-based micro-supercapacitors is demonstrated via simple and low-cost spray painting of MoS2 nanosheets on Si/SiO2 chip and subsequent laser patterning. The obtained micro-supercapacitors are well defined by ten interdigitated electrodes (five electrodes per polarity) with 4.5 mm length, 820 μm wide for each electrode, 200 μm spacing between two electrodes and the thickness of electrode is ∼0.45 μm. The optimum MoS2 -based micro-supercapacitor exhibits excellent electrochemical performance for energy storage with aqueous electrolytes, with a high area capacitance of 8 mF cm(-2) (volumetric capacitance of 178 F cm(-3) ) and excellent cyclic performance, superior to reported graphene-based micro-supercapacitors. This strategy could provide a good opportunity to develop various micro-/nanosized energy storage devices to satisfy the requirements of portable, flexible, and transparent micro-electronic devices. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. New strategy for eliminating zero-sequence circulating current between parallel operating three-level NPC voltage source inverters

    DEFF Research Database (Denmark)

    Li, Kai; Dong, Zhenhua; Wang, Xiaodong

    2018-01-01

    A novel strategy based on a zero common mode voltage pulse-width modulation (ZCMV-PWM) technique and zero-sequence circulating current (ZSCC) feedback control is proposed in this study to eliminate ZSCCs between three-level neutral point clamped (NPC) voltage source inverters, with common AC and DC......, the ZCMV-PWM method is presented to reduce CMVs, and a simple electric circuit is adopted to control ZSCCs and neutral point potential. Finally, simulation and experiment are conducted to illustrate effectiveness of the proposed strategy. Results show that ZSCCs between paralleled inverters can...

  12. A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.

    Science.gov (United States)

    Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S

    2016-03-01

    Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Tetrazolyl isoxazole amino acids as ionotropic glutamate receptor antagonists: synthesis, modelling and molecular pharmacology

    DEFF Research Database (Denmark)

    Frølund, Bente; Greenwood, Jeremy R; Holm, Mai Marie

    2005-01-01

    and 1b were pharmacologically characterized in receptor binding assays, and electrophysiologically on homomeric AMPA receptors (GluR1-4), homomeric (GluR5 and GluR6) and heteromeric (GluR6/KA2) kainic acid receptors, using two-electrode voltage-clamped Xenopus laevis oocytes expressing these receptors...

  14. Electrochemical reactivity at graphitic micro-domains on polycrystalline boron doped diamond thin-films electrodes

    International Nuclear Information System (INIS)

    Mahe, E.; Devilliers, D.; Comninellis, Ch.

    2005-01-01

    This paper deals with the electrochemical reactivity of boron doped diamond (BDD) electrodes. A comparative study has been carried out to show the influence of the presence of graphitic micro-domains upon the surface of these films. Those graphitic domains are sometimes present on as-grown boron doped diamond electrodes. The effect of doping a pure Csp 3 diamond electrode is established by highly oriented pyrolytic graphite (HOPG) abrasion onto the diamond surface. In order to establish the effect of doping on a pure Csp 3 diamond electrode, the amount of graphitic domains was increased by means of HOPG crystals grafted onto the BDD surface. Indeed that method allows the enrichment of the Csp 2 contribution of the electrode. The presence of graphitic domains can be correlatively associated with the presence of kinetically active redox sites. The electrochemical reactivity of boron doped diamond electrodes shows a distribution of kinetic constants on the whole surface of the electrode corresponding to different active sites. In this paper, we have studied by cyclic voltammetry and electrochemical impedance spectroscopy the kinetics parameters of the ferri/ferrocyanide redox couple in KCl electrolyte. A method is proposed to diagnose the presence of graphitic domains on diamond electrodes, and an electrochemical 'pulse cleaning' procedure is proposed to remove them

  15. A Review and Performance Investigation of NPCC Based UPQC by Using Various Artificial Intelligence Techniques

    Directory of Open Access Journals (Sweden)

    Venkata Rami Reddy K

    2017-03-01

    Full Text Available This paper presents a comprehensive review and performance investigation of Neutral Point Clamped Converter (NPCC based Unified Power Quality Conditioner (UPQC by using Artificial Intelligent (AI techniques. A Novel application of various levels of Diode Clamped Multi-Level Inverters [DCMLI] with Anti Phase Opposition and Disposition (APOD Pulse Width Modulation (PWM Scheme to Unified Power Quality Conditioner (UPQC. The Power Quality problem became a burning issues since the starting of high voltage AC transmission system. Hence, in this article it has been discussed to mitigate the PQ issues in high voltage AC systems through a three phase four wire Unified Power Quality Conditioner (UPQC under non-linear loads. The emphasised PQ problems such as voltage and current harmonics along with voltage sags and swells have also been discussed with improved performance. Also, it proposes to control the DCMLI based UPQC through conventional control schemes. Thus application of these control technique makes the system performance in par with the standards and also compared with existing system. The simulation results based on MATLAB/Simulink are discussed in detail to support the concept developed in the paper.

  16. Specific Localization of High-Voltage Discharge in Vicinity of Two Gases

    Science.gov (United States)

    Leonov, Sergey; Shurupov, Michail; Shneider, Michail; Napartovich, Anatoly; Kochetov, Igor

    2011-10-01

    A subject of paper is the appearance and dynamics of sub-microsecond long filamentary high-voltage discharge generated in atmosphere, and in non-homogeneous gaseous media. Typical discharge parameters are: maximal current 1-3kA, breakdown voltage >100 kV, duration 30-100 ns, gap distance 50-100mm. The effect of discharge specific localization within mixing layer of two gases is particularly discussed. The second discussed idea is the filamentary discharge movement within a region with concentration gradient of different components. For the short-pulse discharge the physical mechanism appears as the following. The first stage of the spark breakdown is the multiple streamers propagation from the high-voltage electrode toward the grounded one. In case of high-power electrical source those streamers occupy a huge volume of the gas, covering all possible paths for the further development. The next phase consists of the real selection of the discharge path among the multiple channels with non-zero conductivity. Experiments and calculations are presented for Air-CO2 and Air-C2H4 pairs. The effects found are supposed to be applied for lightning prediction/protection, and for high-speed mixing acceleration. The work was funded through EOARD-ISTC project #3793p. Some part of this work was supported by RFBR grant #10-08-00952.

  17. Simulation of diffusion-induced stress using reconstructed electrodes particle structures generated by micro/nano-CT

    International Nuclear Information System (INIS)

    Lim, Cheolwoong; Yan Bo; Yin Leilei; Zhu Likun

    2012-01-01

    Highlights: ► The microstructure of LIB electrodes was obtained by X-ray micro/nano-CT. ► We studied diffusion-induced stresses based on realistic 3D microstructures. ► Stresses depend on geometric characteristics of electrode particle. ► Stresses in a real particle are much higher than those in a spherical particle. - Abstract: Lithium ion batteries experience diffusion-induced stresses during charge and discharge processes which can cause electrode failure in the form of fracture. Previous diffusion-induced stress models and simulations are mainly based on simple active material particle structures, such as spheres and ellipsoids. However, the simple structure model cannot reveal the stress development in a real complex lithium ion battery electrode. In this paper, we studied the diffusion-induced stresses numerically based on a realistic morphology of reconstructed particles during the lithium ion intercalation process. The morphology of negative and positive active materials of a lithium ion battery was determined using X-ray micro/nano computed tomography technology. Diffusion-induced stresses were simulated at different C rates under galvonostatic conditions and compared with spherical particles. The simulation results show that the intercalation stresses of particles depend on their geometric characteristics. The highest von Mises stress and Tresca stress in a real particle are several times higher than the stresses in a spherical particle with the same volume.

  18. Mitigation of the voltage fluctuations using an efficient disturbance extraction technique

    Energy Technology Data Exchange (ETDEWEB)

    Elnady, Amr; Salama, M.M.A. [University of Waterloo, Electrical and Computer Engineering, 200 University Ave. West, Waterloo, Ont. (Canada N2L3G1)

    2007-03-15

    This paper introduces an efficient technique for extracting the disturbance signal of the voltage flicker. The proposed technique depends on the supervised state estimation that is controlled by the Widrow-Hoff delta rule. The extracted disturbance signal is employed for mitigating the cyclic voltage flicker by using series and parallel mitigating devices. The speed and accuracy of the proposed technique are verified by simulation results with EMTDC/PSCAD. In addition, experimental results are presented to prove the validity of the proposed algorithm. (author)

  19. Fixture-abutment connection surface and micro-gap measurements by 3D micro-tomographic technique analysis

    Directory of Open Access Journals (Sweden)

    Deborah Meleo

    2012-01-01

    Full Text Available X-ray micro-tomography (micro-CT is a miniaturized form of conventional computed axial tomography (CAT able to investigate small radio-opaque objects at a-few-microns high resolution, in a nondestructive, non-invasive, and tri-dimensional way. Compared to traditional optical and electron microscopy techniques, which provide two-dimensional images, this innovative investigation technology enables a sample tri-dimensional analysis without cutting, coating or exposing the object to any particular chemical treatment. X-ray micro-tomography matches ideal 3D microscopy features: the possibility of investigating an object in natural conditions and without any preparation or alteration; non-invasive, non-destructive, and sufficiently magnified 3D reconstruction; reliable measurement of numeric data of the internal structure (morphology, structure and ultra-structure. Hence, this technique has multi-fold applications in a wide range of fields, not only in medical and odontostomatologic areas, but also in biomedical engineering, materials science, biology, electronics, geology, archaeology, oil industry, and semi-conductors industry. This study shows possible applications of micro-CT in dental implantology to analyze 3D micro-features of dental implant to abutment interface. Indeed, implant-abutment misfit is known to increase mechanical stress on connection structures and surrounding bone tissue. This condition may cause not only screw preload loss or screw fracture, but also biological issues in peri-implant tissues.

  20. A simple technique to measure regional cerebral blood flow during intravascular ballon clamping

    International Nuclear Information System (INIS)

    Furuhata, Shigeru; Kubo, Atsushi; Kawase, Takeshi; Ibata, Yukio; Toya, Shigeo

    1988-01-01

    A case of giant internal carotid ophthalmic aneurysm was presented. In order to clarify whether the patient could tolerate carotid occlusion, a ballon clamping test was performed before surgery. The cerebral blood flow was measured using early imaging by single photon emission computed tomography (SPECT) with N-isopropyl-(iodine-123)-p-iodoamphetamine ( 123 I-IMP). When the ballon clamping test was performed the tracer was injected, and scanning was performed 35 minutes after removing the catheter. This tracer enabled a 'memory of blood flow' during temporary ischemia to determine the character of quick diffusion and slow wash out, that could not be performed by other methods of cerebral blood flow measurement. SPECT with 123 I-IMP can simplify the measurement of cerebral blood flow during the balloon clamping test. (author)

  1. Active gate driver for dv/dt control and active voltage clamping in an IGBT stack

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg

    2005-01-01

    For high voltages converters stacks of IGBTs can be used if the static and dynamic voltage sharing among the IGBTs can be applied. dVCE/dt should also be controlled in order not to damage insulation material. This paper describes theory and measurements of an active gate driver for stacking IGBTs....... For the measurements two series connected standard IGBTs made for hard switching applications are used. Problems are shown and proposals for improvements are given....

  2. Curare Alkaloids: Constituents of a Matis Dart Poison.

    Science.gov (United States)

    Malca Garcia, Gonzalo R; Hennig, Lothar; Shelukhina, Irina V; Kudryavtsev, Denis S; Bussmann, Rainer W; Tsetlin, Victor I; Giannis, Athanassios

    2015-11-25

    A phytochemical study of dart and arrow poison from the Matis tribe led to the identification of D-(-)-quinic acid, L-malic acid, ethyldimethylamine, magnoflorine, and five new bisbenzyltetrahydroisoquinoline alkaloids (BBIQAs), 1-5. D-Tubocurarine could not be identified among these products. BBIQA (3) contains a unique linkage at C-8 and C-11'. All structures were characterized by a combination of NMR and HRESIMS data. The effects of Matis poison and individual BBIQAs (1-3) on rat muscle nAChR expressed in Xenopus oocytes have been investigated using the two-electrode voltage clamp technique.

  3. Voltage uniformity study in large-area reactors for RF plasma deposition

    Energy Technology Data Exchange (ETDEWEB)

    Sansonnens, L.; Pletzer, A.; Magni, D.; Howling, A.A.; Hollenstein, C. [Ecole Polytechnique Federale, Lausanne (Switzerland). Centre de Recherche en Physique des Plasma (CRPP); Schmitt, J.P.M. [Balzers Process Systems, Palaiseau (France)

    1996-09-01

    Non-uniform voltage distribution across the electrode area results in inhomogeneous thin-film RF plasma deposition in large area reactors. In this work, a two-dimensional analytic model for the calculation of the voltage distribution across the electrode area is presented. The results of this model are in good agreement with measurements performed without plasma at 13.56 MHz and 70 MHz in a large area reactor. The principal voltage inhomogeneities are caused by logarithmic singularities in the vicinity of RF connections and not by standing waves. These singularities are only described by a two-dimensional model and cannot be intuitively predicted by analogy to a one-dimensional case. Plasma light emission measurements and thickness homogeneity studies of a-Si:H films show that the plasma reproduces these voltage inhomogeneities. Improvement of the voltage uniformity is investigated by changing the number and position of the RF connections. (author) 13 figs., 20 refs.

  4. Static Response of Microbeams due to Capillary and Electrostatic Forces

    KAUST Repository

    Bataineh, Ahmad M.

    2016-03-07

    Micro-sensors or micro-switches usually operate under the effect of electrostatic force and could face some environmental effects like humidity, which may lead to condensation underneath the beams and create strong capillary forces. Those tiny structures are principally made of microbeams that can undergo instabilities under the effect of those created huge capillary forces. In fact, during the fabrication of microbeams, there is an important step to separate the beam from its substrate (wet etching). After this step, the microstructure is dried, which may causes the onset of some droplets of water trapped underneath the beam that could bring about a huge capillary force pulling it toward its substrate. If this force is bigger than the microbeam\\'s restoring force, it will become stuck to the substrate. This paper investigates the instability scenarios of both clamped-clamped (straight and curved) and cantilever (straight and curled) microbeams under the effect of capillary and/or electrostatic forces. The reduced order modeling (ROM) based on the Galerkin procedure is used to solve the nonlinear beam equations. The non-ideal boundaries are modeled by adding springs. The volume of the fluid between the beam and the substrate underneath it is varied and the relation between the volume of the water and the stability of the beam is shown. An analysis for the factors of which should be taken in to consideration in the fabrication processes to overcome the instability due to huge capillary forces is done. Also the size of the electrode for the electrostatic force is varied to show the effect on the micro-switch stability. A variation of the pull-in voltage with some specific beam parameters and with more than one case of electrode size is shown. It is found that capillary forces have a pronounced effect on the stability of microbeams. It is also found that the pull-in length decreases as the electrode size increases. It is also shown that the pull-in voltage decreases

  5. High voltage switches having one or more floating conductor layers

    Science.gov (United States)

    Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

    2015-11-24

    This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.

  6. Processing of carbon composite paper as electrode for fuel cell

    Energy Technology Data Exchange (ETDEWEB)

    Mathur, R.B.; Maheshwari, Priyanka H.; Dhami, T.L. [Carbon Technology Unit, National Physical Laboratory, New Delhi 110012 (India); Sharma, R.K.; Sharma, C.P. [Soft Polymeric Group, Division of Engineering Materials, National Physical Laboratory, New Delhi 110012 (India)

    2006-10-27

    The porous carbon electrode in a fuel cell not only acts as an electrolyte and a catalyst support, but also allows the diffusion of hydrogen fuel through its fine porosity and serves as a current-carrying conductor. A suitable carbon paper electrode is developed and possesses the characteristics of high porosity, permeability and strength along with low electrical resistivity so that it can be effectively used in proton-exchange membrane and phosphoric acid fuel cells. The electrode is prepared through a combination of two important techniques, viz., paper-making technology by first forming a porous chopped carbon fibre preform, and composite technology using a thermosetting resin matrix. The study reveals an interdependence of one parameter on another and how judicious choice of the processing conditions are necessary to achieve the desired characteristics. The current-voltage performance of the electrode in a unit fuel cell matches that of a commercially-available material. (author)

  7. Allosteric substrate switching in a voltage sensing lipid phosphatase

    Science.gov (United States)

    Grimm, Sasha S.; Isacoff, Ehud Y.

    2016-01-01

    Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We find the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), to have not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage sensing domain (VSD). Using fast FRET reporters of PIPs to monitor enzyme activity and voltage clamp fluorometry to monitor conformational changes in the VSD, we find that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This novel 2-step allosteric control over a dual specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility and endo/exocytosis. PMID:26878552

  8. Development of a polymer based fully flexible electrode tip for neuronal micro-stimulation applications

    Science.gov (United States)

    David, Romain; Miki, Norihisa

    2017-06-01

    Neural stimulation systems design is highly impacted by the overall resolution and adaptability of the device to the targeted application and area to stimulate. In this paper, we report a novel design for neural micro-stimulation electrode presenting high resolution and adaptability to any targeted area via a high flexibility. We propose the use of liquid metal micro-channels encapsulated into a polymer volume, achieving micro-stimulation pads at the tip of the channels. It presents a high degree of patternability to match different possible targeted applications, and good flexibility and mechanic properties to make it insertable and adaptable into soft tissues. A stable fabrication process, including insertion of the liquid alloy into 50 µm half-channels, the necessity of the U-shape to produce functional conductive micro-channels and the mechanical integrity of the device are discussed.

  9. Micro-arc oxidation of Ti-15Zr-based alloys for osseointegrative implants

    International Nuclear Information System (INIS)

    Correa, Diego Rafael Nespeque; Rocha, Luis Augusto; Doi, Hisashi; Tsutsumi, Yusuke; Hanawa, Takao

    2016-01-01

    Full text: Micro-arc oxidation (MAO) is well-known as low-cost coating technique which can produce porous structure in valve metals [1]. Studies have indicated that MAOcoatings are suitable for improve biofunctionalization of Ti-based implants by bioactive ions incorporation in the oxide layer [2]. This work aims to evaluate the characteristics of the MAO-coating in recent developed biomedical Ti-15Zr-based alloys in order to use as osseointegrative implants. Ti-15Zr-xMo (x = 0, 5, 10 and 15 % wt.) alloys were produced by argon arc-melting and molded in a centrifugal casting machine. MAO treatment were performed in disks (ϕ 8 mm x 1.5 mm), at room temperature, with a 304 stainless steel plate as counter electrode. Electrolyte was composed by 0.15 M calcium acetate and 0.10 M calcium glycerophosphate. The electrodes were connected to a DC power supply, and applied a density current of 311 A/m 2 , for 10 min, with voltages of 300, 350 and 400 V. Morphology, thickness, composition and crystal structure of the oxide layer were evaluated by SEM, XRF and XRD techniques. A typical porous layer was produced in all surfaces, being the porosity, porous size and thickness increased with the voltage. The composition of the oxide layer indicated Ca and P incorporation, being the concentration increased with the voltage applied. The XRD patterns do not exhibited peaks from oxides compounds, but only peaks from bulk-Ti phases. The results showed that the bioactive coatings were successfully growth in the Ti-15Zr-based alloys, being suitable for osseointegrative implants. References: [1] Hanawa, T. Japanese dental Science Review 46, 93-101, 2010; [2] Tsutsumi, Y. et al. Metals 6, 76-85, 2016. (author)

  10. Micro-arc oxidation of Ti-15Zr-based alloys for osseointegrative implants

    Energy Technology Data Exchange (ETDEWEB)

    Correa, Diego Rafael Nespeque; Rocha, Luis Augusto [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil); Doi, Hisashi; Tsutsumi, Yusuke; Hanawa, Takao [Tokyo Medical and Dental University (Japan)

    2016-07-01

    Full text: Micro-arc oxidation (MAO) is well-known as low-cost coating technique which can produce porous structure in valve metals [1]. Studies have indicated that MAOcoatings are suitable for improve biofunctionalization of Ti-based implants by bioactive ions incorporation in the oxide layer [2]. This work aims to evaluate the characteristics of the MAO-coating in recent developed biomedical Ti-15Zr-based alloys in order to use as osseointegrative implants. Ti-15Zr-xMo (x = 0, 5, 10 and 15 % wt.) alloys were produced by argon arc-melting and molded in a centrifugal casting machine. MAO treatment were performed in disks (ϕ 8 mm x 1.5 mm), at room temperature, with a 304 stainless steel plate as counter electrode. Electrolyte was composed by 0.15 M calcium acetate and 0.10 M calcium glycerophosphate. The electrodes were connected to a DC power supply, and applied a density current of 311 A/m{sup 2}, for 10 min, with voltages of 300, 350 and 400 V. Morphology, thickness, composition and crystal structure of the oxide layer were evaluated by SEM, XRF and XRD techniques. A typical porous layer was produced in all surfaces, being the porosity, porous size and thickness increased with the voltage. The composition of the oxide layer indicated Ca and P incorporation, being the concentration increased with the voltage applied. The XRD patterns do not exhibited peaks from oxides compounds, but only peaks from bulk-Ti phases. The results showed that the bioactive coatings were successfully growth in the Ti-15Zr-based alloys, being suitable for osseointegrative implants. References: [1] Hanawa, T. Japanese dental Science Review 46, 93-101, 2010; [2] Tsutsumi, Y. et al. Metals 6, 76-85, 2016. (author)

  11. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  12. Reference materials for micro-analytical nuclear techniques

    International Nuclear Information System (INIS)

    Valkovic, V.; Zeisler, R.; Bernasconi, G.; Danesi, P.R.

    1994-01-01

    Direct application of many existing reference materials in micro-analytical procedures such as energy dispersive x-ray fluorescence (EDXRF), particle induced x-ray emission spectroscopy (PIXE) and ion probe techniques for the determination of trace elements is often impossible or difficult because: 1) other constituents present in large amounts interfere with the determination; 2) trace components are not sufficiently homogeneously distributed in the sample. Therefore specific natural-matrix reference materials containing very low levels of trace elements and having high degree of homogeneity are required for many micro-analytical procedures. In this report, selection of the types of environmental and biological materials which are suitable for micro-analytical techniques will be discussed. (author)

  13. High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1995-01-01

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

  14. High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

    Science.gov (United States)

    Shimer, D.W.; Lange, A.C.

    1995-05-23

    A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

  15. Electrochemical reactivity at graphitic micro-domains on polycrystalline boron doped diamond thin-films electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Mahe, E. [LI2C CNRS/UMR 7612, Laboratoire d' Electrochimie, Universite Pierre-et-Marie Curie - case courrier 51, 4, Place Jussieu, 75252 Paris Cedex 05 (France); Devilliers, D. [LI2C CNRS/UMR 7612, Laboratoire d' Electrochimie, Universite Pierre-et-Marie Curie - case courrier 51, 4, Place Jussieu, 75252 Paris Cedex 05 (France); Comninellis, Ch. [Unite de Genie Electrochimique, Institut de sciences des procedes chimiques et biologiques, Ecole Polytechnique Federale de Lausanne, 1015, Lausanne (Switzerland)

    2005-04-01

    This paper deals with the electrochemical reactivity of boron doped diamond (BDD) electrodes. A comparative study has been carried out to show the influence of the presence of graphitic micro-domains upon the surface of these films. Those graphitic domains are sometimes present on as-grown boron doped diamond electrodes. The effect of doping a pure Csp{sup 3} diamond electrode is established by highly oriented pyrolytic graphite (HOPG) abrasion onto the diamond surface. In order to establish the effect of doping on a pure Csp{sup 3} diamond electrode, the amount of graphitic domains was increased by means of HOPG crystals grafted onto the BDD surface. Indeed that method allows the enrichment of the Csp{sup 2} contribution of the electrode. The presence of graphitic domains can be correlatively associated with the presence of kinetically active redox sites. The electrochemical reactivity of boron doped diamond electrodes shows a distribution of kinetic constants on the whole surface of the electrode corresponding to different active sites. In this paper, we have studied by cyclic voltammetry and electrochemical impedance spectroscopy the kinetics parameters of the ferri/ferrocyanide redox couple in KCl electrolyte. A method is proposed to diagnose the presence of graphitic domains on diamond electrodes, and an electrochemical 'pulse cleaning' procedure is proposed to remove them.

  16. Fluctuation-Coupling of Cathode Cavity Pressure and Arc Voltage in a dc Plasma Torch with a Long Inter-Electrode Channel at Reduced Pressure

    International Nuclear Information System (INIS)

    Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia

    2014-01-01

    Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet

  17. Stable operation of a high-power piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers and a stepped horn

    Science.gov (United States)

    Adachi, Kazunari; Suzuki, Kohei; Shibamata, Yuki

    2018-06-01

    We previously developed a 100 W piezoelectric transformer comprising two identical bolt-clamped Langevin-type transducers (BLTs) and a stepped horn whose cross-sectional area ratio determines the specified step-up voltage transformation ratio. Unlike conventional piezoelectric transformers, this transformer is driven at a frequency quite near its mechanical resonance, and thus can be mechanically held firmly at its clearly identified vibratory node without mechanical energy loss. However, it has been revealed that the high-power operation of the transformer often becomes very unstable owing to the “jumping and dropping” phenomena first found by Takahashi and Hirose [Jpn. J. Appl. Phys. 31, 3055 (1992)]. To avoid this instability, we have investigated the peculiar phenomena, and found that they can be attributed to a heavily distorted electric field inside the piezoelectric ceramic disks of the BLT on the primary side of the transformer being driven by a low-impedance voltage source near the mechanical resonance. The resultant concentration of the electric field leads to the local reversal of piezoelectric polarization in every half period of the vibration, viz., the instability. Consequently, we have developed a scheme for the steady high-power operation of this type of piezoelectric transformer and examined its validity experimentally. The method has eventually improved the linearity and power transfer efficiency of the transformer significantly.

  18. Real-time management of faulty electrodes in electrical impedance tomography.

    Science.gov (United States)

    Hartinger, Alzbeta E; Guardo, Robert; Adler, Andy; Gagnon, Hervé

    2009-02-01

    Completely or partially disconnected electrodes are a fairly common occurrence in many electrical impedance tomography (EIT) clinical applications. Several factors can contribute to electrode disconnection: patient movement, perspiration, manipulations by clinical staff, and defective electrode leads or electronics. By corrupting several measurements, faulty electrodes introduce significant image artifacts. In order to properly manage faulty electrodes, it is necessary to: 1) account for invalid data in image reconstruction algorithms and 2) automatically detect faulty electrodes. This paper presents a two-part approach for real-time management of faulty electrodes based on the principle of voltage-current reciprocity. The first part allows accounting for faulty electrodes in EIT image reconstruction without a priori knowledge of which electrodes are at fault. The method properly weights each measurement according to its compliance with the principle of voltage-current reciprocity. Results show that the algorithm is able to automatically determine the valid portion of the data and use it to calculate high-quality images. The second part of the approach allows automatic real-time detection of at least one faulty electrode with 100% sensitivity and two faulty electrodes with 80% sensitivity enabling the clinical staff to fix the problem as soon as possible to minimize data loss.

  19. Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.

    Science.gov (United States)

    Genc, Ayten; Bakirci, Busra

    2015-01-01

    The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.

  20. Effect of ciguatoxin 3C on voltage-gated Na+ and K+ currents in mouse taste cells.

    Science.gov (United States)

    Ghiaroni, Valeria; Fuwa, Haruhiko; Inoue, Masayuki; Sasaki, Makoto; Miyazaki, Keisuke; Hirama, Masahiro; Yasumoto, Takeshi; Rossini, Gian Paolo; Scalera, Giuseppe; Bigiani, Albertino

    2006-09-01

    The marine dinoflagellate Gambierdiscus toxicus produces highly lipophilic, polycyclic ether toxins that cause a seafood poisoning called ciguatera. Ciguatoxins (CTXs) and gambierol represent the two major causative agents of ciguatera intoxication, which include taste alterations (dysgeusiae). However, information on the mode of action of ciguatera toxins in taste cells is scarce. Here, we have studied the effect of synthetic CTX3C (a CTX congener) on mouse taste cells. By using the patch-clamp technique to monitor membrane ion currents, we found that CTX3C markedly affected the operation of voltage-gated Na(+) channels but was ineffective on voltage-gated K(+) channels. This result was the exact opposite of what we obtained earlier with gambierol, which inhibits K(+) channels but not Na(+) channels. Thus, CTXs and gambierol affect with high potency the operation of separate classes of voltage-gated ion channels in taste cells. Our data suggest that taste disturbances reported in ciguatera poisoning might be due to the ability of ciguatera toxins to interfere with ion channels in taste buds.

  1. Classification of assembly techniques for micro products

    DEFF Research Database (Denmark)

    Hansen, Hans Nørgaard; Tosello, Guido; Gegeckaite, Asta

    2005-01-01

    of components and level of integration are made. This paper describes a systematic characterization of micro assembly methods. This methodology offers the opportunity of a cross comparison among different techniques to gain a choosing principle of the favourable micro assembly technology in a specific case...

  2. “Imaging” LEIS of micro-patterned solid oxide fuel cell electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Druce, John, E-mail: john.druce@i2cner.kyushu-u.ac.jp [International Institute for Carbon Neutral Energy Research (wpi-I2CNER), Kyushu University, Fukuoka 819-0395 (Japan); Simrick, Neil [Department of Materials, Imperial College London, London SW7 2BP (United Kingdom); Ishihara, Tatsumi [International Institute for Carbon Neutral Energy Research (wpi-I2CNER), Kyushu University, Fukuoka 819-0395 (Japan); Kilner, John [International Institute for Carbon Neutral Energy Research (wpi-I2CNER), Kyushu University, Fukuoka 819-0395 (Japan); Department of Materials, Imperial College London, London SW7 2BP (United Kingdom)

    2014-08-01

    Understanding the kinetics of oxygen exchange between the gas phase and a ceramic electrode is key to optimising the performance of electrochemical energy conversion devices such as Solid Oxide Fuel Cells. Clearly the surface chemistry of these materials is important, and surface sensitive techniques such as Low Energy Ion Scattering (LEIS) can provide important compositional information key to unravelling electrode kinetics. In this work, we use high lateral resolution LEIS to perform local analyses of a micropatterned electrode structure, of the type often used for studies of the geometrical dependences of electrode performance. We find that the results are comparable to those for bulk materials, but detect evidence of cation interdiffusion from the electrode to the electrolyte. Finally, we note that this preliminary study could open the prospect of in situ measurements of cells near operating conditions.

  3. Simulation For Synchronization Of A Micro-Grid With Three-Phase Systems

    OpenAIRE

    Mohammad Jafari Far

    2015-01-01

    Abstract today due to the high reliability of the micro-grids they have developed significantly. They have two states of operation the island state and connection to the main grid. Under certain circumstances the micro-grid is connected to or disconnected from the network. Synchronization of a micro-grid with the network must be done when its voltage is synchronized with the voltage in the main grid. Phase lock loops are responsible to identify the voltage phase of the micro-gird and the main...

  4. A planar micro-flame ionization detector with an integrated guard electrode

    International Nuclear Information System (INIS)

    Kuipers, W J; Müller, J

    2008-01-01

    The flame ionization detector (FID) quantifies small concentrations of organic compounds by flame ionization of hydrocarbons and measurement of the resulting ion current. The ion current represents the number of carbon atoms in the sample gas. The miniaturization of the FID by MEMS technology (µFID) is expected to increase its use, because of reduced oxyhydrogen consumption. This loosens safety precautions and makes portable applications possible. In contrast to a former µFID design, the current planar µFID is designed to prevent environmental air from entering the system and deteriorating the measurement signal. The oxyhydrogen flame burns in the silicon plane of an almost completely encapsulating glass–silicon–glass sandwich. Only a small opening remains for removal of the exhaust gas from the system. In between the detector electrodes, a guard electrode is integrated to intercept and by-pass leak currents past the picoammeter, which then only measures the ion current. Due to the design of the guard electrode, small leak currents are still measured by the picoammeter. Yet, these leak currents can be corrected for to obtain the ion current. Measurements of the ion current as a function of the applied voltage and the sample gas flow show expected FID behaviour

  5. Water Desalination Using Capacitive Deionization with Microporous Carbon Electrodes

    NARCIS (Netherlands)

    Porada, S.; Weinstein, L.; Dash, R.; Wal, van der A.F.; Bryjak, M.; Gogotsi, Y.; Biesheuvel, P.M.

    2012-01-01

    Capacitive deionization (CDI) is a water desalination technology in which salt ions are removed from brackish water by flowing through a spacer channel with porous electrodes on each side. Upon applying a voltage difference between the two electrodes, cations move to and are accumulated in

  6. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. The design considerations and methods along with the development tests are presented. Special considerations to guard against adverse cracking of the insulation material, to maintain the clamp-pipe stiffness desired during a seismic event, to minimize clamp restraint on the pipe during normal pipe heatup, and to resist clamp rotation or spinning on the pipe are emphasized

  7. Use of multi-functional flexible micro-sensors for in situ measurement of temperature, voltage and fuel flow in a proton exchange membrane fuel cell.

    Science.gov (United States)

    Lee, Chi-Yuan; Chan, Pin-Cheng; Lee, Chung-Ju

    2010-01-01

    Temperature, voltage and fuel flow distribution all contribute considerably to fuel cell performance. Conventional methods cannot accurately determine parameter changes inside a fuel cell. This investigation developed flexible and multi-functional micro sensors on a 40 μm-thick stainless steel foil substrate by using micro-electro-mechanical systems (MEMS) and embedded them in a proton exchange membrane fuel cell (PEMFC) to measure the temperature, voltage and flow. Users can monitor and control in situ the temperature, voltage and fuel flow distribution in the cell. Thereby, both fuel cell performance and lifetime can be increased.

  8. Pulsed voltage deposited lead selenide thin film as efficient counter electrode for quantum-dot-sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Bin Bin [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Department of Chemical Engineering, Institute of Chemical Industry, Shaanxi Institute of Technology, Xi’an 710300 (China); Wang, Ye Feng [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China); Wang, Xue Qing [Faculty of Chemical, Environmental and Biological Science and Technology, Dalian University of Technology, Dalian 116024 (China); Zeng, Jing Hui, E-mail: jhzeng@ustc.edu [Key Laboratory of Macromolecular Science of Shaanxi Province & School of Materials Science and Engineering, Shaanxi Normal University, Xi’an 710062 (China)

    2016-04-30

    Highlights: • PbSe thin film is deposited on FTO glass by a pulse voltage electrodeposition method. • The thin film is used as counter electrode (CE) in quantum dot-sensitized solar cell. • Superior electrocatalytic activity and stability in the polysulfide electrolyte is received. • The narrow band gap characteristics and p-type conductivity enhances the cell efficiency. • An efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells. - Abstract: Lead selenide (PbSe) thin films were deposited on fluorine doped tin oxide (FTO) glass by a facile one-step pulse voltage electrodeposition method, and used as counter electrode (CE) in CdS/CdSe quantum dot-sensitized solar cells (QDSSCs). A power conversion efficiency of 4.67% is received for the CdS/CdSe co-sensitized solar cells, which is much better than that of 2.39% received using Pt CEs. The enhanced performance is attributed to the extended absorption in the near infrared region, superior electrocatalytic activity and p-type conductivity with a reflection of the incident light at the back electrode in addition. The physical and chemical properties were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), energy-dispersive spectroscopy (EDS), reflectance spectra, electrochemical impedance spectroscopy (EIS) and Tafel polarization measurements. The present work provides a facile pathway to an efficient CE in the QDSSCs.

  9. Development of a Piezoelectric Vacuum Sensing Component for a Wide Pressure Range

    Directory of Open Access Journals (Sweden)

    Bing-Yu Wang

    2014-11-01

    Full Text Available In this study, we develop a clamped–clamped beam-type piezoelectric vacuum pressure sensing element. The clamped–clamped piezoelectric beam is composed of a PZT layer and a copper substrate. A pair of electrodes is set near each end. An input voltage is applied to a pair of electrodes to vibrate the piezoelectric beam, and the output voltage is measured at the other pair. Because the viscous forces on the piezoelectric beam vary at different air pressures, the vibration of the beam depends on the vacuum pressure. The developed pressure sensor can sense a wide range of pressure, from 6.5 × 10−6 to 760 Torr. The experimental results showed that the output voltage is inversely proportional to the gas damping ratio, and thus, the vacuum pressure was estimated from the output voltage.

  10. Modeling and evaluation of the influence of micro-EDM sparking state settings on the tool electrode wear behavior

    DEFF Research Database (Denmark)

    Puthumana, Govindan

    2017-01-01

    materials characterized by considerable wear ofthe tool used for material removal. This paper presents an investigation involving modeling and estimation of the effect of settings for generation of discharges in stable conditions of micro-EDM on the phenomenon of tool electrode wear. A stable sparking...... a condition for the minimum tool wear for this micro-EDM process configuration....

  11. Response surface modelling of tool electrode wear rate and material removal rate in micro electrical discharge machining of Inconel 718

    DEFF Research Database (Denmark)

    Puthumana, Govindan

    2017-01-01

    conductivity and high strength causing it extremely difficult tomachine. Micro-Electrical Discharge Machining (Micro-EDM) is a non-conventional method that has a potential toovercome these restrictions for machining of Inconel 718. Response Surface Method (RSM) was used for modelling thetool Electrode Wear...

  12. Nickel hydrogen bipolar battery electrode design

    Science.gov (United States)

    Puglisi, V. J.; Russell, P.; Verrier, D.; Hall, A.

    1985-01-01

    The preferred approach of the NASA development effort in nickel hydrogen battery design utilizes a bipolar plate stacking arrangement to obtain the required voltage-capacity configuration. In a bipolar stack, component designs must take into account not only the typical design considerations such as voltage, capacity and gas management, but also conductivity to the bipolar (i.e., intercell) plate. The nickel and hydrogen electrode development specifically relevant to bipolar cell operation is discussed. Nickel oxide electrodes, having variable type grids and in thicknesses up to .085 inch are being fabricated and characterized to provide a data base. A selection will be made based upon a system level tradeoff. Negative (hydrpogen) electrodes are being screened to select a high performance electrode which can function as a bipolar electrode. Present nickel hydrogen negative electrodes are not capable of conducting current through their cross-section. An electrode was tested which exhibits low charge and discharge polarization voltages and at the same time is conductive. Test data is presented.

  13. Analysis of Energy and Power Generation in a Photovoltaic Micro installation Interconnected with a Low Voltage Grid

    Directory of Open Access Journals (Sweden)

    Marian Sobierajski

    2015-12-01

    Full Text Available The paper discusses the performance of the 15 kW photovoltaic micro installation located on the roof of building D-1 of the Faculty of Electrical Engineering at Wroclaw University of Technology. The micro installation is connected to the low voltage grid, which supplies the new, air-conditioned building D-20. The paper discusses the energy and power generation output in yearly, monthly, and daily intervals. The micro installation’s output in the summer morning peaks is compared with the daily wind generation against the background of the demand, generation, regulation reserve, and overhauls in the National Power System.

  14. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers.

    Science.gov (United States)

    Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar

    2018-04-17

    This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  15. Experimental investigation on low-frequency vibration assisted micro-WEDM of Inconel 718

    Directory of Open Access Journals (Sweden)

    Deepak Rajendra Unune

    2017-02-01

    Full Text Available The micro-wire electric discharge machining (micro-WEDM has emerged as the popular micromachining processes for fabrication of micro-features. However, the low machining rate and poor surface finish are restricting wide applications of this process. Therefore, in this study, an attempt was made to improve machining rate of micro-WEDM with low-frequency workpiece vibration assistance. The gap voltage, capacitance, feed rate and vibrational frequency were chosen as control factors, whereas, the material removal rate (MRR and kerf width were selected as performance measures while fabricating microchannels in Inconel 718. It was observed that in micro-WEDM, the capacitance is the most significant factor affecting both MRR and kerf width. It was witnessed that the low-frequency workpiece vibration improves the performance of micro-WEDM by improving the MRR due to enhanced flushing conditions and reduced electrode-workpiece adhesion.

  16. Mechanics of wafer bonding: Effect of clamping

    Science.gov (United States)

    Turner, K. T.; Thouless, M. D.; Spearing, S. M.

    2004-01-01

    A mechanics-based model is developed to examine the effects of clamping during wafer bonding processes. The model provides closed-form expressions that relate the initial geometry and elastic properties of the wafers to the final shape of the bonded pair and the strain energy release rate at the interface for two different clamping configurations. The results demonstrate that the curvature of bonded pairs may be controlled through the use of specific clamping arrangements during the bonding process. Furthermore, it is demonstrated that the strain energy release rate depends on the clamping configuration and that using applied loads usually leads to an undesirable increase in the strain energy release rate. The results are discussed in detail and implications for process development and bonding tool design are highlighted.

  17. Enhanced DC-Link Capacitor Voltage Balancing Control of DC–AC Multilevel Multileg Converters

    DEFF Research Database (Denmark)

    Busquets-Monge, Sergio; Maheshwari, Ram Krishan; Nicolas-Apruzzese, Joan

    2015-01-01

    This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc-link vol......This paper presents a capacitor voltage balancing control applicable to any multilevel dc–ac converter formed by a single set of series-connected capacitors implementing the dc link and semiconductor devices, such as the diode-clamped topology. The control is defined for any number of dc...

  18. Electrochemical behavior of two and one electron redox systems adsorbed on to micro- and mesoporous silicate materials: Influence of the channels and the cationic environment of the host materials

    International Nuclear Information System (INIS)

    Senthil Kumar, K.; Natarajan, P.

    2009-01-01

    Electrochemical behavior of two electron redox system, phenosafranine (PS + ) adsorbed on to micro- and mesoporous materials is investigated by cyclic voltammetry and differential pulse voltammetry using modified micro- and mesoporous host electrodes. Two redox peaks were observed when phenosafranine is adsorbed on the surface of microporous materials zeolite-Y and ZSM-5. However, only a single redox peak was observed in the modified electrode with phenosafranine encapsulated into the mesoporous material MCM-41 and when adsorbed on the external surface of silica. The observed redox peaks for the modified electrodes with zeolite-Y and ZSM-5 host are suggested to be primarily due to consecutive two electron processes. The peak separation ΔE and peak potential of phenosafranine adsorbed on zeolite-Y and ZSM-5 were found to be influenced by the pH of the electrolyte solution. The variation of the peak current in the cyclic voltammogram and differential pulse voltammetry with scan rate shows that electrodic processes are controlled by the nature of the surface of the host material. The heterogeneous electron transfer rate constants for phenosafranine adsorbed on to micro- and mesoporous materials were calculated using the Laviron model. Higher rate constant observed for the dye encapsulated into the MCM-41 indicates that the one-dimensional channel of the mesoporous material provides a more facile micro-environment for phenosafranine for the electron transfer reaction as compared to the microporous silicate materials. The stability of the modified electrode surface was investigated by multisweep cyclic voltammetry.

  19. Laser microsurgery of higher plant cell walls permits patch-clamp access

    International Nuclear Information System (INIS)

    Henriksen, G.H.; Taylor, A.R.; Brownlee, C.; Assmann, S.M.

    1996-01-01

    Plasma membranes of guard cells in epidermal peels of Vicia faba and Commelina communis can be made accessible to a patch-clamp pipet by removing a small portion (1-3 micrometer in diameter) of the guard cell wall using a microbeam of ultraviolet light generated by a nitrogen laser. Using this laser microsurgical technique, we have measured channel activity across plasma membranes of V. faba guard cells in both cell-attached and isolated patch configurations. Measurements made in the inside-out patch configuration revealed two distinct K+-selective channels. Major advantages of the laser microsurgical technique include the avoidance of enzymatic protoplast isolation, the ability to study cell types that have been difficult to isolate as protoplasts or for which enzymatic isolation protocols result in protoplasts not amenable to patch-clamp studies, the maintenance of positional information in single-channel measurements, reduced disruption of cell-wall-mediated signaling pathways, and the ability to investigate intercellular signaling through studies of cells remaining situated within tissue

  20. Progress in micro-pattern gas detectors

    International Nuclear Information System (INIS)

    Bellazzini, Ronaldo

    2001-01-01

    Micro-Pattern Gas Detectors are position-sensitive proportional counters whose sense electrodes are constructed using micro-electronics , thin-film or advanced PCB techniques.The feature size attainable using these methods is of the order of a few microns and the detectors demonstrate excellent spatial resolution and fast charge collection. I will review recent progress on Micro patterned Gas Detectors for tracking and other cross-disciplinary applications.I will focus on the design principles,performance capability and limitations. A short list of interesting applications will be discussed

  1. Determination of the cathode fall voltage in fluorescent lamps by measurement of the operating voltage

    International Nuclear Information System (INIS)

    Hilscher, A.

    2002-01-01

    A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)

  2. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  3. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  4. SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5

    Directory of Open Access Journals (Sweden)

    Musaab Ahmed

    2016-01-01

    Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.

  5. Depositing bulk or micro-scale electrodes

    Science.gov (United States)

    Shah, Kedar G.; Pannu, Satinderpall S.; Tolosa, Vanessa; Tooker, Angela C.; Sheth, Heeral J.; Felix, Sarah H.; Delima, Terri L.

    2016-11-01

    Thicker electrodes are provided on microelectronic device using thermo-compression bonding. A thin-film electrical conducting layer forms electrical conduits and bulk depositing provides an electrode layer on the thin-film electrical conducting layer. An insulating polymer layer encapsulates the electrically thin-film electrical conducting layer and the electrode layer. Some of the insulating layer is removed to expose the electrode layer.

  6. Multimodal Examination of Atrial Fibrillation Substrate: Correlation of Left Atrial Bipolar Voltage Using Multi-Electrode Fast Automated Mapping, Point-by-Point Mapping, and Magnetic Resonance Image Intensity Ratio.

    Science.gov (United States)

    Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D

    2018-01-01

    Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p0.74 corresponded to bipolar voltage voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, pvoltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.

  7. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  8. Spraying Techniques for Large Scale Manufacturing of PEM-FC Electrodes

    Science.gov (United States)

    Hoffman, Casey J.

    Fuel cells are highly efficient energy conversion devices that represent one part of the solution to the world's current energy crisis in the midst of global climate change. When supplied with the necessary reactant gasses, fuel cells produce only electricity, heat, and water. The fuel used, namely hydrogen, is available from many sources including natural gas and the electrolysis of water. If the electricity for electrolysis is generated by renewable energy (e.g., solar and wind power), fuel cells represent a completely 'green' method of producing electricity. The thought of being able to produce electricity to power homes, vehicles, and other portable or stationary equipment with essentially zero environmentally harmful emissions has been driving academic and industrial fuel cell research and development with the goal of successfully commercializing this technology. Unfortunately, fuel cells cannot achieve any appreciable market penetration at their current costs. The author's hypothesis is that: the development of automated, non-contact deposition methods for electrode manufacturing will improve performance and process flexibility, thereby helping to accelerate the commercialization of PEMFC technology. The overarching motivation for this research was to lower the cost of manufacturing fuel cell electrodes and bring the technology one step closer to commercial viability. The author has proven this hypothesis through a detailed study of two non-contact spraying methods. These scalable deposition systems were incorporated into an automated electrode manufacturing system that was designed and built by the author for this research. The electrode manufacturing techniques developed by the author have been shown to produce electrodes that outperform a common lab-scale contact method that was studied as a baseline, as well as several commercially available electrodes. In addition, these scalable, large scale electrode manufacturing processes developed by the author are

  9. Single-Carrier Modulation for Neutral-Point-Clamped Inverters in Three-Phase Transformerless Photovoltaic Systems

    DEFF Research Database (Denmark)

    Guo, Xiaoqiang; Cavalcanti, Marcelo C.; Farias, Alexandre M.

    2013-01-01

    Modulation strategy is one of the most important issues for three-level neutral-point-clamped inverters in three-phase transformerless photovoltaic systems. A challenge for modulation is how to keep the common-mode voltages constant to reduce the leakage currents. A single-carrier modulation...... strategy is proposed. It has a very simple structure, and the common-mode voltages can be kept constant with no need of complex space-vector modulation or multicarrier pulsewidth modulation. Experimental results verify the theoretical analysis and the effectiveness of the presented method....

  10. Indirect Electrochemical Oxidation with Multi Carbon Electrodes for Restaurant Wastewater Treatment

    Directory of Open Access Journals (Sweden)

    I Dewa Ketut Sastrawidana

    2018-01-01

    Full Text Available The removal of organic matter from the restaurant wastewater was investigated using the electrochemical oxida-tion method with multi carbon electrodes in a parallel construction. The degradation process was monitored by the measurement of COD concentration as a function of electrolysis time. The effectof operating parameter conditions on COD removal were investigated including initial pH, distance between electrodes, and the applied voltage difference.The results showed that the treatment of restaurant wastewater containing 2 g/L chloride ion using the electrochemical oxidation technique at the operation conditions characterized by: pH 5, distance between electrode of 10 cm and applied voltage of 12 V, enabled to obtained COD removal of 92.84% within 90 min electrolysis time. It is can be concluded that the indirect electrochemical oxidation method with multi carbon electrodes can be used effectivelyas an alternative technology for reducing COD and may be potentially applied for removal organic pollutants from wastewater at the industrial scale.

  11. Stopping potential and ion beamlet control for micro-resistive patterning through sub-Debye length plasma apertures

    Directory of Open Access Journals (Sweden)

    Abhishek Chowdhury

    2014-12-01

    Full Text Available Focused multiple ion beamlets from a microwave plasma source is investigated for localized micron-scale modification of substrates in a patterned manner. Plasma electrodes (PE with an array of through apertures having aperture diameters of the order of plasma Debye length are investigated for generating the beamlets. Extraction through sub-Debye length apertures becomes possible when the PE is kept at floating potential. It is found that the current – voltage characteristics of the extracted beamlets exhibits interesting features such as a space-charge-limited region that has a different behaviour than the conventional Child-Langmuir’s law and an extraction-voltage-limited region that does not undergo saturation but exhibits a Schottky-like behaviour similar to that of a vacuum diode. A switching technique to control the motion of individual beamlets is developed and the stopping potential determined. The beamlets are thereafter used to create localized micro-resistive patterns. The experimental results are compared with simulations and reasonably good agreement is obtained.

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter

    DEFF Research Database (Denmark)

    Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus

    2011-01-01

    This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...

  14. Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

    Science.gov (United States)

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-12-27

    An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

  15. Environmental and biotechnological applications of high-voltage pulsed discharges in water

    International Nuclear Information System (INIS)

    Sato, Masayuki

    2008-01-01

    A high-voltage pulse has wide application in fields such as chemistry, physics and biology and their combinations. The high-voltage pulse forms two kinds of physical processes in water, namely (a) a pulsed electric field (PEF) in the parallel electrode configuration and (b) plasma generation by a pulsed discharge in the water phase with a concentrated electric field. The PEF can be used for inactivation of bacteria in liquid foods as a non-thermal process, and the underwater plasma is applicable not only for the decomposition of organic materials in water but also for biological treatment of wastewater. These discharge states are controlled mainly by the applied pulse voltage and the electrode shape. Some examples of environmental and biotechnological applications of a high-voltage pulse are reviewed.

  16. In-situ experimental characterization of the clamping pressure effects on low temperature polymer electrolyte membrane electrolysis International Journal of Hydrogen Energy

    DEFF Research Database (Denmark)

    Al Shakhshir, Saher; Cui, Xiaoti; Frensch, Steffen Henrik

    2017-01-01

    as a gas with the circulating water. The effects of clamping pressure (Pc) on the LT-PEME cell performance, polarization resistances, and hydrogen and water crossover through the membrane, and hydrogen and oxygen production rate are studied. A 50 cm2 active area LT-PEME cell designed and manufactured......-PEME splits water into hydrogen and oxygen when the voltage is applied between anode and cathode. Electrical current forces the positively charged ions to migrate to negatively charged cathode through PEM, where hydrogen is produced. Meanwhile, oxygen is produced at the anode side electrode and escapes...... in house is utilized in this work. Higher Pc has shown higher cell performance this refers to lower ohmic and activation resistances. Water crossover from anode to cathode is slightly decreased at higher Pc resulting in a slight decrease in hydrogen crossover from cathode to anode. Also, the percentage...

  17. Targeted Endovascular Temporary Vessel Occlusion with a Reverse Thermosensitive Polymer for Near-Bloodless Partial Nephrectomy: Comparison to Standard Surgical Clamping Techniques

    Energy Technology Data Exchange (ETDEWEB)

    Flacke, Sebastian, E-mail: Sebastian.Flacke@lahey.org [Lahey Clinic, Tuft University Medical School, Department of Radiology (United States); Harty, Niall J.; Laskey, Daniel H.; Moinzadeh, Alireza [Lahey Clinic, Tuft University Medical School, Department of Urology (United States); Benn, James A. [Pluromed Inc (United States); Villani, Rosanna [DaVinci Biomedical Research Products (United States); Kalra, Aarti [Lahey Clinic, Tuft University Medical School, Department of Pathology (United States); Libertino, John A.; Madras, Peter N. [Lahey Clinic, Tuft University Medical School, Department of Urology (United States)

    2012-10-15

    Purpose: To determine whether reversible blood flow interruption to a randomly chosen target region of the kidney may be achieved with the injection of a reverse thermoplastic polymer through an angiographic catheter, thereby facilitating partial nephrectomy without compromising blood flow to the remaining kidney or adding risks beyond those encountered by the use of hilar clamping. Methods: Fifteen pigs underwent partial nephrectomy after blood flow interruption by vascular cross-clamping or injection of polymer (Lumagel Trade-Mark-Sign ) into a segmental artery. Five animals were euthanized after surgery (three open and two laparoscopic resection, cross-clamping n = 2), and 10 (open resection, cross-clamping n = 4) were euthanized after 6 weeks' survival. Blood specimens were obtained periodically, and angiogram and necropsy were performed at 6 weeks. Results: Selective renal ischemia was achieved in all cases. Surgical resection time averaged 9 and 24.5 min in the open and laparoscopic groups, respectively. Estimated blood loss was negligible with the exception of one case where an accessory renal artery was originally overlooked. Reversal of the polymer to a liquid state was consistent angiographically and visually in all cases. Time to complete flow return averaged 7.4 and 2 min for polymer and clamping, respectively. Angiography at 6 weeks revealed no evidence of vascular injury. Laboratory data and necropsies revealed no differences between animals undergoing vascular clamping or polymer injection. Conclusion: Lumagel was as effective as vascular clamping in producing a near bloodless operative field for partial nephrectomy while maintaining flow to the uninvolved portion of the affected kidney.

  18. Impedances of electrochemically impregnated nickel electrodes as functions of potential, KOH concentration, and impregnation method

    Science.gov (United States)

    Reid, Margaret A.

    1989-01-01

    Impedances of fifteen electrodes form each of the four U.S. manufactures were measured at 0.200 V vs. the Hg/HgO reference electrode. This corresponds to a voltage of 1.145 for a Ni/H2 cell. Measurements were also made of a representative sample of these at 0.44 V. At the higher voltage, the impedances were small and very similar, but at the lower voltage there were major differences between manufacturers. Electrodes from the same manufacturers showed only small differences. The impedances of electrodes from two manufacturers were considerably different in 26 percent KOH from those in 31 percent KOH. These preliminary results seen to correlate with the limited data from earlier life testing of cells from these manufacturers. The impedances of cells being tested for Space Station Freedom are being followed, and more impendance measurements of electrodes are being performed as functions of manufacturer, voltage, electrolyte concentration, and cycle history in hopes of finding better correlations of impedance with life.

  19. The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma

    International Nuclear Information System (INIS)

    Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.

    2006-01-01

    The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)

  20. Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

    Science.gov (United States)

    Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  1. Analytical Formulation of the Electric Field Induced by Electrode Arrays: Towards Automated Dielectrophoretic Cell Sorting

    Directory of Open Access Journals (Sweden)

    Vladimir Gauthier

    2017-08-01

    Full Text Available Dielectrophoresis is defined as the motion of an electrically polarisable particle in a non-uniform electric field. Current dielectrophoretic devices enabling sorting of cells are mostly controlled in open-loop applying a predefined voltage on micro-electrodes. Closed-loop control of these devices would enable to get advanced functionalities and also more robust behavior. Currently, the numerical models of dielectrophoretic force are too complex to be used in real-time closed-loop control. The aim of this paper is to propose a new type of models usable in this framework. We propose an analytical model of the electric field based on Fourier series to compute the dielectrophoretic force produced by parallel electrode arrays. Indeed, this method provides an analytical expression of the electric potential which decouples the geometrical factors (parameter of our system, the voltages applied on electrodes (input of our system, and the position of the cells (output of our system. Considering the Newton laws on each cell, it enables to generate easily a dynamic model of the cell positions (output function of the voltages on electrodes (input. This dynamic model of our system is required to design the future closed-loop control law. The predicted dielectrophoretic forces are compared to a numerical simulation based on finite element model using COMSOL software. The model presented in this paper enables to compute the dielectrophoretic force applied to a cell by an electrode array in a few tenths of milliseconds. This model could be consequently used in future works for closed-loop control of dielectrophoretic devices.

  2. A HIGH CURRENT, HIGH VOLTAGE SOLID-STATE PULSE GENERATOR FOR THE NIF PLASMA ELECTRODE POCKELS CELL

    International Nuclear Information System (INIS)

    Arnold, P A; Barbosa, F; Cook, E G; Hickman, B C; Akana, G L; Brooksby, C A

    2007-01-01

    A high current, high voltage, all solid-state pulse modulator has been developed for use in the Plasma Electrode Pockels Cell (PEPC) subsystem in the National Ignition Facility. The MOSFET-switched pulse generator, designed to be a more capable plug-in replacement for the thyratron-switched units currently deployed in NIF, offers unprecedented capabilities including burst-mode operation, pulse width agility and a steady-state pulse repetition frequency exceeding 1 Hz. Capable of delivering requisite fast risetime, 17 kV flattop pulses into a 6 (Omega) load, the pulser employs a modular architecture characteristic of the inductive adder technology, pioneered at LLNL for use in acceleration applications, which keeps primary voltages low (and well within the capabilities of existing FET technology), reduces fabrication costs and is amenable to rapid assembly and quick field repairs

  3. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers

    Directory of Open Access Journals (Sweden)

    Francesco Dell’ Anna

    2018-04-01

    Full Text Available This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  4. Mapping the fine structure of cortical activity with different micro-ECoG electrode array geometries

    Science.gov (United States)

    Wang, Xi; Gkogkidis, C. Alexis; Iljina, Olga; Fiederer, Lukas D. J.; Henle, Christian; Mader, Irina; Kaminsky, Jan; Stieglitz, Thomas; Gierthmuehlen, Mortimer; Ball, Tonio

    2017-10-01

    Objective. Innovations in micro-electrocorticography (µECoG) electrode array manufacturing now allow for intricate designs with smaller contact diameters and/or pitch (i.e. inter-contact distance) down to the sub-mm range. The aims of the present study were: (i) to investigate whether frequency ranges up to 400 Hz can be reproducibly observed in µECoG recordings and (ii) to examine how differences in topographical substructure between these frequency bands and electrode array geometries can be quantified. We also investigated, for the first time, the influence of blood vessels on signal properties and assessed the influence of cortical vasculature on topographic mapping. Approach. The present study employed two µECoG electrode arrays with different contact diameters and inter-contact distances, which were used to characterize neural activity from the somatosensory cortex of minipigs in a broad frequency range up to 400 Hz. The analysed neural data were recorded in acute experiments under anaesthesia during peripheral electrical stimulation. Main results. We observed that µECoG recordings reliably revealed multi-focal cortical somatosensory response patterns, in which response peaks were often less than 1 cm apart and would thus not have been resolvable with conventional ECoG. The response patterns differed by stimulation site and intensity, they were distinct for different frequency bands, and the results of functional mapping proved independent of cortical vascular. Our analysis of different frequency bands exhibited differences in the number of activation peaks in topographical substructures. Notably, signal strength and signal-to-noise ratios differed between the two electrode arrays, possibly due to their different sensitivity for variations in spatial patterns and signal strengths. Significance. Our findings that the geometry of µECoG electrode arrays can strongly influence their recording performance can help to make informed decisions that maybe

  5. UV-LIGA technique for ECF micropumps using back UV exposure and self-alignment

    Science.gov (United States)

    Han, D.; Xia, Y.; Yokota, S.; Kim, J. W.

    2017-12-01

    This paper proposes and develops a novel UV-LIGA technique using back UV exposure and self-alignment to realize high aspect ratio micromachining (HARM) in high power density electro-conjugate fluid (ECF) micropumps. ECF is a functional fluid designed to be able to generate strong and active jet flow (ECF jetting) between anode and cathode in ECF when high DC voltage is applied. We have developed high power density ECF micropumps consisting of triangular prism and slit electrode pairs (TPSEs) fabricated by HARM. The traditional UV-LIGA technique for HARM is mainly divided into two approaches: (a) single thick layer and (b) multiple thin layers. Both methods have limitations—deformed molds in the former and misalignment between layers in the latter. Using the finite element method software COMSOL Multiphysics, we demonstrate that the deformed micro-molds critically impair the performance of ECF micropumps. In addition, we experimentally prove that the misalignment would easily trigger electric discharge in the ECF micropumps. To overcome these limitations, we conceive a new concept utilizing the seed electrode layer for electroforming as the UV shield and pattern photoresist (KMPR) by back UV exposure. The seed electrode layer should be composed of a non-transparent conductor (Au/Ti) for patterning and a transparent conductor (ITO) for wiring. Instead of ITO, we propose the concept of transparency-like electrodes comprised of thin metal line patterns. To verify this concept, KMPR layers with thicknesses of 70, 220, and 500 µm are experimentally investigated. In the case of 500 µm KMPR thickness, the concept of transparency-like electrode was partially proved. As a result, TPSEs with a height of 440 µm were successfully fabricated. Characteristic experiments demonstrated that ECF micropumps (367 mW cm-3) fabricated by back UV achieved almost the same output power density as ECF micropumps (391 mW cm-3) fabricated by front UV. This paper proves that the proposed

  6. UV-LIGA technique for ECF micropumps using back UV exposure and self-alignment

    International Nuclear Information System (INIS)

    Han, D; Xia, Y; Yokota, S; Kim, J W

    2017-01-01

    This paper proposes and develops a novel UV-LIGA technique using back UV exposure and self-alignment to realize high aspect ratio micromachining (HARM) in high power density electro-conjugate fluid (ECF) micropumps. ECF is a functional fluid designed to be able to generate strong and active jet flow (ECF jetting) between anode and cathode in ECF when high DC voltage is applied. We have developed high power density ECF micropumps consisting of triangular prism and slit electrode pairs (TPSEs) fabricated by HARM. The traditional UV-LIGA technique for HARM is mainly divided into two approaches: (a) single thick layer and (b) multiple thin layers. Both methods have limitations—deformed molds in the former and misalignment between layers in the latter. Using the finite element method software COMSOL Multiphysics, we demonstrate that the deformed micro-molds critically impair the performance of ECF micropumps. In addition, we experimentally prove that the misalignment would easily trigger electric discharge in the ECF micropumps. To overcome these limitations, we conceive a new concept utilizing the seed electrode layer for electroforming as the UV shield and pattern photoresist (KMPR) by back UV exposure. The seed electrode layer should be composed of a non-transparent conductor (Au/Ti) for patterning and a transparent conductor (ITO) for wiring. Instead of ITO, we propose the concept of transparency-like electrodes comprised of thin metal line patterns. To verify this concept, KMPR layers with thicknesses of 70, 220, and 500 µ m are experimentally investigated. In the case of 500 µ m KMPR thickness, the concept of transparency-like electrode was partially proved. As a result, TPSEs with a height of 440 µ m were successfully fabricated. Characteristic experiments demonstrated that ECF micropumps (367 mW cm −3 ) fabricated by back UV achieved almost the same output power density as ECF micropumps (391 mW cm −3 ) fabricated by front UV. This paper proves that the

  7. Simulation and optimization of a polymer directional coupler electro-optic switch with push pull electrodes

    Science.gov (United States)

    Zheng, Chuan-Tao; Ma, Chun-Sheng; Yan, Xin; Wang, Xian-Yin; Zhang, Da-Ming

    2008-07-01

    Structural model and design technique are proposed for a polymer directional coupler electro-optic switch with rib waveguides and push-pull electrodes, of which the electric field distribution is analyzed by the conformal transforming method and image method. In order to get the minimum mode loss and the minimum switching voltage, the parameters of the waveguide and electrode are optimized, such as the core with, core thickness, buffer layer between the core and the electrode, coupling gap between the waveguides, electrode thickness, electrode width and electrode gap. Switching Characteristics are analyzed, which include the output power, insertion loss, and crosstalk. To realize normal switching function, the fabrication error, spectrum shift, and coupling loss between a single mode fiber (SMF) and the waveguide are discussed. Simulation results show that the coupling length is 3082 μm, push-pull switching voltage is 2.14 V, insertion loss is less than 1.17 dB, and crosstalk is less than -30 dB for the designed device.

  8. Screening of E. coli β-clamp Inhibitors Revealed that Few Inhibit Helicobacter pylori More Effectively: Structural and Functional Characterization

    Directory of Open Access Journals (Sweden)

    Preeti Pandey

    2018-01-01

    Full Text Available The characteristic of interaction with various enzymes and processivity-promoting nature during DNA replication makes β-clamp an important drug target. Helicobacter pylori (H. pylori have several unique features in DNA replication machinery that makes it different from other microorganisms. To find out whether difference in DNA replication proteins behavior accounts for any difference in drug response when compared to E. coli, in the present study, we have tested E. coli β-clamp inhibitor molecules against H. pylori β-clamp. Various approaches were used to test the binding of inhibitors to H. pylori β-clamp including docking, surface competition assay, complex structure determination, as well as antimicrobial assay. Out of five shortlisted inhibitor molecules on the basis of docking score, three molecules, 5-chloroisatin, carprofen, and 3,4-difluorobenzamide were co-crystallized with H. pylori β-clamp and the structures show that they bind at the protein-protein interaction site as expected. In vivo studies showed only two molecules, 5-chloroisatin, and 3,4-difluorobenzamide inhibited the growth of the pylori with MIC values in micro molar range, which is better than the inhibitory effect of the same drugs on E. coli. Therefore, the evaluation of such drugs against H. pylori may explore the possibility to use to generate species-specific pharmacophore for development of new drugs against H. pylori.

  9. Screening of E. coli β-clamp Inhibitors Revealed that Few Inhibit Helicobacter pylori More Effectively: Structural and Functional Characterization.

    Science.gov (United States)

    Pandey, Preeti; Verma, Vijay; Dhar, Suman Kumar; Gourinath, Samudrala

    2018-01-11

    The characteristic of interaction with various enzymes and processivity-promoting nature during DNA replication makes β-clamp an important drug target. Helicobacter pylori ( H. pylori ) have several unique features in DNA replication machinery that makes it different from other microorganisms. To find out whether difference in DNA replication proteins behavior accounts for any difference in drug response when compared to E. coli , in the present study, we have tested E. coli β-clamp inhibitor molecules against H. pylori β-clamp. Various approaches were used to test the binding of inhibitors to H. pylori β-clamp including docking, surface competition assay, complex structure determination, as well as antimicrobial assay. Out of five shortlisted inhibitor molecules on the basis of docking score, three molecules, 5-chloroisatin, carprofen, and 3,4-difluorobenzamide were co-crystallized with H. pylori β-clamp and the structures show that they bind at the protein-protein interaction site as expected. In vivo studies showed only two molecules, 5-chloroisatin, and 3,4-difluorobenzamide inhibited the growth of the pylori with MIC values in micro molar range, which is better than the inhibitory effect of the same drugs on E. coli . Therefore, the evaluation of such drugs against H. pylori may explore the possibility to use to generate species-specific pharmacophore for development of new drugs against H. pylori .

  10. Site Selection for Hvdc Ground Electrodes

    Science.gov (United States)

    Freire, P. F.; Pereira, S. Y.

    2014-12-01

    High-Voltage Direct Current (HVDC) transmission systems are composed of a bipole transmission line with a converter substation at each end. Each substation may be equipped with a HVDC ground electrode, which is a wide area (up to 1 km Ø) and deep (from 3 to 100m) electrical grounding. When in normal operation, the ground electrode will dissipate in the soil the unbalance of the bipole (~1.5% of the rated current). When in monopolar operation with ground return, the HVDC electrode will inject in the soil the nominal pole continuous current, of about 2000 to 3000 Amperes, continuously for a period up to a few hours. HVDC ground electrodes site selection is a work based on extensive geophysical and geological surveys, in order to attend the desired design requirements established for the electrodes, considering both its operational conditions (maximum soil temperature, working life, local soil voltage gradients etc.) and the interference effects on the installations located up to 50 km away. This poster presents the geophysical investigations conducted primarily for the electrodes site selection, and subsequently for the development of the crust resistivity model, which will be used for the interference studies. A preliminary site selection is conducted, based on general geographical and geological criteria. Subsequently, the geology of each chosen area is surveyed in detail, by means of electromagnetic/electrical geophysical techniques, such as magnetotelluric (deep), TDEM (near-surface) and electroresistivity (shallow). Other complementary geologic and geotechnical surveys are conducted, such as wells drilling (for geotechnical characterization, measurement of the water table depth and water flow, and electromagnetic profiling), and soil and water sampling (for measurement of thermal parameters and evaluation of electrosmosis risk). The site evaluation is a dynamic process along the surveys, and some sites will be discarded. For the two or three final sites, the

  11. Experimental and theoretical investigation of an impact vibration harvester with triboelectric transduction

    Science.gov (United States)

    Ibrahim, Alwathiqbellah; Ramini, Abdallah; Towfighian, Shahrzad

    2018-03-01

    There has been remarkable interest in triboelectric mechanisms because of their high efficiency, wide availability, and low-cost generation of sustainable power. Using impact vibrations, we introduce piece-wise stiffness to the system to enlarge frequency bandwidth. The triboelectric layers consist of Aluminum, which also serves as an electrode, and Polydimethylsiloxane (PDMS) with micro semi-cylindrical patterns. At the bottom of the PDMS layer, there is another Al electrode. The layers are sandwiched between the center mass of a clamped-clamped beam and its base. The center mass enhances the impact force on the triboelectric layers subjected to external vibrations. Upon impact, alternating current, caused by the contact electrification and electrostatic induction, flows between the Al electrodes. Because of the impact, the equivalent stiffness of the structure increases and as a result, the frequency bandwidth gets wider. The output voltage and power reach as large as 5.5 V, 15 μW, respectively at 0.8 g vibrational amplitude. In addition, we report how the surface charge density increases with the excitation levels. The analysis delineates the interactions between impact vibrations and triboelectric transductions. The ability of the system to achieve wider bandwidth paves the way for efficient triboelectric vibrational energy harvesters.

  12. Influence of a pulse duration of high-voltage supply on the efficiency of ozone synthesis in the 'needle-plane' electrode system

    International Nuclear Information System (INIS)

    Golota, V.I.; Zavada, L.M.; Karas, V.I.; Kotjukov, O.V.; Poliakov, O.V.; Pugach, S.G.

    2007-01-01

    We present the results of studies of the electrodynamic characteristics of a barrier less discharge with electrodes of the 'needle-plane' type and a high-voltage pulse of positive polarity, being applied to the edge electrode. The efficiency of ozone synthesis is determined as a function of the pulse duration and repetition rate. It is shown that the electrodynamic characteristics of the discharge and the effectiveness of ozone synthesis in oxygen-containing gas mixtures essentially depend on the parameters of the pulse supply

  13. Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

    International Nuclear Information System (INIS)

    Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

    1988-01-01

    A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

  14. Harmonic elimination technique for a single-phase multilevel converter with unequal DC link voltage levels

    DEFF Research Database (Denmark)

    Ghasemi, N.; Zare, F.; Boora, A.A.

    2012-01-01

    Multilevel converters, because of the benefits they attract in generating high quality output voltage, are used in several applications. Various modulation and control techniques are introduced by several researchers to control the output voltage of the multilevel converters like space vector...... modulation and harmonic elimination (HE) methods. Multilevel converters may have a DC link with equal or unequal DC voltages. In this study a new HE technique based on the HE method is proposed for multilevel converters with unequal DC link voltage. The DC link voltage levels are considered as additional...

  15. Small area analysis using micro-diffraction techniques

    International Nuclear Information System (INIS)

    Goehner, Raymond P.; Tissot, Ralph G. Jr.; Michael, Joseph R.

    2000-01-01

    An overall trend toward smaller electronic packages and devices makes it increasingly important and difficult to obtain meaningful diffraction information from small areas. X-ray micro-diffraction, electron back-scattered diffraction (EBSD) and Kossel are micro-diffraction techniques used for crystallographic analysis including texture, phase identification and strain measurements. X-ray micro-diffraction primarily is used for phase analysis and residual strain measurements. X-ray micro-diffraction primarily is used for phase analysis and residual strain measurements of areas between 10 microm to 100 microm. For areas this small glass capillary optics are used for producing a usable collimated x-ray beam. These optics are designed to reflect x-rays below the critical angle therefore allowing for larger solid acceptance angle at the x-ray source resulting in brighter smaller x-ray beams. The determination of residual strain using micro-diffraction techniques is very important to the semiconductor industry. Residual stresses have caused voiding of the interconnect metal which then destroys electrical continuity. Being able to determine the residual stress helps industry to predict failures from the aging effects of interconnects due to this stress voiding. Stress measurements would be impossible using a conventional x-ray diffractometer; however, utilizing a 30 microm glass capillary these small areas are readily assessable for analysis. Kossel produces a wide angle diffraction pattern from fluorescent x-rays generated in the sample by an e-beam in a SEM. This technique can yield very precise lattice parameters for determining strain. Fig. 2 shows a Kossel pattern from a Ni specimen. Phase analysis on small areas is also possible using an energy dispersive spectrometer (EBSD) and x-ray micro-diffraction techniques. EBSD has the advantage of allowing the user to observe the area of interest using the excellent imaging capabilities of the SEM. An EDS detector has been

  16. Electrode design for direct-methane micro-tubular solid oxide fuel cell (MT-SOFC)

    Science.gov (United States)

    Rabuni, Mohamad Fairus; Li, Tao; Punmeechao, Puvich; Li, Kang

    2018-04-01

    Herein, a micro-structured electrode design has been developed via a modified phase-inversion method. A thin electrolyte integrated with a highly porous anode scaffold has been fabricated in a single-step process and developed into a complete fuel cell for direct methane (CH4) utilisation. A continuous and well-dispersed layer of copper-ceria (Cu-CeO2) was incorporated inside the micro-channels of the anode scaffold. A complete cell was investigated for direct CH4 utilisation. The well-organised micro-channels and nano-structured Cu-CeO2 anode contributed to an increase in electrochemical reaction sites that promoted charge-transfer as well as facilitating gaseous fuel distribution, resulting in outstanding performances. Excellent electrochemical performances have been achieved in both hydrogen (H2) and CH4 operation. The power density of 0.16 Wcm-2 at 750 °C with dry CH4 as fuel is one of the highest ever reported values for similar anode materials.

  17. Synthesis of Pt nanoparticles as catalysts of oxygen reduction with microbubble-assisted low-voltage and low-frequency solution plasma processing

    Science.gov (United States)

    Horiguchi, Genki; Chikaoka, Yu; Shiroishi, Hidenobu; Kosaka, Shinpei; Saito, Morihiro; Kameta, Naohiro; Matsuda, Naoki

    2018-04-01

    In the preparation of metallic nanoparticles by conventional solution plasma (SP) techniques, unstable plasma emission becomes an issue when the voltage and frequency of the waves applied between two electrodes placed in solution are lowered to avoid the boiling of the solution. In this study, we confirm that, in the presence of microbubbles, plasma is generated stably at low voltage (440 V) and low frequency (50-100 Hz) and small-size (≤10 nm) Pt nanoparticles (PtNPs) are synthesized in succession using a flow cell. The smallest PtNPs, ∼3.3 nm in diameter, are obtained using half-wave rectification, a tungsten wire anode, and a platinum wire cathode. The PtNPs are characterized by X-ray diffraction, X-ray photoelectron spectroscopy, transmission electron microscopy, and thermogravimeter-differential thermal analysis. The oxygen reduction reaction (ORR) is investigated in 0.1 M HClO4 solution on carbon-supported PtNPs using a rotating ring-disk electrode. The catalytic activities per initial electrochemical active surface area of the carbon-supported PtNPs synthesized employing the low-voltage, low-frequency (LVLF)-SP technique is higher than that of the commercially available 20 wt% Pt on Vulcan XC-72R. These results indicate that the LVLF-SP technique is a promising approach to producing carbon-supported PtNPs that catalyze ORR with low energy consumption.

  18. A Comparison Study of Sinusoidal PWM and Space Vector PWM Techniques for Voltage Source Inverter

    Directory of Open Access Journals (Sweden)

    Ömer Türksoy

    2017-06-01

    Full Text Available In this paper, the methods used to control voltage source inverters which have been intensively investigated in recent years are compared. Although the most efficient result is obtained with the least number of switching elements in the inverter topologies, the method used in the switching is at least as effective as the topology. Besides, the selected switching method to control the inverter will play an effective role in suppressing harmonic components while producing the ideal output voltage. There are many derivatives of pulse width modulation techniques that are commonly used to control voltage source inverters. Some of widespread methods are sinusoidal pulse width modulation and space vector pulse width modulation techniques. These modulation techniques used for generating variable frequency and amplitude output voltage in voltage source inverters, have been simulated by using MATLAB/SIMULINK. And, the total harmonic distortions of the output voltages are compared. As a result of simulation studies, sinusoidal pulse width modulation has been found to have more total harmonic distortion in output voltages of voltage source inverters in the simulation. Space vector pulse width modulation has been shown to produce a more efficient output voltage with less total harmonic distortion.

  19. Chromatic aberrations of two-electrode transaxial mirrors

    International Nuclear Information System (INIS)

    Bejzina, L.G.; Karetskaya, S.P.

    1991-01-01

    Second order chromatic aberrations of electrostatic two-electrode transaxial mirrors in case the beam axial trajectory of charged particles is curvilinear are considered. Interrelations between coefficients of linear and angular chromatic aberrations are determined. Values of these coefficients for concave and convex transaxial mirrors with plane electrodes in dependence on potential ratio on electrodes by different onnular clearance radii are presented

  20. Physical degradation of membrane electrode assemblies undergoing freeze/thaw cycling: Micro-structure effects

    Energy Technology Data Exchange (ETDEWEB)

    Kim, S. [Fuel Cell Dynamics and Diagnostics Laboratory, Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, PA 16802 (United States); Research and Development Division, Hyundai Motor Company, Yongin 446-912 (Korea); Mench, M.M. [Fuel Cell Dynamics and Diagnostics Laboratory, Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, PA 16802 (United States)

    2007-11-22

    The objective of this work is to investigate physical damage of polymer electrolyte fuel cell (PEFC) materials subjected to freeze/thaw cycling. Effects of membrane electrode assembly micro-structures (catalyst layer cracking, membrane thickness, and membrane reinforcement) and diffusion media with micro-porous layers were analyzed by comparing scanning electron microscopy images of freeze/thaw cycled samples (-40 C/70 C) with those of virgin material and thermal cycled samples without freezing (5 C/70 C). Ex situ testing performed in this study has revealed a strong direction for the material choices in the PEFC and confirmed the previous computational model in the literature [S. He, M.M. Mench, J. Electrochem. Soc., 153 (2006) A1724-A1731; S. He, S.H. Kim, M.M. Mench, J. Electrochem. Soc., in press]. Specifically, the membrane electrode assemblies were found to be a source of water that can damage the catalyst layers under freeze/thaw conditions. Damage was found to occur almost exclusively under the channel, and not under the land (the graphite that touches the diffusion media). Conceptually, the best material to mitigate freeze-damage is a crack free virgin catalyst layer on a reinforced membrane that is as thin as possible, protected by a stiff diffusion media. (author)

  1. Methods for Specific Electrode Resistance Measurement during Transcranial Direct Current Stimulation

    Science.gov (United States)

    Khadka, Niranjan; Rahman, Asif; Sarantos, Chris; Truong, Dennis Q.; Bikson, Marom

    2014-01-01

    Background Transcranial Direct Current Stimulation (tDCS) is investigated to treat a wide range of neuropsychiatric disorders, for rehabilitation, and for enhancing cognitive performance. The monitoring of electrode resistance before and during tDCS is considered important for tolerability and safety, where an unusually high resistance is indicative of undesired electrode or poor skin contact conditions. Conventional resistance measurement methods do not isolate individual electrode resistance but rather measures overall voltage. Moreover, for HD-tDCS devices, cross talk across electrodes makes concurrent resistance monitoring unreliable. Objective We propose a novel method for monitoring of the individual electrode resistance during tDCS, using a super-position of direct current with a test-signal (low-intensity and low-frequency sinusoids with electrode– specific frequencies) and a single sentinel electrode (not used for DC). Methods To validate this methodology, we developed lumped-parameter models of two and multi-electrode tDCS. Approaches with and without a sentinel electrode were solved and underlying assumptions identified. Assumptions were tested and parameterized in healthy participants using forearm stimulation combining tDCS (2 mA) and sinusoidal test-signals (38 μA and 76 μA peak to peak at 1 Hz, 10 Hz, and 100 Hz) and an in vitro test (where varied electrode failure modes were created). DC and AC component voltages across the electrodes were compared and participants were asked to rate subjective pain. Results A sentinel electrode is required to isolate electrode resistance in a two-electrode tDCS system. For multi-electrode resistance tracking, cross talk was aggravated with electrode proximity and current/resistance mismatches, but could be corrected using proposed approaches. Average voltage and average pain scores were not significantly different across test current intensities and frequencies (two-way repeated measures ANOVA) indicating the

  2. Insulating electrodes: a review on biopotential front ends for dielectric skin–electrode interfaces

    International Nuclear Information System (INIS)

    Spinelli, Enrique; Haberman, Marcelo

    2010-01-01

    Insulating electrodes, also known as capacitive electrodes, allow acquiring biopotentials without galvanic contact with the body. They operate with displacement currents instead of real charge currents, and the electrolytic electrode–skin interface is replaced by a dielectric film. The use of insulating electrodes is not the end of electrode interface problems but the beginning of new ones: coupling capacitances are of the order of pF calling for ultra-high input impedance amplifiers and careful biasing, guarding and shielding techniques. In this work, the general requirements of front ends for capacitive electrodes are presented and the different contributions to the overall noise are discussed and estimated. This analysis yields that noise bounds depend on features of the available devices as current and voltage noise, but the final noise level also depends on parasitic capacitances, requiring a careful shield and printed circuit design. When the dielectric layer is placed on the skin, the present-day amplifiers allow achieving noise levels similar to those provided by wet electrodes. Furthermore, capacitive electrode technology allows acquiring high quality ECG signals through thin clothes. A prototype front end for capacitive electrodes was built and tested. ECG signals were acquired with these electrodes in direct contact with the skin and also through cotton clothes 350 µm thick. They were compared with simultaneously acquired signals by means of wet electrodes and no significant differences were observed between both output signals

  3. Design and experimental research of a novel inchworm type piezo-driven rotary actuator with the changeable clamping radius.

    Science.gov (United States)

    Zhao, Hongwei; Fu, Lu; Ren, Luquan; Huang, Hu; Fan, Zunqiang; Li, Jianping; Qu, Han

    2013-01-01

    In this paper, a novel piezo-driven rotary actuator with the changeable clamping radius is developed based on the inchworm principle. This actuator mainly utilizes three piezoelectric actuators, a flexible gripper, a clamping block, and a rotor to achieve large stroke rotation with high resolution. The design process of the flexible gripper consisting of the driving unit and the clamping unit is described. Lever-type mechanisms were used to amplify the micro clamping displacements. The amplifying factor and parasitic displacement of the lever-type mechanism in the clamping unit was analyzed theoretically and experimentally. In order to investigate the rotation characteristics of the actuator, a series of experiments was carried out. Experimental results indicate that the actuator can rotate at a speed of 77,488 μrad/s with a driving frequency of 167 Hz. The rotation resolution and maximum load torque of the actuator are 0.25 μrad and 37 N mm, respectively. The gripper is movable along the z direction based on an elevating platform, and the clamping radius can change from 10.6 mm to 25 mm. Experimental results confirm that the actuator can achieve different rotation speeds by changing the clamping radius.

  4. The plastic instability of clamped-clamped conical thin-walled pipe reducers

    International Nuclear Information System (INIS)

    Awad, Ibrahim; Saleh, Ch.A.R.; Ragab, A.R.

    2016-01-01

    The analytical study for plastic deformation of clamped–clamped conical reducer pipe under internal pressure does not deduce a closed form expression for the pressure at plastic instability. The presented study employs finite element analysis (FEA) to estimate the internal pressure at instability for conical reducers made of different materials and having different dimensional configurations. Forty dimensional configurations, classified as medium type, and five types of materials have been included in the analysis using ABAQUS package. A correlation expression is derived by nonlinear regression to predict the instability pressure. The proposed expression is verified for other dimensional configurations out of the above used forty models and for other materials. Experiments have been conducted by pressurizing conical clamped-clamped reducers until bursting in order to verify the finite element models. Comparison of instability pressures, strains and deflections at specific points along the conical surface shows satisfactory agreement between analysis and experiments. - Highlights: • This study offers a parametric study of the plastic instability pressure of clamped-clamped conical reducers. • A closed form analytical expression for the instability pressure is derived by using nonlinear regression. • The finite element analysis is validated by conducting bursting tests.

  5. High performance control strategy for single-phase three-level neutral-point-clamped traction four-quadrant converters

    DEFF Research Database (Denmark)

    Kejian, Song; Konstantinou, Georgios; Jing, Li

    2017-01-01

    Operational data from Chinese railways indicate a number of challenges for traction four-quadrant converter (4QC) control including low-order voltage and current harmonics and reference tracking. A control strategy for a single-phase three-level neutral-point-clamped 4QC employed in the electric...

  6. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  7. Amperometric micro pH measurements in oxygenated saliva.

    Science.gov (United States)

    Chaisiwamongkhol, Korbua; Batchelor-McAuley, Christopher; Compton, Richard G

    2017-07-24

    An amperometric micro pH sensor has been developed based on the chemical oxidation of carbon fibre surfaces (diameter of 9 μm and length of ca. 1 mm) to enhance the population of surface quinone groups for the measurement of salivary pH. The pH analysis utilises the electrochemically reversible two-electron, two-proton behaviour of surface quinone groups on the micro-wire electrodes. A Nernstian response is observed across the pH range 2-8 which is the pH range of many biological fluids. We highlight the measurement of pH in small volumes of biological fluids without the need for oxygen removal and specifically the micro pH electrode is examined by measuring the pH of commercial synthetic saliva and authentic human saliva samples. The results correspond well with those obtained by using commercial glass pH electrodes on large volume samples.

  8. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  9. A theoretical analysis of the feasibility of a singularity-induced micro-electroporation system.

    Directory of Open Access Journals (Sweden)

    Gregory D Troszak

    Full Text Available Electroporation, the permeabilization of the cell membrane lipid bilayer due to a pulsed electric field, has important implications in the biotechnology, medicine, and food industries. Traditional macro and micro-electroporation devices have facing electrodes, and require significant potential differences to induce electroporation. The goal of this theoretical study is to investigate the feasibility of singularity-induced micro-electroporation; an electroporation configuration aimed at minimizing the potential differences required to induce electroporation by separating adjacent electrodes with a nanometer-scale insulator. In particular, this study aims to understand the effect of (1 insulator thickness and (2 electrode kinetics on electric field distributions in the singularity-induced micro-electroporation configuration. A non-dimensional primary current distribution model of the micro-electroporation channel shows that while increasing insulator thickness results in smaller electric field magnitudes, electroporation can still be performed with insulators thick enough to be made with microfabrication techniques. Furthermore, a secondary current distribution model of the singularity-induced micro-electroporation configuration with inert platinum electrodes and water electrolyte indicates that electrode kinetics do not inhibit charge transfer to the extent that prohibitively large potential differences are required to perform electroporation. These results indicate that singularity-induced micro-electroporation could be used to develop an electroporation system that consumes minimal power, making it suitable for remote applications such as the sterilization of water and other liquids.

  10. Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

    DEFF Research Database (Denmark)

    Micallef, A.; Apap, M.; Spitero-Stanies, C.

    2012-01-01

    This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

  11. Wearable Solid-State Supercapacitors Operating at High Working Voltage with a Flexible Nanocomposite Electrode.

    Science.gov (United States)

    Li, Xiaoyan; Wang, Jun; Zhao, Yaping; Ge, Fengyan; Komarneni, Sridhar; Cai, Zaisheng

    2016-10-05

    The proposed approach for fabricating ultralight self-sustained electrodes facilitates the structural integration of highly flexible carbon nanofibers, amino-modified multiwalled carbon nanotubes (AM-MWNT), and MnO 2 nanoflakes for potential use in wearable supercapacitors. Because of the higher orientation of AM-MWNT and the sublimation of terephthalic acid (PTA) in the carbonization process, freestanding electrodes could be realized with high porosity and flexibility and could possess remarkable electrochemical properties without using polymer substrates. Wearable symmetric solid-state supercapacitors were further assembled using a LiCl/PVA gel electrolyte, which exhibit a maximum energy density of 44.57 Wh/kg (at a power density of 337.1 W/kg) and a power density of 13330 W/kg (at an energy density of 19.64 Wh/kg) with a working voltage as high as 1.8 V. Due to the combination of several favorable traits such as flexibility, high energy density, and excellent electrochemical cyclability, the presently developed wearable supercapacitors with wide potential windows are expected to be useful for new kinds of portable electric devices.

  12. Characterization of Platinum Electrodes and In-situ Cell Confluency Measurement Based on Current Changes of Cell-Electrodes

    Directory of Open Access Journals (Sweden)

    Chin Fhong SOON

    2015-04-01

    Full Text Available This study aimed at the development of a biosensor to examine the growth confluency of human derived keratinocytes (HaCaT cell lines in-situ. The biosensor consists of a sputter- coated glass substrate with platinum patterns. Cells were grown on the conductive substrates and the confluency of the cells were monitored in-situ based on the conductivity changes of the substrates. Characterization of the cell proliferation and confluency were interrogated using electrical cell-substrate impedance sensing (ECIS techniques and current change of cells using a pico-ammeter. The investigation was followed by the electrical characterization of the platinum electrode (PE using a two probe I-V measurement system. The surface morphology of platinum electrodes were studied using an atomic force microscopy (AFM and the HaCaT cell morphology was studied using Field-Emission Scanning Electron Microscopy (FE-SEM. The microscopy results showed that the cells coupled and proliferated on the platinum electrodes. For monitoring the conductivity and impedance changes of the cell-electrode in-situ, the cover of a Petri dish was inserted with pogo pins to be in contact with the platinum electrodes. The impedance was sampled using the ECIS technique at a twenty-four hour interval. In our findings, the cell proliferation rate can be measured by observing the changes in capacitance or impedance measured at low ac frequencies ranged from 10 - 1 kHz. In good agreement, the current measured at micro-ampere range by the biosensor decreased as the cell coverage area increased over the time. Thus, the percent of cell confluence was shown inversely proportional to the current changes.

  13. Aging of electrochemical double layer capacitors with acetonitrile-based electrolyte at elevated voltages

    International Nuclear Information System (INIS)

    Ruch, P.W.; Cericola, D.; Foelske-Schmitz, A.; Koetz, R.; Wokaun, A.

    2010-01-01

    Laboratory-scale electrochemical capacitor cells with bound activated carbon electrodes and acetonitrile-based electrolyte were aged at various elevated constant cell voltages between 2.75 V and 4.0 V. During the constant voltage tests, the cell capacitance as well as the capacitance and resistance of each electrode was determined. Following each aging experiment, the cells were analyzed by means of electrochemical impedance spectroscopy, and the individual electrodes were characterized by gas adsorption and X-ray photoelectron spectroscopy. At cell voltages above 3.0 V, the positive electrode ages much faster than the negative. Both the capacitance loss and resistance increase of the cell could be totally attributed to the positive electrode. At cell voltages above 3.5 V also the negative electrode aged significantly. X-ray photoelectron spectroscopy indicated the presence of degradation products on the electrode surface with a much thicker layer on the positive electrode. Simultaneously, a significant decrease in electrode porosity could be detected by gas adsorption.

  14. Techniques for radiation measurements: Micro-dosimetry and dosimetry

    International Nuclear Information System (INIS)

    Waker, A. J.

    2006-01-01

    Experimental Micro-dosimetry is concerned with the determination of radiation quality and how this can be specified in terms of the distribution of energy deposition arising from the interaction of a radiation field with a particular target site. This paper discusses various techniques that have been developed to measure radiation energy deposition over the three orders of magnitude of site-size; nano-meter, micrometer and millimetre, which radiation biology suggests is required to fully account for radiation quality. Inevitably, much of the discussion will concern the use of tissue-equivalent proportional counters and variants of this device, but other technologies that have been studied, or are under development, for their potential in experimental Micro-dosimetry are also covered. Through an examination of some of the quantities used in radiation metrology and dosimetry the natural link with Micro-dosimetric techniques will be shown and the particular benefits of using Micro-dosimetric methods for dosimetry illustrated. (authors)

  15. Ion collection from laser-induced plasma by applying radio-frequency voltage

    International Nuclear Information System (INIS)

    Shibata, Takemasa; Ogura, Koichi

    1995-01-01

    Ions were collected on the electrodes from a laser resonance photoionized plasma by applying 1.8MHz radio-frequency voltage to the electrode. It was demonstrated that the ions are collected in a shorter time at the same kinetic energy of the collected ions compared with ion collection by applying DC voltage to the electrode. A simple one-dimensional model was extended for prediction of ion collection times in the cases of applications of not only the DC voltage but also the radio-frequency voltage. The ion collection times estimated using the simple one-dimensional model agreed with experimental values in both cases of DC and radio-frequency voltages. (author)

  16. Review on Micro- and Nanolithography Techniques and Their Applications

    Directory of Open Access Journals (Sweden)

    Werayut Srituravanich

    2012-01-01

    Full Text Available This article reviews major micro- and nanolithography techniques and their applications from commercial micro devices to emerging applications in nanoscale science and engineering. Micro- and nanolithography has been the key technology in manufacturing of integrated circuits and microchips in the semiconductor industry. Such a technology is also sparking a magnificent transformation of nanotechnology. The lithography techniques including photolithography, electron beam lithography, focused ion beam lithography, soft lithography, nanoimprint lithography and scanning probe lithography are discussed. Furthermore, their applications are reviewed and summarized into four major areas: electronics and microsystems, medical and biotech, optics and photonics, and environment and energy harvesting.

  17. Fabrication of Micro-Needle Electrodes for Bio-Signal Recording by a Magnetization-Induced Self-Assembly Method

    Directory of Open Access Journals (Sweden)

    Keyun Chen

    2016-09-01

    Full Text Available Micro-needle electrodes (MEs have attracted more and more attention for monitoring physiological electrical signals, including electrode-skin interface impedance (EII, electromyography (EMG and electrocardiography (ECG recording. A magnetization-induced self-assembling method (MSM was developed to fabricate a microneedle array (MA. A MA coated with Ti/Au film was assembled as a ME. The fracture and insertion properties of ME were tested by experiments. The bio-signal recording performance of the ME was measured and compared with a typical commercial wet electrode (Ag/AgCl electrode. The results show that the MA self-assembled from the magnetic droplet array under the sum of gravitational surface tension and magnetic potential energies. The ME had good toughness and could easily pierce rabbit skin without being broken or buckling. When the compression force applied on the ME was larger than 2 N, ME could stably record EII, which was a lower value than that measured by Ag/AgCl electrodes. EMG signals collected by ME varied along with the contraction of biceps brachii muscle. ME could record static ECG signals with a larger amplitude and dynamic ECG signals with more distinguishable features in comparison with a Ag/AgCl electrode, therefore, ME is an alternative electrode for bio-signal monitoring in some specific situations.

  18. Electrochemical surface plasmon resonance sensor based on two-electrode configuration

    International Nuclear Information System (INIS)

    Zhang, Bing; Dong, Wei; Wen, Yizhang; Pang, Kai; Wang, Xiaoping; Li, Yazhuo; Zhan, Shuyue

    2016-01-01

    To obtain detailed information about electrochemistry reactions, a two-electrode electrochemical surface plasmon resonance (EC-SPR) sensor has been proposed. We describe the theory of potential modulation for this novel sensor and determine the factors that can change the SPR resonance angle. The reference electrode in three-electrode configuration was eliminated, and comparing with several other electrode materials, activated carbon (AC) is employed as the suitable counter electrode for its potential stability. Just like three-electrode configuration, the simpler AC two-electrode system can also obtain detailed information about the electrochemical reactions. (paper)

  19. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  20. Modulation Methods for Three-level Neutral-Point-Clamped Inverter Achieving Stress Redistribution under Moderate Modulation Index

    DEFF Research Database (Denmark)

    Ma, Ke; Blaabjerg, Frede

    2016-01-01

    This letter investigates the loss and thermal behaviors of a three-level neutral-point-clamped (3L-NPC) inverter undergoing moderate modulation index, which is typically presented during minor voltage sags of the power grid or speed changes of the electric machines. A series of new space vector m...

  1. Safety of minimally invasive mitral valve surgery without aortic cross-clamp.

    Science.gov (United States)

    Umakanthan, Ramanan; Leacche, Marzia; Petracek, Michael R; Kumar, Sathappan; Solenkova, Nataliya V; Kaiser, Clayton A; Greelish, James P; Balaguer, Jorge M; Ahmad, Rashid M; Ball, Stephen K; Hoff, Steven J; Absi, Tarek S; Kim, Betty S; Byrne, John G

    2008-05-01

    We developed a technique for open heart surgery through a small (5 cm) right-anterolateral thoracotomy without aortic cross-clamp. One hundred and ninety-five consecutive patients (103 male and 92 female), age 69 +/- 8 years, underwent surgery between January 2006 and July 2007. Mean preoperative New York Heart Association function class was 2.2 +/- 0.7. Thirty-five patients (18%) had an ejection fraction 0.35 or less. Cardiopulmonary bypass was instituted through femoral (176 of 195, 90%), axillary (18 of 195, 9%), or direct aortic (1 of 195, 0.5%) cannulation. Under cold fibrillatory arrest (mean temperature 28.2 degrees C) without aortic cross-clamp, mitral valve repair (72 of 195, 37%), mitral valve replacement (117 of 195, 60%), or other (6 of 195, 3%) procedures were performed. Concomitant procedures included maze (45 of 195, 23%), patent foramen ovale closure (42 of 195, 22%) and tricuspid valve repair (16 of 195, 8%), or replacement (4 of 195, 2%). Thirty-day mortality was 3% (6 of 195). Duration of fibrillatory arrest, cardiopulmonary bypass, and "skin to skin" surgery were 88 +/- 32, 118 +/- 52, and 280 +/- 78 minutes, respectively. Ten patients (5%) underwent reexploration for bleeding and 44% did not receive any blood transfusions. Six patients (3%) sustained a postoperative stroke, eight (4%) developed low cardiac output syndrome, and two (1%) developed renal failure requiring hemodialysis. Mean length of hospital stay was 7 +/- 4.8 days. This simplified technique of minimally invasive open heart surgery is safe and easily reproducible. Fibrillatory arrest without aortic cross-clamping, with coronary perfusion against an intact aortic valve, does not increase the risk of stroke or low cardiac output. It may be particularly useful in higher risk patients in whom sternotomy with aortic clamping is less desirable.

  2. Two simple examples for the micro-nano integration of nanowires as electronic device elements

    International Nuclear Information System (INIS)

    Adelung, Rainer

    2011-01-01

    As a part of the conference talk about the mass fabrication and applications of nanostructures, the aim of this paper is to review and compare two approaches for the simple fabrication and integration and of nanostructures into Si-based microchips. The purpose of the integration is the utilization of the different and advanced electronic properties of nanowires. The first method is based on a fracture approach, that integrates nanowires bound to a Si substrate between micro electrodes. These are arrange in a horizontal manner, the second approach allows to integrate free standing nanowires and even 3 dimensional nanowire networks in the chip. As an example for the electronic properties of the nano-micro integrated structures the UV light sensitivity is sown here.

  3. Fabrication of TiNb{sub 2}O{sub 7} thin film electrodes for Li-ion micro-batteries by pulsed laser deposition

    Energy Technology Data Exchange (ETDEWEB)

    Daramalla, V. [Materials Research Centre, Indian Institute of Science, Bengalore 560012 (India); Penki, Tirupathi Rao; Munichandraiah, N. [Department of Inorganic and Physical Chemistry, Indian Institute of Science, Bengalore 560012 (India); Krupanidhi, S.B., E-mail: sbk@mrc.iisc.ernet.in [Materials Research Centre, Indian Institute of Science, Bengalore 560012 (India)

    2016-11-15

    Graphical abstract: The TiNb{sub 2}O{sub 7} thin film electrodes as anode material in Li-ion rechargeable micro-batteries are successfully demonstrated. The pulsed laser deposited TiNb{sub 2}O{sub 7} thin film electrode delivers high discharge specific capacity of 143 μAh μm{sup −1} cm{sup −2} at 50 μA cm{sup −2} current density, with 92% coulombic efficiency. The thin films are very stable in crystal structure, with good fast reversible reaction at average Li-insertion voltage 1.65 V. - Highlights: • TiNb{sub 2}O{sub 7} thin films fabricated by pulsed laser deposition. • TiNb{sub 2}O{sub 7} as anode thin films demonstrated successfully. • High discharge specific capacity with 92% coulombic efficiency. • Excellent crystal stability and good reversible reaction. - Abstract: Pulsed laser deposited TiNb{sub 2}O{sub 7} thin films are demonstrated as anode materials in rechargeable Li-ion micro-batteries. The monoclinic and chemically pure TiNb{sub 2}O{sub 7} films in different morphologies were successfully deposited at 750 °C. The single phase formation was confirmed by grazing incident X-ray diffraction, micro-Raman spectroscopy, high resolution transmission electron microscopy, field emission scanning electron microscopy and X-ray photoelectron spectroscopy. The oxygen partial pressure during the deposition significantly influenced the properties of TiNb{sub 2}O{sub 7} films. The TiNb{sub 2}O{sub 7} thin films exhibited excellent stability with fast kinetics reversible reaction. The TiNb{sub 2}O{sub 7} films showed initial discharge specific capacity of 176, 143 μAh μm{sup −1} cm{sup −2} at 30, 50 μA cm{sup −2} current densities respectively with 92% coulombic efficiency in a non-aqueous electrolyte consisting of Li{sup +} ions. The high discharge specific capacity of TiNb{sub 2}O{sub 7} thin films may be attributed to nanometer grain size with high roughness which offers high surface area for Li-diffusion during charge and discharge

  4. Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2014-01-01

    Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.

  5. Development of innovative micro-pattern gaseous detectors with resistive electrodes and first results of their applications

    CERN Document Server

    Di Mauro, A; Martinengo, P; Nappi, E; Oliveira, R; Peskov, Vladimir; Periale, L; Picchi, P; Pietropaolo, F; Rodionov, I; Santiard, Jean-Claude

    2007-01-01

    The paper summarizes our latest progress in the development of newly introduced micro pattern gaseous detectors with resistive electrodes. These resistive electrodes protect the detector and the front-end electronics in case of occasional discharges and thus make the detectors very robust and reliable in operation. As an example, we describe in greater detail a new recently developed GEM-like detector, fully spark-protected with electrodes made of resistive kapton. We discovered that all resistive layers used in these studies (including kapton), that are coated with photosensitive layers, such as CsI, can be used as efficient photo cathodes for detectors operating in a pulse counting mode. We describe the first applications of such detectors combined with CsI or SbCs photo cathodes for the detection of UV photons at room and cryogenic temperatures.

  6. Poly(3,4-ethylene dioxythiophene (PEDOT as a micro-neural interface material for electrostimulation

    Directory of Open Access Journals (Sweden)

    Seth J Wilks

    2009-06-01

    Full Text Available Chronic microstimulation-based devices are being investigated to treat conditions such as blindness, deafness, pain, paralysis and epilepsy. Small area electrodes are desired to achieve high selectivity. However, a major trade-off with electrode miniaturization is an increase in impedance and charge density requirements. Thus, the development of novel materials with lower interfacial impedance and enhanced charge storage capacity is essential for the development of micro-neural interface-based neuroprostheses. In this report, we study the use of conducting polymer poly(3,4-ethylene dioxythiophene (PEDOT as a neural interface material for microstimulation of small area iridium electrodes on silicon-substrate arrays. Characterized by electrochemical impedance spectroscopy, electrodeposition of PEDOT results in lower interfacial impedance at physiologically-relevant frequencies, with the 1kHz impedance magnitude being 23.3 ± 0.7 kΩ compared to 113.6 ± 3.5 kΩ for iridium oxide (IrOx on 177μm2 sites. Further, PEDOT exhibits enhanced charge storage capacity at 75.6 ± 5.4 mC/cm2 compared to 28.8 ± 0.3 mC/cm2 for IrOx, characterized by cyclic voltammetry (50 mV/s. These improvements at the electrode interface were corroborated by observation of the voltage excursions that result from constant current pulsing. The PEDOT coatings provide both a lower amplitude voltage and a more ohmic representation of the applied current compared to IrOx. During repetitive pulsing, PEDOT-coated electrodes show stable performance and little change in electrical properties, even at relatively high current densities which cause IrOx instability. These findings support the potential of PEDOT coatings as a micro-neural interface material for electrostimulation.

  7. Characterization of impact materials around Barringer Meteor Crater by micro-PIXE and micro-SRXRF techniques

    Energy Technology Data Exchange (ETDEWEB)

    Uzonyi, I. E-mail: uzonyi@atomki.hu; Szoeor, Gy.; Rozsa, P.; Vekemans, B.; Vincze, L.; Adams, F.; Drakopoulos, M.; Somogyi, A.; Kiss, A.Z

    2004-06-01

    A combined micro-PIXE and micro-SRXRF method has been tested successfully for the characterization of impact materials collected at the well-known Barringer Meteor Crater. The micro-PIXE technique proved to be sensitive in the Z{<=}28 atomic number region while the micro-SRXRF above Fe especially for the siderophile elements. Quantitative analysis has become available for about 40 elements by these complementary methods providing new perspectives for the interpretation of the formation mechanism of impact metamorphosed objects.

  8. Design and Comparison of Cascaded H-Bridge, Modular Multilevel Converter, and 5-L Active Neutral Point Clamped Topologies for Motor Drive Applications

    Energy Technology Data Exchange (ETDEWEB)

    Marzoughi, Alinaghi [Virginia Tech, Blacksburg, VA (United States). Center for Power Electronics Systems; Burgos, Rolando [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Boroyevich, Dushan [Virginia Tech, Blacksburg, VA (United States). Bradley Dept. of Electrical and Computer Engineering; Xue, Yaosuo [Siemens Corporate Research, Princeton, NJ (United States). Power Electronics Dept.

    2018-03-01

    This paper presents the design procedure and comparison of converters currently used in medium-voltage high-power motor drive applications. For this purpose, the cascaded H-bridge (CHB), modular multilevel converter (MMC), and five-level active neutral point clamped (5-L ANPC) topologies are targeted. The design is performed using 1.7-kV insulated gate bipolar transistors (IGBTs) for CHB and MMC converters, and utilizing 3.3- and 4.5-kV IGBTs for 5-L ANPC topology as normally done in industry. The comparison is done between the designed converter topologies at three different voltage levels (4.16, 6.9, and 13.8 kV, with only the first two voltage levels in case of the 5-L ANPC) and two different power levels (3 and 5 MVA), in order to elucidate the dependence of different parameters on voltage and power rating. Finally, the comparison is done from several points of view such as efficiency, capacitive energy storage, semiconductor utilization, parts count (for measure of reliability), and power density.

  9. Insulated pipe clamp design

    International Nuclear Information System (INIS)

    Anderson, M.J.; Hyde, L.L.; Wagner, S.E.; Severud, L.K.

    1980-01-01

    Thin wall large diameter piping for breeder reactor plants can be subjected to significant thermal shocks during reactor scrams and other upset events. On the Fast Flux Test Facility, the addition of thick clamps directly on the piping was undesired because the differential metal temperatures between the pipe wall and the clamp could have significantly reduced the pipe thermal fatigue life cycle capabilities. Accordingly, an insulated pipe clamp design concept was developed. 5 refs

  10. Water Electrolysis at Different Current - Voltage Regimes

    International Nuclear Information System (INIS)

    Kleperis, J.; Blums, J.; Vanags, M.

    2007-01-01

    Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)

  11. Theoretical and experimental nonlinear dynamics of a clamped-clamped beam MEMS resonator

    NARCIS (Netherlands)

    Mestrom, R.M.C.; Fey, R.H.B.; Nijmeijer, H.

    2008-01-01

    Microelectromechanical resonators feature nonlineardynamic responses. A first-principles based modeling approach is proposed for a clamped-clamped beam resonator. Starting from the partial differential equation for the beam including geometric and electrostatic nonlinear effects, a reduced-order

  12. Optimization of Contact Force and Pull-in Voltage for Series based MEMS Switch

    Directory of Open Access Journals (Sweden)

    Abhijeet KSHIRSAGAR

    2010-04-01

    Full Text Available Cantilever based metal-to-metal contact type MEMS series switch has many applications namely in RF MEMS, Power MEMS etc. A typical MEMS switch consists of a cantilever as actuating element to make the contact between the two metal terminals of the switch. The cantilever is pulled down by applying a pull-in voltage to the control electrode that is located below the middle portion of the cantilever while only the tip portion of the cantilever makes contact between the two terminals. Detailed analysis of bending of the cantilever for different pull-in voltages reveals some interesting facts. At low pull-in voltage the cantilever tip barely touches the two terminals, thus resulting in very less contact area. To increase contact area a very high pull-in voltage is applied, but it lifts the tip from the free end due to concave curving of the cantilever in the middle region of the cantilever where the electrode is located. Again it results in less contact area. Furthermore, the high pull-in voltage produces large stress at the base of the cantilever close to the anchor. Therefore, an optimum, pull-in voltage must exist at which the concave curving is eliminated and contact area is maximum. In this paper authors report the finding of optimum contact force and pull-in voltage.

  13. Facile synthesis of nanostructured transition metal oxides as electrodes for Li-ion batteries

    Science.gov (United States)

    Opra, Denis P.; Gnedenkov, Sergey V.; Sokolov, Alexander A.; Minaev, Alexander N.; Kuryavyi, Valery G.; Sinebryukhov, Sergey L.

    2017-09-01

    At all times, energy storage is one of the greatest scientific challenge. Recently, Li-ion batteries are under special attention due to high working voltage, long cycle life, low self-discharge, reliability, no-memory effect. However, commercial LIBs usage in medium- and large-scale energy storage are limited by the capacity of lithiated metal oxide cathode and unsafety of graphite anode at high-rate charge. In this way, new electrode materials with higher electrochemical performance should be designed to satisfy a requirement in both energy and power. As it known, nanostructured transition metal oxides are promising electrode materials because of their elevated specific capacity and high potential vs. Li/Li+. In this work, the perspective of an original facile technique of pulsed high-voltage plasma discharge in synthesis of nanostructured transition metal oxides as electrodes for lithium-ion batteries has been demonstrated.

  14. Suspended polytetrafluoroethylene nanostructure electret film in dual variable cavities for self-powered micro-shock sensing

    Science.gov (United States)

    Zhu, Jianxiong; Chen, Cong; Guo, Xiaoyu

    2018-04-01

    We report a suspended polytetrafluoroethylene (PTFE) nanostructure electret film in dual variable cavities for a self-powered micro-shock sensing application. The prototype contained series variable air cavities, a suspended nanostructure PTFE electret film and independent electrode films. The charges on the suspended nanostructure PTFE electret film provided the electrostatic field around the electret film in the series variable air cavities. When the reported device was driven by a micro-shock pressure, the inducted electrostatic charges on both the top and bottom electrodes would vary as the micro-shock pressing or releasing. Experimental results showed that the maximum of a short-circuit current density (J sc ) and an open-circuit voltage (V oc ) reached 3 ± 0.1 nA cm‑2 and 3.6 ± 0.1 V, respectively. It was found that the parameter J sc was more advantageous in identifying stronger shocks (parameter acceleration a bigger than 0.1 m s‑2), whereas the parameter V oc was more sensitive for weaker shocks, such as acceleration a smaller than 0.1 m s‑2. Moreover, finger continuous micro-shock pressure taps application was used to demonstrate the mechanical energy conversion performance with 4.5 ± 0.2 V open-circuit voltages. The research on the nanostructure electret PTFE film in series dual variable air cavities not only gave us a fresh idea about the principle and design of the shocking sensor, but also provided an easy fabrication and a low cost shocking sensor for the Internet of Things (IoT) systems.

  15. A novel voltage clamp circuit for the measurement of transistor dynamic on-resistance

    NARCIS (Netherlands)

    Gelagaev, R.; Jacqmaer, P.; Everts, J.; Driesen, Johan

    2012-01-01

    For determining the dynamic on-resistance Rdyn,on of a power transistor, the voltage and current waveforms have to be measured during the switching operation. In measurements of voltage waveforms, using an oscilloscope, the characteristics of an amplifier inside the oscilloscope are distorted when

  16. Trace vanadium analysis by catalytic adsorptive stripping voltammetry using mercury-coated micro-wire and polystyrene-coated bismuth film electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Dansby-Sparks, Royce; Chambers, James Q. [Department of Chemistry, University of Tennessee, Knoxville, TN 37996-1600 (United States); Xue Ziling, E-mail: xue@ion.chem.utk.edu [Department of Chemistry, University of Tennessee, Knoxville, TN 37996-1600 (United States)

    2009-06-08

    An electrochemical technique has been developed for ultra-trace (ng L{sup -1}) vanadium (V) measurement. Catalytic adsorptive stripping voltammetry for V analysis was developed at mercury-coated gold micro-wire electrodes (MWEs, 100 {mu}m) in the presence of gallic acid (GA) and bromate ion. A potential of -0.275 V (vs Ag/AgCl) was used to accumulate the complex in acetate buffer (pH 5.0) at the electrode surface followed by a differential pulse voltammetric scan. Parameters affecting the electrochemical response, including pH, concentration of GA and bromate, deposition potential and time have been optimized. Linear response was obtained in the 0-1000 ng L{sup -1} range (2 min deposition), with a detection limit of 0.88 ng L{sup -1}. The method was validated by comparison of results for an unknown solution of V by atomic absorption measurement. The protocol was evaluated in a real sample by measuring the amount of V in river water samples. Thick bismuth film electrodes with protective polystyrene films have also been made and evaluated as a mercury free alternative. However, ng L{sup -1} level detection was only attainable with extended (10 min) deposition times. The proposed use of MWEs for the detection of V is sensitive enough for future use to test V concentration in biological fluids treated by the advanced oxidation process (AOP).

  17. Biomimetic hydrogels for biosensor implant biocompatibility: electrochemical characterization using micro-disc electrode arrays (MDEAs).

    Science.gov (United States)

    Justin, Gusphyl; Finley, Stephen; Abdur Rahman, Abdur Rub; Guiseppi-Elie, Anthony

    2009-02-01

    Our interest is in the development of engineered microdevices for continuous remote monitoring of intramuscular lactate, glucose, pH and temperature during post-traumatic hemorrhaging. Two important design considerations in the development of such devices for in vivo diagnostics are discussed; the utility of micro-disc electrode arrays (MDEAs) for electrochemical biosensing and the application of biomimetic, bioactive poly(HEMA)-based hydrogel composites for implant biocompatibility. A poly(HEMA)-based hydrogel membrane containing polyethylene glycol (PEG) was UV cross-linked with tetraethyleneglycol diacrylate following application to MDEAs (50 mum discs) and to 250 mum diameter gold electrodes within 8-well culture ware. Cyclic voltammetry (CV) of the MDEAs revealed a reduction in the apparent diffusion coefficient of ferrocenemonocarboxylic acid (FcCO(2)H), from 6.68 x 10(-5) to 6.74 x 10(-6) cm(2)/s for the uncoated and 6 mum thick hydrogel coated devices, respectively. Single frequency (4 kHz) temporal impedance measurements of the hydrogels in the 8-well culture ware showed a reversible 5% change in the absolute impedance of the hydrogels when exposed to a pH change between 6.1 to 7.2 and a 20% drop between pH 6.1 and 8.8.

  18. A new configuration for multilevel converters with diode clamped topology

    DEFF Research Database (Denmark)

    Nami, A.; Zare, F.; Ledwich, G.

    2008-01-01

    Due to the increased use of renewable energy and power elctronic applications, more multilevel converters (MLC) are developed. A Neutral Point Clamped (NPC) inverter is one of the most used multilevel topologies for wind turbine (WT) and photovoltaic (PV) applications. One of the most crucial...... of load changes which can avoid neutral point balancing problem in such converters. In addition, the presented topology is suitable for renewable energy systems to boost the low rectified output-voltage. In order to verify the proposed topology, steady state analysis, modelling and simulations are carried...

  19. Voltage-gated Na+ currents in human dorsal root ganglion neurons

    Science.gov (United States)

    Zhang, Xiulin; Priest, Birgit T; Belfer, Inna; Gold, Michael S

    2017-01-01

    Available evidence indicates voltage-gated Na+ channels (VGSCs) in peripheral sensory neurons are essential for the pain and hypersensitivity associated with tissue injury. However, our understanding of the biophysical and pharmacological properties of the channels in sensory neurons is largely based on the study of heterologous systems or rodent tissue, despite evidence that both expression systems and species differences influence these properties. Therefore, we sought to determine the extent to which the biophysical and pharmacological properties of VGSCs were comparable in rat and human sensory neurons. Whole cell patch clamp techniques were used to study Na+ currents in acutely dissociated neurons from human and rat. Our results indicate that while the two major current types, generally referred to as tetrodotoxin (TTX)-sensitive and TTX-resistant were qualitatively similar in neurons from rats and humans, there were several differences that have important implications for drug development as well as our understanding of pain mechanisms. DOI: http://dx.doi.org/10.7554/eLife.23235.001 PMID:28508747

  20. Image-guided Electro-assisted Drug Delivery: Comparison Between Two Types of Electrodes

    Directory of Open Access Journals (Sweden)

    Biliana Nikolova

    2015-06-01

    Full Text Available Electroporation-based cancer treatment techniques are currently after active investigations in the field of drug delivery, optimization of electrical parameters and elucidation of the exact mechanisms at a molecular level. The present study is designed to investigate the exact in vivo redistribution and persistence of nanoparticles in the tumor tissue of colon-cancer grafted mice after electroporation with two different kinds of electrodes. The aim of the study is to avoid artifacts during electroporation due to accumulation of nanoparticles in the surrounding non-cancer tissues. The isolated electrodes are appropriate for the treatment of 3-dimensional tumors and have a large potential in this field.